MIR27A, a microRNA, has been implicated in various biological processes and diseases. It has been shown to damage mitochondrial functions and exacerbate MAFLD-related fibrosis when transplanted via lipotoxic HC-exosomal mechanisms in vivo [PMC8607138]. The microRNA is also involved in the regulation of the Nrf2 pathway, which is crucial for cellular defense mechanisms, by binding to Nrf2 through multiple distinct sites when co-existing with other miRs [PMC3517581]. Genetic variants within MIR27A have been studied for their association with the risk of coronary artery disease (CAD), highlighting its potential role in cardiovascular conditions [PMC9141586]. Furthermore, MIR27A is suggested to have a regulatory role in both stem cell and adipocyte differentiation processes [PMC6158720]'>PMC6158720], and its overexpression has been observed to inhibit the migration of preadipocytes [PMC6158720]. The microRNA also interacts with key transcription factors and signaling pathways by regulating Sp1 repressors involved in the expression of VEGF and VEGFR1 [PMC7168141]. Lastly, despite a reduced level of Dicer enzyme which is crucial for miRNA maturation, overexpression of MIR27A has been observed in Treg cells from MRL/lpr mice models [PMC3072673], indicating its potential regulatory role within the immune system.
a a A U g u cac cug gg gc GGGCUUAGCUGCU GUGAGCA gg c a ||| || || ||||||||||||| ||||||| || | gac cc CG CUUGAAUCGGUGA CACUUgu cu g c c c C - g - aac
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004501 |
| Description | Homo sapiens hsa-miR-27a-5p mature miRNA |
| Sequence | 10 - AGGGCUUAGCUGCUUGUGAGCA - 31 |
| Evidence |
experimental
cloned [4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000084 |
| Description | Homo sapiens hsa-miR-27a-3p mature miRNA |
| Sequence | 51 - UUCACAGUGGCUAAGUUCCGC - 71 |
| Evidence |
experimental
cloned [1,3-5], Northern [1] |
| Database links |
|
| Predicted targets |
|
|