miRBase entry: hsa-mir-27a

Stem-loop hsa-mir-27a


Accession
MI0000085
Symbol
HGNC: MIR27A
Description
Homo sapiens hsa-mir-27a precursor miRNA mir-27
Gene
family?
RF00644; mir-27

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR27A, a microRNA, has been implicated in various biological processes and diseases. It has been shown to damage mitochondrial functions and exacerbate MAFLD-related fibrosis when transplanted via lipotoxic HC-exosomal mechanisms in vivo [PMC8607138]. The microRNA is also involved in the regulation of the Nrf2 pathway, which is crucial for cellular defense mechanisms, by binding to Nrf2 through multiple distinct sites when co-existing with other miRs [PMC3517581]. Genetic variants within MIR27A have been studied for their association with the risk of coronary artery disease (CAD), highlighting its potential role in cardiovascular conditions [PMC9141586]. Furthermore, MIR27A is suggested to have a regulatory role in both stem cell and adipocyte differentiation processes [PMC6158720]'>PMC6158720], and its overexpression has been observed to inhibit the migration of preadipocytes [PMC6158720]. The microRNA also interacts with key transcription factors and signaling pathways by regulating Sp1 repressors involved in the expression of VEGF and VEGFR1 [PMC7168141]. Lastly, despite a reduced level of Dicer enzyme which is crucial for miRNA maturation, overexpression of MIR27A has been observed in Treg cells from MRL/lpr mice models [PMC3072673], indicating its potential regulatory role within the immune system.

Literature search
380 open access papers mention hsa-mir-27a
(2322 sentences)

Sequence

556854 reads, 3484 reads per million, 150 experiments
cugaggagcAGGGCUUAGCUGCUUGUGAGCAggguccacaccaagucgugUUCACAGUGGCUAAGUUCCGCcccccag
(((.((.((.(((((((((((((.(((((((.((.(........))).)))))))))))))))))))).)).)).)))

Structure
   a  a  A             U       g  u cac 
cug gg gc GGGCUUAGCUGCU GUGAGCA gg c   a
||| || || ||||||||||||| ||||||| || |    
gac cc CG CUUGAAUCGGUGA CACUUgu cu g   c
   c  c  C             -       g  - aac 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA was previously named miR-27 [1,2] but is renamed here to avoid confusion with the more recently described miR-27b (MIR:MI0000440).

Genome context
chr19: 13836440-13836517 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-27a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-27a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-27a is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-27a is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-27a-5p

Accession MIMAT0004501
Description Homo sapiens hsa-miR-27a-5p mature miRNA
Sequence 10 - AGGGCUUAGCUGCUUGUGAGCA - 31
Evidence experimental
cloned [4]
Database links
Predicted targets

Mature hsa-miR-27a-3p

Accession MIMAT0000084
Description Homo sapiens hsa-miR-27a-3p mature miRNA
Sequence 51 - UUCACAGUGGCUAAGUUCCGC - 71
Evidence experimental
cloned [1,3-5], Northern [1]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  5. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728