Stem-loop sequence oha-mir-29a-2

AccessionMI0031446 (change log)
DescriptionOphiophagus hannah miR-29a-2 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   aaaaca         -  ggc           ucu       ---     uc 
5'       ucucuuaca ca   ugaccgauuuc   ugguguu   cagag  u
         ||||||||| ||   |||||||||||   |||||||   |||||  u
3'       gggggaugu gu   auuggcuaaag   accacga   guuuu  a
   -gaaaa         a  ---           uuu       ucu     ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01004013.1: 152357-152455 [+]
intergenic
Database links

Mature sequence oha-miR-29a-2-5p

Accession MIMAT0036881
Sequence

21 - 

ugaccgauuucucuugguguu

 - 41

Get sequence
Evidence not experimental

Mature sequence oha-miR-29a-3p

Accession MIMAT0036877
Sequence

61 - 

uagcaccauuugaaaucgguua

 - 82

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).