Stem-loop sequence mdo-mir-1545d-2

AccessionMI0040957 (change log)
DescriptionMonodelphis domestica miR-1545d-2 stem-loop
Stem-loop
   ---u     cug       u   u  ucuc 
5'     gugcc   ggauaga aag ga    c
       |||||   ||||||| ||| ||    u
3'     cacgg   ccuaucu uuc cu    u
   uggu     -ua       u   c  uucc 
Get sequence
Deep sequencing
2253 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 13996260-13996318 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-1545d-2
mdo-mir-1544achrX: 14005428-14005509 [-]
mdo-mir-1545achrX: 14003847-14003918 [-]
mdo-mir-1544c-6chrX: 13998842-13998902 [-]
mdo-mir-1545d-2chrX: 13996260-13996318 [-]
mdo-mir-1544gchrX: 13994231-13994290 [-]
Database links

Mature sequence mdo-miR-1545d-5p

Accession MIMAT0050386
Sequence

1 - 

ugugcccugggauagauaaguga

 - 23

Get sequence
Deep sequencing4240 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence mdo-miR-1545d-3p

Accession MIMAT0050387
Sequence

37 - 

ccuuuucuauccauggcacugg

 - 58

Get sequence
Deep sequencing532 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).