sort by

508 publications mentioning mmu-mir-155 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-155. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 451
Together, these data support this hypothesis that miR-155 upregulates GLUT4 expression through downregulating HDAC4 expression, thereby leading to enhanced glucose uptake in insulin-sensitive tissues (i. e., SM), strongly supporting that miR-155 play a positive role in regulating insulin sensitivity of peripheral tissues, at least in part, through suppressing HDAC4 expression (Fig 8). [score:16]
Our studies revealed that the expression of miR-155 targets (i. e. C/EBPβ, HDAC4 and SOCS1) and PDK4, a direct target of C/EBPβ[43, 44], were negatively regulated by miR-155, and C/EBPβ knockdown reduced PDK4 expression in hepa1-6 cells. [score:12]
As expected, the global overexpression of miR-155 in mice reduced the expression of C/EBPβ, HDAC4, PTEN, SOCS1 and SOCS3 in liver, adipose tissue and SM of RL-m155 mice (Figs 6A, 6B and 7C), while our results from 7402 and hepa1-6 cells revealed that miR-155 negatively regulated the expression of C/EBPβ, HDAC4, SOCS1 and SOCS3 (Figs 6C and 7D), indicating that decreased expression of C/EBPβ, HDAC4, PTEN, SOCS1 and SOCS3 in insulin target organs of RL-m155 mice is consistent with increased whole-body insulin sensitivity. [score:12]
Therefore, miR-155 negatively regulates it targets C/EBPβ, HDAC4 and SOCS1 expression, and C/EBPβ target PDK4 expression. [score:10]
In RL-m155 mice, Gck expression was increased in liver and WAT, and pyruvate kinase M2 (PKM2) expression was enhanced in SM, while pyruvate dehydrogenase kinase 4 (PDK4) and activating transcription factor 4 (ATF4) expression were reduced in liver, WAT, BAT or SM (Fig 6A and S5 Fig), suggesting that in RL-m155 mice, glycolysis is stimulated in these tissues examined by global miR-155 overexpression. [score:9]
Besides these aforementioned miR-155 targets, many metabolic genes that lack predicted miR-155 target sites exhibit the altered expression upon modulation of miR-155 expression. [score:9]
But our results indicate that the relatively low levels of miR-155 transgene expression in major insulin target organs or tissues (liver, adipose tissues and SM) are sufficient to induce phenotypes described above and observed in our paper[8], indicating that modest overexpression of miR-155 could be safe; in support of this idea, physiological and pathological side effects of miR-155 overexpression were not observed in RL-m155 mice and Rm155LG/Alb-Cre mice of up to one years of age. [score:9]
As expected, mRNA and protein levels of C/EBPβ, HDAC4 and SOCS1, and C/EBPβ target PDK4 in the liver of RL-m155 mice was remarkably down-regulated (Figs 6A, 6B and 7C, S5 and S7C Figs), whereas C/EBPβ, HDAC4, SOCS1 and PDK4 protein levels in the livers of miR-155 [-/-] mice were significantly up-regulated (Fig 7C and S7C Fig). [score:9]
Although we cannot rule out the possibility that other known (such as CES3)[8] and unknown target genes of miR-155 (S5 Table) contribute to glucose metabolism, we speculate that the coordinated regulation of the miR-155 target genes (C/EBPβ, HDAC4 and SOCS1) could profoundly alter gene expression profiling related with glucose metabolism, thereby modulating the above-mentioned multiple metabolic phenotypes. [score:8]
Moreover, siRNA -mediated knockdown of miR-155 target genes (C/EBPβ and HDAC4) and C/EBPβ target gene PDK4 mimicked miR-155 -induced glucose uptake in hepa1-6 cells (Fig 7G and S10 Fig), which is similar as the results caused by miR-155 overexpression (Fig 6F and S9 Fig), suggesting that C/EBPβ and HDAC4 are involved in miR-155 -induced glucose uptake. [score:8]
Our results revealed that miR-155 negatively regulated its target gene SOCS1 expression in insulin-sensitive tissues and liver cells, and miR-155 overexpression led to enhanced IRS-1 phosphorylation and AKT phosphorylation in SM and adipose tissue of RL-m155 mice after insulin treatment. [score:8]
Moreover, circulating levels of miR-155 were downregulated in plasma from patients with coronary artery disease plus diabetes[32], while miR-155 expression was reduced in diabetic kidney, heart, aorta, PBMCs and sciatic nerve of diabetic rats[33]. [score:8]
The effect of in vitro overexpression of miR-155 by using miRNA mimics and the repression of endogenous miR-155 expression by a miR-155 inhibitor on insulin-stimulated AKT phopshorylation was examined in hepa1-6 cells. [score:7]
To examine the influences of miR-155 on endogenous expression of these miR-155 targets, we firstly determined their expression in the livers of RL-m155 mice and miR-155 [-/-] mice. [score:7]
We found that miR-155 overexpression decreased miR-155 target gene HDAC4 expression and increased GLUT4 levels in SM of RL-m155 mice, and increased glucose uptake in cells (including C2C12 cells) examined, similar to what was observed upon HDAC4 siRNA. [score:7]
Interestingly, our study revealed that miR-155 overexpression in mice fed a conventional diet resulted in the aforementioned multiple metabolic phenotypes, whereas miR-26a overexpression led to reduced blood-glucose levels, better glucose tolerance and insulin sensitivity, and decreased hepatic glucose production in high-fat diet-fed mice, but not in conventional diet–fed mice[42], suggesting that miR-155 and miR-26a might play different roles in regulating glucose metabolism. [score:6]
miR-155 expression in PBMCs from T2D patients was decreased[11], which is consistent with our findings that the downregulated miR-155 levels were found in serum from T2D patients. [score:6]
The mouse or human miR-155 mimics, mimics control, miR-155 inhibitor and inhibitor control were purchased from RiboBio Co. [score:5]
Third, miR-155 transgene is universally expressed at relatively low levels in liver, WAT, BAT, SM, pancreas and isolated islets of RL-m155 mice, and in liver of Rm155LG/Alb-Cre mice[8], while miR-155 transgene is expressed at relatively high levels in brain, testis and heart of RL-m155 mice. [score:5]
In vivo, miR-155 overexpression in transgenic mice caused the reduction of brown adipose tissue mass and impairment of brown adipose tissue function, whereas, miR-155 inhibition in mice resulted in a hyperactive brown adipose tissue and induced a brown adipocyte-like phenotype ('browning') in white adipocytes[49]. [score:5]
Procedure for producing RL-m155 transgenic mice (i. e., RL-m155 mice) which can globally overexpress miR-155 transgene and express mRFP and luciferase (Luc) reporter transgenes in multiple organs and tissues is detailedly illustrated in S1A, S1D and S1E Fig exhibited whole-body fluorescence (b) and bioluminescence (c) imaging for newborn (S1D Fig) and adult RL-m155 mice (S1E Fig), respectively. [score:5]
Conversely, 7402 and hepa1-6 cells transfected with miR-155 inhibitor exhibited the enhanced expression of C/EBPβ, HDAC4, SOCS1 and PDK4 (Fig 6C and S8 Fig). [score:5]
The ectopic expression of miR-155 significantly inhibited adipogenesis in vitro[50, 51]. [score:5]
Silencing of miR-155 targets (i. e. C/EBPβ and HDAC4) and C/EBPβ target PDK4 in cultured liver cells enhanced insulin-stimulated AKT activation and glucose uptake. [score:5]
Collectively, the findings prompt us to speculate that miR-155 might activate IRS-1/PI3K/AKT insulin pathway by inhibiting SOCS1 expression, which at least partially contributes to the above-mentioned metabolic phenotypes (Fig 8 and S11 Fig). [score:5]
It is likely that these differentially expressed genes act the downstream of target genes of miR-155. [score:5]
Therefore, these observations support that miR-155 might negatively regulate PDK4 via negatively modulating C/EBPβ expression, thereby resulting in the aforementioned metabolic phenotypes (Fig 8 and S11 Fig). [score:4]
In future study, we can prove it by observing the changes of miR-155 expression in different insulin-sensitive tissues and blood during the development of diet -induced obesity and diabetes in mice. [score:4]
In summary, our findings firstly reveal that (1) miR-155 regulates multiple aspects of normal glucose metabolism and insulin signaling through coordinated regulation of critical metabolic genes in mice; (2) miR-155 is a positive regulator of insulin sensitivity; and (3) miR-155 is physiologically required for normal blood glucose homeostasis in mice. [score:4]
Here, we determine that miR-155 levels are downregulated in serum from type 2 diabetes (T2D) patients, and shows a negative correlation with HOMA-IR, suggesting that miR-155 might be involved in glucose homeostasis and insulin action. [score:4]
In addition, consistent with a positive regulatory role of miR-155 in glucose metabolism, miR-155 positively modulates glucose uptake in all cell types examined, while mice overexpressing miR-155 transgene show enhanced glycolysis, and insulin-stimulated AKT and IRS-1 phosphorylation in liver, adipose tissue or skeletal muscle. [score:4]
In this study, when globally overexpressed in mice, miR-155 resulted in hypoglycaemia, improved glucose tolerance and enhanced insulin sensitivity of peripheral tissues, whereas mice lacking miR-155 developed hyperglycemia, glucose intolerance and insulin resistance, suggesting the beneficially regulatory roles of miR-155 in glucose homeostasis. [score:4]
[18]F-FDG microPET/CT scan was employed to reveal that miR-155 -expressing 7402 cells, and hepa1-6 and C2C12 cells transiently transfected with miR-155 mimics exhibited significantly enhanced cellular [18]F-FDG uptake (Fig 6F and S9 Fig), further supporting that miR-155 plays a positive role in regulating insulin sensitivity of peripheral tissues. [score:4]
Furthermore, Western-blot analysis revealed that insulin-stimulated AKT phosphorylation was increased in hepa1-6 cells transfected with miR-155 mimics (Fig 6E), whereas insulin-stimulated AKT phosphorylation was reduced in hepa1-6 cells transfected with miR-155 inhibitor (Fig 6E), suggesting that miR-155 is a positive regulator of insulin sensitivity. [score:4]
More importantly, these aforementioned results suggest that C/EBPβ and HDAC4 are direct targets of miR-155. [score:4]
Furthermore, SOCS1 is identified as a direct target gene of miR-155 in human and mouse cells[28– 30]. [score:4]
SOCS1 is a direct target of miR-155. [score:4]
Regulation of gene expression and insulin signalling by miR-155. [score:4]
Global overexpression of miR-155 transgene in RL-m155 mice. [score:3]
Finally, both Luc- and mRFP -positive F2 animals with white fur and without Cre gene (determined by PCR -based genotyping) were intercrossed to produce RL-m155 transgenic mice (R: mRFP; L: Luc) (S1D Fig) which can globally and constantly express mRFP (S2A Fig), Luc (S2A Fig) and miR-155 (S2B Fig) transgenes in multiple organs and tissues of RL-m155 transgenic mice. [score:3]
Our findings show, for the first time, that miR-155 enhances insulin sensitivity through coordinated regulation of multiple genes in mice, including important negative regulators (i. e. C/EBPβ, HDAC4 and SOCS1) of insulin signaling. [score:3]
These aforementioned data indicate that the metabolic phenotypes in mice with loss of function of C/EBPβ[16, 22] or PDK4[45, 46] are similar to what was observed upon miR-155 overexpression in mice, and are opposite to what we found in miR-155 [-/-] mice. [score:3]
We hypothesized that increased glucose uptake induced by miR-155 overexpression (Fig 6F and S9 Fig) represented an increase in glycolytic metabolism. [score:3]
The data on the fold changes in [18]F-FDG uptake between miR-155 -expressing indicated cells and the corresponding control cells were shown in S9 Fig. UC: untransfected cells. [score:3]
Global transgenic overexpression of miR-155 in mice leads to hypoglycaemia, improved glucose tolerance and insulin sensitivity. [score:3]
Together, these data suggest that global overexpression of miR-155 alters the metabolic state of these tissues, driving enhanced glucose uptake and favoring glycolytic metabolism. [score:3]
To achieve global overexpression of miR-155, we crossed Rm155LG mice with EIIa-Cre mice. [score:3]
Moreover, miR-155 overexpression in 7402 and hepa1-6 cells resulted in significant reduction of endogenous C/EBPβ, HDAC4, SOCS1 and PDK4 (Fig 6C and S8 Fig). [score:3]
