Stem-loop sequence aly-MIR167b

AccessionMI0014540 (change log)
DescriptionArabidopsis lyrata miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Stem-loop
      u   caacuugu    cagg    -u    gacaa    --acaa     ca     a    - -c           u   u    aa   aug      u 
5' auc gca        ugcu    uauu  ugaa     gucc      gggaa  aguga gcug c  agcaugaucua cuu gguu  gag   aaugug a
   ||| |||        ||||    ||||  ||||     ||||      |||||  ||||| |||| |  ||||||||||| ||| ||||  |||   ||||||  
3' uag cgu        acga    auag  acuu     cagg      uccuu  ucacu cgac g  ucguacuggau gaa ccaa  uuc   uuauac a
      c   -acaccuu    ---a    uc    ---ac    auuugg     cc     c    a uc           c   c    -a   --g      a 
Get sequence
Deep sequencing
3705 reads, 1.26e+05 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 21158356-21158550 [+]
intergenic
Database links

Mature sequence aly-miR167b-5p

Accession MIMAT0017475
Previous IDsaly-miR167b
Sequence

55 - 

ugaagcugccagcaugaucua

 - 75

Get sequence
Deep sequencing3702 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR167b-3p

Accession MIMAT0017476
Previous IDsaly-miR167b*
Sequence

125 - 

ggucaugcucugacagccucacu

 - 147

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2