sort by

329 publications mentioning hsa-mir-23a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-23a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 452
Other miRNAs from this paper: hsa-mir-26a-1, hsa-mir-26b, hsa-mir-23b, hsa-mir-26a-2, hsa-mir-23c
Overexpression of mir-23a could significantly potentiate the in vitro and in vivo anti-tumor effect of etoposide; however, ectopic expression of miR-23a fails to sensitize HCC cells to 5-fluorouracil treatment, indicating the miR-23a -induced cancer cell hypersensitivity in chemotherapy is TOP2A-specific though miR-23a overexpression could not directly up-regulate TOP2A expression. [score:13]
MiR-23a could directly bind to 3′untranslated region of TOP1 mRNA, and suppress the corresponding protein expression and inhibition of miR-23a further arguments the expression of TOP1. [score:12]
Both mRNA transcripts and protein expression of TOP1 are suppressed in miR-23a -overexpressing HCC cells, and luciferase assay shows that miR-23a may directly bind to the 3′UTR of TOP1 mRNA to suppress its expression. [score:11]
Cells were exposed to nutlin-3α (20 μM) then the pri-miR-23a and pre-miR-23a expressions were analyzed by RT-qPCR; both primary and precursor form of miR-23a was up-regulated upon nutlin-3α treatment; C shows that suppression of p53 down-regulated miR-23a. [score:11]
Cellular response to etoposide when TOP1 was suppressed by miR-23a may be indicated by the increasing impaired cell progression through S phase upon etoposide treatment (Figure  2D), and interestingly, cell cycle progression of wild-type and miR-23a -overexpressed HCC cells with treatment of 5-Fu have no differences (Additional file 1: Figure S2) These data suggest that simultaneous down-regulation of TOP1 -mediated enhanced response to etoposide may be responsible for the enhancing sensitivity to TOP2A poison in HCC cells with miR-23a overexpression. [score:10]
Up-regulation of p53 induces mir-23a expression, while suppression of p53 inhibits miR-23a in HCC cells. [score:10]
The protein expression of TOP2A remains unchanged with miR-23a was forcedly expressed in HCC cells, while TOP1 was significantly suppressed in miR-23a -overexpressed HCC cells (Figure  2C). [score:9]
The pCMV-MIR Vectors with and without human miR-23a expression, luciferase expressing-pMir-Target Vectors with and without TOP1 3′UTR expression were purchased from Origene (USA). [score:9]
Although TOP2A expression remained unchanged in miR-23a -overexpressing HCC cells, TOP1 was remarkably down-regulated, which may lead to the overall topoisomerase activity fall below the critical threshold for cell survival when cells are exposed to TOP2A poisons and consequently accelerates cell death. [score:8]
Significant suppression of TOP1 protein level could be observed in miR-23a -overexpressing cells; C shows that TOP1 mRNA transcript was inhibited after long exposure to miR-23a. [score:7]
The expression of miR-23a was suppressed when p53 is genetically or pharmacologically inhibited (Figure  5C and Additional file 1: Figure S8). [score:7]
Suppression of miR-23a by specific inhibitor restored the mRNA and protein expression of TOP1 (Figure  3B and C). [score:7]
The primary transcripts and the precursor forms of miR-23a were induced, indicating that p53 may transcriptionally up-regulate miR-23a expression (Figure  5B). [score:6]
To further our knowledge on the regulation of miR-23a expression by p53, the MDM2 inhibitor nutlin-3α was used to activate p53 in HepG2 and MHCC97L. [score:6]
The possible target of miR-23a was predicted with TargetScan5.2 software, and miR-23a was predicted to directly bind to the 3′UTR region of human TOP1 mRNA (Figure  3A). [score:6]
As the content of TOP1 could predominantly regulate sensitivity of cancer cells in response to TOP1 poisons, suppression of TOP1 expression by miR-23a is therefore capable to reduce the content of TOP1-DNA covalent complex through removing available TOP1 from the system. [score:6]
Significant inhibition of TOP1 mRNA by miR-23a overexpression indicated a post-transcriptional regulatory mechanism is involved [17]. [score:6]
Consistently it was observed in our study that TOP1 down-regulation by miR-23a in HCC cells could largely potentiate cells to etoposide and doxorubicin treatment but not 5-Fu exposure, and forced overexpression of miR-23a in HCC cells reduced the cytotoxicity of TOP1 poison irinotecan, whose activity was dominated by the content of endogenous TOP1 level [8]. [score:6]
Interestingly, induced expression of miR-23a in hepatoma cells could be also observed upon DNA damage induced by either UV irradiation or hydrogenperoxide treatment (Figure  4B and Additional file 1: Figure S3), which suggested that miR-23a up-regulation might be the common feature during DNA damage. [score:6]
Considering that direct overexpression of miR-23a in tumor cells may promote tumor progression as reported [33], it may be more practical to trigger miR-23a expression via inducing DNA damage by genotoxic agents, which may in consequence potentiate the response to etoposide treatment. [score:6]
Activation of miR-23a could be induced during DNA damage in parallel with up-regulation of p53 expression. [score:6]
A shows that induction of p53 by nutlin-3α up-regulates expression of miR-23a. [score:6]
The other topoisomerase, TOP1 was suppressed in miR-23a-overxpressed HCC cells and was validated as the direct target of miR-23a. [score:6]
Topoisomerase 1(TOP1) is down-regulated in miR-23a -overexpressed HCC cells. [score:6]
Forced overexpression of miR-23a in HCC cells reduces the cytotoxicity of TOP1 poison irinotecan, and up-regulation of miR-23a could be observed in HCC cells upon DNA damage, during which miR-23a may play a role in the intracellular TOP1 homeostasis. [score:6]
assay confirmed the inhibition of TOP1 expression by miR-23a (Figure  3B), which was in line with the mRNA inhibition of TOP1 by miR-23a (Figure  3C). [score:6]
A shows that the possible target of TOP1 3′UTR interaction with miR-23a predicted by TargetScan software. [score:5]
D shows that the luciferase activity of vector expressing TOP1 3′UTR could be suppressed in the presence of miR-23a. [score:5]
Overexpression of miR-23a could not synergize 5-Fu -induced cytotoxicity and tumor inhibition, which indicates the mechanism of hypersensitivity induced by miR-23a is TOP2A poison-specific. [score:5]
HEK293T cells were co -transfected with luciferase-containing plasmid expressing TOP1 3′UTR and the plasmid expressing miR-23a. [score:5]
Overexpression of miR-23a could further impair the cell progression through S phase when HCC cells were exposed to etoposide, while the TOP2A expression has not changed. [score:5]
MiR-23a was up-regulated during DNA damage in cancer cells in line with the p53 expression. [score:5]
Since TOP1 is critically required for DNA repair, we examined if miR-23a could be regulated during DNA damage/repair which may further evidence the regulation of TOP1 expression by miR-23a. [score:5]
Although it was found the expression of miR-23a is slightly increased in HCC as evidenced by literature [15] and our own study (Additional file 1: Figure S1), we found that overexpression of miR-23a could potentiate the response of HCC to TOP2A poison etoposide (Figure  1A). [score:5]
Suppression of TOP1 expression by miR-23a results in reduction of overall intracellular topoisomerase activity when the cells are exposed to etoposide, which in consequence enhances drug response of HCC cells. [score:5]
C shows that miR-23a overexpression enhances inhibition of HCC tumorigenesis by etoposide. [score:5]
B shows that TOP1 protein expression was inhibited by miR-23a. [score:5]
C shows that miR-23a suppresses TOP1 expression without significantly inducing TOP2A in HCC cells. [score:5]
Significant reduction of TOP1 expression in miR-23a overexpressed HCC cells could be observed. [score:5]
Our study sheds light on the role of miR-23a as a potential target in regulating chemosensitivity of HCC cells. [score:4]
B shows that miR-23a was up-regulated upon DNA damage. [score:4]
DNA damage -induced miR-23a regulates TOP1 expression in hepatoceullar carcinoma cells. [score:4]
To further decipher the role of TOP2A in miR-23a-regulated chemosensitivity of HCC cells to TOP2A poison, we first confirmed if the cellular expression of TOP2A has been altered. [score:4]
Figure 4 DNA damage -induced miR-23a regulates TOP1 expression. [score:4]
TOP1 is the direct target of miR-23a in hepatocellular carcinoma. [score:4]
Furthermore, we found expression of miR-23a is regulated by p53 in HCC cells. [score:4]
Our findings shed light on the role of miR-23a as a potential target in regulating drug responses of HCC cells. [score:4]
Our study shed lights on the potential of miR-23a as a novel target in regulating chemosensitivity of cancer cells. [score:4]
Figure 3 TOP1 is the direct target of miR-23a. [score:4]
These results indicate that TOP1 may be the direct target of miR-23a. [score:4]
Neither delayed presence of megascopic xenograft nor reduced tumor size could be observed in miR-23a -overexpressed group. [score:3]
This may suggest the involvement of p53 in DNA damage -induced miR-23a expression in our observation. [score:3]
Wildtype and miR-23a -overexpressed HCC cells were treated with etoposide (20 μM) for 24 h and then fixed. [score:3]
Expression of miR-23a was transcriptional activated by p53. [score:3]
As the drug response of miR-23a -overexpressing HCC cells was potentiated particularly when cells were treated with TOP2A poisons, we assumed that TOP2A is required for miR-23a -mediated increased chemosensitivity in HCC cells. [score:3]
D shows that miR-23 overexpression increase tumor response to etoposide. [score:3]
With co-transfection of the luciferase reporter vector encoding 3′UTR of TOP1 mRNA and miR-23a into HE293T cells, we observed that the luciferase activity was significantly suppressed by miR-23a transfection (Figure  3D). [score:3]
In closing, overexpression of miR-23a potentiates HCC cell to etoposide -induced cell death. [score:3]
HepG2, MHCC97L cells (p53-proficient) and Hep3B cells (p53 -deficient) were treated with nutlin-3α (20 μM) for 24 h. The miR-23a expression was analyzed by qRT-PCR. [score:3]
Activation of miR-23a could be observed upon nutlin-3α treatment in p53-proficient HepG2 and MHCC97L cells, and it was observed that in p53-dificient Hep3B cells, nutlin-3α could not influence miR-23a expression (Figure  5A). [score:3]
Moreover in our study, we found that miR-23a could target TOP1, which is essential to maintain genomic stability during DNA damage [24]. [score:3]
Mir-23a was showed to regulate the glucose metabolism during tumorigenesis via suppressing gluconeogenesis related genes. [score:3]
The cells were transiently transfected with either vector of miR-23a -expressing plasmids. [score:3]
In vivo study further confirmed that forced miR-23a expression could not potentiate the response of HCC xenograft to 5-Fu (25 mg/kg/2 days). [score:3]
Activation of p53 could increase the transcripts of pri-, pre- and mature form of miR-23a, while inhibition of p53 significantly reduced miR-23a level in p53-proficient HCC cells, indicating that miR-23a may be transactivated by p53 in HCC cells. [score:3]
The interaction between miR-23a and TOP1 was further evidenced in our study by the fact that forced overexpression of miR-23a significantly reduced the response of HCC cells with TOP1 poison irinotecan treatment (Figure  4A). [score:3]
Figure 5 Expression of miR-23a was control by p53. [score:3]
Significant induction of miR-23a expression in HepG2 and MHCC97L but not Hep3B cells could be observed. [score:3]
The interaction between miR-23a and TOP1 was further evidenced by the fact that forced overexpression of miR-23a could attenuate the cytotoxicity of TOP1 poison irinotecan. [score:3]
A shows that overexpression of miR-23a attenuates the cytoxicity of TOP1 poison irinotecan. [score:3]
D shows that overexpression of miR-23a further impaired cell progression through S phase in etoposide -treated HCC cells. [score:3]
Overexpression of miR-23a sensitizes tumor cell to TOP2A poisons. [score:3]
A shows etoposide exhibits more toxic to HCC cells with ectopic miR-23a expression. [score:3]
Increasing cell death after etoposide treatment was observed in miR-23a -overexpressed HCC cells; B shows ectopic miR-23a could significantly potentiate HCC cells to doxorubicin treatment. [score:3]
This may be correlated with p53 -induced miR-23a expression, as it was indicated by our observation. [score:3]
Significant reduction on tumor size could be found in miR-23a-expressed group. [score:3]
Potent inhibition of TOP1 mRNA transcripts could be observed in cells with exposure to miR-23a. [score:3]
In this study, we report that overexpression of miR-23a could sensitize HCC to the in vitro and in vivo treatment of etoposide. [score:3]
In vivo study shows that overexpression of miR-23a could promote the tumor-free survival of the mice upon treatment of 7.5 mg/kg etoposide (Figure  1C). [score:3]
Briefly, 6-week-old female BALB/c nu/nu athymic nude mice received MHCC97L cells transfected with pCMV vector injection subcutaneously in 0.2 ml at its left side of waist and MHCC97L cells with miR-23a overexpression injection at its right. [score:3]
No significant difference could be observed between the cytotoxicity of 5-Fu on wild-type or miR-23a -overexpressing HCC cells (Figure  2A). [score:3]
Delayed presence of megascopic tumor was observed in miR-23a-expressed group. [score:3]
The involvement of miR-23a in potentiating cancer cells to etoposide treatment was shown in Figure  6. Figure 6 Overall regulatory mechanism underlying regulation of chemosensitivity by miR-23a in HCC cells. [score:3]
Differential expression level of miR-23a could be found in the four HCC cell lines PLC/PRF/5, Hep3B, MHCC97L and HepG2, and the miR-23a level was correlated with p53 status in different HCC cell lines (Additional file 1: Figure S5). [score:3]
Cells were introduced with RNAi against p53 and significant reduced expression of miR-23a could be observed in cells in which p53 was repressed. [score:3]
Initiation of pri- and pre-miR-23a expressions in hepatoma cells exposed to UV irradiation exhibits that miR-23a was transcriptionally activated upon DNA damage (Figure  4C). [score:3]
The scramble negative control to miRNAs (scr negative control) and inhibitor against miR-23a were purchased from Exiqon (Denmark). [score:3]
Wild-type and miR-23a -overexpressed HCC cells were treated with etoposide (20 μM) or 5-Fu (50 μg/mL) for 24 h then protein was collected. [score:3]
MiR-23a fails to boost up response of HCC cells to 5-fluorouracil (5-Fu) treatment, indicating that the regulation of miR-23a on response of HCC cell may be TOP2A poisons-specific. [score:2]
Neither delay on tumorigenesis nor reduced end-point tumor size could be found in miR-23 -overexpressed xenograft in compared with wild-type (Figure  2B). [score:2]
These findings suggest the p53 is a positive regulator involved in miR-23a transcription activation. [score:2]
No different cytotoxicity was observed in miR-23a -overexpressed cells in compared with wild-type cells. [score:2]
Wild-type and miR-23a overexpressed HCC cells were treated with irinotecan and cell viability was determined by MTT assay. [score:2]
In our study, we found that expression of miR-23a may increase in HCC tissue when compared with non-tumor livers, which is consistent with some previous reports [15]. [score:2]
In p53-proficient cell lines, high level of miR-23a could be observed, but ablation miR-23a was found in Hep3B cells in which p53 is deficient. [score:1]
This was further evidenced by the fact that HCC cells with ectopic miR-23a are vulnerable to another TOP2A poison doxorubicin (Figure  1B). [score:1]
However, our study may suggest the DNA damage -induced miR-23a is responsible for sensitizing HCC cells to etoposide treatment. [score:1]
Our findings may advance the knowledge of DNA damage-induce etoposide sensitivity of cancer cells by introducing the involvement of miR-23a. [score:1]
Some previous studies showed that miR-23a could function to promote tumor progression by inducing tumor cell proliferation and invasion [3, 23]. [score:1]
B shows that miR-23a could not enhance chemotoxocity of 5-Fu in vivo. [score:1]
Accumulation at S phase was observed after etoposide treatment and ectopic miR-23a enhances this effect of etoposide. [score:1]
Total RNA was collected and miR-23a was detected by RT-qPCR. [score:1]
B shows transcriptional activation of miR-23a induced by p53. [score:1]
TOP2A is responsible for the hypersensitivity of miR-23a-overxpressing HCC cells to etoposide. [score:1]
Tumor size was significantly reduced by ectopic miR-23a in mice treated with etoposide (Figure  1D). [score:1]
The HEK293T cells were co -transfected with pMIR Vectors containing TOP1 3′UTR and miR-23a mimics. [score:1]
Mice were subcutaneously injected with MHCC97L cells with or without ectopic miR-23a and treated with etoposide (25 mg/kg/2 days, i. p. ). [score:1]
C shows miR-23a was transcriptionally activated upon DNA damage; RNA was collected and the pri-miR-23a and pre-miR-23a were detected as described. [score:1]
Figure 2 miR-23a -induced HCC cell hypersensitivity to 5-Fu treatment requires TOP2A. [score:1]
These findings suggest that high level of miR-23a may particularly potentiate cellular response to TOP2A poisons. [score:1]
We then conducted luciferase reporter assay to confirm the direct binding of miR-23a to the 3′UTR of TOP1 mRNA. [score:1]
Figure 1 miR-23a enhances cytoxicity of etoposide in human HCC. [score:1]
A shows that miR-23a fails to potentiate HCC cells to 5-Fu treatment. [score:1]
[1 to 20 of 113 sentences]
2
[+] score: 304
Although the reason for the co -expression of miR-23a/b is not fully understood, a possibility is that the simultaneous upregulation or downregulation of miR-23a/b is related to their cooperative effects in regulating specific genes and cellular pathways. [score:10]
Because miR-23a/b are upstream regulators of PDCD4 and can specifically block the targeted PDCD4 mRNA with high efficiency and convenience, it is possible to downregulate miR-23a/b for restoration of PDCD4 expression in vivo. [score:9]
Because miRNA is an important mode of post-transcriptional regulation, we searched for miRNAs that target PDCD4 and validated the direct inhibition of PDCD4 translation through miR-23a/b. [score:9]
Among the candidates, PDCD4, a potent tumor suppressor gene that is frequently downregulated in human cancers, 21, 22 was predicted to be a miR-23a/b target by all three of the algorithms and was selected for further experimental verification. [score:8]
AP-1 downregulation leads to a decrease in miR-23a expression and subsequent PDCD4 activation, which in turn results in the depletion of AP-1 expression. [score:8]
Since miRNAs are generally thought to have an opposite expression pattern to that of their targets, [5] we next investigated whether miR-23a/b expression was inversely correlated with PDCD4 expression in gastric cancer tissues. [score:7]
When MKN-45 cells were simultaneously transfected with miR-23a/b mimics plus PDCD4-overexpression plasmid, restoration of PDCD4 expression decreased the effects of miR-23a/b -mediated suppression of the cleavage of CASP9, 3, 6, 7 and PARP in MKN-45 cells (Figures 4e and f). [score:7]
The results indicated that combined miR-23a/b overexpression may be involved in the progression of gastric cancer through co -targeting tumor suppressor PDCD4 in this malignancy. [score:7]
Furthermore, because miR-23a/b and PDCD4 had opposing effects on cell apoptosis, it is quite possible that miR-23a/b suppressed PDCD4 expression and consequently inhibited cell apoptosis and promoted tumor growth during gastric cancer progression. [score:7]
For example, Zhu et al. [30] reported significant upregulation of miR-23a in gastric adenocarcinoma tissues and demonstrated that miR-23a could target IL6R and promote growth in gastric adenocarcinoma cells. [score:6]
Thus, the inhibition of cell apoptosis by PDCD4 knockdown was similar to that elicited by miR-23a/b overexpression, further indicating that miR-23a/b and PDCD4 have opposing effects on cell apoptosis. [score:6]
To confirm that miR-23a/b directly target the presumed binding site in the PDCD4 3′-UTR and negatively regulate PDCD4 expression, a luciferase reporter assay was performed. [score:6]
To determine the level at which miR-23a/b regulate PDCD4 expression, we repeated the above experiments and examined the expression of PDCD4 mRNA after transfection. [score:6]
Compared with cells transfected with miR-23a/b mimics plus control plasmid, the cells transfected with miR-23a/b mimics plus PDCD4-overexpression plasmid exhibited a significantly higher PDCD4 protein level (Figures 4c and d), suggesting that the overexpression of miR-23a/b-resistant PDCD4 was sufficient to rescue the suppression of PDCD4 by miR-23a/b. [score:6]
In conclusion, our results demonstrated that miR-23a/b directly bind to the 3′-UTR of the PDCD4 transcript to suppress PDCD4 expression. [score:6]
Regulation of PDCD4 by miR-23a/b may explain why the upregulation of miR-23a/b during gastric carcinogenesis promotes tumor growth. [score:5]
Consequently, MKN-45 cells simultaneously transfected with miR-23a/b mimics and the PDCD4-overexpression plasmid showed significantly higher apoptotic rates than the cells transfected with miR-23a/b mimics plus control plasmid (Figures 4a and b), suggesting that the overexpression of miR-23a/b-resistant PDCD4 was sufficient to attenuate the anti-apoptotic effects of miR-23a/b. [score:5]
Interestingly, we showed that the restoration of PDCD4 expression successfully attenuated the anti-apoptotic effects of miR-23a/b on gastric cancer cells, indicating that the targeting of PDCD4 may be a major mechanism through which miR-23a/b exerted its anti-apoptotic function. [score:5]
For the overexpression of PDCD4, a plasmid designed to specially express the full-length ORF of PDCD4 without the miR-23a/b-responsive 3′-UTR was constructed and transfected into MKN-45 cells. [score:5]
miR-23a/b suppress apoptosis in gastric cancer cells by inhibiting PDCD4. [score:5]
Moreover, we downloaded the miRNA expression data from The Cancer Genome Atlas (TCGA) website and analyzed the expression profiles of miR-23a/b in 42 normal tissues and 476 gastric cancer tissues. [score:5]
Theoretically, co-overexpression of miR-23a/b in cancer tissues may be associated with aggressive tumor progression and poor prognosis, and determining the expression patterns of miR-23a/b may help in elucidating the risk for cancer patients. [score:5]
To explore the molecular mechanism by which miR-23a/b contributes to gastric cancer progression, three computational algorithms, TargetScan, [18] PicTar [19] and miRanda, [20] were used in combination to search for potential targets of miR-23a/b. [score:5]
For example, PDCD4 has been reported to play a role as an inhibitor in AP-1 signaling pathway, [36] and AP-1 signaling has been shown to activate miR-23a expression. [score:5]
Therefore, we looked for the target genes of miR-23a/b and identified PDCD4 as a co-target. [score:5]
In summary, as miR-23a/b and PDCD4 had opposite expression patterns and biological functions in gastric cancer cells, it is quite possible that miR-23a/b suppress apoptosis in gastric cancer cells by silencing PDCD4. [score:5]
Validation of PDCD4 as a direct target of miR-23a/b. [score:4]
miR-23a/b are upregulated in gastric cancer tissues. [score:4]
In summary, this study not only uncovered the critical roles of miR-23a/b as oncomiRs in gastric cancer but also explored the molecular mechanisms through which miR-23a/b contributed to gastric cancer progression and identified PDCD4 as a direct target gene. [score:4]
Knockdown of miR-23a/b was achieved by transfecting with miRNA inhibitors (chemically modified single-stranded antisense oligonucleotides designed to specifically sequester mature miR-23a/b). [score:4]
On the other hand, co-regulation by miR-23a/b may be a fail-proof mode of miRNA regulation to ensure that when one member of the miR-23a/b family is disabled by mutations or dysfunction, the other one is still available to exert its biological function. [score:4]
The findings that miR-23a/b are co -upregulated in gastric cancer and have concordant cellular functions allowed us to hypothesize that the miR-23a/b combination might play an important role in gastric carcinogenesis. [score:4]
The results indicated again that miR-23a/b were upregulated in gastric cancer tissues (Supplementary Figure 1). [score:4]
The correlation between miR-23a/b and PDCD4 was further examined by evaluating PDCD4 expression levels in two human gastric cancer cell lines, MKN-45 and AGS, after overexpression or knockdown of miR-23a/b. [score:4]
These results demonstrated that miR-23a/b specifically regulate PDCD4 protein expression at the post-transcriptional level, which is the most common mechanism for animal miRNAs. [score:4]
After 25 days of xenograft growth in vivo, tumors from the miR-23a/b -overexpressing groups showed significant increase in miR-23a/b expression compared to tumors from the control group (Figure 5d). [score:4]
Overexpression or knockdown of miR-23a/b. [score:4]
The mutated luciferase reporter was unaffected by overexpression of miR-23a/b (Figure 3e). [score:3]
Overexpression of miR-23a/b was achieved by transfecting gastric cancer cells with miRNA mimics (synthetic RNA oligonucleotides mimicking precursors of miR-23a/b). [score:3]
The predicted interaction between miR-23a/b and the target site in the PDCD4 3′-UTR is illustrated in Figure 2a. [score:3]
A mammalian expression plasmid encoding the full-length human PDCD4 open reading frame (ORF) without the miR-23a/b-responsive 3′-UTR was purchased from Invitrogen. [score:3]
Studies of the functions of co-expressed miR-23a/b are a promising way to decipher the cooperative effects of multiple miRNAs. [score:3]
In contrast to miR-23a, miR-23b has a dual role in carcinogenesis and functions as either tumor promoter or tumor suppressor. [score:3]
Prediction of PDCD4 as a target gene of miR-23a/b. [score:3]
MKN-45 cells were cultured in 12-well plates and transfected with pre-miR-23a/b, anti-miR-23a/b, PDCD4 siRNA or PDCD4-overexpression plasmid. [score:3]
Immunohistochemical staining also revealed the presence of lower levels of PDCD4 in the groups implanted with miR-23a/b -overexpressing cells (Figures 5h and i). [score:3]
The efficient overexpression of miR-23a/b by lentiviral infection is shown in Supplementary Figure 4A. [score:3]
Overexpression of miR-23a/b by lentiviral transfection reduced PDCD4 protein levels in MKN-45 cells (Supplementary Figure 4B and 4C). [score:3]
We first determined the expression patterns of miR-23a/b in human gastric cancer tissues. [score:3]
As expected, overexpression of miR-23a/b resulted in ~50% reduction of luciferase reporter activity (Figure 3e). [score:3]
Each well was transfected with 0.2  μg of firefly luciferase reporter plasmid, 0.1  μg of a β-galactosidase (β-gal) expression plasmid (Ambion), and equal amounts 100 pmol of pre-miR-23a/b, anti-miR-23a/b or the scrambled negative control RNAs using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). [score:3]
Consistent with this hypothesis, Li et al. [31] also found that Fas is a co-target of miR-23a/b in thymic lymphoma cells. [score:3]
MKN-45 cells were infected with a control lentivirus or lentiviruses to overexpress miR-23a or miR-23b. [score:3]
[32] Ma et al. [33] found a positive feedback loop comprised of KLF3 and miR-23a promoting the expression of β-like globin genes and the miR-23a/27a/24-2 cluster during erythropoiesis. [score:3]
Synthetic miR-23a/b mimics (pre-miR-23a/b), inhibitors (anti-miR-23a/b) and scrambled negative control RNAs (pre-miR-control and anti-miR-control) were purchased from GenePharma (Shanghai, China). [score:3]
The human gastric cancer cell line MKN-45 was infected with a control lentivirus or lentiviruses to overexpress miR-23a or miR-23b. [score:3]
Cooperation among the miR-23a/b family thus provides an interesting area of study that may change our perception of how miRNAs mediate gene regulation. [score:2]
Furthermore, we introduced a point mutation into the corresponding complementary site in the PDCD4 3′-UTR to disrupt the predicted miR-23a/b binding site. [score:2]
To investigate if miR-23a/b may regulate the apoptosis of gastric cancer cells through a PDCD4 -dependent manner, we co -transfected MKN cells with miR-23a/b mimics and PDCD4-overexpression plasmid. [score:2]
Likewise, tumors from the mice infected with miR-23a/b -overexpressing MKN-45 cells displayed reduced PDCD4 protein levels, but not mRNA levels, compared to tumors from the control group (Figures 5e and g). [score:2]
This type of regulation is important because when miR-23a/b work in concert to repress a gene, the effect may be more efficient and potent than that by a single miRNA. [score:2]
A significant increase in the size and weight of the tumors was observed in the miR-23a/b -overexpressing group compared to the control group (Figures 5b and c). [score:2]
5, 28, 29 miR-23a/b are involved in the regulation of a wide variety of cellular processes, including cell differentiation, proliferation, apoptosis, migration and cell-cycle distribution, and also play important roles in several types of human cancers with diverse effects. [score:2]
The results revealed more cell mitosis in the miR-23a/b -overexpressing groups compared to the control group (Figure 5h). [score:2]
[35] In this study, we predicted transcription factors that can potentially regulate miR-23a/b. [score:2]
Through bioinformatics analysis, we found some signaling pathways and transcription factors that may take part in regulation of miR-23a/b and PDCD4. [score:2]
Thus, miR-23a/b function as anti-apoptotic factors in gastric cancer cells. [score:1]
In contrast, the tumor cell apoptosis rate, as measured by the staining intensity of cleaved-CASP3 -positive cells, was decreased in tumors from the miR-23a/b -overexpressing groups (Figures 5h and i). [score:1]
As anticipated, transfection of miR-23a/b mimics reduced the cleavage of CASP9, 3, 6, 7 and PARP in MKN-45 cells, whereas transfection of miR-23a/b antisenses induced the cleavage of CASP9, 3, 6, 7 and PARP (Figures 4e and f). [score:1]
miR-23a/b function as oncomiRs in gastric cancer. [score:1]
As anticipated, cellular miR-23a/b levels were significantly increased when MKN-45 and AGS cells were transfected with miR-23a/b mimics and were decreased when treated with miR-23a/b antisenses (Figure 3a). [score:1]
In a future study, the clinical implications of the combined high expression of miR-23a/b in cancer tissues should be evaluated. [score:1]
The tumor cell proliferation rate, as measured by the staining intensity of Ki-67 -positive cells, was increased in tumors from the miR-23a/b -overexpressing groups (Figures 5h and i). [score:1]
Consequently, the protein levels of PDCD4 were significantly reduced by the introduction of miR-23a/b mimics in MKN-45 and AGS cells, whereas miR-23a/b antisenses significantly increased the PDCD4 protein levels (Figures 3b and c). [score:1]
For each well, equal amounts of pre-miR-23a/b, pre-miR-control, anti-miR-23a/b or anti-miR-control were used. [score:1]
The 3′-UTR of PDCD4 contains one conserved binding site for miR-23a/b. [score:1]
The PDCD4 3′-UTR containing the presumed miR-23a/b binding site was fused downstream of the firefly luciferase gene in a reporter plasmid. [score:1]
Subsequently, total RNA was extracted from tumors and used to evaluate the expression levels of miR-23a/b. [score:1]
Detection of inverse correlations between miR-23a/b and PDCD4 protein levels in gastric cancer tissues. [score:1]
[31] In this study, we evaluated the expression patterns of miR-23a/b in gastric cancer tissues and observed that both miR-23a and miR-23b could function as an anti-apoptotic factor in gastric cancer cells. [score:1]
The recombination plasmid was co -transfected into HEK293T cells along with miR-23a/b mimics. [score:1]
Because PDCD4 is a well-known pro-apoptotic gene, [23] we investigated whether miR-23a/b may suppress gastric cell apoptosis by silencing PDCD4. [score:1]
[49] Further studies should be performed to characterize the feasibility of targeting miR-23a/b in gastric cancer therapy and to develop simplified and cost-effective delivery system. [score:1]
To test the binding specificity, the sequences that interact with the miR-23a/b seed sequence were mutated, and the mutant PDCD4 3′-UTR was inserted into an equivalent luciferase reporter. [score:1]
[37] Thus, AP-1/miR-23a/PDCD4 is likely to form a double -negative (overall positive) feedback loop that contributes to gastric cancer progression. [score:1]
We also showed that hypermethylated in cancer 1 (HIC1) and miR-23~27~24 clusters form a double -negative feedback loop in breast cancer. [score:1]
[1 to 20 of 86 sentences]
3
[+] score: 277
However, SMAD3 mRNA levels were not significantly influenced by the overexpression or inhibition of miR-23a (data not shown), suggesting that SMAD3 expression was primarily inhibited by miR-23a at the translational level. [score:11]
Downregulation of miR-23a suppresses prostate cancer metastasis by targeting the PAK6-LIMK1 signaling pathway [21]. [score:8]
Our data suggest the regulation of miR-23a may be SMAD3 -dependent because SMAD3 expression was significantly suppressed when miR-23a was overexpressed. [score:8]
The results revealed that EEC -associated EMT was inhibited, since the expression of both the transdifferentiation marker a-SMA and mesenchymal marker vimentin were inhibited, and the epithelial marker E-cadherin was restored when HEC-1-A cells were treated with the miR-23a agomir. [score:7]
Hsa-miR-23a, hsa-miR-3941, hsa-miR-27a-3p and hsa-miR-3651 were the most significantly down-regulated miRNAs, whereas hsa-miR-920, hsa-miR-1204, hsa-miR-508-5p and hsa-miR-501-5p were the most significantly up-regulated miRNAs (n = 12 per group). [score:7]