siRNA -mediated silencing of C/EBPβ, HDAC4 or PDK4 in hepa1-6 cells enhanced insulin-stimulated AKT phosphorylation (Fig 7F), respectively, similar to what was observed upon miR-155 overexpression (Fig 6E). [score:3]
Rm155LG transgenic mice that can conditionally overexpress mouse miR-155 transgene mediated by Cre/lox P system have been generated on C57BL/6 background, as previously described[8]. [score:3]
As described in the section, to examine the roles of miR-155 by gain of function, Rm155LG transgenic mice (i. e., Rm155LG mice) for the conditional overexpression of mouse miR-155 transgene mediated by Cre/lox P system were generated by us[8]. [score:3]
Global overexpression of miR-155 transgene in RL-m155 transgenic mice. [score:3]
Quantitative analysis also revealed no difference in insulin 1 (Ins1) and insulin 2 (Ins2) expression (Fig 3C), and in total β-cell mass (Fig 3D) between control and RL-m155 mice or between WT and miR-155 KO mice. [score:3]
The dual luciferase reporter gene plasmids [pLuc-C/EBPβ-3’-UTR-wt or pLuc-HDAC4-3’-UTR-wt (Kangbio, Shenzhen, China)] were cotransfected into hepa1-6 cells with the miR-155 mimics, mimics control or miR-155 mimics plus miR-155 inhibitor using Lipofectamine 2000 Reagent (Invitrogen), respectively. [score:3]
Procedure for producing transgenic mice which can globally overexpress mouse miR-155 transgene in multiple organs and tissues of mice was detailedly illustrated in S1A Fig. Briefly, at 6–8 wk of age, the heterozygous Rm155LG transgenic mice[8] were mated with the homozygous EIIa-Cre transgenic mice (FVB/N-Tg(EIIa-cre)C5379Lmgd/J)[65] to generate F1 (S1B Fig); next, both luciferase (Luc)- and mRFP -positive F1 animals (2 [#], 4 [#] or 6 [#]) (shown in S1B-b,c Fig) were intercrossed to produce F2 (shown in S1C Fig), including Luc- and mRFP -positive F2 animals with white fur (6 [#]). [score:3]
In line with this idea, a minor or modest increase in miR-155 expression in mice was sufficient to induce multiple phenotypic changes. [score:3]
Summarily, miR-155 represents a promising target for the treatment of insulin resistance and diabetes. [score:3]
Among miR-155 target genes, C/EBPβ, HDAC4 and SOCS1 especially caught our attention. [score:3]
Additionally, global overexpression of miR-155 transgene did not alter the final body weight of RL-m155 mice (S2C–S2F Fig). [score:3]
Together global miR-155 overexpression in mice enhances insulin sensitivity in liver, muscle and fat cells of RL-m155 mice. [score:3]
These results from this study and the recent report[42] demonstrate that a single miRNA, such as miR-155 (this study) and miR-26a[42], can regulate multiple metabolic phenotypes in vivo by coordinated regulation of multiple genes. [score:3]
Thus, the global overexpression of miR-155 improves glucose tolerance and whole body insulin sensitivity, even when mice are challenged with a HFD. [score:3]
In future study, given the important roles of BAT in obesity and glucose metabolism, the conditional gain-of-function (using Rm155LG transgenic mice[8]) and loss-of-function (using miR-155 floxed mice[53]) of miR-155 in BAT of mice will be employed to fully explore the roles of the miR-155 overexpression -induced decreased BAT mass and function on glucose metabolism (including whole-body insulin sensitivity) in mice. [score:3]
Four, the global (this study) or hepatocyte-specific[8] overexpression of miR-155 in mice does not induce weight gain, avoiding the major side effect of increasing insulin sensitivity for diabetes therapies[54]. [score:3]
As a multifunctional miRNA, miR-155 plays crucial roles in various physiological and pathological processes, such as haematopoietic lineage differentiation, cardiovascular diseases and cancer[5– 7]. [score:3]
The putative or verified miR-155 target genes are summarized in S5 Table. [score:3]
Thus, the low and modest miR-155 overexpression can decrease the risk of tumorigenesis. [score:3]
These effects of miR-155 could be greatly consolidated and augmented by crosstalk between glucose metabolism and insulin signaling, which indicates that a small change in miR-155 expression can sometimes have a large physiological effect on metabolic phenotypes. [score:3]
In contrast, transient transfection of wild-type C/EBPβ-Luc reporter or HDAC4-Luc reporter with miR-155 mimics plus inhibitor into hepa1-6 cells could fully reverse the miR-155 -induced decrease in luciferase activity (Fig 7B). [score:3]
Thus, we suspect that the decrease of miR-155 expression in insulin-sensitive tissues (i. e., liver, adipose tissue and skeletal muscle) may cause the decreased blood miR-155 level in diabetic patients. [score:3]
Global overexpression of miR-155 improves glucose metabolism and insulin sensitivity in RL-m155 mice. [score:3]
The verified or putative miR-155 target genes implicated in insulin signaling, glucose metabolism and diabetes. [score:3]
Global overexpression of mouse miR-155 transgene in multiple organs and tissues of RL-m155 transgenic mice. [score:3]
In summary, these observations exhibited that targeted disruption of miR-155 in mice specifically impairs glucose metabolism through induction of insulin resistance. [score:3]
S9 Fig(Extended Data Fig 6F) The fold changes in [18]F-FDG uptake between miR-155 -expressing indicated cells and the corresponding control cells. [score:3]
But the influences of the decreased BAT mass and function caused by miR-155 overexpression in mice on glucose metabolism (including whole-body insulin sensitivity) in mice remains unknown. [score:3]
Given the potent roles of miR-155 in the above observations as well as lipid metabolism[8, 52], these findings suggest miR-155 as a promising novel target for treatment of T2DM. [score:3]
qRT-PCR exhibited significant increases in miR-155 expression levels in liver, WAT, BAT, SM, pancreas and isolated islets of RL-m155 mice (Fig 2C and S2B Fig). [score:3]
Our report showed that Rm155LG/Alb-Cre transgenic mice with liver-specific miR-155 overexpression exhibited the reduced levels of hepatic and serum lipid compositions[8]. [score:3]
Our previous report revealed that liver-specific overexpression of miR-155 transgene resulted in significantly reduced levels of serum total cholesterol, triglycerides (TG) and high-density lipoprotein (HDL), as well as remarkably decreased contents of hepatic lipid, TG, HDL and free fatty acid in Rm155LG/ Cre transgenic mice[8], indicating that miR-155 negatively modulates levels of hepatic and serum lipid compositions, and displays lipid-lowering activity in mice. [score:3]
Regulation of the MIR155 host gene in physiological and pathological processes. [score:2]
miR-155 promotes cellular [18]F-FDG uptake in 7402, hepa1-6 and C2C12 cellsDiabetes and insulin resistance are associated with defects in glucose uptake, while GTTs and ITTs revealed a positive regulatory role of miR-155 in glucose tolerance and insulin sensitivity, further supporting the hypothesis that miR-155 might drive increased glucose uptake. [score:2]
In the present study, we provide evidence for the first time showing that miR-155 is a positive regulator of insulin sensitivity in mice. [score:2]
RL-m155 mice and miR-155 knockout (KO) mice exhibit the unaltered β-cell proliferation and hormone profiles in pancreas. [score:2]
Dysregulated miR-155 levels in serum from T2D patients. [score:2]
Diabetes and insulin resistance are associated with defects in glucose uptake, while GTTs and ITTs revealed a positive regulatory role of miR-155 in glucose tolerance and insulin sensitivity, further supporting the hypothesis that miR-155 might drive increased glucose uptake. [score:2]
Subsequently, we want to address the possible mechanisms by which miR-155 regulates insulin sensitivity and glucose metabolism. [score:2]
RL-m155 mice and miR-155 knockout (KO) mice displayed the unaltered β-cell proliferation and hormone profiles in pancreas. [score:2]
Up to now, there have been very few miRNAs, such as miR-130a-3p[41], miR-26a[42] and miR-155 (this study), to be found to act as positive regulators of glucose tolerance and insulin sensitivity in vivo. [score:2]
Data are presented as fold changes in the miR-155 -expressing cells compared to the control cells. [score:2]
More importantly, we reveal that these aforementioned phenomena occur, at least in part, through the miR-155 -mediated coordinated repression of multiple negative regulators (i. e. C/EBPβ, HDAC4 and SOCS1) of insulin signaling. [score:2]
The data on the fold changes in [18]F-FDG uptake between siRNA -transfected hepa1-6 cells and the corresponding control cells were shown in S10 Fig. UC: untransfected cells Subsequently, we want to address the possible mechanisms by which miR-155 regulates insulin sensitivity and glucose metabolism. [score:2]
Summarily, our results indicate that miR-155 affects insulin's ability to positively regulate AKT phosphorylation in liver cells. [score:2]
This feature prompted us to firstly explore the influences of miR-155 on pancreatic β-cell proliferation, β-cell mass and β-cell function by using both RL-m155 mice and miR-155 knockout (KO) mice[13]. [score:2]
First, miR-155 regulates multiple components of glucose metabolism. [score:2]
In summary, these findings from this study and other studies demonstrate the importance of miR-155 in the multiple aspects of glucose metabolism and insulin signaling, lipid metabolism and adipocyte differentiation through regulation of critical metabolic genes. [score:2]
A proposed mo del on the positive roles of miR-155 in glucose metabolism by coordinated regulation of multiple genes. [score:2]
All in all, our findings firstly demonstrate that miR-155 regulates multiple aspects of glucose metabolism. [score:2]
S7 Fig(A) Sequence alignment of 3’-UTR of human (Hsa), mouse (Mmu), rhesus (Mml) and rat (Rno) SOCS1 highlighting miR-155 binding site. [score:1]
As shown in Fig 8 and S11 Fig, here we provide a working hypothesis that explains the roles of miR-155 in inducing multiple phenotypic changes in mice and the underlying mechanisms. [score:1]
1006308.g005 Fig 5 (A-C) Blood glucose concentrations in fed-state (A), 12-hour–fasted (B) and 24-hour–fasted (C) miR-155 [-/-] mice (males: 3 m and females: 2m). [score:1]
The 3’-UTRs of C/EBPβ (Fig 7B), HDAC4 (Fig 7B) and SOCA1 (S7B Fig) mRNA contain complementary site for the seed region of miR-155, respectively. [score:1]
More importantly, our observations strongly support that miR-155 is entitled to control all 3 hallmarks of T2DM, namely insulin resistance, excessive HGP which primarily results from sustained gluconeogenesis[55], and elevated lipid synthesis. [score:1]
The reasons are as follows: (1) C/EBPβ, HDAC4 and SOCS1 genes harbor miR-155 binding site, which is conserved across different phyla (Fig 7A and S7A Fig); (2) C/EBPβ[16, 22], HDAC4[23, 24] and SOCS1[25] are negative regulators of blood glucose and insulin sensitivity in mice, and SOCS1 is characterized as a positive mediator of insulin resistance[25]; (3) SOCS1 is a negative regulator of IRS-1/PI3K/AKT insulin pathway[26, 27]. [score:1]
Furthermore, there are several lines of evidence that miR-155 is also involved in adipocyte differentiation[49], adipogenesis[50, 51] and lipid metabolism[8, 52]. [score:1]
Besides the multifunctions of miR-155, it is important to pay attention to the following aspects. [score:1]
H&E staining and immunostaining of pancreatic sections with antibodies to insulin and to glucagon exhibited normal islet architecture in RL-m155 mice or miR-155 KO mice (Fig 3B). [score:1]
To further examine the effects of loss of miR-155 function on blood glucose levels, glucose tolerance and insulin sensitivity, we used miR-155 [-/-] mice to perform the following loss-of-function experiments. [score:1]
Impaired glucose metabolism in miR-155 -deficient mice. [score:1]
More importantly, our findings fully reveal that the gain of miR-155 function leads to hypoglycemia and improved glucose tolerance through induction of insulin insensitivity in peripheral tissues, thereby improving whole-body glucose metabolism. [score:1]
More importantly, our findings suggest that C/EBPβ and HDAC4 are involved in miR-155 -mediated insulin-stimulated AKT phosphorylation in liver cells. [score:1]
In pilot experiment, we found that miR-155 levels in serum of type 2 diabetes (T2D) patients were lower than in healthy subjects, suggesting that miR-155 might be involved in blood glucose control and diabetes, which remains to be fully explored. [score:1]
