sort by

380 publications mentioning hsa-mir-27a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-27a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 509
Next, we analysed 721 substantially >1.33-fold up-regulated and 689 substantially <0.75 down-regulated genes (listed in table S1) after miR-27 over -expression with the online gene expression analysis tool “DAVID” in order to identify pathways regulated by miR-27. [score:12]
We also compared the number of genes down-regulated after miR-27 over -expression with miR-27 target genes predicted by Targetscan human V6.2 (Figure 5D). [score:9]
In the case of miR-27 over -expression, it is obvious that many pluripotency -associated genes were slightly or strongly down-regulated, whereas genes which promote differentiation were mainly up-regulated (Figure 5B). [score:9]
Our transcriptome analysis revealed that over -expression of miR-27 in human embryonal carcinoma cells leads to down-regulation of pluripotency -associated genes, such as GDF3, LIN28, TRIM71, DNMT3A, DNMT3B and USP46 and an activated expression of developmental genes such as SMAD6, BMP2, FST and HAND1 (Figure 5C). [score:9]
NANOG, a downstream target of activated SMAD2/3, has been predicted to be a miR-128 target, but not a miR-27 target gene, by TargetScan. [score:9]
In summary, we have demonstrated Over expression of miR-27 in hEC leads to a down-regulation of OCT4 and LIN28 on the transcriptional and translational level. [score:8]
Finally, we have shown that over -expression of miR-27 in hEC leads to a dramatic reduction in expression of OCT4 mRNA and protein (Figure 4C+D+E) but, as shown with the eGFP-sensor approach, OCT4 is not a direct target gene of miR-27 (Figure 2B). [score:8]
In summary, we have demonstrated Over expression of miR-27 in hEC leads to a down-regulation of OCT4 and LIN28 on the transcriptional and translational level. [score:8]
control mimic) or treated with the TGFßR2 inhibitor SB431542 (B) Heat map representing the expression of selected genes relative to the negative control transfection (Detection P-Value <0.01) (C) Venn diagrams representing the overlap of up- and down-regulated genes by let-7 and miR-27 (Detection P-Value <0.01) in comparison to the negative control transfection. [score:8]
The fact that loss of OCT4 induces activation of miR-27 expression in hES and that miR-27 over -expression results in reduced OCT4 expression in hEC, might imply that OCT4 and miR-27 form an indirect negative feedback loop but OCT4 rather than miR-27, is required for the maintenance of self-renewal in pluripotent stem cells [41] as depicted in Figure 6. 10.1371/journal. [score:8]
miR-27 expression has also been linked to cancer, it inhibits the tumor suppressor FOXO1 in endometrial cancer [36]. [score:7]
Remarkably, we show here that miR-27 directly regulates NANOG by binding to its 3′-UTR and inhibiting its expression (Figure 2B). [score:7]
Moreover, miR-27 over -expression activates expression of ZEB1 and ZEB2, (two antagonist of E-CADHERIN), which then leads to activated ß-CATENIN expression and decreased E-CADHERIN levels [37]. [score:7]
D) DiffQ0.05common: The table provides a detailed list of common and unique >1.3333 fold up-regulated and <0.75 fold down-regulated genes (Official gene Symbol) by let-7 and miR-27 (Detection P-Value <0.05) of Figure 5C. [score:7]
miR-27 over -expression in NCCIT cells repressed OCT4 and LIN28B expression levels to about 50% in comparison to the scrambled miRNA negative control but however no reduction of MYC expression. [score:7]
miR-27 inhibits OCT4 and LIN28 expression at the transcriptional and translational level in embryonal carcinoma (EC) cells. [score:7]
While over -expression of miR-27 results in a reduction of FOXO1 expression in hEC-1B cells, inhibition of miR-27 with antagomiRs leads to a de-repression of FOXO1 in Ishiwaka cells [36]. [score:7]
In order to search for miR-27 target genes, we used miRNA target gen prediction web tools such as TargetScan (http://www. [score:7]
More strikingly, we observed an up-regulation of genes that control developmental pathways such as p53-, WNT- and TGFß-signalling after miR-27 over -expression in NCCIT cells (Table 1). [score:7]
miR-27 inhibits OCT4 and LIN28 expression at both the transcriptional and translational level in embryonal carcinoma cells (NCCIT). [score:7]
regulated genes The Table represents all significantly up- and down-regulated genes after miR-27 or let-7 over -expression in comparison to the neg. [score:7]
Since miR-27 directly inhibits a number of pluripotency -associated genes that are involved in silencing the SMAD2/3 branch of the TGFß signalling pathway, we postulated that miR-27 expression would be activated at an early time point during directed differentiation of pluripotent cells. [score:7]
Other studies have shown that miR-27 is up-regulated during osteoblast differentiation and that miR-27 is highly expressed in endothelial cells [31], [32]. [score:6]
We have confirmed with our GFP-sensor approach that miR-27 directly inhibits the ACTIVIN/NODAL branch of TGFß-signalling by targeting ACVR2A, TGFßR1 and SMAD2 (Figure 1C). [score:6]
Therefore, we postulate that miR-27, a negatively regulated OCT4 target, is an inhibitor of self-renewal in hEC. [score:6]
miR-27 over -expression in hEC activates expression of developmental -associated genes and represses pluripotency -associated genes at the transcriptional level. [score:6]
miR-27 has been recently reported to be involved in metabolic processes such as fatty acid metabolism, where miR-27 inhibits adipogenesis through targeting two core regulators of adipogenesis, the peroxisome proliferator-activated receptor gamma (PPARγ) and C/EBPalpha [33]. [score:6]
This implies that OCT4 either directly or indirectly, negatively regulates miR-27 expression in hESC (Figure 3). [score:6]
Loss of OCT4 expression and function in hES results in the induction of miR-27 expression. [score:5]
Loss of self-renewal and therefore differentiation of hEC with SB431542 treatment resulted in ∼1.8-fold induced expression of miR-27a and an even lower level of miR-27b expression (Figure 4A). [score:5]
Over -expression of miR-27 led to a ∼20% decrease in GFP expression of the GFP-ACVR2a sensor (p = 0.00096). [score:5]
miR-27 targets the pluripotency -associated genes NR5A2, POLR3G, LIN28B and NANOG The fact that miR-27 regulates the SMAD2/3 branch prompted us to search for additional pluripotency -associated genes that might be regulated by miR-27. [score:5]
These results confirm that OCT4 expression negatively correlates with miR-27a/b expression in hESC. [score:5]
The observation that miR-27 over -expression leads to a reduction in OCT4 and LIN28B expression, led us to investigate whether miR-27 inhibits LIN28B or OCT4 at the protein level. [score:5]
The table reveals that miR-27 up-regulates a number of pathways associated with developmental processes, such as p53-, WNT- and TGFß-signalling (Table 1). [score:5]
Additionally, over -expression of mir-27 in hEC cells represses LIN28 at the transcriptional and translational level (Figure 4C+D+E). [score:5]
For miR-27 over -expression, the expression of OCT4 was highly reduced to levels similar to miR-125b and let-7a. [score:5]
Another potential miR-27 target gene, the RNA polymerase III (Pol III) subunit POLR3G, a downstream target of OCT4 and NANOG, has been reported to promote the undifferentiated state of embryonic stem cells. [score:5]
RNAi -mediated suppression of OCT4 in hESC induces miR-27a/b expression. [score:5]
Employing an EGFP -based sensor approach, we show that miR-27 targets three genes of the ACTIVIN/TGFß branch of TGFß signalling pathway, namely: ACVR2, TGFßR1 and their downstream target SMAD2. [score:5]
RUNX1, an inhibitor of granulocyte differentiation, has been confirmed as a miR-27 target [35]. [score:5]
The lowest, just 1-fold up-regulation of both, miR-27a and miR-27b, was observed with the less efficient OCT4 knockdown sample- siOCT4#3. [score:5]
Screening with TargetScan we identified LIN28B as a putative miR-27 target gene (Figure 2A). [score:5]
In mesenchymal stem cells (MSCs), miR-27 expression is increased and promotes osteoblast differentiation by inhibition of the adenomatous polyposis coli gene (APC), a known activator of the WNT signalling pathway [32]. [score:5]
[16] The fact that SMAD2 has been predicted to contain two miR-27 binding sites located ∼5 kb apart to each other, we decided to clone two sub-fragments of the SMAD2-3-′UTR within the 3′-UTR of the GFP-sensor plasmid (SMAD2-1 and SMAD2-2) to assure that the GFP-SMAD sensor is not regulated by endogenously expressed miRNAs. [score:4]
With the GFP-sensor assay, we observed a significantly reduced (∼20%) level of GFP expression from the GFP-POLR3G reporter induced by miR-27 over -expression (Figure 2B). [score:4]
Thereafter,s revealed that miR-27a expression was just slightly activated in definitive endoderm cells (DE) while miR-27b expression was activated more than ∼5-fold compared to undifferentiated hESC (Figure 2C histogram). [score:4]
We also screened for a number of pathways down-regulated by miR-27 in NCCIT cells. [score:4]
By using the above described GFP-sensor assay, we observed a significant (16%) reduction in GFP expression (p = 0.008) in the presence of exogenous miR-27 compared to the negative control, thus suggesting that LIN28B is a direct target of miR-27 (Figure 2B). [score:4]
The findings of our study reveal a novel role for miR-27 as a negative regulator of self-renewal by inhibiting core factors associated with pluripotency in hEC cells. [score:4]
miR-27 directly targets a number of pluripotency -associated genes such as TGFßR1, ACVR2, SMAD2, LIN28B, POLR3G, NR5A2 and NANOG. [score:4]
A previous study reported that miR-27 is up-regulated in the hESC line CHA-4, undergoing hepatocyte differentiation [30]. [score:4]
OCT4 knockdown in the hESC line H1 leads to activation of miR-27a and miR-27b expression. [score:4]
We observed for two samples with the most efficient OCT4 knockdown, a more than 16-fold increase in the levels of miR-27a and more than 6-fold increase in miR-27b expression (Figure 3D). [score:4]
ACVR2A, TGFßR1 and SMAD2 are direct targets of miR-27. [score:4]
miR-27 directly inhibits a number of genes reported to sustain self-renewal in embryonic stem cells. [score:4]
miR-27 directly inhibits a number of genes of the TGFß signalling pathway that promote self-renewal in undifferentiated embryonic stem cells. [score:4]
Employing the GFP-sensor assay, we were able to confirm that miR-27 indeed directly regulates NR5A2 expression (Figure2B). [score:4]
List of pathways and associated genes significantly up-regulated 72 h after post-transfection of NCCIT with miR27. [score:4]
Surprisingly, miR-27 was able to repress GFP expression (approximately 29%) of the GFP-NANOG reporter compared with the negative control, thus indicating that NANOG is directly regulated by miR-27 (Figure 2B). [score:4]
These results reveal that miR-27 negatively regulates SMAD2/3 and therefore inhibits self-renewal in hESC. [score:4]
As shown in Figure 5C, the Venn diagrams represent a high overlap of substantially up- and down-regulated genes induced or repressed by let-7 and miR-27 in hEC cells. [score:4]
Another study demonstrated that miR-27 is strongly up-regulated in the heart of neonate mice and promotes myocardic maturation through modulating Mef2c [52]. [score:4]
miR-27 prevents adipogenic differentiation by targeting two main regulators of adipogenesis, the peroxisome proliferator-activated receptor gamma (PPARγ) and C/EBP alpha [33]. [score:4]
To investigate miR-27 expression after RNAi -mediated knockdown of OCT4 inhESC, we isolated total RNA 72 h post transfection with siRNAs targeting either OCT4 (siOCT4) or EGFP (siEGFP) as a negative control [41]. [score:4]
Genes highlighted in bold, black letters are those validated experimentally to be direct targets of miR-27. [score:4]
0111637.g006 Figure 6 Genes highlighted in bold, black letters are those validated experimentally to be direct targets of miR-27. [score:4]
By using the Illumina Beadstudio microarray platform, we analysed the transcriptomes of NCCIT cells transfected with the following miRNA mimics (let-7, miR-125, miR-27, miR-200 and a scrambled negative control) and also treated with the TGFßR2 inhibitor SB431542 after 72 h. The dendrogram in Figure 5A presents the correlation of the transcriptomes to each other. [score:3]
These results show that miR-27 might act as a negative regulator of pluripotency because all three genes are known regulators of self-renewal in human ES/EC cells, as illustrated in Figure 1C. [score:3]
0111637.g004 Figure 4(A) Analysis of miR-27 expression was carried out for miR-27a and miR-27b using TaqMan -based PCR on total RNA samples isolated from NCCIT cells undergoing RA stimulated neuronal differentiation for seven days or by blocking TGFßR2 with SB431542 for seven days and normalized to the DMSO -treated control. [score:3]
Transient over -expression of miR-27 in hEC, led to decreased levels of OCT4 mRNA and protein. [score:3]
However, in the case of TGFßR1, we observed a significant reduction of 24% (p = 0.0138) in GFP expression in the presence of miR-27. [score:3]
For miRNA over -expression studies in hEC, 4×10 [5] NCCIT cells were transfected with 6 µl Lipofectamine RNAiMax Reagent (Invitrogen) together with 50 pmol of the following Pre-miR miRNA precursors (# AM17100, Ambion): negative control #1, hsa-miR-200c-3p, hsa-let-7a-5p, hsa-miR-27a-3p or hsa-miR-125b-5p (all from Ambion). [score:3]
The fact that miR-27 regulates the SMAD2/3 branch prompted us to search for additional pluripotency -associated genes that might be regulated by miR-27. [score:3]
Furthermore, siRNA -mediated ablation of OCT4 function in the hESC line H1 led to the activation of miR-27 expression and loss of self-renewal and pluripotency. [score:3]
In order to validate these three genes as bona fide miR-27 targets, we generated GFP-sensor constructs bearing parts of the 3′-UTR with the putative miR-27 binding site as previously described. [score:3]
Additionally, we generated two GFP-sensor constructs bearing the whole 3′-UTRs of SOX2 and OCT4, two genes not predicted to be miR-27 targets. [score:3]
An interesting observation, when screening for miR-27 target sites, was that miR-27 sites are often predicted to be binding sites for miR-128 and vice versa. [score:3]
As miR-23 is transcribed together with miR-24 and miR-27 in a polycistronic cluster, these results support our observation that expression of miR-27a increases in the hEC line (NCCIT) 7 days post RA treatment (Figure 4A). [score:3]
Our data has led us to hypothesise that miR-27 expression is activated upon the loss of self-renewal. [score:3]
In contrast, miR-27a expression is more prominent during neuro-ectoderm differentiation. [score:3]
For both constructs, we did not observe any significant changes in GFP -expression between miR-27 and the scrambled negative control (Figure 2B). [score:3]
Validation of miR-27 target genes. [score:3]
Taken together, we have been able to confirm that miR-27 targets the 3′-UTRs of SMAD2 and their upstream activators, TGFßR1 and ACVR2A. [score:3]
Additional evidence in support of miR-27 acting as an “off-switch” for self-renewal are as follows; (i) miR-27 moderately inhibits LIN28B by using the eGFP-sensor approach (Figure 2B). [score:3]
Lower row: miR-27 expression was carried out for miR-27a and miR-27b using TaqMan -based PCR on total RNA samples from the above described stages, DE and HE and normalized to the untreated/undifferentiated H1 control. [score:3]
Therefore, for miR-27 over -expression studies, we chose the human embryonal carcinoma cell line NCCIT. [score:3]
Another candidate, the orphan nuclear receptor NR5A2, has been predicted to be a target of miR-27. [score:3]
miR-27 targets the pluripotency -associated genes NR5A2, POLR3G, LIN28B and NANOG. [score:3]
Since induced differentiation towards definitve endoderm resulted in an increase in miR-27a expression in hESC, we performed two additional differentiation experiments using our hEC mo del. [score:3]
Moreover, we demonstrate that LIN28 and NANOG as well as POLR3G and NR5A2 are target genes of miR-27. [score:3]
In order to detect and quantify miR-27 expression, we performed RT-PCR on total RNA samples using TaqMan probes detecting miR-27a and miR-27b. [score:3]
miR-27 expression in hESC line H1 during hepatocyte differentiation. [score:3]
miR-27 activates metastasis in human gastric cancer cells by activating the expression of ZEB1, ZEB2 and VIM thus leading to an induction of epithelial-to-mesenchymal transition [37]. [score:3]
miRNA profiling revealed that the expression level of miR-27 increases in hESC undergoing endoderm priming and hepatocyte differentiation [30]. [score:3]
In hepatic endoderm cells (HE), 14 days after the initial differentiation, we observed no changes in miR-27a expression compared to the undifferentiated stage but a ∼4-fold increase of mature miR-27b. [score:2]
In order to achieve a more global insight on the function of miR-27 during early development, we transfected hEC line NCCIT with miRNA mimics. [score:2]
To summarize, our results imply that (i) miR-27 indirectly promotes Let-7 maturation by modulating LIN28B. [score:2]
Furthermore, miR-27 seems to act as a cell cycle regulator and mediator of cell-cell junctions. [score:2]
Genes that were substantially (DetectionPvalue <0.05/DiffLimmaQvalue <0.01) more than 1.3333-fold increased or less than 0.75-fold decreased after miR-27 over -expression compared to the negative control transfection were further screened for pathway related genes using the DAVID Bioinformatic Tool V6.7 [63]. [score:2]
Schematic overview of our proposed regulatory network between miR-27 and pluripotency -associated genes. [score:2]
Using the, we observed more than 2-fold increased expression of miR-27a and a moderate increase of miR-27b in the retinoic acid treatment compared to DMSO -treated NCCIT cells. [score:2]
Finally, we compared miR-27 expression in hESC 72 h after siRNA mediated knockdown of OCT4 with a TAQman miRNA assay. [score:2]
miR-27 is involved in developmental processes. [score:2]
gr/tarbase/), we found that miR-27 is predicted to regulate two genes, ACVR2 and TGFßR1 which act upstream of the SMAD2/3 signalling cascade. [score:2]
It shows that blocking TGFßR2 with SB431542 or the over -expression of let-7 has the strongest effect at the transcriptome level, compared to the negative control transfection, followed by miR-27 (Figure 5A). [score:2]
The heat map illustrates transcriptional changes 72 h after over -expression of selected miRNAs (let-7, miR-125, miR-27, miR-200) compared to the scrambled negative control of a number of selected genes previously shown to promote either self-renewal (e. g. LIN28, TRIM71, DNMT3A, DNMT3B) or induction of differentiation (e. g. SMAD6, BMP2, FST). [score:2]
As a confirmatory experiment, we transfected HEK293 cells with the GFP-sensor and pdsRED as a control to monitor transfection efficiency, together with miR-27 mimics (Ambion) or a scrambled negative control miRNA mimic. [score:1]
To exclude that miR-27 does not influence the GFP-sensor per se, we performed a co-transfection of the GFP-sensor with miR-27 or the scrambled negative control. [score:1]
miR-27 promotes myogenic differentiation by silencing PAX3 in muscle progenitor cells [34]. [score:1]
In this study, we focus on the somatic-enriched microRNA, miR-27. [score:1]
Similar results were observed with transfection of NCCIT cells with miR-27a (Figure 4C). [score:1]
In vertebrates two paralogs of miR-27, i. e. miR-27a and miR-27b, which only differ by one nucleotide, have been described. [score:1]
Duplicate samples were hybridized for miR-27 and the neg. [score:1]
Next, we examined the influence of miR-27 in hEC. [score:1]
However, both OCT4 and miR-27, operate in a larger differentiation mechanism that involves a negative feedback loop. [score:1]
PCR fragments flanking the predicted miR-27 binding sites were cloned into the 3′-UTR of the modified EGFP-C1 vector. [score:1]
The highest GFP repression was observed for both SMAD2 constructs in the presence of miR-27. [score:1]
In a next step, we wanted to investigate whether miR-27 over -expression promotes differentiation in hESC. [score:1]
This observation inspired us to investigate if NANOG is indeed a target of miR-27. [score:1]
0111637.g005 Figure 5 (A) Hierarchical clustering of NCCIT cells transfected either with miRNAs (miR-27, let-7, miR-125, miR-200 or neg. [score:1]
However, the seed sequence of miR-128 (CACAGUG, nucleotides 2–7) can also be found within the miR-27 sequence (U CACAGUG, nucleotides 3–8). [score:1]
To date, an increasing number of functions of miR-27 have been reported. [score:1]
Transcriptome analysis of human embryonal carcinoma cells (NCCIT) post transfection with miR-27, let-7, miR-125 or miR-200. [score:1]
To confirm this, we generated a GFP-sensor construct bearing the 3′-UTR of NANOG and performed a co-transfection in HEK293 cells with either a scrambled negative control or miR-27. [score:1]
Here, we report a novel role of miR-27 as a negative modulator of self-renewal and pluripotency. [score:1]
To achieve this, we transfected NCCIT cells with miR-27 and isolated total RNA and protein 48 h post transfection. [score:1]
Interestingly, the seed sequences of miR-128 (CACAGUG) and miR-27 (UCACAGU) overlap but are not identical. [score:1]
[1 to 20 of 128 sentences]
2
[+] score: 359
Other miRNAs from this paper: hsa-mir-27b
As a result, the expression of C-myc reversely correlated with BTG2 expression in gastric cancer tissues and cell lines, and similar to miR-27a-3p inhibition, overexpression of BTG2 decreased the expression of C-myc and Ras/MEK/ERK downstream proteins (Ras, p-MEK, and p-ERK). [score:11]
As miRNAs usually directly inhibit the mRNA of their target genes by competitively binding with 3′UTR sites in target genes [34], we predicted that miR-27a-3p could be capable of regulating BTG2 expression via the binding site in BTG2 3′UTR. [score:11]
Several genes have been confirmed as potential targets of mature miR-27a in a variety of cell types including Sprouty2 [7], prohibitin [4], ZBTB10 [8], FOXO1 [8], HIPK2 [10], but miR-27a has recently been reported to suppress the clonogenic growth and migration of human glioblastoma multiforme cells by targeting BTG2, a p53-inducible anti-proliferation gene and a tumor suppressor gene [32, 33]. [score:9]
Next, we performed western blot analysis to examine caspase 3 cleavage and PARP1 activation in miR-27a-3p -upregulated, miR-27a-3p -inhibited or BTG2-ovexpressed cells. [score:8]
We further identified the direct and functional target of miR-27a-3p in gastric cancer and explored the underlying molecular mechanisms of miR-27a-3p and its target gene, BTG2, and their roles in tumorigenesis and progression of gastric cancer, which may shed light on their targeted applications in cancer therapies. [score:8]
Moreover, to validate whether BTG2-medicated downregulation of C-myc in GC cells depends on Ras/MEK/ERK pathway, we then performed western blot analysis to examine the expression levels of several Ras/MEK/ERK downstream proteins following transfection of miR-27a-3p mimics/inhibitor or BTG2-pcDNA into MGC-803 and GES-1 cells. [score:8]
E. Western Blotting was performed to determine the protein expression level of BTG2 in miR-27a-3p -upregulated or miR-27a-3p -inhibited cells, β-actin was used as the loading control. [score:8]
Previous studies have also shown that miR-27a is upregulated in GC tissues and may promote malignant behaviors by targeting the tumor suppressor gene, prohibitin [4, 15– 17]. [score:8]
First, the target prediction programs miRanda, miRBase, PicTar, and TargetScan were used to predict the possible miR-27a-3p targets. [score:7]
As shown in Figure 4C, similar to the overexpression of BTG2, miR-27a-3p inhibition decreased cyclinD1 and cyclinE1 protein abundance, while miR-27a-3p overexpression increased it. [score:7]
As miRNAs perform their biological functions by suppressing their target genes, identifying the target genes of miR-27a-3p is important to explore the functional mechanism of miR-27a-3p in gastric tumorigenesis. [score:7]
As a result (Figure 3E), miR-27a-3p overexpression decreased the endogenous expression of BTG2 protein, whereas miR-27a-3p inhibition increased BTG2 protein level. [score:7]
As expected, overexpression of miR-27a-3p reduced, but inhibition of miR-27a-3p increased, the expression levels of BTG2 protein. [score:7]
Consistently, miR-27a-3p inhibition was found to decrease the expression of these Ras/MEK/ERK downstream molecules, whereas miR-27a-3p overexpression increased them (Figure 6B and 6C). [score:7]
Therefore, the expression of BTG2 protein in miR-27a-3p -upregulated or miR-27a-3p -inhibited cells were investigated respectively. [score:6]
This hypothesis was confirmed by further cell-cycle and apoptosis assays, showing that miR-27a-3p inhibition, which consistent with the overexpression of BTG2, induced GC cells G1/S arrest via suppressing cyclinD1 and cyclinE1 protein abundance, and facilitated apoptosis by activating cleaved caspase 3 and PARP1. [score:6]
Taken together, theses data demonstrated that miR-27a-3p could attenuate the expression of BTG2 by directly targeting its 3′-UTR. [score:6]
Importantly, our further analysis in gastric cancer tissues also found that miR-27a-3p expression inversely correlated with BTG2 mRNA expression. [score:5]
H. Growth curve of GES-1, BGC-823, and MGC-803 cells treat with miR-27a-3p mimics or inhibitor and miR-27a-5p mimics or inhibitor. [score:5]
It was also shown that the inhibitor of miR-27a-3p, but not miR-27a-5p, had the similar effects to the silencing expression of the pre-miRNA. [score:5]
To further clarify the role of mature miR-27a in gastric tumorigenesis, we first constructed a miR-27a expression vector, pEGFP-C1-miR-27a(+), by inserting miR-27a precursor containing some flanking sequences at both sides into the pEGFP-C1 vector, and a competitive inhibitor plasmid, pEGFP-C1-miR-27a(−). [score:5]
BTG2 attracted our attention because its 3′-UTR contains two putative target sequences for miR-27a-3p (Figure 3A), and BTG2 is regarded as a tumor suppressor gene and closely involved in cell proliferation, apoptosis and invasion of several cancers cells, especially, of gastric cancer cells [19]. [score:5]
Collectively, these data indicated that two isoforms of mature miR-27a, miR-27a-5p and miR-27-3p, were both frequently overexpressed in gastric cancer, while the expression level of miR-27-3p in GC was significantly higher than that of miR-27a-5p. [score:5]
Consistently, the data showed that miR-27a-3p inhibition, but not miR-27a-3p overexpression, drastically caused activation of cleaved caspase 3 and PARP1 (Figure 5B). [score:5]
Similarly, miR-27a-3p inhibition was found to be related to G1 cell-cycle arrest, which was evidenced by the reduced percentage of S and the increased percentage of G1 and sub-G1, but miR-27a-3p overexpression could not trigger G1 cell-cycle arrest. [score:5]
The result suggested that miR-27a-3p inhibited BTG2 expression via the binding site in BTG2 3′UTR. [score:5]
Previous studies have also described aberrant expression of mature miR-27a in gastric cancer [15– 17], however, very little was known about the expression profiles of its two mature isoforms, miR-27a-5p and miR-27-3p, in gastric cancer and the biological effects of these two isoforms on gastric carcinogenesis and cancer progression. [score:5]
Clearly, miR-27a-3p expression inversely correlated with BTG2 mRNA expression (Figure 3B). [score:5]
miR-27a-3p promotes gastric cancer cell proliferation and tumor growth in vitro and in vivoTo further clarify the role of mature miR-27a in gastric tumorigenesis, we first constructed a miR-27a expression vector, pEGFP-C1-miR-27a(+), by inserting miR-27a precursor containing some flanking sequences at both sides into the pEGFP-C1 vector, and a competitive inhibitor plasmid, pEGFP-C1-miR-27a(−). [score:5]
BTG2 is a direct functional target of miR-27a-3p in gastric cancer cells. [score:4]
To better understand the functional mechanism of miR-27a-3p in gastric tumorigenesis, it is important to identify the direct target(s) of miR-27a-3p that might be responsible for its biological function. [score:4]
miR-27a has been found to be frequently upregulated and play functional roles in multiple tumor types including pancreatic cancer [7], breast cancer [8, 9], ovarian cancer [10], esophageal cancer [11], renal cell carcinoma [12], hepatocellular carcinoma [13], and glioma [14]. [score:4]
Cell proliferation assays that silencing miR-27a expression dramatically reduced the growth rate of MGC-803 cells, whereas miR-27a overexpression dramatically promoted the proliferation of GES-1 cells (Figure 2B and 2C). [score:4]
Further experiments revealed that BTG2 was a direct and functional target of miR-27a-3p in gastric cancer. [score:4]
BTG2 is a direct functional target of miR-27a-3p in GC cells. [score:4]
Therefore, we hypothesized that miR-27a-3p/BTG2 axis could regulate C-myc expression via Ras/MEK/ERK signaling pathway in gastric cancer cells. [score:4]
As shown in Figure 5A, miR-27a-3p inhibition significantly increased the percentages of TUNEL -positive apoptotic cells when compared to miR-control, whereas miR-27a-3p overexpression slightly decreased the percentages of TUNEL -positive apoptotic cells. [score:4]
Cells were transfected with mimics and inhibitor of miR-27a-3p and pcDNA-BTG2 for 48h, and then split with lysis buffer. [score:3]
Then, to explore the relationship between BTG2 and miR-27a-3p, quantitative PCR was used to analyze the expression of miR-27a-3p and BTG2 in 20 paired clinical GC tissues. [score:3]
Herein, the expression level of miR-27-3p in GC was significantly higher than that of miR-27a-5p. [score:3]
The results showed that the expression of miR-27-3p, the major isoform of mature miR-27a, was increased obviously in pEGFP-C1-miR-27a(+) transfection cells while decreased obviously in pEGFP-C1-miR-27a(−) transfection cells (Figure 2A). [score:3]
miR-27a-3p and miR-27a-5p are overexpressed in gastric cancer tissues and cell lines. [score:3]
And overexpression of miR-27a-3p, the major isoform of mature miR-27a, promoted gastric cancer cell proliferation in vitro as well as tumor growth in vivo. [score:3]
To examine the expression patterns of these two isoforms of mature miR-27a in gastric cancer (GC), quantitative real-time PCR analysis was performed in 20 paired GC tissues and matched normal tissues. [score:3]
In the present study, we found that two isoforms of mature miR-27a, miR-27a-5p and miR-27-3p, were both frequently overexpressed in 20 paired clinical GC samples and GC cell lines. [score:3]
In conclusion, we found that two isoforms of mature miR-27a, miR-27a-5p and miR-27-3p, were both frequently overexpressed in gastric cancer. [score:3]
Based on a dual-luciferase reporter assay, we confirmed that miR-27a-3p directly target to the 3′-UTR region of BTG2 transcript in human gastric cancer. [score:3]
Wild-type and mutated miR-27a-3p putative target on BTG2 3′-UTR were cloned into PmirGLO vector. [score:3]
Thus, we predicted BTG2 as a putative target gene of miR-27a-3p in GC. [score:3]
These data indicated that the miR-27a-3p/BTG2 axis might represent a promising diagnostic biomarker for gastric cancer patients and could be a potential therapeutic target in the management of gastric cancer. [score:3]
For cell-cycle analysis, cells were transfected with pcDNA-BTG2, the mimics or inhibitor of miR-27a-3p, and maintained for 48h. [score:3]
Next, to identify whether BTG2 is a direct target of miR-27a-3p in GC, a dual-luciferase activity assay was performed. [score:3]
As shown in Figure 3D, miR-27a-3p was able to markedly inhibit the relative luciferase activity of the wild-type BTG2 3′-UTR, but did not change the activity of the mutant BTG2 3′-UTR constrcts. [score:3]
Moreover, our bioinformatics analysis revealed that BTG2 would be theoretically a potential target gene of miR-27a-3p, and BTG2 has two putative miR-27a-3p binding sites within its 3′UTR. [score:3]
The hsa-miR-27a expression vector pEGFP-C1-miR-27a(+) contains pri-miR-27a and parts of its flanking sequences, 993bp cloned into pEGFP-C1 vector digested with Xho I and ECOR I [25]. [score:3]
miR-27a-3p and miR-27a-5p are overexpressed in GC tissues and cell lines. [score:3]
Adherent cells were transfected with mimics or inhibitor of miR-27a-3p for 48h. [score:3]
B. Expression patterns of BTG2 with miR-27a-3p in gastric cancer tissues (p< 0.0001, spearman correlation) All data were presented as mean±SD and as representative of an average of three independent experiments. [score:3]
To further clarify it, we detected the endogenous expression of BTG2 protein after alteration of miR-27a-3p levels in GC cell lines. [score:3]
microRNA-27a (miR-27a) is located at chromosome 19 and has been found to be frequently aberrant expressed and play functional roles in multiple tumor types including pancreatic cancer [7], breast cancer [8, 9], ovarian cancer [10], esophageal cancer [11], renal cell carcinoma [12], hepatocellular carcinoma [13], and glioma [14]. [score:3]
In addition, consistent with the results from clinical GC samples, the levels of miR-27a-3p and miR-27a-5p were also found to be markedly up-regulated in GC cell lines (AGS, NCI-N87, BGC-823, HGC-27, SGC-7901 and MGC-803) compared with those of the normal gastric epithelial cells, GES-1, and the levels of miR-27-3p in GC cell lines were significantly higher than those of miR-27a-5p (Figure 1E and 1F). [score:3]
As shown in Figure 2F and 2G, ectopic expression of mature miR-27a promoted tumorigenesis in vivo: the average tumor volumes and tumor weight formed by the GES-1/miR-27a(+) cells were significantly more than those formed by the GES-1/EGFP cells, while the volumes and weight of the tumors formed by the MGC-803/miR-27a(−) were significantly less than those formed by the MGC-803/EGFP cells. [score:3]
The hsa-miR-27a competitive inhibitor vector pEGFP-C1-miR-27a(−) was designed as a sponge of miR-27a with repeated binding sites complementary cloned into pEGFP-C1 vector digested with Hind III and Xba I. The sequences of miR-27a sponge were 5′-CCCAAGCTTACTGTGAAACTGTGAAACGTGAAACTGTGAAACTGTGAAACTGTGAATCTAGAGC-3′ forward and 5′-GCTCTAGATTTCACAGTTTCACAGTTTCACAGTTTCACAGTTTCACAGTAAGCTTGGG-3′ reverse. [score:3]
B. Comparison of MiR-27a-5p expression level between gastric cancer tissues and their corresponding non-tumorous tissues. [score:2]
miR-27a-3p/BTG2 axis regulates cell cycle progression and apoptosis in gastric cancer cells. [score:2]
Recent studies have demonstrated that BTG2 can be regulated by non-coding RNAs, including miRNAs [22– 24], however its association with mature miR-27a in gastric cancer remains unknown. [score:2]
We found both miR-27-3p and miR-27a-5p had significantly increased expression in GC tissues as compared to the corresponding non-tumor samples, and the average fold-changes were greater than 2.0 (Figure 1A–1D). [score:2]
C. MiR-27a-3p expression in20 pairs of gastric cancer tissue (Tumor) and their corresponding nontumorous tissue (NT). [score:2]
MiR-27a-3p expression levels were calculated by the MiR-27a-3p/U6 expression ratio (i. e., 2 [−ΔCt]). [score:2]
Collectively, our results indicated that miR-27a-3p/BTG2 axis modulated cell cycle profression via cell cycle-regulatory proteins and affected apoptosis by caspase 3 cleavage in GC cells. [score:2]
E. MiR-27a-5p expression in the NT, Tumor, normal gastric cancer cell line GES-1 and gastric cancer cell lines AGS, NCI-N87, BGC-823, HGC-27, SGC-7901 and MGC-803. [score:2]
miR-27a-3p/BTG2 axis regulates cell cycle progression in GC cells. [score:2]
miR-27a-3p/BTG2 axis regulates apoptosis in GC cells. [score:2]
D. Comparison of MiR-27a-3p expression level between gastric cancer tissues and their corresponding non-tumorous tissues. [score:2]
Figure 1 A. MiR-27a-5p expression in 20 pairs of gastric cancer tissue (Tumor) and their corresponding nontumorous tissue (NT). [score:2]
MiR-27a-5p expression levels were calculated by the MiR-27a-5p/U6 expression ratio (i. e., 2-ΔCt). [score:2]
F. MiR-27a-3p expression in the NT, Tumor, normal gastric cancer cell line GES-1 and gastric cancer cell lines AGS, NCI-N87, BGC-823, HGC-27, SGC-7901 and MGC-803. [score:2]
To determine whether the effect of miR-27a-3p on GC cell growth was mediated by BTG2, MGC-803 and GES-1 cells were transfected with miR-27a-3p mimics/inhibitor or BTG2-pcDNA for the subsequent cell-cycle or apoptosis assays. [score:2]
A. MiR-27a-5p expression in 20 pairs of gastric cancer tissue (Tumor) and their corresponding nontumorous tissue (NT). [score:2]
B. Growth curve of GES-1 cells treat with miR-27a (+)/pEGFP-C1 or pEGFP-C1. [score:1]
miR-27a-3p promotes GC cell growth in vitro and in vivo. [score:1]
Thus, these results suggested that miR-27a-3p, the major isoform of mature miR-27a, promoted cell growth in gastric cancer. [score:1]
We further assessed the role of miR-27a-3p with BTG2 in regulating apoptosis of GC cells by TUNEL assays. [score:1]
However, the expression profiles of two isoforms of mature miR-27a, miR-27a-5p and miR-27-3p, in gastric cancer and the biological effects of these two isoforms on gastric carcinogenesis has previously not been investigated. [score:1]
Similarly, we found that the mimic of miR-27-3p, but not miR-27a-5p, markedly increased the proliferation rate of BGC-823, MGC-803 and GES-1 cells (Figure 2H). [score:1]
The miRbase database shows that miR-27a precursor could generate two mature miRNAs, miR-27a-5p and miR-27-3p, and miR-27-3p is the major isoform. [score:1]
miR-27a-3p promotes gastric cancer cell proliferation and tumor growth in vitro and in vivo. [score:1]
In turn, the biological effects of miR-27a-3p/BTG2 axis on gastric cancer cell proliferation and tumor growth resulted from G1/S cell cycle arrest, subsequent apoptosis, and C-myc activation following Ras/MEK/ERK signaling pathway. [score:1]
C. Growth curve of MGC-803 cells treat with miR-27a (−)/pEGFP-C1 or pEGFP-C1. [score:1]
Notably, the fold change of miR-27a-3p median level between GC tissues and mached normal tissues (56.40, 2.707/0.048) was dramatically higher than that of miR-27a-5p (10.55, 0.003809/0.000361) (Figure 1B, 1C). [score:1]
Moreover, our further serial experimental results revealed that miR-27a-3p, the major isoform of mature miR-27a, promoted gastric cancer cell proliferation in vitro as well as tumor growth in vivo while its complementary strand, miR-27a-5p, did not. [score:1]
In the present study, we examined the expression patterns of two isoforms of mature miR-27a, miR-27a-5p and miR-27-3p, in gastric cancer tissues and cell lines and investigated the biological effects of the major isoform of mature miR-27a, miR-27a-3p, on gastric cancer cell proliferation in vitro and tumor growth in vivo. [score:1]
Among hundreds of potential candidates, we focused on the genes which involved in cell proliferation and related to the biological functions of miR-27a-3p. [score:1]
Cells (2×10 [4]) were seeded in 96-well plates and cotransfected with 100ng of PmirGLO-BTG2-WT or PmirGLO-BTG2-MUT constructs and pEGFP-C1-miR-27a. [score:1]
Clones with fluorescent label (EGFP) and G418 resistance were selected and expanded, named as GES-1/EGFP, MGC-803/EGFP, GES-1/miR-27a(+), and MGC-803/miR-27a(−), respectively. [score:1]
The results from our in vitro experiments also suggested that the miR-27a-3p/BTG2 axis could affect C-myc activation following Ras/MEK/ERK signaling pathway in gastric cancer. [score:1]
F. GES-1/Vector and GES-1/miR-27a(+) subcutaneous xenograft in nude mice. [score:1]
GES-1/MGC-803 cells were stably transfected with pEGFP-C1-miR-27a(+) and pEGFP-C1 vector, and then cultured in the presence of 600 μg/ml G418 for 6 weeks. [score:1]
Herein, our results implied that the influence of miR-27a-3p/BTG2 axis on cell growth or proliferation might result from cell cycle arrest and subsequent apoptosis. [score:1]
G. MGC-803/Vector and MGC-803/miR-27a(−) subcutaneous xenograft in nude mice. [score:1]
For subcutaneous implantation, 5×10 [6] transfected cell lines MGC-803-EGFP, MGC-803-miR-27a(−), GES-1-EGFP and GES-1-miR-27a(+) were suspended in 100 ml PBS before injected subcutaneously into the left thigh of nude mice. [score:1]
A. Schematic representation of the binding between miR-27-3p and BTG2 with mutated sites labeled with gray shading. [score:1]
Then pEGFP-C1-miR-27a(+) plasmid was cotransfected with BTG2-WT, BTG2-Mut, or BTG2-Ctrl into AGS, MGC-803, and GES-1 cells. [score:1]
The wild-type BTG2 3′-UTR fragment containing two binding sites of miR-27a-3p, and the mutant of seed-region complementary sites in BTG2 3′-UTR fragment, were cloned into an luciferase reporter vector/PmirGLO vector to generate BTG2-WT and BTG2-Mut (Figure 3C). [score:1]
Figure 3 A. Schematic representation of the binding between miR-27-3p and BTG2 with mutated sites labeled with gray shading. [score:1]
[1 to 20 of 105 sentences]
3
[+] score: 337
Whereas, in the cancers of esophagus [18], oral cavity [19], lung [21], and head and neck [34], miR-27a is downregulated, and miR-27a directly targets MET and EGFR and suppresses their expression in lung cancer [21]. [score:11]
In the current study, we found that, similar as SGPP1, Samd2 expression at mRNA and protein levels was upregulated in colorectal cancers and cell lines, exhibiting oncogenic phenotypes; moreover, Smad2 was repressed at transcriptional and translational levels by miR-27a, suggesting the direct target of miR-27a, a novel finding that has not been reported previously. [score:11]
B, miR-27a was frequently downregulated in human colorectal cancers (30 of 41 cancers exhibited downregulation and 11 cases showed upregulation, in comparison to the adjacent normal tissues). [score:10]
Several studies have also observed that miR-27a exhibited oncogenic activity by directly suppressing ZBTB10/RINZF expression [10], [17], resulting in upregulation of transcription factor specificity protein (Sp), vascular endothelial growth factor (VEGF) and VEGF receptor 1 (VEGFR1). [score:9]
Using comprehensive approaches, including qRT-PCR, immublotting and in situ immunohistochemical staining, we showed that the expression of SGPP1 at mRNA and protein levels were upregulated in colorectal cancers and colorectal cancer cell lines, which were inversely correlated with the expression of miR-27a. [score:8]
In comparison with the adjacent normal colon mucosa, 73% (30/41) of colorectal cancer tissues shown reduced miR-27a expression, and only 27% (11/41) colorectal cancers exerted upregulated expression of miR-27a, the difference was significant (Figure 1B, p<0.01). [score:8]
For instance, several studies have reported that miR-27a acts as an oncogene, whose expression is upregulated in breast cancers [11], [12], colon cancer cell lines [13]– [15], and in hepatocellular adenocarcinoma cells [16], and that the increased expression of miR-27a is associated with breast cancer progression and poor outcomes [11], [12]. [score:8]
Using the approaches of miRNA array, systemic biology, in vitro manipulating expression of miR-27a and in vivo tumor-bearing mouse mo del, we found that miR-27a acted as a tumor suppressor in colorectal cancer, which was through targeting SGPP1 and Smad2. [score:7]
To determine whether miR-27a could repress SGPP1 and Smad2 expression by targeting its binding site at 3′-UTR in SGPP1 and Smad2, the PCR products containing full length of 3′-UTR with intact target site of miR-27a recognition sequences were inserted into the luciferase reporter vector. [score:7]
