sort by

30 publications mentioning mmu-mir-149

Open access articles that are associated with the species Mus musculus and mention the gene name mir-149. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 243
We also showed that GRA treatment upregulated miR-149-3p expression, which inhibited cell cycle progression and induced cell apoptosis in gastric tumor cells by suppressing the expression of its direct target gene Wnt-1. Our study suggests that GRA could be exploited as a chemoprophylactic and therapeutic agent against gastric cancer. [score:15]
In conclusion, we propose that GRA inhibited the initiation and progression of gastric cancer by ameliorating the inflammatory microenvironment through inhibition of COX-2 expression, and by decreasing Wnt-1 expression through the upregulation of tumor suppressor miR-149-3p. [score:14]
We also confirmed that miR-149-3p played a tumor suppressor role by downregulating its direct target gene Wnt-1. Chronic infection correlates with cancer in 15–20% of cases [10] and systemic inflammation is associated with poor prognosis in patients with advanced cancers [28]. [score:9]
In our study, GRA inhibited gastric tumorigenesis through the upregulation of tumor suppressor miR-149-3p. [score:8]
Figure 6MiR-149-3p directly targets the 3′-UTR of Wnt-1 mRNA(A) Schematic representation of the mature miR-149-3p sequence, the target sequence in the 3′-UTR of Wnt-1, and a 3′-UTR mutant of Wnt-1 containing seven mutated nucleotides in the putative target site. [score:8]
In addition to miR-149-3p, we found 13 other miRNAs that were upregulated and 22 that were downregulated in GC after GRA administration (Supplementary Table S1). [score:7]
miR-149-3p was upregulated after GRA administration, and frequently downregulated in GC tissues and cells. [score:7]
However, there was no increase in relative luciferase activity in HEK293T cells cotransfected with miR-149-3p inhibitor and pmirGLO-Wnt1-WT (Figure 6C), and only slightly changes were detected in Wnt-1 expression in MKN-1 cells transfected with miR-149-3p inhibitor (Figure 6D). [score:7]
Thus, gastric tumor cells BGC-823 and MKN-1 were chosen to detect the effects of GRA on the expressions of miR-149-3p, and qRT-PCR results demonstrated that miR-149-3p levels were upregulated by GRA in a time- and dose -dependent manner (Figure 4D and 4E). [score:6]
In addition, more gastric tumor tissues were used to confirm the results of the microarray analysis, and qRT-PCR showed that −ΔCt in the control group (n = 16) was 5.96, and 4.54 in GRA -treated group (n = 11) (Figure 4C), the results pointed out that GRA indeed upregulated the expression of miR-149-3p. [score:6]
GRA upregulated miR-149-3p expression in (D) BGC-823 and (E) MKN-1 in a time- and dose -dependent manner. [score:6]
Overexpression of miR-149-3p induced (D) cell apoptosis, (E) G0/G1 arrest, and (F) suppressed cell colony formation in BGC-823 cells. [score:5]
Overexpression of miR-149-3p induced (A) cell apoptosis, (B) G0/G1 arrest, and (C) suppressed cell colony formation in MKN-1 cells. [score:5]
In addition, to explore the relationship between miR-149-3p expression and GC progression, 74 cases of gastric cancer with intact clinical pathological information were divided into two groups according the median level of miR-149-3p expression. [score:5]
miR-149-3p suppressed GC cell proliferation and cell cycle progression in vitroNext, we used MKN-1 and BGC-823 cells to monitor the impact of ectopic overexpression of miR-149-3p on cell cycle, apoptosis and reproducibility. [score:5]
Inhibition of miR-149-3p suppressed (J) cell apoptosis, (K) G0/G1 arrest, and (L) stimulated cell colony formation in BGC-823 cells. [score:5]
Wnt-1 was predicted to be an important target gene of miR-149-3p with two complementary sites in its 3′-UTR using the online software TargetScan (http://www. [score:5]
Figure 5Overexpression of miR-149-3p induced (A) cell apoptosis, (B) G0/G1 arrest, and (C) suppressed cell colony formation in MKN-1 cells. [score:5]
Inhibition of miR-149-3p suppressed (G) cell apoptosis, (H) G0/G1 arrest, and (I) stimulated cell colony formation in MKN-1 cells. [score:5]
Additionally, the miRNA miR-149-3p was significantly upregulated by GRA in a dose- and time -dependent manner. [score:4]
Wnt-1 is a direct target gene of miR-149-3p. [score:4]
miR-149-3p was frequently downregulated in human gastric cancer and negatively associated with the presence of lymph node metastasis. [score:4]
Among these miRNAs, miR-149-3p was upregulated the most by 3.84-fold (P < 0.001) (Figure 4B). [score:4]
These results revealed that Wnt-1 was a direct target gene of miR-149-3p. [score:4]
miR-149-3p was upregulated by GRA administration in a dose- and time -dependent manner. [score:4]
In our study, GRA administration upregulated miR-149-3p (Figure 4B). [score:4]
Eight μg pGL3-miR-149-3p/miR-CK or 200 nM miR-149-3p inhibitor/miR-NC were transfected using Lipofectamine 2000 (1:2, Invitrogen, Carlsbad, USA). [score:3]
Next, we used MKN-1 and BGC-823 cells to monitor the impact of ectopic overexpression of miR-149-3p on cell cycle, apoptosis and reproducibility. [score:3]
Additionally, miR-149-3p was highly expressed in the normal epithelial cell line GES-1, while its levels were reduced in various gastric tumor cell lines, such as AGS, BGC-823, MGC-803 and MKN-1 (P < 0.001, Figure 4E). [score:3]
This suggests that the interaction between the 3′-UTR of Wnt-1 and low-levels of endogenous miR-149-3p was weak and therefore decreased miR-149-3p expression did not increase luciferase activity from the reporter vector. [score:3]
The correlation analysis of miR-149-3p expression with (I) differentiated grade of tumor, (J) T stage, (K) N stage, (L) M stage, and (M) pTNM stages. [score:3]
Our analyses showed that miR-149-3p functions as a tumor suppressor in GC (Figure 5). [score:3]
The relationship between clinical parameters and miR-149 expression (mean ± SD) in gastric adenocarcinoma. [score:3]
miR-149-3p induced cell apoptosis and suppressed cell cycle progression. [score:3]
Indeed, miR-149-3p expression correlated negatively correlated with lymphonode metastasis (P = 0.02, Figure 4K), in agreement with other reports [32, 33]. [score:3]
MiR-149-3p directly targets the 3′-UTR of Wnt-1 mRNA. [score:3]
The gastric tumor cell lines MKN-1 and BGC-823 were planted in 24-well plates with 4 × 10 [5] cells per well, and transfected with 8 μg miR-149-3p/miR-CK or 200 nM miR-149-3p inhibitor/miR-NC. [score:3]
HEK-293T cells were cotransfected with pGL3-miR-149-3p or miR-149-3p inhibitor and pmirGLO-Wnt-1-WT/Mut using Lipofectamine2000 (Invitrogen) in a 24-well plate. [score:3]
miR-149-3p suppressed GC cell proliferation and cell cycle progression in vitro. [score:3]
To address the clinical impact of miR-149-3p expression in gastric cancer, we used qRT-PCR to analyze 11 cases of GC tissues and paired control tissues collected in our hospital. [score:3]
However, the tumor suppressor role of miR-149-3p was firstly identified in our study. [score:3]
To further ascertain miR-149-3p expression in human gastric cancer, stomach adenocarcinoma (STAD) and normal samples deposited in the TCGA database (n = 432) were analyzed. [score:3]