Moreover, miR-155 levels showed negative correlation with HOMA-IR (R2 = 0.1191, P = 0.0069, Fig 1C) and no statistically significant correlation with HOMA-β (R2 = 0.0346, P = 0.1548, Fig 1D). [score:1]
Collectively, analysis of GSIS, morphological and structure analysis of pancreatic islets, and determination of pancreatic β-cell mass and proliferation revealed no alterations (Figs 3, 5D and 5I), further supporting the hypothesis that impaired glucose metabolism in miR-155 [-/-] mice arises primarily from insulin resistance of peripheral tissues rather than impaired insulin secretion. [score:1]
Insulin-stimulated Akt phosphorylation in hepa1-6 cells in the absence (miR-con) or presence of miR-155 mimics. [score:1]
Moreover, the number of BrdU- and Ki67 -positive β-cells did not differ between control and RL-m155 mice or between WT and miR-155 KO mice (Fig 3E and 3F). [score:1]
S6 Fig Hepa1-6 cells transfected with miR-155 mimics or mimics control were challenged with human insulin at 50 IU/L or 100 IU/L for 0, 15 and 30min, respectively. [score:1]
miR-155 [-/-] mice exhibited increased blood glucose levels (Fig 5A–5C), and unaltered plasma insulin concentrations (Fig 5D). [score:1]
Animal studies with miR-155 transgenic mice and miR-155 [-/-] mice. [score:1]
1006308.g003 Fig 3 (A) Morphology of the entire pancreas from RL-m155 mice and miR-155 KO mice. [score:1]
miR-155 deficiency in mice led to hyperglycaemia and insulin resistance. [score:1]
miR-155 promotes cellular [18]F-FDG uptake in 7402, hepa1-6 and C2C12 cells. [score:1]
In addition, miR-155 displays blood glucose-lowering activity and lipid-lowering activity in mice. [score:1]
1006308.g001 Fig 1. (A-B) Basal levels of miR-107(A), miR-155 (B) and miR-146a (B) in healthy subjects (HS) (n = 30) and T2D patients (n = 30) detected by qRT-PCR. [score:1]
Second, our results from this study and previous report[8] reveal the blood glucose-lowering activity and lipid-lowering activity of miR-155. [score:1]
We observed impaired glucose tolerance (Fig 5E–5H) and insulin resistance (Fig 5J–5M) in miR-155 [-/-] mice, which is contrary to the results of RL-m155 mice. [score:1]
Moreover, GSIS test revealed that serum insulin levels for mice of both genotypes were similar during GTT analysis (Fig 5I), suggesting that impaired glucose metabolism in miR-155 [-/-] mice results from reduced insulin sensitivity of peripheral tissues, but not decreased insulin secretion. [score:1]
More importantly, there was also no difference in circulating insulin levels between control and RL-m155 mice (Fig 4D and S3D Fig) or between WT and miR-155 KO mice (Fig 5D), while glucose-stimulated insulin secretion (GSIS) tests revealed the unaltered insulin secretion following a glucose challenge between control and RL-m155 mice (Fig 4G and S3G Fig) or between WT and miR-155 KO mice (Fig 5I). [score:1]
Furthermore, these findings from this study and other studies revealed the decreased BAT mass and function in miR-155 transgenic mice, and the preliminary data from this study displayed the enhanced glucose uptake & glycolysis and insulin-stimulated AKT phosphorylation in BAT of RL-m155 mice. [score:1]
As shown in Fig 8 and S11 Fig, this study uncovers partially molecular mechanisms underlying miR-155’s functions in the above-mentioned multiple metabolic phenotypes. [score:1]
Our above-mentioned results exhibited that the gain and loss of miR-155 function in mice didn’t have influences on pancreas morphology, islet architecture, β-cell proliferation and mass, and insulin and glucagon immunoreactivity (Fig 3), leading us to further explore the roles of miR-155 in normal glucose homeostasis and insulin sensitivity using RL-m155 mice. [score:1]
Conversely, miR-155 deficiency in mice causes hyperglycemia, impaired glucose tolerance and insulin resistance. [score:1]
As mentioned in “Introduction section”, miR-155 might be physiologically required for normal glucose homeostasis. [score:1]
We found that there was no difference in the morphology of the entire pancreas between control mice (i. e., non-transgenic littermates/wild-type littermates) and RL-m155 mice or between WT mice (i. e., wild-type C57BL/6J mice of the same age and sex) and miR-155 KO mice (Fig 3A). [score:1]
Proposed mo del for the role of miR-155 in known molecular pathways crucial for improved glucose metabolism. [score:1]
In this study, the non-transgenic littermates/wild-type littermates [i. e., control (con) mice] were used as controls of RL-m155 mice, while wild-type C57BL/6J mice (i. e., WT) of the same age and sex were used as controls of miR-155 [–/–]C57BL/6J mice. [score:1]
qRT-PCR analysis revealed a higher levels of miR-107 (Fig 1A) and a lower levels of miR-155 and miR-146a (Fig 1B) in serum from patients with type 2 diabetes mellitus (T2DM). [score:1]
Together, our observations strongly support that miR-155 might be involved in glucose homeostasis and insulin action. [score:1]
WT mice: n = 10 (males) and n = 12 (females); miR-155 KO mice: n = 9 (males) and n = 10 (females). [score:1]
Taken together, our findings support that in mouse pancreas, miR-155 don’t have obvious effects on the pancreatic morphology, β-cell proliferation, β-cell mass and β-cell function. [score:1]
RL-m155 transgenic mice have been generated on FVB background, as described in S1 and S2 Figs miR-155 [–/–]C57BL/6J mice (B6. [score:1]
Animal studies with miR-155 transgenic mice and miR-155 [-/-] miceThe homozygous EIIa-Cre transgenic mice (FVB/N-Tg(EIIa-cre)C5379Lmgd/J) and the wild-type FVB/N mice were obtained from Mo del Animal Research Center of Nanjing University. [score:1]
WT mice: n = 8; miR-155 KO mice: n = 8. (E-F) GTT in 12-hour–fasted miR-155 [-/-] mice (E) and area under the curve (AUC) (F) for this GTT (E). [score:1]
[1 to 20 of 143 sentences]
2
[+] score: 415
Other miRNAs from this paper: mmu-mir-122, mmu-mir-21a, mmu-mir-34a, mmu-mir-21b, mmu-mir-21c
Furthermore, expression of miR-155 is decreased during adipogenesis in vitro and over -expression of miR-155 inhibited expression of PPARγ and cEBPα, thus suggesting that miR-155 acts as a negative regulator of adipogenesis [32]. [score:10]
We then compared predicted targets and the miR-155 target database of IPA (TargetScan, Tarbase targets and other literature based targets) with our transcriptomic data to choose candidate genes for further validation (Table S3). [score:10]
Mutation of the Nr1h3 (LXR α) miR-155 target sequence prevented downregulation of luciferase activity by miR-155 mimic (pGLO-LXRa(mt)+miR155) (Figure 5B), thus confirming Nr1h3 (LXRα) as a bonafide miR-155 target gene. [score:9]
For example, miR-155 inhibits translation of c-EBPβ (protein involved in early adipogenesis) and SOCS-1 (inhibitor of insulin signaling) in macrophages [15], [33], thus indicating a potential regulatory role of miR-155 in other metabolic pathways [23]. [score:8]
Expression of the miR-155 validated target gene Socs1 was significantly upregulated in miR-155 [−/−] livers [15] (Figure 3B). [score:8]
In addition, we found that the LXR-responsive genes Fasn, Cd36 and Lpl (Figure 3C, Figure 4B) were upregulated in livers of miR-155 [−/−] mice but not all LXRα target genes were altered in the livers of miR-155 [−/−] mice, despite changes in LXRα expression. [score:8]
Chen et al demonstrated similar findings showing that inhibition of miR-155 expression significantly induced lipid uptake and over -expression miR-155 can decrease the lipid uptake in PMA-differentiated THP-1 cells and dendritic cells [24]. [score:7]
Although miR-155 is generally considered a pro-inflammatory miRNA in macrophages during chronic inflammatory diseases such as rheumatoid arthritis [19], [20], [21], the data herein suggests that increased expression of miR-155 in obese liver macrophages is an important part of a protective negative regulatory feedback mechanism aimed at limiting disease progression by preventing an excessive lipid accumulation in the liver. [score:7]
miR-155 direct targets that are up-regulated in miR-155 [−/−] livers are marked in red. [score:7]
In addition, it has been shown that hepatic miR-155 expression was increased in murine mo dels of NASH and HCC, and its expression correlated with disease severity [6], [7]. [score:7]
There is growing evidence for a role of miRNAs in the pathogenesis of many liver diseases [5], and recent studies have shown that expression of miR-155 is increased in hepatitis C virus infection [16], alcoholic liver disease [17], HCC [18], and in NAFLD [6], [7]. [score:7]
These mapped to 336 genes, of which 286 were upregulated and 50 were downregulated in miR-155 [−/−] livers (Table S1). [score:7]
We confirmed by qPCR that 4 of these potential targets were strongly upregulated in miR-155 [−/−] livers (Figure 4B). [score:6]
Our data demonstrate that miR-155 was upregulated in livers of obese mice, and that this increased expression was primarily detected in CD11b [+] macrophage cells. [score:6]
Among the potential targets examined, Nr1h3 (LXRα) was identified as a direct target of mouse miR-155 and the binding site appears to be conserved in humans (Figure 5A). [score:6]
To identify the cell lineage responsible for upregulated miR-155 expression, we purified hepatic CD11b [+] macrophages. [score:6]
Silencing of endogenous miR-155 in macrophages significantly enhanced oxLDL -induced lipid uptake, up-regulated the expression of scavenger receptors (LOX-1, CD36 and CD68), and promoted the release of several cytokines including IL-6, -8, and TNF-α [23]. [score:6]
miR-155 regulates cholesterol and fatty acid metabolism pathways in liver by directly targeting liver X receptor alpha (LXRα), a transcriptional regulator of many genes in liver lipid metabolism [9]. [score:6]
Inflammatory mediators (e. g. LPS, TNFα) have previously been shown to increase expression of miR-155 in macrophages and fibroblasts [19], [20], thus given the strong pro-inflammatory environment within the steatotic liver it is likely that inflammatory signals can upregulate miR-155. [score:6]
In addition, strong up-regulation of Nos2 expression in miR-155 [−/−] liver was detected. [score:6]
Western blotting for LXRα demonstrated that transfection with a miR-155 inhibitor in CD11b [+] cells from WT livers resulted in an upregulation of LXRα protein. [score:6]
Using luciferase reporter assays the other predicted miR-155 targets (Abcd2, Lpl, Pla2g7, Agtrap, Msr1 or Ywhae) could not be validated as direct targets of miR-155 (Figure S2). [score:5]
For example, miR-155 induced the chemokine CCL2 in macrophages stimulated with mildly oxLDL (moxLDL) and IFN-γ, but not highly oxidized LDL, via direct suppression of Bcl6, a transcription factor that counter-regulates NF-κB activation, thus indicating pro-inflammatory actions in the context of atherosclerotic plaque macrophages [22]. [score:5]
Thus, our data directly implicate miR-155 in liver homeostasis and its deregulation as a pivotal factor in the pathogenesis of fatty liver disease. [score:5]
MiR-155 expression in normal liver is low in comparison to other solid organs in 8-week old WT mice (Figure 1A), but was upregulated under patho-physiological conditions. [score:5]
Elevated miR-155 tissue expression was observed in livers of mice fed HFD, paralleling PCR expression data (Figure 1D and E). [score:5]
LXRα (Nr1h3): A Lipid Pathway Transcriptional Regulator is a Direct Target of miR-155 in Liver. [score:5]
In contrast to endothelial NOS (Nos3) [34], Nos2 is not predicted to be targeted by miR-155 (TargetScan), and LXR has previously been implicated in transrepression of Nos2 rather than its activation [35]. [score:5]
The miR-155 predicted targets in mouse and/or human were identified according to various target prediction algorithms and were further chosen for validation because they were also identified by microarray analysis or had known links to liver/lipid/fibrosis pathways as indicated by Ingenuity pathway analysis (IPA). [score:5]
Altered Inflammatory and Metabolic Gene Expression in Livers of miR-155 [−/−] MiceTo address the molecular mechanisms of enhanced hepatic steatosis in miR-155 [−/−] mice, we examined expression of various inflammatory and metabolic markers in livers and serum of HFD-fed mice. [score:5]