Hsa-miR-23a, hsa-miR-3941, hsa-miR-27a-3p and hsa-miR-3651 were the most significantly down-regulated miRNAs, whereas hsa-miR-920, hsa-miR-1204, hsa-miR-508-5p and hsa-miR-501-5p were the most significantly up-regulated miRNAs (n = 12 per group) (Fig.   2). [score:7]
SMAD5 protein expression was also detected by Western blot and its protein level was not significantly influenced by the overexpression or inhibition of miR-23a. [score:7]
Furthermore, overexpression of miR-23a in HEC-1-A cells increased E-cadherin expression and decreased the expression of vimentin and alpha smooth muscle actin, markers of mesenchymal cellular phenotype. [score:7]
The results of miRNA profiling in human EEC tissues and corresponding nontumorous endometriums demonstrated that miR-23a expression was down-regulated. [score:6]
The results of luciferase reporter assay showed miR-23a directly targets and down-regulates human SMAD3 protein levels, not SMAD5 protein levels. [score:6]
MiR-23a directly targets and down-regulates human SMAD3 protein levels, not SMAD5. [score:6]
The expression of the most prominent miRNA, miR-23a was down-regulated almost tenfold. [score:6]
c Up-regulation of miR-23a repressed the mRNA expression of EMT markers. [score:6]
Our data provide firm evidence of a role for miR-23a in the direct regulation of EMT through its targeting of SMAD3. [score:5]
Significant differences between the EEC tissues and adjacent nontumorous endometrium samples are indicated by an asterisk (*P < 0.05) In silico programs, including PicTar, miRanda, and TargetScan, we found SMAD3 and SMAD5 maybe the target genes for miR-23a with a binding motif. [score:5]
Together, these results confirmed that SMAD3, not SMAD5 is a direct target of miR-23a and is regulated by miR-23a. [score:5]
However, the expression of E-cadherin mRNA was increased by the miR-23a agomir and decreased by the antagomir (n = 6 per group) (*P < 0.05) In this study, we demonstrated differently expressed miRNA in EEC and identified potential miRNA modulator of EMT in endometrial endometrioid adenocarcinoma. [score:5]
We showed that miR-23a targets the 3′-UTR of SMAD3 and inhibits TGF-β induced EMT in HEC-1-A cells. [score:5]
Recently, the expression of miR-23a was decreased in osteosarcoma cells and as a tumor suppressor in osteosarcoma [20]. [score:5]
Because the target genes of miR-23a were SMAD3 or SMAD5, which were the key regulator of EMT, miR-23a was a potential regulator of EMT in EEC. [score:5]
Fig.  6Expression of EMT markers when miR-23a is overexpressed in HEC-1-A cells. [score:5]
SMAD5 protein level was not significantly influenced by the overexpression or inhibition of miR-23a (n = 12 per group) In the present study, we used TGF-β1 to induce EMT in HEC-1-A cells. [score:5]
Moreover, the expression of SMAD5 was unaffected in the presence of either miR-23a mimic or inhibitor. [score:5]
In the present study, we observed that these EMT -associated markers were perturbed by miR-23a overexpression or knockdown. [score:4]
One of the down-regulated miRNAs, miR-23a, merited further investigation because it was predicted to target SMAD3 or SMAD5, which plays an important role in EMT. [score:4]
MiR-23a has previously been shown to be expressed in neuronal precursor cells and hindered the retinoic-acid -induced neuronal differentiation of NT2 cells by targeting Hes1 (hairy and enhancer of split-1) gene [16]. [score:4]
This result indicated that SMAD3, rather than SMAD5, is a specific target gene of miR-23a in the regulation of EMT in EEC. [score:4]
Fig.  4SMAD3 protein levels are down-regulated by miR-23a. [score:4]
Up-regulation of miR-23a repressed the TGF-β induced EMT in HEC-1-A cells. [score:4]
Using an unbiased miRNA screen, we identified miR-23a as an down-regulated miRNA in EC. [score:4]
Based on the significant down-regulation of miR-23a in human EEC, we undertook detailed mechanistic studies. [score:4]
Inhibition of miR-23 represses angiogenesis in vitro and postnatal retinal vascular development in vivo. [score:4]
In the present study, we found that miR-23a was significantly down-regulated in human EEC samples. [score:4]
These results clearly show the up-regulation of miR-23a repressed the TGF-β induced EMT biomarkers in HEC-1-A cells. [score:4]
MiR-23a was selected for further analysis because it was down-regulated approximately tenfold. [score:3]
In contrast, the expression of both α-SMA and vimentin was decreased when the HEC-1-A cells were treated with the miR-23a agomir but increased when the cells were treated with the miR-23a antagomir. [score:3]
However, the expression of E-cadherin mRNA was increased by the miR-23a agomir and decreased by the antagomir (n = 6 per group) (*P < 0.05) The samples were pooled into six groups (con1, con2, con3, EC1, EC2, and EC3. [score:3]
Thus, we demonstrate that miR-23a might be as an EMT-related miRNA in EEC by targeting SMAD3. [score:3]
Due to its ability to repress the EMT, miR-23a may be a novel target for EER therapeutic intervention. [score:3]
However, when the HEC-1-A cells were treated with the miR-23a antagomir, changes in the expression level of these three EMT markers were reversed. [score:3]
Moreover, miR-23 is required for pathological angiogenesis in a laser -induced choroidal neovascularization mouse mo del by promoting angiogenic signaling through targeting Sprouty2 and Sema6A proteins [18]. [score:3]
We found the TGF-β/SMAD signaling pathway was significantly enriched among the predicted targets of miR-23a (P = 0.032). [score:3]
The results shown in Fig.   6 illustrate that E-cadherin protein expression increased when the HEC-1-A cells were treated with the miR-23a agomir but decreased when the HEC-1-A cells were treated with the miR-23a antagomir. [score:3]
The presented evidence underscores the importance of miR-23a as a novel target for therapeutic intervention and indicates that this miRNA merits further investigation as a promising gene therapy target for the treatment of endometrial endometrioid adenocarcinoma. [score:3]
a SMAD3 protein expression was decreased by treatment with the miR-23a agomir but increased by treatment with a miR-23a antagomir in HEC-1-A cells (top data from the gels; bottom normalization to GAPDH) (n = 6 per group) (*P < 0.05). [score:3]
In contrast, the protein expression of both α-SMA and vimentin decreased when the HEC-1-A cells were treated with the miR-23a agomir but increased when the cells were treated with the miR-23a antagomir. [score:3]
MiR-23a mimic, inhibitor, agomir or antagomir were purchased from RiboBio Inc (GuangZhou, China). [score:3]
Human SMAD3 or SMAD5 3′-UTR, containing the putative target site for miR-23a, was amplified from genomic DNA by PCR amplification and inserted into the pmiR-REPORT™ (RiboBio). [score:3]
The expression of mRNAs encoding α-SMA and vimentin was reduced in HEC-1-A cells treated with the miR-23a agomir but increased in cells treated with the miR-23a antagomir. [score:3]
Significantly, partial deletion of the perfectly complementary sites in the 3′-UTR of SMAD3 abolished the suppressive effect due to the disruption of the interaction between miR-23a and SMAD3 (Fig.   3). [score:3]
Significantly, partial deletion of the perfectly complementary sites in the 3′-UTR of SMAD3 abolished the suppressive effect due to the disruption of the interaction between miR-23a and SMAD3. [score:3]
Using bioinformatics, we identified SMAD3 or SMAD5 maybe as a predicted target of miR-23a. [score:3]
Several targets of miR-23a were previously validated in other tumor cell types, including RUNX2 and CXCL12 in osteosarcoma. [score:3]
From the bioinformatics database, miR-23a was predicted to target the SMAD3 (a) or SMAD5 (b) gene at a site in the 3′-UTR. [score:3]
However, there has no report about targets of miR-23a in EMT. [score:3]
b SMAD5 protein expression was decreased by treatment with the miR-23a agomir but increased by treatment with a miR-23a antagomir in HEC-1-A cells (top data from the gels; bottom normalization to GAPDH). [score:3]
From this bioinformatics database, miR-23a was predicted to target the SMAD3 or SMAD5 gene at a site in the 3′-UTR. [score:3]
E-cadherin protein expression was increased when the HEC-1-A cells were treated with the miR-23a agomir but decreased when the cells were treated with the miR-23a antagomir. [score:3]
In the presence of the miR-23a mimic, expression of the renillaluciferase reporter was repressed 2.9-fold compared with the vector-only control. [score:2]
MiR-23a had also been identified in a comparison between EEC and nontumor and it was not reported to be the most differentially expressed [19]. [score:2]
In conclusion, we have identified a molecular mechanism to be involved in EMT during the development of EEC involving miR-23a and SMAD3. [score:2]
Through in silico prediction and luciferase reporterassay, we found that SMAD3, may be one of miR-23a target genes in EEC. [score:2]
Triplicate assays were performed for each sample (n = 6 per group) (*P < 0.05) Furthermore, SMAD3 protein expression was decreased by treatment with the miR-23a agomir but increased by treatment with a miR-23a antagomir in HEC-1-A cells (Fig.   4). [score:2]
Triplicate assays were performed for each sample (n = 6 per group) (*P < 0.05) Furthermore, SMAD3 protein expression was decreased by treatment with the miR-23a agomir but increased by treatment with a miR-23a antagomir in HEC-1-A cells (Fig.   4). [score:2]
Whereas, we didn’t find any significant decrease in relative luciferase activity when pGL3-SMAD5-3′-UTR was cotransfected with a miR-23a mimic. [score:1]
To test the possibility of a direct link between miR-23a and human SMAD3 or SMAD5, we performed a dual luciferase reporter assay in HEC-1-A cells. [score:1]
We didn’t find any known correlation between miR-23a and the clinico-pathological features of EEC through the literature search. [score:1]
It was reported miR-23 is enriched in endothelial cells and highly vascularized tissues. [score:1]
Similarly, E-cadherin mRNA levels were increased by the miR-23a agomir but decreased by the miR-23a antagomir, while α-SMA and vimentin mRNA levels were decreased in HCE-1-A cells treated with the miR-23a agomir but increased in HCE-1-A cells treated with the miR-23a antagomir. [score:1]
Additionally, miR-23a is required to restrict endocardial cushion formation and extracellular hyaluronic acid production [17]. [score:1]
A significant decrease in relative luciferase activity was observed when pGL3-SMAD3-3′-UTR was cotransfected with a miR-23a mimic. [score:1]
[1 to 20 of 71 sentences]
4
[+] score: 265
The tumor suppressor IRF1 appears to be another possible target gene of miR-23a, which is consistent with a mo del whereby miR-23a is an oncogenic miRNA that promotes tumor development by targeting and negatively regulating tumor suppressors. [score:11]
In summary, we have demonstrated that miR-23a down-regulates IRF1 expression by targeting the 3′UTR of IRF1 to regulate pro-proliferative and anti-apoptotic activity in gastric cancer cells. [score:9]
Here, we have reported a post-transcriptional mechanism in which miR-23a directly targets IRF1 and down-regulates its expression level in gastric adenocarcinoma cell lines (Fig. 9). [score:9]
The up-regulated miRNAs, such as miR-23a, may function as oncogenes and may promote tumor growth by suppressing their target genes. [score:8]
In post-transcription level, IRF1 expression level was suppressed and directly targeted by miR-23a, which plays an important role in tumorigenesis of gastric cancer. [score:8]
0064707.g009 Figure 9 In post-transcription level, IRF1 expression level was suppressed and directly targeted by miR-23a, which plays an important role in tumorigenesis of gastric cancer. [score:8]
The ectopic expression of IRF1 also counteracted the inhibition of paclitaxel -induced apoptosis caused by miR-23a expression in the (Fig. 8 A and 8B). [score:7]
When miR-23a expression was inhibited, IRF1 mRNA levels increased, whereas when miR-23a was over-expressed, IRF1 mRNA levels were decreased relative to the control group (Fig. 3D). [score:7]
miR-23a also targets glutaminase (GLS) mRNA and inhibits the expression of the GLS protein [19]. [score:7]
To confirm whether miR-23a can bind to the target site in IRF1 3′UTR directly, we constructed an enhanced green fluorescence protein reporter vector (EGFP-IRF1 3′UTR), in which the predicted target regions were inserted downstream of the EGFP coding region. [score:6]
The miR-23a -induced malignant phenotypes of gastric adenocarcinoma appear to occur through the down-regulation of IRF1 expression. [score:6]
Thus, these results provide strong evidence that miR-23a is prominently over-expressed in gastric adenocarcinomas, and the expression of IRF1 in gastric adenocarcinomas is much lower than normal, which supports the hypothesis that miR-23a negatively regulates IRF1 in gastric adenocarcinoma tissues. [score:6]
To further confirm the up-regulation of miR-23a in gastric adenocarcinomas, quantitative real-time PCR was applied to detect the expression level of miR-23a in 9 pairs of gastric adenocarcinoma tissue samples and matched normal gastric tissue samples. [score:6]
To examine whether miR-23a antagonizes endogenous IRF1 expression, quantitative real-time PCR and western blot analyses were performed to detect IRF1 mRNA and protein expression. [score:5]
An increase in miR-23a expression and a concomitant decrease in IRF1 expression in gastric adenocarcinoma cells appear to contribute to the tumorigenesis of gastric adenocarcinomas. [score:5]
These results suggest that IRF1 is a tumor suppressor, functions as a target of miR-23a and is involved in the miR-23a–mediated malignant phenotype of gastric adenocarcinoma cells. [score:5]
The over -expression of miR-23a suppresses paclitaxel -induced apoptosis of MGC803 and BGC823 cells (Fig. 2A and 2B). [score:5]
Relative to the control, expression of pcDNA3/IRF1 reversed the negative effects of miR-23a on IRF1 protein expression in MGC803 cells and BGC823 cells (Fig. 7A). [score:5]
Accordingly, to further confirm that miR-23a promotes the growth of gastric adenocarcinoma cells by down -regulating IRF1, we constructed pSilencer/sh-IRF1 plasmids to knockdown the expression of IRF1. [score:5]
Compared to the control group, the over -expression of miR-23a suppressed paclitaxel -induced apoptosis in MGC803 and BGC823 cells, whereas the knockdown of miR-23a caused the opposite results (Fig. 6A and 6B). [score:5]
The effects of over -expression or knockdown of miR-23a in MGC803 and BGC823 cells on paclitaxel -induced apoptosis. [score:4]
We also constructed the expression vector pCD3/IRF1, which lacks a 3′UTR and is thus not subjected to miR-23a regulation. [score:4]
Biological effects of the over -expression or knockdown of miR-23a in human gastric adenocarcinoma cells. [score:4]
These observations suggest that miR-23a binds directly to the 3′UTR of IRF1 and represses IRF1 expression. [score:4]
The results showed that miR-23a was remarkably up-regulated in gastric adenocarcinoma tissue samples (Fig. 4A). [score:4]
IRF1 is directly targeted by miR-23a. [score:4]
In a previous study from our lab, we showed that miR-23a is up-regulated in gastric adenocarcinomas based on oligonucleotide microarrays. [score:4]
Collectively, these results suggest that miR-23a regulates endogenous IRF1 expression at the post-transcriptional level. [score:4]
We further validate interferon regulatory factor 1 (IRF1) as a target gene of miR-23a. [score:4]
To determine whether miR-23a represses IRF1 expression by binding directly to its 3′UTR, we first used various algorithms to predict potential miR-23a binding sites in the 3′UTR of IRF1 (Fig. 3A). [score:4]
miR-23a, is located in the miR-23a/24/27a cluster and regulates the TGF-β -induced epithelial–mesenchymal transition (EMT) by targeting E-cadherin in lung cancer cells [16]. [score:4]
U6 RNA was included as an endogenous housekeeping gene, and the relative miR-23a expression is shown (n = 9, p<0.05). [score:3]
Therefore, we used bioinformatic analysis methods to predict potential target genes that could mediate the cell growth functions of miR-23a. [score:3]
Given that miR-23a can promote cell growth viability and colony formation ability, we also performeds to determine the effect of miR-23a expression on paclitaxel -induced apoptosis. [score:3]
The miR-23a/24/27a cluster appears to function as an antiapoptotic and proliferation-promoting factor in liver cancer cells [20], and miR-23a has been shown to be significantly up-regulated in bladder cancers compared to normal bladder mucosa [21]. [score:3]
miR-23a promotes colon carcinoma cell growth, invasion and metastasis through the inhibition of the MTSS gene [18]. [score:3]
Relative to the control vector, the expression of the pcDNA3/IRF1 construct reversed the negative effects of miR-23a on paclitaxel -induced apoptosis from approximately 42%±8% (p<0.05) to 89%±9% (p<0.05) in MGC803 cells and approximately from 39%±7% (p<0.05) to 92%±8% (p<0.05) in BGC823 cells (Fig. 8C). [score:3]
Restoration of IRF1 expression counteracts the effects of miR-23a. [score:3]
0064707.g004 Figure 4 (A) The expression of miR-23a was detected by real-time PCR in 9 pairs of gastric adenocarcinoma tissue and the corresponding adjacent normal tissue. [score:3]
In the current study, we show that human miR-23a can promote cell proliferation and suppress paclitaxel -induced apoptosis in gastric adenocarcinoma cell lines. [score:3]
To validate whether the effects of miR-23a expression on cell growth and paclitaxel -induced apoptosis in MGC803 and BGC823 cells are mediated by IRF1, we transfected pri-miR-23a into MGC803 and BGC823 cells along with either the control pcDNA3 or pcDNA3/IRF1. [score:3]
In our previous study, we demonstrated that IL6R is a target gene of miR-23a [22]. [score:3]
Inverse expression of miR-23a and IRF1 in gastric adenocarcinoma tissues. [score:3]
Differential expressions of miR-23a and IRF1 in gastric adenocarcinoma tissues and matched normal tissues. [score:3]
The miR-23a cluster is a downstream target of PU. [score:3]
Schaefer et al. reported that IRF1 and IRF2 can constitutively activate the promoter of the EBV BamHI Q fragment [43], but whether miR-23a -mediated IRF1 suppression is involved in EBV infection in gastric cancer remains unknown. [score:3]
miR-23a promotes cell proliferation and suppresses paclitaxel -induced apoptosis of gastric adenocarcinoma cells. [score:3]
The relative expression levels of miR-23a in 9 pairs of gastric adenocarcinoma tissue samples were 7.89, 2.22, 2.06, 37.44, 7.09, 5.49, 7.09, 0.64 and 0.76 (p<0.05), respectively, compared to matched normal gastric tissue samples (Fig. 4A). [score:2]
IRF1 is directly repressed by miR-23a. [score:2]
Similarly, we constructed another EGFP reporter vector (EGFP-IRF1 3′UTR mutant) containing mutations in the miR-23a binding sites (Fig. 3A). [score:2]
Moreover, a mutant fragment of the IRF1 3′UTR, containing a mutated miR-23a binding site, was amplified by PCR site-directed mutagenesis and was cloned into the pcDNA3/EGFP plasmid between the BamHI and EcoRI restriction sites (pcDNA3/EGFP - IRF1 3′UTR-mut). [score:2]
The results of this study suggest that miR-23a promotes the tumorigenesis of gastric adenocarcinoma by negatively regulating IRF1. [score:2]
The ectopic expression of IRF1 reversed increased in cell viability caused by miR-23a from approximately 1.34-fold (p = 0.0048) to 0.74-fold (p = 0.0005) in MGC803 cells and from 1.41-fold (p<0.0001) to 1.01-fold (p<0.0001) in BGC823 cells compared to control group (Fig. 7B). [score:2]
miR-23a was also found to act as an oncogene in gastric cancer. [score:1]
Our results show that neither ASO-23a nor pri-miR-23a affects the intensity of the EGFP-IRF1 3′UTR mutant (Fig. 3C). [score:1]
Human gastric adenocarcinoma cells were transfected with pcDNA3, pri-miR-23a, ASO-23a or ASO-NC. [score:1]
Cells were transfected with pcDNA3, pri-miR-23a, ASO-23a or ASO-NC. [score:1]
Restoration of IRF1 counteracts the effect of miR-23a on paclitaxel -induced apoptosis in gastric adenocarcinoma cells. [score:1]
The mutated IRF1 3′UTR containing several mutated nucleotides within the miR-23a binding site is shown. [score:1]
MGC803 cells were co -transfected with the reporter vector and either pcDNA3, pri-miR-23a, ASO-NC or ASO-23a. [score:1]
In a previous study that was conducted in our lab [22], we analyzed gastric adenocarcinoma-related miRNAs using miRNA microarrays, and we identified miR-23a as an oncogenic miRNA. [score:1]
As shown in Figure 3B, the relative intensity of EGFP was increased in the ASO-23a -transfected cells and was decreased in the pri-miR-23a group relative to the negative control group. [score:1]
0064707.g003 Figure 3 (A) As predicted by the TargrtScan and PicTar database, the IRF1 3′UTR contained a miR-23a binding site. [score:1]
MGC803 cells were transfected with the EGFP-IRF1 3′UTR reporter gene together with pcDNA3, pri-miR-23a, ASO-NC or ASO-23a. [score:1]
Conversely, blocking miR-23a promotes paclitaxel -induced apoptosis in MGC803 and BCG823 cells (Fig. 2A and 2B). [score:1]
We transfected MGC803 and BGC823 cells with pri-miR-23a, ASO-23a, pcDNA3 or ASO-NC. [score:1]
The construction of the pcDNA3/pri-miR-23a (pri-miR-23a) plasmid was described in our previous published study [22]. [score:1]
These results indicate that miR-23a can repress paclitaxel -induced apoptosis and promote cell viability, which are the long-term growth ability and the independent growth ability of MGC803 and BGC823 cells. [score:1]
The induced-apoptosis index of BGC823 cells was reduced to 54%±1% (p<0.05) in the pri-miR-23a group and was increased to 1.78-fold (p<0.01) in the ASO-23a group (Fig. 2C). [score:1]
Restoration of IRF1 counteracts the miR-23a -induced cellular phenotypes in gastric adenocarcinoma cells. [score:1]
Recently, several reports have demonstrated that miR-23a has diverse functions in tumor biology. [score:1]
We also commercially synthesized a 2′-O-methyl -modified antisense oligonucleotide for miR-23a (ASO-23a) (GenePharm, Shanghai, China). [score:1]
Cells were transfected with pcDNA3, pri-miR-23a, ASO-NC or ASO-23a. [score:1]
The 3′UTR of IRF1 mRNA contains miR-23a complementary binding sites, and these binding sites are conserved among several species (Fig. 3A). [score:1]
The colony formation ability of BGC823 cells was increased 1.81-fold (p = 0.0312) in the pri-miR-23a group and that of BGC823 cells was reduced to 52%±4.7% (p = 0.0065) in the ASO-23a group (Fig. 1C). [score:1]
The cells were also cotransfected with 20 pmol of miR-23a ASO or 0.2 µg of pcDNA3/pri-23a per well. [score:1]
MGC803 (A) and BGC823 (B) cells were transfected with pcDNA3, pri-miR-23a, ASO-NC or ASO-23a. [score:1]
0064707.g001 Figure 1 Cells were transfected with pcDNA3, pri-miR-23a, ASO-NC or ASO-23a. [score:1]
This reported role for miR-23a may provide new insight into the tumorigenesis of gastric cancer and suggests that miR-23a may have potential value as a diagnostic and treatment marker in cancers. [score:1]
The IRF1 protein level of pri-miR-23a -transfected cells decreased 0.56 fold in MGC803 cells and 0.66 fold in BGC823 cells relative to the control -transfected cells (Fig. 3E). [score:1]
0064707.g002 Figure 2 MGC803 (A) and BGC823 (B) cells were transfected with pcDNA3, pri-miR-23a, ASO-NC or ASO-23a. [score:1]
[1 to 20 of 81 sentences]
5
[+] score: 249
However, in a long-term cell survival assay, up-regulation of miR-23a expression by transfecting T47D cells with the specific mimics significantly increased cell colony formation, and downregulation of miR-23a expression by transfecting MCF-7 cells with the specific ASO significantly decreased cell colony formation (Figure 4A). [score:10]
MiR-23a directly targeted XIAP 3′UTRHaving established the function of miR-23a in autophagy, we next determined whether miR-23a directly targeted XIAP. [score:7]
By using bioinformatic analyses to search for potential target genes of miR-23a, we observed that miR-23a may directly target XIAP mRNA. [score:6]
Of these miRNAs, miR-23a not only significantly down-regulated the expression of XIAP, but also increased LC3-II/LC3-I conversion ratio in both MCF-7 and T47D cells (Figure 2A). [score:6]
Herein, we demonstrated that forced expression of miR-23a inhibits apoptosis, promotes autophagy and enhances cell colony formation, migration and invasion. [score:5]
Overexpression of miR-23a enhanced autophagyTo explore the role of miRNAs in autophagy, we performed qRT-PCR analysis for the expression levels of miR-24, miR-7, miR-513a-5p and miR-23a in MCF-7 and T47D cells treated with EBSS. [score:5]
To this end, we transfected miR-23a mimics, miR-23a mimics plus XIAP expression plasmid or controls into T47D cells and observed that forced -expression of XIAP did not abrogate the anti-apoptotic effect of miR-23a in these cells (Figure 4C). [score:5]
We observed that knockdown of miR-23a expression in MCF-7 cells by miR-23a ASO did not significantly alter cell viability (P > 0.05), and forced -expression of miR-23a in T47D cells by miR-23a mimics did not significantly reduce cell viability (P > 0.05) in MTT assay (data not shown). [score:5]
By transfection of miR-23a mimics, miR-23a mimics plus XIAP expression plasmid or controls, we observed that forced expression of XIAP significantly abrogated miR-23a -induced autophagy in T47D cells (Figure 3E). [score:5]
Liu et al. [30] demonstrated that miR-23a suppressed apoptosis of gastric cancer cells by targeting the PPP2R5E gene. [score:5]
Moreover, co-transfection of cells with miR-23a mimics and the XIAP expression plasmid demonstrated that expression of XIAP significantly abrogated miR-23a mimic-promoted tumor cell migration and invasion (Supplementary Figure 4A). [score:5]
Effects of miR-23a on XIAP expression and tumor cell invasiveness in nude mouse xenograftsTo determine the effect of miR-23a expression in breast cancer cells in vivo, we injected MCF-7-VEC and MCF-7- miR-23a cells orthotopically into the mammary fat pad of female BALB/c nude mice, respectively. [score:5]
We first identified miR-23a as a regulator of autophagy and demonstrated that XIAP is a target gene of miR-23a. [score:4]
By use of immunohistochemistry, we also confirmed decreased protein expression of XIAP, P62 and increased LC3 expression in tumors generated by MCF-7- miR-23a cells compared to those generated by control cells (Figure 5). [score:4]
Figure 3 MiR-23a directly targets XIAP 3′UTR(A) Predicted binding sequences between miR-23a and seed matches in XIAP-3′UTR. [score:4]
In order to generate expression of GFP- LC3 in MCF-7 cells, we transiently expressed miR-23a and miR-23a ASO with the autophagy marker GFP- LC3, compared with negative control, 48h after co-transfection, GFP- LC3 puncta were visualized under a fluorescence microscope (Olympus XSZ-D2) equipped with CCD cameras and images were captured and analyzed for presence of more than five puncta per cell. [score:4]
Figure 5Effects of forced expression miR-23a on regulation of MCF-7 xenograft in nude miceMCF-7-Negative control and MCF-7- miR-23a cells were transplanted into the mammary fat pad of female BALB/c-nu, respectively. [score:4]
Having established the function of miR-23a in autophagy, we next determined whether miR-23a directly targeted XIAP. [score:4]
To determine whether miRNAs potentially participated in regulating autophagy, we identified several miRNAs potentially targeting XIAP by bioinformatic analysis, including miR-24, miR-7, miR-23a and miR-513a-5p. [score:4]
Effects of forced expression miR-23a on regulation of MCF-7 xenograft in nude mice. [score:4]
Transcriptional and/or post-transcriptional regulatory mechanisms may be responsible for increased miR-23a expression. [score:4]
Firstly, we identified two potential binding sites of miR-23a in the XIAP-3′UTR by Targetscan [29] (Figure 3A). [score:3]
Meanwhile, negative control, miR-23a ASO and miR-23a ASO plus XIAP inhibitor Embelin or EBSS were transfected in MCF-7 cells. [score:3]
Overexpression of miR-23a enhanced autophagy. [score:3]
We demonstrated that increased XIAP expression significantly abrogated miR-23a mimics-promoted breast cancer cell autophagy, migration and invasion. [score:3]
In contrast, miR-23a ASO significantly increased the expression of SQSTM1/P62 protein and decreased LC3-II / LC3-I conversion ratio in MCF-7 cells (Figure 2D). [score:3]
T47D cells were transfected with negative control, miR-23a mimics and miR-23a mimics plus plasmid XIAP or an autophagy inhibitor, 3-MA. [score:3]
Forced expression of miR-23a induces autophagic activity. [score:3]
Effects of miR-23a on XIAP expression and tumor cell invasiveness in nude mouse xenografts. [score:3]
It was interesting to note that expression of endogenous miR-23a was increased in response to cellular stress caused by amino acid depletion. [score:3]
To this end, we transfected T47D cells with miR-23a mimics or a negative control followed by treatment with either caspase inhibitor Z-VAD-FMK or vehicle (DMSO). [score:3]
To determine the effect of miR-23a expression in breast cancer cells in vivo, we injected MCF-7-VEC and MCF-7- miR-23a cells orthotopically into the mammary fat pad of female BALB/c nude mice, respectively. [score:3]
Similarly, we demonstrated that miR-23a promotes autophagy and inhibits apoptosis by different mechanisms in breast cancer cells. [score:3]
Finally, we demonstrated that miR-23a enhanced breast cancer cell autophagic activity through modulation of XIAP expression and also promoted cell migration and invasion. [score:3]
Herein, suppression of breast cancer cell apoptosis by miR-23a is probably mediated by some other genes rather than XIAP. [score:3]
To explore the role of miRNAs in autophagy, we performed qRT-PCR analysis for the expression levels of miR-24, miR-7, miR-513a-5p and miR-23a in MCF-7 and T47D cells treated with EBSS. [score:3]
Interestingly, our data also revealed that miR-23a did indeed inhibit cell apoptosis but this function was not mediated by XIAP. [score:3]
T47D cells were grown and transfected with miR-23a mimics, miR-23a mimics plus vector, miR-23a mimics plus expression of XIAP, or negative control. [score:3]
In MCF-7 and T47D cell lines, we found that forced expression of miR-23a resulted in a significant increase LC3-II accumulation and SQSTM1/P62 degradation. [score:3]
Previous studies have demonstrated that miR-23a suppressed apoptosis in colorectal and gastric cancer cells [30, 31]. [score:3]
Furthermore, 48 h after transient transfection of miR-23a mimics, cells were treated with the autophagy inhibitor 3-MA for 24h. [score:3]
Moreover, XIAP inhibitor Embelin and autophagy inducer EBSS dramatically abrogated miR-23a ASO-decreased tumor cell migration and invasion (Supplementary Figure 4C, 4D). [score:3]
QRT-PCR were performed to detect the expression of XIAP, ATG5, ATG7, ATG12, Beclin1, miR-23a, GAPDH, and U6 as described previously [53– 55]. [score:3]
MiR-23a directly targeted XIAP 3′UTR. [score:3]
Consistently, we observed that miR-23a significantly inhibited apoptosis of breast cancer cells (Figure 4B). [score:3]
In addition, suppression of miR-23a by specific antagonism exerted the opposite effect. [score:3]
While there was no significant change concerning P62 and LC3-II/I expression after transfection of miR-23a mimics or ASO in MCF-10A cell line. [score:3]
However, there is not a significant change about the expression of SQSTM1/P62 and XIAP protein after transfection with miR-23a mimics or ASO in non-tumorigenic MCF-10A (Figure 2E). [score:3]
Figure 2Forced expression of miR-23a induces autophagic activity(A) MCF-7 and T47D cells were transfected with miR-24 mimics, miR-7 mimics, miR-23a mimics and miR-513a-5p mimics. [score:3]
MiR-23a directly targets XIAP 3′UTR. [score:3]
GFP- LC3 Localization assayIn order to generate expression of GFP- LC3 in MCF-7 cells, we transiently expressed miR-23a and miR-23a ASO with the autophagy marker GFP- LC3, compared with negative control, 48h after co-transfection, GFP- LC3 puncta were visualized under a fluorescence microscope (Olympus XSZ-D2) equipped with CCD cameras and images were captured and analyzed for presence of more than five puncta per cell. [score:3]
Herein, to investigate the regulatory mechanism of XIAP in cell autophagy, we scanned several miRNAs and identified miR-23a as a target miRNA for XIAP -mediated autophagy and also play a role in cell viability, invasion and migration of breast cancer. [score:2]
demonstrated that miR-23a directly interacted with XIAP 3′UTR and this interaction occurred at positions 3115-3121 (Figure 3B), but not positions 1017–1024 (data not shown). [score:2]
These data implied that miR-23a promoted autophagy and cell migration and invasion using similar signaling pathways by regulation of XIAP. [score:2]
Our results support the idea that there were differences between miR-23a regulated cell lines. [score:2]
Several lines of evidence suggest that miR-23a functions as an oncogene and is involved in tumor development. [score:2]
For the essential role of XIAP in regulating cell apoptosis, we may ask that whether miR-23a -induced autophagy was associated with apoptosis. [score:2]
Experimentally by use of reporter assays we observed that XIAP was indeed a target gene of miR-23a as expected. [score:2]
MiR-23a mimics diminished the expression of SQSTM1/P62 protein and increased LC3-II/LC3-I conversion ratio in T47D cells. [score:2]
The level of miR-23a expression was the most increased of 4 miRNAs in cells cultured with EBSS, compared with cells cultured with normal medium (Figure 2B). [score:2]
MiR-23a expression has been reported in a wide range of malignancies, including gastric, colorectal, and breast cancers [30, 31, 37]. [score:2]
Next, we determined whether XIAP was involved in miR-23a-regulated apoptosis. [score:2]
In the present study, we have identified miR-23a as a novel miRNA regulating basal autophagy. [score:2]