Previous studies have shown that miR-149 inhibited cell proliferation, progression, migration, invasion and metastasis [32– 34]. [score:3]
To find potential target genes of miR-149-3p in the COX-2 and the canonical Wnt pathways, we used miRDB software (http://www. [score:3]
In addition, the human miR-149-3p inhibitor and a negative control (miR-NC) were designed and provided by Ribobio (Guangzhou, Guangdong, China). [score:3]
After exposure to GRA (0, 100, and 150 μM) or transfection with 8 μg miR-149-3p/miR-CK or 200 nM miR-149-3p inhibitor/miR-NC for 24 h (n = 3), MKN-1 and BGC-823 cells were collected and stained with PI in the dark. [score:3]
Other genes such as PPM1F, GIT1, Rap1a, Rap1b, IL-6 and EP2 have been previously identified as miR-149 targets [33– 6]. [score:3]
Results from our analyses showed that miR-149-3p overexpression induced apoptosis, increased the numbers of cells in G0/G1 phase and G2/M phase while decreasing those in S phase, and led to smaller and fewer colonies compared to miR-CK cells (P < 0.01) both in MKN-1 (Figure 5A–5C) and BGC-823 (Figure 5D–5F). [score:2]
In contrast, transfection with miR-149-3p inhibitors led to decreased apoptosis compared to the miR-NC group, fewer cells in G0/G1 and G2/M arrest, and higher cell reproducibility (P < 0.01) in both MKN-1 (Figure 5G–5I) and BGC-823 (Figure 5J–5L) cells. [score:2]
The pGL3-miR-149-3p and pmirGLO-Wnt1-WT vectors were cotransfected into HEK293T cells, and luciferase assays showed that overexpression of miR-149-3p decreased the activity of Wnt-1 3′-UTR luciferase (P = 0.01, Figure 6B). [score:2]
To verify this result, we constructed another plasmid pmirGLO-Wnt1-Mut containing a mutation in the miR-149-3p binding sites. [score:2]
The ability of gastric tumor cells to divide unlimitedly after transfection with miR-149-3p or miR-149-3p inhibitor was tested using colony formation assay as previously described [47]. [score:2]
The miR-149-3p sequence is highly conserved in Mus musculus and Homo sapiens. [score:1]
MKN-1 and BGC-823 cells were seeded in 6-cm plates, and treated with serial dilutions of GRA (0, 100, and 150 μM) (n = 3) for 24 h. In addition, MKN-1 and BGC-823 cells were seeded in 24-well plates, and were transfected with 8 μg miR-149-3p/miR-CK or 200 nM miR-149-3p inhibitor/miR-NC for 24 h. Apoptotic and necrotic cells were evaluated by Annexin V (AV) binding and 7-AAD or PI uptake (BD Bioscience, Bedford, MA, USA). [score:1]
In addition, the protein level of Wnt-1 in MKN-1 cells decreased after pGL3-miR-149-3p transfection (Figure 6D). [score:1]
The hsa-miR-149-3p was cloned and constructed into a pGL3 vector to create a pGL3-miR-149-3p plasmid, and a blank plasmid was used as the control (miR-CK). [score:1]
Of note, pre-miR-149 transcripts exist in two different forms, 1) miR-149 transcribed from the 5′-end, and 2) miR-149-3p, which is transcribed from the 3′-end. [score:1]
The miR-149-3p level was 34.74 ± 25.70 in normal tissue (n = 42) and 22.19 ± 38.05 in STAD (n = 390) (Figure 4D). [score:1]
Results from our analyses showed that low levels of miR-149-3p correlated positively with the presence of lymphonode metastasis (P = 0.01, Figure 4K). [score:1]
Hereby, we constructed pmirGLO vectors containing the binding sites of miR-149-3p in 3′-UTR of Wnt-1 and pGL3 vector containing miR-149-3p sequence independently. [score:1]
Hsa-miR-149-3p was cloned and constructed into pGL3 vector to create pGL3-miR-149-3p. [score:1]
[1 to 20 of 61 sentences]
2
[+] score: 212
Our study demonstrated that miR-149-3p directly targets and negatively regulates Prdm16 and that inhibition of miR-149-3p promotes the differentiation of precursors from subcutaneous to beige cells, thereby leading to increased mitochondrial activity (Figs 4 and 5). [score:7]
Using two computational algorithms TargetScan and miRanda, miR-149-3p, which has a conserved target site with the seed sequence in the 3′UTR of the Prdm16 mRNA, was selected for further experimental verification. [score:5]
However, in PRDM16 -depleted cells, overexpression of miR-149-3p failed to induce visceral-selective inflammatory gene expression (Fig. 6c-i). [score:5]
Overexpression of miR-149-3p induces visceral-selective gene expression in differentiated inguinal adipocytes. [score:5]
Three weeks post-infection, lentivirus -driven expression of anti-miR-149-3p in mice efficiently decreased miR-149-3p expression in ingWAT (Fig. 7a; Supplementary Fig. 7e). [score:5]
Although the visceral-selective genes were repressed by miR-149-3p inhibition in ingWAT, the expression levels of the general adipogenic markers aP2 and AdipoQ were not affected (Fig. 7g,h). [score:5]
Next, overexpression of miR-149-3p by lentivirus efficiently reduced the PRDM16 protein level in the ingWAT of mice, although only a downward trend in Prdm16 mRNA expression was observed (Fig. 8a-c; Supplementary Fig. 7g). [score:5]
The ingWAT of mice overexpressing miR-149-3p showed reduced UCP1 [+] adipocytes along with reduced expression of a broad panel of thermogenic genes, including BAT-selective and mitochondrial genes (Fig. 8d-f). [score:5]
Given that miR-149-3p overexpression appeared to ‘visceralize' ingWAT at the molecular level, we assessed the physiological effects of this overexpression. [score:5]
Control animals showed a marked increase in O [2] consumption following NE injection; however, overexpression of miR-149-3p in ingWAT blunted this NE -induced elevation, suggesting that this ingWAT-specific overexpression of miR-149-3p can affect whole-body energy expenditure (Fig. 8q). [score:5]
Conversely, inhibition of miR-149-3p decreased the mRNA level of the visceral-selective marker Wt1 in adipocytes, and it subsequently suppressed IL-6 and Resistin, two representative WAT-selective secreted proteins in culture medium (Fig. 5h–j). [score:5]
miR-149-3p was significantly downregulated during differentiation (Fig. 5a). [score:4]
Prdm16 is directly targeted by miR-149-3p. [score:4]
miR-149-3p directly targeting PRDM16 in subcutaneous ingWAT. [score:4]
These data suggest that PRDM16 is a direct target of miR-149-3p in subcutaneous ingWAT. [score:4]
Here, we demonstrated that subcutaneous inhibition by anti-miR-149-3p-activated beige cell development in ingWAT and subsequently increased whole-body energy expenditure without causing dysfunction in other tissues, which might be a potential strategy to counteract obesity (Fig. 7). [score:4]
Moreover, increased lipogenesis and decreased lipolysis were observed in cells overexpressing miR-149-3p (Fig. 6m). [score:3]
Because miR-149-3p is also expressed in visceral epiWAT, to examine whether miR-149-3p plays a role in visceral fat cells, we isolated SV cells from the epiWAT of mice and performed the same set of experiments. [score:3]
The broad sets of genes (BAT-selective, mitochondrial oxidation and beige-signature genes) associated with the thermogenic programme were also markedly increased by miR-149-3p inhibition, especially the beige-signature genes (Fig. 7f). [score:3]
Adenoviral vectors expressing a control scrambled sequence or Prdm16 shRNA (sh-Prdm16) were used to infect sub-confluent cultured SV cells from ingWAT, and these cells were transfected with miR-149-3p mimic when induced to undergo adipogenesis 2 days after adenovirus transduction. [score:3]
