Stem-loop sequence mdo-mir-1549b

AccessionMI0040937 (change log)
DescriptionMonodelphis domestica miR-1549b stem-loop
Stem-loop
   --a         c   gc      aaaac 
5'    ccgggcuug agg  ggaagc     a
      ||||||||| |||  ||||||     a
3'    ggcccgagc ucc  ucuucg     a
   agc         a   -a      acuca 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
NW_001586660.1: 16845-16902 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-1549b
mdo-mir-1549bNW_001586660.1: 16845-16902 [-]
mdo-mir-1549NW_001586660.1: 16844-16906 [+]
Database links

Mature sequence mdo-miR-1549b-5p

Accession MIMAT0050368
Sequence

1 - 

accgggcuugcagggcggaag

 - 21

Get sequence
Deep sequencing36 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence mdo-miR-1549b-3p

Accession MIMAT0050369
Sequence

38 - 

uucuaccuacgagcccggcga

 - 58

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).