Therefore, upregulation of these genes in livers of miR-155 [−/−] mice is likely to be a result of secondary effects of deregulation of the miR-155/LXRα pathway. [score:5]
In line with increased miR-155, the miR-155 target genes CCAAT/enhancer -binding protein beta (Cebpb) and suppressor of cytokine signaling 1 (Socs1) were decreased. [score:5]
In addition, we would like to speculate that lipids themselves might directly regulate expression of miR-155. [score:5]
We also found significantly increased expression in the genes for inducible nitric oxide synthase (Nos2), no change in interleukin-6 (Il6) or tumor necrosis factor α (Tnf), but reduced expression of interleukin-1β (Il1b) in miR-155 [−/−] vs WT mice (Figure 3B). [score:5]
However, not all LXRα target genes were altered in miR-155 [−/−] livers, despite changes in LXRα expression (e. g. Cyp7a1 and Srebp1). [score:5]
Finally, molecular studies showed that miR-155 could directly target proteins that were implicated in metabolism. [score:4]
MiR-155 target prediction was carried out using the algorithms TargetScanHuman V6.2 (http://www. [score:4]
Concordantly, both of these genes are also upregulated in miR-155 [−/−] livers in our study. [score:4]
Our studies suggest that the LXR and LXR-regulated genes are highly induced in livers, and liver macrophages, from miR-155 [−/−] mice, and using luciferase assays we show that LXRα is a direct molecular target of miR-155. [score:4]
By comparing this list with our transcriptomic data (Table S1) in Ingenuity Pathway Analysis, 7 genes emerged as potential direct miR-155 target genes that were implicated in liver metabolism (Abcd2, Lpl, Pla2g7, Agtrap, Msr1, Nr1h3 and Ywhae) for further validation (Figure 4A, Tables S3 & S4). [score:4]
Pathway analysis identified the LXR/RXR pathway as the top canonical pathway upregulated in livers from miR-155 [−/−] mice (Table S2). [score:4]
In contrast, transfection with a miR-155 mimic in CD11b [+] cells from miR-155 [−/−] livers resulted in downregulation of LXRα. [score:4]
However, it has remained unclear whether miR-155 functionally contributes to development of liver disease. [score:4]
0072324.g004 Figure 4(A) Interaction map showing liver mRNA that are direct targets of miR-155 by Ingenuity Pathway Analysis that shows genes involved in Lipid Metabolism, Molecular Transport, and Small Molecule Biochemistry. [score:4]
Thus, we speculate that LXRα upregulation in the absence of repression by miR-155 leads to excessive lipid accumulation in liver. [score:4]
Furthermore, previous studies have shown that diet -induced activation of NF-κB is critical mediator regulating expression of miR-155 [6]. [score:4]
Identification of miR-155 direct targets in liver. [score:4]
These data suggest that the effect of miR-155 absence on Nr1h3 (LXRα) upregulation may be taking place in Kupffer cells, and not in other liver cell lineages. [score:4]
Liver expression of miR-155 is increased in murine mo dels of obesity. [score:3]
To address the molecular mechanisms of enhanced hepatic steatosis in miR-155 [−/−] mice, we examined expression of various inflammatory and metabolic markers in livers and serum of HFD-fed mice. [score:3]
Identification of Nr1h3 (LXRα) as a miR-155 target gene. [score:3]
Using the Rank Products method out of ∼28,853 probesets analyzed we found 573 probeset IDs that were differentially expressed in miR-155 [−/−] vs. [score:3]
To identify the cell type where the miR-155/LXRα pathway is operating in the liver, we examined the expression of LXRα in CD11b [+] and CD11b [−] hepatic fractions. [score:3]
demonstrated significantly higher hepatic expression of miR-155 in WT mice fed HFD (Figure 1B), and in ob/ob mice on normal chow versus their respective controls (Figure 1C). [score:3]
Conflicting data has also been obtained using in vivo murine atherosclerosis mo dels where one study showed that haematopoietic deficiency of miR-155 in LDLR [−/−] mice led to enhanced early atherosclerosis due to an increase in neutrophil migration [25], while another study more recently demonstrated that haematopoietic deficiency of miR-155 in ApoE [−/−] mice led to decreased atherosclerosis via inhibition of Bcl6 in macrophages [22]. [score:3]
Table S2 The top five significantly upregulated canonical pathways in livers from miR-155 [−/−] mice compared to WT livers as assessed by use of Ingenuity Pathway Analysis. [score:3]
Table S3 List of potential miR-155 targets chosen for further validation. [score:3]
A more detailed analysis of glucose responses over several weeks following inhibition of miR-155 is warranted in future studies in mouse mo dels of diabetes. [score:3]
In summary, deletion of miR-155 significantly alters the expression of selected inflammatory and metabolic pathways within liver. [score:3]
In summary, we have shown that miR-155 has a novel regulatory role as an important regulator of cholesterol and lipid metabolism, operating at least in liver via the LXRα pathway. [score:3]
These data confirm and extend previous studies showing that expression of miR-155 is increased in livers of animal mo dels of NAFLD [6], [7]. [score:3]
Figure S2 miR-155 does not target the 3′UTR of Abcd2, Lpl, Pla2g7, Agtrap, Msr1 or Ywhae mRNAs. [score:3]
Firstly, we identified putative binding sites for miR-155 in the 3′UTR of 440 genes (TargetScanHuman v6.2) that were also conserved across species. [score:3]
The evidence for this is shown in Figure 5B - significant inhibition of luciferase activity was observed in HEK293 cells co -transfected with plasmids for the 3′UTR of mouse Nr1h3 (LXRα) and the corresponding miR-155 mimic (pGLO-LXRa+miR155) versus scramble control mimic (pGLO-LXRa+SCRAM). [score:3]
Next we mapped the expression pattern of miR-155 in liver by in situ hybridization. [score:3]
However, a loss of repression of LXRα expression in miR-155 [−/−] mice does represent a plausible mechanism by which the hepatic phenotype is induced (Figure 5E). [score:3]
0072324.g001 Figure 1Expression of miR-155 by qRT-PCR in: (A) Tissues from 8-week old WT mice fed normal chow (n = 3)(WAT: white adipose tissue); (B) Livers from WT mice fed either normal chow or HFD for 24 weeks; (C) Livers from WT and ob/ob mice fed normal chow for 5 weeks. [score:3]
miR-155 [−/−] mice have altered expression of inflammatory and metabolic genes in liver. [score:3]
In fact, we observed a strong increase in Socs1 expression in livers of miR-155 [−/−] mice suggesting the presence of functional interaction between miR-155 and Socs1 in liver. [score:3]
Expression of Liver miR-155 is Increased in Murine Mo dels of Diet -induced Obesity. [score:3]
Expression of miR-155 by qRT-PCR in: (A) Tissues from 8-week old WT mice fed normal chow (n = 3)(WAT: white adipose tissue); (B) Livers from WT mice fed either normal chow or HFD for 24 weeks; (C) Livers from WT and ob/ob mice fed normal chow for 5 weeks. [score:3]
Table S1 List of differentially expressed genes obtained by microarray analysis of livers from WT vs miR-155 [−/−] mice. [score:3]
Altered Inflammatory and Metabolic Gene Expression in Livers of miR-155 [−/−] Mice. [score:3]
Nr1h3 (LXRα) was upregulated only in CD11b [+] macrophages, and not in CD11b [−] cells, purified from livers of miR-155 [−/−] mice compared WT control (Figure 5C). [score:3]
Given the potent role of Socs1 in inhibiting insulin signaling, it is likely that de-repression of Socs1 in miR-155 [−/−] livers is responsible for an increase in the circulating insulin levels. [score:3]
Interestingly, the expression of genes involved in gluconeogenesis (Pck1, Cebpa), cholesterol uptake (Cd36) and fatty acid synthesis (Fasn, Fabp4) were significantly increased in HFD-fed livers of miR-155 [−/−] mice vs WT mice (Figure 3C), indicating that they could be responsible, or contribute to the observed phenotype in miR-155 [−/−] mice. [score:3]
Increased expression of miR-155 in mo dels of NAFLD likely plays a critical homeostatic role designed to prevent excessive lipid accumulation in livers that can ultimately lead to liver damage. [score:3]
MiR-155 Target Prediction and Validation. [score:2]
In order to validate the candidate miR-155 predicted targets, luciferase reporter assays were carried out. [score:2]
MiR-155 is a multi-functional miRNA known to regulate numerous biological processes including hematopoiesis, inflammation, immunity, atherosclerosis, and cancer (reviewed in 8). [score:2]
Table S4 List of primer sequences designed for the potential murine miR-155 targets chosen for further validation. [score:2]
Expression of miR-155 in sub-cutaneous fat biopsies was significantly higher in samples from normal glucose control subjects as compared to those with T2D [30]. [score:2]
In fact, we observe a relative minor difference in inflammatory cytokines between WT and miR-155 [−/−] mice on HFD (a decrease in IL-1β, no change in IL-6 and TNFα) suggesting miR-155 preferentially regulates lipid metabolism pathways in these cells. [score:2]
Next, in order to identify the direct molecular mechanism responsible for miR-155 action, we combined bioinformatics and transcriptomic profiling of miR-155 [−/−] livers as follows. [score:2]
In WT mice fed HFD for 24 weeks, miR-155 expression was higher in CD11b [+] macrophages compared to the CD11b [−] fraction, comprising of all other hepatic cell lineages (Figure 1F). [score:2]
Analysis of the human and mouse miR-155 promoter (MATInspector) reveals multiple binding sites for LXR/RXR heterodimers indicating that miR-155 could be directly induced by oxysterols generated as part of a HFD. [score:2]
To investigate this further we isolated CD11b [+] cells from liver of WT and miR-155 [−/−] mice and transfected them with control or miR-155 mimics, control or miR-155 inhibitors (Figure 5D). [score:1]
Deficiency of miR-155 did not alter the final body weight of mice at 24 weeks (Table 1), but mean liver weight was increased by 30% in miR-155 [−/−] mice fed HFD (Figure 2A). [score:1]
Recent studies also suggest that miR-155 may have metabolic effects beyond liver. [score:1]
Several other key genes involved in lipid and glucose metabolism were not significantly different (Ppparc1a, Pparg, Cebpb, Srebf1, Cyp7a1, Acc, Ampk, Cpt1a, Crot), or were significantly reduced (Hmgcr, and Ldlr) in miR-155 [−/−] mice on HFD (Figure 3C). [score:1]
WT or miR-155 [−/−] mice were fed either normal chow or HFD and livers examined at 24 weeks. [score:1]
HEK293 cells were co -transfected with 0.2 µg pmiRGLO containing potential miR-155 MREs and 40 nM miR155 mimic or scrambled mimic control, using Attractene (Qiagen). [score:1]
Lipid metabolism and cell cycle networks were significantly enriched in livers from miR-155 [−/−] mice, as were networks involved with hepatocellular carcinoma and liver steatosis. [score:1]
Furthermore, serum levels of VLDL/LDL cholesterol were significantly higher in HFD-fed miR-155 [−/−] mice vs WT. [score:1]
Serum levels of the enzyme ALT, indicative of liver damage, were increased in miR-155 [−/−] mice fed HFD (Table 1). [score:1]
Future studies determining how miR-155 may interact with lipid, fibrosis and inflammatory pathways in liver (and other metabolic tissues) are warranted and could offer new insights into the pathogenesis of hepatic steatosis and type 2 diabetes. [score:1]
However, other studies show contrasting anti-inflammatory effects of miR-155 in lipid-laden macrophages. [score:1]
Murine pGLO-LXRα 3′UTR luciferase plasmids were co -transfected with miR-155 or scrambled (SCRAM) control mimic (40 nM) in HEK293 cells. [score:1]
Thus, it is clear that miR-155 can have different effects on macrophage lipid uptake and inflammatory signals in different settings. [score:1]
miR-155 [−/−] mice are susceptible to hepatic steatosis. [score:1]
These data suggest that homeostatic effects of miR-155 in liver are likely mediated by macrophages/Kupffer cells, and not by hepatocytes. [score:1]
However, fasting glucose and ITT were similar between WT and miR-155 [−/−] mice (Figure S1). [score:1]
However, the functional role of miR-155 in liver homeostasis is unknown. [score:1]
In fact, in the context of lipid and inflammatory signaling in macrophages conflicting data has been obtained for miR-155. [score:1]
Serum insulin levels were significantly higher in both chow and HFD-fed miR-155 [−/−] mice (Table 1). [score:1]
