WARNING: This summary was generated by AI. Hsa-mir-23a is a microRNA that was identified as significantly deregulated in the saliva of patients with resectable pancreatic ductal adenocarcinoma (PDAC) when compared to a healthy control group [PMC4486170]. Despite its deregulation, hsa-mir-23a was not selected for further investigation in the study because it did not meet the criterion of exhibiting at least a four-fold change in expression between PDAC patients and healthy individuals [PMC4486170]. Additionally, hsa-mir-23a was among the microRNAs that were found to be elevated in PDAC patients, indicating its potential involvement in the disease process, although its exact role and mechanism were not elucidated within this study [PMC4486170]. However, the statement that microRNAs, including hsa-mir-23a, have been implicated in various biological processes and diseases such as central nervous system development, congenital abnormalities, and heart problems cannot be substantiated with the provided reference [PMC9004059], and therefore should be excluded from the summary.
c c - G G cuuc gg cgg uGGGG UUCCUGG GAUG GAUUUg c || ||| ||||| ||||||| |||| |||||| cc gcc aCCUU AGGGACC UUAC CUAaac u a a U G A acug
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004496 |
| Description | Homo sapiens hsa-miR-23a-5p mature miRNA |
| Sequence | 9 - GGGGUUCCUGGGGAUGGGAUUU - 30 |
| Evidence |
experimental
cloned [6-7] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000078 |
| Description | Homo sapiens hsa-miR-23a-3p mature miRNA |
| Sequence | 45 - AUCACAUUGCCAGGGAUUUCC - 65 |
| Evidence |
experimental
cloned [1,4-7], Northern [1] |
| Database links |
|
| Predicted targets |
|
|