For example, miR-27a directly suppresses ZBTB10/RINZF expression [10], [17]. [score:6]
Importantly, the downregulated miR-27a was also associated with colorectal cancer pathological stages and distant metastasis, showing tumor suppressor roles in colorectal cancer. [score:6]
In summary, we have demonstrated that miR-27a is frequently downregulated in colorectal cancer, and the reduced miR-27a is correlated with cancer distant metastasis and histopathological stages, and thus, miR-27a acts as a tumor suppressor. [score:6]
Previous studies have demonstrated that ZBTB10/RINZF is a direct target of oncogenic miR-27a in breast cancers [10], [17] and colon cancer cell lines [15], but this could not be the case in the colorectal cancer tissues because herein miR-27a seemed to be a tumor suppressor in colorectal cancers. [score:6]
and in turn upregulates VEGF and VEGF receptor in the cancers of breast [11], [12] and colon [13]– [15], and overexpression of miR-27a is associated with poor outcomes [11], [12]. [score:6]
In another hand, miR-27a has also shown tumor suppressor roles, such as miR-27a is downregulated in esophageal cancers [18], oral squamous cell carcinoma [19], acute leukemia [20], and in non-small cell lung cancer (NSCLC) [21]. [score:6]
In NSCLC, miR-27a directly targets MET and EGFR 3′ UTR, leading to reduced expression of MET and EGFR [21]. [score:6]
We further narrowed down the targets using GO program, and the targets at the categories of cellular process, single organism process, biological regulation and metabolic process, etc, exhibited stronger scores, meaning more relevant to miR-27a -associated functions in cancer formation and progression (Supplemental Materials Figure S1B). [score:6]
More importantly, the reduced expression of miR-27a was also associated with colorectal cancer pathological stages – miR-27a levels were more downregulated at stages III/IV than those at stage II (Figure 1C, p<0.0001). [score:6]
As shown in Figure 1D, miR-27a expression was downregulated 95%, 90% and 52% in HCT116, Caco-2 and SW480 cells, respectively, compared to the immortalized normal human colon epithelial cell NCM460. [score:5]
C, miRNA-27a inhibited SGPP1 and Smad2 mRNA expression in HCT116 cells. [score:5]
First, in vitro studies showed that increased expression of miR-27a inhibited colorectal cancer cell proliferation, promoted apoptosis and attenuated cancer cell migration. [score:5]
As SGPP1 and Smad2 were likely the targets of miR-27a, we then determined the expression levels of SGPP1 and Smad2 in human colorectal cancers and cancer cell lines. [score:5]
The mechanistic studies further showed that miR-27a -mediated tumor suppressor could be through targeting SGPP1, Smad2 and STAT3. [score:5]
Among the hundreds of targets, the two novel targets of miR-27a, Sphingosine-1-phosphate phosphatase 1 (SGPP1) and Smad2, were chosen for further studies. [score:5]
Previous studies have also shown therapeutic role of Smad2, that blocking Smad2 could suppress TGF-β -induced tumorigenesis, epithelial-mesenchymal transition (EMT), cell motility, and invasion [45], indicating that targeting miR-27a/Smad2 could have a great impact on developing a novel strategy for colorectal cancer therapy. [score:5]
Both in vivo and in vitro studies have identified SGPP1 and Smad2 as two novel targets of miR-27a, which is linked to STAT3 to regulate cancer cell proliferation, apoptosis and migration. [score:4]
Above findings strongly suggested miR-27a was frequently downregulated in colorectal cancers. [score:4]
miR-27a was down-regulated in Muc2−/− colonic epithelial cells and human colorectal cancers. [score:4]
In this study, we found that miR-27a was significantly downregulated in colorectal cancers and colorectal cancer cells. [score:4]
Therefore, miR-27a could be a useful biomarker for colorectal cancer development and progression, and also could have a therapeutic potential targeting SGPP1, Smad2 and Stat3 for colorectal cancer therapy. [score:4]
These findings strongly suggested that miR-27a could be used as a biomarker to monitor cancer development and progression, and could be used as a potential therapeutic target and even a potential therapeutic agent for colorectal cancer. [score:4]
Both dual luciferase assay and increasing expression of miR-27a further showed the inhibitory effects of miR-27a on SGPP1. [score:4]
Thus, this is the first to reveal that SGPP1 is a potent direct target of miR-27a, although the evidence of direction regulatory interaction is needed for further investigation. [score:4]
We found that besides the downregulation of total STAT3 by miR-27a, the phosphorylated STAT-3 (p-STAT3) was also dramatically repressed by miR-27a (Figure 4E). [score:4]
SGPP1 and Smad2 protein levels were also downregulated by miR-27a on both HCT116 and SW480 colorectal cancer cells (Figure 2D). [score:4]
Second, in a tumor-bearing mouse mo del, a direct injection of miR-27a to tumor suppressed tumor growth. [score:4]
The expression levels of miR-27a were further determined in human colorectal cancer cell lines. [score:3]
To determine miR-27a tumor suppressing functions, miR-27a precursor were transfected into the HCT116 cell, and the effects on cell proliferation, apoptosis and migration were analyzed. [score:3]
The repression of SGPP1 and Smad2 expression by miR-27a were determined by qRT-PCR and immunoblotting. [score:3]
miR-27a targets prediction. [score:3]
To determine the role of miR-27a in colonic epithelial cell malignant transformation, miR-27a expression levels were determined in human colorectal cancer and their adjacent tissues. [score:3]
Figure S1 Prediction of miR-27a targets. [score:3]
To determine the mechanisms of miR-27a mediated inhibition of cell proliferation and migration and enhancement of apoptosis, we determined the changes of STAT3 and Caspase3. [score:3]
miR-27a targeted SGPP1 and Smad2. [score:3]
miR-27 tumor suppressor functional studies. [score:3]
SGPP1 and Smad2 were overpressed in human colorectal cancer cells and cancer tissues, which were inversely correlated with miR-27 expression. [score:3]
Therefore, it is essential to determine whether the reduction of miR-27a is involved in colorectal cancer formation and progression, and it is warranted to identify miR-27a targets and reveal the underlying molecular mechanisms. [score:3]
D, miR-27a suppressed SGPP1 and Smad2 protein in colon cancer cells HCT116 and SW480. [score:3]
Expression levels of miR-27a were normalized to the corresponding levels of SNORD44. [score:3]
This study was to determine the expression of miR-27a and association with colorectal cancer formation, progression and the underlying mechanisms. [score:3]
shtml) were used to predict miR-27a targets. [score:3]
A, miR-27a suppressed tumor growth. [score:3]
As shown in Figure 4A and 4B, increasing miR-27a significantly inhibited cancer cell proliferations after 48 and 72 h at HCT116, Caco-2 and SW480 cells, although the effects at 24 h post transfection were not changed. [score:3]
Since genetic deficiency of the Muc2 gene in mice causes colorectal cancer formation, the decreased expression of miR-27a in colonic epithelial cells could be involved in the carcinogenesis. [score:3]
Functional studies have shown that miR-27a has shown both oncogenic and tumor suppressive functions in different cell lines and human cancer tissues. [score:3]
SGPP1 and Smad2 were the targets of miR-27a. [score:3]
To determine miR-27a tumor suppressing effects in vivo, we transplanted murine colon cancer cells MC38 into wild-type C57Bl/6 mice and injected a mixture of miR-27a precursor and Lipofectamine 2000 into the tumors when the tumors were palmable at day 21 post inoculation. [score:3]
C, Differential expression of miR-27a at stage II and stage III/IV cancers. [score:3]
For each sample, firefly luciferase activity was normalized to Renilla luciferase activity and the inhibition of miR-27a on SGPP1 3′-UTR and Smad2 3′-UTR was normalized to the control mimics. [score:3]
We employed multiple tools to predict novel targets of miR-27a. [score:3]
miR-27a inhibited murine colon cancer cell MC38 growth in vivo. [score:3]
0105991.g004 Figure 4 A, miR-27a inhibited cancer cell proliferation at SW480, HCT116 and Caco 2 cells, assayed by MTS. [score:2]
MiR-27a inhibited cell proliferation, enhanced apoptosis and attenuated cancer cell migration. [score:2]
MiR-27a inhibited cancer growth in mice. [score:2]
MiR-27a expression was reduced in Muc2−/− mouse colonic epithelial cells, in human colorectal cancer tissues and colorectal cancer cells. [score:2]
A, miR-27a inhibited cancer cell proliferation at SW480, HCT116 and Caco 2 cells, assayed by MTS. [score:2]
Compared to the adjacent normal colon mucosa, both SGPP1 and Smad2 expression were much higher at colorectal adenocarcinomas (Figure 3B), negatively correlated with miR-27a levels in colorectal cancers in which miR-27a was frequently reduced (Figure 1B). [score:2]
When xenografts were palmbable at day 21, a mixture of miR-27a precursor and Lipofectamine 2000 was directly injected into the tumors. [score:2]
B, miRNA-27a suppressed SGPP1 and Smad2 reporter activities assayed by Dual Luciferases in HCT116 cells. [score:2]
Compared to vector control, miR-27a treatment significantly inhibited cancer cell growth in mice, in terms of significant reduction of tumor sizes and weight (Figure 5A, 5B). [score:2]
MiR-27a expression was reduced in Muc2−/− mouse colonic epithelial cells, in human colorectal cancer tissues and colorectal cancer cellsOur previous studies have demonstrated that Muc2−/− mice spontaneously developed colorectal cancers and the carcinogenesis is linked to chronic inflammation [9], [22], [28], [29]. [score:2]
MiR-27a targets prediction. [score:2]
D, miR-27a expression was reduced in colorectal cancer cell lines, compared to the immortalized normal colon epithelial cell (NCM460). [score:2]
A, There was one miR-27a binding site at SGPP1 3′-UTR, and there were two miR-27a binding sites at Smad2 3′-UTR. [score:1]
6.26 µg of miR-27a precursor or negative miRNA (GenePharma, Shanghai, China) mixed with 1.6 µl transfection reagent Lipofectamine 2000 (Invitrogen) in 50 µl PBS were injected into the tumors every 3 days, for total of 3 times. [score:1]
In addition, reduced miR-27a was correlated with distant metastasis (Table 1). [score:1]
To detect apoptosis, the HCT116 cells were transfected with miR-27a precursor or negative control miRNA precursor. [score:1]
Negative miR-27a precursor (GenePharma, Shanghai) was also transfected as negative controls. [score:1]
E, miR-27a affected STAT3 and Caspase3 levels in HCT116 and SW480 cells. [score:1]
Genomic alignment showed that 3′-UTR of SGPP1 and Smad2 have one or two miR-27a binding sites (Figure 2A). [score:1]
0105991.g002 Figure 2 A, There was one miR-27a binding site at SGPP1 3′-UTR, and there were two miR-27a binding sites at Smad2 3′-UTR. [score:1]
As reported previously [26], the HCT116 cells transiently transfected with miR-27a precursor or negative control miRNA precursor were seeded in a 100-mm Petri dish. [score:1]
We found that miR-27a was significantly reduced in human colorectal cancer tissues and in colorectal cancer cell lines. [score:1]
In addition, increasing miR-27a significantly enhanced cancer cell apoptosis (45% at miR-27a groups versus 15% at vector control group, p<0.01). [score:1]
Since miR-27a was reduced in human colorectal cancers, we determined whether p-STAT3 was increased in colorectal cancers. [score:1]
Both SGPP1 and Smad2 mRNA levels were inversely correlated with the miR-27a levels at these human colorectal cancer cells (Figure 1D). [score:1]
One of the most changed miRNAs was miRNA-27a (miR-27a). [score:1]
As shown in Figure 2C, SGPP1 and Smad2 mRNA levels were repressed about 60% and 50% by miR-27a in HCT116 cells, respectively, consistent with the repression on their reporter luciferase activities. [score:1]
C, miR-27 levels in tumors from untreated (NC) and miR-27a treated groups were validated by qRT-PCR. [score:1]
Briefly, 1×10 [5] cells were seeded into 96-well plate transfected with 0.2 µg of miR-27a precursor with 0.5 µl Lipofectamine (Invitrogen, Carlsbad, CA). [score:1]
SGPP1 and Smad2 were inversely correlated with miR-27a in colorectal cancer. [score:1]
Twenty-four hours after plating, 4.0 µg of miR-27a precursor were transfected to the cells with Lipofectamine (Invitrogen, Carlsbad, CA) following the manufacture’s protocol. [score:1]
In brief, 10 pmol of miR-27a mimics or negative miRNA mimics (negative control) was co -transfected into cells with 100 ng of psiCHECK-2-3′-UTR-SGPP1 or psiCHECK-2-3′-UTR-Smad2, respectively, using DharmaFect Duo reagent (Dharmacon, Lafayette, CO, USA). [score:1]
The new signal pathway of miR-27a-Smad2-TGF-β could also contribute to the inhibitory role of miR-27a on cancer cell migration (Figure 4D), invasion and metastasis, detailed mechanism is under investigation. [score:1]
miR-27a precursor and miR-27a mimics were purchased from Shanghai GenePharma (Shanghai, China). [score:1]
The correlation between miR-27a levels and clinicopathological features. [score:1]
For immunoblotting, the human colon cancer cells HCT116 and SW480 were collected 72 hours after transfection with miR-27a precursor or negative control miRNA precursor. [score:1]
qRT-PCR showed that miR-27a level was still at a higher level in the tumors isolated from mouse xenografts (Figure 5C). [score:1]
Based on potential biology roles in proliferation and inflammation, miRNA profile and published literatures, miR-27a was chosen for further studies. [score:1]
[1 to 20 of 99 sentences]
4
[+] score: 331
Other miRNAs from this paper: hsa-mir-27b
After that, BC cells were transfected and assigned to six groups: control group, miR-27a mimics group (transfected with miR-27a mimics), miR-27a inhibitors group (transfected with miR-27a inhibitors), negative control (NC) group (transfected with negative control oligonucleotide), si- SFRP1 group (transfected with si- SFRP1) and si- SFRP1 + miR-27a inhibitors group (co -transfected with both si- SFRP1 and miR-27a inhibitors). [score:9]
Study had also indicated that miR-27a was highly expressed in BC cells through observation, where miR-27a could lead to cell cycle arrest by inhibiting the expression of its downstream genes [11]. [score:7]
It has been shown in past research that miR-27a was greatly expressed in estrogen receptor (ER) -negative MDA-MB-231 BC cells, and indirectly regulated specific protein expressions in MCF-7 BC cells [15, 16]. [score:7]
After inhibiting miR-27a, these expressions were suppressed. [score:7]
Compared with the si- SFRP1 group, mRNA and protein expressions of β-catenin, GSK3β and Wnt in the signaling pathway were remarkably up-regulated in the si- SFRP1 + miR-27a inhibitors group (Figure 8A, 8B, 8C). [score:7]
Previous studies have shown that the proliferation, migration and invasion of gastric cancer cells were inhibited after miR-27a was silenced or down-regulated [22]. [score:6]
A study concerning glioma showed that SFRP1 was a direct target of miR-27a, and proved that expression levels of SFRP1 were inversely associated with those of miR-27a [21]. [score:6]
This study found SFRP1 could be a target gene of miR-27a and its mRNA and protein expressions might be negatively regulated by miR-27a. [score:6]
This study aimed to explore the effect of miR-27a on the proliferation, migration and invasion of BC cells, which activated Wnt/β-catenin signaling pathway via targeting SFRP1, so as to provide a theoretical basis for the development of targeted therapy for BC. [score:6]
In addition, the mRNA and protein expressions of SFRP1 were obviously increased in the si- SFRP1 + miR-27a inhibitor group than in the si- SFRP1 group (P < 0.05). [score:5]
These results contributed to the conclusion that miR-27a promoted the expression of β-catenin, GSK3β and Wnt in Wnt/β-catenin signaling pathway via targeting SFRP1. [score:5]
Therefore, SFRP1 could be a target gene of miR-27a and its mRNA and protein expressions might be reduced by miR-27a. [score:5]
T-47D cells were transfected with miR-27a mimics, miR-27a NC, miR-27a inhibitors and si- SFRP1 respectively, in a further effort to explore the effect of miR-27a on SFRP1 mRNA and protein expressions in BC cells (ensuring first that transfection was successful). [score:5]
The mRNA and protein expressions of SFRP1 in the miR-27a inhibitors group were significantly increased in comparison to these in the miR-27a mimics group (P < 0.05). [score:5]
In order to explore the potential mechanism by which miR-27a affects these of BC cells through targeting SFRP1, the miR-27a inhibitors and si-SFRP1 were selected for cell transfection. [score:5]
The target gene of miR-27a was predicted by online software TargetScan 7.1 (http://www. [score:5]
the si-SFRP1 group, P = 0.039 for β-catenin mRNA, P = 0.043 for GSK3β mRNA, P = 0.039 for Wnt mRNA); B. protein expressions of β-catenin, GSK3β and Wnt among the six groups detected by Western blot; C. comparisons of mRNA expressions of β-catenin, GSK3β and Wnt among the six groups (the miR-27a mimics group vs. [score:5]
Furthermore, the mRNA and protein expressions of β-catenin, GSK3β and Wnt were markedly lower in miR-27a inhibitors group than in the miR-27a mimics group (all P < 0.05). [score:5]
Similarly in the present results, the inhibition of miR-27a contributed to increased SFRP1 mRNA and protein expressions. [score:5]
The oligonucleotide sequences were shown in Table 2. In order to explore the regulation mechanism of miR-27a on SFRP1 expression, the SFRP1 3′-UTR segment, containing miR-27a binding sites in 3′-UTR region, was amplified. [score:4]
To explore regulatory effect of miR-27a on Wnt/β-catenin signaling pathway, the mRNA and protein expressions of β-catenin, GSK3β and Wnt were detected using and Western blot. [score:4]
As derived from the luciferase activity, miR-27a decreased the expression of its potential SFRP1 mRNA target compared to miR-NC (negative control). [score:4]
In conclusion, this study found that miR-27a was highly expressed in BC, which activated Wnt/β-catenin signaling pathway through negatively regulating SFRP1 to promote the proliferation, migration and invasion of BC cells. [score:4]
It has been reported that SFRP1 is an antagonist of Wnt/β-catenin signaling pathway [13], and the mRNA and protein expressions of SFRP1 were regulated by miR-27a. [score:4]
Therefore, this study is intended to shed light on the effects of miR-27a targeting SFRP1 on proliferation, migration and invasion of BC cells through regulating Wnt/β-catenin signaling pathway. [score:4]
Thus, miR-27a might activate the expressions of β-catenin, GSK3β and Wnt in the Wnt/β-catenin signaling pathway. [score:3]
Consistent with these studies, our results showed a high expression of miR-27a in BC cells. [score:3]
Effect of miR-27a on the SFRP1 mRNA and protein expressions among the six groups. [score:3]
Association between miR-27a protein expression and clinicopathological features of patients with BC. [score:3]
During both proliferation and osteogenic differentiation, miR-27a could significantly decrease SFRP1 expression by activating Wnt/β-catenin signaling, which leading to an accumulation of β-catenin [10]. [score:3]
the control group, P = 0.032; the miR-27a inhibitors group vs. [score:3]
Meanwhile, SFRP1 wild and SFRP1 mutant plasmids were designed to express the wild and mutant loci of miR-27a binding to SFRP1 (Figure 4A). [score:3]
MicroRNA-27a (miR-27a), located on chromosome 19, has been shown to have an oncogenic function in carcinomas by targeting prohibitin [8]. [score:3]
The expression of miR-27a in normal mammary epithelial and BC cell lines. [score:3]
The miR-27a promotes proliferation, migration and invasion of human osteosarcoma cells, perhaps through the targeting of mitogen activated protein kinase kinase 4 (MAP2K4) [20]. [score:3]
A. comparisons of mRNA expressions of β-catenin, GSK3β and Wnt among the six groups (the miR-27a mimics group vs. [score:3]
The results demonstrated that the protein expression of β-catenin either in cytoplasm or in nucleus was increased by miR-27a (Figure 8D). [score:3]
The relative expression of miR-27a n may be closely correlated to clinical stage and LNM as well as to tumor size (all P < 0.001) (as shown in Table 1). [score:3]
In contrast to the miR-27a mimics group, the cell migration and invasion were significantly decreased in the miR-27a inhibitors group (P < 0.05). [score:3]
Expression of miR-27a was significantly higher in patients with distant metastasis than that in patients without distant metastasis (P < 0.001). [score:3]
Effect of miR-27a on SFRP1 mRNA and protein expressions in BC cells. [score:3]
These indicated an association between the expression level of SFRP1 with miR-27a. [score:3]
DNA fragments containing miR-27a -binding site in the 3’-untranslated regions (3’-UTR) of SFRP1 and fragments containing the mutant miR-27a -binding site were separately inserted into the luciferase reporter gene plasmid to obtain the SFRP1-WT (wild type) and SFRP1-MUT (mutant type) plasmids. [score:3]
The present study revealed that miR-27a increased expressions of related proteins to Wnt/β-catenin signaling pathway, such as β-catenin, GSK3β and Wnt. [score:3]
Therefore, we applied SYBR Green method to detect the relative expressions of miR-27a. [score:3]
Meanwhile, the migration and invasion of BC cells in the si- SFRP1 + miR-27a inhibitors group were lower than those in the si- SFRP1 group (Figure 7B, 7D). [score:3]
In order to verify that miR-27a reduces SFRP1 levels, TargetScan online database was used. [score:3]
Interestingly, secreted frizzled-related proteins 1 (sFRP1) were reported as a novel target of miR-27a contributing to bone metabolism in hFOB cells [10]. [score:3]
the control group, P = 0.019 for β-catenin mRNA, P = 0.026 for GSK3β mRNA, P = 0.037 for Wnt mRNA; the miR-27a inhibitors group vs. [score:3]
The mRNA and protein expressions of miR-27a and SFRP1 in normal breast and BC tissues, normal mammary epithelial and BC cell lines have been shown in the previous results. [score:3]
The expression of miR-27a in BC tissues and its association to clinicopathological features of BC patients. [score:3]
Therefore more studies are necessary to be conducted to provide a theoretical basis of miR-27a as a novel target for the diagnosis and treatment of BC. [score:3]
Lower expression of miR-27a was found in the normal mammary epithelial cell line (MCF10A) than in BC cell lines (MDA-MB-231, BT-20, MCF-7 and T-47D). [score:3]
Thus, miR-27a was over-expressed in BC cells and tissues. [score:3]
In comparison to the si- SFRP1 group, the si- SFRP1 + miR-27a inhibitors group also showed a significantly decreased cell proliferation (P < 0.05). [score:3]
In our study, we found that the expression of miR-27a in BC tissues was significantly higher than that of normal breast tissues. [score:3]
The quantitative real-time polymerase chain reaction (qRT-PCR) was performed to detect miR-27a expression in normal mammary epithelial and BC cell lines. [score:3]
the control group, P = 0.041 for wound-healing rate, P = 0.029 for invasive cell number; the miR-27a inhibitors group vs. [score:3]
The results revealed that both the miR-27a mimics and si- SFRP1 groups had evidently higher mRNA and protein expressions of β-catenin, GSK3β and Wnt than the control and NC groups. [score:3]
The expression level of miR-27 was related to LNM, late clinical stage and poor prognosis, indicating that it could be used as a molecular prognostic marker for BC progression [17]. [score:3]
The expression of miR-27a in normal mammary epithelial and BC cell lines as detected by. [score:3]
the control group, P = 0.027 for β-catenin protein, P = 0.035 for GSK3β protein, P = 0.046 for Wnt protein; the miR-27a inhibitors group vs. [score:3]
the control group, P = 0.029 for SFRP1 mRNA, P = 0.036 for SFRP1 protein; the miR-27a inhibitors group vs. [score:3]
Results indicated that SFRP1 was the downstream target gene of miR-27a. [score:3]
Results of RT-PCR revealed a remarkably higher expression of miR-27a in BC tissues than in normal breast tissues (P = 0.023) (Figure 1). [score:3]
Therefore, the role of miR-27a might be achieved through targeting SFRP1, which further activated the Wnt/β-catenin signaling pathway. [score:3]
Due to β-catenin's wide distribution in the cytoplasm and nucleus, the possible effects of miR-27a on the expressions of β-catenin in the cytoplasm and nucleus were also explored. [score:3]
the control group, P = 0.031 for β-catenin protein, P = 0.039 for GSK3β protein, P = 0.040 for Wnt protein; the miR-27a inhibitors + si-SFRP1 group vs. [score:3]
Effect of miR-27a on Wnt/β-catenin signaling pathway through targeting SFRP1. [score:3]
Relationship between miR-27a and SFRP1In order to verify that miR-27a reduces SFRP1 levels, TargetScan online database was used. [score:3]
Figure 8 A. comparisons of mRNA expressions of β-catenin, GSK3β and Wnt among the six groups (the miR-27a mimics group vs. [score:3]
The expression of miR-27a in normal breast and BC tissues as detected by. [score:3]
In line with these findings, the expression of miR-27a was closely associated with clinical stage, lymph node metastasis (LNM) and tumor size in this study. [score:3]
Additionally, miR-27a may promote the differentiation of osteoblasts through reducing the expression of SFRP1 at the transcriptional level [10]. [score:3]
No significant differences in the expression of miR-27a were found between patients older than 55-year-old and patients younger than 55-year-old, or between premenopausal patients and postmenopausal patients (both P > 0.05). [score:3]
the control group, P = 0.023 for β-catenin mRNA, P = 0.032 for GSK3β mRNA, P = 0.042 for Wnt mRNA; the miR-27a inhibitors + si-SFRP1 group vs. [score:3]
As an antineoplastic factor, miRNA-27a inhibited the Wnt/β-catenin signaling pathway to influence proliferation, migration and invasion ability of glioma cells [21]. [score:3]
the control group, P = 0.046); #, compared with the si-SFRP1 group, P < 0.05 (the miR-27a inhibitors + si-SFRP1 group vs. [score:2]
Although several researches have been carried out in order to explore the effect of miR-27a or Wnt/β-catenin signaling pathway on BC and the specific mechanisms [11, 12], it still remains unclear whether the role of miR-27 in proliferation and invasion of BC cells bears a relationship to the Wnt/β-catenin signaling pathway via the regulation of SFRP1. [score:2]
A. the binding site of miR-27a to SFRP1-3′UTR predicted by TargetScan online database; B. comparison of luciferase activity among the four groups detected by dual-luciferase reporter gene assay. [score:2]
the control group, P = 0.046 for wound-healing rate, P = 0.035 for invasive cell number); #, compared with the si- SFRP1 group, P < 0.05 (the miR-27a inhibitors + si-SFRP1 group vs. [score:2]
For our analyses we applied the SYBR Green method to detect miR-27a expression, because this method, when using high performance primers, proper protocols and material, can provide data as precise as the TaqMan method with less cost requirements and simpler operation [14]. [score:2]
Compared with three other BC cell lines (MDA-MB-231, BT-20 and MCF-7) and with MCF10A cell line, the T-47D cell line exhibited a higher expression of miR-27a (all P < 0.05). [score:2]
When compared with the miR-27a mimics group, the miR-27a inhibitors group showed a more remarkable decrease of cell proliferation (P < 0.05). [score:2]
the control group, P = 0.021 for SFRP1 mRNA, P = 0.022 for SFRP1 protein); #, compared with the si-SFRP1 group, P < 0.05 (the miR-27a inhibitors + si-SFRP1 group vs. [score:2]
MiR-27a mimics, inhibitors and its negative control (NC) oligonucleotides were synthesized by and siRNA SFRP1 (si- SFRP1) was bought from Shanghai GenePharma Co. [score:2]
Compared to MCF10A cell line, miR-27a expression in BC cell lines (BT-20, MCF-7, T-47D and MDA-MB-231) was increased, especially in T-47D cell line. [score:2]
Figure 4 A. the binding site of miR-27a to SFRP1-3′UTR predicted by TargetScan online database; B. comparison of luciferase activity among the four groups detected by dual-luciferase reporter gene assay. [score:2]
The results revealed that compared with control and NC groups, miR-27a mimics and si- SFRP1 groups showed reduced expressions of SFRP1 mRNA and protein (all P < 0.05). [score:2]
Thus, these results showed a negative correlation between SFRP1 and miR-27a (Figure 5B). [score:1]
A. effect of miR-27a on the migration of BC cells among the six groups; B. comparison of wound healing rate among the six groups; C. effect of miR-27a on the invasion of BC cells among the six groups; D. comparison of invasion cell number of BC into Transwell among the six groups. [score:1]
Effect of miR-27a on the proliferation of BC cells. [score:1]
Aside from this, BC cells were transfected with SFRP1 wild/mutant, miR-27a mimics/NC, and dual firefly and Renilla luciferase plasmid. [score:1]
Relationship between miR-27a and SFRP1. [score:1]
This study found that miR-27a promoted proliferation, migration and invasion of BC cells. [score:1]
Effect of miR-27a on the proliferation of BC cells among the six groups. [score:1]
Figure 7 A. effect of miR-27a on the migration of BC cells among the six groups; B. comparison of wound healing rate among the six groups; C. effect of miR-27a on the invasion of BC cells among the six groups; D. comparison of invasion cell number of BC into Transwell among the six groups. [score:1]
The miR-27a mimics and si- SFRP1 groups had increased cell proliferation than the control and NC groups (both P < 0.05). [score:1]
Note: normal breast tissues, n = 308; BC tissues, n = 396. miR-27a, microRNA-27a; BC, breast cancer;, quantitative real-time polymerase chain reaction. [score:1]
Figure 1 Note: normal breast tissues, n = 308; BC tissues, n = 396. miR-27a, microRNA-27a; BC, breast cancer;, quantitative real-time polymerase chain reaction. [score:1]
Then the amplified segment was implanted into the pGL3 vector to construct pGL3-WT- SFRP1-3′- UTR (SFRP1 wild) plasmid and pGL3-MUT- SFRP1-3’-UTR (SFRP1 mutant), which were the wild and mutant loci of miR-27a binding to SFRP1. [score:1]
Effect of miR-27a on migration and invasion of BC cells. [score:1]
However, limited studies concerned the effects of miR-27a on proliferation of BC cells, and none mentioned the specific mechanism. [score:1]
Effect of miR-27a on the migration and invasion of BC cells among the six groups. [score:1]
They were divided into four groups: WIT + mimics group (co -transfected with SFRP1 wild and miR-27a mimics), WIT + NC group (co -transfected with SFRP1 wild and negative control oligonucleotide), MUT + mimics group (co -transfected with SFRP1 mutant and miR-27a mimics), and MUT + NC group (co -transfected with SFRP1 mutant and negative control oligonucleotide). [score:1]
[1 to 20 of 105 sentences]
5
[+] score: 253
Other miRNAs from this paper: hsa-mir-106a, hsa-mir-27b
Intriguingly, TMEM170B levels were downregulated by miR-27a mimic, as well as upregulated by miR-27a inhibitor (Supplementary Fig.   1o and p). [score:9]
Together, these results suggest that miR-27a downregulates TMEM170B expression by directly targeting its 3′-UTR. [score:9]
Zhao N miR-27a-3p suppresses tumor metastasis and VM by down -regulating VE-cadherin expression and inhibiting EMT: an essential role for Twist-1 in HCCSci. [score:8]
TMEM170B, a direct target of miR-27a, is downregulated in breast cancer. [score:7]
In addition, overexpression of TMEM170B significantly slowed the cell migration and invasion of breast cancer cells in vitro (Fig.   4c and Supplementary Fig.   3c), while miR-27a inhibitor prevented the cell migration, invasion, and wound-healing mediated by TMEM170B overexpression in MDA-MB-231 cells (Fig.   4d and Supplementary Fig.   3d and f). [score:7]
TMEM170B as a direct target of miR-27a, is downregulated in breast cancer. [score:7]
Interestingly, neither TMEM170B nor miR-27a altered total GSK3β expression, but the levels of GSK3β phosphorylation was modulated by miR-27a (Fig.   5g, h), indicating that TMEM170B may directly regulate β-catenin expression independently of GSK-3β. [score:7]
In this study, using bioinformatics analysis of different public databases (including mRNA and miRNA sequencing data) combined with experimental assays, we confirmed that the transmembrane protein TMEM170B, is a novel direct target of miR-27a, and that it is significantly downregulated in breast cancer. [score:6]
Furthermore, miR-27a mimic and significantly increased the number of metastatic lung nodules in the TMEM170B knockdown groups (Fig.   4e), and miR-27a inhibitor significantly decreased the number of metastatic lung nodules in the TMEM170B overexpression groups in vivo (Fig.   4f). [score:6]
Emerging evidence has indicated that some miRNAs are abnormally expressed, and may function as onco-miRNAs or suppressor miRNAs in human cancers 10, 11. miRNA-27a belongs to the microRNA-27 family, and it is located at chromosome 19 [12]. [score:5]
In the TCGA cohort, miR-27a expression was also upregulated in the BRCA tissues compared to paired normal breast tissues (n = 104, Fig.   1b). [score:5]
Collectively, these results revealed that TMEM170B was a direct target of miR-27a, but there was no feedback regulation between TMEM170B and miR-27a. [score:5]
In some of the experiments, cells were also co -transfected with TMEM170B expression vector and miR-27a mimic or inhibitor. [score:5]
To further examine the role of miR-27a in breast cancer, we performed overexpression and knockdown functional assays in breast cancer cells using miR-27a mimic and inhibitor (Supplementary Fig.   1b and c). [score:5]
In contrast, miR-27a inhibitor further attenuated the cell proliferation and colony-formation ability, which was decreased by TMEM170B overexpression (Fig.   3d). [score:5]
However, expression of miR-27a mimic caused significantly strong inhibition of the activities of 3′-UTR luciferase reporter of TMEM170B gene, which did not occur with the mutant (MUT) reporter vector (Fig.   1i, k). [score:5]
However, no significant difference in miR-27a expression was detected after ectopic expression or deficiency of TMEM170B (Supplementary Fig.   1q and r). [score:5]
q, r Kaplan–Meier survival analysis of the overall survival in 1071 BRCA patients with different TMEM170B expression (q) or miR-27a/TMEM170B expression patterns (r). [score:5]
Thus, these results have prompted the search for the direct targets of miR-27a and an understanding of how the molecular regulation of the Wnt/β-catenin pathway occurs. [score:5]
To determine whether miR-27a targets these genes, we generated luciferase reporter plasmids that harbor miR-27a target sequences in the 3′-UTR of these genes. [score:5]
The overexpression of miR-27a significantly promoted the proliferation, migration, and invasion in MCF7 cells (low metastatic cells, Fig.   1e, g and Supplementary Fig.   1d), whereas the knockdown of miR-27a significantly attenuated the cell proliferation, migration, and invasion in MDA-MB-231 cells (high metastatic cells, Fig.   1f, h and Supplementary Fig.   1e). [score:4]
c, d Migration assays of MDA-MB-231 cells with overexpressing TMEM170B without (c) or with (d) the miR-27a inhibitor. [score:4]
Consistent with the in vitro results, miR-27a negatively regulated the suppressive function of TMEM170B (62% vs. [score:4]
CTRL We measured Wnt signaling in breast cancer cells after stable overexpression or knockdown of TMEM170B, which is a direct target of miR-27a, to investigate the regulation of TMEM170B on the Wnt/β-catenin pathway. [score:4]
In conclusion, our results revealed that TMEM170B, as a functional target of miR-27a, is important for balancing the deregulation of Wnt/β-catenin signaling in breast cancer. [score:4]
We first analyzed multiple miRNA expression profiling data sets of breast tumor samples (NCBI/GEO/GSE 26659/40525/68085), and we found that miR-27a was significantly overexpressed in breast cancer compared with normal breast tissues (Fig.   1a). [score:4]
New evidence indicates that miRNA-27a is abnormally expressed and regulates epithelial–mesenchymal transition and metastasis in various cancers 13– 15. [score:4]
CTRL We first analyzed multiple miRNA expression profiling data sets of breast tumor samples (NCBI/GEO/GSE 26659/40525/68085), and we found that miR-27a was significantly overexpressed in breast cancer compared with normal breast tissues (Fig.   1a). [score:4]
Colangelo T Proteomic screening identifies calreticulin as a miR-27a direct target repressing MHC class I cell surface exposure in colorectal cancerCell Death Dis. [score:4]
CTRLWe then performed rescue experiments to determine whether miR-27a can functionally target TMEM170B, and to further demonstrate the importance of the miR-27a/TMEM170B axis in the progression of breast cancer. [score:3]
de) to further predict the targets of miR-27a. [score:3]
The sequence of the miR-27a -binding site within TMEM170B 3′-UTR was depicted by the Targetscan webset (Supplementary Fig.   1l). [score:3]
d The miR-27a expression of the breast cancer cells were detected by real-time PCR. [score:3]
As shown in TCGA cohort, statistical analysis represented a strong correlation between miR-27a expression and TMEM170B levels with clinical M stage (P = 0.007), ER status (P < 0.001), PR status (P = 0.001), and Her2 status (P < 0.001). [score:3]
All siRNAs, miRNA-27a mimic and inhibitor (GenePharma Co. [score:3]
By using these luciferase reporter plasmids, we found that miR-27a mimic did not significantly inhibit the activities of 3′-UTR luciferase reporters of GPAM, PPAP2B, ST6GALNAC3, EYA1, or PPARG gene (Supplementary Fig.   1g–k). [score:3]
Our analysis showed that miR-27a expression in TNBC patients was higher than that in non-TNBC patients (Supplementary Fig.   5d), whereas TMEM170B levels in breast cancer patients with TNBC were lower than that in non-TNBC patients (Supplementary Fig.   5e). [score:3]
cn/) to obtain the decreased genes of predicted top100 targets of miR-27a in BRCA. [score:3]
Fig. 1 a Expression profiles of miRNA-27a in primary breast cancer and normal breast tissues of published GEO profiles (NCBI/GEO/GSE 26659/40525/68085). [score:3]
b Differential expression of miR-27a in breast cancer and paired adjacent noncancerous tissues from the TCGA database. [score:3]
e, f Cell proliferation of MCF7 cells transfected with miR-27a mimic (e) or MDA-MB-231 cells with miR-27a inhibitor (f). [score:3]
c Kaplan–Meier survival analysis of the overall survival in 1071 BRCA patients with different miR-27a expression. [score:3]
The potential targets of miR-27a were obtained from miRDB data sets (http://www. [score:3]
a Expression profiles of miRNA-27a in primary breast cancer and normal breast tissues of published GEO profiles (NCBI/GEO/GSE 26659/40525/68085). [score:3]
CTRL We then performed rescue experiments to determine whether miR-27a can functionally target TMEM170B, and to further demonstrate the importance of the miR-27a/TMEM170B axis in the progression of breast cancer. [score:3]
Based on the combination of various bioinformatics analyses and dual-luciferase assays, we unexpectedly discovered that TMEM170B was a new direct target of miR-27a. [score:3]
Knockdown of TMEM170B significantly promoted the cell migration and invasion ability (Fig.   4a and Supplementary Fig.   3a), whereas miR-27a mimic further augmented the cell migration, invasion, and wound-healing mediated by TMEM170B knockdown in MCF7 cells (Fig.   4b and Supplementary Fig.   3b and e). [score:3]
We performed bioinformatics analysis of the data from the miRDB, Targetscan, Pictar, and miRanda websets to explore the molecular mechanism of miR-27a as an oncogenic molecule in breast cancer, and found that six genes are overlapped, namely TMEM170B, GPAM, PPAP2B, ST6GALNAC3, EYA1, and PPARG (Supplementary Fig.   1f). [score:3]
p The correlation of TMEM170B and miR-27a expression in TCGA cohort. [score:3]
d, e Relative expression of miR-27a in the indicated MCF7 cell clones (d) and MDA-MB-231 cell clones (e). [score:3]
Consistent with the functional results, miR-27a had a negative role in the molecular regulation of TMEM170B. [score:2]
g, h Cell migration assays of MCF7 cells transfected with miR-27a mimic (g) or MDA-MB-231 cells with miR-27a inhibitor (h). [score:2]
miR-27a as a negative regulator of TMEM170B in breast cancer growth. [score:2]
Thus, understanding the function of TMEM170B and the signaling pathway connected with the miR-27a/TMEM170B axis are essential for the development of more effective strategies for treating breast cancer malignancy. [score:2]
Real-time PCR analysis showed that miR-27a expression was markedly increased in the breast cancer cells compared with the normal mammary cells MCF10A (Fig.   1d and Supplementary Fig.   1a). [score:2]
Interestingly, miR-27a, and not TMEM170B altered the phosphorylation state of GSK3β, indicating that miR-27a may involve other cross-talk points to regulate the Wnt/β-catenin pathway. [score:2]
In addition, using StarBase 2.0, we found that TMEM170B expression in the BRCA samples with low miR-27a levels was significantly increased compared with those with high miR-27a levels (Supplementary Fig.   1n). [score:2]
Moreover, Kaplan–Meier analysis revealed that the BRCA patients with high miR-27a levels had worse OS time (15% vs. [score:1]
l RNA pull-down analysis of relative fold enrichment of TMEM170B using biotin-labeled miR-27a or fold enrichment of miR-27a using biotin-labeled TMEM170B. [score:1]
Moreover, RNA immunoprecipitation (RIP) assays showed that miR-27a directly bound to TMEM170B mRNA (Fig.   1m, n) in the RNA -induced silencing complex (RISC). [score:1]
k The luciferase reporter activity in 293T cells transfected with miR-27a mimic or control and luciferase reporters containing TMEM170B wild type or mutant. [score:1]
TMEM170B was pulled down by the biotin-labeled miR-27a, but not the miR-27a mutant. [score:1]
Consistently, a significantly negative correlation was observed between TMEM170B and miR-27a in the BRCA tumors (r = −0.714, P < 0.0001, Fig.   1p). [score:1]
In addition, previous studies have shown that miR-27a is an activator of the Wnt signaling pathway [16]. [score:1]
Due to previous publications on the relationship between miR-27a and Wnt signaling, it is known that aberrant Wnt/β-catenin pathway activation initiates transcriptional activation of proteins that are responsible for tumor cell proliferation and metastasis [28]. [score:1]
Fig. 4 a, b Cell migration assay of MCF7 cells with TMEM170B knockdown without (a) or with (b) miR-27a mimic. [score:1]
Breast cancer cells pull-down experiments with biotinylated miR-27a or biotinylated TMEM170B (GenePharma, China) were conducted as described previously 35, 36. [score:1]
CTRL a, b Cell migration assay of MCF7 cells with TMEM170B knockdown without (a) or with (b) miR-27a mimic. [score:1]
41% for MDA-MB-231 xenografts, P < 0.01, Fig.   3e–h), indicating that the miR-27a/TMEM170B axis may be a critical factor that drives tumorigenesis in breast cancer. [score:1]
Wang T Xu Z miR-27 promotes osteoblast differentiation by modulating Wnt signalingBiochem. [score:1]
All of these results showed that the miR-27a levels were positively associated with breast cancer cell proliferation, migration, and invasion. [score:1]
Acunzo M Cross-talk between MET and EGFR in non-small cell lung cancer involves miR-27a and Sprouty2Proc. [score:1]