Histology of xenografts showed that tumors derived from MCF-7- miR-23a cells were poorly encapsulated and highly invasive in comparison to tumors derived from control cells (Figure 5). [score:1]
5 × 10 [6] MCF-7-VEC and MCF-7- miR-23a cells were suspended in 120 μl Matrigel /PBS at a ratio of 1:1 (v/v) and then injected into the mammary fat pad of female BALB/c-nu. [score:1]
MCF-10A cells were transiently transfected with miR-23a mimics and miR-23a ASO. [score:1]
Forty-eight hours after transfected with miR-23a mimics and Negative control in T47D cells, which were treated with 20 uM Z-VAD-FMK or DMSO for 2 h. Cell lysates were analyzed by Western blotting. [score:1]
T47D cells were transiently transfected with miR-23a mimics and MCF-7 cells were transiently transfected with miR-23a ASO. [score:1]
As shown in Figure 2F, there was a significant increase of GFP- LC3 puncta in miR-23a mimics transfected cells and a decrease of GFP- LC3 puncta in miR-23a ASO transfected cells both in non-starved and EBSS-exposed breast cancer cells. [score:1]
We then performed qRT-PCR to examine the level of XIAP mRNA in cells transfected with miR-23a mimics and miR-23a ASO. [score:1]
Effects of miR-23a on breast cancer cell viability, migration, invasion and apoptosis. [score:1]
Next, miR-23a mimics and miR-23a ASO, respectively, were transfected into T47D and MCF-7 cells together with the GFP- LC3 plasmid and examined by fluorescence microscopy. [score:1]
MCF-7-Negative control and MCF-7- miR-23a cells were transplanted into the mammary fat pad of female BALB/c-nu, respectively. [score:1]
We demonstrated that miR-23a promoted XIAP -mediated autophagy was independent of the caspase -mediated apoptotic pathway. [score:1]
As shown in Supplementary Figure 2, miR-23a produced a slight decrease in the XIAP mRNA level and miR-23a ASO exerted the opposite effect. [score:1]
Cells were plated on a 24-well plate 24h before transfection at 50% confluence and then co -transfected with 0.2 ug of psiCHECK2- XIAP 3′UTR or psiCHECK2 control vector and 30 nM miR-23a mimics or its negative control by using Lipofectamine 3000. [score:1]
We performed Western blot analysis to detect LC3-II/LC3-I conversion ratio in T47D and MCF-7 cells after transfection with miR-23a mimics and miR-23a ASO, respectively. [score:1]
We next determined whether promotion of autophagy by miR-23a was mediated by XIAP. [score:1]
Effects of miR-23a on breast cancer cell viability, migration, invasion and apoptosisWe next explored the effect of miR-23a on the behaviors of breast cancer cells in vitro. [score:1]
Luciferase reporter assay demonstrated that miR-23a directly interacted with XIAP 3′UTR and this interaction occurred at positions 3115-3121 (Figure 3B), but not positions 1017–1024 (data not shown). [score:1]
This work shed light on the independent relationship between autophagy and apoptosis mediated by miR-23a. [score:1]
3-MA significantly abrogated miR-23a mimic-promoted tumor cell migration and invasion (Supplementary Figure 4B). [score:1]
Breast cancer T47D and MCF-7 cells (1.0 × 10 [5] /well) were seeded in 6-well plates overnight and then respectively transfected with miR-23a mimics (GenePharma, Shanghai) or its negative control and 2′-O methylated single-stranded miR-23a antisense oligonucleotide (ASO, GenePharma) or its negative control, and RNA duplex control using Lipofectamine 3000 (Invitrogen, Carlsbad, Calif, CA, USA) following the instructions of the manufacturer. [score:1]
Effects of miR-23a on breast cancer cell viability and apoptosis. [score:1]
Shown is the qRT-PCR analysis for miR-24, miR-7, miR-513a-5p and miR-23a. [score:1]
T47D and MCF-7 cells were grown and transiently transfected with miR-23a mimics and miR-23a ASO, respectively, and then seeded in 0.35% top agarose and 10% FBS in six-well plates in triplicate. [score:1]
We further observed by transmission electron microscopy that accumulation of autophagosomes was increased in cells transfected with miR-23a and concordantly observed enhancement of GFP- LC3 puncta formation by fluorescence microscopy. [score:1]
It was observed that the effect of miR-23a on LC3-II/LC3-I conversion ratio and the protein level of XIAP in T47D cells was not affected by Z-VAD-FMK treatment (Figure 3F), suggesting that miR-23a induced XIAP -mediated autophagy was independent of caspase -mediated apoptosis. [score:1]
The mechanisms of miR-23a-promoted cell autophagy, survival, migration and invasion required further delineation. [score:1]
To determine whether the effect of miR-23a on breast cancer cell migration and invasion was medicated by XIAP in vitro, we used a Transwell insert (8 μm, Corning, NY). [score:1]
We next explored the effect of miR-23a on the behaviors of breast cancer cells in vitro. [score:1]
Furthermore, 3-MA decreased miR-23a mimics -induced cell migration and invasion. [score:1]
Western blot analysis showed that the cellular levels of XIAP protein were significantly decreased in miR-23a mimics transfected cells and significantly increased in miR-23a ASO transfected cells (Figure 2D). [score:1]
[1 to 20 of 93 sentences]
6
[+] score: 240
Furthermore, the recent experiments demonstrated that miR-23a-3p was up-regulated in both aged and senescent fibroblasts and miR-23a expression was remarkably up-regulated in HaCaT cells after the UVB irradiation [13, 14]. [score:9]
However, miR-23a serves as a promising target as the link between miRNA expression and photoaging, as it has been reported to be up-regulated in several in vitro and in vivo aging mo dels [17– 19]. [score:8]
Finally, studies on the expression levels of miR-23a in diseases with autophagy abnormalities may reveal the potential of this miRNA as a disease marker. [score:7]
The effects of the miR-23a -induced down-regulation of AMBRA1 in SIPS fibroblasts may indicate the inhibition of its autophagy while no obvious apoptosis is present. [score:6]
MiR-23a inhibits AMBRA1 expression by targeting its 3′-UTR. [score:6]
While upregulation of miR-23a could accelerate the senescence of fibroblasts, Ant-23a -treated cells showed increased percentage of EdU -positive cells and decreased expressions of senescence-related proteins, G1 phase arrested cell percentage, and SA-β-gal positive cell percentages. [score:6]
For example, miR-23a induces cellular senescence by downregulating HAS2 expression and HA synthesis in vitro [14]. [score:6]
To confirm whether AMBRA1 is a direct target of miR-23a in fibroblasts, we cloned either a 1038-bp fragment of the AMBRA1 3′-UTR containing the target sequence or a fragment of the 3′-UTR containing a target site mutated to be a luciferase reporter vector (Figure S4) and investigated the effect of miR-23a on the luciferase activity of each construct in 293T cells. [score:6]
In conclusion, mir-23a plays an important role in regulation of aging by inhibiting AMBRA1 expression and autophagy. [score:6]
The putative miR-23a targets were predicted using several different algorithms, including TargetScan (http://www. [score:5]
In SIPS, the expression of miR-23a was increased, whereas the autophagy levels and AMBRA1 expression were decreased. [score:5]
miR-23a downexpression suppressed the PUVA- and UVB -induced SIPS. [score:5]
Moreover, overexpression of miR-23a led to the attenuation of GFP-LC3 puncta formation (Figure 6a-6b), decrease in protein levels of LC3 II, and prevention of SQSTM1/p62 degradation (Figure 6c and Figure S6), confirming the inhibitory effect of this miRNA on autophagy. [score:5]
As shown in Figure 5b, miR-23a suppressed the luciferase activity of the pmiR-AMBRA1-wt compared with the negative control, while the mutation of the miR-23a binding site blocked this suppressive effect. [score:5]
AMBRA1 as a direct target of miR-23a- and miR-23aaffected AMBRA1 levels in fibroblasts. [score:4]
Upregulation of AMBRA1 activated autophagic flux and restrained senescence in PUVA- and UVB-SIPS fibroblasts and its effects can be mitigated by miR-23a agomirs. [score:4]
Surprisingly, down-regulated miR-23a, but not miR-27a or miR-24, is necessary for reducing the SA-β-gal percentage and increasing EdU -positive cell percentage, which is the hallmark of PUVA-SIPS and UVB-SIPS fibroblasts. [score:4]
MiR-23a targets the LRP5 to inhibit osteogenic differentiation of human bone marrow-derived mesenchymal stem cells [28]. [score:4]
Furthermore, the molecular target of miR-23a was also identified via a bioinformatics approach in an effort to elucidate the mechanism of regulation of miR-23a. [score:4]
Our experiments demonstratedmiR-23a binding sites on the 3′-UTR of AMBRA1 mRNA, and corresponding biological assays suggest that miR-23a suppresses AMBRA1 expression in humans. [score:4]
As previously discussed, miR-23a, miR-24, and miR-27a are in the same gene cluster, but up-regulation of miR-27a and miR-24 does not produce the same effects as miR-23a. [score:4]
Our group previously found that miR-23a was up-regulated during UVB irradiation in mouse epidermis and keratinocytes, as well as human keratinocytes (cell line HaCaT) cells [13, 24, 25]. [score:4]
In humans, miR-23a is predicted to be the most likely miRNA that regulates AMBRA1 (miRanda-mirSVR and Targetscan). [score:4]
a., b., c. The expression levels of miR-23a, miR-27a and miR-24 were detected via qRT-PCR in the UVB- and PUVA-SIPS fibroblasts as well as the sham-irradiated cells groups. [score:3]
Overexpression of miR-23a blocked rapamycin -induced increased autophagy activity. [score:3]
However, again these effects of AMBRA1were found to be suppressed in fibroblasts transfected by miR-23a agomirs. [score:3]
To further confirm these results, experiments were performed to characterize the effect of miR-23a underexpression on G1 arrest and p53, p16, and p21 protein expression. [score:3]
The above results demonstrated that under -expression of miR-23a may decrease SA-ß-gal -positive cells and increase EdU -positive cells in PUVA- and UVB-SIPS fibroblasts, suggesting an anti-SIPS effect following Ant-23a transfection. [score:3]
As shown in Figure 3a and 3b, after ultraviolet irradiation, down -expression of miR-23a significantly increased GFP-LC3 dot formation. [score:3]
Overexpression of miR-23a blocked Ad-AMBRA1 -induced anti-SIPS activity. [score:3]
Overexpression of miR-23a blocked rapamycin -induced anti-SIPS activity. [score:3]
Taken together, these results demonstrated that miR-23a-regulated autophagy mediates the development of SIPS. [score:3]
However, in our study, autophagy levels were significantly reduced in photoaged cells and the induction of autophagy by miR-23a inhibition or AMBRA1 induction only gained a relatively normal level of autophagy. [score:3]
Therefore, inhibition of endogenous miR-23a using antagomirs led to a further stimulation of the autophagic activity in UV-SIPS cells, suggesting that endogenous miR-23a contributes to the limitation of stress-activated autophagic cell responses. [score:3]
However, these effects were suppressed in fibroblasts transfected by miR-23a agomirs (Figure 7a-7e and Figure S7). [score:3]
Expression and effects of miR-23a ~27a ~24-2 cluster in PUVA- and UVB-SIPS fibroblasts. [score:3]
AMBRA1 protein levels were increased when miR-23a was underexpressed in PUVA- and UVB-SIPS fibroblasts (Figure 5c and Figure S5). [score:3]
Bioinformatic analysis of miR-23a target genes. [score:3]
The down -expression of miR-23a resulted in increased autophagic activity in the PUVA- and UVB-SIPS fibroblasts. [score:3]
The data show that under -expression of miR-23a in human dermal fibroblasts can delay PUVA- and UVB -induced premature senescence. [score:3]
The “miR-23a cluster” (miR-23a, miR-27a, miR-24-2) is located on human chromosome 19p13.2, and is expressed from its own upstream promoter, located in the 2600 to +36 bp region, which includes a GC-rich region and a transcription start site (0 to 124 bp). [score:3]
These results demonstrate that over -expression of miR-23a increased SA-Δ-gal -positive cells and decreased EdU -positive cells in non-ultraviolet irradiation group (Figure 2g-2i). [score:3]
However, these effects of Ad-AMBRA1were found to be suppressed in fibroblasts transfected by miR-23a agomirs (Figure 8c-8e and Figure S8). [score:3]
We demonstrated that the under -expression of miR-23a decreased SA-Δ-gal -positive cells and increase EdU -positive cells in PUVA- and UVB-SIPS fibroblasts. [score:3]
An interaction between miR-23a and the 3′-UTR of its target gene was predicted using RNAhybrid (http://bibiserv. [score:3]
MiR-23a impairs bone differentiation in osteosarcoma via down-regulation of GJA1 [29]. [score:3]
The expression level of miR-23a was increased in PUVA- and UVB-SIPS fibroblasts. [score:3]
Figure 2 a., b., c. The expression levels of miR-23a, miR-27a and miR-24 were detected via qRT-PCR in the UVB- and PUVA-SIPS fibroblasts as well as the sham-irradiated cells groups. [score:3]
To detect the effects of endogenous miRNA inhibition on SIPS, we transfected PUVA- and UVB-SIPS cells with miR-23a-specific antagomirs (Ant-23a), miR-24-specific antagomirs (Ant-24), miR-27a-specific antagomirs (Ant-27a), and Ant-CNT (Ant-CNT), and then analyzed the percentage of SA-Δ-gal -positive and EdU -positive cells. [score:3]
Overexpression of miR-23a blocked Ad-AMBRA1 -induced increased autophagy activity. [score:3]
By targeting AMBRA1, miR-23a affects several critical events in the autophagy pathway. [score:3]
AMBRA1 (GenBank accession number: NM_017749) was identified as a miR-23a target using the following bioinformatics methods. [score:3]
MiR-23a-specific antagomirs (Ant-23a) suppressed senescence in PUVA- and UVB-SIPS fibroblasts. [score:3]
This indicates that miR-23a functions to repress the autophagy signaling pathway during the physiological development process. [score:2]
These results suggest that rapamycin -induced autophagy rescues fibroblasts from ultraviolet -induced premature senescence and that this pathway is negatively regulated in part by miR-23a. [score:2]
In this study, miR-23a is a photo-sensitive miRNA that wi dely participates in the regulation of UV -induced photo-damage. [score:2]
Mutations in the predicted miR-23a binding sites were generated using the KOD -Plus- Mutagenesis Kit (TOYOBO, Osaka, Japan) with pmiR-AMBRA1-3′-UTR-wt as a template. [score:2]
But how miR-23a -mediated autophagy mediates the development of ultraviolet stress -induced premature senescence has yet to be established. [score:2]
The predicted interaction between miR-23a and the AMBRA1 3′ UTR is shown in Figure 5a. [score:1]
However, miR-23a has also been found to function as a growth-promoting and anti-apoptotic factor in hepatocellular carcinoma and gastric adenocarcinoma cell lines [26, 27]. [score:1]
Thus, it is apparent that miR-23a initiates senescence following ultraviolet irradiation, whereas miR-27a and miR-24 do not exert a synergistic effect. [score:1]
AMBRA1 protein level was increased in Rapamycin -treated cells (Figure 7f and Figure S7), and endogenous miR-23a level was decreased following rapamycin treatment (Figure 7g). [score:1]
The roles of miR-23a on the SA-Δ-gal -positive percentages in PUVA-SIPS and UVB-SIPS fibroblasts. [score:1]
Future in vivo studies should be conducted to explore the balance between the potential beneficial effects and side effects of autophagy modulation by miR-23a, antagomirs, and their derivatives. [score:1]
Furthermore, fibroblasts were transfected with miR-23a-specific agomirs (Ago-23a, a cholesterylated miRNA mimic shown to have similar in vitro effects as endogenous miRNA) and then analyzed the percentage of SA-Δ-gal -positive and EdU -positive cells (Wang XG, et al., 2013). [score:1]
Figure 5 a. The “seed region” of the miR-23a in the AMBRA1-3′-UTR-wt. [score:1]
To investigate the effects of endogenous miR-23a inhibition on autophagy, fibroblasts were transfected with either miR-23a -specific antagomirs (Ant-23a) or control antagomirs (Ant-CNT) and analyzed for autophagic activity. [score:1]
a. The “seed region” of the miR-23a in the AMBRA1-3′-UTR-wt. [score:1]
MiR-23a-specific antagomirs (Ant-23a) stimulated autophagy in PUVA- and UVB-SIPS fibroblasts. [score:1]
miR-23a mitigated rapamycin -induced autophagy and anti-senescence in PUVA- and UVB-SIPS fibroblasts. [score:1]
d. Prior to ultraviolet irradiation, cultured fibroblasts were transfected with miR-23a antagomirs (Ant-23a) or miR-24 antagomirs (Ant-24) in addition to either miR-27a antagomirs (Ant-27a) or control antagomirs (Ant-CNT). [score:1]
The 293T cells were co -transfected in 96-well plates with either miR-23a mimics or a negative control and either pmiR-AMBRA1-3′-UTR-wt or pmiR-AMBRA1-3′-UTR-mut via Lipofectamine 2000. [score:1]
One explanation for this discrepancy is that miR-23a is closest to transcriptional factor binding sites. [score:1]
The relation between miR-23a expression levels and autophagy levels in both PUVA- and UVB-SIPS fibroblasts was then evaluated. [score:1]
The 3′-UTR segments of AMBRA1 containing the miR-23a binding sites were amplified via PCR from the genomic DNA of 293T cells (AMBRA1-F: 5′-CCGCTCGAGAGACAAACGTTGCACTGGTGC-3′, AMBRA1-R: 5′-GAATGCGGCCGCGCGAGGGGCATGTCATCAT-3′) and were cloned into the XhoI and NotI sites downstream of the luciferase reporter gene of the pmiR-RB-Report [TM] vector (RiboBio), which was named pmiR-AMBRA1-3′-UTR-wt. [score:1]
g. qRT-PCR analysis of miR-23a mRNA levels(means ±SEM of the independent experiments, ** p < 0.01). [score:1]
g. Cultured fibroblasts were transfected with miR-23a agomir (Ago-23a) or control agomir (Ago-CNT). [score:1]
[1 to 20 of 77 sentences]
7
[+] score: 221
These findings indicated that our dual luciferase screen was able to identify miRNAs that downregulated endogenous TRF2 expression and that miR-23a may be a novel regulator of telomeres by directly targeting TRF2. [score:10]
In comparison, ectopic expression of miR-23a led to ∼35% and ∼80% decrease, respectively, in TRF2 mRNA and protein levels (Fig. 4A, B), indicating that increased miR-23a expression likely resulted in TRF2 mRNA degradation and translational inhibition. [score:9]
Importantly, the above senescent phenotypes in miR-23a overexpression cells could be rescued with the co -expression of exogenous TRF2 (Fig. 5A–E), further supporting the notion that miR-23a regulates telomere maintenance and senescence through direct inhibition of TRF2. [score:9]
We further demonstrated that miR-23a could directly target TRF2 3′UTR and inhibit TRF2 expression, inducing telomere dysfunction and cellular senescence in human fibroblast cells. [score:8]
Using five different miRNA target prediction programs, TargetScan, DIANAmT, miRanda, miRWalk, and RNA22, we derived a putative miR-23a target site within the TRF2 3′UTR (687–693 bp) that appears conserved among primates and mice (Fig. 3A). [score:7]
Interestingly, we found upregulated expression of miR-23 (∼twofold) to coincide with the reduction in TRF2 levels in replicative senescent BJ (PD88) and MRC-5 cells (PD58) (Fig. 3F and Supplemental Figure S1B). [score:6]
These data indicate specific association between miR-23a and TRF2 3′UTR and support the notion that miR-23a could directly target TRF2 by base-pairing with its target site within TRF2 3′UTR. [score:6]
Our screening of a human miRNA expression library with 553 miRNAs revealed miR-23a as a novel regulator of TRF2 expression and telomere maintenance. [score:6]
Importantly, when we mutated the highly conserved putative miR-23a target site within TRF2 3′UTR, it abrogated the ability of miR-23a to negatively regulate TRF2 expression. [score:6]
In senescent BJ and MC-5 human fibroblast cells, we also observed upregulated miR-23a levels; additionally, a concomitant reduction of TRF2 expression in both mRNA and protein levels was also apparent. [score:6]
We have provided evidence here that miR-23a could regulate TRF2 -dependent telomere maintenance and senescence control; more importantly, ectopic expression of TRF2 could rescue the phenotypes caused by miR-23a overexpression. [score:6]
Of the three cell lines, we only observed a slight increase (∼20%) in miR-23a expression in TRF2 knockdown cells (Fig. 4C), perhaps a result of increased p53 levels in TRF2 knockdown cells (Fig. 5F). [score:5]
Furthermore, we also observed accumulation of p53, p21, and p16 in miR-23a overexpressing cells, implying that miR-23a induced cell growth inhibition and senescence was p53 dependent (Fig. 5F). [score:5]
We reasoned that reduced TRF2 protein levels because of miR-23a overexpression might lead to decreased targeting of TRF2 to telomere chromatin, thus resulting in TIF induction and ATM activation. [score:5]
Given the importance of TRF2 in telomere protection, we postulated that increased expression of miR-23a should inhibit TRF2 function and disrupt normal telomere maintenance. [score:5]
In the case of miR-23a, its overexpression did not repress TRF2 expression to a level that would induce chromosome end-to-end fusions (data no shown). [score:5]
miR-23a can directly target TRF2 3′UTR. [score:4]
These data suggest that miR-23a may function as a general senescence regulatory miRNA in mammalian cells and that TRF2 is the main target in miR23a -mediated senescence pathways. [score:4]
As TRF2 knockdown activates ATM signaling and induces intermediate state telomeres in human primary fibroblast (Karlseder et al., 1999; Cesare et al., 2013), we next examined ATM activation in miR-23a overexpressed cells. [score:4]
To further confirm the effect of miR-23a on TRF2 expression regulation, we introduced into early passage and senescent cells antisense oligos against endogenous miR-23a (miR-23a antagomir). [score:4]
miR-23a was previously reported to be upregulated in replicative senescent human umbilical vein endothelial cells and human umbilical cord blood-derived multipotent stem cells (Lee et al., 2011; Dellago et al., 2013). [score:4]
Here, we identified four miRNAs, including miR-23a, that could repress endogenous TRF2 mRNA and protein expression, expanding the regulatory network that modulates TRF2 and telomere function. [score:4]
In addition, activation of p53 by nutlin-3α treatment could upregulate miR-23a level in hepatocellular carcinoma cell lines (Wang et al., 2013). [score:4]
Taken together, these data support our hypothesis that miR-23a could negatively regulate TRF2 expression during replicative senescence. [score:4]
To determine whether TRF2 could also affect miR-23a expression, we compared miR-23a levels in early passage (PD18) parental BJ fibroblasts with cells ectopically expressing full-length TRF2 or TRF2 shRNA. [score:4]
mutant 3′UTRs and found that the relative luciferase activities were reduced by ∼70% with wild-type 3′UTR (wTRF2) but remained unchanged with the 3′UTR mutant (mTRF2) (Fig. 3B), indicating that the mutated region was indeed important for miR-23a -mediated regulation of TRF2 expression. [score:4]
Consistent with the ability of miR-23a to negatively regulate TRF2 expression, we observed increased levels of endogenous TRF2 in these cells (Fig. 3G). [score:4]
miR-23a targeting of TRF2 appeared to be specific, because the protein levels of other telosome/shelterin components, such as TRF1, POT1, TIN2, and TPP1, were unaffected (Fig. 4D). [score:3]
To further determine the role of miR-23a in cellular senescence, we monitored the proliferation of cells ectopically expressing miR-23a. [score:3]
These observations indicate that TIF induction as a result of miR-23a overexpression was TRF2 dependent. [score:3]
To test this possibility, we stably expressed miR-23a in early passage BJ fibroblasts. [score:3]
As TRF2-RAP1 interaction is critical for RAP1 protein stability (Celli & de Lange, 2005), we also noticed that endogenous RAP1 level decreased in miR-23a overexpressed cells (Fig. 4D). [score:3]
Overexpression of miR-23a led to telomere deprotection by reducing telomere-bound TRF2 proteins. [score:3]
For rescue experiments, miR-23a expressing cells were superinfected with retroviruses encoding GFP-SFB or TRF2-SFB and selected with 1 μg mL [−1] puromycin 24 h later. [score:3]
Multiple lines of evidence support direct regulation of TRF2 by miR-23a. [score:3]
Of the candidate miRNAs we examined, miR-23a, miR-129-2, miR-888, and miR-138-2 could suppress both mRNA and protein levels, with miR-23a being the most effective (Fig. 2B, C). [score:3]
As shown in Fig. 5A, forced expression of miR-23a led to decreased cell proliferation (∼twofold decrease by day 6) and enhanced activities of β-galactosidase (SA-β-gal), a senescence biomarker. [score:3]
We next investigated whether the changes in TRF2 expression were accompanied by telomere deprotection and examined the formation of telomere dysfunction -induced foci (TIFs) in BJ cells stably expressing miR-23a. [score:3]
To determine whether the putative site could indeed be targeted by miR-23a, we mutated the predicted seed region (2-8nt) (Bartel, 2009) and generated a TRF2 3′UTR mutant (Fig. 3A, B). [score:3]
As shown in Fig. 4G, overexpression of miR-23a resulted in phosphorylation of ATM S1981, but not the ATM downstream effector Chk2 (T68 phosphorylation) (Fig. 4G). [score:3]
Consistent with our hypothesis, the amount of telomere-bound TRF2 in cells overexpressing miR-23a was ∼30% of that in control cells (Fig. 4H, I), adding further support to the notion that miR-23a can induce telomere dysfunction by reducing the amount of telomere-bound TRF2. [score:3]
Consequently, TRF2 regulation by miR-23a may provide adaptive mechanisms for cells in response to different signaling stimuli and regulatory networks. [score:3]
miR-23a overexpression induced cellular senescence. [score:3]
The ability of miR-23a to target wild-type (wTRF2) vs. [score:3]
As shown in Fig. 4E, F, overexpression of miR-23a led to a sevenfold increase in TIF -positive cells (15% vs. [score:3]
Fig. S1 TRF2 and miR-23a expression in MRC-5 fibroblast cells. [score:3]
Consistent with our SA-β-gal staining results, overexpression of miR-23a also elevated SAHF in these cells, with ∼10% SAHF -positive cells by day 8 compared to ∼1% in control cells (Fig. 5D, E). [score:2]
Perhaps by inducing telomere dysfunction and cellular senescence, miR-23a mediated regulation of TRF2 functions as a part of the p53 -induced senescence mechanism to avoid cell immortality. [score:2]
These findings uncover a novel function for miR-23a and highlight new regulatory mechanisms that control telomere DNA damage response and cellular senescence. [score:2]
Mutations in the seed region of miR-23a binding site in the TRF2 3′UTR were generated by overlap extension PCR. [score:2]
Further work will be needed to better elucidate the relationship between p53 activation and miR-23a activity. [score:1]
Control miRNA antagomir negative oligo (NC) and miR-23a antagomir oligo were purchased from Genepharma; miRNA antagomir negative control (NC): 5′-UUGUACUACACAAAAGUACUG-3′ and miR-23a antagomir: 5′-GGAAAUCCCUGGCAAUGUGAU-3′. [score:1]
For miR-23a, total RNAs were isolated using Trizol (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed using ReverTra-Ace-α-Transcriptase (TOYOBO, Japan). [score:1]
Furthermore, we were able to pull down endogenous miRNA23a using biotin-labeled TRF2 3′UTR, and vice versa with labeled miR-23a (Fig. 3C, D). [score:1]
Data from previous studies support the importance of miR-23a in controlling cell growth and proliferation (Chhabra et al., 2009). [score:1]
Biotin-labeled miR-23a and miR-23a antisense oligos were purchased from Genepharma; miR-23a: 5′-biotin-AUCACAUUGCCAGGGAUUUCC-3′ and miR-23a anti-sense: 5′-biotin-GGAAAUCCCUGGCAAUGUGAU-3′. [score:1]
Here, miR-23a significantly increased the percentage of SA-β-gal -positive cells over controls (∼6.8-fold by day 8) (Fig. 5B, C and supplementary Figure S2). [score:1]
Taken together with our results, these data point to a putative p53-miR-23a-TRF2 signaling cascade. [score:1]
[1 to 20 of 58 sentences]
8
[+] score: 211
Other miRNAs from this paper: hsa-mir-122, hsa-mir-132
As miR-23a directly targets the 3′ UTR of IRF1 and down-regulates its expression, an expression vector containing only the open reading frame (ORF) of IRF1 should rescue the enhancement of viral replication induced by ectopic expression of miR-23a. [score:13]
To confirm that miR-23a directly binds the IRF1 3′ UTR and regulates gene expression in HeLa cells, either a pcDNA3 vector expressing EGFP and carrying the 3′ UTR of IRF1 containing the predicted miR-23a -binding sites downstream or a control vector containing the mutational sites (Fig. 2A) was co -transfected with a vector expressing pre-miR-23a. [score:10]
Most likely, by targeting IRF1, miR-23a indirectly suppresses RSAD2 expression to facilitate HSV-1 replication (Fig. 6E). [score:8]
Although the miR-23a targets predicted by Targetsscan 6.2 suggest that miR-23a cannot directly target the RSAD2 UTR, we need to go further confirmed. [score:8]
Our laboratory previously demonstrated that miR-23a directly targets IRF1 genes and negatively regulates their expression in gastric adenocarcinoma cells [26]. [score:7]
miR-23a targets IRF1 directly and negatively regulates IRF1 expression in HeLa cells. [score:7]
As shown in Fig. 2B, the intensity of EGFP fluorescence in cells transfected with the wide type reporter vector was lower compared to the control group at 48 h post-transfection, suggesting that miR-23a may target IRF1 and specifically suppress its expression by binding to 3′ UTR. [score:6]
These suggest that miR-23a facilitates virus replication by down -regulating IRF1 mRNA to suppress RSAD2 expression and apoptosis. [score:6]
The results indicated that expression of miR-23a promoted viral replication, whereas down-regulation of miR-23a reduced or completely reversed the pro-virus effect (Fig. 1D). [score:6]
To exert the least influence on cell viability with abnormal expression of miR-23a, we first examined the viability of HeLa cells transfected with different doses of miR-23a expression vector (Pri-miR-23a) or anti-miR-23a expression vector (Anti-miR-23a) by MTT assay. [score:6]
During early HSV infection, the down-regulated miR-23a may be due to the host stress response which will initiate the antiviral system or suppress the virus-promoting system to prevent the virus infection. [score:6]
For example, IRF1 -dependent transcriptional activation of caspase 8 regulates the apoptotic pathway [45], and up-regulation of miR-23a permits anti-caspase -dependent apoptosis in several types of human cells [46], [47]. [score:5]
HeLa cells were transfected with 0.2 µg of the fluorescent reporter vector with 0.2 µg of the miR-23a expression vector or the inhibitor and controls. [score:5]
But during late infection, the virus antagonizing the host's defense, and the virus antigen expression and replication may both induce miR-23a expression and other virus-promoting system to benefit its own infection. [score:5]
Recently, interferon regulatory factor 1 (IRF1), which is involved in innate antiviral immunity, inflammation, and the pro-apoptotic pathway, was identified as a target of miR-23a to regulate cells growth and apoptosis in gastric adenocarcinoma [26]. [score:5]
This mo del shows the probable pathways by which miR-23a can promote viral replication, which is involved in the down-regulation of RSAD2, an anti-viral gene. [score:4]
IRF1 is the direct target of miR-23a. [score:4]
Conversely, knockdown of miR-23a by anti-miR-23a enhanced EGFP expression (Fig. 2B). [score:4]
miR-23a regulates cell functions through modulation of target genes, such as transcription factor HOXB4 and metallothionein 2A [24], [25]. [score:4]
To up-regulate miR-23a, two doses of vectors were used for transfection, 0.5 µg/well and 0.3 µg/well. [score:4]
Some studies suggest that miR-23a acts as an oncogene by regulating cell growth and apoptosis [15], [16], but few studies have examined its role in viral diseases. [score:4]
Based on miR-23a served pro-virus function, IRF1 is supported it is to be a candidate target of miR-23a. [score:3]
Ectopic expression of IRF1 counteracts the viral replication induced by miR-23a. [score:3]
A detailed time-course experiment further showed that miR-23a was not steadily increased or decreased in HSV-1-infected HeLa cells, reaching its peak expression as late as 18 h post-infection (Fig. 5A). [score:3]
This suggests that miR-23a induction could be the result of viral gene expression rather than viral binding. [score:3]
To illustrate the possible mechanism underlying the above effect, it is necessary to identify the target genes of miR-23a. [score:3]
Time course of endogenous miR-23a and IRF1 expression are affected by HSV-1 infection (Fig. 5). [score:3]
At 24 h post-transfection, total RNA was extracted and analyzed for miR-23a expression by quantitative real-time PCR. [score:3]
Anti-miR-23a plasmid expressing miR-23a antisense was constructed by inserting annealed double strand oligogmers of miR-23a-sense-Top(GATCCGGAAATCCCTGGCAATGTGATTTTTTC) and miR-23a-antisense-Bot (TCGAGAAAAAATCACATTGCCAGGGATTTCCG) into BamHI and XhoI sites of pRNAT-U6.2/Lenti. [score:3]
However, when the miR-23a binding site in the EGFP-IRF1 3′ UTR reporter vector was mutated (EGFP-IRF1 3′ UTR mutant), neither overexpression nor blocking of miR-23a affect the intensity of EGFP fluorescence (Fig. 2C). [score:3]
0114021.g005 Figure 5 (A) miR-23a expression was determined by quantitative real-time PCR at indicated time. [score:3]
0114021.g002 Figure 2 (A) As predicted in the TargetScan database, the IRF1 3′UTR carries a miR-23a -binding site. [score:3]
In contrast, ectopic expression of miR-23a caused the amount of RSAD2 mRNA and protein to decrease by about 40% and 30%, respectively (Fig. 6A). [score:3]
However, whether HSV-1 infection could induce miR-23a expression and miR-23a has a similar function during infection with other viruses remain a subject for future study. [score:3]
As in viral titers in cell, over -expression miR-23a showed the most viral replication (Fig. 1E). [score:3]