Although the overexpression of miR-149-3p in ingWAT resulted in a slight increase in visceral WAT, no significant alteration in whole-body weight was observed (Fig. 8o,p). [score:3]
Furthermore, inhibition of miR-149-3p resulted in slightly decreased lipogenesis and markedly increased lipolysis, along with induced O [2] consumption, suggesting that loss of miR-149-3p elevated energy expenditure in the ingWAT of mice (Fig. 7i,j). [score:3]
However, inhibition of miR-149-3p did not alter the thermogenic programme, lipogenesis/lipolysis or mitochondrial respiration of epididymal adipocytes, suggesting that miR-149-3p might have tissue specific roles (Fig. 5q; Supplementary Fig. 5d–o). [score:3]
Ectopic miR-149-3p expression did not influence the adipocyte differentiation per se (Fig. 6j–l; Supplementary Fig. 6d). [score:3]
Importantly, overexpression of miR-149-3p led to a marked reduction in mitochondrial respiration, indicating a functional change in the differentiated inguinal adipocytes (Fig. 6n,o). [score:3]
The induction of PRDM16 protein was highly correlated with browning effects, as determined by the induction of UCP1 expression in the ingWAT of miR-149-3p -depleted mice (Fig. 7d,e). [score:3]
However, neither of these alterations were observed in epididymal adipocytes overexpressing miR-149-3p (Supplementary Fig. 6f–n). [score:3]
These results suggest that inhibition of miR-149-3p stimulates the thermogenic programme of ingWAT, leading to increased energy expenditure in mice. [score:3]
In our animal mo del, the level of PRDM16 protein in ingWAT was robustly enhanced by miR-149-3p inhibition. [score:3]
Inhibition of miR-149-3p stimulates Ing adipocytes browning. [score:3]
The expression levels of three genes common to both white and brown fat cells, Pparγ, aP2 and AdipoQ, were similar in the presence or absence of miR-149-3p (Fig. 5k-m). [score:3]
Of note, neither cold nor fasting markedly changed the expression of miR-149-3p in BAT or visceral (-epi, -mes) WAT (Fig. 4b). [score:3]
After 2 days of differentiation, transfer of the miR-149-3p mimic resulted in a significant reduction of the PRDM16 protein level in control (scrambled) cells along with decreased Prdm16 mRNA expression (Fig. 4f,g; Supplementary Fig. 4f). [score:3]
Notably, miR-149-3p inhibition did not affect inguinal adipocyte differentiation per se (Supplementary Fig. 5c). [score:3]
Importantly, inhibition of miR-149-3p in ingWAT increased O [2] consumption and decreased RER, indicating a substantial elevation of fat -based fuel (Fig. 7m,n). [score:3]
How to cite this article: Ding, H, et al. Fasting induces a subcutaneous-to-visceral fat switch mediated by microRNA-149-3p and suppression of PRDM16. [score:3]
A higher oxygen consumption rate (OCR) from proton leakage and an increase in the maximal respiratory capacity were observed in adipocytes after miR-149-3p inhibition (Fig. 5o,p). [score:3]
Moreover, at day six of differentiation, the mRNA levels of the fatty acid synthesis-related genes Lpl, Fas and Glut4 were significantly repressed, whereas Cpt1a, Acox1 and Acsl1, three genes involved in fatty acid oxidation, were markedly increased by miR-149-3p inhibition (Fig. 5n). [score:3]
However, when mice were exposed to cold, fasting failed to induce miR-149-3p expression in ingWAT, and it subsequently led to a relatively stable level of PRDM16 protein (Supplementary Fig. 4a,b). [score:3]
Quantitative real-time PCR analysis was used to verify miRNA-149-3p expression. [score:3]
Inhibition of miR-149-3p induces thermogenesis in differentiated inguinal adipocytes. [score:3]
At 24 h after plating, 0.2 μg of firefly luciferase reporter plasmid, 0.2 μg of β-galactosidase (cat# 10586-014) expression vector (Ambion, Carlsbad, CA, USA), and equal amounts (20 pmol) of miR-149-3p mimic or scrambled negative control RNA were transfected into cells with Lipofectamine 2000 (cat# 11668-019) (Invitrogen, Carlsbad, CA, USA) according to manufacturer's instructions. [score:3]
Conversely, inhibition of the miRNA using an anti-miR-149-3p oligonucleotide markedly increased the protein level of PRDM16 in control cells. [score:3]
However, mice overexpressing miR-149-3p exhibited a markedly increased RER, suggesting a decrease in the utilization of fatty acid oxidation as an energy substrate (Fig. 8j–n). [score:3]
Subcutaneous overexpression of miR-149-3p induces a visceral-like phenotype in mouse inguinal adipose. [score:3]
ingWAT inhibition of miR-149-3p increases mice thermogenesis. [score:3]
Inhibition of miR-149-3p markedly increased the set of brown-selective genes Cox7a, Cox8b, Cidea and Evovl6. [score:3]
Subcutaneous inhibition of miR-149-3p induced browning of ingWAT in mice. [score:3]
Although adipogenesis per se (aP2 and AdipoQ) was not affected by ectopic miR-149-3p expression, the sets of classic WAT and visceral-selective genes were significantly increased (Fig. 8g). [score:3]
Subcutaneous WAT links energy balance through miR-149-3p -mediated regulation of Prdm16. [score:2]
miR-149-3p inhibition also caused significant increases in PGC-1α and UCP1 protein levels compared with controls (Fig. 5c; Supplementary Fig. 5b). [score:2]
Because myomiR-133 has been reported to regulate brown fat differentiation through Prdm16, we focused on the role of the newly identified candidate miR-149-3p in the following study. [score:2]
The inhibition of miR-149-3p increased the protein level of PRDM16 approximately sixfold at day six of differentiation, compared with an approximately threefold increase in cells treated with scrambled anti-miR. [score:2]
Quantitative RT–PCR (PCR with reverse transcription) assays verified that cold exposure significantly decreased miR-149-3p expression, whereas fasting resulted in a marked increase in miR-149-3p in both male and female mice. [score:2]
During differentiation, overexpression of miR-149-3p decreased the protein levels of PRDM16, PGC-1α and UCP1 compared with controls, in addition to repressing the brown fat-selective genes Cox7a and Cox8b (Fig. 6b; Supplementary Fig. 6a–c). [score:2]
In contrast, miR-149-3p overexpression markedly increased the visceral-selective genes, Wt1, Bnc1 Raldh2, Agt and Saa3, in differentiated cells, as well as the secreted proteins IL-6 and Resistin in cultured medium, compared with cells transfected with control-miR. [score:2]
As shown in Fig. 4j, because miR-149-3p has rarely been reported, we also measured its expression level in different mouse tissues. [score:1]
miR-149-3p causes partial visceralization of ingWAT in mice. [score:1]
After fasting for 24 h, subcutaneous ingWAT takes on many of the morphological and molecular characteristics of visceral fat to preserve energy via miR-149-3p -mediated suppression of PRDM16. [score:1]
However, in PRDM16 -deficient cells, these genes were not altered in the absence of miR-149-3p, suggesting that miR-149-3p acts through PRDM16 (Fig. 5d–g). [score:1]
However, neither of these alterations was observed in miR-149-3p -depleted epididymal adipocytes, suggesting that miR-149-3p might have tissue-specific roles. [score:1]
miR-149-3p induces Ing adipocytes visceral differentiation. [score:1]
Therefore, overexpression of miR-149-3p caused an impaired thermogenic programme along with the acquisition of partial visceral-selective characteristics during the course of inguinal adipocyte differentiation. [score:1]