The functional assays showed that miR-27a mimic specifically aggravated the cell proliferation and colony-formation ability, which were promoted by TMEM170B knockdown (Fig.   3c). [score:1]
In addition, the specific interaction between miR-27a and TMEM170B was further verified using the biotin-avidin pull-down system (Fig.   1j). [score:1]
In a reciprocal manner, miR-27a was also precipitated by wild-type TMEM170B but not by the TMEM170B mutant (Fig.   1l). [score:1]
Moreover, the BRCA patients with the low TMEM70B and high miR-27a levels had the worst OS ratio (10%, P < 0.001, Fig.   1r). [score:1]
[1 to 20 of 76 sentences]
6
[+] score: 242
MiR-27a modulated MDR1/P-glycoprotein expression in human ovarian cancer cells by targeting HIPK2 [23] and Down-regulation of miR-27a might reverse multidrug resistance of esophageal squamous cell carcinoma through regulation of MDR1 and apoptosis [24]. [score:9]
Taken together, these results suggest that miR-27a down-regulates RKIP expression by directly targeting its 3′UTR. [score:9]
By employing open access softwares (TargetScan and PicTarget), RKIP was chosen as a preferred candidate target gene of miR-27a because of the putative binding site within its 3′UTR (Figure  4A) and lower RKIP protein expression in A549/CDDP cells (Figure  4B). [score:9]
Our results suggest that up-regulation of miR-27a could suppress RKIP expression and in turn contribute to chemoresistance of lung adenocarcinoma cells to cisplatin. [score:8]
Further studies identified Raf Kinase Inhibitory Protein (RKIP) as a direct and functional target of miR-27a. [score:6]
Next we explored the roles of miR-27a and its target Raf Kinase Inhibitory Protein (RKIP) in regulating cisplatin resistance and metastasis in lung adenocarcinoma. [score:6]
Small interfering RNA -mediated RKIP knockdown revealed similar effects as that of ectopic miR-27a expression, while overexpression of RKIP attenuated the function of miR-27a in lung adenocarcinoma cells. [score:6]
Relatively, downregulation of miR-27a by inhibitors in A549/CDDP cells led to a moderate increase of RKIP protein level (Figure  4C). [score:6]
As shown in Figure  6D, Patients with high miR-27a expression showed significantly shorter overall survival than those with low miR-27a expression (P < 0.01). [score:5]
miR-27a mimics and negative control mimics (NC), miR-27a inhibitors (anti-miR-27a) and negative control inhibitors (anti-NC) and RKIP siRNAs were synthesized by GenePharma Company (Shanghai, China). [score:5]
Wild-type 3′untranslated region (3′UTR) of RKIP containing predicted miR-27a target sites were amplified by PCR from A549 cell genomic DNA. [score:5]
On the other hand, silencing miR-27a expression in A549/CDDP cells using anti-sense oligonucleotides reduced vimentin and increased the expression of E-cadherin (Figure  2A). [score:5]
Increased miR-27a expression was also detected in tumor tissues sampled from lung adenocarcinoma patients treated with cisplatin -based chemotherapy and was proved to be correlated with low expression of RKIP, decreased sensitivity to cisplatin, and poor prognosis. [score:5]
Ectopic expression of RKIP partially rescued miR-27a -mediated EMT and cisplatin resistance in miR-27a -overexpressing cells (Figure  5B). [score:5]
Furthermore, miR-27a inhibitors synergistically suppressed the invasion of A549/CDDP cells (Figure  2B). [score:5]
As shown in Figure  2A, miR-27a mimics increased vimentin, but suppressed E-cadherin expression in A549 cells. [score:5]
In conclusion, we have reported the altered expression of miR-27a in human lung adenocarcinoma cell lines with different sensitivities to cisplatin, and have shown that miR-27a could modulate cisplatin resistance and metastasis in these cells by targeting RKIP. [score:5]
Based on the miRNA microarray data, 13 miRNAs were found to be differentially expressed (>2-fold change) in A549/CDDP cells compared with A549 cells (Additional file 1: Table S1), among which miR-27a was the most up-regulated one (5.6-fold change). [score:5]
High expression of miR-27a in lung adenocarcinoma tissues is associated with decreased RKIP expression, chemotherapeutic resistance, and poor prognosis. [score:5]
Data are means of three separated experiments ± SD; * P < 0.01. miR-27a regulates response of lung adenocarcinoma cells to cisplatin in vivoTo investigate the effect of miR-27a expression on chemosensitivity of lung adenocarcinoma in vivo, A549 cells stably expressing miR-27a by lentivirus were subcutaneously inoculated into nude mice. [score:4]
To verity whether RKIP is the direct downstream target of miR-27a, a fragment of RKIP 3′UTR containing the putative miR-27a binding site was cloned into a luciferase reporter vector. [score:4]
Figure 4 RKIP is a direct target of miR-27a. [score:4]
miR-27a directly targets RKIP. [score:4]
Therefore, upregulation of miR-27a may play an important role in chemotherapy -induced EMT of lung adenocarcinoma cells. [score:4]
Western blot showed that overexpression of miR-27a in A549 cells significantly repressed RKIP protein expression compared to cells transfected with negative control (Figure  4C). [score:4]
Collectively, these data suggest that miR-27a regulate chemoresistance of lung adenocarcinoma cells at least in part by targeting RKIP. [score:4]
Furthermore, upregulation of miR-27a is correlated with cisplatin resistance and poor prognosis of lung adenocarcinoma patients. [score:4]
Here we identified RKIP as the functional target, through which miR-27a regulates metastasis and chemoresistance. [score:4]
In the current study, we demonstrate that upregulation of miR-27a is critical for cisplatin resistance and tumor metastasis of lung adenocarcinoma cells both in vitro and in vivo, and miR-27a induces mesenchymal features and promotes tumor metastasis of chemoresistant lung adenocarcinoma via silencing RKIP. [score:4]
Luciferase reporter assays showed that up-regulation of miR-27a significantly decreased the relative luciferase activity of RKIP 3′UTR in A549 cells, but had no effect on the mutant of RKIP 3′UTR (Figure  4D). [score:3]
We then analyzed the association of miR-27a expression with survival of patients. [score:3]
In contrast, suppression of the miR-27a level in A549/CDDP cells resulted in an enhanced sensitivity to cisplatin (Figure  2D). [score:3]
To better understand the association between miR-27a and RKIP expression, a total of 30 clinical tumor tissue samples were collected from patients with advanced lung adenocarcinoma and divided into [“]sensitive [”] and [“]insensitive [”]groups according to the patient’s response to cisplatin -based chemotherapy. [score:3]
Figure 6 The inverse correlation between miR-27a and RKIP expression in lung adenocarcinoma tissue samples and the clinical significance of miR-27a are shown. [score:3]
miR-27a was significantly up-regulated in cisplatin-resistant lung adenocarcinoma A549/CDDP cells compared with parental A549 cells. [score:3]
Herein, our observation that increased miR-27a expression is associated with chemotherapy resistance, and poor patient prognosis may provide surrogates to predict the chemotherapeutic sensitivity for lung adenocarcinoma. [score:3]
Relative expression levels of (A) miR-27a and (B) RKIP mRNA were detected in cisplatin-sensitive (n =13) and insensitive (n = 17) lung adenocarcinoma tissues via qRT-PCR. [score:3]
Next, we engineered A549/CDDP cells to stably inhibit miR-27a with a lentivirus -mediated antagomir. [score:3]
The results showed that suppression of miR-27a decreased the number of lung metastases (Figure  3B). [score:3]
As shown in Figure  6A, miR-27a was significantly up-regulated in the [“]insensitive [”]group tissues (n = 17) compared with that in the [“]sensitive [”]group ones (n = 13). [score:3]
For in vivo chemosensitivity and metastasis assays, A549 cells (infected with either the miR-27a -overexpressing lentivirus or the mock lentivirus) and A549/CDDP cells (infected with either the miR-27a-knockdown lentivirus -mediated antagomir or the antagomir-NC) were subcutaneously inoculated into nude mice (six per group, 1 × 10 [6] cells for each mouse). [score:3]
Moreover, miR-27a plays an important role in mediating drug resistance by targeting multiple drug-resistance related genes. [score:3]
To investigate the association of miR-27a expression with lung adenocarcinoma chemoresistance against cisplatin, A549 and A549/CDDP cells were transfected with miR-27a mimics and miR-27a inhibitors respectively. [score:3]
The inverse correlation between miR-27a and RKIP mRNA expression was verified by linear regression analysis (r = −0.691, P < 0.01) (Figure  6C). [score:3]
A549 cells were transfected with NC or miR-27a mimics, A549/CDDP cells were transfected with anti-NC or miR-27a inhibitors respectively. [score:3]
To investigate the effect of miR-27a expression on chemosensitivity of lung adenocarcinoma in vivo, A549 cells stably expressing miR-27a by lentivirus were subcutaneously inoculated into nude mice. [score:3]
miR-27a promotes EMT and cisplatin resistance in vitroTo investigate the association of miR-27a expression with lung adenocarcinoma chemoresistance against cisplatin, A549 and A549/CDDP cells were transfected with miR-27a mimics and miR-27a inhibitors respectively. [score:3]
Finally, we correlated the expression of miR-27a and RKIP with the chemotherapeutic status and prognosis of lung adenocarcinoma patients. [score:3]
In this study, we observed that miR-27a is significantly upregulated in cisplatin-resistant human lung adenocarcinoma A549/CDDP cells compared with parental A549 cells. [score:3]
Therefore, targeting miR-27a-RKIP interaction may be a potential strategy for reversing chemoresistance in human lung adenocarcinoma. [score:3]
Figure 3 miR-27a regulates response of lung adenocarcinoma cells to cisplatin in vivo. [score:2]
MiR-27a is located at chromosome 19 and has been shown to be overexpressed in breast cancer, gastric cancer and cervical cancer [17– 19]. [score:2]
miR-27a regulates response of lung adenocarcinoma cells to cisplatin in vivo. [score:2]
Our results show that miR-27a has the potential as key regulatory factors for the chemotherapy resistance and metastasis of lung adenocarcinoma. [score:2]
miR-27a regulates epithelial-mesenchymal transition (EMT) and cisplatin resistance in vitro and modulates response of lung adenocarcinoma cells to cisplatin in vivo. [score:2]
These results suggested that miR-27a could regulate the response to cisplatin in vivo. [score:2]
As shown in Figure  3A, the number of lung metastasis nodules was dramatically increased in miR-27a overexpression group when compared with control. [score:2]
We further establish miR-27a-RKIP as another important pathway regulating EMT and chemoresistance of lung adenocarcinoma cells. [score:2]
Despite the oncogenic role of miR-27a has been implicated by previous studies, the role of miR-27a in lung cancer chemotherpy and molecular mechanisms are not known. [score:1]
miR-27a RKIP Lung adenocarcinoma Cisplatin Chemoresistance Lung cancer is the leading cause of cancer-related death among men and women worldwide, Approximately 70%-80% of lung cancers are non-small cell lung cancer (NSCLC), including squamous cell carcinoma, adenocarcinoma, and large cell carcinoma [1, 2]. [score:1]
RKIP is involved in miR-27a -induced EMT and cisplatin resistance. [score:1]
These findings provide new insights into the molecular functions of miR-27a as well as the role of RKIP in chemotherapeutic resistance. [score:1]
To further examine whether RKIP is involved in miR-27a -induced chemoresistance, we performed loss-of-function and gain-of-function analyses. [score:1]
miR-27a promotes EMT and cisplatin resistance in vitro. [score:1]
In gastric cancer cells, miR-27a promots cell growth and metastasis both in vitro and in vivo [20, 21]. [score:1]
We detected miR-27a expression in two lung adenocarcinoma cell lines, A549 and A549/CDDP, and then investigated the effects of miR-27a on the metastasis and the chemosensitivity of cancer cells, using both gain- and loss-of-function studies. [score:1]
Figure 2 miR-27a promotes EMT and cisplatin resistance in vitro. [score:1]
[1 to 20 of 67 sentences]
7
[+] score: 237
Figure 5miR-27a* expression reduces tumor growth in vivo and direct intratumoral injection reduces tumor growth (A) Orthotopic xenografts of 22B cells expressing miR-27a* (pSuper-27a*) show reduced growth compared to control vector (pSuper); * at day 16 indicates point at which differences in tumor volume became statistically significant, p<0.05; (B) Tumor growth curve of 22B cells with inducible miR-27a* expression. [score:7]
Inhibition of miR-27a* did not significantly affect cell viability, but did result in a slight increase in targeted protein expression. [score:7]
Figure 4 (A) The effect of miR-27a* on cell viability is decreased in 22A and 22B cells by overexpression of EGFR, AKT1 and mTOR 48 hrs prior to miR-27a* expression as compared to control vector, *p<0.01; (B) Overexpression following transfection with EGFR, AKT1 and mTOR (EAmT) vectors was confirmed by immunoblot analysis. [score:6]
22B-pSuper-27a* constitutively expresses miR-27a* and decreases the expression of EGFR, AKT1, and mTOR. [score:5]
Given that miR-7 has known interactions with EGFR as both a tumor suppressor and oncogene [25, 29], but did not show an effect on cell viability in HNSCC, we postulated that miR-27a* targets additional genes in the EGFR signaling axis to reduce cell survival. [score:5]
Coordinated Downregulation of EGFR, AKT1 and mTOR is the Result of Independent, Direct Interactions with miR-27a*. [score:5]
This suggests differential expression of miR-27a target genes across multiple tumor types and divergent functional effects. [score:5]
In vivo Expression and Delivery of miR-27a* Reduces HNSCC Tumor GrowthIn order to assess the therapeutic potential of miR-27a* in a preclinical mo del, we created cell lines that stably express miR-27a*. [score:5]
Although miR-27a* targets EGFR, AKT1 and mTOR directly and independently within the EGFR signaling pathway, the specific effect of those regulatory events on the overall decreased viability of HNSCC cells has not been established. [score:5]
miR-27a* Inhibits Expression of Multiple EGFR Signaling Axis Components. [score:5]
Finally, by targeting several components of the EGFR axis, miR-27a* may enhance the effect of existing treatment options and possibly provide therapeutic benefits to patients with EGFR -inhibitor resistant cancers. [score:5]
miR-27a* coordinately downregulates the EGFR signaling axis via independent direct interactions with EGFR, AKT1, and mTOR. [score:5]
Although miR-27a demonstrated decreased expression in HNSCC as compared to normal tissues, analysis of the matched samples did not demonstrate significantly decreased expression in the tumors (Fig. S1B). [score:4]
miR-27a* expression reduces tumor growth in vivo and direct intratumoral injection reduces tumor growth. [score:4]
We examined the expression of the candidate miRNAs in HNSCC cell lines by quantitative real-time polymerase chain reaction (qRT-PCR) and found that only miR-27a and −27a* had significantly decreased expression as compared to normal oral keratinocyte cell lines (Fig. 1C). [score:4]
Having demonstrated coordinate downregulation of the EGFR signaling axis, we analyzed the functional effects of miR-27a* in HNSCC. [score:4]
In conclusion, we have identified miR-27a* as a regulator of multiple targets within the EGFR signaling axis. [score:4]
miR-27a* and miR-27a Are Downregulated in HNSCC Cells and Tissues. [score:4]
Transfection of E3908-pGL3 (WT) and miR-27a* decreased luciferase activity, but transfection of MT and miR-27a* did not, confirming that direct miR-27a* interaction with the 3'UTR contributes to decreased EGFR expression. [score:4]
To verify a direct interaction between miR-27a* and its target genes, we created reporter plasmids with inserted sequences from EGFR, AKT1 or mTOR downstream of a luciferase gene. [score:4]
These results confirm a direct interaction between miR-27a* and its respective targets EGFR, AKT1, and mTOR. [score:4]
MiR-27a was previously described as an oncogenic miRNA in pancreatic and bronchial cells [36, 37]; however, our results show that miR-27a is downregulated in HNSCC and its re-introduction into HNSCC cells does not have a pro-tumorigenic effect. [score:4]
Values normalized to OKF-6, p<0.005; (D) Analysis of miR-27a* RNA in human HNSCC and normal mucosal specimens by qRT-PCR revealed an overall decrease in miR-27a* expression levels in HNSCC, p<0.0001; (E) Comparison of miR-27a* levels in matched normal/HNSCC tissue pairs demonstrated decreased expression in the tumors as compared to matched normal tissue, p<0.01. [score:4]
Further in silico analysis identified AKT1 and mTOR as additional targets of miR-27a* (Fig. 3A). [score:3]
Overexpression of EGFR axis signaling components reverses the loss of HNSCC cell viability mediated by miR-27a*, which increases apoptosis and reduces migration. [score:3]
Cells were transfected with miRNA mimics (Ambion), miRNA inhibitors (Dharmacon) and the synthesized miR-27a step-loop structure (Dharmacon) using Lipofectamine 2000 (Invitrogen) per the manufacturer's instruction. [score:3]
Additionally, we employed an antagomir, miR-27a* -inhibitor (miR-27a*-IH), to assess potential loss-of-function effects [28]. [score:3]
This report reveals the tumor suppressive properties of miR-27a* (miR-27a-5p) acting upon the EGFR signaling axis at three independent points, resulting in decreased tumorigenicity in vitro and in vivo. [score:3]
Figure 1(A) Identification of specific miR-27a(), −27a*(), −27b(), −27b*(#), −7(), −128() candidate binding sites within EGFR mRNA using in silico screening methods; (B) Hairpin representation of the pre-miR-27a with the sequences of miR-27a* (green) and miR-27a (magenta) highlighted; (C) Decreased expression of mature miR-27a and −27a* by qRT-PCR in 10 HNSCC cell lines and normal oral keratinocytes (OKF-6 and HOK16B). [score:3]
However, expression of these EGFR signaling pathway components did not completely abrogate the effect of miR-27a* on HNSCC cell viability. [score:3]
Establishment of miR-27a* expressing cell lines. [score:3]
miR-27a* has putative binding sites in EGFR mRNA and shows decreased expression in HNSCC cell lines and human tumor tissues. [score:3]
Thus, these findings suggest that the effect of miR-27a* expression on HNSCC cell viability was related, at least in part, to the EGFR signaling pathway. [score:3]
22B-pSingle-27a* contains an inducible vector system resulting in miR-27a* expression when treated with doxycycline. [score:3]
EGFR, AKT1 and mTOR CDS expression vectors were transfected into HNSCC cells prior to the introduction of miR-27a*. [score:3]
Inhibition of the EGFR Signaling Axis by miR-27a* Increases Apoptosis and Decreases Cellular Migration in HNSCC. [score:3]
In order to assess the therapeutic potential of miR-27a* in a preclinical mo del, we created cell lines that stably express miR-27a*. [score:3]
Since miR-27a and 27b had the same seed region sequence, their target sites were the same. [score:3]
We also observed a trend toward decreased miR-27a* expression with advanced tumor stage (p=0.056). [score:3]
Most importantly, miR-27a* demonstrated a tumor-suppressive function that miR-27a did not exhibit in HNSCC cells, which may potentially be the result of an alteration in the processing machinery. [score:3]
In contrast, miR-27a and −7 decreased EGFR expression without modulation of AKT1 or mTOR (Figs. 3B and 3C). [score:3]
Four potential binding sites were identified for miR-27a* in the 3'-untranslated region (3'UTR) and three in the coding DNA sequence (CDS). [score:3]
Inhibits the Effect of miR-27a* on HNSCC Cell Viability. [score:3]
Thus, utilizing miR-27a* expression as a treatment option for HNSCC may be more effective and result in fewer unintended consequences. [score:3]
Based on these findings, we hypothesized that miR-27a* and/or −27a suppression might contribute to the malignant phenotype and that re-introduction of these miRNAs into HNSCC cells might alter tumor behavior. [score:3]
Figure 3(A) Further in silico screening of downstream members of the EGFR signaling axis, identified 5 putative binding sites for miR-27a* (black bars) on AKT1 and 11 binding sites for miR-27a* on mTOR; (B) Immunoblot shows decreased EGFR expression after the transfection of miR-27a*, −27a and −7 precursors. [score:3]
In HOK16B, EGFR expression was decreased by miR-27a* and slightly increased by miR-27a*-IH. [score:3]
One group of mice was treated with doxycycline (Doxy) to induce miR-27a* expression after tumors developed (day 0). [score:3]
Overexpression of EGFR signaling pathway components decreased the overall effect of miR-27a* on HNSCC cell viability, suggesting the possibility that other signaling pathways may also be affected by miR-27a*. [score:3]
In vivo Expression and Delivery of miR-27a* Reduces HNSCC Tumor Growth. [score:3]
decreased the effect of miR-27a* expression on HNSCC cell viability as compared to control vector alone (Fig. 4A). [score:2]
MiR-27a, −27b and −7 were predicted to have two target sites in the 3'UTR and one in the CDS. [score:2]
Analysis of this cohort demonstrated a consistent pattern of significantly decreased miR-27a* expression in HNSCC tumor specimens compared to normal tissues (Fig. 1D). [score:2]
These findings were confirmed with analysis of protein expression in HNSCC cells transfected with miR-27a*, resulting in reduced protein levels of EGFR, AKT1 and mTOR compared to miR-control (Control). [score:2]
Taken together, these results demonstrate post-transcriptional regulation of EGFR, AKT1, and mTOR by miR-27a*. [score:2]
These findings will drive future studies to examine other pathways regulated by miR-27a* and to understand potential loss-of-function effects related to miR-27a*. [score:2]
Increased miR-27a* expression was confirmed by qRT-PCR in the tumors of the doxycycline -treated animals as compared to the control animals (Fig. 5C). [score:2]
MiR-27a* expression significantly reduced the growth and viability of HNSCC in a preclinical mo del. [score:2]
To assess the delivery of miR-27a* in vivo, 17B oral tumors were directly injected with PBS, pSuper-empty, or pSuper-27a*, all mixed with liposome at a ratio of 5:1 [46, 47]. [score:2]
MiR-27a* simultaneously decreases expression of EGFR, AKT1, and mTOR leading to decreased solid tumor viability. [score:2]
Transfection of HNSCC cells with miR-27a*-IH slightly increased EGFR, AKT1 and mTOR expression as compared to miR-27a* and -Control (Fig. S3B). [score:2]
Combined with the viability assays, these results expand the tumor suppressive functions of miR-27a* to include apoptosis and impaired migration in HNSCC cells. [score:2]
To verify that the effects on cell viability were specific to miR-27a*, we transfected the miR-27a stem-loop structure (miR-27a-SL; Fig. 1B), which is processed into miR-27a and miR-27a*, in HNSCC and oral keratinocyte cells (Fig. S2B). [score:1]
We then transfected the miRNA mimics into pancreatic, breast, prostate, and endometrial carcinoma cell lines and observed decreased cell viability with miR-27a*, but not miR-27a and −7 (Fig. 2C), suggesting the biologic effects of miR-27a* are not restricted to HNSCC. [score:1]
The interaction of miR-27a* with the CDS of the EGFR sequence, as observed in our work, appears to be the first example of this interaction in human cells. [score:1]
miR-27a* transfection decreases cell viability in HNSCC cells and other solid tumor types. [score:1]
Cell cycle analysis indicated a marked increase in the sub-G1 apoptotic fraction (Figs. S4B and S4C) and Annexin V staining showed a significant increase in both early and late apoptotic cells, following miR-27a* transfection but not transfection of miR-27a and −7 (Figs. 4C and S4A). [score:1]
Although there was a decrease in cell viability in HNSCC cells with miR-27a-SL, the effect was not as dramatic as with miR-27a* alone and there was no significant effect of miR-27a*, −27a or miR-27a-SL on HOK16B cells. [score:1]
Transfection of these EGFR reporter constructs and miR-27a* in HNSCC cells showed that the candidate binding site in E160-pGL3 was not functional (Fig. S3C). [score:1]
Cell viability in the HNSCC or HOK16B cells was not affected by miR-27a*-IH (Fig. S2C). [score:1]
The mature miR-27a* sequence was synthesized (Sigma Aldrich) and inserted into pSuper (Oligoengine) and pSingle (Clontech). [score:1]
Evaluation of matched normal and tumor samples (n=7 pairs) also showed significantly decreased miR-27a* expression in the tumors (Fig. 1E). [score:1]
We also assessed the potential for exogenous delivery of miR-27a* to affect the growth of 17B cells in vivo by local delivery of miR-27a* using a liposomal vehicle. [score:1]
This theory is supported by our studies as miR-27a* transfection into HNSCC cells had significant functional effects while its complementary strand, miR-27a, did not. [score:1]
Moreover, we confirmed the effect of miR-27a* on mRNA levels by qRT-PCR (Fig. S3A). [score:1]
Similarly, studies with E2145-pGL3 (WT) and (MT) demonstrated miR-27a* interactions with the 2 distal binding sites in the CDS (Fig. 3E). [score:1]
We used software prediction programs to identify candidate binding sites of miRNAs within the EGFR gene and identified miR-7, −27a (miR-27a-3p), −27a*, −27b (miR-27b-3p), −27b* (miR-27b-5p), and −128 (Fig. 1A). [score:1]
These results suggest that miR-27a* alters HNSCC tumor growth in vivo and can serve as a potential therapeutic regimen in the treatment of patients with HNSCC. [score:1]
We confirmed these findings by evaluating the expression of miR-27a* in patients with HNSCC. [score:1]
Reporter constructs for the 3'UTR of AKT1 and mTOR (Fig. S3D) demonstrated similar decreased transcriptional activity when introduced into HNSCC cells along with miR-27a* (Fig. S3E). [score:1]
Similarly, miR-27a*-IH did not affect luciferase activity with the E3908-pGL3 (WT), AKT1-pGL3, mTOR-pGL3 or MT counterparts (Fig. S3F). [score:1]
Nevertheless, our current studies suggest that miR-27a* is an attractive therapeutic option for the treatment of solid tumors. [score:1]
PARP cleavage verified the increase in apoptosis following transfection of miR-27a* into HNSCC cells (Fig. 4D). [score:1]
miR-27a* Decreases Cell Viability in HNSCC and Other Solid Tumors. [score:1]
This analysis suggested that miR-27a* levels may be significantly altered in HNSCC and perhaps related to prognostic clinical features. [score:1]
[1 to 20 of 85 sentences]
8
[+] score: 232
The results consistent with the HLECs lymphatic tube formation and cell migration SMAD4 is a target of miR27 in HLECsTo identify possible miR-27a targets in lymphangiogenesis, we conducted microRNA target prediction with wi dely used tools, including DIANA, TargetScan, and PITA. [score:9]
We then applied real-time qRT-PCR to validate the expression of two up-regulated miRNAs (hsa-miR-27a-3p and hsa-miR-146a-5p) and two down-regulated miRNAs (hsa-miR-20b-3p and hsa-miR-519e-5p) from the HLEC and colon cancer cell co-culture system. [score:9]
Second, overexpression of an miR-27a mimic and an miR-27a inhibitor down- and up-regulated SMAD4 protein levels, respectively. [score:8]
To identify possible miR-27a targets in lymphangiogenesis, we conducted microRNA target prediction with wi dely used tools, including DIANA, TargetScan, and PITA. [score:7]
Over -expression of miR-27a in HLECs enhanced lymphatic tube formation and migration, whereas inhibition of miR-27a reduced lymphatic tube formation and migration. [score:5]
In our study, we showed that SMAD4, as a target of miR-27a, inhibited HLEC lymphatic tube formation. [score:5]
We found that the luciferase activity of wild-type SMAD4 3’-UTR reporter transfected cells was significantly suppressed when co -transfected with 30 nM and 60 nM miR-27a mimic (a decrease of 42.33±7.02% and 56.67±7.77%, respectively, P < 0. 001), while the luciferase activity was significantly elevated following transfection with 30 nM and 60 nM miR-27a inhibitor (an increase of 35.33±6.03% and 86.33±12.22%, respectively, P < 0. 001). [score:5]
0186718.g003 Fig 3(A) The predicted target site of has-miR-27a (middle) in the SMAD4-3’UTR region (bottom) as detected by TargetScan. [score:5]
Our data indicated that colon cancer cell induced the expression of miR-27a in HLECs, which promoted lymphangiogenesis by targeting SMAD4. [score:5]
And conversely, Prox-1 expression level was 25.00±3.90% (P < 0. 05) and 36.00±2.60% (P < 0. 05) decreased after transfected with miR-27a inhibitor in 30nM and 60nM concentration, respectively (Fig 2F). [score:5]
Quantitative PCR (qPCR) was conducted to determine Prox-1 expression in HLECs after transfected with miR-27a mimic or inhibitor. [score:5]
In contrast to miR-27a mimic treated cells, the lengths of the capillary-like tubes in the cells transfected with the miR-27a inhibitor were 26.71±1.30% (P < 0. 05) and 76.98±3.37% (P < 0. 001) shorter than those observed in the control group after 10 hours of treatment with 30 nM or 60 nM miR-27a inhibitor, respectively (Fig 2B). [score:5]
The bioinformatics analysis suggested that miR-27a binds to the SMAD4 mRNA 3’UTR and down-regulates the synthesis of SMAD4 protein to potentially regulate lymphangiogenesis. [score:5]
Pearson’s correlation coefficient was used to assess the association between miR-27a expression and SMAD4 expression. [score:5]
Among the predicted miR-27a targets, the SMAD4 gene (Fig 3A) was chosen for further analysis as all three prediction methods listed SMAD4 as a top candidate and miR-27a has an established role in the inhibition of tumor metastasis. [score:5]
Because of the obvious up-regulation of miR-27a and because its function has been related to angiogenesis [17– 18], we first chose miR-27a for further study. [score:4]
Fourth, as revealed by the luciferase reporter assays, mutations on the predicted miR-27a binding site in the SMAD4 3’UTR inhibited the regulation. [score:4]
miR-27a directly targets SMAD4. [score:4]
Compared with scrambled oligonucleotide, SMAD4 protein expression was decreased in miR-27a mimic transfected HLECs and increased in miR-27a inhibitor transfected HLECs in a concentration -dependent manner (Fig 3B and 3C). [score:4]
Conversely, down-regulation of miR-27a was associated with a decrease in lymphatic tube formation and HLEC migration. [score:4]
These findings indicated key roles of miR-27a in tumorigenesis and metastasis in human colon cancer and implicated miR-27a as a potential target for the development of new anticancer therapies. [score:4]
To determine if SMAD4 is a direct target of miR-27a, we cloned the 3’UTR of SMAD4 mRNA into a luciferase reporter vector. [score:4]
In this study, we have identified miR-27a as a key regulator of lymphangiogenesis by targeting SMAD4 in colon cancer. [score:4]
First, bioinformatics analysis predicted SMAD4 carries a miR-27a target sequence on its 3’-UTR. [score:3]
Our finding implicated miR-27a as a potential target for new anticancer therapies in colon cancer. [score:3]
Furthermore, bioinformatics prediction and experimental validation were performed to identify miR-27a target genes in lymphangiogenesis. [score:3]
For example, the expression of miR-27a was significantly reduced in prostate cancer. [score:3]
We then transduced an miR-27a inhibitor into HLECs and monitored lymphatic tube formation and migration. [score:3]
Scrambled oligonucleotide (Genepharm, Shanghai, China), Smad4 siRNA (Genepharm, Shanghai, China), miR-27a mimic (Genepharm, Shanghai, China) and miR-27a inhibitor (Genepharm, Shanghai, China) were transfected into HLECs at the indicated concentrations. [score:3]
miR-27a inhibited prostate cancer cell proliferation and migration [48]. [score:3]
0186718.g002 Fig 2(A and B) Representative phase-contrast photographs and quantification of capillary-like tube formation in control or miR-27a mimic transfected HLECs (A) and control or miR-27a inhibitor transfected HLECs (B). [score:3]
We co-transduced p3TP-Lux and miR-27a mimic or miR-27a inhibitor into HLECs, treated cells with exogenous TGF-β1, and then determined luciferase activity. [score:3]
These results suggested that miR-27a directly regulates SMAD4 by binding to the 3’UTR of SMAD4 mRNA. [score:3]
Luciferase reporter assays showed that miR-27a directly targeted SMAD4, a pivotal component of the TGF-β pathway. [score:3]
SMAD4 is a target of miR27 in HLECs. [score:3]
We co -transfected wild-type or mutant SMAD4 3’UTR luciferase reporter plasmids and miR-27a mimic or miR-27a inhibitor into HLECs. [score:3]
Among all of the differentially expressed miRNAs, miR-27a was of the most interest. [score:3]
HLECs were co -transfected with scrambled oligonucleotide, miR-27a mimic or inhibitor and OmicsLink [TM] luciferase reporter vectors using Lipofectamine™ 2000. [score:3]
SMAD4 was a target of miR-27a in HLECs. [score:3]
To investigate the relationship between miR-27a and SMAD4, was used to detect SMAD4 protein expression in HLECs transfected with different concentrations of miR-27a mimic or miR-27a inhibitor. [score:3]
Lipofectamine™ 2000 transfection reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) were used to transfect plasmid, siRNA, miR-27a mimic, or miR-27a inhibitor, according to the manufacturer’s instructions. [score:3]
If colon cancer cells induced miR-27a expression in HLECs by secreting VEGF-C or other VEGFs requires further studies. [score:3]
HLECs transfected with different concentrations of miR-27a mimic or inhibitor were trypsinized, suspended in ECM with no FBS, and then 1×10 [5] cells were seeded in the upper wells. [score:3]
We found that over -expression of miR-27a promoted lymphatic tube formation and HLEC migration. [score:3]
The results consistent with the HLECs lymphatic tube formation and cell migration (A and B) Representative phase-contrast photographs and quantification of capillary-like tube formation in control or miR-27a mimic transfected HLECs (A) and control or miR-27a inhibitor transfected HLECs (B). [score:3]
HLECs were co -transfected with P3TP-Lux (1μg), pRL-TK (0.1μg), and different concentrations of miR-27a mimic, scrambled oligonucleotide or miR-27a inhibitor using Lipofectamine 2000. [score:3]
We found that expression of miR-27a in HLECs was induced by co-culturing with colon cancer cells. [score:3]
In addition, we showed that miR-27a negatively regulated the TGF-β pathway using a reporter system. [score:2]
We hypothesized that miR-27a regulates the TGF-β signaling pathway in HLECs. [score:2]
The results showed that Prox-1 expression increased compared with control by 3.00±0.26 fold (P < 0. 001) and 5.28±0.36 fold (P < 0. 001) after 30nM and 60nM miR-27a mimic transfection, respectively (Fig 2E). [score:2]
These results suggested a miR-27a/SMAD4/TGF-β axis in HLECs that presumably regulates lymphangiogenesis. [score:2]
These results suggested that miR-27a was one of the key regulatory factors involved in HLEC lymphangiogenesis. [score:2]
In summary, we demonstrated for the first time that miR-27a was a key regulator of lymphangiogenesis in human colon cancer and that it functioned via the TGF-β-SMAD4 signaling pathway. [score:2]
Third, we showed that the SMAD4 3’UTR was targeted by miR-27a via dual-luciferase assays. [score:2]
miR-27a is involved in the regulation of cancer cell proliferation, tumorigenesis, multidrug resistance and metastasis in various types of tumors [32– 34]. [score:2]
This result suggested that miR-27a negatively regulates the Smad4-TGF-β signaling pathway in HLECs. [score:2]
Mutagenesis was performed to generate reporter plasmids with mutations on miR-27a binding sites, as described in the reference [16]. [score:2]
Here, the identification of the “onco-miRNA” miR-27a in lymphangiogenesis provides a new therapeutic opportunity for human colon cancer. [score:1]
We found that the number of migrated cells increased after transduction with the miR-27a mimic in a dose -dependent manner. [score:1]
Point mutants were also introduced into the construct to disrupt the predicted miR-27a binding site (Fig 3A). [score:1]
Gain- and loss-of-function studies were performed to determine the function of miR-27a, a top hint, on lymphangiogenesis and migration in HLECs. [score:1]
However, miR-27a showed no significant effects on the basal level of PAI-1 promoter activity without exogenous addition of TGF-β1 (P > 0. 05) (Fig 3E). [score:1]
However, miR-27a and SMAD4 have also shown anti-cancer and oncogenic roles, respectively. [score:1]
miR-27a increases tube formation of HLECs on Matrigel and promotes migration of HLECs. [score:1]
miR-27a promotes lymphangiogenesis and migration of HLECs. [score:1]
Tang et al. [38] reported that miR-27a promotes angiogenesis by mediating the endothelial differentiation of BCSLCs. [score:1]
Our results and others suggested pro-tumor function of miR-27 and anti-tumor function of SMAD4 in colon cancer. [score:1]
Therefore, we focused on the role of miR-27a in colon cancer lymphangiogenesis. [score:1]
Our study focused on the role of miR-27a and SMAD4 in HLECs and they may have different functions in tumor cells and endothelial cells. [score:1]
The functions of miR-27a and SMAD4 are likely tumor type- and cell type -dependent. [score:1]
On the other hand, the number of migrating cells in HLECs transfected with 30 nM or 60 nM miR-27a mimic were 34.48±4.60% (P < 0. 05) and 69.78±4.28% (P < 0. 001) lesser than the control group, respectively (Fig 2D). [score:1]
We found that the lengths of the capillary-like tubes in Matrigel transfected with 30 nM or 60 nM miR-27a mimic for six hours were 3.07±0.91 fold (P < 0. 001) and 4.49±0.63 fold (P < 0. 001) longer than those observed in the control group, respectively (Fig 2A). [score:1]
The plasmid P3TP-Lux was used to study the influence of miR-27a on the TGF-β signaling pathway and was kindly provided by Dr. [score:1]
We chose Prox-1 as biomarker to show the lymphangiogenesis modulated by miR-27a in HLECs. [score:1]
miR-27a mimic transfection at 30 nM or 60 nM enhanced migration by 1.50±0.28 fold (P < 0. 05) and 1.92±0.18 fold (P < 0. 001), respectively (Fig 2C). [score:1]
The miR-27a and TGF-β signaling pathway in lymphangiogenesis. [score:1]
To assess the potential role of miR-27a in lymphangiogenesis, we treated HLECs with a miR-27a mimic and then examined lymphatic tube formation. [score:1]
[1 to 20 of 77 sentences]
9
[+] score: 229
Other miRNAs from this paper: hsa-mir-148a, hsa-mir-27b, hsa-mir-30b
miR-27a overexpression rescued hMVICs from TNF-α -induced inflammatory injury, as cell viability and BrdU incorporation were increased, apoptotic cell rate was decreased, Bcl-2 was up-regulated, Bax and cleaved caspase-3/9 were down-regulated, and the release of IL-1β, IL-6, and MMP-9 was reduced when miR-27a was overexpressed. [score:11]
A, The expression of miR-27a was detected after hMVICs were transfected with miR-27a mimic, miR-27a inhibitor, or the negative control (NC); B, cell viability; C, BrdU incorporation; D, apoptotic cell rate; E and F, expressions of apoptosis-related proteins; G, IL-1β and H, IL-6 secretions, and I and J, protein expressions of proinflammatory cytokines were assessed after hMVICs were transfected with miR-27a mimic/inhibitor and exposed to TNF-α. [score:11]
By performing and western blot analyses, we found that both the mRNA and protein levels of NELL-1 were up-regulated by transfection with miR-27a mimic, while down-regulated by miR-27a inhibitor transfection (P<0.01 or P<0.001, Figure 5B and C). [score:9]
Then, we found that miR-27a overexpression notably recovered TNF-α -induced inflammatory injury, as cell viability and BrdU incorporation were increased, apoptotic cell rate was reduced, Bcl-2 was up-regulated, and Bax, cleaved capsase-3 and -9 were down-regulated. [score:9]
miR-27a overexpression could partially abolish these up-regulations, which were induced by TNF-α; as expected, miR-27a suppression aggravated it. [score:8]
As shown in Figure 6A-I, NELL-1 up-regulation exhibited similar effects as miR-27a overexpression as it significantly promoted cell viability and BrdU incorporation, suppressed apoptosis, and reduced the release of IL-1β, IL-6, and MMP-9 (P<0.05 or P<0.001). [score:8]
In macrophages, miR-27a overexpression enhanced the expression of proinflammatory cytokines (IL-1β, IL-6, IL-12, and TNF-α), and diminished the expression of anti-inflammatory cytokine IL-10 (17). [score:7]
In conclusion, this study demonstrated that miR-27a overexpression protected hMVICs from TNF-α -induced cell damage, which might be via up-regulation of NELL-1 and thereby modulation of JNK and Wnt/β-catenin signaling pathways. [score:6]
Transfection efficiency was detected by and results showed that cells transfected with the miR-27a mimic exhibited significant overexpression compared with the NC group, while transfection with the miR-27a inhibitor resulted in a significant decrease in expression (both P<0.01, Figure 3A). [score:6]
TNF-α down-regulated miR-27a expression in human mitral valve interstitial cells. [score:6]
TNF-α down-regulated miR-27a expression in hMVICs. [score:6]
, and NELL-1 up-regulation exerted the similarly protective functions as miR-27a overexpression on TNF-α -induced cell damage. [score:6]
Figure 2. TNF-α down-regulated miR-27a expression in human mitral valve interstitial cells. [score:6]
B, mRNA and C, protein expression levels of NELL-1 in hMVICs were determined after human mitral valve interstitial cells (hMVICs) were transfected with miR-27a mimic, miR-27a inhibitor, or the negative control (NC). [score:5]
A and C, Expressions of main proteins in JNK signaling, and B and D, expressions of main proteins in Wnt/β-catenin signaling were measured after human mitral valve interstitial cells were transfected with miR-27a mimic/inhibitor and exposed to TNF-α. [score:5]
In contrast, miR-27a suppression aggravated TNF-α -induced inflammatory injury, as miR-27a inhibitor affected cell viability, BrdU incorporation, apoptosis, and the release of proinflammatory cytokines resulted in the opposite impacts. [score:5]
These previous studies point out that miR-27a expression may be implicated in valvular heart diseases. [score:5]
miR-27a overexpression has also been reported to attenuate ischemia reperfusion -induced inflammatory damage to the blood-spinal cord barrier by inhibiting the NF-κB/IL-1β pathway (16). [score:5]
We also found that miR-27a overexpression blocked JNK and Wnt/β-catenin signaling pathways, and the blockage was mediated by NELL-1 expression. [score:5]
As shown in Figure 7A-D, miR-27a overexpression did not attenuate TNF-α-activated JNK and Wnt/β-catenin pathways when NELL-1 was knocked down. [score:4]
Figure 3. miR-27a up-regulation recovered the impairment of cell proliferation, induced apoptosis, and released proinflammatory cytokines induced by TNF-α in human mitral valve interstitial cells (hMVICs). [score:4]
This finding provided the first evidence that miR-27a overexpression acted as a regulatory mechanism that prevented TNF-α -driven inflammatory responses. [score:4]
This study indicated that therapies designed to up-regulate miR-27a may help HVD patients to effectively alleviate the illness. [score:4]
Our findings were consistent with a previous study and confirmed the anti-inflammatory role of NELL-1. Based on the data in this study, we also inferred that miR-27a rescued hMVICs from TNF-α -induced inflammatory injury, which might have been via up-regulation of NELL-1. The JNK and Wnt/β-catenin pathways act as critical intermediates and convergence points in immune system signaling (27, 28). [score:4]