To express miR-23a, we amplified a DNA fragment containing the pri-miR-23a from genomic DNA using the following PCR primers: miR-23a-S, 5′– GCGGTACCTGGCTCCTGCATATGAG – 3′, miR-23a-AS: 5′ – GATGAATTCCAGGCACAGGCTTCGG – 3′, the amplified fragment was then inserted into pcDNA3 between the KpnI and EcoRI sites. [score:2]
Over -expression of miR-23a by transiently transfected with Pri-miR-23a resulted in larger plaques compared to the control vector. [score:2]
And it is unclear whether IRF1 as a transcription factor would regulates miR-23a level. [score:2]
To quantify the level of gene expression, 1 µl of cDNA was used as the template in each 20-µl reactionwith SYBR Premix ExTaq (TakaRa, Otsu, Shiga, Japan), the specific primer pairs were designed as follows: miR-23a forward: 5′ – TGCGGATCACATTGCCAGG – 3′; miR-23a reverse, 5′-CCAGTGCAGGGTCCGAGGT-3′;RSAD2-qPCR-S: 5′ CTGTCCGCTGGAAAGTG 3′; RSAD2-qPCR-AS: 5′ GCTTCTTCTACACCAACATCC 3′. [score:2]
Dysregulation of miR-23a has been found in various human cancers, including tumors occurring in the breast, colon, and lung; gastric cancers; hepatocellular carcinoma; and acute myeloid leukemia [18]– [23]. [score:2]
These data further confirm that miR-23a and IRF1 are inversely correlated not only in regulation but also in function. [score:2]
Fluorescent-report assay indeed revealed it to be a target gene of miR-23a in HeLa cells. [score:2]
The IRF1 3′UTR mutant, containing four mutated nucleotides within the miR-23a -binding site, is shown. [score:1]
0114021.g001 Figure 1(A) HeLa cells were transfected with Pri-miR-23a, pcDNA3, Anti-miR-23a and pRNAT-U6.2, respectively. [score:1]
In this study, we found that miR-23a modulated the IRF1 -mediated pathway to facilitate HSV-1 replication in HeLa cells, revealing that miRNAs play an important role in virus-host interaction during viral infection. [score:1]
Another group was transfected with Anti-miR-23a and its control vector in the same way. [score:1]
These data indicate that miR-23a facilitates HSV-1 replication in host cells. [score:1]
miR-23a also increased the number of cells infected, as shown by the level of fluorescence, while blocking miR-23a had the opposite effect (Fig. 1F). [score:1]
Here, we examined the role of a host-encoded miR-23a in the promotion of viral replication. [score:1]
We hypothesized that miR-23a may modulate viral-host interaction through IRF1. [score:1]
Viral yields were determined by standard plaque assays at 48 h post-infection with HSV-1. (E) Mo del of miR-23a regulation in HSV-1 replication. [score:1]
Increased levels of miR-23a in HeLa cells led to decrease levels of IRF1 mRNA and RSAD2 mRNA, with a consequent increase in HSV-1 replication. [score:1]
Like miR-23a, IRF1 also possesses essential functions in modulating cell growth and apoptosis [33], [34]. [score:1]
As shown in Fig. 1B, HeLa cells transfected with Pri-miR-23a or Anti-miR-23a at 0.3 µg per well/48-well plate showed no obvious change in viability. [score:1]
The initial functional result was confirmed that miR-23a facilitated HSV-1 replication. [score:1]
Endogenous miR-23a and IRF1 levels are affected by HSV-1 infection. [score:1]
To further verify the role of miR-23a in virus replication, we quantified the concentration of infectious viruses in the supernatant. [score:1]
The specificity of the anti-miR-23a has been validated in our previous study [21], [26]. [score:1]
In conclusion, we found that the influence of miR-23a on virus replication is mediated by IRF-1 and proposed the mo del depicted in Fig. 6E. [score:1]
Western-blot assay showed that IRF1 expression was significantly increased in HeLa cells co -transfected with IRF1 and miR-23a compared to those transfected with miR-23a and pcDNA3 (Fig. 4 A). [score:1]
miR-23a facilitates HSV-1 replication in HeLa cells. [score:1]
Time course of miR-23a and IRF1 in HeLa cells infected with HSV-1.. [score:1]
However, the mechanism of miR-23a and IRF1 induction during HSV-1 infection remains largely unknown. [score:1]
0114021.g004 Figure 4 (A) HeLa cells were co -transfected with two of pcDNA3, Pri-miR-23a and IRF1. [score:1]
HeLa cells were transfected with pcDNA3, Pri-miR-23a, pRNAT-U6.2 or Anti-miR-23a. [score:1]
Transfection with IRF1 cDNA lacking a 3′UTR counteracts the effects of miR-23a on HSV-1 replication. [score:1]
And the viral titer of supernatant further confirms a role for miR-23a in promoting HSV-1 replication (Fig. 1E). [score:1]
HeLa cells were seeded on 48-well plates at 4000 cells per well and transfected with pcDNA3/miR-23a or pcDNA3/IRF1 and controls. [score:1]
Thus, miR-23a may promote infection at the cellular level. [score:1]
0114021.g006 Figure 6(A) HeLa cells were transfected with IRF1 and pcDNA3 or co -transfected with IRF1 and Pri-miR-23a and control vector, as indicated. [score:1]
[1 to 20 of 70 sentences]
9
[+] score: 196
The main findings were fourfold: (1) fifteen differential miRNAs and 372 differential mRNAs were identified, and the reliability of microarray data was validated for randomly selected eight miRNAs and nine genes; (2) 174 miRNA target were identified, and most of their functions and regulating pathways were related to tumor therapeutic resistance; (3) a posttranscriptional regulatory network including 375 miRNA-target gene pairs was constructed, in which the ten genes were coregulated by the six miRNAs; (4) IL-8 was a direct target of miRNA-23a, the expression levels of IL-8 were elevated in the radioresistant NPC tissues and showed inverse correlation with miRNA-23a expression, and genetic upregulation of miRNA-23a and antibody neutralization of secretory IL-8 could reduce NPC cells radioresistance. [score:18]
Taken together, these results demonstrated that miRNA-23a downregulation played an important role in NPC radioresistance through targeting IL-8. In summary, we identified fifteen differentially expressed miRNAs, 372 differentially expressed mRNAs, and 174 miRNA target genes anticorrelated with miRNA expressions in the radioresistant NPC cells, and constructed a posttranscriptional regulatory network including 375 miRNA-target gene pairs. [score:17]
We identified fifteen differential miRNAs and 372 differential mRNAs in the radioresistant NPC cells, constructed a posttranscriptional regulatory network including 375 miRNA-target gene pairs, discovered the ten target genes coregulated by the six miRNAs, and validated that downregulated miRNA-23a was involved in NPC radioresistance through directly targeting IL-8. Our data form a basis for further investigating the mechanisms of NPC radioresistance. [score:11]
miRNA-31 downregulation conferred resistance to radiotherapy and chemotherapy in several types of cancers [37], [38], and downregulation of miRNA-30a [39], miRNA-203 [40], miRNA-183 [41], miRNA-130a [42], miRNA-24 [43] and miRNA-23a [43], and upregulation of miRNA-193b [44] increased tumor cells resistant to chemotherapy. [score:10]
We for the first time showed that IL-8 was a direct target of miRNA-23a, and upregulated miRNA-23a played an important role in NPC radioresistance by targeting IL-8. Our data are helpful for elucidating the molecular mechanism of NPC radioresistance. [score:9]
Our results showed that miRNA-23a, miRNA-203, miRNA-31, miRNA-30a, miRNA-183, miRNA-130a, and miRNA-24 were downregulated, and miRNA-193b upregulated in the radioresistant NPC cells, suggesting that deregulation of these miRNAs might be involved in the NPC radioresistance. [score:8]
Furthermore, the expression level of IL-8 in the radioresistant NPC cells was significantly higher than that in the radiosensitive NPC cells, and transfection of miRNA-23a into the radioresistant NPC cells resulted in significant inhibition of IL-8 protein expression. [score:7]
These results demonstrated that miRNA-23a downregulation and IL-8 upregulation were involved in NPC cells radioresistance. [score:7]
In addition, Western blot showed that the expression level of IL-8 in the CNE2-IR was significantly higher than that in the CNE2 cells, and transfection of miRNA-23a into CNE2-IR cells resulted in significant inhibition of IL-8 protein expression as compared with the cells transfected by the mimic control (Figure. [score:6]
In the miRNA-target gene regulatory network, IL-8 was cotargeted by the three miRNAs (miRNA-23a, miRNA-203 and miRNA-660). [score:6]
These results indicated that IL-8 might be a target of miRNA-23a in the NPC tissues, and downregulaion of miRNA-203 and upregulation of IL-8 might be involved in the clinical NPC radioresistance. [score:6]
These results indicated that IL-8 might also be a target of miRNA-23a in the NPC tissues, and downregulaion of miRNA-203 and upregulation of IL-8 might be involved in the clinical NPC radioresistance. [score:6]
To understand the effects of miRNA-23a and its target gene IL-8 on NPC radioresistance, we first detected the expression of miRNA-23a and IL-8 in the radioresistant and radiosensitive NPC tissues. [score:5]
Furthermore, the expression levels of IL-8 were inverse correlation with miRNA-23a expression (Pearson's correlation coefficient  = −0.698, P<0.01) (Figure 4C). [score:5]
DLR-blank, a dual luciferase reporter without the 3′UTR of IL-8; DLR-IL8 3′UTR, a dual luciferase reporter with the 3′UTR of IL-8. To understand the roles of miRNA-23a and its target gene IL-8 in NPC radioresistance, we first detected the expression of miRNA-23a and IL-8 in the radioresistant and radiosensitive NPC tissues. [score:5]
Furthermore, the expression levels of IL-8 were inverse correlation with the expression levels of miRNA-23a. [score:5]
These results demonstrated that IL-8 is a direct target of miRNA-23a in the radioresistant NPC cells. [score:4]
To determine the effects of miRNA-23 downregulation on NPC radioresistance, miRNA-23a mimic and mimic control (RiboBio) were transfected into the CNE2-IR cells using riboFect™ CP transfection kit (RiboBio) according to manufacturer's instructions, respectively. [score:4]
To test whether IL-8 is a direct target of miRNA-23a in NPC cells, a dual luciferase reporter with the 3′UTR of IL-8 or without the 3′UTR of IL-8 was cotransfected with miRNA-23a mimic or mimic control into CNE2-IR cells. [score:4]
The results demonstrated that IL-8 is a direct target of miRNA-23a in the NPC cells. [score:4]
The results showed that IL-8 expression was significantly increased, whereas miRNA-23a expression was significantly decreased in the radioresistant NPC tissues as compared with the radiosensitive NPC tissues. [score:4]
In the miRNA-gene regulatory network of radioresistant NPC cells, IL-8 was cotargeted by the three down-miRNAs (miRNA-203, miRNA-23a and miRNA-660) (Figure 2, Table 4), which was validated by qRT-PCR analysis (Figure 1C). [score:4]
We further investigated the roles of downregulated miRNA-23a and its target gene IL-8 in the NPC radioresistance. [score:4]
The Expressions of miRNA-23a and IL-8 in the NPC tissues with different radiosensitivity. [score:3]
Analysis of miRNA-23a and IL-8 Expression in the NPC Tissues with Different Radiosensitivity. [score:3]
The Expressions of miRNA-23a and IL-8 in the NPC Tissues with Different Radiosensitivity and Their Roles in NPC Radioresistance. [score:3]
Validation of IL-8 as a Target of miRNA-23a in NPC cells. [score:3]
To test whether miRNA-23a can specifically target IL-8, a dual-luciferase reporter with the 3′UTR of IL-8 (Catalog#, HmiT009678-MT01; GeneCopoeia, USA) and miRNA-203 mimic or mimic control (RiboBio) were cotransfected into the radioresistant NPC CNE2-IR cells using Lipofectamine 2000 as previously described [35]. [score:3]
The expression levels of miRNA-23a in the same NPC tissue samples were detected by qRT-PCR as above described. [score:3]
Significant inverse correlation of miRNA-23a and IL-8 expression was determined by Pearson's correlation analysis. [score:3]
Validation of IL-8 as a target of miRNA-23a. [score:3]
To validate the effect of dowregulated miRNA-23a on the NPC radioresistance, miRNA-23a mimic was transfected into CNE2-IR cells, and radiosensitivity of the transfected cells was determined. [score:2]
In this network, ten genes (SOCS6, SMAD2, CDKN2B, PPARGC1A, FOS, FOSL2, IL8, IRS2, JAK1, WDR32) were coregulated by six miRNAs (miRNA-23a, miRNA-24, miRNA-30a, miRNA-545, miRNA-203, miRNA-660) (Figure 2, Table 4). [score:2]
qRT-PCR showed that miRNA-23a expression was significantly decreased in the radioresistant NPC as compared with the radiosensitive NPC (Figure 4B). [score:2]
A dual-luciferase reporter system assay showed that miRNA-23a could directly bind with the 3′UTR of IL-8 in the radioresistant NPC cells. [score:1]
Therefore, we selected one of miRNA-target gene pairs, miRNA-23a and IL-8, for further investigation. [score:1]
The sixty formalin-fixed and paraffin-embedded archival NPC tissue specimens, comprising thirty radioresistant and thirty radiosensitive ones, were obtained from Xiangya Hospital of Central South University (Changsha, China) between January 2007 and June 2009, and used for immunohistochemical staining of IL-8 and qRT-PCR analysis of miRNA-23a. [score:1]
Analysis of the Role of miRNA-23a and IL-8 in NPC Radioresistance. [score:1]
We further investigated the roles of miRNA-23a and its target gene IL-8 in the NPC radioresistance. [score:1]
Next, the effect of dowregulated miRNA-23a on the radioresistance of NPC CNE2-IR cells was determined, and both clonogenic survival assay and Hoechst 33258 staining of apoptotic cells showed that transfection of miRNA-23a mimic significantly increased the radiosensitivity of CNE2-IR cells. [score:1]
The roles of miRNA-23a and IL-8 in the radioresistance of NPC cells. [score:1]
[1 to 20 of 41 sentences]
10
[+] score: 192
Since miR-23a was significantly upregulated in A549 cells after the treatment with TGF-β1 and mediated EMT, we proceeded to identify potential targets known to play a role in EMT by using the Target Scan database. [score:8]
Furthermore, overexpression of miR-23a induced EMT by suppressing E-cadherin expression and contributed to the reduced sensitivity to gefitinib in A549 cells. [score:7]
Furthermore, in these A549 cells, inhibition of miR-23a could also partially suppress TGF-β -induced EMT, while overexpression was associated with the tendency for EGFR-TKI resistance. [score:7]
Furthermore, overexpression of miR-23a decreased E-cadherin expression and increased levels of vimentin, resulting in the EMT phenomenon in A549 lung cancer cells; silencing of miR-23a partially restored E-cadherin expression. [score:7]
To examine whether the CDH1 was a target of miR-23a, we knocked down miR-23a in A549 cells by using a specific inhibitor. [score:6]
Control or specific miR-23a inhibitor was transfected into A549 cells for 24 h, which were then treated with or without TGF-β1 for a further 48 h. We confirmed that miR-23a was effectively knocked down by miR-23a inhibitor in A549 cells (Fig. 3B). [score:6]
Knockdown of Smad2/3 significantly decreased TGF-β1 -induced miR-23a expression in A549 cells in which miR-23a was overexpressed (Fig. 2E). [score:6]
These findings demonstrated that miR-23a inhibition partially suppressed TGF-β -induced EMT phenomenon in A549 cells. [score:5]
Interestingly, E-cadherin was still expressed in A549 cells transfected with miR-23a inhibitor after TGF-β1 exposure (Fig. 3C). [score:5]
These findings demonstrated that suppression of EMT by miR-23a inhibition might overcome the resistance to EGFR-TKIs observed in NSCLC. [score:5]
Next, we examined whether the Smad signal pathway directly regulated miR-23a expression. [score:5]
Thus, 5 cell lines (A549, LC-2/ad, ABC1, PC1 and SQ5) showed high expression of miR-23a and Smad2/3 (Fig. 2A), while low expression of miR-23a and Smad2/3 was found in the other 5 cell lines (PC9, PC14, LC-KJ, LC-MS and LK2) (Fig. 2A). [score:5]
In addition, overexpression of mature miR-23a reduced E-cadherin expression and stimulate the EMT phenomenon which is involved in tumorigenesis. [score:5]
In addition, c-myc suppression of miR-23a enhances mitochondrial glutamine metabolism and glutaminase expression (36). [score:5]
High expression of miR-23a was observed in those NSCLC cells which also overexpressed Smad2/3. [score:5]
Furthermore, miR-23a/24/27a functioned as a growth-promoting and anti-apoptotic factor in HCC cells (26), while miR-23a was also shown to promote the growth of gastric adenocarcinoma cells and downregulate interleukin-6 receptor (35). [score:4]
In this study, we found that expression of miR-23a was directly induced by the TGF-β1/Smad pathway in A549 lung adenocarcinoma cells with the EMT phenomenon. [score:4]
We suggest that TGF-β1 mainly regulates the expression of miR-23a in lung cancer cells. [score:4]
This cluster functions as an oncogenic miRNA in several human cancers, and previous studies have reported that miR-23a/24/27a was upregulated in human cancers (26, 35). [score:4]
This is the first report showing that miR-23a regulated TGF-β1 -induced EMT via E-cadherin suppression in lung cancer cells. [score:4]
In conclusion, our study has provided evidence that miR-23a regulated TGF-β -induced EMT by suppression of E-cadherin and contributed to EGFR-TKI resistance in lung cancer cells. [score:4]
We have demonstrated that, in lung cancer cells, miR-23a is regulated by the TGF-β/Smad pathway and plays a critical role in EMT through the targeting of E-cadherin. [score:4]
MiR-23a regulates TGF-β1 -induced EMT by targeting E-cadherin. [score:3]
In contrast, PC14 cells with low expression of miR-23a and Smad2/3 retained their epithelial morphology after TGF-β1 treatment (Fig. 2B). [score:3]
N-cadherin expression was also weak after miR-23a treatment followed by TGF-β1 exposure (Fig. 3C). [score:3]
In this study, A549 cells which over-expressed miR-23a and Smad2/3 was treated with 5 ng/ml of TGF-β1 for 48 h. We observed that, while the parent A549 cells exhibited a classic epithelial morphology (Fig. 2B), after TGF-β1 exposure they had a less uniform epithelial appearance (Fig. 2B). [score:3]
MiR-23a, miR-24 and miR-27a expression in lung cancer cells. [score:3]
These results suggested that miR-23a may affect EMT by targeting E-cadherin in lung cancer cells. [score:3]
MiR-23a expression is directly induced by TGF-β1 in a Smad -dependent manner. [score:3]
We evaluated the correlation between miR-23a, miR-24 and miR-27a expression levels and Smad expression. [score:3]
MiR-23a inhibitor, its negative control, miR-23a precursor (Pre-miR-23a) and its cognate negative control (Pre-miR-ctl) were synthesized by Ambion (Ambion). [score:3]
These results suggested that, in A549 lung cancer cells, miR-23a was directly regulated by TGF-β1/Smad pathway and contributed to the EMT phenomenon. [score:3]
Among the candidate miRNAs for the E-cadherin gene (CDH1), we found that the region of 3′ UTR of the CDH1 gene may serve as a binding site for miR-23a based on the prediction of Target Scan database (Fig. 3A). [score:3]
In contrast, miR-23a expression level in PC14 cells, which had not shown the EMT phenomenon, was unaffected by exposure to TGF-β1 (Fig. 2C). [score:3]
In this present study, we analyzed miR-23a/24/27a expression in non-small cell cancer (NSCLC) cells and evaluated the correlation between its expression and TGF-β/Smad signaling. [score:3]
After the treatment of precursor miR-23a, decreased E-cadherin expression and increased levels of vimentin were observed in A549 cells at 48 h (Fig. 3E). [score:3]
Using western blot analysis, we evaluated the expression of EMT markers after the treatment of miR-23a inhibitor to confirm the occurrence of EMT. [score:3]
Pre-miR-23a and miR-23a inhibitor were transfected using Lipofectamine™ 2000 reagent 24 h after seeding, as per the manufacturer’s instructions (Invitrogen). [score:3]
We also examined whether TGF-β1 stimulated miR-23a expression in these two cells. [score:3]
Under a light microscope, overexpression of miR-23a enhanced the spindle integration, resulting in an additive effect with TGF-β1 -induced EMT in A549 cells (Fig. 3F). [score:3]
On the other hand, in PC14 cells with low miR-23a, miR23a expression was unaffected by treatment with Smad siRNAs (Fig. 2F). [score:3]
MiR-23a might be a potential prognostic marker and a new therapeutic target in NSCLC. [score:2]
The miR-23a, miR-24 and miR-27a expression levels were quantified by quantitative reverse transcription-PCR (qRT-PCR) using TaqMan [®] MicroRNA Assay System (Applied Biosystems, Foster City, CA). [score:2]
MiR-23a expression level was significantly higher in A549 cells, which had shown the EMT phenomenon after the treatment of the respective parent cells with TGF-β1 (Fig. 2C). [score:2]
These findings indicate that induction of EMT affects cellular response to gefitinib and that miR-23a contributes to the resistance as well as TGF-β1. [score:1]
Further studies should be performed to clarify the connection between miR-23a and TGF-β/Smad signaling during the EMT process in NSCLC. [score:1]
A549 cells (5,000 cells/well) were seeded into 96-well plates for 24 h. After being treated with Pre-miR-ctl or Pre-miR-23a, at a final concentration of 40 nM for 24 h, the cells were incubated in the various concentrations of gefitinib for 72 h at 37°C. [score:1]
Mature miR-23a was remarkably induced by the miR-23a precursor in A549 cells between 24 to 72 h (Fig. 3D). [score:1]
Interestingly, the resistance to gefitinib was also found in A549 cells after treatment with Pre-miR-23a only (Fig. 4A). [score:1]
We transiently transfected A549 cells with the miR-23a precursor (Pre-miR-23a), and the control precursor miR (Pre miR-ctl). [score:1]
We first investigated miR-23a, miR-24 and miR-27a expression levels in NSCLC cell lines, including 6 AC cell lines and 4 SCC cell lines. [score:1]
A recent study reported that a specific cluster of miRNA, miR-23a/24/27a, was induced by TGF-β in a Smad -dependent manner in hepatocellular carcinoma (HCC) cells (26). [score:1]
Taken together, miR-23a/24/27a can be induced by TGF-β and act as an oncogenic or tumor repressive miRNA in multiple human malignancies. [score:1]
The IC [50] values of gefitinib with TGF-β1 and gefitinib after treatment with Pre-miR-23a were 32 and 24, respectively, whereas that of gefitinib monotherapy was 6.8 (Fig. 4B). [score:1]
We found that miR-23a could be induced by TGF-β in a Smad -dependent manner in A549 cells. [score:1]
However, the relation between miR-23a/24/27a and TGF-β/Smad pathway remains unclear in lung cancer cells. [score:1]
A recent study reported that miR-23a/24/27a was induced by TGF-β in a Smad -dependent manner in HCC cells (26). [score:1]
MiR-23a/24/27a is a miRNA cluster located in chromosome 19p13.12 and can be induced by TGF-β (26). [score:1]
[1 to 20 of 58 sentences]
11
[+] score: 166
miR-23a/b directly targets Tmem64miRNAs have been shown to regulate the expression of mRNAs by binding to coding sequences or the 3’-untranslated regions (3′-UTRs) of target genes. [score:11]
The decline in miR-23a/b expression in BMSCs with age results in an attenuation of the suppression of Tmem64 and consequently the increased expression of Tmem64 protein, which inhibits the Wnt/β-catenin signaling pathway. [score:9]
Moreover, a microRNA can regulate the expression of multiple target genes; therefore, the miR-23 target genes that are relevant to osteoblast maturation and BMSC differentiation might be different. [score:8]
These results together show that Tmem64 shows increased expression with age and is the major target of miR-23a/b during BMSC differentiation and that miR-23a/b affects Tmem64 expression at the post-transcriptional level. [score:7]
These findings suggest that the upregulation of miR-23a/b in BMSCs could be a potential therapeutic target for osteoporosis. [score:6]
To clarify whether miR-23a/b could directly target the Tmem64 gene, a luciferase reporter construct including the putative binding site of the Tmem64 3′-UTR (WT-pGL3- Tmem64) was generated, and three mutant nucleotides were introduced into the predicted target sequences (MUT-pGL3- Tmem64) and used as a control. [score:6]
2011) to predict the possible target genes of miR-23a/b, considering the predicted intersections of miRanda, PicTar, and TargetScan and using medium stringency. [score:5]
Alizarin Red staining indicated that the overexpression of miR-23a/b facilitated the osteogenic differentiation of BMSCs, whereas the silencing of miR-23a/b inhibited osteogenic differentiation (Figure 3b and c). [score:5]
The overexpression of miR-23a/b promoted the osteogenic differentiation of BMSCs, whereas the inhibition of miR-23a/b intensified adipogenic differentiation from BMSCs in vitro. [score:5]
Furthermore, we determined that miR-23a/b regulated BMSCs differentiation by directly targeting Teme64. [score:5]
The overexpression of miR-23a/b decreased endogenous levels of Tmem64 protein, whereas the inhibition of miR-23a/b elevated Tmem64 protein levels (Figure 4c); however, Tmem64 mRNA levels remained stable (Figure 4d). [score:5]
However, Hassan and colleagues have reported that miR-23a had an inhibitory role in the maturation of primary rat osteoblasts and mouse MC3T3-E1 cells through the targeting of SATB2. [score:5]
In this study, we demonstrated that Tmem64 was directly targeted by miR-23a/b and was responsible for regulating BMSC differentiation. [score:5]
[23] Several studies have shown that the activation of miR-23a by NFATc3 regulates cardiac hypertrophy [24] and that miR-23b inhibits autoimmune inflammation. [score:4]
In the present study, we observed that miR-23a/b is prominently downregulated in BMSCs of aged mice and humans. [score:4]
miR-23a/b is markedly downregulated in BMSCs during the aging process. [score:4]
In this study, we identified two novel miRNAs, miR-23a, and miR-23b, that are downregulated in the BMSCs of aged vs young mice and humans. [score:4]
miR-23a/b directly targets Tmem64. [score:4]
In addition, we confirmed that the level of miR-23a/b expression in human BMSCs also showed significant age-related differences. [score:3]
In the present study, we demonstrated that Tmem64 was the major target of miR-23a/b during mouse BMSC differentiation. [score:3]
Previously, it had been reported that miR-23a/b reinforces the expression of glutaminase in mitochondria and participates in glutamine metabolism. [score:3]
[5] We identified miR-23a/b to be the most significantly downregulated miRNAs in aged vs young mice, and in this study, we chose to study miR-23a/b further and investigated its function in the regulation of BMSC differentiation. [score:3]
[9] Our study revealed that miR-23a/b mediates BMSC differentiation by post-transcriptionally repressing Tmem64 expression. [score:3]
A QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) was used to insert mutations into the miR-23a/b seed region to obtain MUT-pGL3- Tmem64. [score:3]
We next determined the role of miR-23a/b during the osteogenic differentiation of BMSCs by overexpressing or silencing miR-23a/b in BMSCs. [score:3]
31) are potential target genes of miR-23a or miR-23b. [score:3]
miR-23a/b inhibits the adipogenic differentiation of BMSCs. [score:3]
Our results showed that miR-23a/b expression gradually increased in BMSCs from 6- to 8-week-old mice during the process of osteoblastic differentiation (Figure 3a). [score:3]
The overexpression of miR-23a/b attenuated lipid droplet formation in adipogenesis -induced BMSCs (Figure 2c and d). [score:3]
We demonstrate that miR-23a/b strikingly enhanced osteoblast and attenuated adipocyte differentiation from BMSCs by targeting Tmem64. [score:3]
miR-23a/b expression was revealed by to gradually decrease during adipogenic differentiation in the BMSCs of 6- to 8-week-old mice (Figure 2a). [score:3]
We transfected WT-pGL3- Tmem64 or MUT-pGL3- Tmem64 along with agomiR-23a/b or agomiR-NC into BMSCs and assessed the effects of miR-23a/b on luciferase translation by luciferase enzyme activity. [score:3]
[25] However, there had been no studies of the action of miR-23a/b on the regulation of BMSC differentiation. [score:2]
To further investigate the age-related switch in differentiation potential of BMSCs, we observed and identified two important downregulated miRNAs, miR-23a and miR-23b, in the BMSCs of aged mice. [score:2]
miR-23a and miR-23b belong to the same family and have strong similarities in their nucleotide sequences, and importantly, they function as synergistic regulators of BMSC functions. [score:2]
Taken together, these observations suggest that miR-23a/b negatively regulates the adipogenic differentiation of BMSCs. [score:2]
Consistently, the expression of miR-23a/b was notably decreased in elderly samples compared with that in young samples (Figure 1b and c). [score:2]
Sequence analysis showed one miR-23a/b binding site in the 3′-UTR of the Tmem64 gene (position 1069-1076; Figure 4a). [score:1]
This result suggests that miR-23a/b is involved in age-related effects on BMSCs in mouse and human. [score:1]
To overexpress or silence miR-23a/b in BMSCs for functional investigation, we transfected BMSCs with agomiR-23a/b, antagomiR-23a/b or their negative control and subsequently induced adipogenic differentiation (Figure 2b). [score:1]
miR-23a/b promotes the osteogenic differentiation of BMSCs. [score:1]
Consequently, our study suggests that miR-23a/b acts as an age-related ‘switch’ to divert BMSCs from being adipogenic to osteogenic. [score:1]
A segment of the mouse Tmem64 3′-untranslated region (UTR) containing the predicted miR-23a/b binding site was amplified by PCR using the forward primer 5′- CTAGAGGAATTCTGAAATGTGAAATTGTCTCAAGGCCGG - 3′ and the reverse primer 5′- CCTTGAGACAATTTCACATTTCAGAATTCCT-3′. [score:1]
Conversely, silencing miR-23a/b promoted lipid droplet formation (Figure 2c and d) and increased the levels of Pparg and Fabp4 mRNA during the adipogenic differentiation of BMSCs (Figure 2e and f). [score:1]
Our study confirmed that miR-23a/b has promoting effects on the osteogenic differentiation of mouse BMSCs in vitro. [score:1]
This finding confirmed that miR-23a/b can specifically bind to the predicted 3′-UTR of Tmem64. [score:1]
These results suggest that miR-23a/b has a critical role in BMSC differentiation. [score:1]
Altogether, all of these data indicate that miR-23a/b enhances the osteogenic differentiation of BMSCs. [score:1]
Taken together, these findings indicate that miR-23a/b has a crucial effect on the aging process of BMSCs in both mouse and human. [score:1]
[1 to 20 of 49 sentences]
12
[+] score: 159
Other miRNAs from this paper: hsa-mir-23b, hsa-mir-155, hsa-mir-23c
HMGN2 is the potential target of miR-155 and miR-23a to participate in the regulation of K. pneumoniae adhesionWe then applied an online algorithmfor miRNA target prediction (TargetScan) to identify the putative binding sequences for miR-155 or miR-23a in 3′ UTR of HMGN2 mRNA (Fig. 2A). [score:8]
Pharmacological inhibition of integrin/Rac1 pathway and actin polymerization partially block K. pneumoniae adhesion induced by miR-155 and miR-23aTo further confirm the involvement of integrin function in miR-155 or miR-23a -mediated K. pneumoniae adhesion regulation, we applied integrin inhibitor-RGD tri-peptide, and Rac1 GTPase specific inhibitor-NSC23766 to block integrin and Rac1 signaling during K. pneumoniae infection. [score:8]
To further confirm the involvement of integrin function in miR-155 or miR-23a -mediated K. pneumoniae adhesion regulation, we applied integrin inhibitor-RGD tri-peptide, and Rac1 GTPase specific inhibitor-NSC23766 to block integrin and Rac1 signaling during K. pneumoniae infection. [score:6]
MiR-155 and miR-23a expression were down-regulated in K. pneumoniae infected A549 cells and promoted K. pneumoniae adhesion. [score:6]
Furthermore, other transcription suppressors that directly target the promoters of bic or a miR-23∼24∼27 cluster could also participate in the transcriptional repression of these precursor genes since the pri-miR-155 level was detected to correlate with miR-155 reduction (Fig. S1B,C). [score:6]
To our surprise, the expression of miR-155 (Fig. 1A,B and S1A) and miR-23a (Fig. 1C,D) were both significantly down-regulated upon bacterial infection where the dosage (the multiplicity of infection (MOI) of K. pneumoniae was from 50 to 100) and time (the infection time was from 2 to 6 hours) dependences were not observed. [score:6]
Our study demonstrated a potential mechanism utilized by pulmonary epithelial cells during K. pneumoniae infection: host cells actively down-regulate the cellular levels of miR-155 and miR-23a which target non-histone nuclear factors HMGN2 and/or NFI. [score:6]
As mentioned above, p65 represses miR-23a expression, rendering the possibility that K. pneumoniae infection results in the down-regulation of these two miRNAs via NF-κB pathway. [score:6]
Similarly, miR-23a is commonly down-regulated in lymphoid tumor cells 57, and this modulation was found to de-repress glutaminase (GLS) expression for tumor cell proliferation and survival under elevated glutamine consumption condition 51. [score:6]
We therefore hypothesized that HMGN2 level is targeted by miR-155 and/or miR-23a in un-infected epithelial cells, whereas the exposure to K. pneumoniae de-represses its expression. [score:5]
MiR-23a was shown to directly target HMGN2 mRNA 3′ UTR by luciferase assay (Fig. 2E), while miR-155 only influenced the protein level (Fig. 2D) but not the mRNA level of HMGN2 (Fig. S3B,C) indicating the indirect regulation of miR-155 on this protein. [score:5]
In addition, our pharmacological results revealed miR-155 and miR-23a promoted K. pneumoniae adhesion partially through integrin function and actin polymerization by using specific inhibitor targeting integrin, Rac1 and actin polymerization (Fig. 6A–C). [score:5]
We then applied an online algorithmfor miRNA target prediction (TargetScan) to identify the putative binding sequences for miR-155 or miR-23a in 3′ UTR of HMGN2 mRNA (Fig. 2A). [score:5]
In our experiment, HMGN2 was significantly suppressed by mimics of miR-23a (Fig. 2C) and miR-155 (Fig. 2D upper panel) during K. pneumoniae infection, while the miR-155 inhibitor displayed the opposite effect in both cell lines. [score:5]