We next performed luciferase assays to investigate the direct targeting of the Prdm16 3′-UTR by miR-149-3p. [score:1]
Mouse miR-149-3p mimic and miR-149-4p antisense were packaged into lentiviruses by GenePharma. [score:1]
To identify whether miR-149-3p alters the function of subcutaneous adipocytes, we isolated SV cells from the ingWAT of mice and induced their differentiation into beige adipocytes (Supplementary Fig. 5a). [score:1]
By contrast, 24-h cold exposure decreased miR-149-3p and led to increased PRDM16 protein levels and adaptive thermogenesis in ingWAT. [score:1]
The decreased visceral WAT appeared to account for the slight body decrease in weight in anti-miR-149-3p treated mice (Fig. 7o–q). [score:1]
To further investigate the functions of miR-149-3p in inguinal adipocytes, we overexpressed miR-149-3p in inguinal preadipocytes (Fig. 6a). [score:1]
Although Prdm16 mRNA was unchanged, the loss of miR-149-3p robustly elevated the level of PRDM16 protein in ingWAT (Fig. 7b,c; Supplementary Fig. 7f). [score:1]
In addition to increasing lipogenesis, ectopic miR-149-3p expression significantly reduced O [2] consumption in ingWAT, suggesting visceral functional characteristics (Fig. 8h,i). [score:1]
The mRNA level of Prdm16 was largely unchanged in cells transfected with the anti-miR-149-3p, although a trend towards elevation was observed (Fig. 4h,i; Supplementary Fig. 4g). [score:1]
Plasmids carrying the Renila luciferase gene linked to a fragment of the Prdm16 3′UTR harbouring miR-149-3p putative binding sites were co -transfected into HEK293T cells (Human Embryonic Kidney, purchased from the Type Culture Collection of the Chinese Academy of Sciences, Shanghai, China, authenticated by STR Profiling, no mycoplasma contamination) along with control miRNA or miR-149-3p mimic (Genepharm, Suzhou, China). [score:1]
Considering striking effect of miR-149-3p deficiency in ingWAT, the mice were subjected to metabolic analysis. [score:1]
However, because the levels of PRDM16 mRNA and protein were both very efficiently decreased (greater than 75% reduction) by the sh-Prdm16 vectors in adipocytes, transfection with neither the miR-149-3p mimic nor the anti-miR-149-3p oligonucleotide significantly altered the PRDM16 protein level (Fig. 4g,i). [score:1]
Human embryonic kidney 293 T (HEK293T) cells transfected with reporter plasmids containing the Prdm16 3′-UTR showed markedly decreased luciferase activity in the presence of ectopic miR-149-3p. [score:1]
A mutant 3′-UTR of Prdm16 was constructed by mutagenesis of miR-149-3p from AGGGAGG into GGAGGGA. [score:1]
As expected, although the NE treatment increased O [2] consumption in control mice, the energy expenditure induction was significantly enhanced in miR-149-3p -depleted mice (Fig. 7r). [score:1]
[1 to 20 of 78 sentences]
3
[+] score: 198
Other miRNAs from this paper: mmu-mir-155, mmu-mir-122
In the current work, our results from Figures 3, 4 and 5 show that miR-149* regulated different STAT3 target gene sets in the different conditions, which may be due to the possibility that the suppression of miRNA-149* on STAT3 target gene expression are in a condition -dependent manner. [score:10]
It was found that S3I-201 enhanced the inhibition of miR-149* on some proinflammatory gene expression induced by LPS (Supplementary Figure 1) Figure 6(A) miR-149* suppressed STAT3-meidated target genes induced by LPS. [score:9]
It was found that S3I-201 enhanced the inhibition of miR-149* on some proinflammatory gene expression induced by LPS (Supplementary Figure 1) Figure 6(A) miR-149* suppressed STAT3-meidated target genes induced by LPS. [score:9]
We found that miR-149* mimics suppressed LPS -induced expression of C3, MMP2 and SOCS3 mediated by STAT3 (Figure 6A), suggesting that miR-149* suppressed inflammation response possibly through antagonizing STAT3 cell signaling. [score:7]
Ding et al. reported that miR-149* directly targets and negatively regulates Prdm16 and that inhibition of miR-149-3p stimulates the thermogenic programme of subcutaneous inguinal WAT, leading to increased energy expenditure in mice [16]. [score:7]
We noted that miR-149* suppressed specific sets of STAT3 target genes, but not all the target genes, with or without LPS treatment. [score:7]
We noticed that miR-149* mimics suppressed STAT3-meidated gene expression from the above results in vitro and in vivo. [score:5]
These findings indicate that miR-149* is a potential therapeutic target for treatment of inflammation, and its mimic or agomir offers possible therapies for preventing and treating inflammatory -associated liver diseases. [score:5]
It was found that the gene expression of c-Jun and JunB was downregulated in miR-149* [−/−] mouse liver compared with the WT group (Supplementary Figure 2), which was different from the report of Fan et al. [31]. [score:5]
Figure 2miR-149* [−/−] mouse hepatic tissue display increased expression of proinflammatory genesQuantitative real-time PCR analysis of the expression of proinflammatory genes in livers from 8-week-old wild-type (WT) or miR-149* [−/−] (KO) mice (n = 5). [score:5]
miR-149* suppressed inflammatory gene expression induced by LPS in mouse liver. [score:5]
Moreover, we found these genes are the target genes of STAT3, which indicates that miR-149* may be a regulator of STAT3 signaling pathway. [score:4]
There is no report about miR-149* in liver inflammation response except that El-Guendy et al. demonstrated that miR-149* is upregulated in hepatitis C virus-infected Egyptian patients [33]. [score:4]
Thus, miR-149* may be a potential therapeutic target for treatment of inflammation. [score:3]
The agomir of miR-149* reduced LPS -induced the expression of ICAM-1, IL-2, MMP9 and TNF-α (Figure 4). [score:3]
Quantitative real-time PCR analysis of the expression of proinflammatory genes in livers from 8-week-old wild-type (WT) or miR-149* [−/−] (KO) mice (n = 5). [score:3]
However, Lin et al. found that miR-149* induces apoptosis by inhibiting Akt1 and E2F1 in human cancer cells [32]. [score:3]
In this article, using miR-149* knockout mice generated by CRISPR/CAS9 technique and cell culture system, we identify miR-149* as a negative regulator of inflammatory response. [score:3]
Our results reveal the suppression function of miR-149* in inflammation in vitro and in vivo, suggesting that miR-149* may be a potential protector in liver inflammation. [score:3]
There are a few reports about the functions of miR-149* in different diseases. [score:3]
miR-149* suppressed STAT3 cell signaling pathway. [score:3]
We found that miR-149* mimics in HepG2 cells inhibited STAT3 phosphorylation induced by IL-6 by about 28% (Figure 6D, 6E). [score:3]
miRNA-149 (miR-149) became a focus in some studies because of its essential functions in suppressing cancer cell proliferation and migration and inflammatory response, while there are few reports about the functions of miRNA-149* in physiological condition except for the reports of Ding et al. and Jin et al. [14, 16]. [score:3]
IL-6 increased STAT3 transcactivity obviously (Figure 6G) and miR-149* mimics suppressed STAT3 activity induced by IL-6 (Figure 6G). [score:3]
miRNA-149* may also serve as an oncogenic regulator in T-ALL by negatively regulating JunB [31]. [score:3]
