Stem-loop sequence mdo-mir-1544g

AccessionMI0040956 (change log)
DescriptionMonodelphis domestica miR-1544g stem-loop
Stem-loop
   -ugca  g          u  c  ---u  a 
5'      cc agggauagaa ag gg    cc c
        || |||||||||| || ||    ||  
3'      gg ucccuaucuu uc cc    gg u
   gguca  g          u  a  cgac  u 
Get sequence
Deep sequencing
33166 reads, 400 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 13994231-13994290 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-1544g
mdo-mir-1545achrX: 14003847-14003918 [-]
mdo-mir-1544c-6chrX: 13998842-13998902 [-]
mdo-mir-1545d-2chrX: 13996260-13996318 [-]
mdo-mir-1544gchrX: 13994231-13994290 [-]
mdo-mir-1545b-3chrX: 13985682-13985740 [-]
Database links

Mature sequence mdo-miR-1544g-5p

Accession MIMAT0050397
Sequence

1 - 

ugcaccgagggauagaauagcgg

 - 23

Get sequence
Deep sequencing29229 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence mdo-miR-1544g-3p

Accession MIMAT0050398
Sequence

39 - 

acuuuucuaucccugggacugg

 - 60

Get sequence
Deep sequencing3937 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).