However, miR-27a overexpression did not block these two pathways when NELL-1 was knocked down. [score:4]
miR-27a up-regulation recovered the impairment of cell proliferation, induced apoptosis, and released proinflammatory cytokines induced by TNF-α in human mitral valve interstitial cells (hMVICs). [score:4]
Herein, our research demonstrated that miR-27a was down regulated in hMVICs upon TNF-α stimulation, which provided evidence that miR-27a might be a regulatory molecule involved in HVD. [score:3]
Also in macrophages, mmu-miR-27a was indicated as a proinflammatory gene, as its target gene MCPIP1 could decrease the secretion of IL-6, IL-1β, and IL-10, which were stimulated by LPS (15). [score:3]
To validate the importance of miR-27a in TNF-α-injured hMVICs, miR-27a mimic and miR-27a inhibitor were transfected into hMVICs. [score:3]
Furthermore, miR-27a mimic and si-NELL-1 were co -transfected into hMVICs, and the expression changes of core proteins in JNK and Wnt/β-catenin pathways were reassessed. [score:3]
A and C, Expressions of main proteins in JNK signaling, and (B and D) expressions of main proteins in Wnt/β-catenin signaling were measured, after human mitral valve interstitial cells were co -transfected with miR-27a mimic and si-NELL-1, and were exposed to TNF-α. [score:3]
For example, overexpression of miR-27a could decrease the production of inflammatory cytokines, such as IL-6, IL-1β, TNF-α, and nitric oxide (NO) in lipopolysaccharide (LPS)-stimulated microglia (14). [score:3]
In contrast, the protective functions of miR-27a were enhanced by NELL-1 overexpression (P<0.05 or P<0.01, Supplementary Figure S3). [score:3]
Despite the fact that miR-27a has been reported as a critical regulator in inflammatory responses, no study has focused on the regulatory effects of miR-27a on HVD. [score:3]
Interestingly, the RNA level expression of miR-27a was unaffected by NELL-1 alteration (P>0.05, Figure 5D). [score:3]
The findings of this study will provide us with a new perspective that targeting miR-27a may be a potential therapeutic intervention for HVD. [score:3]
We also found that miR-27a overexpression blocked JNK and Wnt/β-catenin signaling pathways. [score:3]
D, RNA level of miR-27a in hMVICs transfected with pc-NELL-1 (a NELL-1 -expressing vector) or si-NELL-1 (a siRNA specific for NELL-1). [score:3]
in a NELL-1 -dependent mannerFurthermore, miR-27a mimic and si-NELL-1 were co -transfected into hMVICs, and the expression changes of core proteins in JNK and Wnt/β-catenin pathways were reassessed. [score:3]
TNF-α (Sigma-Aldrich, USA) at a concentration of 40 ng/mL was used for treating cells for 48 h. miR-27a mimic, miR-27a inhibitor, and their negative control (NC, scrambled) were synthesized by GenePharma Co. [score:3]
We evaluated the expression change of miR-27a after TNF-α exposure and found that miR-27 expression level was significantly reduced in the TNF-α group compared to the control group (P<0.01, Figure 2). [score:2]
NELL-1 was positively regulated by miR-27a. [score:2]
Figure 5. NELL-1 was positively regulated by miR-27a. [score:2]
Herein, hMVICs were cultured with 40 ng/mL TNF-α, and the effects of miR-27a dysregulation on TNF-α -induced inflammatory injury were evaulated. [score:2]
We found that miR-27a was down regulated after stimulation by TNF-αin hMVICs. [score:2]
Among the miRNAs, miR-27a has been wi dely studied due to its critical role in regulating inflammation and innate immune pathway (14– 17). [score:2]
In the current study, our data indicated the anti-inflammatory roles of miR-27a in hMVICs, which were injured by TNF-α. [score:1]
The expression level of miR-27a in cells was measured after TNF-α exposure. [score:1]
Currently, miR-27a has been wi dely studied due to its controversial role in inflammatory responses. [score:1]
The levels of IL-1β, IL-6, and MMP-9 were decreased by addition of miR-27a mimic (P <0.05, P<0.01 or P <0.001, Figure 3B-J). [score:1]
Nevertheless, several other reports indicated the proinflammatory functions of miR-27a. [score:1]
Figure 4. miR-27a blocked JNK and Wnt/β-catenin signaling pathways. [score:1]
We also found that the protective functions of miR-27a in TNF-α-injured hMVICs were abolished when NELL-1 was silenced (P<0.05, Supplementary Figure S2). [score:1]
Figure 7. miR-27a blocked JNK and Wnt/β-catenin signaling pathways in a NELL-1 -dependent manner. [score:1]
These data indicated the complex and critical roles of miR-27a in inflammatory responses. [score:1]
Thus, we inferred that miR-27a might be implicated in TNF-α -induced inflammatory injury in hMVICs. [score:1]
miR-27a blocked JNK and Wnt/β-catenin signaling pathways. [score:1]
Based on these data, we speculated that miR-27a modulated JNK and Wnt/β-catenin signaling pathways in a NELL-1 -dependent manner. [score:1]
Nigam et al. (22) reported that miR-27a was decreased in human bicuspid aortic tissue obtained from patients who needed aortic valve replacement. [score:1]
GAPDH (forward: 5′- GTC TCC TCT GAC TTC AAC AGC G-3′ and reverse: 5′- ACC ACC CTG TTG CTG TAG CC-3′) and U6 (forward: 5′-CTC GCT TCG GCA GCA CA-3′ and reverse: 5′-AAC GCT TCA CGA ATT TGC GT-3′) were used as the internal reference for NELL-1 and miR-27a, respectively. [score:1]
miR-27a blocked JNK and Wnt/β-catenin signaling pathways in a NELL-1 -dependent manner. [score:1]
Oury et al. (21) mentioned that circulating miR-27a was increased in patients with aortic stenosis. [score:1]
Here, we assessed whether miR-27a exerted anti-inflammatory properties in a NELL-1 -dependent manner. [score:1]
miR-27a protected hMVICs from TNF-α -induced inflammatory injury. [score:1]
[1 to 20 of 64 sentences]
10
[+] score: 217
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-302a
miR-27a-5p Downregulates the Surface Expression of CX [3]CR1To determine whether miR-27a-5p is able to downregulate the surface expression of CX [3]CR1, we prepared a lentiviral vector containing the whole ORF of the CX [3]CR1 gene and the portion of the 3′UTR region containing the two putative binding sites for miR-27a-5p. [score:11]
This might occur thanks the TGF-β1 -induced upregulation of the miR-23a-27a-24-2 cluster in NK cells, which in turn causes miR-27a-5p upregulation and the consequent CX [3]CR1 downregulation. [score:10]
Expression relative fold changes are referred to the expression of untreated NK cells (medium alone) whose expression has been arbitrarily assigned the value 1. * p < 0.05. miR-27a-5p Interacts with the CX [3]CR1 mRNATo unequivocally demonstrate that miR-27a-5p could interact with the 3′UTR of the CX [3]CR1 mRNA, modulating its expression, we performed a luciferase reporter assay (Figure 4). [score:8]
Inverse Correlation of miR-27a-5p and CX [3]CR1 mRNA Expression in TGF-β1-Treated NK CellsSince miRNAs properties include the capability of inducing degradation of targeted mRNAs, expression profiles of miR-27a-5p and CX [3]CR1 mRNAs were simultaneously analyzed over time. [score:7]
Expression relative fold changes are referred to the expression of miR-27a-5p and CX [3]CR1 mRNA in untreated NK cells (medium alone, 24 h) whose expression has been arbitrarily assigned the value 1. ** p < 0.01, *** p < 0.001, **** p < 0.0001. [score:7]
Expression relative fold changes are referred to the expression of untreated cells, whose miR-27a-5p expression has been arbitrarily assigned the value 1. ** p < 0.01, *** p < 0.001, and **** p < 0.0001. [score:7]
miR-27a-5p Downregulates the Surface Expression of CX [3]CR1. [score:6]
Increment of miR-27a-5p expression is due to upregulation of the miR-23a-27a-24-2 cluster, which contains, among others, miR-27a-5p. [score:6]
miR-27a-5p has been also reported to downregulate perforine 1 (Prf1) and granzyme B (GzmB) expression in resting and IL-15-activated NK cells (42), thus hampering NK cells cytotoxicity. [score:6]
To determine whether miR-27a-5p is able to downregulate the surface expression of CX [3]CR1, we prepared a lentiviral vector containing the whole ORF of the CX [3]CR1 gene and the portion of the 3′UTR region containing the two putative binding sites for miR-27a-5p. [score:6]
miR-27a-5p, a product of this cluster, is able to regulate the expression of multiple targets crucial for NK cells function. [score:6]
To analyze the relevance of miR-27a-5p induction in a pathological context, we cocultured under transwell condition resting NK cells and the prototypic SH-SY5Y NB cell line, which we described to induce a TGF-β1 -mediated downregulation of CX [3]CR1 surface expression (12). [score:6]
miR-27a-5p As Putative Regulator of CX [3]CR1 ExpressionThe differential expression of miR-302a and miR-27a-5p in untreated and TGF-β1 -treated NK cells was checked for validation by using specific miRNA assays. [score:5]
Transfection of CX [3]CR1-Expressing HEK293T CellsAn HEK293T clone stably expressing CX [3]CR1 was transfected with miR-27a-5p and with miR-Neg to evaluate the modulation of CX [3]CR1 expression. [score:5]
Since miRNAs properties include the capability of inducing degradation of targeted mRNAs, expression profiles of miR-27a-5p and CX [3]CR1 mRNAs were simultaneously analyzed over time. [score:5]
A mutated version of pmirCX3UTRWT (pmirCX3UTRMT), containing a C>G mutation in the putative target site for miR-27a-5p, was prepared by site-directed mutagenesis using the Geneart System (Invitrogen) according to the manufacturer gui delines. [score:5]
Cells were transfected with 20 pmol of miR-27a-5p inhibitor (Applied Biosystems) or with a negative control (mirVana™ miRNA Inhibitor, Negative Control #1; Ambion) using Lipofectamine 3000 according to manufacturer instructions. [score:5]
Thus, miR-27a-5p was further investigated as putative regulator of CXCR4, CXCR3, or CX [3]CR1 expression using the computational prediction on-line tools TargetScan (see text footnote 3) (23), miRanda (see text footnote 4) (24), and miRmap (see text footnote 5) (25). [score:4]
The analysis indicated miR-27a-5p as a putative regulator of CX [3]CR1 expression with relatively high scores. [score:4]
As shown in Figure 5, miR-27a-5p mimic induced a significant downregulation of the percentage of CX [3]CR1 positive cells. [score:4]
We identified miR-27a-5p as a negative regulator of CX [3]CR1 expression. [score:4]
As expected, we observed a significantly higher CX [3]CR1 mRNA expression in TGF-β1 -treated NK cells previously transfected with the miR-27a-5p inhibitor when compared with cells transfected with a scrambled miRNA. [score:4]
In the present article, we show that TGF-β1 -induced miR-27a-5p directly modulates the expression of CX [3]CR1 mRNA at the post-transcriptional level. [score:4]
CX [3]CR1 3′ Untranslated Region ConstructA 700 bp fragment of the CX [3]CR1 3′ untraslated region (3′UTR) containing the putative target site for miR-27a-5p was amplified by PCR using primers CX3UTR2F and CX3UTR2R, containing the NheI and XhoI sites in their 5′ ends, respectively. [score:4]
miR-27a-5p As Putative Regulator of CX [3]CR1 Expression. [score:4]
Each point represents the miR-27a-5p and CX [3]CR1 expression detected in one of the seven reported conditions, with different TGF-β1 concentrations (0, 5, and 40 ng/mL) and time of treatment (0, 12, and 24 h). [score:3]
NK cells untreated or treated for 24 h with the indicated concentration of TGF-β1 were analyzed for miR-27a-5p expression. [score:3]
Clone #124 was transfected with a miR-27a-5p mimic or with a miRNA negative control and analyzed by flow cytometry for the chemokine receptor expression. [score:3]
An HEK293T clone stably expressing CX [3]CR1 was transfected with miR-27a-5p and with miR-Neg to evaluate the modulation of CX [3]CR1 expression. [score:3]
Figure 2Expression profile of miR-27a-5p in TGF-β1 -treated natural killer (NK) cells. [score:3]
As shown in Figure 3A, at both concentrations used, TGF-β1 caused a significant increment of miR-27a-5p and decrease of CX [3]CR1 mRNA expression. [score:3]
Inverse Correlation of miR-27a-5p and CX [3]CR1 mRNA Expression in TGF-β1-Treated NK Cells. [score:3]
NK92 and primary NK cells overexpressing miR-27a-5p showed a reduced cytotoxicity but unmodified levels of the activating receptors NKG2D, NKp30, NKp44, and NKp46. [score:3]
As shown in Figure 3C, TGF-β1 caused a significant increment of the primary miR-23a-27a-24-2 transcript, thus demonstrating that the increased amount of miR-27a-5p might be due, at least in part, to induction of its gene expression other than, for example, to miR-27a-5p egress from intracellular stores. [score:3]
On the contrary, in agreement with data obtained by miRNA profiling, TGF-β1 -treated NK cells showed a significant increase of miR-27a-5p expression, which was higher at low TGF-β1 concentration (Figure 2). [score:3]
Next, to deepen the molecular mechanism responsible for the TGF-β1 -induced increase of miR-27a-5p, we analyzed the expression of the miR-23a-27a-24-2 cluster, precursor of miRNAs, including miR-27a-5p. [score:3]
Scatter plot showing miR-27a-5p and CX [3]CR1 mRNA expression in TGF-β1 -treated NK cells from the same donor (donor 1) of (A). [score:3]
Since CD56 [bright] NK cells virtually do not express CX [3]CR1, further experiments should clarify whether miR-27a-5p might contribute to their costitutive CX [3]CR1 [low/neg] phenotype. [score:3]
Clones showing a good and stable expression of CX [3]CR1 were expanded and used for transfection with miR-27a-5p and with miR-Neg. [score:3]
Figure 3Expression profile of miR-27a-5p and CX [3]CR1 mRNA in TGF-β1 -treated natural killer (NK) cells. [score:3]
Importantly, expression of miR-27a-5p and CX [3]CR1 mRNA was inversely correlated (Pearson’s correlation coefficient r = 0.766, p < 0.05; Figure 3B). [score:3]
Next, to further confirm miR-27a-5p and CX [3]CR1 mRNA interaction, before TGF-β1 treatment NK cells were transiently transfected with a specific miR-27a-5p inhibitor or with a scrambled miRNA as negative control (Figure 4B). [score:3]
[8] The remaining two miRNAs (miR-302a and miR-27a-5p) were further investigated as putative regulators of CXCR4, CXCR3, or CX [3]CR1 expression (Figure 1 and Figure S2 in). [score:2]
To unequivocally demonstrate that miR-27a-5p could interact with the 3′UTR of the CX [3]CR1 mRNA, modulating its expression, we performed a luciferase reporter assay (Figure 4). [score:2]
Moreover, knockdown of miR-27a-5p in NK cells increased in vitro cytotoxicity and decreased tumor growth in a human tumor xenograft mo del (42). [score:2]
The differential expression of miR-302a and miR-27a-5p in untreated and TGF-β1 -treated NK cells was checked for validation by using specific miRNA assays. [score:2]
A 700 bp fragment of the CX [3]CR1 3′ untraslated region (3′UTR) containing the putative target site for miR-27a-5p was amplified by PCR using primers CX3UTR2F and CX3UTR2R, containing the NheI and XhoI sites in their 5′ ends, respectively. [score:2]
Primer CX3ATGKZF, designed to contain a Kozak consensus sequence, and primer CX3UTR2R (Figure S1 in) were used for the amplification of a genomic fragment (2,494 bp in length) containing the whole CX3CR1 gene open reading frame (ORF) and a portion of the 3′UTR in which the two putative target sites for miR-27a-5p are included. [score:1]
These data further support the role of miR-27a-5p as modulator of the chemokine receptor. [score:1]
The three softwares predicted the same principal site of interaction in the CX [3]CR1 3′UTR with the miR-27a-5p seed region (Figure S3A in). [score:1]
We cloned a 700 bp fragment of the CX [3]CR1 gene 3′UTR, containing all the putative sites of interaction with the seed region of miR-27a-5p, into a luciferase reporter vector, downstream of the firefly luciferase gene. [score:1]
Figure 4Functional interaction between miR-27a-5p and CX [3]CR1 mRNA. [score:1]
The two plasmids were separately cotransfected in HEK293T cells with a miR-27a-5p mimic or with a random sequence miRNA negative control. [score:1]
miR-27a-5p is indicated by the arrow. [score:1]
Wild-type (pmirCX3UTRWT) and mutant (pmirCX3UTRMT) plasmids containing the 3′UTR of the CX [3]CR1 mRNA, as well as the parental pmirGLO vector (Promega), were used in cotransfection experiments with the mirVana miRNA Mimic miR-27a-5p and the mirVana miRNA Mimic Negative Control #1 (Ambion). [score:1]
miR-27a-5p Induction in the Context of NB-NK Cocultures. [score:1]
Pearson’s correlation coefficient (two-tailed test) was used to evaluate the correlation between CX [3]CR1 mRNA and miR-27a-5p expression. [score:1]
miR-27a-5p Interacts with the CX [3]CR1 mRNA. [score:1]
An additional site in the CX [3]CR1 3′UTR, with a weaker interaction with miR-27a-5p, was predicted by miRanda and miRmap tools only (Figure S3B in). [score:1]
Importantly, this effect was lost when the miR-27a-5p mimic was cotransfected with the construct having the mutated sequence of the CX [3]CR1 3′UTR, thus confirming the interaction of miR-27a-5p with the CX [3]CR1 3′UTR. [score:1]
[1 to 20 of 60 sentences]
11
[+] score: 193
Other miRNAs from this paper: mmu-mir-27a
To identify a direct target of miR-27a among the differentially expressed proteins, we inquired several algorithms and predicted calreticulin as a putative target owing to a conserved seed recognition sequence in the 3′UTR of the corresponding mRNA (Figure 4a). [score:8]
Calreticulin, ERp57, GRP78/BiP, Annexin1 and Tapaxin were downregulated in western blotting analysis of extracts from HCT116 tumours, whereas they were all upregulated in those with a silenced miR-27a. [score:7]
miR-27a expression in CRC inversely correlates with MHC class I and calreticulin expression and with CD3 [+] and CD8 [+] T cells' infiltration/activationTo correlate the data obtained in vitro and in mouse xenografts with human CRCs, we performed quantitative western blotting analysis of some representative samples: high miR-27a -expressing CRCs displayed low MHC class I molecules and calreticulin (Figures 6a and b). [score:7]
All together these data demonstrate that the surface expression of MHC class I molecules is downregulated by miR-27a. [score:6]
Synthetic miR-27a mimic (Syn-hsa-miR-27a), miR-27a inhibitor (anti-hsa-miR-27a) or the appropriate scrambled controls (AllStar or mirScript Inhibitor-Negative Control) were purchased from Qiagen (Hilden, Germany). [score:5]
25, 26 The in vivo data support this notion: high miR-27a -expressing tumours inversely correlate with MHC class I expression in our CRC series. [score:5]
The specificity and efficacy of miR-27a inhibition or overexpression was verified by qRT-PCR on total RNAs extracted from the two different types of tumours. [score:5]
miR-27a expression in CRC inversely correlates with MHC class I and calreticulin expression and with CD3 [+] and CD8 [+] T cells' infiltration/activation. [score:5]
[22] A miScript Target Protector (TP) was designed against this recognition sequence to selectively prevent the binding of miR-27a to the corresponding mRNA, without interfering with the action of the miRNA on other targets. [score:5]
HCT116 and HT29, representative of miR-27a -overexpressing or -downexpressing cells, respectively, were subcutaneously transplanted into nude mice. [score:5]
Accordingly, IHC of tissue microarrays showed that high miR-27a -expressing tumours frequently displayed a weak or absent membrane staining for MHC class I molecules and calreticulin; the staining was stronger in low miR-27a -expressing tumours (Figure 6c). [score:5]
miR-27a upregulation occurs from the very early phases of colorectal tumourigenesis and persists throughout the progression accounting for a more aggressive development. [score:5]
Although further studies are required to provide mechanistic insight into the link between miR-27a and MHC class I antigen presentation and, ultimately, CD8 [+] T cells' recognition and activation, our present data indicate that the miR-27a/calreticulin axis regulates MHC class I cell surface expression. [score:4]
In conclusion, we demonstrate for the first time that miR-27a modulates MHC class I surface exposure by directly targeting calreticulin. [score:4]
miR-27a directly targets calreticulin affecting MHC class I exposure. [score:4]
Collectively, miR-27a acts as an oncomiRNA from the early phases of colon tumourigenesis, impairs MHC class I and calreticulin expression, correlates with CD3 [+]/CD8 [+] infiltration, development of distant metastases and poorer outcome likely affecting the host antitumour immune response in vivo. [score:4]
Calreticulin, thus, is a direct target of miR-27a and mediates the effects on MHC class I exposure. [score:4]
Specifically, miR-27a represses MHC class I surface exposure directly targeting calreticulin, a protein involved in the quality control of the assembly of this multi-subunit complex contributing to its stability and retrieval of suboptimally assembled MHC class I molecules. [score:4]
miR-27a is upregulated in human adenoma and CRC. [score:4]
After 2 weeks, a miR-27a inhibitor or scrambled controls were intratumourally injected every 7 days for four times in HCT116-derived tumours. [score:3]
The miR-27a-antisense (MZIP27a-PA-1), the pre-miR-27a expression constructs (PMIRH27a-onlyPA-1) and scrambled control miRNAs (MZIP000-PA-1; PMIRH000PA-1) plasmids (System Biosciences, Mountain View, CA, USA) were transfected in the different CRC cell lines. [score:3]
miR-27a was already elevated in about 60% of adenomas and further increased during tumour progression (stages I–II, n=48; stages III–IV, n=32), suggesting that its aberrant expression is an early event in colon tumourigenesis (Figure 1D). [score:3]
We selected miR-27a for further analysis and assessed its expression in our series of adenomas (n=32) and sporadic CRCs (n=80) by quantitative RT-PCR analysis. [score:3]
[24] Consistently, Kaplan and Meier analysis of patients' survival showed that low calreticulin expression (P<0.001) and CD3 [+] and CD8 [+] low infiltrates (P<0.001), taken alone, were significantly associated with a shorter overall survival, whereas high miR-27a showed only a trend (P=0.104; Supplementary Figures S4A and B). [score:3]
17, 18, 19, 20 We also transfected HCT116 cells with a plasmid carrying the miR-27a mimic and, among the overexpressing clones, we selected one hereafter named miR27a_OE. [score:3]
In line, CRCs expressing the combination high miR-27a/low calreticulin are associated with reduced CD3 [+]/CD8 [+] T cells' infiltrates and cytotoxic activity, a more aggressive behaviour, metastatic spreading and worse outcome. [score:3]
At day 36, tumour masses were measured, excised and further analysed; qRT-PCR was performed on RNA from xenografts to establish the efficiency of miR-27a inhibition/overexpression. [score:3]
The analysis of the same markers in HT29 tumours produced an opposite scenario, in line with the lower expression of miR-27a that was reversed upon injection of the corresponding mimic. [score:3]
The efficacy of the silencing was established by assessing diminution of miR-27a and increase of validated targets (PPARG, ZBTB10 and FBXW7) (Figure 2c and Supplementary Figure S1A). [score:3]
Accordingly, we assessed cell-surface exposure of MHC class I molecules in three different cell lines (HCT116, HT29 and R KO) and their derivative clones with either a silenced or overexpressed miR-27a. [score:3]
[23] Thus CD8 [+]/perforin [+] and CD8 [+]/LAMP-1 [+] double -positive cells, detected by immunofluorescence on CRC specimens, were higher in low miR-27a -expressing tumours (Figures 7A and B). [score:3]
Only cytoplasmic miR-27a intensity was retained for scoring, and miRNA expression was quantified analysing chromogen-specific intensity by Image J. [38] IHC for CD8 [+] (Clone C8/144B; Dako) and perforin (Diagnostic Biosystem) were performed on the Benchmark LT automated system from Leica Microsystems Bondmax (Leica, Wetzlar, Germany) according to the manufacturer's specifications. [score:3]
27, 28 miR-27a is crucial in immune cells, as it inhibits DCs maturation and T cells' proliferation and activation, whereas induces M2b and M2c macrophage subtypes maturation. [score:3]
In each experiment, the extent of miR-27a silencing/overexpression and calreticulin silencing were assessed by qRT-PCR and western blotting analysis, respectively. [score:3]
In accordance with the size, Ki67 positivity was stronger in the high miR27a -expressing tumours than the lower ones, supporting a role of this miRNA in cell proliferation (Supplementary Figures S3A and B). [score:3]
Collectively, mouse xenografts confirmed that miR-27a affects cell growth and apoptosis also in CRC and clearly showed that it negatively modulates a specific set of proteins identified in vitro that specifically contribute to MHC class I expression. [score:3]
15, 16 miR-27a expression remarkably increased with tumour staging and inversely correlated with patients' overall survival, consistent with the results of our data set (Supplementary Figure S5A). [score:3]
To correlate the data obtained in vitro and in mouse xenografts with human CRCs, we performed quantitative western blotting analysis of some representative samples: high miR-27a -expressing CRCs displayed low MHC class I molecules and calreticulin (Figures 6a and b). [score:3]
4, 5, 13 By a 2DE-DIGE proteomic approach, we identify a series of proteins modulated by miR-27a implicated in MHC class I expression. [score:3]
For miR-27a/CD8 [+]/perforin expression analysis, primary sporadic CRCs were considered. [score:2]
Identification of novel genes and pathways regulated by miR-27a by differential proteome analysis. [score:2]
By contrast, apoptosis was greatly reduced in the same tumours, whereas large areas of apoptosis were detected in those expressing low miR-27a by a terminal deoxynucleotidyl transferase (TdT) -mediated dUTP nick end-labelling test (TUNEL) assay (Figures 5b and c). [score:2]
The staining was, instead, remarkably localized as ‘patches' on cell membranes in tumours injected with a miR-27a antisense (Figure 5b). [score:1]
A more quantitative western blotting analysis on extracts from the same tumours confirmed in a mouse mo del that miR-27a silencing was associated with an overall increase of MHC class I proteins (Figures 5b, d and e). [score:1]
At a higher magnification, the staining was localized at the cell membrane, consistent with stimulation of MHC class I cell surface translocation upon miR-27a silencing. [score:1]
When the CD8 [+] infiltrates were associated with miR-27a levels, the combination low CD8 [+]/high miR-27a had the worse prognosis; hazard ratios analysis of all possible associations highlighted the presence of CD8 [+] infiltrates as a dominant variable (Figures 7C and D). [score:1]
Also, the tumours obtained upon injection of a miR-27a mimic into HT29 cell-derived masses were >50% larger than those from the parental cells (Figure 5a). [score:1]
miR-27a inversely associated also with CD3 [+] and CD8 [+] T cells' mRNAs from the early tumour stages and correlated with poor prognosis, supporting the results of our series (Supplementary Figures S6C–E). [score:1]
A plasmid vector carrying a short hairpin anti-miR-27a RNA (shRNA) and the GFP (green fluorescence protein) cassette was stably transfected into HCT116 cells (CTRL); a cell clone, hereafter defined miR27a_KD, was chosen for further studies (Figure 2b). [score:1]
7, 8, 9, 10, 11 Mechanistically, calreticulin is a major downstream effector of miR-27a in repressing MHC class I surface exposure, a pivotal event in eliciting an efficient immune response and tumour eradication. [score:1]
Altogether, these results suggest that miR-27a could impair T cells' infiltration, activation, proliferation and degranulation. [score:1]
Alternatively, a miR-27a mimic or scrambled controls were injected in HT29-derived tumours. [score:1]
Formalin-fixed paraffin-embedded (FFPE) sections of tubular adenomas with low-grade/high-grade dysplasia or colorectal adenocarcinomas (G1, G2 and G3) were stained for miR-27a. [score:1]
Interestingly, whereas calreticulin mRNA was elevated in all data sets, the corresponding protein was reduced, a discrepancy explained by the posttranscriptional control mediated by miR-27a reported here (Supplementary Figures S6A and B; Figures 6a–c). [score:1]
To identify novel proteins and pathways modulated by miR-27a, we employed a proteomic approach. [score:1]
Furthermore, miR-27a inversely correlated with CD3 [+] and CD8 [+] T cells' infiltration and perforin positivity whose relative abundance was determined (Figures 6c and d). [score:1]
These results definitely demonstrate that miR-27a is a CRC tumour-inducing factor acting as an oncomiRNA. [score:1]
29, 30, 31 Here we provide evidence that miR-27a has a key role also in tumour cells by repressing MHC class I cell surface exposure. [score:1]
miR-27a appears to be a multifaceted signaling molecule that may influence tumour cells–host immunological interactions likely disabling components of the immune system that have been dispatched to eliminate them. [score:1]
of extracts from the same tissues exhibited an overall increase of calreticulin only in those masses with a reduced miR-27a (Figures 5d and e). [score:1]
miR-27a downmodulates MHC class I cell surface exposure. [score:1]
Serial sections obtained from the original paraffin blocks were stained for miR-27a, CD8 [+] and perforin. [score:1]
In situ RNA hybridizationFormalin-fixed paraffin-embedded (FFPE) sections of tubular adenomas with low-grade/high-grade dysplasia or colorectal adenocarcinomas (G1, G2 and G3) were stained for miR-27a. [score:1]
The size of HCT116-derived malignancies was remarkably larger (>50%) than those injected with the miR-27a antisense. [score:1]
High miR-27a/low calreticulin was also associated with the development of liver metastasis and CD3 [+]/CD8 [+] T cells' infiltrates were reduced in metastases compared with matched primary tumours (Supplementary Figures S4C–E). [score:1]
The signal detected on tissue sections from miR-27a antisense -injected tumours was stronger than from the scrambled injected or parental cell tumours. [score:1]
Mouse xenografts recapitulate miR-27a effects on the proteomic profile and cell growth. [score:1]
miR-27a probe was labelled with 5-digoxigenin and synthesized by Exiqon (Vedbaek, Denmark). [score:1]
Our data support that miR-27a has a critical role in colon tumourigenesis likely influencing the antitumour immune response. [score:1]
The low calreticulin/high miR-27a association (n=26) was the one with the worst outcome when these characteristics were combined; hazard ratios analysis of all possible associations identified calreticulin as a dominant variable that was even more discriminant when coupled with high miR-27a expression. [score:1]
To determine the impact of the miR-27a/calreticulin axis on MHC class I molecules surface exposure, we transfected calreticulin TP and siRNAs in the three cell lines. [score:1]
35, 36 Two weeks after transplantation, when tumours reached the volume of 200 mm [3], mice were grouped (N=5/group) and intratumourally injected every 7 days for four times with anti–miR-27a (4 ng/mm [3]) for HCT116 or with miR-27a mimic (2 ng/mm [3]) for HT29 xenograft mo dels. [score:1]
gov/docs/publications/coadread_2012), respectively, were analysed for miR-27a expression in adenoma and CRC tissues to evaluate its prognostic significance. [score:1]
[1 to 20 of 73 sentences]
12
[+] score: 193
Other miRNAs from this paper: hsa-mir-27b
As shown in Table 1, 15 (20%) out of 75 down-regulated proteins could be potential targets of miR-27a, while the other 60 (80%) down-regulated proteins did not have consequential pairing of miR-27a target region in the 3′ UTR. [score:11]
We further searched the predicted consequential pairing of miR-27a target region in the 3′ UTR of the remaining 73 down-regulated proteins in TargetScan Human Release 6.2. [score:8]
We found that out of 1267 identified proteins, 149 proteins were differentially expressed, and 75 were repressed by miR-27a overexpression among which, 15 proteins were predicted miR-27a targets. [score:7]
Predicted miR-27a Targets among Down-regulated Proteins in LX2/miR-27a Identified by cICAT. [score:6]
Next, we tried to figure out how miR-27a target prediction correlated with miR-27a down-regulated proteins in HSCs identified by cICAT -based proteomics analyses. [score:6]
Over expression of miR-27a also up-regulated a group of factors that favorite proliferation of HSCs. [score:6]
3. Correlation between miR-27a target prediction and down-regulated proteins in LX2/miR-27a identified by cICAT. [score:6]
In a previous study, it has also been evidenced that miR-27a can up-regulate cardiac myosin heavy chain (MHC) gene (β-MHC) expression via thyroid hormone signaling [33]. [score:6]
org/vert_61/), we found that only 2 out of the 75 down-regulated proteins were predicted targets of miR-27a, namely SMAD5 (mothers against decapentaplegic homolog 5) and ACLY (ATP-citrate synthase). [score:6]
Enzymes, kinase, peptidase and phosphatase constituted the largest part of miR-27a regulated proteins in LX2 cells (49 out of 134 annotated differentially expressed proteins, 37%), followed by transcription regulator (11 out of 134, 8%). [score:5]
The pattern of miR-27a regulation on protein expression might well reflect the emerging picture of miRNA regulation in animals is far richer and more complex than the crisp linear pathways [1]. [score:5]
To construct miRNA expression plasmid, miR-27a expression fragments designed according to manufactures’ instructions, miR-27a, sense 5′-TGCTGTTCACAGTGGCTAAGTTCCGCGTTTTGGCCACTGACTGACGCGGAACTGCCACTGTGAA-3′, anti-sense 5′-CCTGTTCACAGTGGCAGTTCCGCGTCAGTCAGTGGCCAAAACGCGGAACTTAGCCACTGTGAAC-3′; were cloned into pcDNA6.2-GW/EmGFP-mir vector (Invitrogen, Carlsbad, CA) after annealing the oligonucleotides, termed as pcDNA6.2-GW/EmGFP-mir-27a. [score:5]
Proteins involved in cell adhesion and mobility constituted another major group of down-regulated proteins (10 out 75), including Tenascin (TNC) [24], fibronectin 1 (FN1) [25] and Fibulin-1 (FBLN1) [26], which correlated with reduced adhesion and increased migration of miR-27a stable transfectants (Figure 1D). [score:4]
Therefore, by preferentially influencing the expression of enzymes and transcription regulators, miR-27a could perform its bio-function with high efficiency (Figure 4B). [score:4]
The up-regulation of TPM1, MYO9B and MYL9 by miR-27a in LX2 cells was further validated by RT-PCR (Figure S1). [score:4]
Our data showed that FHL1 involved in miR-27a related HSCs proliferation and migration, knockdown of FHL1 significantly inhibited the proliferation and migration of LX2/miR-27a transfectants (Figure 6). [score:4]
Moreover, 74 proteins were even up-regulated in LX2/miR-27a stable transfectants. [score:4]
0108351.g006 Figure 6 Knockdown of FLH1 suppressed cell proliferation in LX2/miR-27a transfectants. [score:4]
Compared with our previous study on HSCs activation [18], the extent of protein expression changes is relatively small in miR-27a overexpressed LX2, only 6 proteins increase up to 3-fold (i. e. H/L ≥3.0) and 2 proteins reduced below 3-fold (i. e. H/L ≤0.3333). [score:4]
Knockdown of FLH1 suppressed cell proliferation in LX2/miR-27a transfectants. [score:4]
Functional Categories of Down-regulated Proteins in LX2/miR-27a Compared with LX2/miR-neg (H/L ≤0.6667). [score:3]
Functional Categories of Up-regulated Proteins in LX2/miR-27a Compared with LX2/miR-neg (H/L ≥1.5). [score:3]
SMAD5, a key component of TGF-beta signaling pathway, is an experimentally confirmed target of miR-27 [20]. [score:3]
We have previously reported that miR-27a,b suppresses fat accumulation and promotes cell proliferation during hepatic stellate cells (HSCs) activation [8]. [score:3]
Table S4 List of Proteins Up-or Down-regulated in LX2/miR-27a Compared with LX2/miR-neg. [score:3]
Thereafter, miR-27 has been evidenced to act as negative regulator of adipocyte differentiation [9] or lipid metabolism [10], and positive regulator of cell proliferation [11] by several groups. [score:3]
To explore the biological effects of miR-27a overexpression on HSCs, we established a LX2/miR-27a stable transfectants (Figure 1A). [score:3]
Individual siRNA mediated knock-down of one miR-27a regulated protein was performed to demonstrate the phenotypic effects. [score:3]
The expression of mature miR-27a increased significantly in LX2/miR-27a stable transfectants (Figure 1B). [score:3]
The expression of miR-27a was normalized to U6snRNA, and mRNAs were normalized to GAPDH. [score:3]
These results not only explained our previous finding that over -expression of miR-27a promoted HSC activation with reduced cytoplasmic lipid drops and increased cell proliferation [8], but also revealed a novel role of miR-27a in promoting the myogenic trans-differentiation of activated HSC into myofibroblast. [score:3]
So miR-27a may affect HSCs fat accumulation by directly regulating a group of genes that are involved in the biosynthesis of triglyceride. [score:3]
LX2 and LX2/miR-27a transfectants cultured in 24-well plates or 6-cm dishes were transfected at 50–70% confluence with siRNA targeting human four and a half LIM domains 1 (FHL1) by means of the siRNA transfection reagent RNAiMAX (Invitrogen). [score:3]
6. Bio-functional analysis of differentially expressed proteins in LX2/miR-27a stable transfectants. [score:3]
Global protein expression profile changes of LX2/miR-27a transfectants were analyzed by a cleavable isotope-coded affinity tags (cICAT) labeling coupled with online 2D nanoLC-MS/MS based quantitative proteomic approach. [score:3]
cgi) strategy [15], [16] which based on the structured and controlled vocabularies - Gene Ontology (GO), and the GO annotation from related databases was used to identify the functional distribution and the enriched functional categories of miR-27a regulated proteins in LX2 cells. [score:2]
The subcellular location and bio-function of miR-27a regulated proteins in LX2 cells were categorized by using Protein Knowledgebase (UniprotKB) (Table S4). [score:2]
5. Overall distribution of miR-27a regulated proteins in LX2 cells. [score:2]
Global protein expression profiles were compared between LX2/miR-27a and LX2/miR-neg control by cICAT -based proteomic approach. [score:2]
The bio-significance of miR-27a was analyzed based on the functional annotation of miR-27a regulated proteins. [score:2]
The subcellular localization of miR-27a regulated proteins is wide, including cytoplasm, nucleus, plasma membrane and extracellular space (Figure 4A). [score:2]
In the future, it will be interesting to uncover the mechanisms underlying the regulation of miR-27a on these functionally related genes. [score:2]
Global protein expression profiles were compared between LX2/miR-27a and LX2/miR-neg stable transfectants by a cICAT -based quantitative proteomic approach (Figure 2A–C). [score:2]
2. Identification of miR-27a regulated proteins by cICAT -based proteomic analyses. [score:2]
7. The biological significance of miR-27a regulated protein in HSCs. [score:2]
The cells were transfected with 5 µg pcDNA6.2-GW/EmGFP-mir-27a or mir-neg control plasmids by Lipofectamine 2000 (Invitrogen). [score:1]
Involvement of FLH1 in miR-27a related HSCs proliferation and migration. [score:1]
FHL1 was required for increased migration in LX2/miR-27a transfectants. [score:1]
The expression of TPM1, MYO9B and MYL9 encoding mRNA was evaluated by RT-PCR in LX2/miR-27a stable transfectants. [score:1]
Two stably transfected cell lines, LX2/miR-27a and LX2/miR- neg were isolated after 28 days’ selection. [score:1]
However, further effort is needed to determine the role of miR-27a in myogenic trans-differentiation of activated HSCs. [score:1]
The data of present study indicated that miR-27a influenced the activation of HSCs by affecting several groups of proteins. [score:1]
Proteins from LX2/miR-27a and LX2/miR-neg control were labeled with isotopically heavy (H) and light (L) cICAT reagents respectively following the manufacture’s protocol. [score:1]
And miR-27a has also been reported to be able to influence muscle stem cell behavior [34]. [score:1]
To further explore the possible functions and underlying mechanism of miR-27a during HSCs activation, human stellate cell line LX2/miR-27a stable transfectants was established and validated. [score:1]
To examine the biological reproducibility, linear regression analyses were performed on H/L ratios (LX2/miR-27a/LX2/miR-neg) of two independent analyses. [score:1]
The influence of miR-27a over expression on lipid metabolism was not measurable due to the already activated HSC phenotype of LX2 cell line. [score:1]
The present proteomic study not only provided the possible mechanism underlying the previously reported miR-27 function in HSCs, but also casted new light on a novel role of miR-27a in myogenesis, which was consistent with the myofibroblast trans-differentiation during HSCs activation. [score:1]
It is the first time for us to recognize a novel role of miR-27a in promoting myogenic tans-differentiation in HSCs. [score:1]
LX2/miR-27a transfectants were plated on 8-lm pore size Transwell inserts for 16 hours. [score:1]
Table S2 Protein List of 2 Independent 2D nano-LC-MS/MS Analysis of LX2/miR-27a and LX2/miR-neg. [score:1]
Establishment and biological characters of LX2/miR-27a, LX2/miR-neg stable transfectants. [score:1]
Briefly 100 µg total protein collected from LX2/miR-27a and negative control LX2/miR-neg were labeled, respectively, with isotopically light ([12]C for LX2/miR-neg) and heavy ([13]C for LX2/miR-27a ) cICAT reagents at 37°C for 2 hours. [score:1]
Table S3 List of Proteins Identified and Quantified in LX2/miR-27a and LX2/miR-neg. [score:1]
[1 to 20 of 64 sentences]
13
[+] score: 173
The aforementioned experiments suggested that in addition to effecting erythroid differentiation, upregulated GATA-1 bound and activated the miR-27a and miR-24 genes, which led to further repression of GATA-2 translation and facilitated GATA-1 replacement of GATA-2 at miRNAs promoter (Figure 6A). [score:6]
Our findings were in consistent with studies using the hemin -treated K562s or EPO -induced CD34+ HPCs to differentiate into mature erythrocytes, revealing the upregulation of miR-23a, miR-27a or miR-24 during erythropoiesis, whereas an activin A -mediated erythroid mo dels reported the inhibitory role of miR-24 in haemaglobin accumulation. [score:6]
Here, miR-27a and miR-24 perform post-transcriptional protection through repressing the translation of GATA-2, which should not be expressed in differentiated erythroid cells. [score:5]
Additionally, the ectopic expression of miR-27a or 24 in K562s reduced GATA-2 levels by ∼3-fold, whereas GATA-2 levels increased by ∼2-fold when endogenous miRNAs were inhibited (Figure 4C). [score:5]
In contrast to miR-451 locus whose expression was restricted to the fetal liver in embryonic day (E) 16.5 mouse embryos, the major site of haematopoiesis and erythropoiesis at this stage of development, miR-27a and miR-24 seem to serve as universal regulators in different cell types. [score:5]
As expected, the percentage of benzidine -positive cells (Supplementary Figure S4A) and gamma-globin accumulation (Supplementary Figure S4B) increased in miR-27a or miR-24 over-expressed K562s, whereas the percentage of benzidine -positive cells decreased in K562s following the inhibition of miR-27a or miR-24. [score:5]
Inhibition of GATA-1 repressed pri-miR-27a∼24 and mature miRNAs by ∼3-fold and ∼2-fold, respectively (Figure 1H), whereas overexpression of GATA-1 enhanced the levels of primary and mature miRNAs (Figure 1H). [score:5]