To generate a miR-149* -null allele, one single guide RNAs (sgRNA) targeting miR-149* of the mouse gene (Figure 1A) was co -injected with Cas9 mRNA into the cytoplasm of fertilized eggs with well recognized pronuclei in M2 medium (Sigma). [score:3]
miR-149* [−/−] mouse hepatic tissue display increased expression of proinflammatory genes. [score:3]
Generation of miR-149* [−/−] mice by CRISPR/Cas9 systemTo generate a miR-149* -null allele, one single guide RNAs (sgRNA) targeting miR-149* of the mouse gene (Figure 1A) was co -injected with Cas9 mRNA into the cytoplasm of fertilized eggs with well recognized pronuclei in M2 medium (Sigma). [score:3]
miR-149* [−/−] mouse hepatic tissue display increased expression of proinflammatory genesIn order to investigate the function of miR-149* in inflammatory response, we determined the expression of proinflammatory genes in WT and miR-149* [−/−] mouse liver. [score:3]
MiR-149* mimics suppressed STAT3 activity induced by LPS by about 24% (Figure 6F). [score:2]
miR-149* regulates liver cell inflammatory response in HepG2 cells. [score:2]
Compared with the mRNA levels of proinflammatory genes in control group, miR-149* mimics resulted in the decrease of mRNA levels of MCP-1, IL-6, MMP12, TGFβ and IP-10 (Figure 5), which suggests that miR-149* suppresses liver cell inflammatory response in vitro. [score:2]
One possibility is that miR-149* may affect IL-6, an upstream regulator of STAT3. [score:2]
DNA sequencing confirmed that the same miR-149* mutation was present in the F1 mice, thereby suggesting that this mutated miR-149* allele is heritable. [score:2]
Cleavage bands indicate the presence of mutations in the miR-149* gene in F0 mice. [score:2]
After T7EI digestion, 5 out of 12 pups were identified as F0 founders, bearing mutations in the miR-149* (Figure 1B). [score:2]
Among these, the 19 base pairs of miR-149* DNA was deleted in the mutation in founder #6 (Figure 1C). [score:2]
Jin et al. reported that miR-149*, as a p53-responsive microRNA, functions as an oncogenic regulator in human melanoma [14]. [score:2]
miR-149* regulates liver inflammatory response in vivo and in vitro. [score:2]
We compared proinflammatory gene expression in livers between miR-149* [−/−] and WT mice after LPS administration. [score:2]
It suggests that miR-149* regulates JUN signaling in a specific tissue- or cell-type -dependent manner. [score:2]
Moreover, we show that the regulation of miR-149* on inflammatory response is associated with deactivation of STAT3 cell signaling. [score:2]
MiR-149* mimics suppressed the phosphorylation of STAT3 and STAT3 transactivity in HepG2 cells. [score:2]
We next transfected HepG2 cells with a STAT3 reporter plasmid and the control plasmid to assess the effects of the miR-149* mimics on the STAT3 reporter activity. [score:1]
WT mice were injected in the tail vein with miR-149* agomir or negative control agomir. [score:1]
In the current work, our results shown that miRNA149* has anti-inflammatory properties in the mouse liver at least partially through antagonizing STAT3 cell signaling. [score:1]
HepG2 cells were cotransfected with miR-149* mimic or control mimic (Scr-miR), the STAT3 reporter plasmid and phRL-TK. [score:1]
Furthermore, we investigated the role of overexpression of miR-149* mimics in HepG2 cells. [score:1]
Figure 1(A) Schematic of the mouse miR-149* sequence (mmu-miR-149*) and the binding sites of the sgRNA. [score:1]
The results indicate that certain inflammatory genes in the deficiency of miR-149* in mouse liver are more sensitive to LPS induction. [score:1]
We bred founder #6 with WT mice for at least two generations, and miR-149*+ /− mice were then bred to homozygotes. [score:1]
HepG2 cells were transfected with miR-149* mimics or control mimics (Scr-miR). [score:1]
The function of miR-149* in inflammatory response are still not known. [score:1]
Generation of miR-149* [−/−] mice by CRISPR/Cas9 system. [score:1]
In conclusion, our work shows that miR-149* is a repressor of STAT3 -mediated hepatic inflammation. [score:1]
Con, negative control mimics; miR-149-3p, miR-149* mimics. [score:1]
8-week-old WT and miR-149* [−/−] (KO) mice were treated with LPS (10mg/Kg body weight) for 16 hours. [score:1]
The results reveal that miR-149* [−/−] mice are more sensitive to LPS -induced liver injury. [score:1]
The following day, cells were transfected with miR-149* mimics (25nM) or negative control mimics using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). [score:1]
After LPS treatment, AST levels in miR-149* [−/−] mice were higher than that in WT mice. [score:1]
LPS administration increased the numbers of Ki67 -positive cells with 0.8 folds and 1.1 folds in WT and miR-149* [−/−] mouse livers, respectively. [score:1]
In order to test whether miR-149* is an inhibitor of inflammation, we investigated the levels of aspartate aminotransferase (AST), a marker of liver damage, after LPS treatment. [score:1]
The deficiency of miR-149* in mouse liver is more sensitive to LPS -induced liver injury. [score:1]
The deficiency of miR-149* in mouse liver is more sensitive to LPS -induced inflammation and injury. [score:1]
It indicates that miR-149* may be a repressor of STAT3 pathway. [score:1]
The mice were given a tail vein injection with miR-149* agomir (40 nmol/20 g body weight) or miRNA negative control (Ribo-bio, Guangzhou, China). [score:1]
Figure 38-week-old WT and miR-149* [−/−] (KO) mice were treated with LPS (10mg/Kg body weight) for 16 hours. [score:1]
The mRNA levels of C3, IL-6, IL-4 and iNOS induced by LPS was greater in miR-149* [−/−] mice than that in WT mice (Figure 3D). [score:1]
For other mouse experiments, eight-week-old wild-type (WT) (C57BL/6J) and miR-149* [−/−] female mice (on C57BL/6J background) were maintained in a pathogen-free animal facility under a standard 12-hour light-dark cycle. [score:1]
The results indicate that miR-149* can antagonize STAT3 activity at the levels of gene transcription. [score:1]
Cells were transfected with miR-149* mimics (25 nM) or negative control mimics. [score:1]
Generation of miR-149* mutant mice by using the CRISPR/Cas9 system. [score:1]
Administration of miR-149* agomir. [score:1]
We observed that LPS increased 2-fold higher of STAT3 phosphorylation in miR-149* [−/−] livers than that in WT livers (Figure 6B, 6C). [score:1]
In order to investigate the function of miR-149* in inflammatory response, we determined the expression of proinflammatory genes in WT and miR-149* [−/−] mouse liver. [score:1]
It suggested that LPS increased Ki67 -positive cell number more significantly in miR-149* [−/−] mouse liver. [score:1]
Our current work shows that miR-149* is a potential repressor of STAT3-regualted inflammatory response through antagonizing STAT3 phosphorylation and its transactivity. [score:1]
We demonstrate that the deficiency of miR-149* in vivo are more sensitive to LPS -induced mouse liver inflammation and injury. [score:1]
LPS treatment significantly increased AST levels in miR-149* [−/−] mice but not in WT mice (Figure 3A). [score:1]
Cells were transfected with miR-149* mimics or control mimics (Scr-miR). [score:1]
Deficiency of miR-149* in liver is more sensitive LPS -induced STAT3 phosphorylation. [score:1]
