Stem-loop sequence cfa-mir-8798

AccessionMI0027878 (change log)
DescriptionCanis familiaris miR-8798 stem-loop
Stem-loop
   -----------------a    u      guuua      u    ga   ccu   g   ---a    agg        u 
5'                   ccuc gaggcc     gguagc cgcg  acu   gcg ucg    ugcg   ccccggcu u
                     |||| ||||||     |||||| ||||  |||   ||| |||    ||||   ||||||||  
3'                   ggag cuucgg     ucgucg gugc  uga   ugu agu    gcgc   ggggucga g
   agccgauccugcccccaa    -      -----      -    --   --u   g   aaaa    --a        g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr38: 17579162-17579290 [-]
sense
ENSCAFT00000021389 ; UCK2-201; 5'UTR (exon 1)
Database links

Mature sequence cfa-miR-8798

Accession MIMAT0034288
Sequence

36 - 

ugcggucgaugcgaggccccgg

 - 57

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).