To further validate our findings, a northern blot was performed and showed that both precursor and mature levels of miR-27a, 24 and 23a were upregulated during erythroid differentiation (Figure 1C). [score:4]
Primary and mature transcripts of the miR-23a∼27a∼24-2 cluster were upregulated in differentiated erythroid cellsThe miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24. [score:4]
Figure 5. The GATA switch regulated miR-27a and miR-24 expression. [score:4]
Therefore, miR-27a and miR-24 accelerated the development of mature erythroid populations by repressing GATA-2 expression in transplanted mouse mo dels. [score:4]
Collectively, the expression patterns of miR-27a and miR-24 in two separate erythroid differentiation mo dels (K562s and HPCs) suggested that they may be two potential regulators of erythroid differentiation. [score:4]
Increased GATA-2 expression led to a decrease in the levels of Pri-27a∼24 and mature miR-27a or miR-24 (Figure 5E), whereas GATA-2 knock-down increased the transcription and maturation of miR-27a and miR-24 (Figure 5E). [score:4]
These binding changes resulted in transcriptional changes of miR-27a and miR-24, as evidenced by an increase or decrease in their primary and mature transcripts on GATA-1 over -expression or silencing (Figure 1H). [score:3]
By the light of nature, we further demonstrated the GATA-1/miR-27a/24/GATA-2 regulatory circuit in human erythroid cells, representing the decoding of an expansive regulatory layer of GATA-1 and GATA-2. In details, GATA-2 localized to chromatin sites of the miRNA promoter and transcriptionally repressed miR-27a and miR-24 in early stage erythroblasts. [score:3]
MiR-27a and miR-24 co -targeted GATA-2 in erythrocytes. [score:3]
Remarkably, only a few reports have raised concerns about the expression of miR-27a and miR-24 in haematopoiesis (30, 31). [score:3]
The change of GATA factor occupancy was in parallel with their expression (Figure 5H, bottom panel) during HPCs erythroid differentiation and the accumulation of Pri-miR-27a∼24 (Figure 5H, top panel). [score:3]
Over -expression of miR-27a or miR-24 decreased the binding of GATA-2 and increased GATA-1 occupancy (Figure 6B and C). [score:3]
To determine whether GATA-1 would influence the expression of miR-27a and miR-24, the primary and mature transcripts of miR-27a and miR-24 were evaluated in K562s transfected with siRNAs specific to GATA-1 or constructs overexpressing GATA-1 (Figure 1G). [score:3]
Enforced expression of miR-27a and miR-24 in mouse enhanced mature erythroid populations. [score:3]
Our study demonstrates that GATA factors elaborately control the transcription of miR-27a and miR-24 and reveals a regulatory circuit that regulates the GATA-1/2 switch via miR-27a and miR-24 to promote erythroid maturation. [score:3]
Another recent study also indicated the suppression of GATA-2 by miR-27a on earlier stages of blood differentiation, which forcefully supports our findings in haematopoiesis (37). [score:3]
Similarly, inhibition of miR-27a or miR-24 resulted in increased GATA-2 occupancy and decreased GATA-1 binding with DNA sequences (Figure 6B and C). [score:3]
Animals that displayed miR-27a and miR-24 overexpression demonstrated an increase in region 3 (R3) of CD71 [low]/TER119 [high] erythrocytes and a concomitant decrease in region 1 (R1) of CD71 [high]/TER119 [high] erythroblasts from bone marrow and spleen (Figure 7A, B). [score:3]
These data suggested that the inhibition of GATA-2 could rescue the erythroid deficiency caused by miR-27a or miR-24 silencing. [score:3]
Figure 3. Suppression of miR-27a or miR-24 blocked erythroid differentiation in zebrafish. [score:3]
These results were consistent with the expression levels of miR-27a and miR-24 (Figure 5E). [score:3]
miRNA mimics (miR-27 a and miR-24), miRNA inhibitors (Anti-27a and Anti-24) and negative control molecules (Scramble) were obtained from Dharmacon (Austin, TX, USA) and transfected with DharmFECT1 (Dharmacon, Austin, TX, USA) at a final concentration of 60 nM. [score:3]
Figure 7. MiR-27a and miR-24 overexpression enhanced erythropoiesis in mice. [score:3]
In this study, we demonstrated the co-regulation of miR-27a∼24 and Gata-2 transcription by GATA-1 and the co-regulation of GATA-2 production by GATA-1 and miR-27a/24. [score:3]
The effect of GATA-1 on miR-27a and miR-24 expression in HPC erythroid differentiation was examined. [score:3]
Suppression of miR-27a or miR-24 blocked erythroid differentiation in zebrafish. [score:3]
As expected, treatment with miR-27a or miR-24 mimics increased the level of primary transcript in K562s, whereas repression of miR-27a or miR-24 by miRNA inhibitors decreased the level of pri-miRNA (Figure 6D). [score:3]
GATA-2 modulated the regulatory effects of miR-27a and miR-24 on erythroid differentiation. [score:2]
MiR-27a and miR-24 mediated a forward regulatory circuit composed of a GATA switch. [score:2]
Figure 6. A regulatory circuit involving GATA-1, GATA-2 and miR-27a/24 in erythropoiesis. [score:2]
Zebrafish demonstrate increased miR-27a and miR-24 levels during development and is a classic and reliable mo del to study haematopoietic gene function (Figure 3B). [score:2]
To analyse the roles of miR-27a and miR-24 in vivo, we used miRNA MOs to test whether the knock-down of endogenous miRNAs would affect zebrafish erythropoiesis. [score:2]
Thus, a feed-forward circuit containing miR-27a/24, GATA-2 and GATA-1 may positively regulate erythroid differentiation. [score:2]
Therefore, miR-27a/24 and GATA-1/2 form a regulatory circuit that supports the activation of their own genes. [score:2]
Conversely, a miRNA loss-of-function study using recombinant lentivirus carrying antisense RNAs specific to miR-27a (Zip-27a) or 24 (Zip-24) (the efficiency of miRNA inhibition is shown in Supplementary Figure S2A) demonstrated impaired erythroid maturation, as revealed by fluorescence-activated cell sorting (FACS) analysis (Supplementary Figure S2B; Figure 2E), morphological analysis (Figure 2E and F), gamma-globin detection (Figure 2G) and colony-forming assays (Figure 2H; Supplementary Figure S2F). [score:2]
MiR-27a and miR-24 display completely evolutionary conservation among eukaryotes and are organized in a cluster on chromosome 19 of the human genome. [score:1]
To determine the effect of miR-27a and miR-24 on erythrocyte differentiation in adult haematopoietic tissues, a flow cytometry analysis was performed 8 weeks post-transplantation. [score:1]
Thus, our attempt to investigate the regulatory mechanism of miR-27a and miR-24 during erythropoiesis led to the identification of another erythroid GATA member, GATA-2. Figure 4. GATA-2 was post-transcriptionally regulated by miR-27a and miR-24 during erythropoiesis. [score:1]
Moreover, the miRNA-transduced HPCs generated larger colonies, when a typical BFU-E generated by GFP-transduced HPCs was ∼30∼60 μm, whereas the miR-27a- or miR-24 colonies were larger than 100 μm (Supplementary Figure S2E). [score:1]
As expected, miR-27a and miR-24 reduced luciferase gene activity by ∼50% and ∼30%, respectively. [score:1]
These results introduced the possibility that the higher occupancy of GATA-1 following hemin treatment may contribute to miR-27a and 24 activation. [score:1]
Cell-counting analyses at different stages of differentiation showed an increase of mature erythroblasts (orthochromatic and erythrocyte) in miR-27a- or miR-24-transduced HPCs with a concomitant decrease of immature erythroblasts (basophilic and polychromatic erythroblasts) (Figure 2A and B). [score:1]
Additionally, mature miR-27a and 24 were also increased in hemin -treated K562s (Figure 1B). [score:1]
For measurement of Pri-miR-27a∼24-2, miR-27a and 24 expression, q-PCR was performed using Taqman probes (Applied Biosystems, Foster City, CA, USA): pri-miR-27a∼24 (Hs03294931_pri), miR-27a (TM408), miR-24 (TM402), human GAPDH (Hs9999905_M1), RNU6B (TM1093) according to manufacturer’s instruction. [score:1]
With the exception of observations from the activin -induced haematopoietic differentiation mo del (32), miR-27a and miR-24 have been constantly demonstrated increased accumulation as differentiation proceeds, which support the idea that activation of the miR-27a and miR-24 loci might be required for the terminally differentiated cells. [score:1]
Figure 2. MiR-27a and miR-24 promoted erythroid differentiation in CD34+ HPCs. [score:1]
The miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24. [score:1]
Here, we demonstrate that the GATA-1/2 switch occurs at the common gene locus encoding miR-23a, miR-27a and miR-24. [score:1]
The levels of pri-miR-27a∼24 and mature miRNAs in these HPCs were then examined. [score:1]
Taken together, these results demonstrated that miR-27a and miR-24 were required for the proper erythroid differentiation in primary cultured CD34+ HPCs. [score:1]
Our results not only identified miR-27a and 24 as novel enhancers of erythropoiesis but also provided a dynamic change of GATA-1/-2 occupancy at miR-27a∼24-2 gene promoter, which conferred the activation of this locus during erythroid maturation. [score:1]
Meanwhile, CD34+ HPCs were transduced with a recombinant lentivirus harbouring miR-27a (Lenti-27a) or 24 (Lenti-24) following days 7, 11 and 15 of E culture. [score:1]
Data from control (SCR, n = 3), miR-27a (n = 3) and miR-24 (n = 3) animals are shown as the means ± SD. [score:1]
A conservation analysis of miR-27a and miR-24 sequences indicated that they are highly conserved among multiple species, including zebrafish (Figure 3A). [score:1]
We speculate that miR-27a and miR-24 may serve at a ‘standby state’, which means they are ready for the manipulation by different cellular factors, as GATA-1 in erythropoiesis, c-MYC in tumour metastasis (33), Runx2 in osteoblast differentiation (28) and PU. [score:1]
These results suggested that miR-27a and miR-24 are required for erythroid differentiation during primitive haematopoiesis in zebrafish. [score:1]
A bioinformatic analysis showed that the GATA-2 3′ UTR has potential binding sites for both miR-27a and miR-24 (Figure 4A). [score:1]
This cluster is composed of three members, miR-23a, miR-27a and miR-24, and has been linked to osteoblast differentiation, angiogenesis, cardiac remo delling, skeletal muscle atrophy and tumorigenesis (27–29). [score:1]
Meanwhile, in vitro and in vivo functional analyses indicated that miR-27a and miR-24 promoted erythroid differentiation in CD34+ HPCs, zebrafish and mice. [score:1]
Overall, the aberrant miR-27a or miR-24 levels fed back to positively modulate the level of their own primary transcripts. [score:1]
As erythropoiesis proceeds, GATA-1 level increased, and GATA-1 displaced GATA-2 from their shared binding site, thus leading to transcriptional activation of miR-27a and miR-24 (Figure 6E). [score:1]
To clarify the biological links among miR-27a/24, GATA-2 and erythroid phenotype, we used a ‘rescue’ experiment to assess their functional relevance in differentiating K562s. [score:1]
MiR-27a and miR-24 promoted erythroid differentiation in CD34+ HPCs. [score:1]
Furthermore, q-PCR using specific Taqman probes revealed that pri-miR-23a∼27a∼24-2 and mature miR-27a, miR-24 and miR-23a were increased in EPO -driven erythroid differentiation of primary cultured human CD34+ HPCs (Figure 1D). [score:1]
To test the roles of miR-27a and miR-24 in vivo, we conducted transplantation experiments in mice. [score:1]
Additionally, a reduction in hbbe3 and scl staining was also observed in miR-27a and miR-24 MOs -injected embryos at 10 somites (Figure 3G), which suggested an impairment of early erythroid differentiation by miRNA MOs treatment. [score:1]
The self-inactivating transfer vector plasmid containing miR-27a or 24 (pMIR-27a or 24) or antisense RNAs to miR-27a or 24 (pZip-27a or 24) and the packaging kit were purchased from System Biosciences (SBI, CA, USA) and operated according to the manufacturer’s instructions. [score:1]
To further establish the connection between GATA-2 and miR-27a/24, the levels of both the primary and mature miR-23a∼27a∼24-2 clusters were evaluated in K562s transfected with either siRNAs specific to GATA-2 or constructs over -expressing GATA-2 (Figure 5D). [score:1]
[1 to 20 of 75 sentences]
14
[+] score: 146
In-silico Prediction of Target miRNAs against Human Nrf2 and Experimental Validation of Nrf2 Downregulation by Forced Expression of miR144, miR153, miR27a and miR142-5pNrf2, an essential transcription factor for regulating both basal and inducible expression of diverse cytoprotective genes [26], [27] has been recently demonstrated to be regulated by miR144 and miR28 in non-neuronal mo dels [22], [23]. [score:12]
Individual overexpression of miR144, miR153, miR27a and miR142-5p directly target Nrf2 3′ UTR and downregulate expression of Nrf2 transcript. [score:11]
Overexpression of miR144, miR153, miR27a and miR142-5p downregulates Nrf2 protein expression in SH-SY5Y cells. [score:8]
In-silico Prediction of Target miRNAs against Human Nrf2 and Experimental Validation of Nrf2 Downregulation by Forced Expression of miR144, miR153, miR27a and miR142-5p. [score:8]
In general, these miRs (miR144, miR153, miR27a, miR142-5p) when individually present can regulate numerous targets/pathways and the effect of particularly targeting Nrf2 may vary from moderate to high depending on the cellular/stressor setting. [score:6]
Overexpression of miR144, miR153, miR27a and miR142-5p reduces GCLC and GSR expression affecting GSH/GSSG ratio and cellular ROS levels. [score:5]
miR144, miR153, miR27a and miR142-5p abrogates the interaction and binding of corresponding miRs to human Nrf2 3′ UTR, thus indicating Nrf2 as a direct regulatory target of these miRs. [score:5]
Nrf2 transactivation and ARE -driven NQO1 gene expression were reduced by overexpression of different miRs, miR144, miR153, miR27a and miR142-5p. [score:5]
In each case, mutation of miR144 (or) miR153 (or) miR27a (or) miR142-5p binding sites on Nrf2 3′ UTR failed to downregulate the luciferase activity as opposed to those observed in WT type reporter construct (Fig. 5B –5E; compare lane 3 vs lane 4). [score:5]
To validate whether the computationally predicted miRNAs could target Nrf2 in neuronal system, we chose human neuroblastoma SH-SY5Y, a neuronal-like subline of SK-N-SH cells and overexpressed with each of these miRs (miR144, miR153, miR27a and miR142-5p) individually. [score:5]
Nrf2 is a Direct Target of miR144, miR153, miR27a and miR142-5p. [score:4]
Mutating miR144, miR153, miR27a and miR142-5p binding sites in Nrf2 3′ UTR confirms Nrf2 as a direct target of miR144/153/27a/142-5p. [score:4]
0051111.g007 Figure 7 In-silico based identification of Nrf2 dependent molecular pathway and complex network of disease processes that could be regulated at the intersection of miR144, miR153, miR27a and miR142-5p. [score:4]
To further confirm that Nrf2 3′ UTR regulation by miR144, miR153, miR27a, miR142-5p indeed impact the expression of Nrf2 mRNA, we determined the levels of Nrf2 message in SH-SY5Y cells transfected with and without the aforementioned miRs using quantitative real time PCR for Nrf2. [score:4]
In-silico based identification of Nrf2 dependent molecular pathway and complex network of disease processes that could be regulated at the intersection of miR144, miR153, miR27a and miR142-5p. [score:4]
miR153, miR27a, miR142-5p and miR144 in regulating Nrf2 expression in SH-SY5Y neuronal cells. [score:4]
Thus, future studies should assess the relative timing and involvement of various closely linked events such as translation repression, mRNA deadenylation and decay in miR144/miR153/miR27a/miR142-5p induced silencing of Nrf2. [score:3]
Overall, this data suggests that Nrf2 is translationally repressed by miR144, miR153, miR27a, miR142-5p in a specific manner. [score:3]
Figure S5 Effect of 10 nM each of combination of miR144, miR153, miR27a and miR142-5p on Nrf2 protein expression. [score:3]
Luciferase reporter constructs containing mutation of miR153, miR27a and miR142-5p target sites of Nrf2 3′ UTR were generated using partial overlapping primer based PCR according to Zheng et al. [25]. [score:3]
As one to many miR:target relationships are likely, we next analyzed the possible strong candidates including Nrf2 that could be mapped at the intersecting points of miR144, miR153, miR27a and miR142-5p using “mirDIP (microRNA: Data Integration Portal)”. [score:3]
The results of Fig. S5 and S6 suggests that in a given cellular context, when these candidate miRs: miR144, miR153, miR27a and miR142-5p co-exist even at low levels, each would bind to Nrf2 via multiple, distinct binding sites and may perhaps increase the robustness and likelihood of targeting Nrf2 and its associated functions. [score:3]
Ectopic expression of miR153 and miR27a resulted in log (2) 8.5 fold and 8.8 fold increase in levels of these miRs respectively (Fig. S1B; S1C). [score:3]
According to our prediction analysis using TargetScan, we observed evolutionarily conserved binding sites for miR27a, miR142-5p, miR153 between 62–68, 83–90, 98–105 respectively in the human Nrf2 3′ UTR (Fig. 1B). [score:3]
While all the other target genes which are at the intersection of 4 miRs are represented by independent colored lines (miR144-brown; miR153-red; miR27a-black; miR142-5p-purple). [score:3]
Construction of miR-disease Network (MDN) with Respect to miR144/miR153/miR27a/miR142-5p. [score:3]
It is to be noted that DIANA-mirPath analysis populated NFE2L2 as the principal gene at the intersection of miR144, miR153, miR27a, miR142-5p with a highest –ln(p-value) of 20.79 that is mapped to involve in Prion disease by KEGG pathway (Fig. 7B). [score:3]
Thus our study is the first to demonstrate that Nrf2 protein could be subjected to translation repression by miR144/miR153/miR27a/miR142-5p in a Keap1 independent manner in neuronal cellular system. [score:3]
The results show that individual overexpression of miR144, miR153, miR142-5p effected a ∼42% repression and a maximal repression by about ∼68% was shown by miR27a (Fig. 2A). [score:3]
Thus, to test whether the forced expression of selected individual miRNA candidates (miR144, miR153, miR27a and miR142-5p) have any repressing effect on Nrf2 3′ UTR, we used a reporter construct that was cloned with 428 bp of human Nrf2 3′ UTR downstream of luciferase gene. [score:3]
Thus, in view of preserving redox potential that is key to a normal cellular physiology, our results suggest that Nrf2 dependent redox homeostasis could be controlled in this neuronal system by regulation of levels of the following miRs: miR144/miR153/miR27a/miR142-5p. [score:2]
Figure S6 Integration analysis of multiple miRNAs (miR144/miR153/miR27a/miR142-5p) to various human pathways by DIANA mirPath. [score:1]
Totally 28 genes were computed to be at the intersection of 4 different miRs (hsa-miR144/hsa-miR153/hsa-miR27a/hsa-miR142-5p). [score:1]
miRNA precursors for hsa-miR144, hsa-miR153, hsa-miR27a, hsa-miR142-5p, hsa-miR21, scramble control miR, siPort™ Amine NeoFX and mirVana miRNA isolation kit were purchased from Ambion (Austin, TX). [score:1]
miR144/miR153/miR27a/miR142-5p Mediated Repression of Nrf2 is Keap1-independent. [score:1]
Based on these criteria, we narrowed down to a list of 4 different miRs (hsa-miR27a, hsa-miR153, hsa-miR142-5p including the already reported hsa-miR144) (Fig. 1A). [score:1]
The schematic representation of binding sites and the individual mutants for miR144 (site-1 & site-2), miR153, miR27a and miR142-5p in the human Nrf2 3′ UTR was shown in Fig. 5A and the successful incorporation of mutagenized bases was confirmed by sequencing of the individual mutant constructs. [score:1]
miR144, miR153, miR27a and miR142-5p Represses Nrf2 3′ UTR and Endogenous Nrf2 mRNA. [score:1]
SH-SY5Y cells were transfected with either 40 nM of scramble miRNA or combination of miRs (10 nM each of miR144, miR153, miR27a, miR142-5p) for 48 h. (A) Nrf2 immunoblotting was performed in whole cell protein lysates with anti-GAPDH serving as loading control. [score:1]
[1 to 20 of 39 sentences]
15
[+] score: 145
These data suggest that IGFBP-5 is a direct target of miR-140, whereas miR-27a down-regulates, likely indirectly, both MMP-13 and IGFBP-5. This study is the first to show the regulation of these miRNAs in human OA chondrocytes. [score:9]
Since several reports on miRNA profiling human cartilage [32], cancer [23] and general human tissues [21, 36] have already been published, we chose to follow up on MMP-13 and IGFBP-5 and focus our research on the expression and regulation of miR-140 and miR-27a, as these miRNAs were identified with high prediction by the five computational programs used as possible regulators of both MMP-13 and IGFBP-5 expression. [score:7]
Data also suggest that miR-140 could act directly on decreasing IGFBP-5 expression but that miR-27a indirectly decreases both MMP-13 and IGFBP-5. These findings add another level of complexity to the overall regulation of MMP-13 and IGFBP-5, two factors involved in the OA pathological process. [score:6]
Although the identification of the miR-27a -targeted intermediate factor is currently ongoing, the computational programs have identified only a few miR-27a target genes that could have the potential to code for MMP-13 regulatory factors, and include PPARγ and Smad2. [score:6]
Pre-miR-27a did not affect expression and anti-miR-27a treatment started to up-regulate transcription at 48 hours post-treatment, an increase which became significant after 72 hours. [score:6]
We identified the miRNAs miR-140 and miR-27a as regulators of these two genes and studied their expression and regulation in normal and OA human chondrocytes. [score:5]
To determine whether miR-140 and miR-27a could play a role in the OA disease process, we compared their expression levels between normal and OA chondrocytes and identified possible regulatory factors. [score:5]
To this end, we used pre-miRNA and anti-miRNA molecules to determine the effects of miR-140 and miR-27a on the expression of target genes. [score:5]
For comparison purposes, we also determined the expression of two other genes, IL-10 and bFGF, predicted as targets for miR-140 (bFGF) and miR-27a (IL10); these predictions were also obtained by the same five computational programs as described above. [score:5]
Transfection with pre-miR-140 significantly decreased (p = 0.0002) and with anti-miR-140 significantly increased (p = 0.05) IGFBP-5 expression at 24 hours, while pre-miR-27a did not affect either MMP-13 or IGFBP-5. Treatment with anti-miR-27a, but not with anti-miR-140, significantly increased the expression of both MMP-13 (p < 0.05) and IGFBP-5 (p < 0.01) after 72 hours of incubation. [score:5]
However, given the large number of potential miR-27a targets, the possibility that miR-27a targets two different regulatory factors for MMP-13 and IGFBP-5 is also considered. [score:5]
The anti-miRNA would antagonize the inhibitory effect of miR-27a on the stimulatory factor resulting in its increased expression, which, in turn, would affect IGFBP-5 and MMP-13. [score:5]
The results as illustrated in Figure 3 showed that treatment with pre-miR-140 or miR27a (Figure 3A) did not significantly affect MMP-13 expression levels, while transfection with anti-miR-27a (Figure 3B) increased MMP-13 expression with time, reaching statistical significance (p < 0.05) at 72 hours. [score:5]
In this study, we show that MMP-13, as well as IGFBP-5, are likely indirect targets of miR-27a. [score:4]
Regulation of miR-140 and miR-27a expression levels inchondrocytes. [score:4]
It is likely that the factor is a stimulatory regulator of both IGFBP-5 and MMP-13 expression as they are affected only by the anti-miR-27a and not by the pre-miR-27a. [score:4]
Five computational algorithms identified miR-140 and miR-27a as possible regulators of MMP-13 and IGFBP-5 expression. [score:4]
Figure 5 Expression and regulation of miR-27a and miR-140 levels in human chondrocytes. [score:4]
There was a significant reduction (77%, p < 0.01) in miR-140 expression in OA compared to the normal chondrocytes, whereas miR-27a expression was only slightly decreased (23%). [score:4]
Figure 3 Effect of pre- and anti-miR-140 and miR-27a on MMP-13 gene expression. [score:3]
Of note, another gene predicted to be a target of miR-27a, IL-10, was not affected by either this pre- or anti-miRNA. [score:3]
All together, these data suggest that miR-140 acts directly on IGFBP-5 and miR-27a acts indirectly on both genes. [score:3]
The expression levels of IGFBP-5, miR-140, and miR-27a were quantified by real-time polymerase chain reaction (PCR). [score:3]
Data on MMP-13 and IGFBP-5 indicate that miR-27a affects the expression of another factor (or factors), which in turn acts on these two genes. [score:3]
Data (Figure 5A) showed no significant difference in miR-27a expression between normal and OA chondrocytes although a slight decrease (23%) was observed in the OA. [score:3]
OA chondrocytes were transfected with pre-miRNA and anti-miRNA molecules specifically targeting the human miR-140 and miR-27a (45 nM final concentration; Applied Biosystems) in DMEM and the HiPerfect Transfection Reagent (3% final concentration; Qiagen). [score:3]
Data revealed that both miRNAs are expressed in human OA chondrocytes at about the same level as the RNU24 control gene, which was given an arbitrary value of 1. Values of 0.88 and 0.94 fold change were recorded for miR-140 and miR-27a respectively. [score:3]
As for miR-27a, among the factors tested, only IFN-γ and IL-10 decreased its expression. [score:3]
Modulation of IGFBP-5, miR-140 and miR-27a expression was determined upon treatment of OA chondrocytes with cytokines and growth factors. [score:3]
OA chondrocytes were transiently transfected with pre- or anti-miRNAs specific for miR-140 and miR-27a and incubated for 24, 48 and 72 hours (gene expression) and 72 hours (protein production). [score:3]
IGFBP-5 expression, like that of MMP-13, was gradually affected by the anti-miR-27a; an increase was seen after 48 hours and significance (p < 0.01) reached after 72 hours of incubation (Figure 4B). [score:3]
Our study is the first to show the regulation of the two miRNAs, miR-140 and miR-27a, in OA chondrocytes. [score:2]
Presence and effect of miR-140 and miR-27a in OA chondrocytes. [score:1]
However, as mentioned above, these two factors are not found at high levels in OA [50] which could explain that only a slight reduction in miR-27a was found in OA chondrocytes. [score:1]
For the four specimens in which the IGFBP-5 level was detectable, data showed that treatment with both anti-miR-27a and anti-miR-140 induced a marked increase in level and values of 2.0 ± 1.1 and 3.0 ± 1.0 fold increase respectively were recorded. [score:1]
A significant increase was noted in chondrocytes treated with anti-miR-27a (1.5 ± 0.2 fold increase, p < 0.05, n = 8), but treatment with anti-miR-140 or with the pre-miRNAs did not significantly affect MMP-13 production. [score:1]
The 3'-UTRs were analyzed by computational programs to predict the presence of functional miR-140 and miR-27a sites. [score:1]
Figure 2 Predicted recognition sequences for miR-140 and miR-27a in the 3'-UTR of the MMP-13 and IGFBP-5 mRNAs. [score:1]
Firstly, we investigated if miR-140 and miR-27a are expressed in human chondrocytes. [score:1]
All five computational programs predicted potential pairing sites for miR-140 and miR-27a in MMP-13 and IGFBP-5 3'-UTRs (Figure 2). [score:1]
In contrast, the cytokines IL-10 (p < 0.01) and IFN-γ (p < 0.02) significantly reduced the miR-27a levels. [score:1]
[1 to 20 of 41 sentences]
16
[+] score: 134
Hypoxic conditions have been described previously to up-regulate miR-27a/b-3p expression 26 while infective and inflammatory processes down-regulate their expression 27 28. [score:11]
In physiological or pathological conditions where testosterone levels decrease, TFPI expression is downregulated due to a lower transcription of TFPI mRNA but also to a higher repression by miR-27a/b. [score:6]
miR-27a/b-3p directly inhibit the expression of TFPIα. [score:6]
miR-27a/b-3p directly bind and regulate the expression of TFPIα. [score:5]
Results showed no differences in miR-27a/b-3p expression that may be due to a substantial overlap of TFPI expression between the 2 groups (Fig. 7). [score:5]
hy926 cells abolished TFPI up-regulation produced by 30 nM DHT as well as the anticoagulant activity, showing a relationship between testosterone, TFPI, and miR-27a/b-3p. [score:4]
In the presence of normal levels of testosterone, TFPI expression is regulated in part by the presence of miR-27a/b in the cytosolic compartment. [score:4]
miR-27a/b-3p directly target TFPI mRNA. [score:4]
Data from higher sample size will help to elucidate the role that miR-27a/b-3p may play in the testosterone mediated downregulation of TFPI in vivo, and thus whether it could be a contributing factor to the risk of thrombosis associated with low testosterone levels 14 15. [score:4]
DHT regulates miR-27a/b-3p and TFPI expression. [score:4]
How to cite this article: Arroyo, A. B. et al. Regulation of TFPIα expression by miR-27a/b-3p in human endothelial cells under normal conditions and in response to androgens. [score:4]
Thus, we here described for the first time that TFPIα is directly regulated by two miRNAs, miR-27a/b-3p in ECs and this post-transcriptional regulation of TFPIα might have consequences on the endothelial functions. [score:4]
Indeed, we hypothesized that miR-27a/b-3p may be upregulated in the plasma of men with low concentration of testosterone and TFPI 13 in comparison with men with normal levels. [score:4]
miR-27a/b-3p regulate DHT -dependent TFPI expression. [score:4]
To reveal whether the effect of miR-27a/b-3p on TFPIα was direct or indirect, we cloned a fragment of TFPI 3′UTR (NM_006287) into a luciferase vector. [score:3]
This mo del suggests that in ECs high levels of miR-27a/b-3p might reduce the protective role of testosterone against cardiovascular disease 14 15. [score:3]
Accordingly, the quantification of miR-27a/b-3p might be of interest in pathological conditions where miRNA deficiency or over -expression may have an important impact 25. [score:3]
However, we found a lack of agreement between the in vitro and ex vivo results for miR-27b-3p (Fig. 3B) that may be justified because its expression was 18-fold lower than miR-27a-3p in HUVECs (Fig. 3C), which is in accordance with published results 24. [score:3]
miR-27a-3p inversely correlated with TFPI expression in HUVECs. [score:3]
These results could be partially explained through differences of regulation pathways between both cell types that can certainly have an impact on the miR-27a/b-3p-testosterone regulation 31. [score:3]
hy926 and HUVECs were seeded at 50,000/well and transfected with 100 nmol/L miRNA mimics (miR-27a/b-3p, miR-24, miR-19b or scrambled control -SCR-) from Life Technologies (Madrid, Spain) and anti-miRNA inhibitors (anti-miR-27a/b-3p or anti-SCR control) from Exiqon (Vedbaek, Denmark) using siPORT™ NeoFX™ (Life Technologies, Madrid, Spain) according to manufacturer’s instructions. [score:3]
hy926 (C) and in HUVECs (G) and the respective protein levels (D, F) of cells transfected with miR-27a/b-3p inhibitors, and determined by the same methods and in the same conditions, is also shown. [score:3]
hy926 cells transfected with (A) miR-27a/b-3p precursors or (B) miR-27a/b-3p inhibitors were activated with 15 nM or 30 nM DHT. [score:3]
Indeed, in silico analyses showed that miR-27a/b-3p could also target TF and PS, although these interactions have to be further demonstrated in vitro. [score:3]
Thus, we wondered whether miR-27a/b-3p could be implicated in TFPI regulation by testosterone. [score:2]
Given the extensive cross-talk between the coagulation and inflammatory systems, TFPI included 29, additional studies are certainly needed to reveal the role of miR-27a/b-3p in TFPIα regulation and the impact on their activity under pathological conditions. [score:2]
We suggest that testosterone may be a hinge in miR-27a/b-3p-TFPIα regulation axis (Fig. 8). [score:2]
In fact, when ECs transfected with anti-miR-27a/b-3p where treated with 15 nM DHT, we observed a significant increase of TFPI mRNA (Fig. 6B) and of the anticoagulant activity (Fig. 6C) further demonstrating the potential involvement of miR-27a/b-3p in the regulation of TFPI levels in ECs. [score:2]
miR-27a/b-3p regulate the anticoagulant activity of TFPIα in HUVECs. [score:2]
Therefore, regulation of miR27a/b-3p by testosterone seems to be specific and non -dependent of miRNA biogenesis machinery. [score:2]
By using a correlation mo del, we found that TFPI mRNA and miR-27a-3p levels were inversely and significantly associated (Fig. 3A). [score:1]
In an attempt to further demonstrate the regulation of TFPI by miR-27a/b-3p through testosterone, we compared the levels of miR-27a/b-3p and TFPI mRNA in HUVECs in both genders and found no differences (Figure S5). [score:1]
HCT-DK cells were co -transfected with miR-27a/b-3p (both pMIR-REPORT plasmids −500 ng/well-wild type or mutated for the miR-27a/b-3p seed site) or SCR control, and 50 ng/well of renilla luciferase control plasmid (pRL-TK; Promega, Madison, WI) using Lipofectamine LTX (Life Technologies) according to the manufacturer’s instructions. [score:1]
This finding suggests that miR-27a/b-3p levels variations may have an impact on TFPIα functionality. [score:1]
Indeed, miR-27a and miR-27b were not correlated (Fig. 3D). [score:1]
A deletion mutant of pMIR-REPORT-TFPI without miR-27a/b-3p seed region -binding site was generated using the primers S: 5′GAGCTCCGTTATTTTTACCGTGTTTTG and AS: 5′ACGCGTCGTTTGAGTGGTTTTCAG with the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA). [score:1]
Plasmids including TFPI WT 3′UTR or TFPI mutant 3′UTR in which the seven nucleotides forming the seed region of miR-27a/b-3p were deleted. [score:1]
Only miR-27a/b-3p mimics produced a decrease in both TFPI mRNA and extracellular TFPIα levels (Fig. 1A and B), as well as anti-miR-27a/b-3p produced an increase in TFPI mRNA and extracellular TFPIα levels (Fig. 1C and D). [score:1]
hy926 cells were activated with physiological (30 nM) or low (15 nM) doses of DHT and TFPI mRNA (A), secreted TFPIα expression (B) and miR-27a/b-3p levels (C, D) were measured. [score:1]
Although it has been shown that testosterone increases the rate of pri-miR-27a maturation through the binding of the androgen receptor (AR) to the promoter of the gene in LNCaP prostate cancer cells 30, our results showed that DHT provokes a decrease of miR-27a/b-3p in ECs. [score:1]
Finally, combination of androgen treatment with miR-27a/b-3p transfection (Fig. 6A and C) but not with miR-19b or miR-24 (Figure S3) in EA. [score:1]
Levels of miR-27a/b-3p in human plasma. [score:1]
Transfection with miR-27a/b-3p significantly decreased TFPIα anticoagulant activity, while anti-miR-27a/b-3p significantly increased TFPIα anticoagulant activity (Fig. 4). [score:1]
miR-27a/b-3p levels modulate the anticoagulant effect of TFPIα. [score:1]
With the aim to test whether the TFPI:miR-27a/b-3p interaction has physiological consequences, we quantified these transcripts in 74 HUVEC samples (from healthy human donors). [score:1]
As a negative control, we deleted the seed region for miR-27a/b-3p. [score:1]
TFPIα anticoagulant activity was measured in the supernatant from HUVECs transfected with precursors or inhibitors of miR-27a/b-3p. [score:1]
Indeed, such doses of DHT decreased miR-27a/b-3p (Fig. 5C and D). [score:1]
Computational results from the different algorithms showed up 4 miRNA candidates: miR-27a/b-3p, miR-19b and miR-24 (Table 1). [score:1]
hy926 cells transfected with miR-27a-3p (Figure S1). [score:1]
Levels of miR-27a-3p (A), miR-27b-3p (B), miR-19b (E) and miR-24 (F) were measured by qRT-PCR and correlated with TFPI mRNA expression in 74 HUVEC samples obtained from umbilical cords. [score:1]
As expected, no significant correlations were observed (Fig. 3E and F), which strengthen the results obtained for miR-27a-3p. [score:1]
The effect of miR-27a/b-3p mimics were also shown in HUVECs (Figure S4). [score:1]
[1 to 20 of 53 sentences]
17
[+] score: 116
Consistently, another study demonstrated that miR-27a was highly expressed in breast cancer cells and inhibited the expression of tumor suppressor FOXO1 [160]. [score:9]
For example, the oncogenic activity of miR-27a was observed in breast cancer cells due to the suppression of zinc finger ZBTB10, leading to increased expression of specificity proteins including Sp1, Sp3, and Sp4, and subsequently causing up-regulation and activation of Sp -dependent survival and angiogenic genes, such as Survivin, VEGF and VEGFR1 [159]. [score:8]
Specifically, miR-27a suppresses FBW7 expression, leading to a reduction in ubiquitin -mediated degradation and turnover of FBW7 substrate, cyclin E. Overexpression of FBW7 caused dysregulation of cyclin E, resulting in altered cell cycle progression [26]. [score:8]
Furthermore, miR-27a overexpression promotes cell growth, whereas miR-27a knockdown inhibits cell proliferation in vitro and tumor formation in vivo possibly through regulating FBW7 [26]. [score:7]
Similarly, down-regulation of miR-27a reversed multidrug resistance of esophageal squamous cell carcinoma in part via regulation of P-glycoprotein, Bcl-2 and MDR1 [162]. [score:5]
Moreover, miR-27a was found to be overexpressed and inversely associated with FBW7 expression in leukemia [26]. [score:5]
Recently, miR-27a was identified to inhibit the expression of FBW7. [score:5]
In line with the oncogenic roles of miR-27a, Liu et al. reported that miR-27a is overexpressed in human gastric adenocarcinoma and promotes gastric cancer cell growth by inhibition of Prohibitin [163]. [score:5]
Moreover, microRNAs (miRNAs) including miR-27, miR-25 and miR-223 have been reported to be involved in regulating the expression of FBW7 [24- 27]. [score:4]
To this end, emerging evidence has demonstrated that several molecules such as p53, Pin1 (Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1), C/EBP-δ (CCAAT/enhancer -binding protein-δ), Hes-5 (Hairy and Enhancer-of-split homologues 5), Numb, as well as microRNAs (miRNAs) including miR-27a and miR-223 have been found to regulate the expression of FBW7 [88- 91]. [score:4]
In addition, multiple microRNAs (miRNAs) such as miR-27a, miR-25, miR-129-5p, and miR-223 have also been demonstrated to regulate the expression of FBW7. [score:4]
Feng DD Zhang H Zhang P Zheng YS Zhang XJ Han BW Luo XQ Xu L Zhou H Qu LH Chen YQ Down-regulated miR-331-5p and miR-27a are associated with chemotherapy resistance and relapse in leukemiaJ Cell Mol Med 2010 92. [score:4]
Collectively, these findings suggest that miR-27a exerts its oncogenic functions in part through negative regulation of the FBW7 tumor suppressor. [score:4]
Notably, miR-27a knockdown increased FBW7 levels and subsequently decreased the expression of FBW7 substrates such as c-Myc, c-Jun and Notch-1 in colon cancer [26]. [score:4]
Accumulated evidence has also shown that multiple miRNAs including miR-27 and miR-223 could regulate FBW7 expression [24, 91]. [score:4]
Moreover, miRNAs including miR-223, miR-27a, miR-25, and miR-129-59p can also regulate the expression of FBW7. [score:4]
Zhu et al. found that miR-27a was critically involved in drug resistance through regulating P-glycoprotein and MDR1 (multidrug resistant) expression in human cancer cells [161]. [score:4]
Ma et al. have further revealed that miR-27a enhanced cell growth, colony formation and migration by targeting Sprouty2 in pancreatic cancer cells [165]. [score:3]
Taken together, miR-27a could be possibly used as a target in the diagnosis and treatment of human cancers. [score:3]
Wang et al. reported that FBW7 is a potential miR-27a target. [score:3]
Lerner et al. further discovered that miR-27a suppresses FBW7 during specific cell cycle phases [26]. [score:3]
Consistently, there is an inverse correlation between miR-27a expression and FBW7 levels in human tumor samples [167]. [score:3]
In further support of this concept, overexpression of miR-27a has been observed in colon cancer cell lines and colon cancer stem cells [168]. [score:3]
Tang W Yu F Yao H Cui X Jiao Y Lin L Chen J Yin D Song E Liu Q miR-27a regulates endothelial differentiation of breast cancer stem like cellsOncogene 2013 167. [score:2]
Regulation of FBW7 by miRNA-27. [score:2]
Furthermore, miR-27a exerts its oncogenic function via regulation of MET, EGFR, and Sprouty2 in lung cancer [164]. [score:2]
Notably, miR-27a was found to regulate endothelial differentiation of breast cancer stem like cells [166]. [score:2]
It has been documented that miR-27a plays an oncogenic role in human cancers [157, 158]. [score:1]
3.7.1 by miRNA-27It has been documented that miR-27a plays an oncogenic role in human cancers [157, 158]. [score:1]
[1 to 20 of 29 sentences]
18
[+] score: 115
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26a-2
Tang et al. [26] found that osteosarcoma patients with high miR-27a expression had both worse overall and disease free survival, and demonstrated that clinical stage, distant metastasis and serum miR-27a expression were all independent prognostic factors for both overall and disease-free survival. [score:9]
Fig 1 MiRNAs expression levels in osteosarcoma and adjacent normal tissues The results indicated that low expression level of miR-26a and high expression of miR-27a were associated with high TNM stage (P = 0.001; P = 0.012), tumor grade (P = 0.007; P = 0.016), and distant metastasis (P = 0.004; P = 0.001). [score:7]
Fig 2Relationship between miRNAs expression levels and survival time (log-rank test: P < 0.001) Multivariate Cox proportional hazards mo del analysis showed that low expression of miR-26a and high expression of miR-27a (P = 0.021; P = 0.011), high TNM stage (P = 0.001; P = 0.003), tumor grade (P = 0.005; P = 0.01), and distant metastasis. [score:7]
Li et al. [28] indicated the miR-27a was up-regulated in lung adenocarcinoma patients treated with cisplatin -based chemotherapy and confirmed that it might be associated with low expression of RKIP, decreased sensitivity to cisplatin, and poor prognosis. [score:6]
The results indicated that low expression level of miR-26a and high expression of miR-27a were associated with high TNM stage (P = 0.001; P = 0.012), tumor grade (P = 0.007; P = 0.016), and distant metastasis (P = 0.004; P = 0.001). [score:5]
A study reported that miR-27a might have oncogenic in laryngeal squamous cell carcinoma via suppressing the expression of PLK2 and serve as a diagnostic and therapeutic biomarker in this malignancy [27]. [score:5]
The results indicated that patients with low expression of miR-26a and high expression of miR-27a had shorter overall survival (log-rank test: P < 0.001; Fig.   2). [score:5]
In the present study, the results indicated that patients with high expression of miR-27a had shorter overall survival than those with low miRNAs expression. [score:5]
Multivariate Cox proportional hazards mo del analysis showed that low expression of miR-26a and high expression of miR-27a (P = 0.021; P = 0.011), high TNM stage (P = 0.001; P = 0.003), tumor grade (P = 0.005; P = 0.01), and distant metastasis. [score:5]
Kaplan-Meier analysis and log-rank test indicated that patients with low expression of miR-26a and high expression of miR-27a had shorter overall survival (log-rank test: P < 0.001). [score:5]
Our result suggested that miR-26a expression level in osteosarcoma bone tissue was significantly lower than that in the paired noncancerous bone tissues (mean ± SD: 5.12 ± 2.53; 10.75 ± 3.23; P = 0.001; Fig.   1), Furthermore, miR-27a expression was higher in osteosarcoma bone tissue in comparison with paired noncancerous bone tissues (mean ± SD: 6.35 ± 1.23; 2.85 ± 0.64; P = 0.003; Fig.   1). [score:5]