Con, negative control agomir -treated group; miR-149*, miR-149* agomir -treated group; LPS, negative control agomir+LPS -treated group; LPS+miR-149*, LPS+miR-149* agomir -treated group. [score:1]
Thus, we investigated that whether miR-149* antagonized STAT3 -mediated target genes. [score:1]
[1 to 20 of 83 sentences]
4
[+] score: 138
As expected, NAC, an inhibitor of ROS, noticeably reversed miR-149 upregulation and ROS cumulation of BPIS -induced (Figure 5D and 5E), including BPIS -inhibited the expression of IL-1β, IL-6 and IL-10 in both RNA and protein level (Figure 5H and 5I). [score:10]
Furthermore, BPIS induced miR-149 up-regulation in HT-29 cells was attenuated by inclusion of ROS inhibitor NAC in the treatment step (Figure 5D) suggesting that ROS played an important role in BPIS induced miR-149 up-regulation. [score:9]
In addition, we found that miR-149 directly targeted the 3′-UTR of Akt to inhibit its downstream NF-κB activation, and then attenuated expression of pro-inflammatory molecules in LPS -induced HT-29 cells. [score:8]
Furthermore, we found that BPIS reduced Akt phosphorylation and subsequently activated the NF-κB-p65, while pretreatment with the miR-149 inhibitor attenuated BPIS -inhibited total Akt, Akt phosphorylation and NF-κB-p65 expression (Figure 4C). [score:7]
miR-149 directly inhibited Akt expression. [score:6]
Simultaneously, BPIS -upregulated IL-10 was reversed by miR-149 inhibitor (Figure 4D). [score:6]
Previous studies reported a downregulation of miR-149 in NSCLC cells, and the expression of miR-149 was inversely correlated with the EMT phenotype of NSCLC cells. [score:6]
miR-149 directly inhibits Akt expression. [score:6]
Further, miR-149 directly targeted the 3′-UTR of Akt to block NF-kB nuclear translocation, and then attenuated expression of pro-inflammatory factors (IL-1β, IL-8 and IL-6) in LPS -induced HT-29 cells. [score:6]
By contrast, miRNA-149 inhibitor increased miR-N. C -inhibited luciferase activity of the Akt1 3’-UTR construct (* p<0.05, ** p<0.01). [score:5]
Hence, the inhibitory action of BPIS on miR-149 expression in response to LPS stimulation is ROS dependent. [score:5]
Thus, we further investigated that miR-149 inhibitor significantly reversed the inhibited IL-1β and IL-6 expression by BPIS, through the mediation of Akt dephosphorylation in LPS-stimulated HT-29 cells. [score:5]
We co -transfected 50 ng of psiCHECK-2-Akt1 3’ -UTR plasmid and 20 μM of miRNA-149 inhibitor or miRNA-149 inhibitor N. C into HT-29 cells. [score:5]
Overall, this data provides experimental evidences that Akt is a direct target gene of miR-149. [score:4]
BPIS reduces upregulated miR-149 by ROS accumulation and exhibits anti-inflammatory activities. [score:4]
Subsequently, we identified that Akt is a target gene of miR-149 (Figure 4). [score:3]
The results showed that BPIS significantly (p<0.01) enhanced the intracellular ROS accumulation and miR-149 expression (Figure 5D and 5E). [score:3]
In conclusion, BPIS inhibits the initiation and progression of CRC by ameliorating the inflammatory microenvironment, and the presence of a signaling cascades of ROS / miR-149 / Akt / NF-κB axis for BPIS -mediated resistance to inflammation in LPS -induced HT-29 cells (Figure 7). [score:3]
Hence, miR-149 functioned as a tumor suppressor [41]. [score:3]
Figure 4 (A) Predicted miR-149 target sequence of the Akt 3’ -UTR used bioinformatics analysis. [score:3]
In addition, the expression of miR-149 was significantly increased in BPIS -treated tumor tissues. [score:3]
BPIS treatment promoted the ROS accumulation, and led to the increase of miR-149 expression. [score:3]
Next, miR-149 inhibitor, or a matched miRNA negative control (miR-N. C) (Genepharma, Shanghai, China) was added to the culture media. [score:3]
Therefore, we speculate that miR-149 may play a positive role in tumor suppression resulted from BPIS treatment in vitro and in vivo (Figure 4 and 6). [score:3]
These results implicate that Akt, a target gene of miR-149, is necessary for NF-κB -mediated inflammation. [score:3]
HT-29 cells seeded into 6-well plates at a density of 8×10 [4] per well, were co -transfected with 50 ng psiCheck-2 with insertion of the wild-type 3′-UTR of Akt1 or empty vector, along with miR-149 inhibitors or negative control (final concentration, 50 nM). [score:3]
Mechanistically, BPIS treatment of HT-29 cells promoted the ROS accumulation leading to the increase of miR-149 expression. [score:3]
However, more importantly we noticed considerable increased in the miR-149 expression level in BPIS -treated bare mice (Figure 6E). [score:3]
MiR-149 functions as a tumor suppressor in vivo [29, 30]. [score:2]
The results implied that miR-149 repressed luciferase activity with a luciferase reporter plasmid containing sites of the Akt 3′-UTR (Figure 4B). [score:1]
These results prove that BPIS activates the existence of an ROS/miRNA-149/anti-inflammation framework. [score:1]
DIANA Lab and miRanda algorithms identified one of the most relevant miRNAs: miR-149. [score:1]
The 3′-UTR of Akt containing miR-149 -binding sites was amplified and cloned into a psiCHECK2 vector to generate psiCHECK2-Akt. [score:1]
Akt1 3′-UTR is complementary to the “seed sequence” of miR-149 (Figure 4A). [score:1]
[1 to 20 of 34 sentences]
5
[+] score: 42
The majority of the targets for miR-155 and miR-146a are still unknown [15], [17]– [19], [21], [42]– [44], while the targets for miR-125a-3p/5p and miR-149 have not yet been explored. [score:5]
The Listeria -induced miRNA signature is composed of the well established in immune regulation miR-155 and mR-146a, as well as the newly detected miR-149 and the miR-125a-3p/5p duplex, all of which are predicted to target important immune-related genes. [score:4]
Interestingly, miR-125a-3p and miR-149 were also significantly up-regulated as early as 3 h pi (Figure 1B and 1E). [score:4]
Strikingly, quantitative analyses of miR-155, miR-146a, miR-125a-3p, miR-125a-5p and miR-149 revealed that all five miRNAs were significantly upregulated by the vacuole-contained bacteria at both timepoints (Figure 1A–E). [score:4]
Additionally, two recently described miRNAs with unknown function in infected macrophages, namely miR-125a-3p and miR-125a-5p, and a newly described miRNA, namely miR-149, were significantly up-regulated in Listeria-infected BMDMs. [score:4]
Specifically, infection induced significant upregulation of 13 miRNAs, including miR-155, miR-146a, miR-125a-3p/5p and miR-149. [score:4]
Our data shows that miR-155, miR-125a-3p, miR-146a and miR-149 response is MyD88 -dependent upon Δhly-Lm infection, suggesting that these miRNAs are among the early-response genes expressed in macrophages upon phagosomal detection of Listeria PAMPs. [score:3]
These data also provide the first evidence on miR-149 and miR-125a-3p regulation by MyD88. [score:2]
We have identified miR-155, miR-146a, miR-125a-3p/5p and miR-149 as highly responsive elements of the vacuolar host response, differentially regulated by inflammatory mediators in macrophages. [score:2]
Interestingly, expression of miR-155, miR-125a-3p, miR-146a and miR-149 was significantly reduced in MyD88 [−/−] compared to WT BMDMs upon infection with Δhly- Lm (Figure 1A–C and 1E, respectively). [score:2]
We found that miR-155, miR-146a, miR-125a-3p/5p and miR-149 were amongst the most significantly regulated miRNAs in infected macrophages. [score:2]