In cell -based experiments incubation of 3T3-L1 adipocytes with insulin resulted in a significant decrease in miR-155 [31]. [score:1]
Briefly, potential miR-155 miRNA recognition elements (MREs) were amplified from relevant genomic DNA using PfuUltra II (HS) (Agilent). [score:1]
CD11b [+] cells from WT and miR-155 [−/−] livers were transfected with miR-155 or control mimics (25 nM; Dharmacon: mmu-miR-155: UUAAUGCUAAUUGUGAUAGGGGU; control mimic cel-67: UCACAACCUCCUAGAAAGAGUAGA) or anti-mmu-miR-155 (MIN0000165) or control anti-miR (1027271, both 25 nM, Qiagen) with N-Ter transfection reagent (Sigma). [score:1]
Thus, we speculate that the magnitude of depression of LXRα in miR-155 [−/−] is able to activate some but not all LXR dependent pathways. [score:1]
Here we report that absence of miR-155 in mice fed high fat diet was associated with significantly increased hepatic steatosis and serum VLDL/LDL cholesterol levels. [score:1]
Male C57BL/6 wild-type (WT) mice and miR-155 [−/−] mice (Jackson Labs) were bred in-house in a pathogen-free facility and fed normal chow or high fat diet (HFD; 0.15% cholesterol and 21% lard, Special Diet Services) ad libitum from 6 weeks old. [score:1]
Total cholesterol, HDL cholesterol and triglyceride levels in serum did not significantly differ between WT and miR-155 [−/−] mice (Table 1). [score:1]
Here we report for the first time that absence of miR-155 in mice fed HFD for 6 months is associated with a significant increase in hepatic steatosis, suggesting a protective role of miR-155 in liver lipid metabolism. [score:1]
To gain further insight into the mechanisms underlying such pleiotropic effects of miR-155 in liver we performed a microarray analysis comparing livers from HFD-fed WT and miR-155 [−/−] mice. [score:1]
Next, we tested the direct interactions of miR-155 with 3′UTR of these mRNAs in luciferase reporter assays. [score:1]
miR-155 [−/−] Mice are Susceptible to Hepatic Steatosis. [score:1]
0072324.g005 Figure 5(A) Schematic showing alignment of mouse and human LXR 3′UTR with the miR155 seed region highlighted. [score:1]
Mouse pGLO-(gene of interest) 3′UTR luciferase plasmids were co -transfected with miR-155 or scrambled (SCRAM) control mimic (40 nM) in HEK293 cells. [score:1]
Abundant lipid droplets were observed in livers of WT and miR-155 [−/−] mice fed HFD (Figure 2E). [score:1]
Hybridization with 5 nmol Locked Nucleic Acid 5′ and 3′ digoxigenin (DIG)-labeled scramble (AGAGCTCCCTTCAATCCAAA) or miR-155–specific (TATCACAATTAGCATTAA) probes (both from Exiqon) was performed at 48°C for 1 h. After hybridization, sections were washed SSC (5x, 1x then 0.2x each for 2 washings of 5 mins) at 48°C and a final wash in 0.2x SSC at RT for 5 min. [score:1]
Changes in the gross appearance of livers from miR-155 [−/−] mice were evident with yellow/brown coloration and visible surface nodules (Figure 2B). [score:1]
Liver triglyceride (Figure 2C) and total cholesterol (TC), free cholesterol (FC) and cholesterol ester (CE) levels were significantly increased in livers of miR-155 [−/−] mice vs WT fed HFD (Figure 2D). [score:1]
Figure S1 Absence of miR-155 does not affect fasting glucose levels or responses in an Insulin Tolerance Test. [score:1]
Flow cytometric and immunohistochemical analysis demonstrated that CD45 [+]F4/80 [+] macrophages did not differ in number between WT and miR-155 [−/−] livers (Figure 3A). [score:1]
Therefore, it was surprising that the insulin tolerance was not altered in the miR-155 [−/−] mice. [score:1]
[1 to 20 of 125 sentences]
3
[+] score: 378
Whether the drastic up-regulation of miR-155 in M1 macrophages is necessary to globally suppress many direct targets or very efficiently suppress a few key targets remains to be determined. [score:13]
wild-type (WT) M1 microarray data with miR-155 targets (high or moderate predicted targets and experimentally observed targets) that were down-regulated ≥2FC in WT M1 vs. [score:10]
Additionally, the miR Target Filter was used to identify potential direct miR-155 targets from the full list of microarray probes, identified as any genes that were down-regulated in the WT M1 vs. [score:9]
The miR-155 inhibitor suppressed Inos and Tnfa expression by 75% and 85%, respectively, in M1(LPS + IFN-γ) macrophages as compared to macrophages transfected with the scrambled inhibitor (Fig 3). [score:8]
To identify miR-155 targets that promoted the inflammatory M1(LPS + IFN-γ) phenotype when repressed, we searched for experimentally observed or high/moderate probability predicted miR-155 targets using the miR Target Filter function in IPA. [score:7]
When expression of these 370 candidate miR-155 target genes was compared between KO M1(LPS + IFN-γ) and KO M0 samples, we observed that ~80% of these genes were up-regulated (i. e., re -induced) to some extent in the absence of miR-155 (highlighted in red in Fig 7A) (FC>1; KO M1 vs. [score:7]
Indeed, macrophages from miR-155 knockout (KO) mice as well as wild-type (WT) macrophages treated with a miR-155 oligonucleotide inhibitor failed to express M1 macrophage markers, including Nos2, Tnfa and Il1b in response to stimulation with LPS + IFN-γ. [score:6]
Here, we show that rapid and robust M1(LPS+ IFN-γ)-selective up-regulation of miR-155 promotes Nos2, Tnfa and Il1b inflammatory gene expression, as well as their protein products. [score:6]
miR-155 targets up-regulated more than 2 fold-change in KOM1(LPS + IFN-γ) vs. [score:6]
This shift in the gene expression trend line shows that genes that are up- or down-regulated in WT M1 conditions are changed to a lesser extent in miR-155 KO macrophages. [score:6]
In conclusion, we have identified miR-155 as a pivotal regulator of the M1(LPS + IFN-γ) inflammatory macrophage signature and a potential therapeutic target in inflammatory diseases. [score:6]
It is still not known how miR-155 regulates inflammatory phenotype but miRNAs generally suppress gene expression. [score:6]
miR-155 targets down-regulated in WT M1 vs. [score:6]
To determine the global effect of miR-155 on regulating gene expression in M1 macrophages, we performed gene expression profiling on miR-155 KO macrophages. [score:6]
The fact that our in vitro data shows that miR-155 oligonucleotide inhibitors are capable of producing effects similar to a miR-155 deficiency in macrophages provides promise for designing therapeutic strategies aimed at dampening inflammatory macrophage -mediated disease. [score:5]
The convergence of multiple inflammatory pathways into miR-155 expression highlights the importance of what are the consequences of miR-155 expression on the inflammatory phenotype of macrophages. [score:5]
miR-155 deficiency restored Inpp5d, Tspan14 and Ptprj expression to WTM0 levels indicating that miR-155 is required for their suppression in M1(LPS + IFN-γ) macrophages. [score:5]
To reveal the temporal pattern of miR-155 expression during macrophage activation, we quantified the relative expression of miR-155 at 0, 6 and 24 hours post-stimulation (Fig 1B). [score:5]
Overall, our data support the hypothesis that inflammatory macrophage phenotype develops as a consequence of miR-155 -dependent suppression of genes that inhibit the M1(LPS + IFN-γ) phenotype. [score:5]
Further work to develop drugs or delivery systems that specifically target miR-155 signaling in macrophages will help translate these promising findings into new effective therapies. [score:5]
miR-155 had a strong influence on gene expression, controlling half of the 2FC M1(LPS + IFN-γ) signature, as well as milder widespread effects, modulating smaller gene expression shifts in the remainder of the M1(LPS + IFN-γ) signature. [score:5]
Expression of miR-155 in M1(LPS + IFN-γ) macrophages increased significantly (t-test, p<0.0001) and reached its maximum expression by 6 hours post-stimulation. [score:5]
Expression of M1 markers was also reduced with miR-155 oligonucleotide inhibitors, suggesting a central role of miR-155 in establishing the M1 phenotype. [score:5]
Maf, an experimentally proven miR-155 target [55], may mediate cytokine effects, as it directly represses IL-12 transcription and indirectly represses other inflammatory cytokines [60]. [score:5]
We confirmed that miR-155 is required to suppress validated miR-155 targets Inpp5d, Tspan14, Ptprj and Mafb in M1 macrophages. [score:5]
0159724.g003 Fig 3(A) Inducible nitric oxide synthase (Nos2) and (B) Tumor Necrosis Factor (Tnfa) expression was determined by Real-Time PCR in wild-type bone marrow-derived macrophages in vitro activated in M0 or M1 conditions for 24 hours and transfected with a scrambled (n = 3) or a miR-155 oligonucleotide inhibitor (n = 3–4). [score:5]
Real-Time PCR on independent datasets confirmed that miR-155 contributed to suppression of its validated targets Inpp5d, Tspan14, Ptprj and Mafb (Fig 7C–7F, respectively) in M1(LPS + IFN-γ) macrophages. [score:5]
As a key molecule driving inflammatory macrophage phenotype, miR-155 shows potential as a therapeutic target in a myriad of inflammatory diseases. [score:5]
miR-155 inhibitor reduces M1 marker expression. [score:5]
This indicates that loss of miR-155 gene regulation prevents the full down-regulation of M2(IL-4) genes that normally occurs under the influence of strong inflammatory activation signals including IFN-γ and LPS. [score:5]
In contrast, M2(IL-4) macrophages did not up-regulate miR-155 at any of these time points. [score:4]
To ensure that impaired gene expression in miR-155 -deficient macrophages was not caused by a defect in immune system development in genetically modified mice, we quantified the relative proportion of monocytes, macrophages, dendritic cells and polymorphonuclear cells in different lymphoid tissues of WT and miR-155 KO mice. [score:4]
However, miR-155 is unique in that it is very quickly (within 6 hours) and robustly (around a 100–180 FC increase) up-regulated during M1 differentiation. [score:4]
Among 5 miRNA important in inflammatory or LPS responses [32, 35– 37, 43], miR-155 was the most dramatically up-regulated in classically activated M1(LPS + IFN-γ) but not alternatively activated M2(IL-4) conditions. [score:4]
miR-155 -dependent M1 genes up-regulated more than 2 Fold Change (FC) in wild-type (WT) M1vs. [score:4]
0159724.g002 Fig 2 (A) Inducible nitric oxide synthase (Nos2), (B) IL1b, (C) Tumor Necrosis Factor-α (Tnfa) (H) and Arginase-1 (Arg1) expression was determined by Real-Time PCR in wild-type (WT, n = 8–11) and miR-155 knockout (KO n = 8–12) bone marrow-derived macrophages in vitro activated in M1 or M2 conditions for 24 hours in three independent experiments. [score:4]
3.1. miR-155 is selectively up-regulated in classically activated M1(LPS + IFN-γ) macrophages. [score:4]
For example, IFN-γ or TNF-α were shown to independently up-regulate miR-155 in the absence of LPS stimulus [49]. [score:4]
Reduced classically activated M1 marker expression in miR-155 knock-out (KO) macrophages. [score:4]
In contrast, miR-155 was not up-regulated in M2(IL-4) macrophages (1.0 ± 0.153) (Fig 1A). [score:4]
Additional work will be required to exactly quantify IFN-γ's synergistic role in miR-155 up-regulation and downstream effects on M1 phenotype. [score:4]
Interestingly, a miR-155/Akt2 positive feedback loop may exist, as Akt2 is required for complete miR-155 up-regulation [51]. [score:4]
Of these miRNAs, miR-155 was the most highly up-regulated in response to M1(LPS + IFN-γ) stimulation conditions (fold change (FC) ± standard deviation (SD) = 182 ± 13, ANOVA followed by post-hoc Bonferroni test p< 0.005). [score:4]
To reveal the scope of the M1(LPS + IFN-γ) macrophage signature that is completely dependent on miR-155 (no longer 2FC up- or down-regulated in KO macrophages), the previously defined WT M1(LPS + IFN-γ) signature [17] (M1 Up Signature shown in red and M1 Down Signature shown in blue) was highlighted on the KO M1 vs. [score:4]
Interestingly, KO M1(LPS + IFN-γ) macrophages clustered more closely with WT M0 or KO M0 macrophages than with WT M1(LPS + IFN-γ) macrophages through this analysis, suggesting a link between the pattern of expression of this group of genes and the switch from M0 to M1(LPS + IFN-γ) inflammatory phenotype that is mediated by miR-155. [score:3]