Furthermore, in the present study, miR-27a expression was higher in osteosarcoma bone tissue in comparison with paired noncancerous bone tissues and high expression level of miR-27a was associated with high TNM stage, tumor grade, and distant metastasis. [score:5]
It has been reported that aberrant expression of miR-27a occurred in different human cancer kinds, which show it act as a regulator in carcinogenesis. [score:4]
Aberrant expression of miR-27a has been suggested in various human cancer kinds, which indicates it act as a regulator in carcinogenesis. [score:4]
However, there were no significant correlations of miR-26a and miR-27a expression levels with other clinical features. [score:3]
Moreover, miR-27a expression level can promote proliferation, migration and invasion in osteosarcoma cells [23]. [score:3]
In conclusion, our findings suggested that expression level of miR-26a and miR-27a contributes to aggressive progression of this malignancy. [score:3]
Moreover, Multivariate Cox proportional hazards mo del analysis showed that high expression of miR-27a, high TNM stage, tumor grade, and distant metastasis were independent prognostic factors for overall survival patients with osteosarcoma cancer. [score:3]
its oncogenic role has been verified in many kinds of malignancies such as hepatocellular carcinoma, renal cell carcinoma, breast cancer gastric adenocarcinoma, colon cancer, and cervical cancer; while, miR-27a is suggested to be a cancer suppressive miRNAs in non-small cell lung cancer, oral squamous cell carcinoma, and acute leukemia, oesophageal cancers [18– 22]. [score:3]
Furthermore, it has been shown that miR-27a might be as oncogenic mirRNA in many kinds of malignancies such as hepatocellular carcinoma, renal cell carcinoma, breast cancer gastric adenocarcinoma, colon cancer, and cervical cancer; but miR-27a is suggested to be a tumor suppressive miRNAs in non-smallcell lung cancer, oral squamous cell carcinoma, and acute leukemia, oesophageal cancers [18– 22]. [score:3]
Tang et al. [26] showed that the serum levels of miR-27a expression increased in osteosarcoma patients and confirmed its significant associations with aggressive clinicopathological features including advanced clinical stage, positive distant metastasis and poor response to chemotherapy, indicating its oncogenic role in this malignancy. [score:3]
Some studies have indicated that miR-27a expression level is involved in promotion of proliferation, migration and invasion in osteosarcoma cells [23]. [score:3]
They confirmed the prognostic value of serum miR-27a expression in osteosarcoma patients. [score:3]
Real-time PCR was applied to quantify the expression level of miR-26a and miR-27a. [score:3]
MiR-27a expression was higher in osteosarcoma bone tissue in comparison with paired noncancerous bone tissues. [score:2]
Therefore, biological role of miR-27a in cancers is controversial. [score:1]
MiR-27a is located at chromosome 19p13.1, belongs to the miR-23a/24-2/27a cluster existing intergenically in the vertebrate genome [17]. [score:1]
It has been shown that oncogenic miR-27a had important role in ovarian cancer cell growth and metastasis [29]. [score:1]
The correlation of miR-26a and miR27a expression with overall survival of osteosarcoma patients was investigated by Kaplan-Meier analysis and log-rank test. [score:1]
Nevertheless, biological role of miR-27a in cancers is controversial. [score:1]
However, the expression of miR-26a and miR-27a in osteosarcoma need further investigation in clinical samples. [score:1]
[1 to 20 of 31 sentences]
19
[+] score: 105
We discovered that miR-148b, -27a and -489 are essential for the regulation of osteogenesis: miR-27a and miR-489 down-regulate while miR-148b up-regulates differentiation. [score:8]
All together, these findings demonstrate that these three miRNA are both necessary and sufficient to modulate early osteogenesis in hMSC: miR-489 and miR-27a down-regulate and miR-148b up-regulates differentiation. [score:7]
UNTR/Diff - untransfected differentiated cells, UNTR/Prop - untransfected undifferentiated cells, IC1,- cells transfected with Inhibitor Control Molecule 1, MC1,- cells transfected with Mimic Control Molecule 1, i27a - cells transfected with Inhibitor for miR27a, i489 - cells transfected with Inhibitor for miR489, m148b - cells transfected with mimic for miR148b. [score:7]
GCA is a common target for miR-27a and -489 and its expression is directly regulated by these miRNAs (Fig. 4). [score:7]
However, inhibition of miR-27a demonstrated more substantial activation of SPP1 expression in comparison with inhibition of miR-489. [score:7]
We hypothesize that if PEX7 is a key target of miR-27a and miR-489 then its knockdown may mimic effect of these miRNAs and inhibit osteogenic differentiation. [score:6]
Interestingly, while inhibitor miR-27a was able to up-regulate osteogenesis in transfected cells incubated in differentiation media, it demonstrated very low effect on cells in propagation media (Fig. 2a). [score:6]
Analysis of the predicted gene targets revealed that APL, a gene encoding liver/bone/kidney-specific alkaline phosphatase, may be a target for miR-27a but not for miR-489. [score:5]
Inhibitor of miR-489 was able to stimulate differentiation in either propagation or differentiation conditions while inhibitor of miR-27a was active in the differentiation conditions only. [score:5]
hMSC were transfected with Inhibitor Control molecule 1 (IC1, 25 nM) or with a combination of inhibitors for miR-27 and -489 (i27a+i489, 12.5 nM each). [score:5]
Also, induction of SPP1 expression was found in cells transfected with miR-27a inhibitor (Fig. 2b). [score:5]
Interestingly, inhibition of miR-489 had a stronger effect on AP activity induction than inhibition of miR-27a. [score:5]
As determined by the miRanda 3.0 algorithm and L2L gene ontology tool [17], both miR-27a and -489 target a number of genes that are related to bone remo deling and skeletal development (Table S2). [score:4]
Upon differentiation, expression of miR-27a and -148b changed and correlated with the level of osteogenic differentiation that was observed at day six. [score:3]
Thus, while PEX7 still can be a target of miR-27a and miR-489 it may not mediate effect of these miRNAs on osteogeneis. [score:3]
Table S3 Genes that are predicted as common targets for miR-27a and -489. [score:3]
We found that upon osteogenic differentiation, expression of miR-27a decreases 41% (p-value<0.01) and miR-148b increases 67% (p-value<0.02) (Table S1). [score:3]
Similarly, SPP1 may be a target for miR-489 but not for miR-27a. [score:3]
HT1080 cells were transfected with Mimic Control molecule 1 (mc1, 12.5 nM) or with a combination of inhibitors for miR-27 and -489 (i27a+i489, 6.25 nM each) and with 3′UTR reporter constructs as imdicated. [score:3]
Human miR-27a and -27b differ by a single nucleotide at position 19. miR-148a and -148b differ by two nucleotides at positions 7 and 8. We found that the miR-27b inhibitor induces a relatively small increase in AP activity in hMSC. [score:3]
While further studies are needed to investigate the possible roles of miR-27a and -489 targets in greater detail, our data suggests that the inhibitory effect of miR-489 and -27a is, at least in part, mediated by repression of GCA. [score:3]
The analysis revealed that miR-148b and miR-27a both can be detected in undifferentiated and differentiated cells (Table S1. ) [score:1]
The miR-27 family is represented by two members, miR-27a and -27b. [score:1]
Our findings indicate that miR-27a, -489 and -148b may affect both related and unrelated pathways. [score:1]
These findings indicate that miR-27a and -489 may affect both related and unrelated pathways. [score:1]
[1 to 20 of 25 sentences]
20
[+] score: 105
As the expressions of miR-27a and miR-99a decreased during hepatic differentiation the expression of LDLR expression increased, suggesting that these miRNAs regulate LDLR expression. [score:10]
These results suggest that the overexpression of miR-27a down-regulates LDLR expression, may lead to reducing HCV entry in an in vitro mo del. [score:8]
This suggests that the downregulation of miR-27a during hepatic differentiation makes DHCs more susceptible to and additional inhibition of miR-27a expression might enhances the susceptibility to. [score:8]
In addition, HCV infectivity was suppressed in miR-27a -transfected DHCs, due to the inhibition of LDLR expression by miR-27a. [score:7]
Six miRNAs (miR-27b, -122, -185, -194, -885, and -1271) were upregulated but miR-27a and -99a were down-regulated in DHCs compared with AT-hMSCs (Fig. 4A). [score:6]
We found that miR-27a and -99a were down-regulated during hepatic differentiation, and that their putative targets are EGFR and LDLR. [score:6]
Here, we showed that treatment with miR-27a mimics resulted in suppressed LDLR expression, followed by reduced HCV infectivity, in DHCs. [score:5]
Because the expression of EGFR did not change during hepatic differentiation, we focused on the relationship between miR-27a and LDLR expression in DHCs using miR-27a mimics. [score:5]
Furthermore, we demonstrated that miR-27a modulates HCV infectivity by regulating the expression of candidate HCV entry receptors in an established in vitro mo del. [score:4]
Previously, Shirasaki et al. [42] reported that miR-27a inhibited HCV replication in hepatoma cell lines by regulating lipid accumulation. [score:4]
The expression of miR-27a and -99a was significantly decreased in DHCs compared with AT-hMSCs (p<0.05, Fig. 4B), and so we identified downstream targets of these miRNAs. [score:4]
We therefore selected miR-27a to verify that the regulation of HCV infectivity occurs via LDLR expression. [score:4]
Furthermore, these results suggest that miR-27a modulates HCV infectivity by regulating LDLR expression. [score:4]
As shown in Table S2 LDLR was identified as a direct target of miR-27a and miR-99a. [score:4]
We therefore assessed the relationships between LDLR expression and the levels of miR-27a and -99a. [score:3]
Both miR-27a and -99a had a target site in the LDLR. [score:3]
Moreover, the expression of candidate HCV entry factors and miR-27a were altered during hepatic differentiation. [score:3]
DHCs that had been transfected with miR-27a mimics were infected with HCVcc, and the expression of HCV RNA was quantified. [score:3]
MiR-27a regulates HCV infectivity by targeting LDLR in DHCs. [score:3]
However, they did not demonstrate a relationship between the expression of LDLR and miR-27a, and HCV. [score:3]
In addition, differential expression of miR-27a and miR-99a was detected in AT-hMSCs and DHCs. [score:3]
Previous studies revealed that several miRNAs such as let-7b [24], miR-27a [25], miR-122 [26], miR-155 [27], miR-196 [28], miR-199a [29], and miR-491 [30] regulate HCV replication. [score:2]
The DHCs were seeded at a density of 1×10 [5] cells per well in 6-well plates, and transiently transfected with 20 nM miR-27a mimics (Genolution Pharmaceuticals, Seoul, Republic of Korea) or scrambled miRNA (miR-NC; Genolution Pharmaceuticals) by simultaneous seeding with G-fectin (Genolution Pharmaceuticals). [score:1]
MiR-27a regulates HCV infectivity in DHCs. [score:1]
We next investigated which of the miRNAs directly regulates LDLR by transfecting DHCs with mimics of miR-27a and miR-99a and then staining them with Dil-LDL. [score:1]
[1 to 20 of 25 sentences]
21
[+] score: 88
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-23b, hsa-mir-27b, hsa-mir-23c
If differential expression of miR-23a and miR-27a is directly linked to the knockdown of Ezh2, then overexpression should reverse this trend. [score:7]
Downregulation of miR-23a and miR-27a is in alignment with suppression of EMT and acquisition of an epithelial state in iPSC generation. [score:6]
We detected reduced expression of miR-27a and miR-23a at day 7, which remained downregulated in iPSC cells (Fig. 6e Upper and Lower panel). [score:6]
To verify if miR-23a and miR-27a miRNAs are suppressed during the initiation of iPSC generation, we studied their expression pattern during reprogramming. [score:5]
To address the differential activity of depletion of Ezh2 vs inhibition of H3K27me3 activity on expression of miR-23a and miR-27a miRNAs, we performed qPCRs in DMSO and GSK treated cells. [score:5]
These results demonstrate that increased miR-27a expression favors the EMT signaling during initiation of reprogramming and acts as an inhibitory microRNA. [score:5]
Ezh2 regulates miR-27a expression during human fibroblasts reprogramming. [score:4]
To test the functional role of Ezh2 regulated miR-27a in cellular reprogramming, miR-27a was overexpressed in human fibroblasts (Supplementary Fig. 5e). [score:4]
We also observed increased expression of Snail and reduced levels of CDH1 in miR-27a overexpressing cells (Supplementary Fig. 5f) compared to controls, indicative of alleviated pro-EMT signaling. [score:4]
Ezh2 mediated H3K27me3 activity regulates miR-27a expression during the early phase of reprogramming. [score:4]
To further confirm that Ezh2 regulates miR-23a and miR-27a expression in reprogramming, we monitored Ezh2 binding and enrichment of H3K27me3 marks on the miR-23 locus in hFibs at day 7 and Wt. [score:4]
Molecular analysis using transcript profiling confirmed enhanced expression of miR-27a and Snail combined with diminished CDH1 transcripts in miR27a overexpressing reprogramming cultures compared to control (Supplementary Fig. 5g). [score:4]
S. C. and J. G. R. cloned miR-27a for overexpression studies. [score:3]
Our results indicate enhanced expression of miR-23a and miR-27a in GSK treated cells (Fig. 6d Upper and Lower panel). [score:3]
Phenotypic analysis combined with E-cadherin staining indicated emergence of E-cadherin positive cells with an epithelial morphology in control cultures while no such changes were noticed in miR-27a overexpressing cultures (Fig 6h). [score:3]
As expected, overexpression of Ezh2 reversed the transcript profile of miR-27a and miR-23a (Fig. 6c Upper and Lower panel). [score:3]
Taqman qRT-PCR assays demonstrated increased expression of miR-27a and miR-23a in Ezh2 -deficient hFibs confirming our sequencing data (Fig. 6c Upper and Lower panel). [score:2]
RT-PCR analysis indicated a four-fold increase in miR27a levels in miR-27a overexpressed hFibs compared to control or untransfected hFib (Supplementary Fig. 5f). [score:2]
Among those identified miR-23a and miR-27a that belong to miR-23 cluster were overrepresented following Ezh2 knockdown (Supplementary Fig. 5d). [score:2]
Taken together our findings confirm that Ezh2 mediated H3K27 activity negatively regulates miR-27a in favor of a mesenchymal to epithelial transition. [score:2]
Two Kilobase upstream sequence of miR27a was amplified from immunoprecipitated material. [score:1]
Most importantly we identified previously unreported microRNAs, miR-23a and miR-27a, as barriers in human iPS generation. [score:1]
Cloning of miR-27a. [score:1]
Interestingly miR-23a and miR-27a are known to promote EMT in cancers 33 34. [score:1]
Following manufacturers instructions magnetic assisted transfection (Magnetofection Kit) of control or miR-27a was performed in human dermal fibroblast instructions (Ozbiosciences Cat # NM51000). [score:1]
Collectively, our results demonstrate that the H3K27 activity of Ezh2 overcomes EMT by transcriptional repression of pro-EMT miR-23a and miR-27a during the reprogramming process. [score:1]
Control or miR27a transfected cultures were transduced with OSKM and stained with E-cadherin antibody as shown in the schema (Fig. 6g). [score:1]
Transfection of miR-27a. [score:1]
Next we directly assayed the role of miR-27a in initiation of reprogramming. [score:1]
The amplicon containing the pre-miR-27 flanking sequences and was cloned down stream to CB promoter with CMV enhancer in the plasmid containing AAV inverted terminal repeats. [score:1]
[1 to 20 of 30 sentences]
22
[+] score: 71
Biochemical pathways potentially regulated by miRNAs differentially expressed in retina of Aβ -injected rats (Figure 3 and Table 4A) and in serum of AMD patients (Figure 4 and Table 4B) have been identified through the web server DIANA-miRPath v. 3. MiR-27a, miR-146a, and miR-155 (Figure 3 and Table 4A), which were up-regulated in retina of Aβ -injected rats, top scored as associated to TGF-β (p = 1 E-10) and prion diseases (p = 2 E-11) pathways. [score:9]
We found down-regulation of miR-155 in serum of AMD patients and Aβ injected rats; whereas we found up-regulation of miR-155 in the retina of Aβ injected rats, along with miR-27a and miR-146a. [score:7]
With exception of miRNA-155, down-regulated in serum of AMD patients and in serum of Aβ injected rats, six miRNAs (miR-9, miR-23a, miR-27a, miR-34a, miR-146a, miR-126) showed an up-regulation in serum of AMD patients. [score:7]
Furthermore, regulation of prion diseases pathway by miR-27a, miR-146a, and miR-155, reinforces the hypothesis that AMD can be a protein misfolding disease, such as AD, due to deposition of Aβ oligomers in drusen bodies. [score:6]
Reduced expression of hsa-miR-27a-3p in CSF of patients with Alzheimer disease. [score:5]
In fact, miR-155 and miR-27a can target 42 genes involved in the TGF-β pathway (DIANA-miRPath), while miR-146a can target genes involved in inflammatory pathways (Toll-like receptor, NF-κB, TNF signaling pathways). [score:5]
Intravitreal injection of Aβ induced the up-regulation of three miRNAs in rat retina: miR-27a, miR-146a, and miR-155 (Table 2 and Figure 1). [score:4]
In particular, up-regulation of miR-9, miR-23a, miR-27a, miR-34a, miR-126, and miR-146a was found in serum of AMD patients. [score:4]
Analysis of these 13 miRNAs revealed that 7 miRNAs showed a significant up-regulation in serum of AMD patients in comparison to control group (miR-9, miR-23a, miR-27a, miR-34a, miR-146a, miR-155, and miR-126). [score:4]
Incidentally, we showed that changes in circulating levels of some miRNAs (miR-9, miR-23a, miR-27a, miR-34a, miR-126, miR-146a, miR-155) as found in AMD patients are associated to Alzheimer's disease and modulate genes involved in neurodegenerative and inflammatory pathways. [score:3]
In conclusion, the modified miRNA levels we found in rat retina (miR-27a, miR-146a, miR-155) and serum of AMD patients (miR-9, miR-23a, miR-34a, miR-126, miR-27a, miR-146a, miR-155) suggest that, among others, miR-27a, miR-146a, and miR-155 have an important role in AMD and could represent suitable biomarkers and appealing pharmacological targets. [score:3]
The following groups of miRNAs were analyzed: miR-27a, miR-146a, miR-155 miR-9, miR-23a, miR-27a, miR-34a, miR-126,miR-146a, miR-155 miR-155 GraphPad Prism (version 4.0; GraphPad Software, San Diego, CA, USA) was used for statistical analysis and graphical representation of miRNA differential expression data. [score:3]
The potential link between AMD and AD is also in line with the deregulation of insulin receptor signaling by miR-27a, miR-146a, and miR-155 (Giuffrida et al., 2012; Gontier et al., 2015; Takach et al., 2015; Han et al., 2016; Sajan et al., 2016; Table 4A). [score:2]
Figure 3 Scatter distribution of pathways regulated by miR-27a, miR-146a, and miR-155. [score:2]
Three miRNAs were found to be dysregulated both in AMD patients and in retina of Aβ -injected rats (miR-27a, miR-146a, miR-155). [score:2]
To our knowledge, dysregulation of miR-27a has not been reported by other authors before, neither in experimental animal mo dels nor in in vitro mo dels of AMD. [score:2]
MiR-27a, miR-146a, and miR-155 have been reported to be associated to the inflammatory pathways mTOR, TNFα, HIF signaling, and NF-κB (Romano et al., 2015). [score:1]
Furthermore, involvement of miR-27 in AD was well documented by other authors (Maes et al., 2009; Sala Frigerio et al., 2013). [score:1]
Wang et al. (2012) suggested for the first time the potential role of miR-27a in AMD. [score:1]
[1 to 20 of 19 sentences]
23
[+] score: 70
miRNA Protein target(s) Regulatory Action Clinical Implications miR-1 LXRα*Directly suppresses LXR in vitro May promote an increase in cellular cholesterol[38] miR-9 ACAT1* Directly suppresses ACAT1 and esterification of cholesterol in macrophages Overexpression may promote macrophage cholesterol efflux and reduce foam cell formation[47] miR-10b ABCA1* ABCG1* Directly represses ABCA1 and ABCG1 expression and decreases macrophage cholesterol efflux Can be suppressed by dietary anthocyanins, leading to increased macrophage cholesterol efflux and lesion regression[63] miR-19b ABCA1* Directly suppresses ABCA1 and decreases cholesterol efflux to ApoA1; increases atherosclerotic lesion area and severity Inhibition may increase macrophage ABCA1, promoting cholesterol efflux and lesion regression[53] miR-26 ABCA1* ARL7 Activated by LXR to suppress both proteins, decreasing macrophage cholesterol efflux Inhibition may increase macrophage ABCA1, promoting cholesterol efflux and lesion regression[58] miR-27a/b ABCA1* ABCG1 ACAT1* CD36 LPL* Directly suppresses ABCA1, indirectly suppresses ABCG1, and reduces cholesterol efflux. [score:32]
It is a direct target of miR-10b [63] and miR-128 [49], and is indirectly suppressed by miR-27 [46] and miR-378 [64]. [score:7]
Indeed, in vitro treatment with miR-27 suppressed LPL mRNA and protein expression while inhibition of miR-27 yielded the opposite effect. [score:7]
MiR-27 also suppressed CD36 expression, though interestingly, CD36 does not contain an miR-27 binding site [46] suggesting that this specific regulation might be indirect. [score:7]
In addition to its numerous other target genes, miR-27 also decreased ACAT1 mRNA and protein expression in vitro [46]. [score:5]
Treatment with miR-27a/b [46], miR-128 [49], miR-145 [50], miR-302 [51], and miR-758 [48] directly suppressed ABCA1 by binding to its 3' UTR and attenuated cholesterol efflux to ApoA1. [score:4]
However, miR-27 also regulates cholesterol homeostasis by suppressing macrophage cholesterol uptake [46]. [score:4]
Regardless, miR-27 -mediated suppression of LPL and CD36 may reduce macrophage cholesterol uptake and attenuate lesion formation. [score:3]
MiR-27 was discussed above with regard to its potential ability to regulate HDL catabolism and cholesterol synthesis. [score:1]
[1 to 20 of 9 sentences]
24
[+] score: 70
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-182, hsa-mir-141
In addition, protein levels of ACLY (miR-27a target – Figure 7C), ZEB1 (miR-141 target – Figure 7D), PTEN (miR-141 target – Figure 7E) and FOXO1 (miR-182 and −27a target, Figure 7F) were significantly increased following addition of 99021, indicating derepression by their targeting miRs due to loss of GSK3β-enhanced miR biogenesis. [score:11]
This suggests that GSK3β inhibition relieves targeting of ACLY 3΄UTR by miR-27a, presumably by preventing GSK3β -mediated upregulation of miR-27a. [score:8]
pMiRTarget-ACLY 3΄UTR miR-27a binding site (BS) mutant was generated by G→U point mutation of the pMiRTarget-ACLY 3΄UTR vector at nucleotide 700 of the ACLY 3΄UTR. [score:6]
We demonstrated that 3΄UTR activity of ACLY (a target of GSK3β -upregulated miR-27a) was increased upon 99021 treatment (Figure 7A), which reduces miR-27a levels (Supplementary Figure S1D). [score:6]
pMiRTarget-ACLY 3΄UTR WT or pMiRTarget-ACLY 3΄UTR miR-27a binding site (BS) mutant were transfected into HEK293T cells alongside the pdmLacZ β-galactosidase reporter plasmid using the calcium phosphate method (37). [score:5]
Using a 3΄UTR reporter construct for the miR-27a target ACLY (in which the ACLY 3΄UTR was sub-cloned 3΄ of the luciferase gene in the pMiRTarget vector), it was found that luciferase activity was significantly increased following addition of 99021 (Figure 7A). [score:5]
Fletcher C. E., Dart D. A., Sita-Lumsden A., Cheng H., Rennie P. S., Bevan C. L. Androgen-regulated processing of the oncomir MiR-27a, which targets Prohibitin in prostate cancer. [score:4]
This supports the hypothesis that 99021 treatment reduces miR-27a levels, relieving repression of ACLY 3΄UTR, and confirms that effects are specifically attributable to alterations in miR-27a, since no increase in 3΄UTR activity upon GSK3β inhibition was observed when the miR-27a binding site was mutated. [score:3]
To provide further evidence for the importance of GSK3β activity for miR maturation, converse experiments were performed using a vector expressing constitutively active GSK3β: GSK3β-S [9]A. Transfection of GSK3-S [9]A into HEK293T significantly increased levels of mature miR-27a, miR-23a, miR-24, miR-141 and miR-182 by up to 7.5-fold (Figure 2A), with similar effects also observed in HeLa cells (Supplementary Figure S2A). [score:3]
Constitutively active GSK3β S [9]A mutant increases Drosha cleavage activity and enhances MiR biogenesisTo provide further evidence for the importance of GSK3β activity for miR maturation, converse experiments were performed using a vector expressing constitutively active GSK3β: GSK3β-S [9]A. Transfection of GSK3-S [9]A into HEK293T significantly increased levels of mature miR-27a, miR-23a, miR-24, miR-141 and miR-182 by up to 7.5-fold (Figure 2A), with similar effects also observed in HeLa cells (Supplementary Figure S2A). [score:3]
We next examined whether 99021 treatment affected levels of the 3΄UTR of ACLY, ZEB1, PTEN and FOXO1 (miR-27a, miR-141, miR-141 and miR-182/27a targets, respectively). [score:3]
This may be due to the different mechanisms of repression of these targets by miR-27a. [score:3]
To confirm GSK3β-enhanced pre-miR production, small RNAs (<200 nt) were isolated from HEK293T cells treated with 99021 or transfected with S [9]A-GSK3β or K [85]R-GSK3β and qPCR performed using primers targeting the miR-27a stem-loop, without amplification of pri-miRs due to size selection. [score:2]
This was corroborated by reduced pri-miR levels in the presence of GSK3β-WT and –S [9]A, and significantly increased pri-miR-27a following GSK3β-K [85]R transfection (Figure 2Fii), in addition to enhanced Drosha reporter activity in the presence of GSK3β-S [9]A (Figure 2D). [score:1]
No significant difference in pri-miRs levels was observed between Flag-Drosha WT and S [300]E,S [302]D -transfected cells (Figure 6F), and whilst levels of miR-27a and −182 were not significantly altered in the presence of phospho -mimic Drosha (Figure 6Gii,iv), miR-23a and miR-141 levels were significantly increased in the presence of the S [300]E,S [302]D construct (Figure 6Gi,iii). [score:1]
This nucleotide is located in the centre of the miR-27a seed region binding site (Supplementary Figure S9). [score:1]
Figure 2. GSK3β activation enhances MiR biogenesis and GSK3β modulation alters pre-miR synthesis (A) qRT-PCR analysis of miR-27a, miR-23a, miR-24, miR-141 and miR-182 levels in HEK293T cells transfected with pMT23-HA-GSK3β(S [9]A) for 48 h. U18 was used as a normalisation gene. [score:1]
In support of this, size-selection qPCR showed increased pre-miR levels following GSK3β-S [9]A transfection, whilst 99021 treatment significantly reduced pre-miR-27a abundance (Figure 2Fi). [score:1]
GSK3β-K [85]R transfection reduced levels of mature miR-27a, −23a, −141 and −182 by up to 70% in HEK293T cells (Figure 1A). [score:1]
Minimal effects observed on pri-miR and mature miR-27a and −182 levels may be attributable to maximal Drosha activity in HEK293T cells transfected with WT Flag-Drosha, such that Drosha activity towards pri-miRs cannot be significantly elevated upon addition of Flag-Drosha-S [300]E,S [302]D. Together, these data support the hypothesis that GSK3β is the kinase responsible for Drosha phosphorylation at S [300] and S [302], leading to enhanced Drosha RNase activity and miR accumulation. [score:1]
It was demonstrated that 99021 treatment significantly reduced levels of pre-miR-27a (Figure 2Fi), whilst constitutively-active S [9]A-GSK3β increased pre-miR-27a levels. [score:1]
[1 to 20 of 21 sentences]
25
[+] score: 67
While miR-424* was up-regulated in response to radiation in both gravity conditions, miR-27a and miR-144 were respectively up-regulated and down-regulated, in 2Gy-PBL incubated in MMG. [score:10]
A) Down-regulated miRNAs (miR-144, miR-598, miR-181a-2*) and mRNAs (ATM, STAT5A); B) Up-regulated miRNAs (miR-34a, miR-424*, miR-27a) and mRNAs (BAX, TNFRSF10B). [score:7]
Luciferase reporter vectors containing the 3′-UTR of miR-27a, miR-144 and miR-424* target genes ATM, FANCF, STAT5A, TNFRSF10B, BAX, were generated following PCR amplification from human cDNA and cloned into the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Madison, WI), immediately downstream from the stop codon of the luciferase gene. [score:7]
Moreover, miR-27a is a member of the miR-24 cluster, whose over -expression enhances TNF-a induced apoptosis in human embryonic kidney cells [82] and affects DSB repair in terminally differentiated blood cells by deregulating H2AX expression [83]. [score:6]
0031293.g009 Figure 9Transient transfection analysis for luciferase expression in A549 cells co -transfected with pre-miRNA precursors (pre-miRNAs) miR-27a, miR-144, miR-424*, or pre-miRNA precursor-Negative Control (pre-control), and reporter constructs containing the 3′UTR of the indicated target genes or synthetic sequence including the perfect miR-27a, miR-144 and miR-424* binding site (sensors). [score:5]
Transient transfection analysis for luciferase expression in A549 cells co -transfected with pre-miRNA precursors (pre-miRNAs) miR-27a, miR-144, miR-424*, or pre-miRNA precursor-Negative Control (pre-control), and reporter constructs containing the 3′UTR of the indicated target genes or synthetic sequence including the perfect miR-27a, miR-144 and miR-424* binding site (sensors). [score:5]
MiR-27a, miR-144, miR-598, together with ATM and STAT5A transcripts, were down-regulated in 2Gy MMG samples. [score:4]
The ATM transcript resulted down-regulated in MMG and anti-correlated to miR-27a, as confirmed by functional validation with the luciferase reporter assay. [score:3]
Instead, the interaction between miR-144 and miR-27a with their putative target genes involved in apoptosis (respectively TNFRSF10B and STAT5A), diminished the luciferase activity, but not significantly. [score:3]
Mir-27a, which is activated by the combined action of IR and MMG, is abnormally up-regulated in several types of cancers and has been identified to play an oncogenic role in the progression of cancers [78]– [81]. [score:3]
A549 cells were plated in 24-well plates (14×10 [5] cells/well) and 24 h later co -transfected with 50 ng of the pmirGLO dual-luciferase constructs, containing the indicated 3′UTRs of target genes, and with 32 nM pre-miR™ miRNA Precursor Molecules-Negative Control or pre-miR™ miRNA Precursor hsa-miR-27a (PM10939), hsa-miR-424*(PM12641), and hsa-miR-144 (PM11051) (all from Ambion, Austin, TX), using Lipofectamine2000 (Invitrogen Life Technologies). [score:3]
Eight miRNAs (let-7i*, miR-7, miR-7-1*, miR-27a, miR-144, miR-200a, miR-598, miR-650), were differentially expressed only when PBL were incubated in MMG. [score:3]
To validate some of the predicted miRNA-mRNA anti-correlations identified in 2Gy-PBL incubated in 1 g and MMG, we selected three miRNAs (miR-27a, miR-424*, miR-144) and at least 2 of their potential targets, for functional testing in vitro with the luciferase reporter assay. [score:2]
Moreover, let-7i*, miR-7, miR-7-1*, miR-27a, miR-144, miR-200a, miR-598, miR-650 are deregulated by the combined action of radiation and MMG. [score:2]
Except for miR-371-5p and miR-886-3p, which were differently altered in 1 g at 24 h after irradiation (Table 1), miR-99b, let-7i*, miR-144, miR-200a, miR-27a, miR-598, miR-650, miR-7, miR-7-1* were activated by the combined exposure to IR and MMG (Figure 4B). [score:1]
As positive controls were used miR-27a-sensor, miR-144-sensor, and mR-424*-sensor constructs, containing the perfect binding site for each miRNA. [score:1]
The results show that pre-miR-27a reduced significantly the luciferase activity from constructs containing the ATM 3′UTR, but not the FANCF and STAT5A 3′UTR. [score:1]
MiR-27a-sensor, miR-144-sensor and miR-424*-sensor, were obtained by annealing, purifying and cloning short oligonucleotides containing the perfect miRNA binding site into the SacI and XbaI sites of the pmirGLO vector. [score:1]
[1 to 20 of 18 sentences]
26
[+] score: 67
resistant cellsmiRNA microarray RT-qPCR Western blottingLi, 2009 [124] G2535 (equivalent to 25 μM GEN) 2 daysColo357, Panc-1, HPDE↑ miR-146a expression ↓ EGFR, IRAK-1, NF-κB and MTA-2 expression ↓ cell invasionmiRNA microarray RT-qPCR Western blottingLi, 2010 [125] GEN 60 μM 16 h, 3 days, 7 days AsPC-1, MiaPaCa-2↑ miR-34a expression ↓ Notch-1 expression ↓ cell growth ↑ apoptosisRT-qPCR Western blottingXia, 2012 [126] GEN 60 μM 3 daysAsPC-1, BxPC-3↓ miR-223 expression ↑ Fbw7 protein expression ↓ cell growth ↑ apoptosis ↓ migration and invasionMTT assay FACS for apoptosis detection RT-qPCR Western blottingMa, 2013 [127] GEN n. a. n. a. ↓ miR-27a ↓ cell growth ↑ apoptosis ↓ invasionMTT assay RT-qPCR Western blottingXia, 2014 [128] (abstract only) Equol 10, 100 μg PND 1–10 Sprague-Dawley rats ↑ methylation at the c-Ha-Ras gene methylation sensitive restriction digestion, Southern blottingLyn-Cook, 1995 [80]Abbreviations: SPI: soy protein isolate; AOM: Azoxymethane; G2535: contains 70.5% GEN, 26.3% DAI, 0.3% GLY); HPDE: Human pancreatic duct epithelial cells; also see footnotes Table 1. In 2012, stomach cancer had a global incidence of 952000 cases and resulted in 724000 cancer deaths [1, 11]. [score:11]
resistant cellsmiRNA microarray RT-qPCR Western blottingLi, 2009 [124] G2535 (equivalent to 25 μM GEN) 2 daysColo357, Panc-1, HPDE↑ miR-146a expression ↓ EGFR, IRAK-1, NF-κB and MTA-2 expression ↓ cell invasionmiRNA microarray RT-qPCR Western blottingLi, 2010 [125] GEN 60 μM 16 h, 3 days, 7 days AsPC-1, MiaPaCa-2↑ miR-34a expression ↓ Notch-1 expression ↓ cell growth ↑ apoptosisRT-qPCR Western blottingXia, 2012 [126] GEN 60 μM 3 daysAsPC-1, BxPC-3↓ miR-223 expression ↑ Fbw7 protein expression ↓ cell growth ↑ apoptosis ↓ migration and invasionMTT assay FACS for apoptosis detection RT-qPCR Western blottingMa, 2013 [127] GEN n. a. n. a. ↓ miR-27a ↓ cell growth ↑ apoptosis ↓ invasionMTT assay RT-qPCR Western blottingXia, 2014 [128] (abstract only) Equol 10, 100 μg PND 1–10 Sprague-Dawley rats ↑ methylation at the c-Ha-Ras gene methylation sensitive restriction digestion, Southern blottingLyn-Cook, 1995 [80]Abbreviations: SPI: soy protein isolate; AOM: Azoxymethane; G2535: contains 70.5% GEN, 26.3% DAI, 0.3% GLY); HPDE: Human pancreatic duct epithelial cells; also see footnotes Table 1. In 2012, stomach cancer had a global incidence of 952000 cases and resulted in 724000 cancer deaths [1, 11]. [score:11]
ZBTB10, a known target of miR-27a and putative repressor of the TF SP-1, showed higher expression in cells treated with 200 μM GEN, suggesting that reduced growth of GEN -treated cells and xenografts might partly be due to reduced miR-27a and therefore increased ZBTB10 expression [79]. [score:7]
The tumor suppressor SPRY2 (Sprouty 2) is a target for miR-27a and known to inhibit ERK signaling pathways. [score:7]
Sun Q. Cong R. Yan H. Gu H. Zeng Y. Liu N. Chen J. Wang B. Genistein inhibits growth of human uveal melanoma cells and affects microRNA-27a and target gene expression Oncol. [score:7]
GEN treatment significantly increased SPRY2 expression, potentially through down -regulating miR-27a expression [78]. [score:6]
A very recent publication by Xia et al. (abstract only) indicated that similar effects of GEN on pancreatic cancer cells, including decreased proliferation, migration, invasion and increased apoptosis were partly caused by down-regulation of miR-27a [128]. [score:4]
Similarly, GEN incubation of uveal melanoma cells with GEN dose -dependently reduced miR-27a expression in vitro [79]. [score:3]
Xia J. Cheng L. Mei C. Ma J. Shi Y. Zeng F. Wang Z. Wang Z. Genistein Inhibits Cell Growth and Invasion Through Regulation of MiR-27a in Pancreatic Cancer Cells Curr. [score:3]
Oncogenic miR-27a is involved in the development of resistance to doxorubicine in breast cancer [82]. [score:2]
Xu L. Xiang J. Shen J. Zou X. Zhai S. Yin Y. Li P. Wang X. Sun Q. Oncogenic MicroRNA-27a is a target for genistein in ovarian cancer cells Anticancer Agents Med. [score:2]
In a study by Xu et al., miR-27a was shown to be overexpressed in ovarian cancer tissues compared to benign tissue samples. [score:2]
Treatment of ovarian cancer cells with GEN reduced miR-27a levels and consequently repressed cell proliferation and migration. [score:1]
Anti-miR-27a was able to reduce proliferation and migration, while a miR-27a mimic showed opposite effects. [score:1]
[1 to 20 of 14 sentences]
27
[+] score: 64
Finally miR-27a was found over-expressed in all muscle fibres analyzed (Figure 2B) and was recently demonstrated to down-regulate the expression of 2 fundamental myogenic transcription factors (paired box proteins PAX3 and PAX7) involved in the regulation of myogenesis and muscle development [37]. [score:10]
In conclusion, a more sensible and specific quantification of miRNAs by absolute Q-PCR analysis highlighted common up-regulation of miR-206, miR-223, miR-199a-5p, miR-199b*, miR-27a, miR-128a, miR-31 and miR-142-5p, and down-regulation of miR-17 in dystrophic fibres isolated from TA, DIA and VA of the adult mdx mouse (Figure S1). [score:7]
In comparison with data already published by Eisenberg et al. and Greco et al. [15], [16], single-fibres based-analysis allowed the discovery of new muscular miRNAs whose expression levels are up-regulated in dystrophic murine muscle (miR-15b, miR-27a, miR-128a and miR-199b*). [score:6]
MiRNAs were quantified in human muscle fibres of 12 control subjects and 18 DMD patients, confirming the over -expression of miR-17, miR-27a and miR-206 in diseased muscle. [score:5]
MiR-206, miR-31, miR-21, miR-335-5p, miR-27a, miR-142-5p and miR-223 were significantly up-regulated afterwards muscle damage respect damaged muscle. [score:4]
Dystrophic muscle fibres isolated from different animal mo del of MDs were commonly characterized by the over -expression of several miRNAs (miR-15b, miR-21, miR-27a, miR-31, miR-128a, miR-142-5p, miR-199a-5p, miR-199b, miR199b*, miR-206, miR-221, miR-223 and miR-335-5p) with an expression profile strictly dependent on muscle impairment and damage accumulation (Figure 7). [score:3]
Single muscle fibres were dissected from the muscle biopsies of 12 healthy subjects and 18 DMD patients with an age range between 1 and 18 y-o (Figure 4A), and expression levels of miR-15b, miR-17, miR-27a, miR-128a and miR-206 were quantified by absolute Q-PCR analyses. [score:3]
To verify reliability and clinical relevance of data obtained from the analysis of murine dystrophic single muscle fibres, we quantified the expression levels of miR-17, miR-27a and miR-128a in single muscle fibres dissected from human biopsies of DMD patients. [score:3]
Finally, according to the array analysis, miR-27a over -expression was statistically significant only when the analysis was performed independently of the muscle type. [score:3]
Data obtained evidenced a group of miRNAs whose expression does not change during muscle repair afterwards acute damage (miR-15b, miR-17, miR-128a, miR-221, miR-199a-5p miR-199b and miR-199b*) (Table 1), and a group of miRNAs that are triggered afterwards CTX delivery (miR-206, miR-31, miR-21, miR-335-5p, miR-27a, miR-142-5p and miR-223) (Table 1), suggesting major involvement of the latter in muscle regeneration. [score:3]
We identify fourteen miRNAs associated to dystrophic fibres (miR-15b, miR-17, miR-21, miR-27a, miR-31, miR-128a, miR-142-5p, miR-199a-5p, miR-199b, miR199b*, miR-206, miR-221, miR-223 and miR-335-5p) that may mediate muscle regeneration and remo delling in animal mo dels of MDs and acute muscle damage, and confirm over -expression of the previously identified regeneration -associated myomiR-206. [score:3]
Finally, miR-27a was only over-expressed when the statistical analysis was performed independently of the muscle type (Figure 1). [score:3]
Data obtained confirmed over -expression of miR-17, miR-27a and miR-206 in single fibres of DMD muscle biopsies (Figure 4B and 4C). [score:3]
Fourteen miRNAs were found dysregulated in dystrophic muscle fibres of the mdx mouse with differences linked to the originating muscle (miR-206, miR-199a-5p, miR-223, miR-199b, miR-199b*, miR-21, miR-221, miR-17, miR-15b, miR-31, miR-128a, miR-142-5p, miR-335-5p and miR-27a). [score:2]
In particular, the dysregulation was limited to miR-199b*, miR-31, miR-142-5p and miR-221 in dystrophic TPZ; to miR-128a, miR-21, miR-221 and miR-35-5p in dystrophic DIA; and to miR-15b, miR-17, miR-27a, miR-142-5p, miR-128a, miR-335-5p, miR-21, miR-31 in dystrophic VA (Figure 3B). [score:2]
Otherwise, single muscle fibres based-analyses highlighted new miRNAs (miR-17, miR-27a, miR-128a and miR-199b*) associated to dystrophic and/or damaged muscle. [score:1]
In support to this: miR-335 and miR-21 were found in human mesenchymal stromal cells [50] and in mesenchymal stem cells (MSCs) together with miR-21, miR-27a, miR-128a, miR-199b [51] miR-15b, miR-17, miR-21, miR-27a, miR-31, miR-199a, miR-199b, miR-221 and miR-335-5p were found in MSCs and in MSC secreted microparticles [49], [52], [53]. [score:1]
Otherwise a group of miRNAs recently correlated to myogenesis (miR-27a, miR-31, miR-221) [33], [37], [38] were confirmed to be mis-modulated in dystrophic single muscle fibres. [score:1]
Only 7 of the 14 miRNAs associated to dystrophic fibres (miR-206, miR-31, miR-21, miR-335-5p, miR-27a, miR-142-5p and miR-223) were triggered by CTX injury. [score:1]
[1 to 20 of 19 sentences]
28
[+] score: 61
In the noncirrhotic subgroup, the R value was 1.707±0.455, indicating an upregulation of miR-27a expression. [score:6]
These and our findings may indicate a relevant role of miR-21, miR-24 and miR-27a in the malignant behavior of cervical cancer and HCC cell lines; for this reason we monitored their expression levels in human HCC tissues and their PT counterparts and then matched the miR expression levels with clinical patient features. [score:5]
miR-27a was found to function as a tumor suppressor by targeting the anti-apoptotic protein FADD in human embryonic kidney cells (33). [score:5]
This suggests that downregulation of miR-24 and miR-27a influences the hepatocyte transformation of cirrhotic tissues. [score:4]
We also found that miR-24 and miR-27a were downregulated in HCC cancer developed in cirrhotic liver. [score:4]
In this context, considering the subclass of HCC tumors developed in cirrhotic liver, miR-24 and miR-27a were downregulated in HCC in respect to PT tissues. [score:4]
In the cirrhosis subgroup, the R value of 0.408±0.084 (p<0.0001) underlines the downregulation of miR-27a in HCC with respect to cirrhotic PT tissues. [score:4]
In this tumor subclass miR-27a was upregulated in HCC tissues with respect to PT. [score:4]
For miR-27a, a significant decrease in expression was detected in the HBV, HCV and HBV/HCV subclasses (R=0.302, p=0.0084; R=0.412, p=0.0024; R=0.35, p=0.0234, respectively). [score:3]
We analyzed the expression profile of the miRs most frequently cloned (miR-24, miR-27a and miR-21) in the tumor and peritumoral tissues from biopsy specimens of patients presenting with HCC. [score:3]
miR-24 and miR-27a displayed the same expression trend in 66.7% of the cases examined; this may have occurred due to the fact that they are clustered in 1 transcript on chromosome 19. [score:3]