Bone marrow derived macrophages (BMDMs) from wild type (WT; n = 4) and MyD88 [−/−] (n = 4) mice were infected (MOI 10) with L. monocytogenes (Lm) and the LLO -deficient mutant Δhly (Lm Δhly) for 3 h and 6 h. Total RNA was extracted and the expression levels of miR-155 (A), miR-146a (B), miR-125a-3p (C), miR-125a-5p (D) and miR-149 (E) were quantified by RT-qPCR using TaqMan miRNA assays. [score:2]
MiR-149 has not been characterised before in macrophages upon TLR activation, while miR-125a-3p/5p were only recently reported to be upregulated upon LPS treatment or heat-killed C. albicans infection, in monocytes [39] and macrophages [23], respectively. [score:2]
At 6 h pi miR-146a, miR-125a-5p and miR-149 were significantly induced by 1.5–2.0 folds (Figure 1C–E). [score:1]
To validate our array data, we performed quantitative RT-PCR and confirmed that miR-155, miR-146a, miR-125a-3p/5p and miR-149 were significantly increased in macrophages upon early sensing of live bacteria, suggesting that these miRNA genes may be implicated in the inflammatory immune response. [score:1]
[1 to 20 of 15 sentences]
6
[+] score: 38
This network reveals five putative direct targets: CACNA1C (Calcium channel) target of miR-149-5p; GJA5 (Gap Junction protein, alpha 5), RNF207 (Ring finger protein 207) and KCNA1 (potassium voltage-gated channel shaker-related subfamily, member 1) targets of miR-145-5p; KCNA1 which is also a miR-21-5p target; and finally, SLC18A2 (Solute carrier family 18 member 2) target of miR-142-5p. [score:12]
Fig 7A shows CACAN1C upregulated at 45 dpi while miR-149-5p is downregulated, both compared to their controls. [score:6]
Ingenuity Pathway Analysis (IPA) software was used to identify molecular networks and targets of the miRNAs miR-146b, miR-21, miR-142-3p miR-142-5p, miR-145 and miR-149, which were differentially expressed in all three time points post infection and were significantly correlated both with changes in parasitemia and QTc interval. [score:5]
As observed, four out of those six miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p), directly or indirectly regulate several genes involved with QTc interval length. [score:4]
The alterations occurring in the host microRNA profile observed here reflect the role of these molecules in the acute phase of the infection and may highlight important aspects of the pathogenesis, opening a broad range of possibilities in the study of Chagas disease S1 Fig In silico analysis done using the IPA software (Ingenuity Systems, USA) showing a biological network built with four miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p). [score:3]
This gene was highly predicted as a miR-149-5p target presenting two seed sequences. [score:3]
Individual mature miRNAs and their respective putative gene targets: A) miR-149-5p and CACAN1C B) miR-21-5p, miR-145-5p and KCNA1 C) miR-145-5p and KCNA1, GJA5, RNF207 and D) miR-142-5p and SLC18A2 were measured by real time RT-PCR in each time point post infection (15, 30 and 45) in four animals per group. [score:1]
In silico analysis done using the IPA software (Qiagen, USA) showing a biological network built with 4 miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p) from the 6 (miR-146b, miR-21-5p, miR-142-3p, miR-142-5p, miR-145-5p and miR-149) uploaded for the analysis. [score:1]
In addition, six (out of nine) microRNAs were significantly correlated with changes in both parasitemia and QTc interval: miR-146b, miR-21, miR-142-3p miR-142-5p (positive correlation) and miR-145-5p and miR-149-5p (negative correlation) (Fig 5). [score:1]
0003828.g006 Fig 6 In silico analysis done using the IPA software (Qiagen, USA) showing a biological network built with 4 miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p) from the 6 (miR-146b, miR-21-5p, miR-142-3p, miR-142-5p, miR-145-5p and miR-149) uploaded for the analysis. [score:1]
In silico analysis done using the IPA software (Ingenuity Systems, USA) showing a biological network built with four miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p). [score:1]
[1 to 20 of 11 sentences]
7
[+] score: 13
A previous study indicated that miR-149-5p regulates the expression of the pro-apoptotic Bcl-2 proteins DP5 and PUMA, which induce human β-cell apoptosis [29]. [score:4]
The five highest-ranking miRNA candidates that are binding targets of each circRNA were identified as: 1) For mmu_circRNA_40001:mmu-miR-466f, mmu-miR-466i-5p, mmu-miR-669n, mmu-miR-1187, and mmu-miR-466c-5p; 2) For mmu_circRNA_013120: mmu-miR-6541, mmu-miR-669c-3p, mmu-miR-466f-5p, mmu-miR-669m-5p, and mmu-miR-466j; and 3) For mmu_circRNA_40806: mmu-miR-7038-3p, mmu-miR-20a-3p, mmu-miR-145a-3p, mmu-miR-346-3p, and mmu-miR-149-5p. [score:3]
For example, among the observed circRNA/miRNA interactions, the potential miRNA targets of mmu_circRNA_40806 include miR-149-5p, mmu-miR-346-3p, and mmu-miR-20a-3p. [score:3]
In addition, another study found that miR-149-5p, as a tumor suppressor, is associated with cellular migration, proliferation, and apoptosis in renal cell carcinoma [30]. [score:3]
[1 to 20 of 4 sentences]
8
[+] score: 12
Furthermore, miR-149 inhibited EMT via directly targeting Forkhead box M1 (FOXM1), which was involved in the TGF-β -induced EMT [48]. [score:6]
For example, miR-149 expression was downregulated in lung cancer and was inversely correlated with invasive capability in NSCLC. [score:6]
[1 to 20 of 2 sentences]
9
[+] score: 12
The top miRNAs (those with the highest number of targets in each time point) were miR-149-5p, miR-138-5p and miR-16-5p for 15, 30 and 45 dpi, with 14, 22 and 21 targets, respectively (targets described in Supplemental Tables  8– 10). [score:7]
Five out of the 35 DEMs in the network have targets involved in all four of the pathophysiological processes (miR-238-3p, miR-149-5p, miR-143-3p, miR-145-5p and miR-486-5p); an additional six DEMs target genes involved in three of the four processes (miR-138-5p, miR-9-5p, miR-26a-5pmiR-185-5p, miR-200b-3p and miR-335-5p). [score:5]
[1 to 20 of 2 sentences]
10
[+] score: 11
Silencing PRDM14 reduced the expression of miRNAs upregulated in breast cancer tissues (e. g. miR-106a, miR-149, miR-18a, miR-221, miR-222, miR-224, miR-23a, miR-24, miR-27a/b, and miR-493) and increased expression of those that were downregulated (e. g. miR-15a, miR-150, miR-183, and miR-203). [score:11]
[1 to 20 of 1 sentences]
11
[+] score: 11
In contrast, the upregulation of miR-149 and miR-193b, and the downregulation of miR-122 and miR-200a were not confirmed in DMD patients (not shown). [score:7]
This included the markedly upregulated miR-378, which is another muscle-enriched miRNA [37] as well as miR-193b, miR-149 and miR-30a. [score:4]
[1 to 20 of 2 sentences]
12
[+] score: 9
In addition to this group of down-regulated miRs, CSCs can be distinguished from embryonic heart cells on the basis of seven up-regulated miRs: let-7a, let-7b, miR-24, miR-125b, miR-132, miR-149 and miR-223 (Fig. 2C). [score:7]
Little is known regarding the function of miR-149, in addition to the fact that it has been identified as being down regulated in response to cardiac injury [18]. [score:2]
[1 to 20 of 2 sentences]
13
[+] score: 8