Next, an oligonucleotide -based inhibitor was used to block miR-155 in WT macrophages during induction of the M1(LPS + IFN-γ) phenotype. [score:3]
Discovery of miR-155 target mRNAs repressed in M1(LPS + IFN-γ) macrophages. [score:3]
miR-155 is required for expression of the full classically activated macrophage signature. [score:3]
3.3. miR-155 is necessary for the full expression of the M1(LPS + IFN-γ) macrophage signature. [score:3]
Utilizing standard 2FC threshold values (red lines in Fig 5A) is helpful to identify WT M1(LPS + IFN-γ) signature genes that fully require miR-155 for expression. [score:3]
Genetic miR-155 deficiency abrogates expression of classically activated M1 macrophage markers. [score:3]
Although it is known that miR-155 is important in regulating inflammation [48], its key function in regulating distinct macrophage effector cells is novel. [score:3]
However, the level of expression of these markers resembled more that of an M0 than an M2 macrophage, supporting that miR-155 is required for M1 differentiation and that its loss maintains macrophages in a more M0-like state. [score:3]
Among the most repressed miR-155 targets we confirmed we found Inpp5d, Tspan14, Ptprj and MafB [52– 55]. [score:3]
Among the top miR-155 inversely correlated genes that may mediate these effects, we identified and validated miR-155 targets Inpp5d, Tspan14, Ptprj and MafB. [score:3]
As a control, macrophages were transfected with a scrambled oligonucleotide inhibitor that lacks specificity for miR-155. [score:3]
Additionally, expression of downstream effector molecules associated with inflammatory responses and bacterial killing, such as IL-1β, IL-6, TNF-α, NO and IL-12, were miR-155 dependent. [score:3]
Increased alternatively activated macrophage gene expression in classically activated miR-155 deficient macrophages. [score:3]
WT M0 were considered potential direct targets of miR-155. [score:3]
The M2-exclusive marker Egr2 [17] was also less suppressed in miR-155 KO macrophages. [score:3]
These results corroborate recent findings, which showed that miR-155 was differentially expressed in murine [45] and human [46, 47] M1 and M2 macrophages. [score:3]
Published data support that miR-155 plays a similar role in in vivo inflammatory disease mo dels. [score:3]
The loss of these miR-155 targets in inflammatory M1(LPS + IFN-γ) macrophages may mediate miR-155 dependent increases in inflammatory mediators and costimulatory/adhesion molecules. [score:3]
Since Akt2 is known to be required for M1 polarization [51], it is possible that miR-155 -mediated suppression of Inpp5d/S and Ptprj in M1(LPS + IFN-γ) macrophages promotes Akt2 signaling. [score:3]
Accordingly, we observed a complete lack of expression of IL-12 in any conditions except for WT M1(LPS + IFN-γ) macrophages (S3 Table), suggesting this is an important link in inflammatory phenotype mediated by miR-155. [score:3]
This indicates that, besides the large ≥2FC effects previously identified in Fig 4, miR-155 has a widespread dampening effect on the magnitude of gene expression changes caused by macrophage stimulation in M1 conditions. [score:3]
miR-155 KO macrophages showed striking reductions in expression of the three M1 genes and the proteins/effector molecules they encode (reduced up to 72%) (Fig 2A–2F). [score:3]
The mRNA profiling data provided an opportunity to identify basic M1 macrophage “functions” that are dependent on miR-155 expression. [score:3]
In WT M1(LPS + IFN-γ) macrophages–in which miR-155 is strongly induced–we identified 370 predicted or proven miR-155 target genes that are decreased to some extent. [score:3]
We analyzed expression of miR-27b, miR-29b, miR-155, miR-124 and miR-223 in bone marrow-derived mouse macrophages differentiated in M0 (unstimulated), M1(LPS + IFN-γ) and M2(IL-4) conditions. [score:3]
Identification of candidate miR-155 targets associated with M1 phenotype. [score:3]
Induction of microRNA-155 is TLR- and type IV secretion system -dependent in macrophages and inhibits DNA-damage induced apoptosis. [score:3]
Our data show that miR-155 controls expression of ~51% of all genes that define the M1(LPS+IFN-γ) phenotype. [score:3]
Power Inhibitor sequence were GTGTAACACGTCTATACGCCCA for nonsense control (NS) (Exiqon 199020–00) and GTGTAACACGTCTATACGCCCA for miR-155 (Exiqon 428232–00). [score:3]
Comparative transcriptional profiling of unstimulated and M1(LPS + IFN-γ) macrophages derived from wild-type (WT) and miR-155 knockout (KO) mice revealed that half (approximately 650 genes) of the signature previously identified in WT M1(LPS + IFN-γ) macrophages [17] was dependent on miR-155. [score:2]
Myeloid cell populations in lymphoid tissues in miR-155 knockout mice. [score:2]
We also evaluated the effect of miR-155 loss on 15 genes that we recently found to be exclusively upregulated in M1(LPS + IFN-γ) macrophages [17]. [score:2]
Classically activated macrophage signature in wild-type and miR-155 knockout macrophages. [score:2]
Several genes involved in TLR and IFN-γ receptor (IFN-γR) signaling also were regulated by miR-155. [score:2]
miRNA expression was determined by Taqman Real-Time PCR using miR-27, miR-29b, miR-155, miR-223, miR-124 and sno-202 primer and probe sets (Life Technologies), according to manufacturer’s instructions. [score:2]
Our data indicate that miR-155 plays a critical role in development of inflammatory M1(LPS + IFN-γ) responses, with particular emphasis on NO and IL-12 signaling pathways. [score:2]
Overall, these data point to a large and central role of miR-155 in regulating M1 phenotype. [score:2]
This suggests that the typical M1(LPS + IFN-γ) phenotype requires direct repression of hundreds of genes by miR-155. [score:2]
In most cases, these genes were found under the 2FC line (Fig 4C), indicating that their induction is highly dependent on miR-155. [score:1]
Similarly, we found no differences in the percentages of CD11b [+]F480 [+] percentage obtained for WT and miR-155 KO BMDMs (data not shown). [score:1]
Since the markers examined correspond to only a small portion of the M1(LPS + IFN-γ) signature, it is likely that miR-155 has more wide-ranging effects on the inflammatory M1 signature. [score:1]
Total RNA was prepared from bone marrow-derived macrophages of 3 WT and 3 miR-155 KO mice treated in M0 or M1 conditions (as defined in M&M section 2.2) for 24 hours using the miRVana isolation kit (Ambion). [score:1]
miRNA mimic sequences/catalog number were AM17111 for miR control and UUAAUGCUAAUUGUGAUAGGGGU/AM17100 for miR-155. [score:1]
Collectively, these data indicate that induction of miR-155 is specifically associated with differentiation of classically activated M1(LPS + IFN-γ) macrophages. [score:1]
miR-155 drives the inflammatory effects of TREM-1 in acute lung injury [65], mediates TNF-α, IL-1β and ROS in ischemia reperfusion injury [66] and promotes autoimmune lupus [67] and inflammation -induced neurological dysfunction [68]. [score:1]
Mo del of molecules involved in miR-155 dependent M1 activated transcriptional networks, identified by Ingenuity Pathway Analysis. [score:1]
Elegant studies by O’Connell et al have shown that microbial and pro-inflammatory stimuli independently promote miR-155 [49]. [score:1]
Conversely, it may be beneficial to enhance miR-155 activity to improve resistance to infections. [score:1]
miR-155 is associated with the classically activated macrophage phenotype. [score:1]
To determine if miR-155 loss promotes an M2 macrophage phenotype under inflammatory conditions, we highlighted a number of previously described M2 macrophage markers [14] (in blue, listed in S4 Table) on the FC vs. [score:1]
This highlighted the strong inverse relationship between miR-155 and its repressed genes, as well as an inverse relationship between miR-155 repressed genes and IPA-selected M1(LPS + IFN-γ) Up genes (Fig 7B). [score:1]
BMDM isolated from WT (n = 5) or miR-155 KO (n = 5) mice were kept unstimulated (M0) or stimulated in M1(LPS + IFN-γ) or M2(IL-4) conditions for 24 hours. [score:1]
Here, we report that miR-155 is critically important for controlling the signature of inflammatory M1(LPS + IFN-γ) macrophages. [score:1]
In conclusion, we have identified miR-155 as a small RNA that has a critical defining effect on the inflammatory M1 macrophage response. [score:1]
Overall, miR-155 is downstream of many inflammatory stimuli via NF-kB and other pathways [49]. [score:1]
Overall, miR-155 deficiency resulted in loss of 51% of the M1 signature. [score:1]
miR-155 dependent M1 signature transcriptional networks. [score:1]
In Akt2 KO mice, such lack of miR-155 decreased M1 and promoted M2 phenotype in a CEBPβ -dependent manner [51]. [score:1]
A Core Analysis was run on this data set to determine the pathways most affected by the loss of miR-155. [score:1]
Wild-type (WT) or miR-155 KO (B6. [score:1]
The miR-155 dependent M1(LPS + IFN-γ) signature is enriched in inflammatory signaling pathways. [score:1]
Genetic loss-of-function experiments were used to determine whether markers of inflammatory macrophage phenotype are dependent on miR-155 by using the M1(LPS + IFN-γ) M1 macrophage mo del [8– 12]. [score:1]
Ingenuity Pathway Analysis (IPA) was applied to the 2FC Up and Down signature M1(LPS + IFN-γ) signature genes that were no longer induced or repressed in KO M1(LPS + IFN-γ) macrophages, revealing that the genes promoted by miR-155 (red molecules designated in Fig 6) encode proteins critical for pathways involved in bactericidal functions, inflammatory responses and costimulation and enhancement of B and Th1 T lymphocyte responses. [score:1]
The bone marrow, lymph nodes and spleen of WT and miR-155 KO mice (n = 6-9/mice/group, three independent experiments) were harvested and processed to a single cell suspension. [score:1]
However, we suspected miR-155 also had subtler, but no less important, quantitative effects on the inflammatory M1 signature. [score:1]
No significant differences in CD11b [+]F480 [+] percentage were observed between WT and miR-155 KO BMDMs (WT: 80 ± 2.3, n = 4, KO: 78 ± 1.5, n = 4, t test p = NS; one experiment representative of 3 independent experiments with n≥3 each). [score:1]
Restoring miR-155 in miR-155 KO macrophages recovered inflammatory cytokine production (Fig 2G). [score:1]
This is consistent with reports that miR-155 is downstream of several molecules necessary for induction of the M1 phenotype, such as TLRs [50] or Akt2 activity [51]. [score:1]
Overall, these data identify various candidate genes that may mediate inflammatory M1(LPS + IFN-γ) phenotype when repressed by miR-155. [score:1]
To reveal these additional effects of miR-155 deletion, we used a FC vs. [score:1]
[1 to 20 of 115 sentences]
4
[+] score: 376
Other miRNAs from this paper: hsa-mir-155
The Expression Levels of the Majority of miR-155 Target Genes in the Spleen Tissue Were Reduced in AA Genotype Kunming Mice Compared With BB Genotype Kunming MiceTo further analyze the difference in miR-155 expression between the AA and BB genotypes, we analyzed the expression profiles of its target genes. [score:10]
After a relatively long period of LPS exposure, many pro-inflammatory and anti-inflammatory factors may intervene in the expression of miR-155 target genes, which could also weaken the genotype effect on the differential expression of miR-155. [score:7]
Equal volumes of RNA from three individuals harboring each genotype who were exposed to LPS for 0, 4, or 8 h were pooled together, and the expression profiles of miR-155 target genes were predicted using TargetScan software and were determined using RNA-seq. [score:7]
Protein Levels of Two Important miR-155 Target Genes Significantly Differed between the Two Genotypes of Kunming MiceTo further confirm the differential expression of miR-155 between the two genotypes of mice, we measured the protein expression of two miR-155 target genes, SHIP1 and PU. [score:7]
We further analyzed the signaling pathways regulated by the 20 downregulated miR-155 target genes [fold-change (FC) ≥ 1.2] at 4 h of LPS exposure using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database (Figure 6E). [score:7]
To further analyze the difference in miR-155 expression between the AA and BB genotypes, we analyzed the expression profiles of its target genes. [score:7]