In the present study, we used mimic and/or inhibitor of miRNAs to demonstrate that miR-155 and miR-23a might stimulate K. pneumoniae adhesion in pulmonary epithelial cells (Figs 1E–G and S2A,B) by targeting two negative transcriptional modulators of integrins-HMGN2 (Fig. 2C,D) and NFI (Fig. 5C). [score:5]
HMGN2 was the potential target of miR-155 and miR-23a to involve in regulating K. pneumoniae adhesion. [score:4]
Consistent with previous result 34, we observed the marked reduction of the luciferase activity in the wild type reporter but not the mutant by transfecting miR-23a mimic (Fig. 2E), reinforcing the direct targeting of HMGN2 mRNA by miR-23a. [score:4]
To further inspect the targeting of HMGN2 by miRNAs, we performed luciferase reporter assay where the luciferase reporter was cloned with the 3′ UTR of HMGN2 transcript containing miR-23a and miR-155 specific targeting sequences. [score:4]
HMGN2 is the potential target of miR-155 and miR-23a to participate in the regulation of K. pneumoniae adhesion. [score:4]
Of particular interest, our previous study has demonstrated that HMGN2 served as an anti-bacterial peptide 33 and the knockdown of HMGN2 correlated with enhanced bacterial internalization (Wang, in press), which resembled the effects of forced expression of miR-155 or miR-23a. [score:4]
MiR-155 and miR-23a are down-regulated in K. pneumoniae infected pulmonary epithelial cells and promote K. pneumoniae adhesion. [score:4]
The expression levels of miR-155 (A, B) and miR-23a (C, D) were examined by RT-qPCR. [score:3]
Double-strand miRNA mimic oligoribonucleotides for miR-155, miR-23a and their negative controls, single-strand miRNA inhibitor oligoribonucleotides for miR-155 and its negative control were synthesized in Ribobio Inc. [score:3]
MiR-155 and miR-23a are down-regulated in K. pneumoniae infected pulmonary epithelial cells and promote K. pneumoniae adhesionTo investigate roles of miR-155 and miR-23a in pulmonary epithelial cells during bacterial infection, we conducted a quantitative RT-qPCR assay to analyze the expression of these two miRNAs in human alveolar type II epithelial cell line A549 and/or bronchial epithelial cell line HBE16 that were exposed to K. pneumoniae. [score:3]
Therefore, we proposed that during K. pneumoniae infection, pulmonary epithelial cells autonomously shut down the expression of miR-155 and/or miR-23a as well as downstream integrin pathway to potentially delay the bacterial invasion. [score:3]
Given that miR-155 and miR-23a facilitated K. pneumoniae adhesion (Fig. 1E,F), we postulated it was possible that host cells might utilize unknown strategies to restrict their cellular expression in order to neutralize integrin engagement and impede acute internalization of pathogens. [score:3]
Our data showed that miR-155 and miR-23a expression were dramatically decreased in A549 and HBE16 cells after K. pneumoniae infection (Figs 1A–D and S1A), which seemed to be controversial to the previous reports. [score:3]
For experimental validation of the HMGN2 3′ UTR as a target of miR-155 or miR-23a, co-transfections of reporter constructs and miR-155 (or miR-23a) mimic were carried out in A549 cell. [score:3]
A549 cells were transfected with miR-155 mimic (E), miR-23a mimic (F), miR-155 inhibitor (G) and according negative controls (miR-NC or NC) for 24 hours prior to 100 MOI of bacterial exposure. [score:3]
Pharmacological inhibition of integrin/Rac1 pathway and actin polymerization partially block K. pneumoniae adhesion induced by miR-155 and miR-23a. [score:3]
Pharmacological inhibition of Integrin/Rac1 and acting polymerization partially blocked miR-155 and miR-23a induced K. pneumoniae adhesion. [score:3]
Cells were transfected with mimic or inhibitor oligoribonucleotides of miR-155 or miR-23a respectively prior to different time lengths of K. pneumoniae exposure. [score:3]
Taken together, we concluded that integrin/Rac1 pathway as well as actin polymerization were involved in miR-155 and miR-23a -mediated K. pneumoniae adhesion regulation (Fig. 6D; See discussion). [score:2]
In our study, we discovered HMGN2 were under regulation of miR-155 and miR-23a, although the underlying mechanisms seemed to vary. [score:2]
Previous study suggested HMGN2 was regulated by miR-23a 34. [score:2]
Assembly PCR was performed to mutate the 8 nucleotides of miR-23a seed region as indicated in Fig. 2A. [score:1]
The pre-treatment of A549 cells with RGD or NSC23766 significantly abolished K. pneumoniae adhesion that was promoted by miR-155 or miR-23a respectively (Fig. 6A), suggesting the involvement of miRNAs in this process. [score:1]
We also noticed that miR-155 relied on integrin/Rac1 pathway more than miR-23a did since the administration of RGD and NSC23766 caused more reduction of K. pneumoniae adhesion in miR-155 mimic transfected cells than that in miR-23a. [score:1]
Our result showed that the transfection of HMGN2 vectors significantly increased its protein levels (Fig. S3E) and in turn counteracted the bacterial adhesion that was induced by miR-155 or miR-23a mimic (Fig. 2F), suggesting HMGN2 participates in miR-155 and miR-23a -mediated K. pneumoniae infection. [score:1]
The adhesion efficiency evaluated by colony counting showed that transfection of miR-155 or miR-23a mimic effectively increased the bacterial adhesion at all time points we checked (Figs 1E,F and S2A), whereas the miR-155 inhibitor reversed the results to its mimic (Figs 1G and S2B). [score:1]
Collectively, our results showed an unexpected moderation of miR-155 and miR-23a during K. pneumoniae infection of epithelial cells that potentially harnessed bacterial adhesion (see discussion). [score:1]
The mutant seed sequence of the HMGN2 3′ UTR matching miR-23a is also presented by dots. [score:1]
Meanwhile, miR-23a was found to be repressed by NF-κB member p65 and PML-RARA fusion protein in human leukemic Jurkat cells 51 and myeloid tumor cells 52. [score:1]
[1 to 20 of 43 sentences]
13
[+] score: 159
To determine the extent to which concomitant down-regulation of miR-212/132 and miR-23a/b and up-regulation of sirt1 observed in aMCI frontal cortex represented a functionally significant relationship, we treated human hNT neuronotypic cells with specific inhibitors of these miRNAs and measured sirt1 protein expression. [score:9]
Interestingly, inhibition of miR-212, miR-132, miR-23a, or miR-23b individually had no effect on sirt1 expression, but we found that concurrent inhibition of miR-212 and miR-23a resulted in a significant ~100% increase in sirt1 (Figure 4), whereas co -inhibition of miR-132 and miR-23a resulted in a ~40% increase in sirt1 (p < 0.05, data not shown). [score:9]
miR-23a and miR-212 down-regulation protects against Aβ [1−42] induced cell death via sirt1To test whether miR-212 and miR-23a regulation of sirt1 results in neuronal protection, hNT cells were treated with inhibitors of either miRNA independently, or with inhibitors of both miRNAs combined, followed by challenge with Aβ [1−42], which has been shown to induce cell death in these neuronal cells (Counts and Mufson, 2010). [score:9]
Experimental down-regulation of miR-212 and miR-23a in cultured neurons up-regulated sirt1 and provided neuroprotection against Aβ toxicity. [score:7]
Here, we show that mir-132/212 and miR-23a/b are selectively down-regulated in the frontal cortex in subjects clinically diagnosed with aMCI and that these alterations appear to be functionally linked to an up-regulation of sirt-1 and sirt-1 mediated protective responses. [score:7]
hNT cultures were transfected with small miRNA inhibitors (miRCURY LNA inhibitors, Exiqon) specific for miR-212, miR-132, miR-23a, miR-23b, or an inhibitor negative control sequence (Exiqon) (n = 8/treatment group in three independent experiments). [score:7]
Since miRNAs negatively regulate transcript stability, down-regulation of the miR-212/132 and miR-23a/b clusters in frontal cortex would be predicted to promote the stability of their target mRNAs in aMCI. [score:7]
Sirt1 mRNA levels were higher in frontal cortex of aMCI subjects but stable in inferior temporal cortex, suggesting a link between miR-212/132 and miR-23a/b down-regulation and reduced transcriptional repression of sirt1 target mRNA. [score:6]
To test whether miR-212 and miR-23a regulation of sirt1 results in neuronal protection, hNT cells were treated with inhibitors of either miRNA independently, or with inhibitors of both miRNAs combined, followed by challenge with Aβ [1−42], which has been shown to induce cell death in these neuronal cells (Counts and Mufson, 2010). [score:6]
Sirt1 protein immunoreactivity was found primarily in the nucleus but also within the cytoplasm of the same neurons, providing evidence that miR-23a has direct access to its sirt1 target and that miR-directed sirt1 regulation in cortex is neuronal in origin. [score:6]
miR-212 and miR-23a down-regulation increases sirt1 protein expression in human neuronal cells. [score:6]
Figure 4 Experimental down-regulation of miR-212 and miR-23a increases sirt1 protein expression. [score:6]
Moreover, the differential roles for this cluster may depend on target binding partners, since miR-212/132 and miR-23a co -inhibition was required for sirt1 activation and neuroprotection. [score:5]
Hence, there are several mechanisms by which miR-212/132 and miR-23a co-regulation of sirt1 expression may promote neuroprotection in the frontal cortex in aMCI. [score:4]
Box plots show that (A) miR-212 and (B) miR-23a were significantly down-regulated by ~50% in aMCI and by ~60% in AD. [score:4]
miR-23a and miR-212 down-regulation protects against Aβ [1−42] induced cell death via sirt1. [score:4]
Figure 5Experimental down-regulation of miR-212 and miR-23a protects against Aβ [1−42] in a sirt1 -dependent manner. [score:4]
Several miRNAs were also significantly down-regulated in AD frontal cortex, including miR-886-3p, miR-132, miR-21, miR-23a, miR-140-3p, miR-212, miR-23b, let-7d, and miR-181a (Table 3). [score:4]
Downregulation of miR-23a and miR-27a following experimental traumatic brain injury induces neuronal cell death through activation of proapoptotic Bcl-2 proteins. [score:4]
In a recent report detailing mechanisms for neuronal cell death in a mo del of traumatic brain injury, in vitro studies revealed that miR-23a inhibition increased etoposide -induced cell death after 24 h in cortical neurons via caspase activation (Sabirzhanov et al., 2014). [score:3]
We report that two families of miRNAs, miR-212/132 and miR-23a/b, were down-regulated in frontal cortex in aMCI and AD compared to NCI, yet remained stable in inferior temporal cortex. [score:3]
Again, these discordances are not incompatible, but suggest that miR-23a has both pro-apoptotic and neuroprotective properties that depend on specific miRNA binding partners and whether these miRNAs are targeting pro-apoptotic factors such as caspases or, as presently shown, factors such as sirt1 that promote neuronal viability. [score:3]
Given the co-localization of miR-23a and sirt1 in the nucleus, cells were harvested 36 h following transfection with the miRNA inhibitors or controls and nuclear fractions were immunoblotted for detection of sirt1. [score:3]
In summary, our data suggest that the transition from normal cognitive function in aging to a clinical diagnosis of aMCI may involve the suppression of brain microRNA networks such as miR212/132 and miR-23a. [score:3]
Figure 1 Differential expression of miR-212, miR-23a, and sirt1 transcripts in the frontal cortex of aMCI subjects. [score:3]
However, co -inhibition of either miR-212 or miR-132 with miR-23a conferred neuroprotection against Aβ [1−42] in a sirt1 -dependent manner. [score:3]
Dual in situ hybridization/immunohistochemistry of miR-23a RNA and sirt1 protein expression was performed in frontal cortex of an 87 year-old female subject who died with a clinical diagnosis of aMCI. [score:3]
By contrast, qPCR analysis of temporal cortex revealed that miR-212 and miR-132 expression levels were decreased only in the AD group, whereas miR-23a and miR-23b were unchanged across the clinical diagnostic groups (Table 4). [score:3]
Hence, we validated these concepts by showing that miR212/132 and miR-23a -mediated neuroprotection against Aβ is prevented by a sirt1-specific inhibitor. [score:3]
By contrast, we found that miR-23a inhibition alone had no effect on Aβ -induced cell death after 48 h, yet was neuroprotective in the presence of miR-212 by activating sirt1. [score:3]
miR-23a/b has also been shown to be dysregulated in the AD brain (Cogswell et al., 2008; Lau et al., 2013), yet much less is known about this miRNA cluster in neuronal function. [score:2]
Dual miR-23a in situ hybridization and sirt1 immunohistochemistry revealed nuclear miR-23a labeling in frontal cortex layer III neurons in tissue obtained from an 87 year-old female subject who died with a clinical diagnosis of aMCI (Figure 3). [score:1]
Figure 3 miR-23a and sirt1 co-localize in the nucleus of frontal cortex layer III neurons. [score:1]
Dual in situ hybridization/immunohistochemical localization of miR-23a and sirt1. [score:1]
Dual in situ hybridization/immunohistochemical localization of miR-23a and sirt1 In situ hybridization to detect miR-23a was performed on 10 μm, cryostat-sectioned samples of frozen frontal cortex using a digoxin (DIG)-labeled hsa-miR-23a probe (Exiqon), adapting the protocol of Doné and Beltcheva (2014). [score:1]
The next day, sections were treated with 20 μg/mL proteinase K for 10 min at 37°C followed by hybridization with 400 nmol hsa-miR-23a probe for 1 h at 55°C. [score:1]
Localization of miR-23a and sirt1 in the frontal cortex. [score:1]
However, like miR-212/132, miR-23a levels have been inversely linked to apoptosis. [score:1]
Note that miR-23a appears localized to the nucleus, whereas sirt1 labeling is nuclear but also with immunoreactivity in the cytoplasm. [score:1]
In situ hybridization to detect miR-23a was performed on 10 μm, cryostat-sectioned samples of frozen frontal cortex using a digoxin (DIG)-labeled hsa-miR-23a probe (Exiqon), adapting the protocol of Doné and Beltcheva (2014). [score:1]
Following miR-23a visualization, the sections were incubated overnight at 4°C with a rabbit anti-sirt1 monoclonal antibody (1:100, Origene) in Tris-buffered saline (TBS, pH 7.4)/0.25% Triton X-100/1% normal goat serum. [score:1]
[1 to 20 of 41 sentences]
14
[+] score: 149
Since PDG-treatment upregulated trophoblast expression of miR-23a and let-7c, miRs that putatively target IL-6 mRNA, we hypothesized that miR-let-7c or miR23a through this mechanism, might also be regulating PDG -mediated inhibition of IL-6 expression. [score:13]
In addition, miR-23a and let-7c regulate TLR2 -mediated inhibition of IL-6 expression by directly targeting IL-6 mRNA. [score:9]
PDG treatment significantly upregulated trophoblast miR-329, miR-23a, miR-let-7c, and miR-23b expression in TLR6 [-], and this was significantly inhibited by the presence of TLR6 (TLR6 [+]). [score:8]
0077249.g006 Figure 6TLR6 [-] trophoblast cells were transfected with an either: an anti-miR scramble sequence; a specific anti-miR-23a inhibitor; a specific anti-let-7c inhibitor; or both the inhibitors of miR-23a and let-7c. [score:7]
Furthermore, by inhibiting both miR-23a and let-7c simultaneously, PDG -mediated inhibition of IL-6 expression could be prevented. [score:7]
Of these 17 miRs, only 4 were expressed at low -high levels, were upregulated in PDG -treated TLR6 [-] cells, and differentially regulated in the PDG -treated TLR6 [+] cells: miR-23a; miR-23b; miR-149; and let-7c (Table 2). [score:7]
This data suggests that the combined inhibition of miR-23a and let-7c is necessary for restoring PDG -mediated inhibition of IL-6 expression in trophoblast. [score:7]
TLR6 [-] trophoblast cells were transfected with an either: an anti-miR scramble sequence; a specific anti-miR-23a inhibitor; a specific anti-let-7c inhibitor; or both the inhibitors of miR-23a and let-7c. [score:7]
In addition to miR-329, we have identified 2 miRs, miR-23a and let-7c, that appear to regulate trophoblast IL-6 expression by directly targeting its mRNA. [score:7]
These studies suggest the important role of miR-23a and miR-let-7c in the regulation of various cellular functions; however, we believe that our studies are first to indicate that TLR2 activation by PDG induces miR-23a and miR-let-7c expression which in turn regulates IL-6 mRNA expression. [score:7]
In contrast, PDG treatment of the cells transfected with either the anti-Let-7c inhibitor alone, the anti-miR-23a inhibitor alone, or a combination of both the anti-let-7c and anti-miR-23a inhibitors, had no significant effect on IL-6 mRNA levels. [score:7]
Following treatment with PDG, miR-23a and miR-let-7c expression were both upregulated in TLR6 [-] cells and this was completely prevented by the presence of TLR6. [score:6]
miR-23a and miR-let-7c regulate PDG -mediated inhibition of IL-6 expression. [score:6]
Combined inhibition of miR-23a and let-7c regulates trophoblast IL-6 expression. [score:6]
In addition, we have identified, miR-23a and let7c, as playing a role in regulating PDG -mediated inhibition of trophoblast IL-6 mRNA expression. [score:6]
To test this, TLR6 [-] cells were transfected with a specific anti-miR-23a inhibitor, an anti-let-7c inhibitor, or a combination of both, followed by treatment with or without PDG. [score:5]
Moreover, the combination of the miR-23a and let-7c inhibitors significantly reversed the PDG -inhibition of IL-6 mRNA when compared to PDG -treated scramble control cells (Figure 6). [score:4]
Again, using a global microRNA microarray, bioinformatics databases, and quantitative RT-PCR, we identified miR-23a and let-7c as potential regulators of IL-6 that were differentially expressed in PDG -treated TLR6 [-] and TLR6 [+] trophoblast cells. [score:4]
The anti-Let-7c and anti-miR-23a inhibitors reduced Let-7c and miR-23a expression, respectively, when compared to the scramble control sequence (data not shown). [score:4]
While IL-6 can induce miR-23a in hepatocytes [51], and miR-23a targets IL-6R in gastric adenocarcinoma cells [52], to our knowledge, there is no information regarding the regulation of IL-6 by miR-23a. [score:4]
For transfection studies, TLR6 [-] cells were transfected with 100nM of either an anti-miR scramble sequence control or specific inhibitors of miR-329, miR-23a or Let-7c (Mirvana, Applied Biosystems; Grand Island, NY) using siPORT [TM] NeoFX [TM] (Invitrogen). [score:3]
Treatment of scramble control cells with PDG significantly reduced IL-6 mRNA levels, and these responses were significantly reversed by the presence of both the anti-miR-23a and anti-let-7c inhibitor. [score:3]
Thus, these findings only validated the microarray data showing that the presence of TLR6 significantly reversed PDG -induced miR-23a and let-7c expression in the trophoblast (Table 2 & Figure 4B & C). [score:3]
PDG treatment of TLR6 [-] cells significantly increased the expression of miR-23a by 1.21 ± 0.16 fold and this was significantly reversed by the presence of TLR6 (Figure 4B). [score:3]
Thus, miR-329, miR-23a and let-7c provide a novel molecular mechanism that regulates trophoblast TLR2/TLR6 function in response to gram -positive bacterial components. [score:2]
Identification of miR-23a and let-7c as a potential regulator of trophoblast IL-6 mRNA. [score:2]
0077249.g004 Figure 4TLR6 [-] or TLR6 [+] trophoblast cells were treated with no treatment (NT) or PDG (80μg/ml) for 12h, after which RNA was collected and the expression of: (A) miR-329; (B) miR-23a; (C) miR-let-7c; (D) miR-149; and (E) miR-23b was measured by qRT-PCR. [score:1]
TLR6 [-] or TLR6 [+] trophoblast cells were treated with no treatment (NT) or PDG (80μg/ml) for 12h, after which RNA was collected and the expression of: (A) miR-329; (B) miR-23a; (C) miR-let-7c; (D) miR-149; and (E) miR-23b was measured by qRT-PCR. [score:1]
[1 to 20 of 28 sentences]
15
[+] score: 132
Therefore, the observation that expression of these 2 miRNAs behaves differently in response to the same pathological stimuli and that expression of miRNA-23a did not seem to vary between mice, in contrast to miRNA-206, prompted us to suggest that regulation of miRNA-23a expression might be part of a more general process of regulation than the expression of miRNA-206. [score:11]
We found an opposite expression pattern between the loss of miRNA-23a and the upregulation of APAF-1 in atrophied mouse tissue that correlated well with detection of the active form of caspase 9. In contrast, in the non-denervated tissues the expression of APAF-1 and cleaved form of Caspase 9 proteins were almost undetectable. [score:8]
To gain insight into the underlying biological consequence of miRNA-23a deregulation in response to muscular atrophy at late time points of atrophy development, we looked at the expression of APAF-1, as well as the main downstream target of the miRNA-23a/APAF-1 axis of regulation, Caspase 9. At autopsy, we collected the atrophied tibialis anterior muscle tissues of the RILES/23aT and RILES groups of mice and performed a western-blot analysis with specific APAF-1 and Caspase-9 antibodies (Fig 8A). [score:8]
Therefore, we propose that in addition to the role of miRNA-23a in the early stage of atrophy, the downregulation of miRNA-23a in the late development phase of this disease might also play a significant role by modulating the miRNA-23a/APAF-1/Caspase 9 axis of regulation. [score:8]
We established, in real time, the kinetic of miRNA-23a expression during development of this disease and examined the potential implication of the miRNA 23a/APAF-1/Caspase 9 axis of regulation in the apoptosis of skeletal muscle undergoing muscular atrophy. [score:7]
These results suggest that the down-regulation of miRNA-23a in the late phase of muscular atrophy might be a detrimental event that could contribute to muscular atrophy development by promoting apoptosis through activation of Caspase 9. Notably, our assumptions are in agreement with a previous study [28] that demonstrated that ectopic expression of miRNA-23a reinforces the protection of skeletal muscle tissues from atrophy both in vitro and in vivo and that miRNA-23a transgenic mice show better resistance to skeletal atrophy induced by administration of dexamethasone. [score:7]
Second, because in other cellular contexts, miRNA-23a is reported to be an anti-apoptotic miRNA, overexpressed in several stress conditions that mediate its protecting function through the downregulation of APAF-1, a major constituent of the apoptosome machinery in cells [30– 33]. [score:6]
In contrast, the expression of miRNA-23a was significantly down-regulated (P = 0.016) in the atrophied skeletal muscle tissues. [score:6]
Mechanistically, miRNA-23a acts as a negative regulator of MAFbx/atrogen-1 and MuRF1 expression, two well-known ubiquitin ligases of the proteasome pathway responsible for the rapid proteolysis of skeletal muscle protein in the early stage of atrophy development [28]. [score:5]
The down-regulation of miRNA-23a in the tibialis anterior muscles of the mice in response to denervation was intriguing. [score:4]
Non-invasive bioluminescence monitoring of miRNA-23a expression during development of skeletal muscle atrophy. [score:4]
Real time monitoring of miRNA-23a expression during muscular atrophy development. [score:4]
To make apparent the kinetic of miRNA-23a expression, the quantitative bioluminescence values collected in each mouse from the pRILES and pRILES/23aT groups of animals were plotted as a function of time (right panels, Fig 7B and 7C). [score:3]
We also established the dynamic expression pattern of miRNA-23a in response to muscular atrophy induced by sciatic nerve transection of one leg of the mice. [score:3]
A) Schematic representation of the procedure used to establish the kinetic of miRNA-23a expression in response to muscular atrophy. [score:3]
Nevertheless, further investigations are required to fully validate the potential value of miRNA-23a as a therapeutic target to treat this chronic disease. [score:3]
At late time points, the expression of miRNA-23a was almost undetectable. [score:3]
Based on these data, we focused our experiment on miRNA-23a, -486 and -206 and managed to visualize their expression by SPECT/CT imaging. [score:3]
We established the kinetic of miRNA-23a expression in response to muscular atrophy. [score:3]
The kinetics of miRNA-23a were almost similar for all mice, with a common shape, comparable to an inverted sigmoid curve, characterized by elevated expressions at early time points and a slow and progressive decrease of expression over time. [score:3]
A possible functional link of correlation between the expression of miRNA-23a and apoptosis of the denervated skeletal muscle tissues has not yet been reported. [score:3]
0177492.g007 Fig 7 A) Schematic representation of the procedure used to establish the kinetic of miRNA-23a expression in response to muscular atrophy. [score:3]
The statistical analysis of the bioluminescence data indicated that the relative miRNA-23a expression values detected in the RILES/23aT group of mice (0.83 ± 0.18 x 10 [7]) was almost 3 fold superior to the basal value detected in the RILES control group of mice (0.28 ± 0.05 x 10 [7]). [score:3]
This again correlated well with the opposite expression pattern between APAF-1 and miRNA-23a. [score:3]
The information collected by bioluminescence imaging guided us to elucidate, at least partially, the biological significance of miRNA-23a deregulation in the apoptotic program of denervated tibialis skeletal muscle tissues. [score:2]
However additional studies are required to confirm this hypothesis and to define more precisely the exact mode of regulation exerted by miRNA-23a in this process. [score:2]
We thus attempted to investigate this point and decided to establish the exact kinetic of miRNA-23a expression during the development of atrophy. [score:2]
We thus hypothesized that miRNA-23a might contribute to the apoptosis of atrophied muscle tissues through regulation of APAF-1. Our Western-Blot analysis performed at day 20 after denervation supports this statement. [score:2]
of this longitudinal analysis indicated that expression of miRNA-23a was high during the first phase of atrophy development (day 0 to day 5) for all the 5 mice investigated and started to decrease gradually from day 5 to day 15, becoming almost undetectable at day 20, the end point of our experiment. [score:2]
The involvement of miR-23a/APAF1 regulation axis in colorectal cancer. [score:2]
The well-known myomirs-133b and -1 were selected in addition to other non-specific muscle miRNAs such as miRNA-23a, -486, -221, previously alleged to be functionally involved in the biology of skeletal muscle cells [27]. [score:1]
In this study, we denoted the RINES plasmids as follows: pRINES/122T when the RINES plasmid contains 4 complementary block sequences to the miRNA-122, and pRINES/23aT when the RINES plasmid contains 4 complementary block sequences to the miRNA-23a. [score:1]
To investigate this hypothesis, we focused on the late time point of atrophy development as the deregulation of miRNA-23a was more pronounced from day 5 to 18. [score:1]
As the kinetic of miRNA-23a expression in response to muscular atrophy has not been previously reported, we decided to investigate this point by molecular imaging. [score:1]
Furthermore, many reports have assigned a key biological role of miRNA-23a in the apoptotic program of many different cell types through modulation of APAF-1, a main compound of the apoptosome, that once bound to cytochrome C can promote the cleavage of the procaspase 9 and the production of the active form of this caspase[30– 33]. [score:1]
Our results suggest that the manipulation of miRNA-23a might have a dual therapeutic interest. [score:1]
[1 to 20 of 36 sentences]
16
[+] score: 116
org and miRDB algorithms, were used and miR-23a was identified as a candidate regulator of CDH1 in the transformation process of primary to metastatic NB; iii) miR-23a was found to be upregulated in metastatic NB tissues compared with primary NB tissues; iv) CDH1 is negatively regulated by miR-23a at the mRNA and protein levels and is a direct target in NB; v) inhibition of miR-23a suppresses the migration and invasiveness of SK-N-SH and GI-LA-N cells; and vi) there exists a miR-23a/CDH1 pathway in the transition of primary to metastatic NB. [score:12]
The oncogene miRNAs (onco-miRs), such as miR-23a, are usually upregulated in tumors and may cause the loss of expression of tumor suppressors and contribute to the tumorigenesis of cancer, including metastasis. [score:8]
Therefore, it was concluded that CDH1 is a direct target of miR-23a in SK-N-SH cells, and that miR-23a regulates the expression of CDH1 at the mRNA and protein levels. [score:7]
Thus, it was concluded that miR-23a is overexpressed in metastatic NB tissues and inhibition of miR-23a suppresses the migration and invasion of NB cells. [score:7]
miR-23a directly targets CDH1 expression in NB cells. [score:6]
To identify the direct regulation of CDH1 by miR-23a in NB cells, qPCR, western blot analysis and EGFP report system were used to demonstrate that CDH1 is a direct target gene of miR-23a (Fig. 4). [score:6]
The tumor suppressor role of CDH1 in NB metastasis may explain the manner in which the upregulation of miR-23a promotes NB cell migration and invasion and contribute to the transformation of primary to metastatic NB (Fig. 5C). [score:6]
To verify that the regulation of CDH1 expression by miR-23a is direct, an EGFP reporter system was used in SK-N-SH cells. [score:5]
miRNA-23a is upregulated in metastatic NB tissues and regulates NB cell migration and invasion. [score:5]
U6 small nuclear B non-coding RNA was used as the internal control to normalize miR-23a expression and GAPDH was used as the internal control to normalize CDH1 expression. [score:5]
This implies that the upregulated miR-23a promotes the invasion of NB cells. [score:4]
Based on these two tables, miR-23a (Fig. 2) was identified as a candidate for directly targeting CDH1 whose mRNA 3′UTR contains a putative binding site. [score:4]
Recently, Cao et al (38) found that miR-23a regulates TGF-β -induced epithelial-mesenchymal transition by targeting E-cadherin (CDH1) in lung cancer cells. [score:4]
As one of the most famous members of the miRNA-cluster, miR-23a has been shown to promote the growth of gastric adenocarcinoma cells by targeting the interleukin-6 receptor (39, 40). [score:3]
miR-23a has also been demonstrated to promote colon carcinoma cell growth, invasion and metastasis through inhibition of the MTSS gene (41, 42). [score:3]
This was found to correlate with the blocking of the expression of miR-23a. [score:3]
The current study revealed that miR-23a is upregulated in metastatic NB tissues when compared with primary NB tissues. [score:3]
However, whether miR-23a may become a new prognostic marker and therapy target for the metastasis of NB must be explored in future studies. [score:3]
miR-23a has been previously reported to play a role as an onco-miR in several types of cancer, and the microarray analysis identified that miR-23a is upregulated in metastatic NB tissues compared with primary NB tissues. [score:3]
As Fig. 3C shows, blocking the expression of miR-23a with miR-23a ASO significantly decreased the number of invaded SK-N-SH and GI-LA-N cells compared with the ASO control group. [score:2]
These results suggest that there exists a miR-23a/CDH1 pathway, which is important in the regulation of NB, particularly in the process of primary to metastatic NB transition (Fig. 5C). [score:2]
miR-23a is a candidate regulator of CDH1 in NB. [score:2]
Next, qPCR assay was used to detect the expression of miR-23a in nine pairs of NB samples (metastatic and matched primary NB tissues). [score:2]
miR-23a was identified as a candidate molecule in the regulation of NB metastasis by the CDH1 pathway (Fig. 2). [score:2]
It was shown that miR-23a expression levels were generally higher in metastatic NB tissues compared with primary NB tissues (Fig. 3A). [score:2]
The alignment of miR-23a with the CDH1 3′UTR insert is illustrated in Fig. 4A. [score:1]
When miR-23a was blocked by miR-23a ASO, the EGFP intensity levels were significantly higher than those in the control group. [score:1]
miR-23a belongs to the miR-23a/24/27a cluster, which is located in chromosome 19p13.12 and may be induced by TGF-β. [score:1]
Consistent with the invasion assay results, blockage of miR-23a significantly inhibited the migration of SK-N-SH and GI-LA-N cells compared with the control group (Fig. 3D). [score:1]
For the, the cells were co -transfected with miR-23a mimics, ASO-miR-23a and pcDNA3/EGFP-CDH1 3′UTR or the mutant 3′UTR, together with the controls. [score:1]
In addition, a mutated 3′UTR was constructed by deleting 4 nt in the seed sequence of miR-23a (asterisk marked in Fig. 4A). [score:1]
However, the EGFP intensity with the mutated 3′UTR was not affected by miR-23a (Fig. 4B). [score:1]
[1 to 20 of 32 sentences]
17
[+] score: 110
This concept is supported by the following findings obtained by using the HeLa cell system: i) concomitant over -expression of miR-23a and miR-125b sharply blocks the expression of the basal levels of Blimp-1α protein isoform; ii) IFN-α stimulates a clear-cut induction of Blimp-1α and this phenomenon is strikingly reversed by co -expression of miR-23a and miR-125b. [score:7]
Moreover, IFN-α DC and pDC were found to share a similar expression pattern of miRNAs associated to a significant expression of Blimp-1. Of interest, following exposure with exogenous IFN-α, pDC further modulated miR-23a and miR-125b and increased Blimp-1 expression. [score:7]
Therefore, IFN-α DC show a distinctive miRNA profile characterized by the down-regulation of miRNAs targeting Blimp-1. Blimp- 1 is modulated by IFN-α during monocyte-derived DC differentiation via miR-23a and miR-125bGiven that the functional significance of the coordinated down-modulation of multiple miRNAs targeting one gene predicts a tight regulation of its activity [31], we focused on the evaluation of Blimp-1 expression in DC during IFN-α -driven differentiation. [score:7]