Mir-29a, miR-219, miR-338 and miR-132 were the miRNAs undergoing the strongest upregulation during development, a result confirmed by reverse transcription PCR (Supplementary Fig. 1) and in agreement with previous data 8, whereas miR-298, miR-149 and miR-331 were the top downregulated miRNAs. [score:8]
[1 to 20 of 1 sentences]
14
[+] score: 8
Mature ID Fold Regulation miR-135b −2.6965 miR-363 −2.5995 miR-98 −2.543 miR-132 −2.355 miR-103 −2.1776 miR-99b −2.044 miR-135a −1.8734 let-7d −1.7861 miR-130a −1.6538 miR-152 −1.6246 miR-129-5p −1.6232 miR-298 −1.6169 miR-185 −1.6035 miR-214 −1.5746 miR-140 −1.5688 miR-134 −1.5667 miR-18b −1.5607 miR-194 −1.5509 let-7f −1.5107 miR-149 −1.51 Because miRNAs typically regulate translation in animal cells, we compared CXCL10 and STAT1 protein levels in both control and Dicer [d/d] animals and cells. [score:4]
Mature ID Fold Regulation miR-135b −2.6965 miR-363 −2.5995 miR-98 −2.543 miR-132 −2.355 miR-103 −2.1776 miR-99b −2.044 miR-135a −1.8734 let-7d −1.7861 miR-130a −1.6538 miR-152 −1.6246 miR-129-5p −1.6232 miR-298 −1.6169 miR-185 −1.6035 miR-214 −1.5746 miR-140 −1.5688 miR-134 −1.5667 miR-18b −1.5607 miR-194 −1.5509 let-7f −1.5107 miR-149 −1.51 A. Scatterplot showing relative expression of miRNAs by macroarray. [score:4]
[1 to 20 of 2 sentences]
15
[+] score: 7
Briefly, 2.5 mg of expression vector bearing mmu–miR-149 precursor, mouse pcDNA–PARP-2, mouse pcDNA–PARP-2 without 39-UTR, 2.3 mg of pmirGLO-PARP-2–39-UTR, or 400 ng of mmu–miR-149 miRCURY LNA knockdown probe (antagomir) or scrambled probe (Exiqon, Woburn, MA) was added. [score:4]
The reduction in eIF5A1 mRNA levels was concomitant with a decrease in eIF5A1 protein levels (Fig. 3D), suggesting that miR-149 predominantly suppresses eIF5A1 mRNA levels. [score:3]
[1 to 20 of 2 sentences]
16
[+] score: 6
Interestingly, after Aire-knockdown, a large number of miRNAs interacted with their respective targets, and miR-149 exhibited an increased number of interactions with the PTA mRNAs. [score:4]
Here, 15 miRNAs (miR-let-7e*, miR-15a*, miR-19b-1*, miR-30e*, miR-130b*, miR-149, miR-296-5p, miR-362-5p, miR-378, miR-425, miR-432, miR-484, miR-574-3p, miR-671-5p, and miR-1249) established interactions with 19 mRNAs. [score:1]
This result is the first evidence for miR-149 participation in the thymus (Figure 4B). [score:1]
[1 to 20 of 3 sentences]
17
[+] score: 6
Interestingly, some of the lens-enriched miRNAs are expressed at significant levels in the cornea (Figure 1D) and by ISH we frequently observe concurrent lens and cornea miRNA expression (e. g. miR-130a, miR-149, miR-883b-5p; red arrowheads in Figure 6), probably reflecting the common origin of these epithelial tissues. [score:5]
For miR-130a, miR-149 and miR-883b-5p concomitant staining of the corneal epithelium can be seen (red arrowheads). [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 6
Two overexpressed miRNAsmiR-149 [10] and miR-29b [12, 21, 22] – have already been described as upregulated in other female breast cancer studies. [score:6]
[1 to 20 of 1 sentences]
19
[+] score: 5
The sequences of targeting motifs used to build the miRNA -inhibitor vectors are listed below: (1) aaagtgccgccatcttttgagt for miR-371b-5p, (2) gcacagcccccgtccctccct for miR-149, (3) cgccgccccgcacctgct for miR-3665, (4) cagagcccgccccaacccac for miR-3940-5p, (5) cccccgcctccgccgccgcc for miR-3960, (6) gcctgccccctccaacagcca for miR-4687-3p, (7) gcggtcccgcggcgccccgcct for miR-663, and (8) gctcggccccggccccagcccc for miR-762. [score:5]
[1 to 20 of 1 sentences]
20
[+] score: 5
For instance, loss of miR-149, miR-200c and mir-141 causes gain of function of oncogenes (KCNMA1, LOX), VEGFA and SEMA6A respectively and increased levels of miR-142-3p, miR-185, mir-34a, miR-224, miR-21 cause loss of function of tumor suppressors LRRC2, PTPN13, SFRP1, ERBB4, and (SLC12A1, TCF21) respectively. [score:3]
As the p-values in Figure 4 indicate, we validate a strong anti-correlation signature between mRNA levels of (KCNMA1, LOX), VEGF, SEMA6A, (LRRC2, PTPN13), SFRP1, ERBB4, SLC12A1 and TCF21, and their identified regulators: miR-149, miR-200c, mir-141, miR-142-3p, miR-185, mir-34a, miR-224 and miR-21 respectively. [score:2]
[1 to 20 of 2 sentences]
21
[+] score: 4
Some miRNAs have been identified to regulate the expression of FoxM1, including miR-149, miR-134, miR-370, miR-494, miR-194, and miR-24-1 [37– 43]. [score:4]
[1 to 20 of 1 sentences]
22
[+] score: 4
In the peripheral CD3 [+] T lymphocytes of DBA-2/J strain, we found 11 miRNAs (miR-302c, miR-691, miR-712, miR-125a-3p, miR-29b*, miR-30b*, miR-10b, miR-149, miR-141, miR-1897-5p and miR-690) that were up-regulated. [score:4]
[1 to 20 of 1 sentences]
23
[+] score: 3
Sheikh M. S. A. Xia K. Li F. Deng X. Salma U. Deng H. Liu W. Yang T. -L. Peng J. Circulating miR-765 and miR-149: Potential noninvasive diagnostic biomarkers for geriatric coronary artery disease patients Biomed. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
Once again we identified a number of miRNAs whose expression appeared to be repressed at a single time point including miR-187 (1 hrs), miR-27b (6 h), miR-29c (6 h), miR-100 (6 h), miR-149 (6 h), miR-150 (6 h) and miR-154 (6 h) (Table S2). [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 2
Mir-497 and mir-149, which were up regulated in IS4 group, were earlier reported to also increase in the brain after TBI [23], [63]. [score:2]
[1 to 20 of 1 sentences]
26
[+] score: 2
Thus, to further investigate relationships between increased plasma VEGF levels (Fig. 2) and the thirteen microRNAs (Table 1) that were downregulated following rIPC, expression levels of miR-6366, miR-711, miR-3960, miR-3072-5p, miR-2137, miR-762, miR-5112, and miR-149-3p were investigated in BM cells (Fig. 4). [score:2]
[1 to 20 of 1 sentences]
27
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
39E-0218mmu-miR-138-5pmir-1380.2612.849.05E-053.20E-0340mmu-miR-140-3pmir-1400.197.891.23E-031.94E-0246mmu-miR-144-3pmir-1440.256.882.38E-033.30E-0268mmu-miR-145-5pmir-1450.177.038.25E-037.73E-0248mmu-miR-146b-5pmir-1460.167.502.60E-033.38E-0225mmu-miR-152-3pmir-1480.196.472.22E-045.65E-0331mmu-miR-149-5pmir-1490.227.694.26E-048.75E-0314mmu-miR-16-5pmir-150.2910.942.74E-051. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
Gene symbols of the 69 targets shown as yellow points whose impacts of DEHP on differential methylation levels as compared to controls were similar between both strains: 1500015O10Rik, 4833417C18Rik, 4930500F04Rik, 9330159F19Rik, Abca17, Acot5, Acrbp, Atad3a, BC003965, BC030336, Birc3, Camk4, Chl1, Chrm5, Cnih1, Cntn6, Crybg3, Ctsl, Egln2, Enam, Enpep, Epha8, Exoc8, Fam134c, Fcer1g, Gm10451, Gm16294, Gm53, Gnptg, Gpr15, Hoxd10, Klc2, Klk1b21, Krt14, Lrrc4b, Mansc4, Mir149, Mir1899, Mir6395, Mrgprg, Mtor, Olfr1306, Olfr656, Omg, Os9, Pigq, Pkn1, Prdx6b, Prg3, Ptgr1, Rasal3, Rnaseh2b, Sbf1, Serpine2, Slc22a1, Slc25a10, Spatc1, Tff2, Tgif1, Timm22, Tnfsf13b, Uevld, Vps8, Wdr43, Wipf2, Wnt3, Zfp319, Zfp459, Zfp62. [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
The inflammatory circuitry of miR-149 as a pathological mechanism in osteoarthritis. [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
Functions of the other three miRNAs, miR149, miR193 and miR466a-3p, have not been previously examined in the intestinal epithelium in vitro or in vivo. [score:1]
[1 to 20 of 1 sentences]