Stem-loop sequence ppy-mir-215

AccessionMI0003029 (change log)
DescriptionPongo pygmaeus miR-215 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   aucauuca   a      ------      a a  a    -u   u          u  ag 
5'         gaa ugguau      acagga a ug ccua  gaa ugacagacaa ac  c
           ||| ||||||      |||||| | || ||||  ||| |||||||||| ||   
3'         cuu aucgug      ugucuu u ac ggau  cuu acugucuguu ug  u
   ------aa   c      ucaaca      a a  c    uu   u          -  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 29611880-29611989 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-215
ppy-mir-194chr1: 29611601-29611685 [+]
ppy-mir-215chr1: 29611880-29611989 [+]
Database links

Mature sequence ppy-miR-215

Accession MIMAT0002732
Sequence

27 - 

augaccuaugaauugacagac

 - 47

Get sequence
Evidence by similarity; MI0000291

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).