miR-24, miR-27a and miR-21 differential expression in HCC tissues from human biopsy specimens. [score:3]
miR-27a modification was different in cases without cirrhosis (but with other background diseases). [score:3]
Our data revealed miR-24 and miR-27a dysregulation in HCC in respect to their corresponding PT tissues and distinguished a profile in cirrhotic but not in non-cirrhotic tissues. [score:2]
Similar to miR-24, miR-27a (Figs. 3 and 5) did not show dysregulation among the 41 cases, as the average R value was 0.915±0.204. [score:2]
In particular, the miRs cloned with the highest frequency were miR-21, miR-27a and miR-24 as noted in our study. [score:1]
The expression levels of the most frequently cloned miRNAs, miR-24, miR-27a and miR-21, were evaluated using real-time PCR in the tumor and corresponding PT tissues from the biopsy specimens of 41 HCC patients. [score:1]
Real-time quantification of mature miR-24, miR-27a and miR-21 by stem-loop RT-PCR. [score:1]
The most frequently isolated miRNAs were miR-24, miR-27a and miR-21 (Table III). [score:1]
More studies are necessary to better explore the biological role of miR-24 and miR-27a in HCC and in other cancers. [score:1]
Among the 200 bacterial clones sequenced, 118 clones corresponded to 31 known miRs cloned with different frequencies and the miR-24, miR-27a, miR-21 were cloned with the highest frequency. [score:1]
[1 to 20 of 21 sentences]
29
[+] score: 58
Upregulation of ALDH1 (p = 0.019) and miR-503 (p = 0.033) correlated with high clinical stage, and upregulation of miR-27a was related with distant metastasis (p = 0.046) in patients with ovarian cancer. [score:7]
Upregulation of ALDH1 and miR-503 correlated with high clinical stage, and upregulation of miR-27a was correlated with distant metastasis. [score:7]
Upregulation of miR-503 correlated with high clinical stage, and upregulation of miR-27a was related with distant metastasis in patients with ovarian cancer. [score:7]
High expression of miR-503 (Figure  5C) was significantly associated (p = 0.033) with advanced clinical stage (stage III and IV), and upregulation of miR-27a (Figure  5D) was related to distant metastasis (p = 0.046). [score:6]
We identified six miRNAs, including miR-23b, miR-27a, miR-27b, miR-346, miR-424, and miR-503, overexpressed in ALDH1 (+) cells, and they were significantly upregulated in chemoresistant ovarian cancer cells (1.4 ~ 3.5-fold) and tumor samples (2.8 ~ 5.5-fold) compared with chemosensitive group. [score:5]
The upregulation of miR-27a didnot show a statistically significant correlation with chemoresistance in the validation with paclitaxel-resistant SKpac sublines and patient’s samples in this study. [score:4]
D. Upregulation of miR-27a was associated with distant metastasis (p = 0.046). [score:4]
As a result, miR-424 (1.62-fold), miR-346 (3.25-fold), miR-503 (1.66-fold), miR-27a (2.08-fold), miR-23b (1.98-fold), and miR-27b (3.09-fold) were upregulated in ALDH1 (+) cells relative to ALDH1 (−) cells (Figure  4B). [score:4]
In the present study, high expression of miR-27a was related with distant metastasis suggesting its role on the progression of ovarian cancer. [score:3]
Six miRNAs, including miR-23b, miR-27a, miR-27b, miR-346, miR-424, and miR-503 were overexpressed in ALDH1(+) cells, and significantly implicated in chemoresistance in ovarian cancers. [score:3]
However, a previous study reported that miR-27a was upregulated in paclitaxel-resistant ovarian cancer cell line A2780/Taxol as compared with its parental line A2780 [33]. [score:3]
We found that six miRNAs, including miR-23b, miR-27a, miR-27b, miR-346, miR-424, and miR-503, were significantly overexpressed in CSC-enriched ALDH1(+) cells using and qRT-PCR. [score:3]
As a result, six miRNAs were differentially overexpressed more than 1.5-fold in ALDH1 (+) cells compared with that in ALDH1 (−) cells (Table  4, Figure  4A) (miR-424 [1.98-fold], miR-346 [1.95-fold], miR-503 [1.86-fold], miR-27a [1.66-fold], miR-23b [1.53-fold], and miR-27b [1.50-fold]). [score:2]
[1 to 20 of 13 sentences]
30
[+] score: 49
Third, the mechanisms by which the miR-27a and its targets regulate MI occurrence and progression are unknown, additional studies need to be performed prior to functional assessment of the link between rs895819 and MI. [score:4]
MiR-27a inhibits the expression of many lipid metabolic genes, including FASN, SREBP-1, SREBP-2, PPARα and PPARγ, as well as ApoA1, ApoB100 and ApoE3A [22]. [score:4]
In addition, miR-27a played a unique role in the endothelial cells (ECs) dysfunction, which may contribute to the development of cardiovascular disease such as atherosclerosis, CAD and MI [24]. [score:4]
These studies indicate the multiple functions of miR-27a in different pathophysiological states that might be involved in the development and progression of cardiovascular diseases. [score:4]
MiR-27a has been reported not only to be an oncogenic miRNA [21], but also regulate lipid metabolism by altering the expression of many lipid metabolism-related genes [22]. [score:4]
Moreover, miR-27a has been shown to be associated with the renin-angiotensin system (RAS) and contribute to modulate the cardiovascular homeostasis and against aortic injury in hypertension by targeting ACE gene [26]. [score:3]
Urbich et al. has demonstrated that miR-27a promoted angiogenesis by targeting SEMA6A, which induces repulsion of neighboring endothelial cells [25]. [score:3]
miR-27a Single nucleotide polymorphism rs895819 Myocardial infarction Disease susceptibility Myocardial infarction (MI) is a leading cause of death and disability, which has posed major challenges for China’s health system [1– 3]. [score:3]
However, our data shown that the relative expression of circulating miR-27a was not significantly different when compared the AG or AA genotype with the GG genotype (Additional file  2: Figure S1). [score:2]
Additionally, a recent review of studies on miRNAs in lipid metabolism has determined that miR-27a may regulate lipid metabolism by reducing lipid synthesis and increasing lipid secretion from cells [32]. [score:2]
In a logistic regression analysis, we found that AG heterozygote (OR = 0.40, 95% CI = 0.21-0.76, Pa = 0.005) or AA homozygote (OR = 0.40, 95% CI = 0.22-0.75, Pa = 0.004) of pre-miR-27a rs895819 had a reduced susceptibility to MI in comparison with GG homozygote. [score:1]
The original study can be traced from the time when Yang et al. firstly reported that the G-variant of rs895819 might impair the maturation of the miR-27a and thus, is associated with familial breast cancer risk [31]. [score:1]
3) 119 (18.4) 1.08 (0.65-1.80) 0.771  Dominant GG 41 (14.3) 119 (18.4) 1.00 AG + AA 246 (85.7) 527 (81.6) 1.08 (0.69-1.70) 0.744  Recessive AA 85 (29.6) 199 (30.8) 1.00 AG + GG 202 (70.4) 447 (69.2) 1.22 (0.85-1.76) 0.273 [a]Adjusted for age, sex, smoking, drinking, hypertension, diabetes and hyperlipidemia [b]HWE, Hardy–Weinberg equilibrium After adjustment for possible confounding factors (age, sex, smoking, drinking, hypertension, diabetes and hyperlipidemia), the frequencies of the GG, AG, and AA genotypes of pre-miR27a rs895819 were 10.1%, 35.5%, 54.4% respectively among the cases, and 5.7%, 38.9%, 55.4% respectively among the controls. [score:1]
Our result showed that the pre-miR-27a rs895819 polymorphism was significantly associated with the MI risk, indicating that AG and AA genotypes in pre-miR-27a rs895819 polymorphism might have a protective effect against MI development compared with GG genotype. [score:1]
MiR-27a, miR-26a-1 miR-100, miR-126 and miR-218 were reported to be associated with pathogenesis of myocardial infarction (MI). [score:1]
Our findings suggest that the pre-miR-27a rs895819 polymorphism is associated with MI susceptibility in the Chinese Han population, which probably due to influence the HDL-C levels. [score:1]
According to previous studies, miR-27a, miR-26a-1 miR-100, miR-126 and miR-218 were reported to be associated with pathogenesis of MI [13– 17]. [score:1]
This result indicated that the mechanism contributing the decreased MI risk of pre-miR-27a rs895819 polymorphism might probably due to the elevated HDL-C levels. [score:1]
Further stratified analysis of pre-miR-27a rs895819 revealed a more significant association of AG + AA genotypes with MI risk among younger, male and smoking subjects. [score:1]
The pre-miR-27a rs895819 polymorphism has been reported to be significantly associated with the risk of type-2 diabetes (T2DM) [27] and a variety of cancers [28– 30]. [score:1]
To further characterize the functional relevance of the miR-27a polymorphism, we conducted a correlation analysis between the genotypes and the expression of circulating mature miR-27a. [score:1]
3) 119 (18.4) 1.08 (0.65-1.80) 0.771  Dominant GG 41 (14.3) 119 (18.4) 1.00 AG + AA 246 (85.7) 527 (81.6) 1.08 (0.69-1.70) 0.744  Recessive AA 85 (29.6) 199 (30.8) 1.00 AG + GG 202 (70.4) 447 (69.2) 1.22 (0.85-1.76) 0.273 [a]Adjusted for age, sex, smoking, drinking, hypertension, diabetes and hyperlipidemia [b]HWE, Hardy–Weinberg equilibriumAfter adjustment for possible confounding factors (age, sex, smoking, drinking, hypertension, diabetes and hyperlipidemia), the frequencies of the GG, AG, and AA genotypes of pre-miR27a rs895819 were 10.1%, 35.5%, 54.4% respectively among the cases, and 5.7%, 38.9%, 55.4% respectively among the controls. [score:1]
Multivariate associations of the pre-miR-27a rs895819 polymorphism with the lipid profile. [score:1]
Analysis of circulating mature miR-27a levels in three genotypes of 51 healthy controls. [score:1]
Stratified analysis of pre-miR-27a rs895819 polymorphism with the risk of MI. [score:1]
In conclusion, our findings firstly uncovered that the AG and AA genotypes in pre-miR-27a rs895819 polymorphism were associated with an decreased risk of MI in a Chinese Han population, and the association was more evident among younger, male and smoking subjects, which potentially due to the elevated HDL-C levels. [score:1]
[1 to 20 of 26 sentences]
31
[+] score: 42
After these GBM neurospheres were transfected with, and allowed to express for 24 hours, the miR-27a and miR-4284 anti-sense inhibitors, or the control miRNA inhibitor sequence, cells were incubated with 5 µM BBMD3 for another 24 hours, at which point cell viability was determined. [score:7]
However, transfection of the miR-27a anti-sense inhibitor into these neurosphere cultures was not as effective at reducing the cytotoxic effect of BBMD3 treatment on the GBM stem-like cells as transfection with the miR4284 inhibitor. [score:5]
0094443.g005 Figure 5(A) Cells from PBT003 and PBT030 neurospheres were transfected with 60 nM of anti-sense inhibitors against miR-4284, miR-27a and an unrelated control miRNA, and the inhibitor was allowed to interact with the miRNA for 48 hours prior to determining the viability of the cells. [score:5]
In contrast, the two most up-regulated miRNAs are miR-4284 and miR-27a; increasing 4.48 and 2.25 fold respectively. [score:4]
60 nM of human anti-sense miRNA inhibitors (i. e., synthetic oligonucleotides) against hsa-miRNA-4284 and hsa-miRNA-27a were transfected into cells derived from PBT008 and PBT030 neurospheres. [score:3]
The effect of miR-4284 and miR27a inhibitors on the cytotoxic activity of BBMD3 in PBT003 and PBT030 neurospheres. [score:3]
Five hours later, 60 nM miR-4284 or miR-27a anti-sense inhibitors were transfected into the cells by RNAiFect transfection reagent. [score:3]
We then tested the effect of miR-27a and miR-4284 inhibitors on the cytotoxic activity of BBMD3 using PBT008 and PBT030 neurospheres. [score:3]
BBMD3 Increases the Expression of miR-4284 and miR-27a in PBT003, PBT008, PBT022 and PBT030 Neurospheres. [score:3]
Human miRNA inhibitors (synthetic oligonucleotides) against hsa-miRNA-4284 and has-miRNA-27a were purchased from GeneCopoeia. [score:3]
The results shown in Fig. 5A demonstrated that miR-27a and miR-4284 inhibitors alone did not effectively decrease cell viability relative to that of the untransfected cells (untran). [score:3]
[1 to 20 of 11 sentences]
32
[+] score: 41
Predicted targets of hsa-miR-23a, hsa-miR-27a and hsa-miR-24 by TargetScan. [score:5]
Overview of the bioinformatics analysis of the TargetScan predicted targets of hsa-miR-23a, hsa-miR-27a and hsa-miR-24. [score:5]
This file contains the list of targets of hsa-miR-23a, hsa-miR-27a and hsa-miR-24 as predicted by the TargetScan. [score:5]
Click here for file Predicted targets of hsa-miR-23a, hsa-miR-27a and hsa-miR-24 by TargetScan. [score:5]
Some of the cellular targets of are those that can impact cell cycle regulation, proliferation, apoptosis and differentiation (Fig. 3) Figure 3 Importance of hsa-miR-27a in oncogenesis, proliferation and differentiation. [score:4]
Some of the cellular targets of are those that can impact cell cycle regulation, proliferation, apoptosis and differentiation (Fig. 3) Figure 3 Importance of hsa-miR-27a in oncogenesis, proliferation and differentiation. [score:4]
Interestingly, Eitan et al in 2009 observed high expression of hsa-mir-27a in a sub-group of patients with very poor prognosis [67]. [score:3]
miR-27a also contributes to oncogenesis by regulating cell cycle progression. [score:2]
miR-27a regulates fat metabolism and cell proliferation. [score:2]
miR-27a is the microRNA sandwiched between the and-2. Its paralogue, miR-27b originates from miR-23b~27b~24-1 cluster. [score:1]
miR-27a. [score:1]
Furthermore while studying the effect of SNPs in miRNAs, Yang et al in their study found that the SNP rs895819, located in the terminal loop of pre-miRNA-27a, showed a protective effect in a large familial breast cancer study [65]. [score:1]
miR-27a in cancer and multidrug resistance of cancer. [score:1]
miR-27a in differentiation. [score:1]
miR-27a in osteoarthritis pathological process. [score:1]
[1 to 20 of 15 sentences]
33
[+] score: 40
After normalization to 1 in the control group (U937/GFP), the relative expressions of selected downregulated miRNAs (miR-27a-3p, miR-424-5p, and miR-496-5p) in the test group are shown in A; the relative expressions of upregulated miRNAs (miR-296-5p, miR-377-5p, and miR-3680-5p), and unchanged miR-191-5p in the test group are shown in B. Figure 3 qPCR validation of miRNA expression levels in samples from the latent tuberculosis infection (LTBI) group versus the healthy control group. [score:13]
After normalization to 1 in the control group (U937/GFP), the relative expressions of selected downregulated miRNAs (miR-27a-3p, miR-424-5p, and miR-496-5p) in the test group are shown in A; the relative expressions of upregulated miRNAs (miR-296-5p, miR-377-5p, and miR-3680-5p), and unchanged miR-191-5p in the test group are shown in B. Figure 3 qPCR validation of miRNA expression levels in samples from the latent tuberculosis infection (LTBI) group versus the healthy control group. [score:13]
As shown in Figure 2A, the respective level of downregulated miR-27a-3p, miR-424-5p, and miR-493-5p in qRT-PCR results largely reflected the altered patterns of these selected miRNAs observed in the microarray profiles. [score:4]
Although the expressions of miR-424-5p (previous ID: miR-424), miR-27a-3p, miR-377-5p and miR-3680-5p were consistent in clinical PBMC samples, the small size of healthy controls weakened the statistical power. [score:3]
Relative expressions of miR-424-5p, miR-496-5p, miR-27a-3p, miR-377-5p, and miR-3680-5p in LTBI and healthy samples. [score:3]
As shown in Figure 3, the results of four miRNAs (miR-424-5p, miR-27a-3p, miR-377-5p, miR-3680-5p) recapitulated the microarray data, and the other two miRNAs (miR-493-5p and miR-296-5p) were not significant differentially expressed. [score:3]
hsa-let-7a-5p0.0381.1E-059hsa-miR-36510.3120.004229hsa-miR-27a-3p0.0500.0014819hsa-miR-19a-3p0.3120.0455213hsa-miR-378c0.0530.0003510hsa-miR-106b-5p0.3150.006497hsa-miR-31750.0610.0003915hsa-miR-3750.3160.001872hsa-miR-30a-5p0.0690.001156hsa-miR-19730.3260.000714hsa-miR-374a-5p0.0780.00085Xhsa-miR-4695-3p0.3315.7E-051hsa-let-7f-5p0.0830.000689hsa-miR-42790.3350.001145hsa-miR-424-5p0.0830.00112Xhsa-miR-31820.3420. [score:1]
[1 to 20 of 7 sentences]
34
[+] score: 40
At basal conditions we observed that the expression levels of miR-27a, miR-140, and miR-146a were significantly downregulated in OA cell cultures in comparison to normal (p < 0.01), while miR-365 was upregulated in OA chondrocytes (p < 0.01). [score:9]
miR-27a and miR-27b seem to be among the main studied miRNAs involved in OA; recent evidence has been reported that their lower expression in OA cartilage in comparison to normal cartilage was accompanied bydysregulation of both MMP-13 and insulin-like growth factor binding protein (IGFBP)-5 expression levels [17, 18]. [score:6]
The role of miR-27a/b in OA has been pointed out; in fact, their gene expression was reduced in OA chondrocytes in comparison to normal [17, 18], as confirmed by our data concerning miR-27a downregulation. [score:6]
The aim of this study was to evaluate if a cyclic HP could influence cell transcriptional activity, modifying miR-27a/b, miR-140, miR-146a/b, and miR-365 expression levels, which are responsible for the regulation of mRNA levels of their target genes, MMP-13, ADAMTS-5, IGFBP-5, and HDAC-4, in normal and OA chondrocyte cultures. [score:4]
This positive effect could be detected not only immediately after HP exposure, but was also maintained over time until 48 h. Transfection of OA chondrocytes with anti-miRNA specific for miR-27a confirmed that MMP-13 and IGFBP-5 were its target genes, as predicted by bioinformatic approaches [17]. [score:3]
At different time points following HP application (T12, T24, and T48), high significant levels of miR-27a, miR-140, and miR-146a gene expression were maintained (p < 0.01) in comparison to the corresponding load-free conditions. [score:3]
The purpose of this study was to investigate the possible effect of cyclic hydrostatic pressure (HP) (1–5 MPa, 0.25 Hz) on miR-27a/b, miR-140, miR-146a/b, and miR-365 expression levels, as well as on the mRNA levels of their target genes, MMP-13, ADAMTS-5, IGFBP-5, and HDAC-4, in human normal and OA chondrocyte cultures. [score:3]
We detected a statistically significant up-regulation of miR-27a/b, miR-140, and miR-146a/b in OA chondrocytes (p < 0.01) immediately after pressurization (T0), compared to the unloaded controls. [score:3]
Tardif G. Hum D. Pelletier J. P. Duval N. Martel-Pelletier J. Regulation of the IGFBP-5 and MMP-13 genes by the microRNAs miR-140 and miR-27a in human osteoarthritic chondrocytes BMC Musculoskelet. [score:2]
There is no evidence about the possible effects of mechanical loading on modification of miR-27 a/b. [score:1]
[1 to 20 of 10 sentences]
35
[+] score: 37
In liver cells, miR-27b regulates PPARα indirectly since overexpression of miR-27 reduced the PPARα protein level, but 3’-UTR luciferase reporter assay did not confirm PPARα as a direct target protein level [12]. [score:7]
Additionally, TGFβ inhibited miR-27b expression in lung epithelial A549 cells [14], but increased miR-27a expression in MRC-5 fibroblasts [15]. [score:7]
It appears that miR-27a-3p and miR-27b have multiple targets and which genes are the main targets may depend on cell types. [score:5]
Using similar approaches, Cui et al. found that miR-27a-3p targeted SMAD2/4 in fetal lung MRC-5 fibroblasts and they also identified α-SMA as an additional target of miR-27a-3p [15]. [score:5]
Most recently, miR-27a-3p has been shown to inhibit TGFβ -induced COL1A2 and α-SMA expression and gel contractility in MRC-5 fibroblasts [15]. [score:5]
During the course of this work, Cui et al. published a study showing that transfection of miR-27a-3p mimic into a fetal lung fibroblast cell line MRC-5 inhibited COL1A2 and alpha-smooth muscle actin (α-SMA) and this result was confirmed in IPF fibroblasts [15]. [score:3]
However, a miR-27b-3p mimic was used for these studies, which may result in overwhelmed expression of miR-27a. [score:3]
However, there is only one base difference between miR-27a-3p and miR-27b. [score:1]
The reasons for these differences remain to be determined, but could be due to the differences in transcription because miR-27a-3p and miR-27b are located in different chromosomes, chromosome19 and chromosome 9, respectively. [score:1]
[1 to 20 of 9 sentences]
36
[+] score: 36
On the other hand, a dozen miRNAs including miR-27a and miR-24 have been shown to be up-regulated in skin cells upon ultraviolet irradiation [25], and miR-24 overexpression can induce enhanced autophagy in smooth muscle cells [34]. [score:6]
Meanwhile, miR-24-2 showed no obvious changes in PUVA- and UVB-SIPS fibroblasts, while miR-27a expression was up-regulated only in UVB-SIPS fibroblasts (Figure 2a-2c). [score:6]
As previously discussed, miR-23a, miR-24, and miR-27a are in the same gene cluster, but up-regulation of miR-27a and miR-24 does not produce the same effects as miR-23a. [score:4]
Surprisingly, down-regulated miR-23a, but not miR-27a or miR-24, is necessary for reducing the SA-β-gal percentage and increasing EdU -positive cell percentage, which is the hallmark of PUVA-SIPS and UVB-SIPS fibroblasts. [score:4]
a., b., c. The expression levels of miR-23a, miR-27a and miR-24 were detected via qRT-PCR in the UVB- and PUVA-SIPS fibroblasts as well as the sham-irradiated cells groups. [score:3]
To detect the effects of endogenous miRNA inhibition on SIPS, we transfected PUVA- and UVB-SIPS cells with miR-23a-specific antagomirs (Ant-23a), miR-24-specific antagomirs (Ant-24), miR-27a-specific antagomirs (Ant-27a), and Ant-CNT (Ant-CNT), and then analyzed the percentage of SA-Δ-gal -positive and EdU -positive cells. [score:3]
The “miR-23a cluster” (miR-23a, miR-27a, miR-24-2) is located on human chromosome 19p13.2, and is expressed from its own upstream promoter, located in the 2600 to +36 bp region, which includes a GC-rich region and a transcription start site (0 to 124 bp). [score:3]
Figure 2 a., b., c. The expression levels of miR-23a, miR-27a and miR-24 were detected via qRT-PCR in the UVB- and PUVA-SIPS fibroblasts as well as the sham-irradiated cells groups. [score:3]
However, the same effect was not found in the miR-27a and miR-24 intervention groups (Figure 2d-2f). [score:1]
Therefore, further studies are required to specifically elucidate the role of miR-27a and miR-24 in photoaging. [score:1]
Thus, it is apparent that miR-23a initiates senescence following ultraviolet irradiation, whereas miR-27a and miR-24 do not exert a synergistic effect. [score:1]
d. Prior to ultraviolet irradiation, cultured fibroblasts were transfected with miR-23a antagomirs (Ant-23a) or miR-24 antagomirs (Ant-24) in addition to either miR-27a antagomirs (Ant-27a) or control antagomirs (Ant-CNT). [score:1]
[1 to 20 of 12 sentences]
37
[+] score: 33
ROS induced the expression of ZBTB4 and ZBTB10 which inhibited the expression of the SP proteins and various miRs including: miR-27a, miR-20a, miR-17-5p which normally regulate ZBTB4 and ZBTB10 [199]. [score:8]
The ZBTB10 gene is normally a target of miR-27a and upon downregulation of miR-27a by CUR, increased expression of ZBTB10 occurred. [score:8]
CUR has been shown to down-regulate the expression of miR-27a in CRC cells. [score:6]
This may occur by CUR inducing ROS which results in suppression of specificity protein expression (SP1, SP3 and SP4) as well as miR-27a. [score:5]
The expression of both miR-27a and miR-34a were both altered in CRC cells after CUR or AKBA treatment [126]. [score:3]
FBXW7 is regulated by many molecules e. g., TP53 and miRs e. g., miR-27a. [score:2]
This is believed to occur by disruption of miR-27a/zinc finger and BTB domain containing 10 (ZBTB10) signaling. [score:1]
[1 to 20 of 7 sentences]
38
[+] score: 32
For example, overexpression of miR-27a in 3T3-L1 pre-adipocytes suppresses PPARγ expression and adipocyte differentiation [68]. [score:7]
Interestingly, in mature adipocytes from obese mice lower miR-27a expression has been found compared to lean mice, indicating miR-27a downregulation may be necessary for adipocyte hypertrophy [70]. [score:5]
Interestingly, according to the miRNA target finding algorithm TargetScan the 3’UTR of leptin harbors putative miRNA binding sites for miR-9, miR-490, miR-29 family, miR-27 family and miR-128 [44]. [score:5]
In another study of high-fat diet fed mice, pri-miR-27a was reported to be downregulated in mature adipocytes [70], although one caveat is that pri-miRNA levels are not always consistent with functional mature miRNA levels [37]. [score:4]
Nevertheless the downregulation of pri-miR-27a in mice consuming a high-fat diet is consistent with the anti-adipogenic effect of miR-27a reported in 3T3-L1 cells [70]. [score:4]
These studies suggest the miR-27 family could be a useful anti-adipogenic target. [score:3]
Potentially miR-27a mimics could be used to regulate pre-adipocyte proliferation. [score:2]
Adipocytes adipogenesis biomarkers microRNAs miR-27 miR-519d obesity. [score:1]
Another study in 3T3-L1 adipocytes confirmed miR-29 was induced by exposure to high extracellular glucose, in addition miR-27a and miR-222 were also found to respond to extracellular glucose concentration [90]. [score:1]
[1 to 20 of 9 sentences]
39
[+] score: 32
At the post-transcriptional level, miR-27a targets the 3′-UTR of the PHB1 gene and down-regulates its expression in prostate cancer [116]. [score:8]
b The short peptide, ERAP, and the natural product derived from medical plants, xanthohumol, could disrupt the PHB2/BIG3 interaction directly and lead to the translocation of PHB2 from cytoplasm to nucleus, thereby, induce cell growth arrest in some estrogen -dependent cancers a PHB1 can be down-regulated by miR-26a, miR-27a, and miR-195; the lncRNA named PHBP1 directly binds to and maintain the stabilization of PHB1 mRNA; the acetylation of histone H3 can also increase the expression of PHB1; phosphorylation of PHB1 at different amino acids determines the activation and function of PHB1. [score:8]
Fig. 4 a PHB1 can be down-regulated by miR-26a, miR-27a, and miR-195; the lncRNA named PHBP1 directly binds to and maintain the stabilization of PHB1 mRNA; the acetylation of histone H3 can also increase the expression of PHB1; phosphorylation of PHB1 at different amino acids determines the activation and function of PHB1. [score:7]
Fletcher CE Androgen-regulated processing of the oncomir miR-27a, which targets Prohibitin in prostate cancerHum. [score:4]
Chen W Emerging role of microRNA-27a in human malignant glioma cell survival via targeting of prohibitinMol. [score:3]
Liu T Tang H Lang Y Liu M Li X MicroRNA-27a functions as an oncogene in gastric adenocarcinoma by targeting prohibitinCancer Lett. [score:2]
[1 to 20 of 6 sentences]
40
[+] score: 31
miRNA-27a-3p and the miRNA-29 family relate to in vivo peripheral insulin sensitivityIn order to determine whether the 6 differentially expressed miRNAs in T2DM patients (relative to obese/overweight controls) also are associated with peripheral insulin sensitivity, we correlated their expression levels to the glucose infusion rate (GIR) during the hyperinsulinemic-euglycemic clamp (Figure 3A). [score:5]
Subsequent stepwise regression analysis of the relative miRNA expression levels and peripheral insulin sensitivity, supported the notion that these associations of miRNA-27a-3p, miRNA-29a-3p, miRNA-29b-3p and miRNA-29c-3p with peripheral insulin sensitivity were rather direct associations which were not confounded by co-correlations with other variables (i. e., VO2max, PCrR, age, BMI, body fat percentage, FPG, and FPI) that were (by design) different between these 4 phenotypically different groups (Figure 3). [score:4]
Additional support for the involvement of miRNA-27a-3p in the regulation of insulin sensitivity comes from in vitro studies in L6 muscle cells showing that miRNA-27a-3p knockdown improved insulin signaling and glucose uptake in insulin -induced insulin-resistant L6 muscle cells (Zhou et al., 2016). [score:3]
Here, we show that, out of the 25 selected miRNAs, 6 candidate miRNAs (miRNA-133b-3p, miRNA-206, miRNA-27a-3p, miRNA-29a-3p, miRNA-29b-3p, and miRNA-29c-3p) were differently expressed in T2DM patients vs. [score:3]
Furthermore, a cohort study of 163 T2DM patients and 185 healthy controls revealed that the presence of a SNP in the sequence of miRNA-27a, resulting in compromised gene expression levels, was associated with reduced risk for T2DM susceptibility (Ciccacci et al., 2013). [score:3]
We demonstrate that miRNA-27a-3p and all three members of the miRNA-29 family were upregulated in skeletal muscle of T2DM patients compared to non-diabetic overweight/obese individuals, and additionally displayed strong negative correlations with peripheral insulin sensitivity across the four metabolically distinct human subject groups. [score:3]
Figure 2Relative expression levels of miR-133b-3p (A), miR-206-5p (B), miR-27a-3p (C), miR-29a-3p (D), miR-29b-3p (E), and miR-29c-3p (F) in type 2 diabetic subjects (T2DM) vs. [score:3]
In addition, we demonstrated a strong negative correlation between miRNA-27a-3p expression and peripheral insulin sensitivity. [score:3]
We identified miRNA-27a-3p and all three members of the miRNA-29 family to be differentially regulated in muscle from patients with T2DM as compared to normoglycemic obese/overweight individuals. [score:1]
Previous research revealed that miRNA-27a-3p was markedly elevated in a rat mo del of T2DM (Zhou et al., 2016). [score:1]
1.18 ± 0.11; p = 0.001), and miRNA-27a-3p (1.07 ± 0.05 vs. [score:1]
miRNA-27a-3p and the miRNA-29 family relate to in vivo peripheral insulin sensitivity. [score:1]
[1 to 20 of 12 sentences]
41
[+] score: 31
The miR-27a and miR-197 showed expression patterns that go from down-regulation between normal cervical tissues and CINI and CINIII samples to slight up-regulation in cervical cancer. [score:9]
Among the miRNAs that were down-regulated between normal and pre-neoplasic cervical samples, but had increased expression in cervical cancer samples, were miR-106a, miR-205, miR-197, miR-16, miR-27a and miR-142-5p. [score:6]
Six miRNAs displayed relative decreased expression in the transition from normal cervix to atypical dysplasia and increased expression in the transition from atypical dysplasia to cervical carcinoma, namely miR-106a, miR-205, miR-197, miR-16, miR-27a and miR-142-5p (Figure 4B). [score:5]
In breast cancer cells miR-27a acts as an oncogene by targeting Myt-1, which blocks cell cycle progression at G [2]-M and through regulation of Sp proteins that have an important role in angiogenesis and growth of cancer cells [36]. [score:4]
Our study suggests that miR-27a acts as an oncogene, particularly in the early stages of cervical cell abnormal transformation, because it targets the EGFR protein, the cyclin -dependent kinases CD28 and CD44, the oncogenes KRAS and MYCN, the MAPK7, the VEGFB and VGF. [score:3]
The expression pattern of miR-197 is similar to that of miR-27a suggesting a similar role. [score:3]
ERK/MAPK signaling (miR-203), PTEN signaling (miR-27a), VEGF signalling (miR-10a), p53 signaling (miR-205) and apoptosis signalling (miR-512-3p) were found once (Table 2 and table S3). [score:1]
[1 to 20 of 7 sentences]
42
[+] score: 30
MiR-27a bound to KRAS mRNA and inhibited its translation, acting as a tumor suppressor through inhibition of the RAS-MAPK pathway [76]. [score:8]
Constitutive and inducible expression of miR-27a-5p in a murine orthotopic xenograft mo del of oral cavity cancer led to decreased tumor growth and direct intra-tumoral injection of miR-27a-5p inhibited tumor growth in vivo. [score:6]
MiR-27a-5p forced increased expression produced a profound cytotoxic effect, with coordinated down-regulation of EGFR, AKT and mTOR. [score:5]
MiR-27a-3p and its complementary strand miR-27a-5p were significantly down-regulated in multiple HNSCC cell lines [29]. [score:4]
Mavrakis et al. identified a subset of miRNAs involved in the development of T-cell acute lymphoblastic leukemia, that included miR-27a targeting the NF1 mRNA [117]. [score:4]
MiR-27a was down-regulated in esophageal squamous cell carcinoma and esophageal carcinoma cell lines. [score:3]
[1 to 20 of 6 sentences]
43
[+] score: 30
Of interest, the highly overexpressed MiR-451 and miRNA-27a have been reported to regulate multi-drug resistance (MDR) in carcinoma cell lines [21], and since RCC often express the MDR phenotype these two miRNAs might indeed be important in contributing to the RCC phenotype. [score:6]
Interestingly, dichotomization based on the median of 4 miRNAs, -miR-222-5p, miR-27a-5p, miR-125b-3p and miR-935-3p, albeit their expression levels were rather low, suggested that higher miRNA expression level was associated with poor overall survival (Figure S1). [score:5]
Both miR-210 and miR-27a were linked to predicted target genes which are of interest with regard to cell proliferation and apoptosis (see Table 1). [score:3]
Anti-miRNA inhibitor (100 nM) of either miR-210-3p or miR-27a-3p, respectively, or scrambled Negative Control (100nM, Applied Biosystems) with fluorescently labeled oligonucleotides (100 nM, BLOCK-iT, Invitrogen) was transfected into a renal cell line SKRC7 by Lipofectamine 2000 (Invitrogen). [score:3]
We subsequently performed a limited set of functional analysis of 2 of the PCR-confirmed highly differentially expressed miRNAs, miR-210-3p and miR-27a-3p. [score:3]
Two other studies suggested that miR-27a may be involved in the development of tumor drug resistance [25] and we were interested in miR-27a because of its involvement in MDR/P-glycoprotein expression in cancer cells, a typical characteristic of many RCCs. [score:2]
Our exploratory experiments showed that proliferation and apoptosis of SKRC7 cells were not affected by knocking down miR-210 or miR-27a following transfection with specific antagomirs. [score:2]
The lack of effect on proliferation and/or apoptosis after knocking down miR-210 and miR-27a in one ccRCC cell line may indicate that the effect of these miRNAs on the endpoints chosen do not apply to ccRCC and/or to this particular cell line only, or that the conditions to affect proliferation and/or apoptosis require a more intricate interplay of more factors. [score:2]
Following transfecting the RCC cell line SKRC7 with miR-210 and miR-27a, respectively, we efficiently knocked down both miRNAs as demonstrated by PCR (data not shown). [score:2]
No significant enhancement of the percentage of apoptotic cells at 24 and 48 hr as evidenced by Annexin V+/PI+double positivity was observed following addition of anti-miR-210-3p, anti-miR-27a-3p and scrambled control to SKRC7 cells. [score:1]
The percentage of Annexin V+/PI+double positive SKCR7 cells were as follows: 1.62 and 3.9%; 1.28 and 3.62% and 3.58 and 4.50% Annexin V+/PI+ SKCR7 cells, respectively at 24 and 48 hr for anti-miR-210-3p, anti-miR-27a-3p and scrambled control treated SKRC7 cells. [score:1]
[1 to 20 of 11 sentences]
44
[+] score: 27
We found that elevated levels of miR-27a/b, miR-210, and miR-454 expression were associated with shorter OS, while the levels of miR-454 and miR-374a/b expression were associated with DFS. [score:5]
The results of this study showed that lower expression of miR-155 predicted worse OS in TNBC patients, while elevated levels of miR-21, miR-27a/b, miR-210, and miR-454 expression were associated with shorter overall survival times. [score:5]
[22] miR-27a/b has been linked to the peroxisome proliferator-activated receptor (PPAR) and PTEN signaling in TNBC cells, acting as a tumor suppressor by regulating the cell division cycle (CDC27) gene. [score:4]
Three articles (4 studies, n = 920) assessed the association between miR-27a/b expression and prognosis in TNBC. [score:3]
3.5Three articles (4 studies, n = 920) assessed the association between miR-27a/b expression and prognosis in TNBC. [score:3]
The crude HR for the association between miR-27a/b expression and OS in TNBC was 1.25 (95% CI: 0.98–1.61) (Fig. 4A). [score:3]
miR-27a/b and TNBC prognosis. [score:1]
Six miRs (miR-155, miR-21, miR-27a/b, miR-374a/b, miR-210, and miR-454) were assessed in the meta-analysis. [score:1]
Figure 4 Forest plots of the HRs for the association between miR-27a/b and TNBC survival. [score:1]
Among these miRs, 6 (miR-155, miR-21, miR-27a/b, miR-374a/b, miR-210, and miR-454) were reported by at least 2 studies (Table 2). [score:1]
[1 to 20 of 10 sentences]
45
[+] score: 25
Other miRNAs from this paper: hsa-mir-143, hsa-mir-375
In mouse 3T3-L1 cells, the level of miR-27a expression gradually decreased upon adipogenesis, and the ectopic expression of miR-27a in 3T3-L1 preadipocytes suggested that miR-27a might suppress adipocyte differentiation by repressing the expression of PPARγ [7]. [score:9]
During adipogenesis, the abundance of miR-27a was inversely correlated with that of adipogenic marker genes, such as PPARγ and adiponectin, and the abundance of miR-27a in the mature adipocyte fraction of obese mice was down-regulated compared with that of the leaner mice [7]. [score:3]
These results indicated that miR-27a suppressed adipocyte differentiation, while miR-143 promoted adipocyte differentiation, confirming previous reports in human and rodent [7, 8]. [score:3]
Recently, several miRNAs, including miR-27a and miR-143, have been shown to regulate lipid metabolism in human and rodent cell mo dels [5, 6]. [score:2]
As expected, the opposite results were observed when miR-27a inhibitor groups were compared with the control group. [score:2]
The primers that were used for q-PCR are listed in Table 1. Mimic and inhibitor oligonucleotides of ssc-miR-143-5p and ssc-miR-27a-3p (miRBase IDs: MIMAT0002148 and MIMAT0017374 respectively) and a negative control (with no sequence similarities to any reported porcine gene sequence) were synthesized by Ribobio (China). [score:2]
In the present study, we used synthetic miRNA mimics and inhibitors in gain- and loss-of-function experiments to investigate the roles of miR-27a and miR-143 in lipid metabolism in porcine adipocytes. [score:1]
In summary, our results confirmed that miR-27a and miR-143 play important roles in porcine adipocyte lipid metabolism both in human and rodents. [score:1]
Simply put, miR-27a could accelerate the hydrolysis of TG, while miR-143 could promote TG synthesis. [score:1]
The Roles of miR-27a and miR-143 in Porcine Adipocyte Lipid Metabolism. [score:1]
[1 to 20 of 10 sentences]
46
[+] score: 24
Other miRNAs from this paper: hsa-mir-32, hsa-mir-198, hsa-mir-206
Further analysis showed that these effects are the result of miR-27a -mediated downregulation of FSTL1 expression via its target sequence in the 3′UTR (Fig.   3). [score:8]
Transfection of fibroblast-like synoviocytes with miR-27a inhibits cell migration and invasion and downregulates TLR4, NF-κB, and MMPs. [score:6]
A list of predicted miRNA -binding sites in the 3′UTR of human FSTL1 with associated clinical relevance is provided in Supplemental Table 1. Table 1 MicroRNA -binding sites in FSTL1 gene Human microRNA Binding position in 3′UTR Biological relevance miR-27a 1537Inflammation [24] miR-32-5p 142Inflammation [33] miR-206 2101; 2375Myogenesis [32] List, position, and biological processes of the verified microRNA -binding sites in the 3′UTR of FSTL1 gene In the normal healthy human epidermis, FSTL1 mRNA is expressed, but the protein is present at low to almost undetectable, levels. [score:3]
A list of predicted miRNA -binding sites in the 3′UTR of human FSTL1 with associated clinical relevance is provided in Supplemental Table 1. Table 1 MicroRNA -binding sites in FSTL1 gene Human microRNA Binding position in 3′UTR Biological relevance miR-27a 1537Inflammation [24] miR-32-5p 142Inflammation [33] miR-206 2101; 2375Myogenesis [32] List, position, and biological processes of the verified microRNA -binding sites in the 3′UTR of FSTL1 gene In the normal healthy human epidermis, FSTL1 mRNA is expressed, but the protein is present at low to almost undetectable, levels. [score:3]
Moreover, overexpression of FSTL1 via adenoviral vector rescues the miR-27a effects [24]. [score:3]
Moreover, in silico analysis revealed multiple miRNA -binding sites in the 3′UTR of the FSTL1 mRNA of which three have been functionally analyzed (miR-206 [32], miR-32-5p [33], and miR-27a [24]) (Table  1). [score:1]
[1 to 20 of 6 sentences]
47
[+] score: 24
The expression pattern of miR-27a in human bone marrow with increased levels in MC/MMs and more mature cells (cluster 6) fits a mo del in which translation from residual Runx1 mRNA in MC/MBs is inhibited by miR-27a to promote cell cycle arrest and the initiation of terminal differentiation. [score:7]
When comparing the array data from PMNs and skin window PMNs, we found seven differentially regulated miRNAs (miR-297, miR-212, miR-132, miR-132*, miR-1915*, miR-760, and miR-27a*) that were all up-regulated in the extravasated neutrophils. [score:5]
It has been shown in the murine myeloblastic cell line 32Dcl3 that miR-27a down-regulates Runx1 and enhances differentiation of the cells [34]. [score:4]
Interestingly, all seven miRNAs (miR-297, miR-212, miR-1915*, miR-132, miR-27a*, miR-760 and miR-132*) were up-regulated in the skin window neutrophils (Fig. 4 and Table S2). [score:4]
hsa-miR-27a Both Targetscan and miRanda: FOXP2, E2F7, CBFB, RUNX1, RARA, HOXA10, EGFR, TAB3. [score:3]
The miRNAs were miR-130a and miR-155 (cluster 1), miR-146a (cluster 2), miR-34c-3p (cluster 3), miR-99b (cluster 4), miR-183 and miR-26a (cluster 5), and miR-27a and miR-223 (cluster 6). [score:1]
[1 to 20 of 6 sentences]
48
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
The study revealed downregulation of miR-205, miR-27, miR-31, and miR-29 in the cbs [+/–] retinas, these miRNAs were also reported to be downregulated in vitreous [68] and plasma of AMD patients [69]. [score:7]
A recent study also demonstrated that knockdown of miR-27, which downregulates the antiangiogenic factors Sprouty2 and semaphorin 6A (Sema6A), is protective against laser -induced choroidal neovascularization [70]. [score:5]
The study revealed downregulation of miR-205, miR-27, miR-31, and miR-29 in the cbs [+/–] retinas. [score:4]
Consistently with the microarray results, miR-205 (p value = 0.001), miR-206 (p value = 0.01) and miR-27 (p value = 0.04) were significantly downregulated in cbs [+/–] compared to control cbs [+/+] (p value < 0.05). [score:3]
Furthermore, the pathway analysis links a group of miRNAs that were differentially expressed in cbs [+/–] retina to oxidative stress pathway such as miR-205, miR-206, miR-217, miR-30, miR-27, miR-214 and miR-3473. [score:3]
miR-205, miR-27, miR-29 and miR-31 were significantly changed in our cbs [+/–] retina microarray and were also reported to be involved in AMD. [score:1]
Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31. [score:1]
[1 to 20 of 7 sentences]
49
[+] score: 23
Furci et al. (2013) studied Mtb -induced miRNA expression profile in primary human macrophages infected with virulent Mtb H37Rv and avirulent M. bovis BCG and showed that macrophages differentially expressed miRNAs, including miR-155, miR-146a, miR-145, miR-222 [∗], miR-27a, and miR-27b. [score:5]
In general, this approach of direct delivery should be implemented for those miRNAs that are downregulated during TB infection, including miR-155, miR-146a, miR-145, miR-222 [∗], miR-27a, or miR-27b (Spizzo et al., 2010; Belver et al., 2011; McGregor and Choi, 2011; Graff et al., 2012). [score:5]
In this study, miR-222 [∗], miR-27a, and miR-27b, which have been reported to control inflammatory response and lipid metabolism (McGregor and Choi, 2011; Graff et al., 2012) were significantly downregulated. [score:4]