Here we report that IFN-α controls Blimp-1 expression during human DC differentiation associated with down-regulation of a selected pattern of miRNAs among which miR-23a and miR-125b are the major players. [score:6]
The over -expression of each single miRNA affected Blimp-1 expression at different extent, being miR-125b more active than miR-23a in limiting the expression of the α isoform, as compared to cells transfected with unrelated miRNAs and to the empty-vector transfection control. [score:6]
Remarkably, the uniqueness of IFN-α -induced miRNA signature targeting Blimp-1 was confirmed by the further up-regulation of miR-125b and the absence of miR-23a modulation in IL4-DC treated with TNF-α (Figure S1B). [score:6]
Overall, our data indicate that during the process of DC differentiation from human CD14+ monocytes IFN-α modulates the expression of miR-23a and miR-125b thus controlling Blimp-1 expression in a time -dependent manner. [score:5]
Of interest, all miRNAs predicted to regulate Blimp-1 expression were concordantly down-modulated by IFN-α; on the contrary, during DC differentiation driven by IL-4, miR-100 and miR-125b resulted up-modulated, whereas miR-23a, miR-30c and let-7e were not differentially expressed compared to the untreated control (Figure 1C). [score:5]
Among the panel of identified Blimp-1 targeting miRNAs, miR-23a and miR-125b have been shown to regulate physiologically hematopoietic development. [score:5]
Conversely, this cytokine did not further affect the expression of miR-23a as well as let-7e, whereas barely induced miR-100 expression (Figure 4B). [score:5]
Of interest, among the IFN-α-regulated miRNAs targeting Blimp-1, miR-23a and miR-125b resulted the only ones recently reported to be implicated in B cell development [35, 36]. [score:5]
We found PRDM-1 gene, encoding Blimp-1, predicted to be the target gene of 5 out of 10 miRNAs regulated in IFN-α DC: miR-23a, miR-30c, miR-100, miR-125b and let-7e (Figure 1C). [score:4]
Altogether, our data demonstrate that during DC differentiation IFN-α regulates a panel of defined miRNAs, some of which namely miR-23a and miR-125b drive the expression of the active Blimp-1α isoform. [score:4]
Hence, although the fine effects of Blimp-1 expression in pDC remain to be addressed, here we provide evidence for a potential role of Blimp-1 in determining the functional identity of this DC subset and envisage that this phenomenon maybe under the control of IFN-α mainly via regulation of miR-23a and miR-125b. [score:4]
Figure S1 Blimp-1, miR23a and miR125b expression in TNF-a-activated IL-4 dC. [score:3]
B. Blimp-1 expression in HeLa cells transfected or not with single or combined miR-23a and miR-125b and treated for 24 or 48 hours with the indicated doses of IFN-α. [score:3]
The assessment of the expression of miR-23a, miR-30c, miR-100, let-7e and miR-125b in pDC exposed to IFN-α for 24 hours revealed that IFN-α stimulated the down-modulation of miR-125b along with that of miR-30c. [score:3]
IFN-α -driven Blimp-1 expression is under the control of miR-23a and miR-125b. [score:3]
Figure S2 miR-23a and miR-125b expression in transfected HeLa cells. [score:3]
Of interest, although in HeLa cells the concomitant exposure to IFN-α and miR-23a/miR-125b over -expression associated with full loss of Blimp-1α isoform but enhanced levels of Blimp-1αΔ, any modulation of this latter isoform protein was not observed in IFN-α DC as well as in IFN-α -treated pDC. [score:3]
By transfecting HeLa cells, we over-expressed miR-23a and miR-125b, alone or in combination (Figure S2). [score:3]
Remarkably, IFN-α capability to induce Blimp-1α expression was completely lost when HeLa cells were concurrently transfected with miR-23a and miR-125b. [score:3]
B. MiR-23a and miR-125b quantification was carried out by qRT-PCR as reported in Material and Methods and fold changes of miRNA expression in the indicated DC populations obtained by 2 different donors (Don. [score:3]
Interestingly, 8 out of these 10 miRNAs were modulated in the same direction in pDC, being miR-23a, miR-27b, miR-30c, miR-32, miR-100, miR-146a, and let-7e significantly down-modulated and miR-155 up-modulated. [score:2]
Intensities of miR-23a and miR-125b bands, alone or in combination, were measured and expressed as arbitrary units on the right of the panel. [score:1]
On this basis, we favor the hypothesis that miR-23a and miR-125b, significantly down-modulated by IFN-α during DC differentiation, may cooperatively drive a lineage-skewing towards B cell features via Blimp-1 modulation. [score:1]
Of interest, the down-modulation of a selected panel of IFN-α -driven miRNAs, among which miR-23a and miR-125b are the major players, tightly associates with up-modulation of Blimp-1 occurring during DC differentiation in these experimental conditions. [score:1]
HeLa cells were transfected with miR-23a and miR-125b or with both miRNAs using lipofectamine according to the manufacturer’s instructions (Invitrogen). [score:1]
Blimp- 1 is modulated by IFN-α during monocyte-derived DC differentiation via miR-23a and miR-125b. [score:1]
[1 to 20 of 29 sentences]
18
[+] score: 72
Other miRNAs from this paper: hsa-mir-223, hsa-mir-15b
In our previous study, we showed that expression levels of miR-223, miR-23a and miR-15b were downregulated in the sera of MS patients versus healthy controls [15]. [score:6]
Moreover, stratifying according to the disease subtype, the downregulation of miR-223 and miR-23a still remained significant in RRMS patients vs. [score:6]
Moreover, based on the fact that genetic alterations could influence miRNA expression and possibly play a role in disease susceptibility, we genotyped three SNPs, mapping in the genomic regions of miR-223, miR-23a and miR-15b genes. [score:5]
2.1. miR-223 and miR-23a Expression Levels Are Altered in MS Patients versus ControlsIn the past few years, the identification of miRNAs differently expressed in blood and lesions of MS patients versus controls led miRNAs to be considered the new potential prognostic biomarkers for MS [4]. [score:4]
In particular, we observed a significant upregulation of miR-223 and miR-23a levels in RRMS, but not in PPMS patients, though this could be due to the small number of PPMS cases. [score:4]
In this study, we found different expression levels of miR-223 and miR-23a in PBMCs of MS patients compared to controls, suggesting a possible involvement of these two miRNAs in the pathogenic mechanisms of the disease. [score:4]
Interestingly, target genes of miR-223, miR-23a and miR-15b seem to play a role in MS pathogenesis [15]. [score:3]
Expression levels of miR-223, miR-23a and miR-15b were analyzed using the One-Way Anova test. [score:3]
On the contrary, a significant downregulation of miR-223, miR-23a, and miR-15b levels was found in the serum of the same MS population when compared with controls (miR-223: 0.31 ± 0.07 vs. [score:3]
2.1. miR-223 and miR-23a Expression Levels Are Altered in MS Patients versus Controls. [score:3]
miR-23a targets FGF-2 gene, a member of the fibroblast growth factor family. [score:3]
Based on these findings, a possible explanation of our results could be that the uptake of circulating miR-223 and miR-23a is increased in PBMCs of MS patients, where they exert their function on targeting genes, possibly involved in MS pathogenesis. [score:3]
org websites, we found predicted target genes of miR-223 and miR-23a involved in immunity and possibly relevant to MS pathology. [score:3]
In the present study, expression levels of miR-223, miR-23a and miR-15b were determined in PBMCs and serum from 15 MS patients and 12 controls (Table 1), as an independent replication. [score:3]
miR-23a levels resulted significantly upregulated only in RRMS patients as compared to controls (1.14 ± 0.24 vs. [score:3]
In particular, we determined the expression levels of these miRNAs both in PBMCs and sera from MS patients in order to establish a possible correlation between the levels of miR-223, miR-23a and miR-15b inside and outside the blood cells. [score:3]
Additionally, miR-23a was demonstrated to regulate lamin B1, which is important for myelin maintenance [24]. [score:2]
Allele and genotype frequencies of miR-223, miR-23a and miR-15b SNPs in MS patients and controls were reported in Table 2. A significantly decreased genotypic frequency of miR-223 rs1044165 T/T genotype was observed in MS patients versus controls (OR = 0.29, CI: 0.17–0.50; p < 0.001). [score:1]
The analysis of the three tagging SNPs revealed that the miR-223 rs1044165T allele likely acts as protective factor, whereas the miR-23a rs3745453C allele seems to exert a risk factor for MS pathogenesis. [score:1]
3.4. miR-223, miR-23a and miR-15b Extraction from PBMCs and Serum and Quantitative Analysis by Real-Time PCR. [score:1]
In order to test the genes coding for the studied miRNAs as susceptibility factors for MS, we also decided to perform genetic analyses of miR-223, miR23a and miR-15b. [score:1]
edu/mpg/haploview/) to identify the tagging SNPs of miR-223, miR-23a and miR-15b genes (rs1044165, rs3745453 and rs1451761, respectively). [score:1]
The ease with which blood can be obtained in a manner that is minimally invasive to the patient encouraged us to go further in the analyses of miR-223, miR-23a and miR-15b in the cells of this tissue. [score:1]
In particular, miR-223, miR-23a and miR-15b levels were significantly reduced [15]. [score:1]
1.00 ± 0.14; miR-23a: 0.47 ± 0.09 vs. [score:1]
The genetic analysis showed miR-223 SNP as a protective factor, and miR-23a variant as a risk factor for MS. [score:1]
Genetic Analysis of miR-223, miR-23a and miR-15b in MS Patients. [score:1]
html) to determine the position of miR-223, miR-23a and miR-15b genes and Haploview software (http://www. [score:1]
[1 to 20 of 28 sentences]
19
[+] score: 58
Stat3 -mediated activation of miR-23a suppresses gluconeogenesis in hepatocellular carcinoma by downregulating G6PC and PGC-1alpha. [score:6]
Previous reports described hepatic expression of mir-99a, mir-23a and mir-181a suggesting processing of the pre-Mir and co -expression of mir-181a* [31– 33]. [score:5]
Moreover, mir-23a down-regulates interleukin-6 receptor [37] whereas high level of circulating IL-6 has been associated with NR [38]. [score:4]
The modulation of mir23a expression may regulate IL6 signalling in patients with CHC. [score:4]
Mir-99a, mir-181a* and mir-23a were down-regulated in NRs whereas mir-217 was accumulated in NRs compared to SVRs. [score:3]
The over -expression of mir-23a has been described in mouse mo dels developing non-alcoholic steato-hepatitis, and HCC [32]. [score:3]
Only few putative mRNAs targets of mir-23a, mir-217, mir-99a and mir-181a* have been described, so far. [score:3]
None of mir-23a, mir-99a and mir-122 was differentially expressed between SVRs and NRs (Fig. 3A). [score:3]
Identification of a 3 miRNAs signature (mir-99a, mir-23a and mir-181a*) predictor of SVR and selective analysis of miRNAs expression in NRs and SVRs. [score:3]
The major novelty of our work consists in the identification of 4 miRNAs (mir-23a, mir-99a, mir-181a*, and mir-217) differentially expressed between NRs and SVRs. [score:3]
Moreover, the expression of mir-23a, mir-99a and mir-122 were not correlated in serum and liver samples (Table 3). [score:3]
Therefore, the expression of mir-99a alone or both mir-23a, mir-99a and mir-181a* has to be assessed in the liver, to provide enough information to predict SVR. [score:3]
We identified a signature combining the hepatic expression 3 miRNAs (mir-23a, mir-99a and mir-181a*) to predict SVR (AUC: 0.7346) (Fig. 2A). [score:3]
The expression of mir-23a, mir-99a and mir-181a* was increased in SVRs compared to NRs. [score:2]
The level of expression of mir-23a and mir-99a were low compared to mir-122 (Fig. 3A). [score:2]
In the serum, the level of expression of mir-23a and mir-99a were low compared to the one of mir-122 (Fig. 3A). [score:2]
The AUC of the mo del consisting in the combination of mir-99a, mir-181a* and mir-23a was 0.7346 (Fig. 2A). [score:1]
The expression of mir-23a, mir-99a, mir-181a*, mir-217 and mir-122 was investigated, in 68 serum samples available (NR = 26, RR = 10, RR = 32) (Fig. 3). [score:1]
Circulating mir-23a was suggested to be associated with type 2 diabetes [41]. [score:1]
0121395.g003 Fig 33A- Mir-23a, mir-99a, mir-181a*, mir-217 and mir-122 were detected by RT-q-PCR in 68 serums (NR = 26, RR = 10, RR = 32). [score:1]
3A- Mir-23a, mir-99a, mir-181a*, mir-217 and mir-122 were detected by RT-q-PCR in 68 serums (NR = 26, RR = 10, RR = 32). [score:1]
2014; 41 Yang Z, Chen H, Si H, Li X, Ding X, Sheng Q, et al Serum miR-23a, a potential biomarker for diagnosis of pre-diabetes and type 2 diabetes. [score:1]
[1 to 20 of 22 sentences]
20
[+] score: 55
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-23b, hsa-mir-27b, hsa-mir-23c
If differential expression of miR-23a and miR-27a is directly linked to the knockdown of Ezh2, then overexpression should reverse this trend. [score:7]
Since Ezh2 depletion upregulated TGF-β signaling thereby activating pro-EMT genes (Snail and Twist), it was intriguing to study if Ezh2 regulated the pro-EMT miR-23 cluster directly. [score:6]
We detected reduced expression of miR-27a and miR-23a at day 7, which remained downregulated in iPSC cells (Fig. 6e Upper and Lower panel). [score:6]
Downregulation of miR-23a and miR-27a is in alignment with suppression of EMT and acquisition of an epithelial state in iPSC generation. [score:6]
To address the differential activity of depletion of Ezh2 vs inhibition of H3K27me3 activity on expression of miR-23a and miR-27a miRNAs, we performed qPCRs in DMSO and GSK treated cells. [score:5]
To verify if miR-23a and miR-27a miRNAs are suppressed during the initiation of iPSC generation, we studied their expression pattern during reprogramming. [score:5]
To further confirm that Ezh2 regulates miR-23a and miR-27a expression in reprogramming, we monitored Ezh2 binding and enrichment of H3K27me3 marks on the miR-23 locus in hFibs at day 7 and Wt. [score:4]
Our results indicate enhanced expression of miR-23a and miR-27a in GSK treated cells (Fig. 6d Upper and Lower panel). [score:3]
As expected, overexpression of Ezh2 reversed the transcript profile of miR-27a and miR-23a (Fig. 6c Upper and Lower panel). [score:3]
Taqman qRT-PCR assays demonstrated increased expression of miR-27a and miR-23a in Ezh2 -deficient hFibs confirming our sequencing data (Fig. 6c Upper and Lower panel). [score:2]
Among those identified miR-23a and miR-27a that belong to miR-23 cluster were overrepresented following Ezh2 knockdown (Supplementary Fig. 5d). [score:2]
These results are consistent with our findings demonstrating that the miR-23 cluster is regulated by H3K27me3 activity of Ezh2 in human fibroblasts. [score:2]
Collectively, our results demonstrate that the H3K27 activity of Ezh2 overcomes EMT by transcriptional repression of pro-EMT miR-23a and miR-27a during the reprogramming process. [score:1]
Most importantly we identified previously unreported microRNAs, miR-23a and miR-27a, as barriers in human iPS generation. [score:1]
Binding of Ezh2 and localization of H3K27me3 marks on miR-23a locus further supports our claim that H3K27me3 activity is critical to negate miRNA mediated pro-EMT signaling. [score:1]
Interestingly miR-23a and miR-27a are known to promote EMT in cancers 33 34. [score:1]
[1 to 20 of 16 sentences]
21
[+] score: 51
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Continuing modifications in the expression pattern of miRNAs in the course of chronic epilepsy support the hypothesis that epileptogenesis is a dynamic process that continues even after the initial diagnosis of the disease, i. e. after the initial spontaneous seizures 1. The comparison between chronic epileptic rats and the human cases identified four miRNAs (miR-21-5p, miR-23a-5p, miR-146a-5p and miR-181c-5p) that are similarly up-regulated in expression levels in both species. [score:10]
Furthermore, we and Gorter et al. 24 observed the up-regulation of miR-17-5p, miR-20a-5p, miR-23a-3p and the down-regulation of miR-139-5p, whereas we and Bot et al. 23 observed the down-regulation of miR-551b-3p. [score:10]
Continuing modifications in the expression pattern of miRNAs in the course of chronic epilepsy support the hypothesis that epileptogenesis is a dynamic process that continues even after the initial diagnosis of the disease, i. e. after the initial spontaneous seizures 1. The comparison between chronic epileptic rats and the human cases identified four miRNAs (miR-21-5p, miR-23a-5p, miR-146a-5p and miR-181c-5p) that are similarly up-regulated in expression levels in both species. [score:10]
Finally, other subsets of miRNAs were either up-regulated (miR-23a-3p, miR132-3p, miR-146a-5p, miR-154-3p, miR-181d-5p, miR-212-3p, miR-212-5p, miR-344b-5p, miR-380-3p, miR-410-3p, miR-433-3p and miR-3584; Fig. 2, Supplementary Fig. S4), or down-regulated (miR-29c-5p, miR-30a-5p, miR-30c-2-3p, miR-30e-3p, miR-138-5p, miR-140-3p, miR-551b-3p and miR-652-3p; Fig. 2, Supplementary Fig. S5) during all phases of the disease. [score:9]
Second, the chronic phase was accompanied by significant alterations in miRNA expression in the rat GCL, and comparison with data from epileptic patients identified several miRNAs (notably miR-21-5p, miR-23a-5p, miR-146a-5p and miR-181c-5p) that were up-regulated in both human and rat epileptic hippocampus. [score:6]
We identified four miRNAs (miR-21-5p, miR-23a-5p, miR-146a-5p and miR-181c-5p) that were up-regulated in both epileptic humans and rats (Table 1). [score:4]
MiR-23a-5p has been proven to be a regulator of cell growth and apoptosis 41. [score:1]
Interestingly, miR-23a-5p and miR-146a-5p are in common with the other two rat data sets that were taken as primary comparator in this 23 24. [score:1]
[1 to 20 of 8 sentences]
22
[+] score: 49
Our findings were in consistent with studies using the hemin -treated K562s or EPO -induced CD34+ HPCs to differentiate into mature erythrocytes, revealing the upregulation of miR-23a, miR-27a or miR-24 during erythropoiesis, whereas an activin A -mediated erythroid mo dels reported the inhibitory role of miR-24 in haemaglobin accumulation. [score:6]
Based on the aforementioned observations, we propose that the GATA1/2 switch at the miR-23a∼27a∼24-2 promoter is responsible for their upregulation during erythropoiesis. [score:4]
Primary and mature transcripts of the miR-23a∼27a∼24-2 cluster were upregulated in differentiated erythroid cellsThe miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24. [score:4]
Primary and mature transcripts of the miR-23a∼27a∼24-2 cluster were upregulated in differentiated erythroid cells. [score:4]
These results suggest the occurrence of GATA-1-directed positive regulation of the miR-23a∼27a∼24-2 cluster (Figure 1K). [score:3]
Figure 1. GATA-1 was located on the upstream of miR-23a∼27a∼24-2 cluster and activated its expression during erythropoiesis. [score:3]
The miR-23a∼27a∼24-2 cluster was regulated by GATA1/2 switch during erythroid differentiationGiven the aforementioned observations that GATA-1 could reside on the −557 promoter site of miR-23a∼27a∼24-2 cluster and activate transcription, we attempted to determine whether GATA-2 and GATA-1 share the same −557 binding site but yield different biological outputs. [score:2]
Despite the fact that miR-451, miR-23a and mir-223 were shown to suffer from GATA-1 regulation in some species (6, 7, 11), there are virtually no data about GATA-1/2 switch dynamically operating on their genes during erythropoiesis. [score:2]
Recently, we reported that miR-23a was a positive erythroid regulator and activated by GATA-1 along erythroid differentiation (7). [score:2]
The activity of GATA-1 on the miR-23a∼27a∼24-2 promoter was examined by using a luciferase reporter assay following co-transfection with a GATA-1 overexpressing-vector and either a wild-type pGL-3-promoter construct (WT) or a mutant promoter (MUT) in 293T cells. [score:2]
So far, a number of non-coding regulators such as miR-451 (5, 6), miR-23a (7), miR-221/222 (8), miR-376a (9) and miR-223 (10) were reported to play positive or negative roles in controlling erythropoiesis. [score:2]
The miR-23a∼27a∼24-2 cluster was regulated by GATA1/2 switch during erythroid differentiation. [score:2]
Thus, the miR-23a∼27a∼24-2 cluster could coordinate with different TFs to determine or maintain such cell fates. [score:1]
Given the significant associations of miR-23a in erythropoiesis demonstrated in our previous studies (7), we decided to examine the primary and mature products from miR-23a∼27a∼24-2 cluster. [score:1]
Here, we demonstrate that the GATA-1/2 switch occurs at the common gene locus encoding miR-23a, miR-27a and miR-24. [score:1]
Given the aforementioned observations that GATA-1 could reside on the −557 promoter site of miR-23a∼27a∼24-2 cluster and activate transcription, we attempted to determine whether GATA-2 and GATA-1 share the same −557 binding site but yield different biological outputs. [score:1]
edu/cgi-bin/tess) sequence analysis was performed and revealed two putative GATA sites scattered within the promoter region of human miR-23a∼27a∼24-2 loci (Figure 1E; detailed information is shown in Supplementary Figure S1). [score:1]
Furthermore, q-PCR using specific Taqman probes revealed that pri-miR-23a∼27a∼24-2 and mature miR-27a, miR-24 and miR-23a were increased in EPO -driven erythroid differentiation of primary cultured human CD34+ HPCs (Figure 1D). [score:1]
The miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24. [score:1]
To confirm this mo del, we analysed the association of GATA-2 and GATA-1 with the −557 site of the miR-23a∼27a∼24-2 cluster following miRNA treatment. [score:1]
This cluster is composed of three members, miR-23a, miR-27a and miR-24, and has been linked to osteoblast differentiation, angiogenesis, cardiac remo delling, skeletal muscle atrophy and tumorigenesis (27–29). [score:1]
These results suggest that GATA-2 -dependent miR-23a∼27a∼24-2 cluster repression occurs. [score:1]
To further establish the connection between GATA-2 and miR-27a/24, the levels of both the primary and mature miR-23a∼27a∼24-2 clusters were evaluated in K562s transfected with either siRNAs specific to GATA-2 or constructs over -expressing GATA-2 (Figure 5D). [score:1]
GATA-1 was located on the miR-23a∼27a∼24-2 cluster promoter and activated its transcription. [score:1]
Therefore, changes in miR-23a∼27a∼24-2 cluster transcription would be able to be predicted by disruption of this feedback loop. [score:1]
[1 to 20 of 25 sentences]
23
[+] score: 46
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-302a
This might occur thanks the TGF-β1 -induced upregulation of the miR-23a-27a-24-2 cluster in NK cells, which in turn causes miR-27a-5p upregulation and the consequent CX [3]CR1 downregulation. [score:10]
It is likely that a tight control of the miR-23a-27a-24-2 cluster expression is necessary, given that its deregulation has been reported in several tumors and other diseases (38). [score:6]
Increment of miR-27a-5p expression is due to upregulation of the miR-23a-27a-24-2 cluster, which contains, among others, miR-27a-5p. [score:6]
Hsa-mir-23a pri-miRNA expression was normalized to the GAPDH expression. [score:5]
Interestingly, TGF-β1 has been shown to be responsible for upregulation of the miR-23a-27a-24-2 cluster in hepatocellular carcinoma cells (39), in lung adenocarcinoma cells (40) as well as in CD8 T cells (41). [score:4]
NK cells cultured for 24 h in the presence or absence of 5 ng/mL of TGF-β1 were analyzed by real-time PCR for the expression of miR-23a~27a~24-2 cluster primary transcript. [score:3]
miR-23a-27a-24-2 Cluster Primary Transcript Expression. [score:3]
Overall, these data suggest that miR-23a-27a-24-2 cluster could be an important target of TGF-β1, possibly acting as an intermediate inducer of its effects. [score:3]
As shown in Figure 3C, TGF-β1 caused a significant increment of the primary miR-23a-27a-24-2 transcript, thus demonstrating that the increased amount of miR-27a-5p might be due, at least in part, to induction of its gene expression other than, for example, to miR-27a-5p egress from intracellular stores. [score:3]
Next, to deepen the molecular mechanism responsible for the TGF-β1 -induced increase of miR-27a-5p, we analyzed the expression of the miR-23a-27a-24-2 cluster, precursor of miRNAs, including miR-27a-5p. [score:3]
[1 to 20 of 10 sentences]
24
[+] score: 43
Overview of the bioinformatics analysis of the TargetScan predicted targets of hsa-miR-23a, hsa-miR-27a and hsa-miR-24. [score:5]
Predicted targets of hsa-miR-23a, hsa-miR-27a and hsa-miR-24 by TargetScan. [score:5]
This file contains the list of targets of hsa-miR-23a, hsa-miR-27a and hsa-miR-24 as predicted by the TargetScan. [score:5]
Click here for file Predicted targets of hsa-miR-23a, hsa-miR-27a and hsa-miR-24 by TargetScan. [score:5]
Moreover inconsistent expression of the miRNA members of miR-23 cluster has also been observed. [score:3]
Although, their significance is yet to be worked out in these conditions, but the simultaneous increase or decrease of mir-23a, and-2 point towards their cooperative role in carrying out their functions in the diseased conditions. [score:3]
Nevertheless, inconsistent expression of the miRNA members of miR-23 cluster has also been observed. [score:3]
The expression consistency of miRNAs in a miR-23 cluster has been shown in several studies (Table 1) but the cooperativity between them is yet to be worked out. [score:3]
miR-23a is the first member of the mir-23a~27a~24-2 cluster. [score:1]
miR-23a in cancer. [score:1]
Figure 2 Role of hsa-miR-23a in various pathological conditions. [score:1]
is the first member of the mir-23a~27a~24-2 cluster. [score:1]
In an independent study, Lee et al had previously observed a block in the processing of pri-miR-23a to mature in HEK293 cells but not in HeLa cells and undifferentiated P19 cells [27]. [score:1]
Biological relevance of miR-23a~27a~24-2 cluster as revealed by bioinformatic analysis. [score:1]
miR-23 cluster paralogs. [score:1]
b. The structure of the 2159 nucleotide pre-miR-transcript of hsa-mir-23a~27a~24-2, the structure of individual miRNAs shown is derived from the Mfold program [101] http://mfold. [score:1]
miR-23a. [score:1]
miR-23a in cardiac hypertrophy. [score:1]
miR-23a in muscle atrophy. [score:1]
[1 to 20 of 19 sentences]
25
[+] score: 35
While hsa-miR-23a and hsa-miR-23b were highly expressed in human pancreatic cancer cells-derived xenografts, they were barely detectable in saliva in this mo del of tumor-bearing mice. [score:3]
We found that these cells and resulting xenografts express high levels of hsa-miR-21, hsa-miR-23a, hsa-miR-23b and hsa-miR-29c (S3 and S4 Tables). [score:3]
We identified hsa-miR-21, hsa-miR-23a, hsa-miR-23b and miR-29c as being significantly upregulated in saliva of pancreatic cancer patients compared to control, showing sensitivities of 71.4%, 85.7%, 85,7% and 57%, respectively and excellent specificity (100%). [score:3]
In this article, we have identified hsa-miR-21, hsa-miR-23a and hsa-miR-23b that were differently expressed between saliva samples of patients with a malignant tumor and cancer-free patients, with excellent specificity and sensitivity. [score:3]
Interestingly, hsa-miR-23a and hsa-miR23b are overexpressed in the saliva of patients with pancreatic cancer precursor lesions. [score:3]
Taken together, we demonstrate for the first time that salivary miRNA are indicative of pancreatic disease and can be used to diagnose unresectable PDAC (hsa-miR-21, hsa-miR-23a, hsa-miR-23b) or pancreatitis (hsa-miR-210). [score:3]
We found that 4 miRNAs (hsa-miR-21, hsa-miR23a, hsa-miR-23b and hsa-miR-29c) were significantly expressed in saliva from patients with pancreatic cancer (n = 7), while undetectable in the saliva of control patients (n = 4; Wilcoxon test, 0.001< p < 0.03) (Fig 1 and Table 2). [score:3]
Hsa-miR-21, hsa-miR-23a and hsa-miR-23b were found significantly deregulated in the saliva of resectable PDAC patients as compared to healthy control during the discovery phase, but were not further investigated as they didn’t exhibit at least a 4-fold change in expression between the two groups [24]. [score:1]
In this pilot study, we found that four salivary miRNAs (hsa-miR-21, hsa-miR-23a, hsa-miR-23b and hsa-miR-29c) successfully segregated PDAC patients from cancer-free donors, while hsa-miR-210 and let-7c indicate pancreatitis and hsa-miR-216 discriminates pancreatitis from cancer. [score:1]
On the contrary, patients diagnosed with pancreatitis and elevated salivary hsa-miR-21, hsa-miR-23a and hsa-miR-23b, or patients diagnosed with IPMN and elevated salivary hsa-miR-23a and hsa-miR-23b may be at-risk of developing PDAC and may require careful clinical follow-up. [score:1]
Of more than 90 miRNAs tested, 4 were identified as being significantly deregulated in saliva of pancreatic cancer patients compared to control (hsa-miR-21, hsa-miR-23a, hsa-miR-23b and hsa-miR-29c). [score:1]
On the other hand, salivary hsa-miR-23a, hsa-miR-23b and hsa-miR-29c were detected at low levels in the saliva of PDAC-bearing mice (Fig 2 and S5 Table). [score:1]
However, our study tends to indicate that hsa-miR-21, hsa-miR-23a and hsa-miR-23b are present in the saliva of patients with pancreatitis, while hsa-miR-210 is detected in the saliva of a fraction of patients with PDAC. [score:1]
In addition, hsa-miR-21, hsa-miR-23a and hsa-miR-23b were strictly specific to cancer patients, with excellent sensitivity (71.4% and 85.7%, respectively). [score:1]
We have obtained preliminary results suggesting that hsa-miR-23a and hsa-miR-23b are also be present in saliva from patients diagnosed with IPMN, and could be used for decision making in IPMN management. [score:1]
Hsa-miR-23a has recently been associated with KRAS [30] and C-MYC [31] mediated signaling pathway, and described as a candidate driving miRNA in pancreatic cancer [30]. [score:1]
Of note, hsa-miR-21, hsa-miR23a, hsa-miR-23b and hsa-miR-29c could be detected in the saliva of patients with pancreatitis (Fig 1). [score:1]
Analysis of salivary hsa-miR-21, hsa-miR-23a, hsa-miR-23b and hsa-miR-29c levels and Lucia blood levels in mice xenografted with Mia PACA-2 Lucia cells at the time indicated following tumor induction. [score:1]
Hsa-miR-23a has also been linked to impaired NK cell cytotoxicity [32], EMT [33] and resistance to treatment [34– 36]. [score:1]
In addition, hsa-miR-23a and hsa-miR-23b are present in the saliva of patients with IPMN. [score:1]
To our knowledge, we provide herein the first demonstration that hsa-miR-23a and hsa-miR-23b could be detected in the saliva of patients diagnosed with cancer; however, the specificity of both candidate miRNAs for PDAC is still to be demonstrated. [score:1]
[1 to 20 of 21 sentences]
26
[+] score: 34
Conversely, miR-23a, miR-149, miR-193b, and miR-324-3p were upregulated, whereas miR-15b, miR-29a, miR-181a, miR-195, and miR-494 were downregulated (Figure 6). [score:7]
Figure 5 Since miR-15b, miR-23a, miR-29a, miR-106b, miR-128, miR-192 and miR-494 were found downregulated and have been shown to induce chemoresistance (Figure 5), we evaluated the expression of some of them, including miR-15b (Hs04231486_s1), miR-23a (Hs03659093_s1) and miR-29a (Hs03849009_s1), through TaqMan microRNA expression assays (Supplementary Figure 4). [score:5]
Figure 6 MiRNAs deregulation was confirmed by TaqMan miRNA expression assays that specifically allowed to detect the expression levels of following miRNAs: miR-23a (Hs03659093_s1), miR-149 (Hs04231523_s1), miR-193b (Hs04231607_s1), miR-324-3p (Hs04273262_s1), miR-15b (Hs04231486_s1), miR-29a (Hs03849009_s1), miR-181a (Hs04231460_s1), and miR-195 (Hs03656088_s1) (Supplementary Figure 6). [score:5]
Figure 5Since miR-15b, miR-23a, miR-29a, miR-106b, miR-128, miR-192 and miR-494 were found downregulated and have been shown to induce chemoresistance (Figure 5), we evaluated the expression of some of them, including miR-15b (Hs04231486_s1), miR-23a (Hs03659093_s1) and miR-29a (Hs03849009_s1), through TaqMan microRNA expression assays (Supplementary Figure 4). [score:5]
Figure 6MiRNAs deregulation was confirmed by TaqMan miRNA expression assays that specifically allowed to detect the expression levels of following miRNAs: miR-23a (Hs03659093_s1), miR-149 (Hs04231523_s1), miR-193b (Hs04231607_s1), miR-324-3p (Hs04273262_s1), miR-15b (Hs04231486_s1), miR-29a (Hs03849009_s1), miR-181a (Hs04231460_s1), and miR-195 (Hs03656088_s1) (Supplementary Figure 6). [score:5]
We found that some miRNAs, including miR-15b, miR-23a, miR-29a, miR-106b, miR-128, miR-192 and miR-494, were downregulated in MDA-MB-231 cells under STS conditions. [score:4]
MiR-15b and miR-23a have been shown to increase Cisplatin-resistance in lung cancer cell line A549 [28] and in tongue squamous cell carcinoma [29], whereas miR-29a induced Adriamycin and Docetaxel resistance in breast cancer (BC) [30], miR-128 enhanced antiblastic resistance in BC cells targeting BAX [31], miR-192 promoted Cisplatin-resistance in lung cancer cells A549/DDP [32], and, finally, miR-106b and miR-494 conferred radioresistance and Sorafenib-resistance in colorectal cancer and hepatocellular carcinoma silencing PTEN and p21 [33– 35]. [score:3]
[1 to 20 of 7 sentences]
27
[+] score: 33
Six out of ten miRNAs selected for validation were found significantly upregulated by anti-TNFα/DMARDs combination therapy (miR-16-5p, miR-23-3p, miR125b-5p, miR-126-3p, miRN-146a-5p, miR-223-3p). [score:4]
That data were further supported by ROC analyses, which showed that hsa-miR-23-3p and hsa-miR-223-3p levels at T1, with a cutoff value of 6.9 and 11.2 (relative expression at T1) respectively, were predictors of non-response to anti-TNFα/DMARD combination treatment (Figure  5B-C) with a sensitivity of 62.5% and 57.1%, and a specificity of 86.4% and 90.2% respectively. [score:3]