In addition, the dual-luciferase assay results indicated that both the A and B haplotype constructs inhibited the expression of the miR-155 target genes Tab2, Bach1, Ikbke, and Map3k14. [score:6]
The dual-luciferase assay results indicated that the pEGFP-C1-h/h1/h2/h3/h4 constructs inhibited the expression of the human miR-155 target genes Tab2, Bach1, Ikbke, and Map3k14. [score:6]
Figure 6Comparisons of the expression levels of miR-155 target genes in spleen tissue. [score:5]
The expression of miR-155 target genes differed between the two genotypes under normal and LPS stimulation conditions in mice. [score:5]
The pEGFP-C1-A and pEGFP-C1-B constructs were then transfected into BHK-21 cells, and the expression of miR-155 was analyzed after 24 h. (C) Real-time PCR was performed to detect the expression of miR-155 after transfection of the pEGFP-C1-A/B construct. [score:5]
Two SNPs in the miR-155 Haplotype Affected miR-155 Expression in MiceTo further explore whether functional SNPs in the haplotype contributed to the different expression levels of the mouse miR-155 gene, we designed a series of mutant constructs (M1–M7). [score:5]
To confirm the differential protein expression of the two important hematopoietic-related miR-155 target genes between the two genotypes of mice, spleen tissue extracts were fractionated according to molecular weight via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to a polyvinylidene difluoride (PVDF) membrane using a semidry transfer apparatus (Bio-Rad, USA). [score:5]
Overexpression of miR-155 in normal human CD34 [+] peripheral blood stem cells (PBSCs) significantly inhibited the generation of myeloid and erythroid colonies (3). [score:5]
The expression of pre- miR-155 and mature miR-155 from the A haplotype construct was significantly higher by approximately 1.5-fold than their expression from the B haplotype construct (P < 0.05) (Figures 8A,B). [score:5]
These results indicated that most of the miR-155 target genes were downregulated at 0 and 4 h of LPS exposure in the AA genotype mice compared with the BB genotype mice. [score:5]
The 256-bp mouse miR-155 expression cassette containing the entire pre- miR-155 sequence and partial flanking regions was inserted into the 3′ untranslated region (UTR) of the green fluorescent protein (GFP) gene in the pEGFP-C1 vector (BD Biosciences Clontech, USA). [score:5]
To further confirm the differential expression of miR-155 between the two genotypes of mice, we measured the protein expression of two miR-155 target genes, SHIP1 and PU. [score:5]
The Expression Levels and Functions of miR-155 Varied According to Its SNPsTo further confirm the differential expression of miR-155 between the A and B haplotypes in mice, we cloned the 256-bp DNA fragment that contained the entire pre- miR-155 sequence into the pEGFP-C1 vector. [score:5]
However, the other two constructs did not have clear effects on the expression of these four miR-155 target genes (Figure 8E). [score:5]
DNA Construction of Different miR-155 SNPsThe 256-bp mouse miR-155 expression cassette containing the entire pre- miR-155 sequence and partial flanking regions was inserted into the 3′ untranslated region (UTR) of the green fluorescent protein (GFP) gene in the pEGFP-C1 vector (BD Biosciences Clontech, USA). [score:5]
Figure 7Comparative analysis of the protein expression of miR-155 target genes in Kunming mice. [score:5]
Moreover, we found in both genotypes that the differences in the expression of miR-155 target genes peaked at 4 h of LPS exposure, and that these differences nearly completely disappeared at 8 h of LPS exposure. [score:5]
These results indicated that miR-155 was rapidly upregulated under LPS treatment, and that AA genotype mice exhibited increased miR-155 expression compared with BB genotype mice under both LPS treatment and non-treatment conditions. [score:5]
Many target genes of miR-155 have been identified, and most of these genes are essential to hematopoietic development. [score:4]
miR-155 was observably upregulated at 4 h of LPS exposure. [score:4]
The results showed that miR-155 was upregulated sharply, reaching its highest level at 8 h of LPS exposure, and then declined to approximately the normal level at 24 h of LPS exposure in the spleen and lung tissues. [score:4]
One previous study indicated that miR-155 was upregulated via the MAPK/NFκ B signaling pathway in RAW 264.7 macrophages in response to stimulation with adiponectin (43). [score:4]
The results of this point mutation analysis confirmed that the two middle SNPs contributed to the differential expression of the mouse miR-155 gene between the A and B haplotypes. [score:4]
Previous studies also found that miR-155 is rapidly upregulated by LPS, poly(I:C), or IFNβ treatment (17, 39, 40). [score:4]
The expression Level of miR-155 Is Increased in AA Genotype Kunming Mice Compared With BB Genotype Kunming MiceThe expression levels of miR-155 in the spleen and lung were detected by northern blotting. [score:4]
The Expression Levels of the Majority of miR-155 Target Genes in the Spleen Tissue Were Reduced in AA Genotype Kunming Mice Compared With BB Genotype Kunming Mice. [score:4]
Other studies demonstrated that upregulation of miR-155 could persist for greater than 24 h after LPS treatment in RAW 264.7 macrophages (41, 42); that finding was not consistent with our results. [score:4]
Figure 5The expression of miR-155 was higher in AA genotype Kunming mice than in BB genotype Kunming mice. [score:3]
Then, the expression levels of pre- miR-155 and mature miR-155 were detected by northern blotting. [score:3]
Melting curves were obtained by increasing the temperature from 58 to 95°C at 0.5°C/s and then holding for 10 s. The U6 or tubulin gene was used as an internal control for the genes expression of miR-155, SHIP1, and PU. [score:3]
The inserted fragments contained the validated miR-155 binding sites located at the 3′UTR of the respective target genes. [score:3]
To further confirm the differential expression of miR-155 between the A and B haplotypes in mice, we cloned the 256-bp DNA fragment that contained the entire pre- miR-155 sequence into the pEGFP-C1 vector. [score:3]
miR-155 participates in the regulation of the development of many specific T lymphocyte subsets (2, 8, 36, 37). [score:3]
2014.12.1252 43 Subedi A Park PH Autocrine and paracrine modulation of microRNA-155 expression by globular adiponectin in RAW 264.7 macrophages: involvement of MAPK/NF-kappaB pathway. [score:3]
Notably, the pEGFP-C1-h2 and pEGFP-C1-h3 constructs had significantly weaker effects on these four miR-155 target genes than pEGFP-C1-h (P < 0.05). [score:3]
These results were consistent with the differential expression of miR-155 between the two genotypes. [score:3]
The results showed that the TCR, BCR, MAPK, insulin, and Wnt pathways as well as various cancer signaling pathways were targeted by miR-155 (Figure 6D, Table S4 in). [score:3]
Moreover, miR-155 expression was rapidly altered by LPS stimulation. [score:3]
Similarly, the middle two SNPs, especially the third SNP, weakened the effects of human miR-155 gene on all the tested target genes. [score:3]
Furthermore, we found that miR-155 expression began to decline at approximately 10 h of LPS exposure and had returned to normal levels at 24 h of LPS exposure. [score:3]
Two SNPs in the miR-155 Haplotype Affected miR-155 Expression in Mice. [score:3]
U6 was used as an internal control for the expression of the mouse miR-155 gene. [score:3]
The miR-155 expression levels, blood parameters, and inflammatory responses differed between mice harboring different haplotypes. [score:3]
We deduced that the middle two SNPs decreased the expression of mature miR-155 in humans. [score:3]
Two SNPs, one located in the stem–loop and the other located near the 3′ end of pre- miR-155, were confirmed to be responsible for the differential expression of miR-155. [score:3]
The Expression Levels and Functions of miR-155 Varied According to Its SNPs. [score:3]
To further explore whether functional SNPs in the haplotype contributed to the different expression levels of the mouse miR-155 gene, we designed a series of mutant constructs (M1–M7). [score:3]
For analysis of miR-155 expression in vitro, the pEGFP-C1-A, pEGFP-C1-B, pEGFP-C1-M1–M7, and pEGFP-C1 empty constructs were transfected into BHK-21 cells at equal plasmid DNA concentrations. [score:3]
One of the pEGFP-C1-h/h1/h2/h3/h4 constructs was co -transfected into BHK-21 cells with one of the psi-check2- hTab2/hBach1/hIkbke/hMap3k14 constructs harboring the miR-155 binding site amplified from the 3′-untranslated region (UTR) of these four human genes. [score:3]
The expression of miR-155 was normalized to that of U6, and the results are presented as the means ± SEM (n = 5). [score:3]
Therefore, the genotype effects on the differential expression of miR-155 were reduced. [score:3]
Two functional SNPs were identified in both humans and mice; these SNPs were responsible for altering the expression levels of mature miR-155 and modulating miR-155 -mediated immune responses. [score:3]
miR-155 is derived from the non-coding transcript of the proto-oncogene B-cell integration cluster (bic) and is highly expressed in activated B and T cells as well as active macrophages and dendritic cells (DCs) (2). [score:3]
Moreover, miR-155 expression in spleen tissue of AA genotype mice was approximately 1.5- to 2-fold higher than that of BB genotype mice at 0 and 8 h of LPS exposure. [score:3]
Figure 9Two important SNPs in the haplotype can affect the expression of miR-155 in mice. [score:3]
The expression levels of miR-155 in the spleen and lung were detected by northern blotting. [score:3]
One possible reason for this result may be that miR-155 expression reaches a very high level in both genotypes at 8 h of LPS exposure. [score:3]
The expression level of miR-155 was detected by northern blotting 24 h after transfection. [score:3]
Thus, we deduced that these two SNPs could affect the expression of miR-155 by interfering with RNA digestion by Dicer or Drosha in mice. [score:3]
These results indicated that the different expression levels of miR-155 were not sufficient to affect growth under normal conditions but could cause observable phenotypic differences under pathological conditions. [score:3]
Moreover, the Q-PCR results confirmed that miR-155 expression from the A haplotype construct was significantly higher than that from the B haplotype construct (P < 0.05) (Figure 8C). [score:3]
Our study provides the first evidence that natural miR-155 SNPs can affect its expression and the host immune response. [score:3]
These results indicated that miR-155 can participate in the immune response by targeting numerous pathways. [score:3]
The trend of miR-155 expression following LPS treatment was similar in between AA and BB genotype mice (Figures 5A,B). [score:3]
The expression level of the mouse miR-155 gene decreased when these two SNPs of the A haplotype were converted to the corresponding nucleotide in the B haplotype and increased when these two SNPs of the B haplotype were converted to the corresponding nucleotide in the A haplotype. [score:3]
Moreover, we confirmed that two important SNPs in the haplotypes were responsible for the differential expression of miR-155 in mice. [score:3]
Protein Levels of Two Important miR-155 Target Genes Significantly Differed between the Two Genotypes of Kunming Mice. [score:3]
The pEGFP-C1-A/B construct was co -transfected into BHK-21 cells with one of the psi-check2- mTab2/mBach1/mIkbke/mMap3k14 constructs harboring the miR-155 binding site amplified from the 3′-untranslated region (UTR) of these four mouse genes. [score:3]
Thus, we hypothesized that a high mutation rate of miR-155 may also be beneficial for the adaptive immunity of the host. [score:2]
Our findings provide new evidence of the functional SNPs of miR-155 and their effects on miR-155-regulated immune responses. [score:2]
Few studies have focused on the regulation of blood parameters by miR-155. [score:2]
Many studies have confirmed that miR-155 plays important roles in the development and activation of immune-related cells. [score:2]
Previous studies have shown that miR-155 can directly repress the C/EBPβ, PU. [score:2]
The expression of miR-155 was significantly increased in the AA genotype mice compared with the BB genotype mice (P < 0.05). [score:2]