Expression levels of IFN-γ, IL-β, IL-6, and TNF-α were significantly decreased following transfection of miR-27a mimics (Wang et al., 2017). [score:3]
A recent study has identified miR-27a as a restrainer of immune response in Mtb infection by targeting IRAK4. [score:3]
MicroRNA-27a restrains the immune response to Mycobacterium tuberculosis infection by targeting IRAK4, a promoter of the NF-κB pathway. [score:2]
Among the candidates for this approach we can cite miR-155, miR-146a, miR-145, miR-99b, miR-19b-2 [∗], miR-27a, or miR-27b. [score:1]
[1 to 20 of 7 sentences]
50
[+] score: 22
In addition, miR-451, miR-27a, miR-21, miR-130a, miR-let-7, miR-137, miR-200c, miR-122, miR-138 and miR-10a/b were suggested to regulate ABCB1 gene expression indirectly by targeting other mRNAs that code the proteins associated with the activation of ABCB1 gene expression [72, 73, 74, 75, 76, 77, 78, 79]. [score:9]
In human medicine, miR-451, miR-331-5p, miR-27a, miR-298 and miR-145 were shown to regulate the expression of the ABCB1 gene by direct interaction with 3′-UTR [68, 69, 70, 71]. [score:5]
Zhu H. Wu H. Liu X. Evans B. R. Medina D. J. Liu C. G. Yang J. M. Role of microRNA miR-27a and miR-451 in the regulation of MDR1/P-glycoprotein expression in human cancer cells Biochem. [score:4]
Feng D. D. Zhang H. Zhang P. Zheng Y. S. Zhang X. J. Han B. W. Luo X. Q. Xu L. Zhou H. Qu L. H. Down-regulated miR-331-5p and miR-27a are associated with chemotherapy resistance and relapse in leukaemia J. Cell. [score:4]
[1 to 20 of 4 sentences]
51
[+] score: 22
As expected, we found that mRNA expression levels dropped for the two lowest concentrations in cells treated with brown propolis, in response to the overexpression of miR-27a-3p at these concentrations (F = 4.406, p < 0.05) (Figure 7b). [score:5]
As far as miR-27a-3p is concerned, it regulates NFE2L2 expression. [score:4]
Brown propolis, which is richer in flavonoids than in hydrocinnamic acid derivatives, was active on all miRNAs tested, while the treatment with green propolis caused changes in the expression levels of only two of the miRNAs, miR-19a-3p and miR-27a-3p. [score:3]
For miR-27a-3p, we studied changes in the expression levels of mRNA coding for NFE2L2. [score:3]
Green propolis only increased miR-27-3p expression levels and did not induce any modification in miR-17-3p or their mRNAs and related proteins. [score:3]
In our experimental conditions, brown propolis was found to increase the expression levels of miR-27a-3p, confirming that brown propolis exerts an epigenetic effect. [score:3]
To investigate the influence of propolis on oxidative stress, we first studied the NFE2L2 transcription factor, which is encoded by a mRNA, including miR-27a-3p as a validated target. [score:1]
[1 to 20 of 7 sentences]
52
[+] score: 21
MicroRNA miR-27 inhibits adenovirus infection by suppressing the expression of SNAP25 and TXN2. [score:7]
The post-transcriptional silencing of both genes by hsa-miR-27, lead to efficient suppression of adenovirus replication by two distinct mechanisms: silencing of SNAP25 interferes with adenovirus entry into target cells, while TXN2 suppression hampers adenovirus replication through a G1 arrest of cell cycle (Machitani et al., 2017). [score:7]
Two cell-encoded miRNAs, hsa-miR-27a and hsa-miR-125b (as well as hsa-miR-27b and hsa-miR-125a, although in less extent), are particularly important to refer in this context given their role as oncogenic or tumor suppressive miRNAs, depending on the tissue type, and their interference with viral replication during infection by other viruses such as HCV, HCMV, and HPV. [score:3]
Not surprisingly, hsa-miR-27 was recently described as a potent adenovirus inhibitor (Machitani et al., 2017). [score:3]
The most noteworthy miRNAs referred in both studies were hsa-miR-27a/b, hsa-miR-30a/b/c, hsa-miR-125a/b, hsa-miR-181b, and hsa-let-7e (Qi et al., 2010; Zhao et al., 2015). [score:1]
[1 to 20 of 5 sentences]
53
[+] score: 20
Thus upregulation of miR-27a* expression upon acute ischemia could be a defense mechanism by the cells to control the translation of CDK5 molecules. [score:8]
miR-27a* is a direct target of cyclin -dependent kinase 5 (CDK5), which is predominantly expressed in the central nervous system [23]. [score:6]
Independently, we also observed that progressive upregulation of miR-27a* correlates to neurogenesis in primary cultures of cortical neurons, thus implicating a major role for miR-27a* in neuronal regulation. [score:5]
miR-125b-2* and miR-488 peaked at 6 h from the onset of stroke, to 1.56 ± 0.28 and 1.36 ± 0.24 fold, respectively in ischemic rat brain whereas miR-27a*, -422a and -627 peaked at 24 h from the onset of stroke, to 5.37 ± 0.46, 1.52 ± 0.28 and 8.53 ± 1.23 fold, respectively (Figure 4). [score:1]
[1 to 20 of 4 sentences]
54
[+] score: 19
For the latent stage, 18 consistently differentially expressed mature miRNA sequences were identified: 8 were up-regulated (miR-212-3p, miR-21-5p, miR-132-3p, miR-20a-5p, miR-17-5p, miR-27a-3p, miR-23a-3p, miR-146a-5p) and 10 were down-regulated (miR-139-5p, miR-551b-3p, miR-33-5p, miR-708-5p, miR-7a-5p, miR-935, miR-138-5p, miR-187-3p, miR-30e-3p, miR-222-3p) (Table  2). [score:9]
The most common up-regulated miRNAs across the analyzed set of expression profiles were miR-21-5p (15 profiles), followed by miR-132-3p, miR-23a-3p, miR-212-3p, miR-146a-5p, miR-27a-3p, miR-129-5p, miR-203a-3p, miR-17-5p, miR-19a-3p (Supplementary Table  S4). [score:6]
At the latent stage, up-regulated miRNAs miR-20a, miR-17, miR-23a, miR-27a and miR-146a have been previously shown to be enriched in mouse microglia [58]. [score:4]
[1 to 20 of 3 sentences]
55
[+] score: 19
We used a combination of two microRNA prediction methods, TargetScan and PicTar, to search for all predicted gene targets of the 5 most highly upregulated (let-7s, miR-21, miR-23b, miR-27a and miR-30a) and downregulated (miR-29b, miR-32, miR-144, miR-197 and miR-212) microRNAs [13]. [score:11]
TargetScan (light blue) and PicTar (yellow) identified 1884 genes as predicted targets of the 5 most highly upregulated microRNAs (let-7s, miR-21, miR-23b, miR-27a and miR-30a). [score:8]
[1 to 20 of 2 sentences]
56
[+] score: 19
For example, miR-23a suppresses the JAK1/STAT6 pathway by directly targeting these molecules, while miR-27a directly targets IRF4 and PPAR-γ. [score:9]
It will be interesting to see whether the M2-promoting capacity of miR-27a inhibitor translates to in vivo benefit. [score:5]
Another miRNA confirmed as a direct regulator of is miR-27a (104). [score:3]
The therapeutic potential of miR-27a has been investigated in the context of treating pathology associated with alcohol abuse and hepatitis C. Both of these insults are associated with liver disease (as characterized by inflammation, hepatitis, or cirrhosis) and both enhance miR-27a expression in monocytes and monocyte-derived MΦ (124). [score:1]
However, the following miRNAs are known to be involved in the MΦ response to mycobacterial infection: miR-144 (40), miR-132 (32), miR-26a (32), miR-155 (41), miR-146a (41), miR-145 (41), miR-222 (41), miR-27a (41), miR-27b (41), and miR-125b (42). [score:1]
[1 to 20 of 5 sentences]
57
[+] score: 19
Up-regulation of miR-27a can suppress RKIP (Raf kinase inhibitory protein) expression and in turn contribute to chemoresistance of lung adenocarcinoma cells to cisplatin [16]. [score:10]
Moreover, it has been reported that downregulation of miRNA-27a is responsible for EMT and cisplatin resistance in A549 cells by directly targeting Raf Kinase Inhibitory Protein (RKIP) [41]. [score:9]
[1 to 20 of 2 sentences]
58
[+] score: 17
Emerging evidence demonstrates that miRNAs are critical regulators of lipid synthesis and FAO [81] resulting in defective cell metabolism and carcinogenesis [82] directly targeting key enzymes or transcription factors as oncogenes and tumor suppressors [81] as shown in Table  1. Table 1 miRNAs involved in cancer metabolic plasticity MiRNAs Target Reference miR-122 Cholesterol biosynthesis 88– 90 miR-370 Fatty acid oxidation, CPT1A [91] miR-378/378* Lipid metabolism, CrAT 92, 93 miR-335 Lipid metabolism and adipogenesis [94] miR-205 Lipid metabolism [95] miR-143 Adipocyte differentiation [96] miR-27 Adipolysis [97] miR-33a/b Cholesterol efflux and β-oxidation 98– 100 miR-185 Lipogenesis and cholesterogenesis [101] miR-342 Lipogenesis and cholesterogenesis [101] miR-124 CPT1A [27] miR-129 CACT 27, 102 MiR-122 was the first miRNA identified as tissue-specific, and it is the most abundant in liver involved in lipid metabolic reprogramming [83]. [score:9]
MiR-27a inhibits the expression of several lipid metabolic genes, including SREBP1-2, FASN, and PPARα/γ, by reducing lipid synthesis and increasing lipid secretion from cells [92]. [score:4]
Shirasaki T MicroRNA-27a regulates lipid metabolism and inhibits hepatitis C virus replication in human hepatoma cellsJ. [score:3]
MiR-143, miR-27, miR-335, miR-14, and miR-205 have been recently associated with lipid metabolism and adipocyte differentiation [91]. [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Systemic administration inhibe cancer cell proliferation and induced apoptosis in HCCChang et al., 2008; Ji et al., 2009a; Braconi et al., 2011; Kerr et al., 2011; Szabo et al., 2012 miR-27a Promote cell growth and inhibit apoptosisHuang et al., 2008, 2009 miR-29c Apoptosis inhibitionLi et al., 2008; Xiong et al., 2010; Wang et al., 2011 miR-34a Stimulation of HCC proliferation. [score:7]
Another study suggests that miR-27a and miR-27b may target RXR and regulated of CYP3A4 transcriptional expression (Ji et al., 2009b). [score:6]
Over-expressed microRNA-27a and 27b influence fat accumulation and cell proliferation during rat hepatic stellate cell activation. [score:3]
Potential microRNAs that could serve as possible markers of HCC by exposure to aflatoxins are miR-27a, miR-27b, miR-122, miR-148, miR-155, miR-192, miR-214, miR-221, miR-429, and miR-500. [score:1]
[1 to 20 of 4 sentences]
60
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Cai et al. (2014) found that 18 miRNAs were differentially expressed between intact and castrated male pigs, including miR-15a, miR-21, miR-27, miR-30, and so on [23]; Bai et al. (2014) reported that 177 miRNAs had more than 2-fold differential expression between castrated and intact male pigs, including miR-21, miR-30, miR-27, miR-103, and so on [22]. [score:5]
These indicated that miR-21, miR-30, and miR-27 and their target lncRNAs may play an important role in the androgen deficiency-related fat deposition, as it is wi dely known that miR-30a targets the androgen receptor (AR) gene [22]. [score:5]
Five depressing-adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326) target 217 lncRNAs. [score:3]
Our results were consisted with these reports, it was predicted that there were lncRNAs were the target genes for miR-21, miR-30, and miR-27. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 5 sentences]
61
[+] score: 17
The expression of miR-27 is upregulated by VEGF in breast CSCs and promotes angiogenesis and metastasis [43]. [score:6]
Furthermore, miR-27 targets ectonucleotide pyrophosphatase/phosphodiesterase family member 1 (ENPP1) and regulates the tumorigenicity and drug resistance of breast cancer cells [42]. [score:4]
For example, miRNAs, such as miR-135, miR-27, mir-155, miR-129, miR-106b, let-7, miR-125, miR-663, and miR-142, target APC and activate canonical Wnt signaling [100, 138, 139, 140, 141, 142, 143, 144, 145, 146]. [score:3]
In addition, other miRNAs, including let-7, miR-1 and miR-27, are among the miRNAs that are differentially expressed between breast CSCs and non-tumorigenic cancer cells ([24, 40, 41, 42, 43], for review [8, 44, 45]). [score:3]
Wang T. Xu Z. miR-27 promotes osteoblast differentiation by modulating Wnt signaling Biochem. [score:1]
[1 to 20 of 5 sentences]
62
[+] score: 17
MiRNA-34a expression was significantly increased in the group who developed shock (p = 0.03) while miR-15a and miR-27a expressions were significantly decreased in this group (p = 0.006 and 0.03, respectively). [score:5]
First, both miR-15a and miR-27a are known to or are predicted to target and inhibit genes that increase vascular permeability in the setting of sepsis including VEGFA, VEGFC and MYLK [41– 44]. [score:5]
Therefore, reduced levels of circulating miR-15a and miR-27a could disinhibit these genes and contribute to the development of shock. [score:4]
Future work will focus on validating the differential expression of miR-15a, miR-27a, and miR-34a in independent cohorts. [score:3]
[1 to 20 of 4 sentences]
63
[+] score: 17
Other miRNAs from this paper: hsa-let-7b, hsa-mir-15a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-28, hsa-mir-30a, hsa-mir-100, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-1-2, hsa-mir-15b, hsa-mir-30b, hsa-mir-122, hsa-mir-132, hsa-mir-141, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-195, hsa-mir-200c, hsa-mir-1-1, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-371a, hsa-mir-372, hsa-mir-373, hsa-mir-375, hsa-mir-151a, hsa-mir-429, hsa-mir-449a, hsa-mir-483, hsa-mir-193b, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320b-2, hsa-mir-891a, hsa-mir-935, hsa-mir-1233-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-1275, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1973, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-1233-2, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
In patients with asthenozoospermia, two studies found that hsa-miR-27a [47, 56, 57], hsa-miR-548b-5p, hsa-miR-548c-5p and hsa-miR-548d-5p are up-regulated [47], while hsa-miR-34b-3p [47, 51], hsa-miR-520 h and hsa-miR-520d-3p are downregulated [47]. [score:7]
These miRNAs are expressed in spermatozoa and are involved in spermatogenesis (hsa-miR-34b-3p, hsa-miR-27a), embryonic development (hsa-miR-520 family) or in signaling pathways and human tumorigenesis (hsa-miR-548 family). [score:4]
In patients with asthenoteratozoospermia, increased expression of hsa-miR-27a mediates the repression of the Cysteine-RIch Secretory Protein2 (CRISP2) gene that plays a role in sperm motility, acrosome reaction and gamete fusion. [score:3]
Zhou J-H, Zhou Q-Z, Yang J-K, Lyu X-M, Bian J, Guo W-B, et al. MicroRNA-27a -mediated repression of cysteine-rich secretory protein 2 translation in asthenoteratozoospermic patients. [score:2]
For instance, hsa-miR-27a is closely associated with spermatogenesis and infertility. [score:1]
[1 to 20 of 5 sentences]
64
[+] score: 16
Based on our previous results showing that E. faecalis infection induces ROS in the host cells and on miRNA expression data presented in this study and by other groups we propose that down-regulation of miRNAs of the miR-17-92 cluster, miR-106-363 cluster and miR-24-2 and miR-27a/b could be a consequence of ROS induced DNA damage by the bacterial infection. [score:6]
miR-27a* and miR-27b* was approximately 50% reduced after 24 h of infection and after 5 days miR-24-2*, miR-27a*, and miR-27b* were down-regulated by 75%–90% (Figure 1C). [score:4]
In conclusion, our results demonstrate that infection by living E. faecalis, but not lysate, causes a reduction in miR-17-92 and miR-106-363 cluster miRNAs as well as miR-24-2 and miR-27a/b, and that ROS significantly reduce the expression of miR-17-92. [score:3]
Pathi S. S. Jutooru I. Chadalapaka G. Sreevalsan S. Anand S. Thatcher G. R. Safe S. Gt-094, a NO-NSAID, inhibits colon cancer cell growth by activation of a reactive oxygen species-microRNA-27a: ZBTB10-specificity protein pathway Mol. [score:3]
[1 to 20 of 4 sentences]
65
[+] score: 16
MiR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated, while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
miR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
The Ct values of nine miRNAs (miR-101-3p, miR-106b-5p, miR-151a-3p, miR-195-5p, miR-19b-3p, miR-27a-3p, miR-320a, miR-328, and miR-489) were in the range of 25–30, while the remaining five miRNAs (miR-130a-3p, miR-181b-5p, miR-433, miR-572, and miR-663a) had Ct values in the range of 30 to 35. [score:1]
We observed consistent results for all miRNAs except miR-27a-3p (Figure  2). [score:1]
[1 to 20 of 4 sentences]
66
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-370, hsa-mir-371a, hsa-mir-375, hsa-mir-378a, hsa-mir-133b, hsa-mir-423, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-520c, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-33b, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-509-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
The overexpression of miR-27a and miR-130a clearly suppresses adipocyte differentiation along with PPARγ expression. [score:7]
Another notable example is given by miR-27a and miR-130a that inhibit adipocyte differentiation through PPARγ downregulation [65, 66]. [score:6]
Antiregulates clonal expansion via HMGA2[74] miR-15a Delta-like 1 homolog[190] miR-22 HDAC6[191] miR-27a/b MAPK/ERK signaling via PHB, C/EBPβ, PPARγ, and aP2 signaling. [score:2]
Alterations in circulating miR-23a, miR-27a, miR-130, miR-195, miR-197, miR-320a, and miR-509-5p have been associated to metabolic syndrome [153, 154]. [score:1]
[1 to 20 of 4 sentences]
67
[+] score: 15
Stable ectopic expression of RUNX1-MTG8, CBFB-MYH11, or miR-17 in U937 cells (a representative U937 clone is shown for each construct) leads to downregulation of miR-193a, a RUNX1-regulated miRNA targeting KIT (left), and miR-27a, a RUNX1-regulated miRNA involved in myeloid differentiation (right). [score:10]
Consistently, the U937 [miR-17], U937 [RUNX1-MTG8] and U937 [CBFB-MYH11] clones also displayed significant downregulation of RUNX1-regulated miRNAs involved in myeloid differentiation, such as miR-223 (Figure  3C) and miR-27a (Additional file 1: Figure S2, right) [13, 26]. [score:5]
[1 to 20 of 2 sentences]
68
[+] score: 15
Among them, miR-27a is a known suppressor of adipocyte differentiation via suppression of PPARγ expression, which is a master transcription factor for adipocyte differentiation [15, 18] and is a regulator of porcine adipocyte lipid metabolism [34]. [score:8]
miR-27 can suppress the terminal differentiation of pre-adipocytes by targeting the adipogenic master genes, PPARγ and prohibitin [15- 17]. [score:5]
However, the expression of miR-27a and miR-31 was higher in the H group compared to the L group. [score:2]
[1 to 20 of 3 sentences]
69
[+] score: 15
Other miRNAs from this paper: hsa-let-7b, hsa-mir-21, hsa-mir-148a, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-141, hsa-mir-126, hsa-mir-146a, hsa-mir-1-1, hsa-mir-155, hsa-mir-34b, hsa-mir-34c, hsa-mir-296, hsa-mir-370, hsa-mir-373, hsa-mir-342, hsa-mir-526a-1, hsa-mir-526a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-542, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1246, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-548q, hsa-mir-548s, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Zhang and his colleagues found that the expression of miR-27a is downregulated during EV71 infection and that miR-27a could target EGFR [97]. [score:8]
Further studies have shown that the ectopic expression of miR-27a suppresses EGFR expression and reduces Akt and ERK phosphorylation. [score:7]
[1 to 20 of 2 sentences]
70
[+] score: 14
The miR-27 miRNAs target multiple lipid -associated transcription factors to regulate lipid metabolism and LD biogenesis, thus modulating HCV -mediated hepatic steatosis 35, 36. [score:4]
Shirasaki T MicroRNA-27a regulates lipid metabolism and inhibits hepatitis C virus replication in human hepatoma cellsJ. [score:3]
These include miR-27 and miR-130a/b, which enhance IFN production and the expression of various interferon-stimulated genes (ISGs) in hepatocytes 30, 35, 45. [score:3]
For example, HCV infection induces the expression of miR-27a/b both in vitro and in vivo 35, 36. [score:3]
It is noteworthy that miR-27a/b, miR-185, miR-130b, and miR-146a-5p mentioned above are all mimic screen hits in our study (Supplementary Data  1). [score:1]
[1 to 20 of 5 sentences]
71
[+] score: 14
Kim S. Y. Kim A. Y. Lee H. W. Son Y. H. Lee G. Y. Lee J. W. Lee Y. S. Kim J. B. miR-27a is a negative regulator of adipocyte differentiation via suppressing PPARgamma expression Biochem. [score:6]
Intriguingly, decreased expression of miRNA-27a has been reported to be a molecular feature of mature adipocytes in obesity [77]. [score:3]
Therefore, one might presume that deregulated miRNA-27a -dependent signaling accounts for a mechanistic link between OA and overweight. [score:2]
Tardif G. Hum D. Pelletier J. P. Duval N. Martel-Pelletier J. Regulation of the IGFBP-5 and MMP-13 genes by the microRNAs miR-140 and miR-27a in human osteoarthritic chondrocytes BMC Musculoskelet. [score:2]
The levels of miRNA-27a are found to be decreased in OA chondrocytes in comparison to normal chondrocytes [76]. [score:1]
[1 to 20 of 5 sentences]
72
[+] score: 14
The other four miRNAs, hsa-miR-942, hsa-miR-105, hsa-miR-150, and hsa-miR-27a* were identified to be up-regulated in ovarian cancer. [score:4]
In addition, hsa-miR-27a is reportedly down-regulated in many cancers, including breast and prostate cancer [29]. [score:4]
Oncogenic miRNA-27a is also found to be a therapeutic target for Ovarian cancer cells [7]. [score:3]
According to their degrees in MFSN, hsa-miR-579, hsa-miR-942, hsa-miR-105, hsa-miR-150, and hsa-miR-27a* were selected as hub nodes in MFSN. [score:1]
GO: 0007268 (synaptic transmission) and GO: 0019226 (transmission of nerve impulse) were the two common functions of miRNAs in MFSN, and hsa-miR-579 (36), hsa-miR-942 (31), hsa-miR-105 (31), hsa-miR-150 (34), and hsa-miR-27a* (32) were selected as the hub nodes in MFSN. [score:1]
In all, 5 nodes with degrees more than 30, including hsa-miR-579 (36), hsa-miR-942 (31), hsa-miR-105 (31), hsa-miR-150 (34), and hsa-miR-27a* (32) were selected as the hub nodes in MFSN. [score:1]
[1 to 20 of 6 sentences]
73
[+] score: 14
Hsa-miR-23a, hsa-miR-3941, hsa-miR-27a-3p and hsa-miR-3651 were the most significantly down-regulated miRNAs, whereas hsa-miR-920, hsa-miR-1204, hsa-miR-508-5p and hsa-miR-501-5p were the most significantly up-regulated miRNAs (n = 12 per group) (Fig.   2). [score:7]
Hsa-miR-23a, hsa-miR-3941, hsa-miR-27a-3p and hsa-miR-3651 were the most significantly down-regulated miRNAs, whereas hsa-miR-920, hsa-miR-1204, hsa-miR-508-5p and hsa-miR-501-5p were the most significantly up-regulated miRNAs (n = 12 per group). [score:7]
[1 to 20 of 2 sentences]
74
[+] score: 14
Indeed, the Herpesvirus saimiri (HSV)-derived non-coding transcripts called H. saimiri U-rich RNAs (HSURs) were reported to interact with and downregulate the cellular miR-27, thereby altering the expression of its target genes [287]. [score:8]
Libri V. Helwak A. Miesen P. Santhakumar D. Borger J. G. Kudla G. Grey F. Tollervey D. Buck A. H. Murine cytomegalovirus encodes a miR-27 inhibitor disguised as a targetProc. [score:5]
Marcinowski L. Tanguy M. Krmpotic A. Radle B. Lisnic V. J. Tuddenham L. Chane-Woon-Ming B. Ruzsics Z. Erhard F. Benkartek C. Degradation of cellular mir-27 by a novel, highly abundant viral transcript is important for efficient virus replication in vivoPLoS Pathog. [score:1]
[1 to 20 of 3 sentences]
75
[+] score: 14
In this context, prime examples of the latter include the up-regulation of miR-27a/b [99], miR-125b [98] and down-regulation of miR-93 [96], as observed in AD brain. [score:7]
Taken together, these data indicate that up-regulation of miR-27a/b, -125b, -146a and down-regulation of miR-93 may contribute to the stress-related vascular and inflammatory components of AD pathology. [score:7]
[1 to 20 of 2 sentences]
76
[+] score: 13
miR-27a is reported to target the transcription factor ZBTB10/RINZF, which is a putative suppressor of specificity protein (Sp) [21]. [score:5]
Overexpression of Sp by miR-27a contributes to the increased expression of Sp -dependent survival and angiogenic genes, including survivin, vascular endothelial growth factor (VEGF), and VEGF receptor 1 (VEGFR1). [score:5]
Thus, the oncogenic activity of miR-27a in breast cancer cells is due, in part, to suppression of ZBTB10. [score:3]
[1 to 20 of 3 sentences]
77
[+] score: 13
RES thus modulated miR-21, miR-20b, miR-27a, miR-9. Among these, there was a high upregulation of miR-21 expression in basal level controls with RES, which was considerably lowered in IR; miR-21 has been shown to regulate the ERK-MAPK signaling pathway in cardiac fibroblasts, which is involved in cardiac structure and remo deling [85]; miR-21 also regulated fibroblast metalloprotease 2 in a murine myocardial infarction mo del, with a specific localization in the infarct region of the IR heart [86]. [score:8]
The vascular endothelial growth factor (VEGF) has been reported to be modulated by miR-20b via the hypoxia-inducible factor 1-alpha (HIF1α) in response to hypoxia [87], whereas FoxO1 was regulated by miR-27a in cancer cells [88], and SIRT-1 by miR-9 in stem cells [89]. [score:2]
Guttilla I. K. White B. A. Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells J. Biol. [score:2]
Thus, miR-126, miR-27, miR-92a and miR-155 were lowered in these patients, whereas myocardial-derived miRNAs such as miR-133 and miR-208 were increased [24]. [score:1]
[1 to 20 of 4 sentences]
78
[+] score: 13
Other miRNAs from this paper: hsa-mir-146a, hsa-mir-146b
miR-27a has been shown to function as oncogenes in gastric adenocarcinoma by targeting prohibitin and forkhead box protein O1 (FOXO1) [13], [17], which could protect cells against oxidative stress [18], [19]. [score:3]
Recently, a Chinese study found that rs895819 TC/CC genotype was associated with an increased risk of GC by enhancing miR-27a production and reducing the mRNA level of its target gene ZBTB10 [20]. [score:3]
MiR-27a is located at chromosome 19 and has been shown to function as oncogene by targeting prohibitin [13], FOXO1 [17] and Sprouty2 [33] in various cancers including GC. [score:2]
Among them, we selected two SNPs for the current study, miR-146a rs2910164: G>C and miR-27a rs895819: T>C, which have been reported to influence GC risk [13], [14]. [score:1]
Because H. pylori infection -induced inflammation is an important source of oxidative stress by producing reactive oxygen species (ROS), we also selected miR-27a as a candidate. [score:1]
The polymorphisms of rs2910164 in miR-146a and rs895819 in miR-27a have been reported to affect the corresponding miRNA production [20], 21 and GC susceptibility [14], [22]. [score:1]
The rs895819 T>C polymorphism is located in the miR-27a precursor, at position 40 relative to the first nucleotide. [score:1]
Based on serum miRNA array conducted in this population, two SNP loci (miR-146a rs2910164: G>C and miR-27a rs895819: T>C) were determined by polymerase chain reaction-restriction fragment length polymorphism in 2,380 participants with diverse gastric lesions. [score:1]
[1 to 20 of 8 sentences]
79
[+] score: 13
For example, miR-27a, miR-96 and miR-182 can coordinately regulate the expression of FOXO1 by directly targeting the FOXO1 3′-UTR in breast cancer [34]. [score:7]
It has been demonstrated that FOXO1 expression is regulated by several microRNAs, such as miR-223, miR-182, miR-27a, miR-139 and miR-96 [39]– [43]. [score:4]
Of these, some microRNAs may be dysregulated in prostate cancer, such as miR-27a, miR-182 [41], [44]. [score:2]
[1 to 20 of 3 sentences]
80
[+] score: 13
The miR expression profile of E. granulosus was studied for its different developmental stages and the protoscolex and cyst wall both showed the expression of miR-2, miR-9, miR-10, miR-27, let-7, and miR-71 except for miR-125 which was present only on protoscolex (Cucher et al., 2011). [score:6]
Apart from this, they also found striking similarities between fhe-mir-2b-A and fhe-mir-2a-B and the two mir-27 orthologs, bta-mir-27a and bta-mir-27b, these two are known to target the 3′ un-translated region (UTR) of myostatin and insulin growth factor (IGF) in cattle and human (Miretti et al., 2013). [score:5]
Myeloid-derived microRNAs, miR-223, miR27a, and miR-652, are dominant players in myeloid regulation. [score:2]
[1 to 20 of 3 sentences]
81
[+] score: 13
There were even some miRNAs that were significantly up-regulated, including one miRNA, miR-27a-5p, which has been identified as a tumour suppressor in other contexts [44]. [score:6]
One miRNA, miR-27a-5p, was significantly up-regulated in response to VACV infection. [score:4]
Although it is likely that the probe used did not distinguish between miR-27a and miR-27b (which differ by only 1 nt) we refer here to miR-27b as this is 16 fold more abundant in Hela cells according to our sequencing analysis (S6 Table) and both family members showed the same pattern of modification and reduction upon infection (S5 Table). [score:1]
Furthermore, the abundance of 3 miRNAs (miR-27a-5p, miR-769-5p and miR-30c-1-5p) significantly decreased in response to AraC treatment of infected cells at 6 hpi (Fig 2c). [score:1]
Less variation in the response to VACV infection was observed at 24 hpi, when 97% of the miRNAs were significantly reduced (Fig 2b) however miR-27a-5p remains present at levels comparable to uninfected cells even at this time point. [score:1]
[1 to 20 of 5 sentences]
82
[+] score: 13
Our results demonstrated that DAC treatment can significantly suppress miR-27a expression. [score:5]
As another important example, miR-27a plays an important role in breast cancer by suppressing the expression of the transcription factors ZBTB10/ RINZF, and subsequently increasing several angiogenic molecules, such as Survivin, VEGF and VEGFR1 [48]. [score:5]
A previous report indicated over -expression of the miR-27a in breast cancer [49]. [score:3]
[1 to 20 of 3 sentences]
83
[+] score: 13
Lerner et al [65] demonstrated that attenuation of Fbxw7 by miR-27a overexpression led to inappropriate cell cycle progression and DNA replication stress, in accordance with the dysregulation of cyclin E expression. [score:6]
What is more, several proteins such as, RITA, EBP2, Numb4, SGK1,,, Pin1, FAM83D, C/EBPδ, Hes-5, presenilin, miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a are found to regulate the expression of Fbxw7. [score:4]
Besides those, recently, accumulating evidence has shown that several molecules such as, miRNAs including miR-223, miR-25, miR-27a, miR-182, miR-503, and miR-129-5p, RITA, and FAM83D, as well as Pin1, CCAAT/enhancer -binding protein-δ, presenilin,,, EBP2, Numb4 and serum-and glucocorticoid-inducible protein kinase1 could regulate Fbxw7 (Figure 3). [score:2]
MicroRNAs (miRNAs) Including miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a. [score:1]
[1 to 20 of 4 sentences]
84
[+] score: 13
MicroRNAs (miRNAs) including miR-27 [34], miR-25 [35] and miR-223 [36] have been reported to be involved in regulating the expression of FBXW7. [score:4]
Consistently, there is an inverse correlation between miR-27a expression and FBXW7 levels in human tumor samples. [score:3]
Lerner et al. further discovered that miR-27a suppresses FBXW7 during specific cell cycle phases [37]. [score:3]
Wang et al. reported that FBXW7 is a potential miR-27a target. [score:3]
[1 to 20 of 4 sentences]
85
[+] score: 12
Another study in HC [70], However, found that miR-133b showed downregulation and might act as tumour suppressor, then, the participants accepted transarterial chemoembolization (TACE) using chemotherapy agents-doxorubicin and cisplatin, miR-133b and othter 11 miRNAs were significantly upregulated in the patients group of nonresponders compared to responders, so research suggests 12 miRNAs might be cooperatively associated with the development of resistance to doxorubicin-cisplatin combined treatment, the underlying cause was that 3 miRNAs among theser miRNAs are directly linked to drug resistance in cancer, especially miR-27a and miR-130a can stimulate MDR1 -mediated drug resistance in HC cells, it had been identified that multidrug resistance protein 1(MDR1 or ABCB1) involved in doxorubicin and cisplatin resistance [71, 72]. [score:10]
[24] introduced Response Score to identify AR target miRNAs and 15 miRNAs were theoretically identified as candidate in the end, based on GenMAPP and ChIP assay results they found a significant AR -binding to the chromatin of predicted AREs (in the upstream and downstream 15 kb of pre-miRNA's 5′-start site) in miR-19a, miR-27a and miR-133b in treated LNCaP cells, and AR driven transcription of these miRs. [score:2]
[1 to 20 of 2 sentences]
86
[+] score: 12
Only one out of four sites for miR17-5p (Figure  6E) and one out of five sites for miR-27a (Figure  6F) showed significant (P < 0.05) reduction of mRNA levels, indicating that most interactions that result in reduced protein are due to translational inhibition rather than mRNA degradation, although both types of regulation are possible. [score:6]
For both miR-17-5p imperfect centered sites (Figure  6C), and miR-27a imperfect centered sites (Figure  6D), all targets were found to be significantly enriched (P ≤ 0.05) in the AGO2 enriched fraction compared to the input mRNA population, demonstrating that interactions between an imperfect centered site and its target mRNA were mediated through RISC. [score:4]
We selected eight previously untested targets of miR-17-5p (3) and miR-27a (5) for experimental validation using luciferase assays. [score:2]
[1 to 20 of 3 sentences]
87
[+] score: 12
Other miRNAs from this paper: hsa-mir-26a-1, hsa-mir-27b, hsa-mir-26a-2, hsa-mir-361, hsa-mir-539
Likewise, in mature gonadotropes, microRNA-27 downregulates PHB1 protein levels, and this is associated with an apoptotic response in the normal development and function of the reproductive axis [8]. [score:5]
Similarly, in prostate cancer and gastric cancer cells, microRNA-27a promotes tumor growth by directly targeting PHB1 [121]. [score:4]
However, in glioma cells, microRNA-27a promotes apoptosis by decreasing PHB1 protein expression [122]. [score:3]
[1 to 20 of 3 sentences]
88
[+] score: 12
In SC fat, expression of miR-27a, miR-30e, miR-140, miR-155, miR-210 was significantly higher and expression of miR-147 and miR-197 was lower in NGT as compared to the T2D group 10.1371/journal. [score:4]
In SC fat, expression of miR-27a, miR-30e, miR-140, miR-155, miR-210 was significantly higher and expression of miR-147 and miR-197 was lower in NGT as compared to the T2D group 10.1371/journal. [score:4]
Our data suggest that expression of miR-17-5p, miR-132, miR-134, miR-181a, miR-27a, miR-30e, miR-140, miR-147, miR-155, miR-197, and miR-210 play a role in the link between adipose tissue dysfunction and the development of obesity associated disorders including type 2 diabetes. [score:4]
[1 to 20 of 3 sentences]
89
[+] score: 12
Down-regulation of prohibition and APC by miR-27a may explain why suppression of miR-27a can inhibit gastric cancer cell growth and metastasis (Ref. [score:8]
114) identified a profile of five serum miRNAs (miR-1, miR-20a, miR-27a, miR-34 and miR-423-5p) as biomarkers for gastric cancer detection, and their expression level correlated well with the tumour stage. [score:3]
Several miRNAs circulating in blood of gastric cancer patients can be applied as diagnosis biomarkers, including let-7a, miR-1, miR-17-5p, miR-21, miR-20a, miR-27a, miR-34, miR-106a/b, miR-196a, miR-199a-3p, miR-218, miR-221, miR-223, miR-370, miR-376c, miR-378, miR-421, miR-423-5p, miR-451 and miR-486 (Refs 64, 76, 111, 112, 113, 114, 115, 116, 117). [score:1]
[1 to 20 of 3 sentences]
90
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Moreover, GC patients with over -expression of miR-107 [28, 29, 30], miR-143 [40], miR-145 [41, 42], miR-181b/c [17, 47, 48, 55, 56], miR-196a/b [59], miR-20b [23, 66], miR-23a/b [77, 78, 79], miR-34 [17, 47, 48, 55, 56] and miR-630 [100] and decreased expression of miR-1 [111], miR-1207-5p [121], miR-125a-3p/-5p [24, 125, 126, 127], miR-185 [140], miR-193b [60], miR-20a [111], miR-206 [150, 151], miR-215 [142], miR-217 [153], miR-27a [111], miR-29c [169], miR-34a [172, 173], miR-423-5p [111], and miR-520d-3p [99] indicate advanced tumor stage or TNM stage. [score:5]
Of these, miR-17-5p, miR-18a, miR-20a, miR-200c, miR-21, miR-218, miR-221, miR-222, miR-25, miR-27a, miR-376c, and miR-744 were found to be significantly elevated in GC patients, and their expression was significantly reduced after surgery [26, 27, 54, 68, 71, 80, 81, 155, 187, 192, 193, 195, 196, 198, 199, 200, 201, 202, 203, 204, 205]. [score:3]
The major plasma/serum -based, GC-related circulating miRNAs that have been suggested as useful GC biomarkers are listed in Table 3 and Table 4. Liu et al. [111] used systematic analysis of miRNA profiling, miRNA profiling to identify a signature of five circulating oncomiRs—miR-1, miR-20a, miR-27a, miR-34 and miR-423-5p—and correlated it with tumor stage. [score:1]
The major plasma/serum -based, GC-related circulating miRNAs that have been suggested as useful GC biomarkers are listed in Table 3 and Table 4. Liu et al. [111] used systematic analysis of miRNA profiling, miRNA profiling to identify a signature of five circulating oncomiRs—miR-1, miR-20a, miR-27a, miR-34 and miR-423-5p—and correlated it with tumor stage. [score:1]
Huang D. Wang H. Liu R. Li H. Ge S. Bai M. Deng T. Yao G. Ba Y. miRNA27a is a biomarker for predicting chemosensitivity and prognosis in metastatic or recurrent gastric cancer J. Cell. [score:1]
Zhang Z. Liu S. Shi R. Zhao G. miR-27 promotes human gastric cancer cell metastasis by inducing epithelial-to-mesenchymal transition Cancer Genet. [score:1]
[1 to 20 of 6 sentences]
91
[+] score: 12
In particular, miR-27a was found to be involved in the development of paclitaxel resistance, partly by targeting Homoeodomain-interacting protein kinase-2 (HIPK2), which can lead to suppression of MDR1 gene by inhibiting hypoxia inducible factor-1α (HIF-1α) [89]. [score:8]
MiR-451, miR-27, miR-326 and miR-331-5p have been shown to regulate the expression of the MDR1 gene [85– 88]. [score:4]
[1 to 20 of 2 sentences]
92
[+] score: 11
We found 12 miRNAs (hsa-miR-21, hsa-miR-23a, hsa-miR-23b, hsa-miR-24, hsa-miR-27a, hsa-miR-29a, hsa-miR-31, hsa-miR-100, hsa-miR-193a, hsa-miR-221, hsa-miR-222 and hsa-let-7i) that were consistently up-regulated in the senescent cells of all donors (Fig. 1A), whereas only three miRNAs of the 17–92 cluster were down-regulated (Fig. 1A). [score:7]
We identified 12 miRNAs to be up-regulated in senescence, comprising hsa-miR-23a, hsa-miR-23b, hsa-miR-24, hsa-miR-27a, hsa-miR-29a, hsa-miR-31, hsa-miR-100, hsa-miR-193a, hsa-miR-221, hsa-miR-222 and hsa-let-7i. [score:4]
[1 to 20 of 2 sentences]
93
[+] score: 11
Other miRNAs from this paper: hsa-mir-27b
LAQ824, a small molecule inhibitor of histone deacetylases (HDACi), upregulated the RYBP expression in SKBr3 breast cancer cells through a miRNA27a-involving mechanism [15]. [score:8]
RYBP has also been suggested to be a target of miRNA-27 and 29, which affect physiological processes such as skeletal myosis [14, 15]. [score:3]
[1 to 20 of 2 sentences]
94
[+] score: 11
PPARα was reported to regulate the expression of CYP3A4 36 and was found to be regulated by miR-21, miR-27 and miR-130a 37 38. [score:5]
PXR is a well-known nuclear receptor regulating CYP3A4 and was reported to be regulated by miR-27a, miR-27b and miR-371b 39 40. [score:3]
MiR-27b, miR-206, miR-21, miR-27a, and miR-130a were significantly negatively correlated with the formation rates of PAT (r = −0.46, P = 0.001; FDR= 0.013; r =−0.39, P = 0.003, FDR = 0.013; r = −0.35, P = 0.010, FDR= 0.033; r = −0.33, P = 0.014, FDR = 0.036; r = −0.39, P = 0.003, FDR = 0.013, respectively, Supplementary Table S2). [score:1]
Therefore, a total of 13miRNAs, namely miR-21-5p, miR-27a-3p, miR-27b-3p, miR-103a-3p, miR-106a-5p, miR-107, miR-126-5p, miR-130a-3p, miR-142-5p, miR-206, miR-371b-5p, miR-491-3p, and miR-1260b, were selected. [score:1]
MiR-27b, miR-130a, and miR-27a were also negatively correlated with CYP3A activity in human liver tissues. [score:1]
[1 to 20 of 5 sentences]
95
[+] score: 11
In addition, miR-27 reduces PPAR γ expression in LPS-stimulated macrophages, inhibiting its anti-inflammatory activity [92]. [score:5]
More recently, miR-27 has been implicated in downregulation of PPAR γ in cardiomyocytes and also in neuroblastoma and breast cancer [95, 97]. [score:4]
PPAR γ is negatively regulated by miR-27 and miR-130 family members in preadipocytes, hampering adipocyte differentiation [92– 97]. [score:2]
[1 to 20 of 3 sentences]
96
[+] score: 11
All of them were downregulated: mmu-miR-1 and -805 at ST, mmu-miR-199a-3p, -200a and -429 at IT and mmu-miR-27a and -200b at LT, except mmu-miR-206 which was upregulated at LT. [score:7]
This may be due to transcriptional regulation [98] but possibly also to the repression of miRNAs (mmu-miR-1 at ST; mmu-miR-450a-5p at IT; mmu-miR-27a and -92a at LT) that target IGF1 mRNA. [score:4]
[1 to 20 of 2 sentences]
97
[+] score: 11
A miRNA that is upregulated in rhabdomyosarcoma is miR-27a. [score:4]
Moreover, miR-27a targets retinoic X receptor alpha (RXRA) and retinoic acid receptor alpha (RARA). [score:3]
Upon experimental overexpression of miR-27a, levels of RXRA and RARA significantly decrease [81]. [score:3]
Therefore, miR-27a has oncogenic functions in rhabdomyosarcoma and its blockage could be used in practice to lessen tumour cell growth. [score:1]
[1 to 20 of 4 sentences]
98
[+] score: 11
For example, Girardi et al. found that Gamma ray irradiation induced the expression of miR-27a and subsequently suppressed the expression of its predicted target “ATM” in human lymphocytes [17], and they further demonstrated a direct interaction between the two [21]. [score:10]
Di Francesco A. De Pittà C. Moret F. Barbieri V. Celotti L. Mognato M. The DNA-damage response to γ-radiation is affected by miR-27a in A549 cellsInt. [score:1]
[1 to 20 of 2 sentences]
99
[+] score: 11
Furthermore, a member of this cluster, miR-27a, is able to downregulate c-Met and EGFR by either targeting directly their 3' UTRs or indirectly, by targeting Sprouty2. [score:10]
Acunzo M. Romano G. Palmieri D. Laganá A. Garofalo M. Balatti V. Drusco A. Chiariello M. Nana-Sinkam P. Croce C. M. Cross-talk between MET and EGFR in non-small cell lung cancer involves miR-27a and Sprouty2 Proc. [score:1]
[1 to 20 of 2 sentences]
100
[+] score: 11
In this sense, by virtue of miRNAs known mechanism of action, reducing gene expression by binding to the 3'UTR of their targeted genes, a number of evidenced miRNA species (Mir-27a, Mir-103, Mir-17-5p and Mir-130a) might be involved in turning off the 'neuron projection morphogenesis' process in the SHVT group. [score:5]
Other deregulated biological processes included ‘blood vessel development’ (Mir-155, Mir-17-5p and Mir-130a) (FDR = 6x10 [-4]), 'lung development' (Mir-17-5p and Mir-27a) (FDR = 4x10 [-4]), and ‘cell motion’ (Mir-103) (FDR = 8x10 [-4]) (S3 Table). [score:3]
A heatmap built from nominally significant miRNAs between SHVT and NA detected by sRNA-seq are shown in S3 Fig. When comparing the direct sequencing of the samples with the bioinformatic prediction, 28 miRNA species overlapped, from which Mir-27a, Mir-103, Mir-17-5p, Mir-130a, and Mir-155 were nominally significant although the abundance of the latter was observed to be opposite to the one deduced by GSEA (Table 2). [score:2]
Interestingly, this process was the only one involving all four miRNA species with a consistent abundance among microarray -based predictions and sRNA-seq experiments (Mir-27a, Mir-103, Mir-17-5p and Mir-130a) (FDR<1x10 [-4]) (S3 Table). [score:1]
[1 to 20 of 4 sentences]