The miRNAs validated by RT-PCR in our cohort of patients (miR146a-5p, miR-16-5p, miR-23-3p, miR-125b-5p, miR223-3p; miR126-3p) have been previously reported to act as relevant regulators of immune cells development, playing crucial roles in the inflammatory response, and acting as key players in the pathogenesis of various chronic and autoimmune disorders, including RA itself [24]. [score:3]
Changed relative expression between T1 and T2 for miR-23, at a cutoff value of 0.83, demonstrated a sensitivity of 62.5% and a specificity of 77.6%. [score:3]
To validate the PCR array data,10 miRNAs differentially expressed were selected (hsa-miR-125b, hsa-miR-23a-3p, hsa-miR-21-5p, hsa-miR-126-3p, hsa-miR-146a-5p, hsa-let-7a-5p, hsa-miR-16-5p, hsa-miR-124a-3p, hsa-miR-155-5p, and hsa-miR-223). [score:3]
In our cohort, IL-6 receptors alpha and beta were found to be putative targets for three of the six validated miRNAs (hsa-miR-23-3p, hsa-miR-125b-5p, and hsa-miR223-3p). [score:3]
To validate the PCR array data, five miRNAs differentially expressed, showing at least 2-fold change between the two conditions, were selected (hsa-miR-125b, hsa-miR-23a-3p, hsa-miR-21-5p, hsa-miR-126-3p and hsa-miR-146a-5p). [score:3]
To validate the PCR array data, ten miRNAs differentially expressed were selected (hsa-miR-125b, hsa-miR-23a-3p, hsa-miR-21-5p, hsa-miR-126-3p, hsa-miR-146a-5p, hsa-let-7a-5p, hsa-miR-16-5p, hsa-miR-124a-3p, hsa-miR-155-5p, and hsa-miR-223). [score:3]
To improve accuracy of the analysis, we performed the combination of ROC curve analyses of miR-23, and miR-223. [score:1]
Further, we identified a specific plasma miRNA signature (miR-23 and miR-223) that may serve both as predictor and biomarker of response to anti-TNFα/DMARDs combination therapy. [score:1]
In total population, six of the ten miRNAs clearly distinguished RA serum samples after anti-TNFα/DMARDs combination therapy with high confidence level (P <0.05): (hsa-miR-125b, hsa-miR-126-3p, hsa-miR146a-5p, hsa-miR-16-5p, hsa-miR-23-3p, and hsa-miR-223-3p) all of them being increased after treatment (Figure  2A; Tables S3 and S4 in Additional file 1). [score:1]
The changes observed in three miRNAs (hsa-miR-146a-5p, hsa-miR-223-3p and hsa-miR-16-5p) significantly correlated with the changes observed in clinical parameters (that is, DAS28), and five of them at least with changes in inflammatory parameters such as CRP or ESR (hsa-miR-146a-5p, hsa-miR-223-3p,hsa-miR-16-5p, hsa- miR-126-3p and hsa-miR-23-3p) (Figure  4). [score:1]
Furthermore, ROC analyses demonstrated that two of these six miRNAs (hsa-miR-23-3p and hsa-miR-223-3p) can act in RA patients as both predictors of therapy response (indicating those patients who would not benefit from anti-TNFα/DMARDs combination therapy), and as biomarkers of response to anti-TNFα/DMARDs combination therapy (so that their levels would be indicative of treatment efficacy and also of the degree of response). [score:1]
Taken together, these results suggest that serum hsa-miR-23a-3p and hsa-miR-223-3p can act both as predictors of therapy response and biomarkers of response to anti-TNFα/DMARDs combination therapy with high specificity. [score:1]
ROC analysis showed the highest AUC for miR-23 and miR-223. [score:1]
Serum miRNAs hsa-miR-23a-3p and hsa-miR-223-3p as predictors of therapy response in RA patients. [score:1]
[1 to 20 of 16 sentences]
28
[+] score: 32
The major findings of this report are as follows: (1) a conserved set of miRNAs was identified that was consistently down-regulated in the migrating cell population relative to cells in the migration-restricted population, (2) miR-23b was significantly down regulated in migrating glioma cells in vitro and in cells from the invasive edge in patient tumor samples, (3) overexpression of miR-23b significantly inhibited glioma cell migration and invasion while inhibition of miR-23b expression significantly increased glioma cell migration, (4) predictive miRNA target analysis revealed a conserved miR-23b target site within the 3’ UTR of Pyk2, a non-receptor tyrosine kinase previously implicated in the regulation of glioma cell migration and invasion, (5) increased expression of miR-23b reduced the expression level of Pyk2 in glioma cells but did not significantly alter the expression level of the related focal adhesion kinase FAK, (6) expression of a Pyk2 transcript, devoid of the 3’UTR containing the miR23-b target sequence, in miR-23b over -expressing cells increased Pyk2 protein expression and partially rescued glioma cell migration. [score:32]
[1 to 20 of 1 sentences]
29
[+] score: 31
In the other hand, although miR-23a-5p was not predicted to target these transcripts, the 3p arm of miR-23 has been found by others, to be enriched in Tregs, and is predicted to target IL6ST 25, 33. [score:5]
More recently, the miR-23~27~24 cluster was shown to be a FOXP3 transcriptional target with roles in Treg biology; and the overexpression of the entire miR-23 cluster was shown to negatively impact the differentiation of Th1 and Th17 lineages [63]. [score:5]
Interestingly, miR-23a was previously shown to directly target the IL-6 mRNA in trophoblasts [62]. [score:4]
Moreover, we showed that IL6R and IL6ST transcript levels are reduced upon introduction of synthetic mimics of selected targeting miRs (namely, miR-23a, -30a, -636 and -1299). [score:3]
Among miRNAs expressed in nTreg five times or more than in naïve CD4 [+] T-cells (as determined by miR-seq), Takahashi et al. identified: miR-10a-5p, miR-21-5p, miR-31-5p, miR-21-3p, miR-146a-5p, miR-423-3p and miR-23a-3p [33]. [score:3]
D1) with synthetic microRNA mimic RNA molecules corresponding to miR-23a (-3p), miR-30a (-5p), miR-636, miR-1299 and a control miR (pre-miR-ctrl) without human predicted targets (Ambion, Austin, TX, USA). [score:3]
Intriguingly, miR-23a-5p also impacted IL6R and IL6ST mRNA levels, despite not being target by this microRNA. [score:3]
To functionally evaluate the predicted destabilization and dowregulation of IL6R and IL6ST by some of the identified microRNAs, we selected a group of four microRNAs (namely, miR-23a-5p, -30a-5p, -636 and -1299) and transfected a cell line, known to express both transcripts, with the corresponding synthetic microRNA mimics. [score:2]
Next, control or mirVana miRNA mimics (pre-miR-ctrl and miR-23a-5p, miR-30a-5p, miR-636 and miR-1299; Ambion, Austin, TX, USA) were added (30 nM final concentration) and the mixtures (100 ul) were further vortexed and incubated for 15 minutes at RT, before being added to the cells. [score:1]
The NTera-2 cell line was independently transfected with the selected group of four synthetic microRNA mimics (namely, miR-23a-5p, -30a-5p, -636 and -1299) and the control mimics and the expression of IL6R and IL6ST transcripts was evaluated by qPCR. [score:1]
In common with their work, we identified miR-10a-5p and the 5p arm of miR-23a (and also miR-10a-3p and miR-10b-5p). [score:1]
[1 to 20 of 11 sentences]
30
[+] score: 30
For the latent stage, 18 consistently differentially expressed mature miRNA sequences were identified: 8 were up-regulated (miR-212-3p, miR-21-5p, miR-132-3p, miR-20a-5p, miR-17-5p, miR-27a-3p, miR-23a-3p, miR-146a-5p) and 10 were down-regulated (miR-139-5p, miR-551b-3p, miR-33-5p, miR-708-5p, miR-7a-5p, miR-935, miR-138-5p, miR-187-3p, miR-30e-3p, miR-222-3p) (Table  2). [score:9]
For the chronic stage, 9 mature miRNA sequences were identified: 8 were up-regulated (miR-146a-5p, miR-23a-3p, miR-135b-5p, miR-21-5p, miR-132-5p, miR-132-3p, miR-210-3p, and miR-212-5p) and one was down-regulated (miR-551b-3p) (Table  2). [score:7]
The most common up-regulated miRNAs across the analyzed set of expression profiles were miR-21-5p (15 profiles), followed by miR-132-3p, miR-23a-3p, miR-212-3p, miR-146a-5p, miR-27a-3p, miR-129-5p, miR-203a-3p, miR-17-5p, miR-19a-3p (Supplementary Table  S4). [score:6]
At the latent stage, up-regulated miRNAs miR-20a, miR-17, miR-23a, miR-27a and miR-146a have been previously shown to be enriched in mouse microglia [58]. [score:4]
Additionally, miR-146a-5p and miR-23a-3p were common up-regulated miRNAs for the latent and chronic stages. [score:4]
[1 to 20 of 5 sentences]
31
[+] score: 28
miR-125a-3p inhibits autophagy through targeting UV radiation resistance -associated gene (UVRAG), miR-33 targets ATG5/LAMP1, miR-144-3p targets autophagy-related gene 4a (ATG4a), miR-23a-5p inhibits the TLR2/MyD88/NF-κB leading to reduced autophagy and miR-33 also plays an inhibitory role via targeting some unknown factors. [score:15]
In another study, overexpression of miR-23a-5p dramatically prevented Mtb -induced activation of autophagy in macrophages by modulating TLR2/MyD88/NF-κB signaling (Gu et al., 2017). [score:3]
In a similar study, miR-23a-5p modulated the host innate immune response by promoting Mtb survival and inhibiting autophagy induction through TLR2/MyD88/NF-κB pathway (Gu et al., 2017). [score:3]
miR-125a-3p, miR-33, miR-144-3p, miR-23a-5p, and miR-142-3p are potential inhibitors of autophagy in Mycobacterium tuberculosis (Mtb) infection. [score:3]
MiR-23a-5p modulates mycobacterial survival and autophagy during Mycobacterium tuberculosis infection through TLR2/MyD88/NF-κB pathway by targeting TLR2. [score:2]
1 macrophages Kim et al., 2015 miR-17-5p ULK-1 Mouse RAW264.7 macrophages Duan et al., 2015 miR-144-3p ATG4a Mouse RAW264.7 macrophages Guo et al., 2017 miR-20a ATG7andATG16L1 Mouse RAW264.7 macrophages Guo et al., 2016 miR-23a-5p TLR2/MyD88/NF-κB Mouse RAW264.7 and BMDMs Gu et al., 2017 miR-26a KLF 4 Mouse RAW264.7 macrophages Sahu et al., 2017 miR-17-5p Mcl-1/STAT3 Mouse RAW264.7 macrophages Kumar et al., 2016 With respect to TB, miR-146a and miR-155 are the most vastly studied miRNAs influencing the host–pathogen interaction. [score:1]
1 macrophages Kim et al., 2015 miR-17-5p ULK-1 Mouse RAW264.7 macrophages Duan et al., 2015 miR-144-3p ATG4a Mouse RAW264.7 macrophages Guo et al., 2017 miR-20a ATG7andATG16L1 Mouse RAW264.7 macrophages Guo et al., 2016 miR-23a-5p TLR2/MyD88/NF-κB Mouse RAW264.7 and BMDMs Gu et al., 2017 miR-26a KLF 4 Mouse RAW264.7 macrophages Sahu et al., 2017 miR-17-5p Mcl-1/STAT3 Mouse RAW264.7 macrophages Kumar et al., 2016With respect to TB, miR-146a and miR-155 are the most vastly studied miRNAs influencing the host–pathogen interaction. [score:1]
[1 to 20 of 7 sentences]
32
[+] score: 25
With exception of miRNA-155, down-regulated in serum of AMD patients and in serum of Aβ injected rats, six miRNAs (miR-9, miR-23a, miR-27a, miR-34a, miR-146a, miR-126) showed an up-regulation in serum of AMD patients. [score:7]
Analysis of these 13 miRNAs revealed that 7 miRNAs showed a significant up-regulation in serum of AMD patients in comparison to control group (miR-9, miR-23a, miR-27a, miR-34a, miR-146a, miR-155, and miR-126). [score:4]
In particular, up-regulation of miR-9, miR-23a, miR-27a, miR-34a, miR-126, and miR-146a was found in serum of AMD patients. [score:4]
The following groups of miRNAs were analyzed: miR-27a, miR-146a, miR-155 miR-9, miR-23a, miR-27a, miR-34a, miR-126,miR-146a, miR-155 miR-155 GraphPad Prism (version 4.0; GraphPad Software, San Diego, CA, USA) was used for statistical analysis and graphical representation of miRNA differential expression data. [score:3]
Incidentally, we showed that changes in circulating levels of some miRNAs (miR-9, miR-23a, miR-27a, miR-34a, miR-126, miR-146a, miR-155) as found in AMD patients are associated to Alzheimer's disease and modulate genes involved in neurodegenerative and inflammatory pathways. [score:3]
In conclusion, the modified miRNA levels we found in rat retina (miR-27a, miR-146a, miR-155) and serum of AMD patients (miR-9, miR-23a, miR-34a, miR-126, miR-27a, miR-146a, miR-155) suggest that, among others, miR-27a, miR-146a, and miR-155 have an important role in AMD and could represent suitable biomarkers and appealing pharmacological targets. [score:3]
Effect of miR-23 on oxidant -induced injury in human retinal pigment epithelial cells. [score:1]
[1 to 20 of 7 sentences]
33
[+] score: 24
After the first round of random walk, we chose the top 10 predicted target miRNAs and discovered that the 3rd target (hsa-mir-450a-2), the 5th target (hsa-mir-23a), the 6th target (hsa-mir-29b-2), the 7th target (hsa-mir-320b-1) and the 10th target (hsa-mir-375) were associated with the predicted disease breast neoplasms [44]. [score:15]
It should be noted that 4 (hsa-mir-21, hsa-mir-23a, hsa-mir-27a and hsa-mir-155) out of the top 5 target miRNAs, when expressed abnormally, were involved in the development of heart failure [44]. [score:6]
After the first round of bi-random walks in miRDDCR on the drug-miRNA bipartite network, potential target miRNAs were ranked, in which the top 5 miRNAs were hsa-mir-21, hsa-mir-27b, hsa-mir-23a, hsa-mir-27a and hsa-mir-155. [score:3]
[1 to 20 of 3 sentences]
34
[+] score: 22
Statistical significance of the qRT-PCR data was obtained for ten of these 17 miRNAs: downregulation of miR-17–5p, miR-186–5p, miR-378a-3p, miR-378f, miR-629–5p and miR-7–5p and upregulation of miR-143–3p, miR-23a-3p, miR-23b-3p and miR-27b-3p, upon E6/E7 silencing (Fig. 2E and indicated in bold in S2 Table). [score:7]
PLoS One 5. 98 Gao P, Tchernyshyov I, Chang TC, Lee YS, Kita K, et al (2009) c-Myc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism. [score:5]
Moreover, two seed families, the miR-23 family (miR-23a-3p, miR-23b-3p) and miR-27 family (miR-27a-3p, miR-27b-3p), were upregulated. [score:4]
On the other hand, continuous E6/E7 expression is linked to a decrease of the intracellular concentrations of miR-23a-3p, miR-23b-3p, miR-27b-3p, and miR-143–3p. [score:3]
However, miR-23a-3p possesses pro-senescent potential [93, 94] and has also been linked to apoptosis induction [92], indicating that miR-23a-3p can exert context -dependent pro- or anti-tumorigenic activities. [score:1]
Specifically, lowered levels of miR-23a-3p and miR-23b-3p have been linked to enhanced glutamine catabolism [98] and a decrease of miR-143–3p favors glucose metabolism by aerobic glycolysis (Warburg effect) [99]. [score:1]
The E6/E7 -dependent reduction of miR-23a-3p is surprising since this miRNA often is elevated in cancers, suggesting that it acts pro-tumorigenic [92]. [score:1]
[1 to 20 of 7 sentences]
35
[+] score: 22
Among those upregulated, we may mention hsa-miR-17-5p, hsa-miR-320, hsa-miR-652, while the downregulated miRNAs were hsa-miR-15a, hsa-miR-16, hsa-miR-23a/b, and hsa-miR-200c [119]. [score:7]
Interestingly, miR-23a was found to facilitate HSV-1 replication by targeting interferon regulatory factor 1 (IRF1) and inhibiting the interferon pathway, an antiviral innate immune pathway [74]. [score:6]
The cellular miRNAs upregulated in EBV -positive DLBCL were hsa-miR-424, hsa-miR-223, hsa-miR-199a, hsa-miR-27b, hsa-miR-378, hsa-miR-26b, and hsa-miR-23a/b. [score:4]
This complex interaction is not yet fully understood, and the mechanisms by which HSV-1 induces miR-23a expression are not clear [74]. [score:3]
Lastly, kshv-miR-K12-3 was found to share seed sequence homology with hsa-miR-23. [score:1]
Manzano M. Shamulailatpam P. Raja A. N. Gottwein E. Kaposi’s sarcoma -associated herpesvirus encodes a mimic of cellular miR-23 J. Virol. [score:1]
[1 to 20 of 6 sentences]
36
[+] score: 21
The authors showed that estradiol inhibits miR-23 -dependent downregulation of connexin 43 in a menopausal rat mo del, and provide new mechanisms of post-menopause-related arrhythmia [99]. [score:6]
In addition to its role in cardiac function, miR-23a levels also differ in males and females after cerebral ischemia and are related to accelerating apoptosis by regulating X-linked inhibitor of apoptosis (XIAP) expression and XIAP-caspase complex formation [100]. [score:6]
Siegel C. Li J. Liu F. Benashski S. E. McCullough L. D. miR-23a regulation of X-linked inhibitor of apoptosis (XIAP) contributes to sex differences in the response to cerebral ischemiaProc. [score:4]
Wang N. Sun L. -Y. Zhang S. -C. Wei R. Xie F. Liu J. Yan Y. Duan M. -J. Sun L. -L. Sun Y. -H. MicroRNA-23a Participates in Estrogen Deficiency Induced Gap Junction Remo deling of Rats by Targeting GJA1Int. [score:2]
Specifically, miR-23a has regulatory regions containing ERα binding sites and plays a protective role in estrogen deficiency -induced cardiac gap-junction damage in rats [98]. [score:2]
Important roles for miR-23a and miR-22 have also been described in cardiac function involving the action of estrogen. [score:1]
[1 to 20 of 6 sentences]
37
[+] score: 21
Down -expression was observed only for miR-21, whereas over -expression was observed in 12 miRNA (miR-143, miR-145, miR-151-5p, miR-155*, miR-199a-5p, miR-23a, miR-30a, miR,30c, miR-21, miR-455-3p, miR-708 and miR-let-7i) and only two were not deregulated in a statistically significant way (miR-30a and miR-30c) (Table 3). [score:6]
In particular, of 34 miRNAs with a p<0.01, 30 showed higher expression levels in tumor tissue, with hsa-miR-23a displaying the highest fold-change value (9.3-fold), whereas 4 more miRNAs were down-regulated (Table 2). [score:6]
The remaining 8 miRNAs (miR-151-5p, miR-155*, miR-17, miR-199a-5p, miR-23a, miR-30a-5p, miR-455-3p, and miR-let-7i) did not exhibit significantly altered expression. [score:3]
By miRNA-network analysis, tissue-specific patterns of miRNA deregulation were traced: the driving miRNAs were miR-195, miR-1280, miR-140-3p and miR-1246 in colorectal tumors, and miR-103, miR-23a and miR-15b in pancreatic cancers. [score:2]
In particular, after excluding the nodes of the clique (miR-103, miR-15b, miR-199a-3p and miR-23a) the lowest ranks, namely 5.78, 5.85, 6.05 and 6.14 were obtained, respectively. [score:1]
In PC network, as shown in panel B, miR-103, miR-23a and miR-15b have the highest degrees and are all linked to miR-199a-3p as well as to each other forming a four nodes clique. [score:1]
Focusing on the principal nodes detected in PC network, miR-103 was associated with alteration of TGF-β signaling pathway, and miR-23a with KRAS -mediated signaling pathway, while for miR-15b a number of biological relevant associations with cellular signaling pathways were observed [26]. [score:1]
In particular, the maximum number of ties was found for miR-103 (degree: 8.88), miR-23a (degree: 8.84) and miR-15b (degree: 8.38). [score:1]
[1 to 20 of 8 sentences]
38
[+] score: 21
Only a few miRNAs were concordantly regulated by both HBx forms e. g. miR-23a up-regulation and miR-19a/b down-regulation (Figure 3A). [score:8]
For example, miR-23a and -125a up-regulation as well as miR-19a/b down-regulation by both HBx forms were verified (Figure 3B). [score:7]
For instance, HBx binding was shown in the 4–4.5 kilo-base upstream promoter region of the miR-23a/27a cluster (Figure 4B) which was significantly up-regulated by HBxΔ35 (Figure 3). [score:4]
On the other hand, in the few miRNAs that were concordantly regulated by both full-length HBx and HBxΔ35 e. g. miR-23a and -27a, similar promoter region (around 4-kb upstream of TSS) was occupied by both forms of HBx (Figure S2). [score:2]
[1 to 20 of 4 sentences]
39
[+] score: 19
Several studies examine the expression of miRNAs during neurodevelopment as well as in the adult CNS and reveal that certain miRNAs are found preferentially expressed in neurons, e. g., miR-124 and miR-128 [10], whereas others, e. g., miR-23, miR-26 and miR-29, seem restricted to astrocytes [11]. [score:6]
The intensity of the yellow scale in the heat map corresponds to the mean log2 expression of miRNAs on the microarrays, as shown in the key on Figure 1. Expression of 3 genomic clusters containing predominantly astrocytic miRNAs; the miR-23a cluster (A), the miR-23b cluster (B) and the miR-29a cluster (C). [score:5]
0011109.g007 Figure 7Expression of 3 genomic clusters containing predominantly astrocytic miRNAs; the miR-23a cluster (A), the miR-23b cluster (B) and the miR-29a cluster (C). [score:3]
Another is miR-23, which, in agreement with the report of Smirnova et al. [11], was preferentially expressed in astrocytes. [score:3]
miR-24 and miR-27a are members of a genomic cluster on chromosome 19 with the astrocytic miRNA miR-23a (Fig. 7A). [score:1]
Similarly, paralogs of miR-24 occur in the miR-23a and miR-23b genomic clusters that were detected in NT-A and primary human astrocytes (microarrays and/or qPCR; Fig. 7A, B & Table S1). [score:1]
[1 to 20 of 6 sentences]
40
[+] score: 18
For example, miR-23a suppresses the JAK1/STAT6 pathway by directly targeting these molecules, while miR-27a directly targets IRF4 and PPAR-γ. [score:9]
In an important test of potential clinical application, the authors also demonstrated that overexpression of the miR-23a/27a/24-5p cluster was capable of suppressing tumor growth in vivo. [score:5]
The miR-23a/27a/24-5p cluster has also been shown to be downregulated in TAMs (85). [score:4]
[1 to 20 of 3 sentences]
41
[+] score: 18
Hu X. Wang Y. Liang H. Fan Q. Zhu R. Cui J. Zhang W. Zen K. Zhang C. Y. Hou D. miR-23a/b promote tumor growth and suppress apoptosis by targeting PDCD4 in gastric cancerCell. [score:5]
Focusing on the miRNAs able to target different genes at the same time, we evidenced that the genes are targeted by twelve following miRNAs: hsa-miR24-3p, hsa-miR-6778-5p, hsa-miR-6514-3p, hsa-miR-5010-5p, hsa-miR-23a-5p, hsa-miR-25-5p, hsa-miR-6792-5p, hsa-miR-6866-5p, hsa-miR-4728-5p, hsa-miR-6825-5p, hsa-miR-6803-3p, hsa-miR-6794-5p (Table 2 and Figure 4). [score:5]
Roufayel R. Kadry S. Expression of miR-23a by apoptotic regulators in human cancer: A reviewCancer Biol. [score:4]
Hsa-miR-23a-5p promotes the cell growth in gastric cancer [103], regulates colon cancer metastasis and induces invasion and progression [104], is capable to induce higher vascular and endothelial permeability in lung cancer [105] and contributes to metastasis and autophagic process in melanoma cancer [106]. [score:2]
Wang Z. Wei W. Sarkar F. H. miR-23a, a critical regulator of “migR” ation and metastasis in colorectal cancerCancer Discov. [score:2]
[1 to 20 of 5 sentences]
42
[+] score: 18
Other miRNAs from this paper: hsa-mir-18a, hsa-mir-494
MYC was found to downregulate miR-23a/b, which targets Gls, resulting in increased production of glutamate from glutamine (Gao et al., 2009). [score:6]
c-Myc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism. [score:5]
Thus, MYC can alter the expression of specific miRNAs (i. e., miR18a and miR23a) which in turn regulate glutamine metabolism. [score:4]
Notably, it had been previously demonstrated in vitro that MYC -dependent suppression of miR-23a/b results in increased Gls1 and glutaminolysis activity (Gao et al., 2009; Kota et al., 2009). [score:3]
[1 to 20 of 4 sentences]
43
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
A recent study showed that the expression levels of three miRNAs including miR-23a were significantly higher in breast cancer with lymph node metastasis, compared with that from patients without lymph node metastasis or normal tissue and also that the expression of the miR-23a/24-2/27a cluster promoted mammary carcinoma cell migration, invasion, and hepatic metastasis, through targeting Sprouty2 (SPRY2) and consequent activation of p44/42 MAPK (mitogen-activated protein kinase) [53]. [score:6]
For example, gene targets of five differentially expressed miRNAs (miR-365-3p, miR-30b-5p, miR-30c, let-7a-5p and miR-23a) were enriched for pathways in immune system (B-cell receptor signaling pathway, chemokine signaling, T-cell receptor signaling and Fc gamma R -mediated phagocytosis). [score:5]
Five differentially expressed miRNAs (bta-miR-184, miR-24-3p, miR-148, miR-486 and let-7a-5p) were unique to E. coli while four (bta-miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus. [score:3]
Furthermore, the differential expression pattern of five miRNAs (bta-miR184, miR-24-3p, miR-148, miR-486 and bta-let-7a-5p) were unique to E. coli while four (bta-miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus. [score:3]
Interestingly, our study shows that a different set of five miRNAs (miR-184, miR-24-3p, miR-148, miR-486 and let-7a-5p) were unique to E. coli bacteria while another set of four (miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus bacteria. [score:1]
[1 to 20 of 5 sentences]
44
[+] score: 17
Overexpression of miR-23a in vitro, led to inhibition of EMT in HEC 1A cells through the targeting of SMAD3 (155). [score:7]
Much like miR-23a, miR-124 when expressed at higher levels reverses the EMT-like phenotype, exhibiting reduced migration, invasion and proliferation through the upregulation of the scaffolding protein IQGAP1 (156). [score:6]
Presently, EMT is suppressed in EC through the action of four miRNAs: miR-194, miR-101, miR-23a, and miR-124. [score:3]
miR-23a has also been found at significantly reduced levels in EC tissue (155). [score:1]
[1 to 20 of 4 sentences]
45
[+] score: 17
The 4HPR treatment increased the expression of miR-16, miR-26b, miR-23a, and miR-15b in ARPE-19 cells, although these increases were modest when compared to the increase in the expression of miR-9. Our studies demonstrate that miR-9 is expressed in the RPE cell line ARPE-19, and its expression is increased by a retinoic acid derivative and by an inhibitor of promoter hypermethylation. [score:10]
The 4HPR treatment also significantly increased the expression of miR-15b, miR-16, miR-23a, and miR-26b. [score:3]
Increases in the expression of miR-16, miR-26b, miR-23a, and miR-15b were observed following 4HPR treatment; however, these increases were modest when compared to the approximately twofold increase observed for miR-9. The 5′-flanking regions (~1 kb) of genes generating miR-16, miR-26b, miR-23a, miR-15b, miR-223, and let-7a were analyzed for the presence of consensus binding sites for CEBP-α and CEBP-β. [score:2]
Several of the verified miRNAs are present in all three hybridization data sets (miR-29, miR-107, let-7d, miR-23a, and miR-143); three others (miR-124, miR-106, and miR-143) are present in at least one of the hybridization data sets. [score:1]
However, putative binding sites for CEBP-α and CEBP-β were absent in the promoter regions of the genes encoding miR-23a and miR-26b. [score:1]
[1 to 20 of 5 sentences]
46
[+] score: 17
Similarly, miRNAs that were up-regulated in other cancers such as miR-126 in colon cancer [30], miR-23a and miR-125b in HCC [33, 34], miR-191 and miR-199a in myeloid leukemia [35], miR-200b [36], miR-10b and miR-26b in breast cancer [37, 38], and miR-98 [28] in head and neck squamous cell carcinoma were also up-regulated in rabbit VX2 tumors. [score:7]
Huang S. He X. Ding J. Liang L. Zhao Y. Zhang Z. Yao X. Pan Z. Zhang P. Li J. Upregulation of miR-23a approximately 27a approximately 24 decreases transforming growth factor-beta -induced tumor-suppressive activities in human hepatocellular carcinoma cells Int. [score:6]
miR-26b, miR-23b, miR-203, and miR-23a were significantly up-regulated in bladder cancers [32]. [score:4]
[1 to 20 of 3 sentences]
47
[+] score: 17
Our data shows the potential of miR-21-5p, miR23a-3p and miR-222-3p, and their target SOD2, as new biomarkers of post-MI HF. [score:3]
We observed a significantly increased expression of the 4 other miRNAs in LV, at 7 days post-MI for miR-23a-3p (Fig.   1D), at 2 months post-MI for miR-21-5p (Fig.   1D) and miR-21-3p (Fig.   1A) and at both times for miR-222-3p (Fig.   1D). [score:3]
Little is known about the role of miR-23a in cardiovascular diseases, with the exception of a correlation between miR-23a and pulmonary function of patients with idiopathic pulmonary hypertension [18]. [score:3]
Interestingly, SOD2 is regulated by 5 of 13 miRNAs selected by IPA, i. e. mir-21-3p, miR-21-5p, miR-23a-3p, miR-145-5p and miR-222-3p (Fig.   1A). [score:2]
The same information was found for the circulating levels of miR-21-5p (Fig.   3A, bottom panel) and miR-23a-3p (Fig.   3B, bottom panel). [score:1]
Here, we focused on 3 miRNAs, miR-21-5p, miR-23a-3p and miR-222-3p and their target SOD2, detected in plasma that we characterized for their potential as biomarkers of HF. [score:1]
Our studies based on in vivo rat experimental mo del and in vitro cardiomyocyte mo dels prompted us to assess levels of circulating SOD2 and interacting miRNAS (miR-21-5p, miR-23a-3p and miR-222-3p) in patients with high LV remo deling following MI. [score:1]
Interestingly, miR-21-5p, miR-23a-3p and miR-222-3p were significantly decreased in the plasma of 7 days MI-rats and significantly increased at 2 months post-MI (Fig.   1E) without any modulation of SOD2 in plasma of HF-rats (not shown). [score:1]
In this study, we showed for the first time, that levels of circulating miR-21-5p, miR-23a-3p and miR-222-3p decrease in patients with high remo deling at baseline and increase at 3 months post-MI. [score:1]
In our study, miR-23a-3p increased in LV of HF-rats only at 7 days post MI. [score:1]
[1 to 20 of 10 sentences]
48
[+] score: 17
Using miRNA microarray analysis, qRT-PCR, and bioinformatics, we identified and selected four downregulated miRNAs including hsa-miR-302a-3p and 27 upregulated miRNAs including hsa-miR-30a-5p, hsa-miR-23a-3p, hsa-miR-195a-5p, hsa-miR-99b-5p and hsa-let-7c-5p under these two conditions as having the potential to target genes involved in the regulation of autophagy (Table 2). [score:10]
0114779.g003 Figure 3Three kinds of human colon cancer cell lines, HT29 (A), DLD1 (B) and HCT116 (C), were treated as described in Fig. 2. qRT-PCR was performed to validate the alteration of the expression of hsa-miR-302a-3p, hsa-miR-548ah-5p, hsa-miR-30a-5p, hsa-miR-23-3p, hsa-miR-195a-5p and hsa-let-7c-5p under 5-FU treatment (5-FU) and starvation. [score:3]
Three kinds of human colon cancer cell lines, HT29 (A), DLD1 (B) and HCT116 (C), were treated as described in Fig. 2. qRT-PCR was performed to validate the alteration of the expression of hsa-miR-302a-3p, hsa-miR-548ah-5p, hsa-miR-30a-5p, hsa-miR-23-3p, hsa-miR-195a-5p and hsa-let-7c-5p under 5-FU treatment (5-FU) and starvation. [score:3]
In our experiment, hsa-let-7c-5p, hsa-miR-195-5p, hsa-miR-23a-3p, hsa-miR-15a-5p, hsa-miR-98-5p, and hsa-miR-181a-5p are predicted to target genes in the Bcl2 family and also warrant further investigation. [score:1]
[1 to 20 of 4 sentences]
49
[+] score: 15
FANCG was confirmed to be a target of miR-23a by ectopic overexpression or knockdown of miR-23a. [score:6]
The correlation between miR-23a overexpression and BN-chewing habit was also reported in oral cancer patients. [score:3]
Thus, BNE -induced miR-23a was correlated with a reduced FANCG expression and DNA double strand break (DSB) repair, which might contribute to BNE -associated human malignancies [91]. [score:3]
BNE -induced overexpression of miR-23a was found to be correlated with an increase of γ-H2AX, a DNA damage marker. [score:3]
[1 to 20 of 4 sentences]
50
[+] score: 15
Such filtering allowed the selection of four miRNAs: miR-181a-5p (liver expression  = 1233 au; 6 prediction algorithms), miR-23a-3p (liver expression  = 6052 au; 5 prediction algorithms), miR-16-5p (liver expression  = 3513 au; 4 prediction algorithms), and miR-195-5p (liver expression  = 3046 au; 4 prediction algorithms) (see Table 1 and Table S1). [score:9]
Commercial assays for miR-181a-5p, miR-23a-3p, miR-16-5p, miR-195-5p, miR-494, and U6 snRNA (endogenous reference control) (Life Technologies, Madrid, Spain) were used to quantify expression levels of miRNAs in human cell lines and/or hepatocytes. [score:2]
0111713.g002 Figure 2HepG2 cells were transfected with 100 nM mimic precursors miR-181a-5p (181a), miR-23a-3p (23a), miR-16-5p (16), miR-195-5p (195), miR-494 (494) or SCR. [score:1]
The predicted binding sites of miR-181a-5p, miR-23a-3p, miR-16-5p, and miR-195-5p are indicated in the F11 3′UTR (1,060 bp). [score:1]
Putative binding sites for miRNAs are shown in Figure 1. Whereas miR-181a-5p and miR-23a-3p bind to two closely located sites, miR-16-5p and miR-195-5p share the same binding site located ∼200 bp downstream of the miR-23a-3p seed (Figure 1). [score:1]
HepG2 cells were transfected with 100 nM mimic precursors miR-181a-5p (181a), miR-23a-3p (23a), miR-16-5p (16), miR-195-5p (195), miR-494 (494) or SCR. [score:1]
[1 to 20 of 6 sentences]
51
[+] score: 15
Other miRNAs from this paper: hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-187, hsa-mir-181a-1, hsa-mir-221, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-152, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-193a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-148b, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-454, ssa-mir-10a-1, ssa-mir-10a-2, ssa-mir-10b-1, ssa-mir-10b-2, ssa-mir-10b-3, ssa-mir-10b-4, ssa-mir-10d-1, ssa-mir-10d-2, ssa-mir-122-1, ssa-mir-122-2, ssa-mir-125b-1, ssa-mir-125b-2, ssa-mir-125b-3, ssa-mir-146a-1, ssa-mir-146a-2, ssa-mir-146a-3, ssa-mir-148a, ssa-mir-148b, ssa-mir-152, ssa-mir-16a-1, ssa-mir-16a-2, ssa-mir-181a-1, ssa-mir-181a-2, ssa-mir-181a-3, ssa-mir-181a-4, ssa-mir-181a-5, ssa-mir-181b, ssa-mir-181c, ssa-mir-192a-1, ssa-mir-192a-2, ssa-mir-192b, ssa-mir-193, ssa-mir-21a-1, ssa-mir-21a-2, ssa-mir-21b, ssa-mir-221, ssa-mir-23a-3, ssa-mir-23a-4, ssa-mir-23a-1, ssa-mir-23a-2, ssa-mir-25-1, ssa-mir-25-2, ssa-mir-25-3, ssa-mir-26a-1, ssa-mir-26a-2, ssa-mir-26a-3, ssa-mir-26a-4, ssa-mir-26a-5, ssa-mir-26a-6, ssa-mir-26b, ssa-mir-26d, ssa-mir-30a-3, ssa-mir-30a-4, ssa-mir-30a-1, ssa-mir-30a-2, ssa-mir-30b, ssa-mir-30c-1, ssa-mir-30c-2, ssa-mir-30d-1, ssa-mir-30d-2, ssa-mir-30e-1, ssa-mir-30e-2, ssa-mir-30e-3, ssa-mir-454, ssa-mir-462a, ssa-mir-92a-1, ssa-mir-92a-2, ssa-mir-92a-3, ssa-mir-92a-4, ssa-mir-92b
From day 2 of the exposure period to day 28, all but one of the examined miRNAs followed two distinct trends: one group of miRNAs was up-regulated (MiR10b-5p, MiR21a-3p, MiR23a-3p, MiR125b-1-3p, MiR221-3p), while the other group was down-regulated (MiR92b-3p, MiR122-5p, MiR122-2-3p, MiR152-5p). [score:7]
Several up-regulated (MiR21a-3p, MiR125b-1-3p, MiR23a-3p, MiR10b-5p, MiR221-3p) and down-regulated (MiR92b-3p, MiR152-5p, MiR122-2-3p or MiR122-5p) miRNAs shown in Fig 4A have been implicated in cirrhosis and hepatocellular carcinoma in humans [31]. [score:7]
Except MiR122-2-3p, MiR23a-3p, and MiR125b-1-3p after 28 days, qPCR analysis (Fig 6; left panel) of the samples from the 14th and the 28th day of the treatment showed high concordance with miRNA-Seq (Fig 6; right panel). [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 15
The increased abundance of miR-23a/b may therefore indicate a regulatory mechanism by which protein ingestion can promote increases in translation initiation, and in turn MPS, through reducing GSK-3β's inhibition of eIF2Bε. [score:6]
Bioinformatics analysis identified GSK-3β as a target of both miR-23 miRNAs. [score:3]
The array contained 13 common miRNAs previously shown in the literature to be regulated following resistance or endurance exercise, and amino acid ingestion in human skeletal muscle including hsa-miR-1, hsa-miR-9-3p, hsa-miR-16-5p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-miR-31-5p, hsa-miR-133a-3p, hsa-miR-133b, hsa-miR-181a-5p, hsa-miR-378a-5p, has-miR-451a, hsa-miR-486-5p, and hsa-miR-494-3p. [score:2]
There were increases in miR-23a and miR-23b abundance above rest at 4 h only in PRO (~38–90%; P < 0.05) that resulted in higher expression at 4 h with PRO compared to PLA (85–127%, P < 0.05; Figures 1B,C). [score:2]
Figure 1(A) mir-9-3p, (B) miR-23a-3p, (C) miR-23b-3p, and (D) miR-133b abundance at rest and at 4 h post-exercise recovery following a concurrent exercise session of resistance (8 sets of 5 leg extension at 80% 1-RM) and endurance (30 min cycling at 70% VO [2peak]) exercise and ingestion of either 500-mL PLA or PRO beverage immediately after exercise. [score:1]
Specifically, miR-23a and 23b were higher post-exercise with protein ingestion which supports previous reports of increased skeletal muscle miR-23a abundance following amino acid ingestion (Drummond et al., 2009). [score:1]
[1 to 20 of 6 sentences]
53
[+] score: 15
The top downregulated lung TIC -associated miRNAs include miR-23a, miR-130a, let-7 family, miR-513a-5p, miR-125b and miR-29a, whereas the top upregulated miRNAs include miR-1290, miR-130b, miR-1246, miR-630, miR-196a/b, miR-9/9* and miR-17∼92 cluster and its miR-106b∼25 analogues. [score:7]
Similarly, miR-23a and miR-130a were shown to be downregulated in chronic myeloid leukaemia 29, and miR-29a/b/c was frequently reduced in a variety of cancers that include lung cancer 30. [score:4]
More importantly, the comparative expression of other miRNA candidates such as miR-130b, miR-23a and miR-125b, which were initially found to be also enriched in TICs, did not provide strong evidence that they were restricted to tumours, whereas miR-1246 and miR-1290 did (Supplementary Fig. 1e). [score:3]
Taqman miRNA probes were as follow: hsa-miR-1246 (462575_mat), hsa-miR-1290 (002863), hsa-miR-130a (000454), hsa-miR-130b (000456), hsa-miR-196a (241070_mat), hsa-miR-196b (002215), hsa-miR-630 (001563), hsa-let-7b-5p (002619), hsa-let-7c (000379), hsa-let-7d-5p (002283), hsa-let-7i (002221), hsa-miR-106b (000442), hsa-miR-125b (000449), hsa-miR-23a (000399), hsa-miR-25 (000403), hsa-miR-320c (241053_mat), hsa-miR-3667-5p (462350_mat), hsa-513-5p (002090), hsa-miR-9* (002231). [score:1]
[1 to 20 of 4 sentences]
54
[+] score: 15
The top five differentially upregulated miRNAs in HCC (Table  5) were: miR-142 (1 million-fold), miR-7704 (257-fold), miR-101 (147-fold), miR-23a (124-fold), and miR-22 (85-fold); whereas, the top five downregulated were: miR-122 (513-fold), Let-7g (358-fold), miR-378c (187-fold), miR-185 (68-fold), and miR-451a (58-fold). [score:7]
miR-23a has been reported to downregulate expression of interferon regulatory factor-1 in HCC [34]. [score:7]
miR-150 (4-fold) was most strongly associated with eHCC, whereas, miR-142 (1-million fold), miR23a (124-fold), miR 130b (65-fold), piR-23670 (2335-fold), piR-24684 (2072-fold), circR-0021905, and snoRD121A were specifically altered in HCC. [score:1]
[1 to 20 of 3 sentences]
55
[+] score: 14
In our dataset, miR-23a was enriched in RPE cells, and its expression was significant increased during development, supporting the hypothesis that miR-23a expression is necessary for maintaining healthy RPE. [score:6]
Lin et al. discovered that miR-23a was down regulated in AMD eyes while upregulation of miR-23a can protect RPE cell from oxidative damage in ARPE19 cells [34]. [score:5]
C) RT-PCR analysis of different RPE differentiation stage showing miR-23a, miR125a, miR-125b, miR-302d and let-7g expression relative to H9 ESC stage. [score:3]
[1 to 20 of 3 sentences]
56
[+] score: 14
Wang N. Zhu M. Wang X. Tan H. Tsao S. Feng Y. Berberine -induced tumor suppressor p53 up-regulation gets involved in the regulatory network of MIR-23a in hepatocellular carcinomaBiochim. [score:7]
These studies on medicinal plants and miRNAs in various cancers have given rise of new cancer therapies, for example, the up-regulation of miR-23a expression may regulate p53 involved in hepatocellular carcinoma (HCC) [47]. [score:7]
[1 to 20 of 2 sentences]
57
[+] score: 14
Other miRNAs from this paper: hsa-mir-195
Factor Pathway Reference Activators BMP2,4 SMAD1,4(18) Retinoic acid RAR/RXR(24, 30) Estrogen Estrogen ERE(12– 14, 31) Inhibitors BMP6 SMAD6(32) ZNF521 Promoter repression(33) ZNF423 Autoregulatory(34) miR-195a 3′UTR(35) bta-miR23a 3′UTR(36) Neurofibromin 1 RAS/MEK(37) WISP WNT bone morphogenic protein (BMP)/SMAD(38) PCR2 H3K27methylation(39) Epigenetic CpG island methylation(40) Co-interacting Early B cell factor Transactivation(17, 41, 42) SMAD1/4 BMP(18) RAR/RXR Retinoids(24, 30) Notch (notch intracellular cytoplasmic domain) Notch(43) Targets Poly(ADP-ribose) polymerase 1 BMP/SMAD(44) Xvent BMP/SMAD(18) SMAD6 BMP/SMAD(32) Hes5 Notch(43) TULP3 Sonic Hedgehog(45) Peroxisome proliferator activated receptor-γ Adipogenesis(46– 48) BRCA1 Estrogen(12– 14, 31) Degradation CTSO Estrogen(13) In neural development, there is considerable evidence supporting a role for ZNF423 in midline patterning of the central nervous system; consistently, homozygous zfp423 deletion pups were found to be ataxic and having defects in the cerebellum, forebrain, and olfactory bulb, which could be attributed to a Purkinje cell intrinsic defect (49– 53). [score:7]
Additionally, microRNA profiling in fetal bovine skeletal muscle has recently identified bta-miR23a as an anti-adipogenic regulatory factor in intramuscular adipogenic commitment acting by targeting ZNF423 (36). [score:4]
Additionally, the 3′UTR of the ZNF423 mRNA contains sites for miR195 (35, 53) and miR23a (36), which control expression. [score:3]
[1 to 20 of 3 sentences]
58
[+] score: 13
Significant differences between the GCK-MODY, type 1 diabetes and control groups were less numerous, with miR-24 showing higher expression in controls than in patients with type 1 diabetes (adjusted p = 0.0060); miR-24, along with miR-23a, miR-145 and miR-99b, also showed significantly lower expression levels in GCK-MODY than in controls (p = 0.0011, p = 0.0103, p = 0.0042 and p = 0.0236, respectively). [score:5]
Among the 11 differentially expressed miRNAs (significant in ANOVA), eight differed significantly between HNF1B-MODY and at least one of the other groups (miR-32, miR-223, miR-23a, miR-199a, miR-27b, miR-24, miR-145 and miR-423; ESM Table 3). [score:3]
Expression levels of: (c) miR-24 ΔC [t]; (d) miR-223 ΔC [t]; (e) miR-27b ΔC [t]; (f) miR-199a ΔC [t]; (g) miR-32 ΔC [t]; (h) miR-23a ΔC [t]; (i) miR-423 ΔC [t]; (j) miR-145 ΔC [t]. [score:3]
Significance criterion was met by 11 distinct miRNAs: miR-223, miR-24, miR-99b, miR-423, miR-92a, miR-27b, miR-23a, miR-199a, miR-101, miR-145 and miR-32; these are presented on a hierarchical cluster heatmap in Fig.   1b. [score:1]
miR-24, miR-223, miR-23 and miR-199a show 100% conservation of seed region sequences between humans and mice [23]. [score:1]
[1 to 20 of 5 sentences]
59
[+] score: 13
MiR-23a, whose expression was recently found to be transactivated by CREB through its binding to miR-23a regulatory sequences, targets and suppresses PTEN expression, leading to hyperactivation of PI3K-Akt signaling [132]. [score:10]
Tan X. Wang S. Zhu L. Wu C. Yin B. Zhao J. Yuan J. Qiang B. Peng X. cAMP response element -binding protein promotes gliomagenesis by modulating the expression of oncogenic microRNA-23a Proc. [score:3]
[1 to 20 of 2 sentences]
60
[+] score: 13
Expression of precursor and mature miRNA of differentially expressed cellular miRNAs (A) miR-489, -630 in HOK and (B) miR-23a, -33a, -155, -489, and 943 in Mφ were determined by RT-qPCR. [score:5]
The expression pattern of miR-23a and miR-33 exhibited an antagonistic relationship. [score:3]
To address this, expression of mature and pre-miRs of miR-489 and miR-630 (from HOK) and miR-23a, miR-33a, miR-155, miR-489, and miR-943 (from Mφ) was examined. [score:3]
However, pre- and mature miRNAs levels of miR-23a and miR-33a did not corroborate. [score:1]
However, pre-miR-23a induction is significant only in the presence of miR-K12-3-3p (Figure 4B; lower panel). [score:1]
[1 to 20 of 5 sentences]
61
[+] score: 13
Inhibition of miR-23/27 effectively suppresses the development of retinal vasculature and is protective against laser -induced CNV in mice [53]. [score:6]
miR-23/27 directly target Sprouty2 and Sema6A, negative regulators of angiogenesis. [score:5]
The miR-23/27/24 clusters have also been implicated in regulating angiogenesis and choroidal neovascularization (CNV). [score:2]
[1 to 20 of 3 sentences]
62
[+] score: 12
The expression levels of miR-17-5p, miR-593, miR-23a-5p, miR-586, miR-1180, miR-508-5p, miR-511, miR-646, miR-634, miR-149-5p, miR-24-3p, miR-1267, miR-504 and miR-1270 were upregulated (Fig. 2A) (P<0.05). [score:6]
The expression levels of miR-17-5p, miR-593, miR-23a-5p, miR-586, miR-1180, miR-508-5p, miR-511, miR-646, miR-634, miR-149-5p, miR-24-3p, miR-1267, miR-504 and miR-1270 were upregulated. [score:6]
[1 to 20 of 2 sentences]
63
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Among miRNAs that were upregulated in plasma was miR23a, which has been confirmed to be of great importance in regulation of apoptosis in ovarian granulosa cells via decreasing X-linked inhibitor of apoptosis protein (XIAP) expression [57]. [score:9]
Further functional analysis in primary granulosa cell cultures revealed that BCL2 and CYP19A1 mRNA levels were decreased when miR23a is overexpressed. [score:3]
[1 to 20 of 2 sentences]
64
[+] score: 12
miR-23a repression was proposed to indirectly suppress TGF-β signaling and contribute to disease persistence [18]. [score:6]
Downregulation of miR-23a was seen in other studies as well. [score:4]
miR-23a was identified to be a regulator of Nedd4L, a ubiquitin ligase [18]. [score:2]
[1 to 20 of 3 sentences]
65
[+] score: 12
Examples are miR-15a and miR-16-1 (targeting MYB mRNA), miR-486-3p (targeting BCL11A mRNA), miR-23a (targeting KLF-2) and miR-27a (targeting Sp1). [score:9]
The identification of microRNAs targeting mRNAs coding for these repressors (data are available for microRNAs miR-15a, miR-16-1, miR-486-3p, miR-23a/27a) [33, 34, 35], could be useful to develop novel approaches for the treatment of β-thalassemia [36]. [score:3]
[1 to 20 of 2 sentences]
66
[+] score: 12
In summary, several previously known downregulated “tumor suppressor miRNAs” in malignant tumors, such as let-7d, miR-451, miR-23a, and miR-29 were found to be upregulated in schwannomas. [score:9]
In human malignant prostate cancers, miR-23a and miR-23b were shown to be downregulated compared to normal prostate tissues [29]. [score:3]
[1 to 20 of 2 sentences]
67
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Upregulation of miR-23a approximately 27a approximately 24 decreases transforming growth factor-beta -induced tumor-suppressive activities in human hepatocellular carcinoma cells. [score:6]
Microarray profiling studies showed reduction in miRNAs expression specific of HCV and HBV -associated cases: down-regulation of miR-190, miR-134, and miR-151 occurs in HCV cases, and of miR-23a, miR-142-5p, miR-34c, in HBV cases (Ura et al., 2009). [score:6]
[1 to 20 of 2 sentences]
68
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Moreover, GC patients with over -expression of miR-107 [28, 29, 30], miR-143 [40], miR-145 [41, 42], miR-181b/c [17, 47, 48, 55, 56], miR-196a/b [59], miR-20b [23, 66], miR-23a/b [77, 78, 79], miR-34 [17, 47, 48, 55, 56] and miR-630 [100] and decreased expression of miR-1 [111], miR-1207-5p [121], miR-125a-3p/-5p [24, 125, 126, 127], miR-185 [140], miR-193b [60], miR-20a [111], miR-206 [150, 151], miR-215 [142], miR-217 [153], miR-27a [111], miR-29c [169], miR-34a [172, 173], miR-423-5p [111], and miR-520d-3p [99] indicate advanced tumor stage or TNM stage. [score:5]
Ma G. Dai W. Sang A. Yang X. Gao C. Upregulation of microRNA-23a/b promotes tumor progression and confers poor prognosis in patients with gastric cancer Int. [score:4]
Another oncomiR, miR-23a, was shown to significantly promote GC cell proliferation by silencing its target, the interleukin (IL)-6 receptor (IL6R) [77, 78, 79]. [score:3]
[1 to 20 of 3 sentences]
69
[+] score: 12
Up-regulated miRNAs (cfa-let-7, cfa-miR-200, cfa-miR-125, cfa-miR-34, cfa-miR-23, cfa-miR-146 clusters, cfa-miR-184 and cfa-miR-214) in adult canine testis treated with DMSO, RA or CYP26B1 inhibitor. [score:6]
MiRNA families such as miR-200 (cfa-miR-200a, cfa-miR-200b and cfa-miR-200c), Mirlet-7 (cfa-let-7a, cfa-let-7b, cfa-let-7c, cfa-let-7g and cfa-let-7f), miR-125 (cfa-miR-125a and cfa-miR-125b), miR-146 (cfa-miR-146a and cfa-miR-146b), miR-34 (cfa-miR-34a, cfa-miR-34b and cfa-miR-34c), miR-23 (cfa-miR-23a and cfa-miR-23b), cfa-miR-184, cfa-miR-214 and cfa-miR-141 were significantly up-regulated with testicular RA intervention via administration of CYP26B1 inhibitor and all-trans-RA (Figure 5). [score:6]
[1 to 20 of 2 sentences]
70
[+] score: 12
The only discrepancy between RT-PCR and microarray analysis data was referred to miR-23a expression: this miRNA, in fact, did not show a significantly differential expression among the four B cell subsets by microarray analysis but it did show a significant upregulation by RT-PCR (P = 0.002) in CD5 [−] activated B cells compared to the other B cell subsets. [score:7]
We validated our microrray results by quantitative RT-PCR on CD5 [+], GC and CD5 [−] activated and resting B cell mRNA samples as shown in Supplementary Figure 3. In fact, we validated 10 different miRNAs: mir-150, mir-20b, mir-23a, mir-211, mir-15b, mir-21, mir-106a, mir-146a, mir-9* and mir-155 whose expression trends by quantitative RT-PCR highlighted the same expression trend shown by microarray analysis. [score:5]
[1 to 20 of 2 sentences]
71
[+] score: 11
We now demonstrate that the miR-23∼24∼27 cluster is up-regulated in CD8 [+]CD28 [−] T cells. [score:4]
This miRNA cluster, miR-23∼24∼27, has been shown to target molecules important for DNA repair (Lal et al., 2009; Srivastava et al., 2011). [score:3]
The second miRNA cluster, which is differentially expressed in CD8 [+]CD28 [−] T cells, is the miR-23∼24∼27 cluster. [score:3]
These miRNA clusters are miR-17∼92 and miR-23∼24∼27, the members of which are cleaved out of a polycistronic pri-miRNA-variant. [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 11
We found 12 miRNAs (hsa-miR-21, hsa-miR-23a, hsa-miR-23b, hsa-miR-24, hsa-miR-27a, hsa-miR-29a, hsa-miR-31, hsa-miR-100, hsa-miR-193a, hsa-miR-221, hsa-miR-222 and hsa-let-7i) that were consistently up-regulated in the senescent cells of all donors (Fig. 1A), whereas only three miRNAs of the 17–92 cluster were down-regulated (Fig. 1A). [score:7]
We identified 12 miRNAs to be up-regulated in senescence, comprising hsa-miR-23a, hsa-miR-23b, hsa-miR-24, hsa-miR-27a, hsa-miR-29a, hsa-miR-31, hsa-miR-100, hsa-miR-193a, hsa-miR-221, hsa-miR-222 and hsa-let-7i. [score:4]
[1 to 20 of 2 sentences]
73
[+] score: 11
According to a more recent study, Smad3 is also directly targeted by miRNA-23a-3p, of which expression in OA cartilage is elevated due to CpG island promoter hypomethylation. [score:6]
Kang L. Yang C. Song Y. Liu W. Wang K. Li S. Zhang Y. MicroRNA-23a-3p promotes the development of osteoarthritis by directly targeting SMAD3 in chondrocytes Biochem. [score:4]
The net result of this miRNA-23a-3p/Smad3 -dependent pathway is the decreased type II collagen/aggrecan content of the cartilage extracellular matrix in OA [109]. [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 11
Other miRNAs from this paper: mmu-mir-23b, hsa-mir-23b, mmu-mir-23a, hsa-mir-23c
Translational suppression of atrophic regulators by microRNA-23a integrates resistance to skeletal muscle atrophy. [score:6]
For example, it has been previously shown that miR-23 a suppresses the translation of both MAFbx/atrogin-1 and MuRF-1 in a 3_-UTR -dependent manner (Wada et al., 2011). [score:5]
[1 to 20 of 2 sentences]
75
[+] score: 11
For example, miR-106b, miR-107, miR-130a, miR-34 [9], miR-93, miR-155, miR-181a, miR-21, miR-23a, miR-320a [8], miR-193b, miR-320b [13] are significantly up-regulated and miR-148a [11, 14], miR-330-5p [15], miR-373 [16] significantly down-regulated. [score:7]
Interestingly, most of these miRNAs are coincident with those appearing in Table 1 (miR-374b, miR-148a, miR-181a, miR-373, miR-320a, miR-93, miR-106b, miR-497, miR-23a, miR-19b, miR-107, miR-15a, miR-330-5p, miR-144), indicating that, apart from being targeting many mRNAs, these miRNAs are participating in the most reliable interactions. [score:3]
These miRNA-mRNA interactions are miR-106b-LRRC55, miR-21-PDCD4, miR-148a-YWHAB, miR-93-FAM129A, miR-330-5p-GPI, miR-330-5p-BHLHE40, miR-93-LRIG1, miR-23a-LRIG1, miR-148a-ARF4, miR-106b-FAM129A, miR-148a-ACVR1, miR-148a-CTTNBP2NL. [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 11
Among adult liver-enriched miRNAs, we confirmed a statistically-significant downregulation of transcripts that have predicted binding sites for the let-7/98, miR-22 and miR-23 seeds, which correspond to the miRNAs identified previously as expressed higher in the adult liver than in the embryo: let-7a, let-7b, let-7c, miR-22, and miR-23b. [score:6]
We observe that this score increases when targets of let-7/98 and miR-23 and miR-22 are considered together, suggesting that many genes are downregulated in the adult by the combined repression of several miRNA species. [score:5]
[1 to 20 of 2 sentences]
77
[+] score: 11
However, other predicted miRNAs that also target the 3′UTR of il12A and il12B, including miR-590-5p, miR-340-5p, miR-23a, miR-23c and miR-494-3p, were not involved in the inhibition of IL-12 production in Omp25 -expressing THP-1 cells. [score:7]
In total, seven miRNA–mRNA target duplexes were predicted by these algorithms (Figure S3 in), including miR-590-5p, miR-21-5p, miR-340-5p, miR-23a, miR-23b, miR-23c, and miR-494-3p. [score:3]
Blocking of PD-1 signaling decreased miR-155, miR-21-5p and miR-23 levels and enhanced IL-12 production. [score:1]
[1 to 20 of 3 sentences]
78
[+] score: 11
Our 2011 study [46] was the first to show that miR-23 is downregulated in human AMD eyes and its putative protective effect is mediated by downregulation of the Fas ligand. [score:7]
We previously reported that miR-23 enhances RPE cell resistance to oxidative stress damage and is downregulated in macular RPE cells from AMD patients [46]. [score:4]
[1 to 20 of 2 sentences]
79
[+] score: 11
Lee et al. reported the first direct evidence from an experiment on a single polycistronic microRNA gene, mir-23a∼27a∼24–2, showing that it can be transcribed by pol II [20]. [score:2]
Additionally, the experimentally identified promoter regions of two H. sapiens microRNA genes, hsa-mir-23a∼27a∼24–2 [20] and hsa-mir-371∼372∼373 [21], contain CT repeats. [score:1]
For H. sapiens, only the promoters of two microRNA genes, hsa-mir23a∼27a∼24–2 [20] and hsa-mir-371∼372∼373 [21], have been identified so far. [score:1]
However, their results, especially those on the promoter of mir-23a∼27a∼24–2, do not match very well with our knowledge of pol II promoters. [score:1]
This is consistent with the previous study on a polycistronic H. sapiens microRNA gene, mir-23a∼27a∼24–2 [20], and the report on some A. thaliana microRNA genes [22]. [score:1]
Lee et al. located the promoter of mir-23a∼27a∼24–2; however, none of the canonical promoter elements were discovered in this promoter [20]. [score:1]
The −56 to −34 upstream region of has-mir-23a∼27a∼24–2 is CTCTCTCTCTCTTTCTCCCCTCC [20]. [score:1]
The promoter of hsa-mir-23a∼27a∼24–2 has been located by biological experiments [20], while the promoter of hsa-mir-371∼372∼373 [21] has been identified by a comparative genomic analysis. [score:1]
Specifically, the promoter of mir-23a∼27a∼24–2 appears to lack the known common promoter elements required for initiating transcription, such as the TATA-box, initiator element, downstream promoter element (DPE), TFIIB recognition element (BRE) [20], or the proximal sequence element (PSE). [score:1]
In addition, the promoters of two microRNA genes in H. sapiens, hsa-mir-23a∼27a∼24–2, and hsa-mir-371∼372∼373, reported in [21, 20], were also correctly predicted in our analysis. [score:1]
[1 to 20 of 10 sentences]
80
[+] score: 11
A. Expression of miR-21 and miR-23a, B. Expression of miR-30b and miR-130a, C. Expression of miR-133b and miR-191, D. Expression of miR-204 and miR-208b. [score:9]
We choose the following miRNAs for validation:MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
We choose the following miRNAs for validation: MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
[1 to 20 of 3 sentences]
81
[+] score: 10
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-182, hsa-mir-141
Constitutively active GSK3β S [9]A mutant increases Drosha cleavage activity and enhances MiR biogenesisTo provide further evidence for the importance of GSK3β activity for miR maturation, converse experiments were performed using a vector expressing constitutively active GSK3β: GSK3β-S [9]A. Transfection of GSK3-S [9]A into HEK293T significantly increased levels of mature miR-27a, miR-23a, miR-24, miR-141 and miR-182 by up to 7.5-fold (Figure 2A), with similar effects also observed in HeLa cells (Supplementary Figure S2A). [score:3]
To provide further evidence for the importance of GSK3β activity for miR maturation, converse experiments were performed using a vector expressing constitutively active GSK3β: GSK3β-S [9]A. Transfection of GSK3-S [9]A into HEK293T significantly increased levels of mature miR-27a, miR-23a, miR-24, miR-141 and miR-182 by up to 7.5-fold (Figure 2A), with similar effects also observed in HeLa cells (Supplementary Figure S2A). [score:3]
No significant difference in pri-miRs levels was observed between Flag-Drosha WT and S [300]E,S [302]D -transfected cells (Figure 6F), and whilst levels of miR-27a and −182 were not significantly altered in the presence of phospho -mimic Drosha (Figure 6Gii,iv), miR-23a and miR-141 levels were significantly increased in the presence of the S [300]E,S [302]D construct (Figure 6Gi,iii). [score:1]
Pre-miR bands were observed in alignment with the 60 nt RNA marker (Figure 2E and Supplementary Figure S3), which is consistent with expected pre-miR-23a, −27a and −24 sizes of 57 nt, 62 nt and 59 nt, respectively. [score:1]
To assess the functional effects of phospho-Drosha on mature and pri-miRs, HEK293T cells were transfected with Flag-Drosha WT or S [300]E,S [302]D phospho -mimic and qPCR performed for pri-miR-23a27a24-2 and −141/200c, and miR-23a, −27a, −141 and −182. [score:1]
Figure 2. GSK3β activation enhances MiR biogenesis and GSK3β modulation alters pre-miR synthesis (A) qRT-PCR analysis of miR-27a, miR-23a, miR-24, miR-141 and miR-182 levels in HEK293T cells transfected with pMT23-HA-GSK3β(S [9]A) for 48 h. U18 was used as a normalisation gene. [score:1]
[1 to 20 of 6 sentences]
82
[+] score: 10
After determining the expression levels of these miRNAs in the same 7 pairs of NSCLC tissues and normal adjacent tissues, we observed that 8 miRNAs (miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101 and miR-9) were downregulated in the NSCLC tissues, while the other 5 miRNAs (miR-125, miR-98, miR-196, miR-23 and miR-499) were upregulated (Fig. S1). [score:9]
A total of 13 miRNAs, including miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101, miR-9, miR-125, miR-98, miR-196, miR-23 and miR-499, were identified as candidate miRNAs by all three computational algorithms (Table S2). [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 10
Neutrophils also expressed high levels of the miR23a-27a-24 cluster which has been reported to be anti-apoptotic, with miR-27a targeting the activity of caspase-3 [48]. [score:5]
Expression levels are shown for the following clusters: A) miR-17-92, B) miR-106b-25, C) miR-23a-27a-24, D) miR-16-1 and miR-15b, E) let-7a-1 and let-7a-3, F) miR-29a and miR-29c, G) miR-181a and H) miR-181c. [score:3]
We also found the miR23a-27a-24 cluster, which has been reported to regulate both caspase -dependent and independent apoptosis [41] (Figure 3c). [score:2]
[1 to 20 of 3 sentences]
84
[+] score: 10
Four-hundred thirty-nine samples had values between 5.0 and 6.99, 9 samples did not express miR451, 24 samples did not expressed miR-23a and 88 samples did not expressed either miRNA. [score:7]
For miR-23a-miR-451, increased delta quantification cyle (Cq) values <5 would suggest little or no haemolysis and >7 would be indicative of significant haemolysis. [score:1]
For our samples, the delta Cq value of miR-23a and miR-451 were <5.0 in 2,179 out of 2,763 samples. [score:1]
This assumption is based on a previous report showing that miR-23a is relatively stable in plasma and not affected by haemolysis 12. [score:1]
[1 to 20 of 4 sentences]
85
[+] score: 10
miR-23a was initially identified as a regulator of lamin B1, an inhibitor of myelin gene expression (Lin and Fu, 2009). [score:6]
miR-23 regulation of lamin B1 is crucial for oligodendrocyte development and myelination. [score:3]
miR-219, -338, -138. miR-23a. [score:1]
[1 to 20 of 3 sentences]
86
[+] score: 10
Figure 1The miRNA levels are expressed as the ratio of the estimated amount of the target gene relative to the miR-23a levels [24]. [score:5]
The miRNA levels are expressed as the ratio of the estimated amount of the target gene relative to the miR-23a levels [24]. [score:5]
[1 to 20 of 2 sentences]
87
[+] score: 9
Among the most down-regulated miRNAs were the hypoxia -induced miR-210 [43], the Myc down-regulated miR-23a [44], the hematological differentiation inducing miR-150 (reviewed in [45]) and the possible tumor suppressor miR-149 [46]. [score:9]
[1 to 20 of 1 sentences]
88
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
This spatial pattern of expression closely mirrors that of miR-23a, miR-143, and miR-150, all of which putatively target the Hoxa11 mRNA. [score:5]
For instance, among the 66 uniformly expressed miRNAs for which IPA assigned functions, we identified 12 candidates that have been implicated in androgen regulation, including: let-7a-5p, miR-15a-5p, miR-17-5p, miR-19b-3p, miR-23a-3p, miR-24-3p, miR-27b-3p, miR-30a-5p, miR-34a-5p, miR-140-5p, miR-193a-3p, miR-205-5p (S1 Fig). [score:4]
[1 to 20 of 2 sentences]
89
[+] score: 9
Other miRNAs from this paper: hsa-mir-23b, hsa-mir-23c
In normoxia, c-Myc activation enhances the expression of some glycolytic genes such as HK2, PFK-M, ENO1 [159] and LDH-A [160], and is able to confer glutamine addiction by directly up -regulating the glutamine transporters ASCT2 and SLC7A25 and indirectly up -regulating enzyme glutaminase (GLS) through the inhibition of miR-23 [161]. [score:9]
[1 to 20 of 1 sentences]
90
[+] score: 9
Similar inhibitory mechanisms (targeting MDV in this case) have been reported for miR-23, miR-378, and miR-505 (133). [score:5]
Conversely, increased replication of ALV-J was associated with the upregulation of miR-23 in the spleen of ALV-J-infected chickens. [score:4]
[1 to 20 of 2 sentences]
91
[+] score: 9
Another potential insight into the biological mechanisms related to KITLG methylation comes from our co -expression network analyses showing that KITLG is part of a gene network enriched for genes regulated by miRNAs 449 (miR449), 23A/23B (miR23A/miR23B) and 9 (miR9). [score:4]
With the webGestalt tool, we found that the 21-gene network around KITLG is a preferred target for three miRNAs: miR449 (genes COL12A1, SHKBP1 and KITLG FDR [hypergeometric] (FDR, false discovery rate)=0.0012), miR23A/miR23B (genes EYA1, HMGN2 and KITLG FDR [hypergeometric]=0.0018) and miR9 (genes COL12A1, CCDC43 and KITLG FDR [hypergeometric]=0.0019; Supplementary Table 3). [score:3]
The entire red module (containing 9,494 of 19,815 genes) was enriched for genes related to these three miRNAs (miR449 Fisher's exact test, odds ratio (OR)=1.4, P=0.0015, FDR=0.009, miR23A/miR23B Fisher's exact test, OR=1.4, P=7.3 × 10 [−6], FDR=9.8 × 10 [−5] and miR9 Fisher's exact test, OR=1.3, P=9.5 × 10 [−5], FDR=0.0006). [score:1]
Several other methylation modules were also enriched for these miRNAs (10 modules enriched for miR449 Fisher's exact test FDR<0.05; 19 modules enriched for miR23A/miR23B Fisher's exact test FDR<0.05 and 20 modules enriched for miR9 Fisher's exact test FDR<0.05; Supplementary Table 4–6). [score:1]
[1 to 20 of 4 sentences]
92
[+] score: 9
Suppression of miR-23a blocked binding of TP53 to the chromatin and blocked transcriptional activation of p21 [Cip1] and GADD45alpha. [score:3]
BBR activates TP53 which increases the expression of miR-23a in HCC. [score:3]
BBR induced miR-23a may suppress never in mitosis A (NIMA) kinase 6 (NEK6) and result in block of cell cycle in G [2]/M [268]. [score:3]
[1 to 20 of 3 sentences]
93
[+] score: 9
In comparison with uninfected reads, highly expressed aae-mir-23, aae-mir-576 and aae-mir-320 were upregulated in CHIKV-infected Ae. [score:6]
Figures a) aae-miR-249 b) aae-miR-23 c) aal-miR-43b and d) aal-miR-5 show the predicted stem-loop structures, star and mature sequences of highly expressed novel microRNAs in Ae. [score:3]
[1 to 20 of 2 sentences]
94
[+] score: 9
In accordance to being upregulated intracellularly in senescent fibroblasts [51, 52] we found miR-23a-5p and miR-137 to be more abundant per vesicle. [score:4]
3 weeks after induction of senescence (D21), 321 (85%) miRNAs were confirmed to be differentially secreted and miR-23a-5p reached the highest level (Fig. S2C), while none were downregulated significantly at both time points (Supplementary List S2). [score:4]
Surprisingly, out of these, only two miRNAs (miR-23a-5p, miR-137) were more abundant in sEVs at both time points (Fig. 5C), while five miRNAs (miR-17-3p, miR-625-3p, miR-766-3p, miR-199b-5p, miR-381-3p) were less abundant in sEVs of senescent cells (Fig. 5D). [score:1]
[1 to 20 of 3 sentences]
95
[+] score: 9
miR-31, miR-150 and miR-184 have shown to be downregulated in oxygen -induced retinopathy mice mo dels [20]; miR-23~24~27 cluster was upregulated in laser induced CNV mice mo dels [21]. [score:7]
Zhou Q. Gallagher R. Ufret-Vincenty R. Li X. Olson E. N. Wang S. Regulation of angiogenesis and choroidal neovascularization by members of microRNA-23∼27∼24 clusters Proc. [score:2]
[1 to 20 of 2 sentences]
96
[+] score: 9
The miRNAs that exhibited at least a 2-fold change in expression in the hADSCs before and after the induction of chondrogenic differentiation are listed in Table I, and these include 12 upregulated miRNAs (miR-196a, miR-143, miR-383, miR-193b, let-7i, miR-26a, miR-539, miR-199a-3p, miR-337-5p, miR-146a-5p, miR-646, and miR-381) and 8 downregulated miRNAs (miR-490-5p, miR-1307, miR-125b, miR-96-3p, miR-302-3p, miR-23a-3p, miR-590, and miR-510). [score:9]
[1 to 20 of 1 sentences]
97
[+] score: 9
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-205, hsa-mir-214, hsa-mir-221, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-184, hsa-mir-193a, hsa-mir-1-1, hsa-mir-29c, hsa-mir-133b, dre-mir-205, dre-mir-214, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-1-2, dre-mir-1-1, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-107a, dre-mir-122, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-184-1, dre-mir-193a-1, dre-mir-193a-2, dre-mir-202, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-202, hsa-mir-499a, dre-mir-184-2, dre-mir-499, dre-mir-724, dre-mir-725, dre-mir-107b, dre-mir-2189, hsa-mir-499b, dre-mir-29b3
Interestingly, several VTGs are targets of miRNAs for silencing [119]: VTG-3 is targeted by miR-122, the most abundant miRNA in the liver, as well as miR-107, VTG-7 by miR-107, VTG-2 by miR-214 and VTG-6 by miR-23a, highlighting the importance that miRNAs have on vitellogenesis, oocyte maturation and reproduction. [score:5]
Another endocrine disruptor, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), has been shown to change the expression of several miRNAs in zebrafish embryos (miR-23a, 23b, 24, 27e and 451) that are critical for hematopoiesis and cardiovascular development [133]. [score:4]
[1 to 20 of 2 sentences]
98
[+] score: 9
Specifically, tumor suppressor miRNAs, such as miR-23a, miR-26a/b, miR-29a/b and miR-101a, were found upregulated, whereas oncogenic miRNAs, like miR-7a and members of the miR cluster 17∼92, were downregulated [34]. [score:9]
[1 to 20 of 1 sentences]
99
[+] score: 9
The 6 upregulated miRNAs (mmu-miR-5132-5p, mmu-miR-3104-5p, mmu-miR-669c-5p, mmu-miR-705, mmu-miR-760-3p, mmu-miR-1962) and the 9 downregulated miRNAs (mmu-miR-146a, mmu-miR-138, mmu-miR-5123, mmu-miR-196b, mmu-miR-5099, mmu-miR-150, mmu-miR-145, mmu-miR-27a, mmu-miR-23a) chosen for validation were also based on their target genes predicted, whose functions are well relevant to inflammation and cancer. [score:9]
[1 to 20 of 1 sentences]
100
[+] score: 9
Other miRNAs from this paper: mmu-mir-23a
Recent studies have highlighted that TGF-β mediates the immunosuppression of CD8 [+] T cells by elevating miR-23a and downregulating Blimp-1, or by upregulating Foxp1 [32– 34]. [score:9]
[1 to 20 of 1 sentences]