Additionally, miR-155 expression in the lung tissue was significantly increased in AA genotype mice compared with BB genotype mice at 0 and 8 h of LPS exposure (Figures 5C–H). [score:2]
The expression Level of miR-155 Is Increased in AA Genotype Kunming Mice Compared With BB Genotype Kunming Mice. [score:2]
These studies indicate that miR-155 plays crucial roles in immune cell development and immune responses. [score:2]
The expression of miR-155 from the M2, M3, and M5 constructs was significantly reduced compared with that from the A haplotype construct (Figures 9E,F). [score:2]
The abundance of T regulatory cells was significantly reduced in the thymus, spleen, and lymph nodes of miR-155 -deficient mice (7). [score:2]
The high mutation rates of miR-155 remind us of classic immune-related MHC genes. [score:2]
The expression of miR-155 from the M1 and M4 constructs was similar to that from the A haplotype construct and was significantly increased compared with that from the B haplotype construct (Figures 9C,D). [score:2]
Additionally, some studies indicated that certain mutations of miR-155 were associated with trisomy 21 (44), eczema (45), and multiple sclerosis (46) in clinic. [score:2]
In this study, we also found that miR-155 was associated with various blood parameters in mice. [score:1]
miR-155 -deficient DCs failed to efficiently present antigens (4). [score:1]
Moreover, these two SNPs affected the functions of human miR-155. [score:1]
In vitro experiments indicated that the A haplotype construct generated more mature miR-155 than the B haplotype construct. [score:1]
The 255-bp human miR-155 fragments were inserted into the 3′UTR of the GFP gene as performed on mouse miR-155. [score:1]
DNA Construction of Different miR-155 SNPs. [score:1]
In our study, we found specific functional SNPs in human miR-155. [score:1]
Identification of miR-155 SNPs in Mice and Humans. [score:1]
In total, 720 SNPs were found in the 15-kb human genomic DNA fragment containing miR-155 (18, 19). [score:1]
The normal and four mutant constructs of human miR-155 gene were generated and were labeled as pEGFP-C1-h or pEGFP-C1-h1–4, respectively. [score:1]
The 255-bp human DNA fragments, including the SNP sites of miR-155, were inserted into the pEGFP-C1 vector; the resulting constructs were labeled as pEGFP-C1-h/h1/h2/h3/h4. [score:1]
Bioinformatics analysis results showed that the RNA secondary structures of the Dicer/Drosha digestion sites of in pre- miR-155 were affected by these two SNPs in mice (Figure 1B). [score:1]
Moreover, Th2 polarization and Th2 cytokine levels were significantly increased in CD4 [+] T cells derived from miR-155 -deficient mice (4, 5). [score:1]
Furthermore, the second SNP affected the function of the human miR-155 gene, although no evident structural variation was observed based on RNAfold analysis (Figure 2B). [score:1]
Notably, the miR-155 gene contains abundant SNPs. [score:1]
Identification of miR-155 Polymorphisms. [score:1]
A 255-bp DNA fragment containing human pre- miR-155, including the four SNPs of interest, was inserted into the pEGFP-C1 vector. [score:1]
Figure 2Identification of SNPs of the human miR-155 gene and the corresponding secondary RNA structures. [score:1]
The roles of these SNPs in miR-155 expression and the immune response were further investigated. [score:1]
This finding indicated that the differences in miR-155 and blood parameters were not influenced by body growth under normal conditions. [score:1]
In humans, according to results of 1,000 human genomic sequence, four SNPs located in the pre- miR-155 regions were identified (Figure 2A, Supplementary Figure 2). [score:1]
Figure 1Identification of the two haplotypes of the mouse miR-155 gene and the corresponding secondary RNA structures. [score:1]
Identification of miR-155 SNPs in Mice and HumansIn mice, a 256-bp genomic fragment of miR-155 was amplified using DNA samples from non-biologically related Kunming (n = 25) and C57BL/6 mice (n = 20). [score:1]
Furthermore, according to our signaling pathway analysis, miR-155 was involved in the TCR and BCR signaling pathways. [score:1]
The hybridization probe sequence was complementary to the mature form of miR-155 (Table S1 in) and was labeled with γ- [32]P. After washing, the membranes were imaged using a phosphor imager (Bio-Rad, USA). [score:1]
In mice, the 256-bp DNA fragment containing the mature miR-155 sequence was amplified using DNA samples from C57BL/6 and Kunming mice. [score:1]
Identification of miR-155 PolymorphismsFor identification of polymorphism in human miR-155, the data of 1,000 genome sequence were examined (18, 19). [score:1]
Fewer Th17 and Th1 cells were present in the spleen and lymph nodes under experimental autoimmune encephalomyelitis in miR-155 -deficient mice (6). [score:1]
In Sus scrofa (pig), one SNP of miR-155 was associated with blood parameters (38). [score:1]
According to these results, two SNPs in miR-155, one in the loop region of miR-155 and the other near the 3′ end of pre- miR-155, influenced the secondary structure of pre- miR-155 in mice (Figure 1B). [score:1]
The structure of human pre- miR-155 was changed by the third SNP according to the RNAfold results. [score:1]
In addition, we found that mice harboring the AA genotype of miR-155 have stronger inflammatory response under LPS treatment. [score:1]
The roles of miR-155 in these signaling pathways were confirmed in previous studies (4, 36, 40). [score:1]
Figure 8Examination of the effects of different SNPs in mouse and human miR-155 in vitro. [score:1]
In this study, we identified four SNPs in the 256-bp DNA fragment containing the miR-155 gene in mice. [score:1]
The expression of miR-155 from the M6 and M7 constructs was significantly increased compared with that from the B haplotype construct but was slightly reduced compared with that from the A haplotype construct (Figures 9G,H). [score:1]
In addition, miR-155 deficiency impairs CD8 [+] T cell proliferation (2), and miR-155 is essential for promoting the clonal expansion, survival, and memory generation behavior of CD8 [+] T cells during antiviral and antibacterial responses (8). [score:1]
Additionally, four SNPs were identified in the human pre- miR-155 based on sequencing data for 1,000 human genomes. [score:1]
Previous studies confirmed that miR-155 plays crucial roles in the immune response (22, 23). [score:1]
U6 was used as a control and was detected in a manner similar to miR-155. [score:1]
Of these four SNPs, only the third SNP changed the secondary structure of pre- miR-155 (Figure 2B). [score:1]
Additionally, the amount of IgG1 produced by B cells following stimulation with lipopolysaccharide (LPS) and interleukin 4 (IL-4) was significantly reduced by miR-155 deficiency (4). [score:1]
The secondary structures of miR-155 containing different SNPs were predicted using mfold (http://unafold. [score:1]
We also found that miR-155 was involved in the MAPK, insulin, and Wnt signaling pathways. [score:1]
The miR-155 levels were significantly different between these two haplotypes. [score:1]
For identification of polymorphism in human miR-155, the data of 1,000 genome sequence were examined (18, 19). [score:1]
In conclusion, we identified two natural functional SNPs of miR-155 in both humans and mice. [score:1]
Thus, we concluded that miR-155 acts during the acute phase of the immune response. [score:1]
These results indicated that miR-155 degraded rapidly in the host. [score:1]
In mice, a 256-bp genomic fragment of miR-155 was amplified using DNA samples from non-biologically related Kunming (n = 25) and C57BL/6 mice (n = 20). [score:1]
The first SNP was located in the mature miR-155 region, the second in the stem–loop regions of miR-155, and the third and the fourth in the miR-155* region. [score:1]
The mature miR-155 sequences are highlighted in bright red. [score:1]
[1 to 20 of 140 sentences]
5
[+] score: 369
T-bet expression is shown relative to scrambled ctrl OT-I. miR-155 Regulating SHIP-1 Expression in Anti-Viral CD8 [+] T Cells Modulating T-Bet LevelsAs T-bet is not predicted to be a direct target of miR-155, we reasoned that miR-155 was regulating T-bet expression indirectly. [score:13]
miR-155 overexpression induced enhanced T-bet expression and downregulated the inhibitory phosphatase SH2 (Src homology 2)-containing inositol phosphatase-1 (SHIP-1). [score:10]
As miR-155 overexpression led to decreased SHIP-1 protein expression and microarray analysis had previously identified a modest (1.20-fold, p = 0.01) upregulation of SHIP-1 mRNA in miR-155 -deficient CTL after 3 days of in vitro activation (16), we sought to assess SHIP-1 protein expression in miR-155 -deficient CTL. [score:10]
Overexpression of miR-155 Altering the Transcription Factor Profile of Memory CD8 [+] T Cells Enhancing the Expression of T-Bet and Blimp-1Since transcription factors such as T-bet, Eomes, Blimp-1, and Bcl-6 are important regulators of CD8 [+] T-cell memory generation (4) and miR-155 overexpression promoted effector memory CTL formation, we examined the transcription factor profile of miR-155 -overexpressing memory CTL. [score:10]
T-bet expression is shown relative to scrambled ctrl OT-I. As T-bet is not predicted to be a direct target of miR-155, we reasoned that miR-155 was regulating T-bet expression indirectly. [score:10]
Western blot analysis (Figure 6B) and intracellular flow cytometry staining (Figures 6C,D) of miR-155-OE OT-I CD8 [+] T cells revealed that miR-155 overexpression resulted in significantly decreased (p < 0.0001) SHIP-1 protein expression in anti-viral CTL on days 9–10 post-influenza virus infection, demonstrating that like T-bet, SHIP-1 expression is modulated at the translational level in miR-155-OE CD8 [+] T cells. [score:9]
SHIP-1 is a bona fide direct target of miR-155 and this downregulation has been shown to play an important functional role in many immune cell subsets including macrophages (26), NK cells (34), and dendritic cells (35) and SHIP-1 levels have been reported to be modulated in CTL by miR-155 overexpression (20). [score:9]
Overexpression of miR-155 Altering the Transcription Factor Profile of Memory CD8 [+] T Cells Enhancing the Expression of T-Bet and Blimp-1. miR-155 Regulating SHIP-1 Expression in Anti-Viral CD8 [+] T Cells Modulating T-Bet Levels. [score:8]
We show that T-bet is indirectly targeted by miR-155 via miR-155’s repression of its direct target SHIP-1. Our studies reveal an unexpected miR-155/SHIP-1/T-bet axis in CTL immunity to viral infection that may play a pivotal role in CTL immunity in the context of infection and cancer. [score:7]
We found that day 10 in vivo miR-155-OE OT-I CD8 [+] T cells express more T-bet protein compared with scrambled ctrl OT-I in the lungs (p = 0.01) (Figures 3B,C) and spleen (p = 0.005) (Figure 3D), indicating that T-bet expression in miR-155-OE OT-I CD8 [+] T cells may be regulated at the translational level as a significant difference was observed only at the protein level and not at the level of mRNA. [score:7]
The link between miR-155 overexpression and T-bet upregulation is essential for the expansion of effector CTL. [score:6]
Since miR-155 is upregulated in effector CTL and we have previously shown that the absence of miR-155 significantly reduces effective CTL responses to infection (16), we argued that its forced overexpression would enhance the CTL response. [score:6]
To the best of our knowledge, this is the first report that miR-155 can regulate T-bet expression in CTL and miR-155 overexpression leads to increased numbers of effector CTL and a skewing of CTL memory to an effector memory phenotype. [score:6]
Figure 3The transcription factor T-bet upregulated in miR-155 -overexpressing anti-viral CD8 [+] T cells. [score:6]
Here, we report that SHIP-1 can be downregulated in CTL as a result of miR-155 overexpression, while miR-155 deficiency leads to increased SHIP-1 levels. [score:6]
Thus, T-bet expression can be controlled by miR-155 via SHIP-1 signaling and we have revealed a novel regulatory pathway for T-bet expression as well as effector and memory CTL generation. [score:6]
Since transcription factors such as T-bet, Eomes, Blimp-1, and Bcl-6 are important regulators of CD8 [+] T-cell memory generation (4) and miR-155 overexpression promoted effector memory CTL formation, we examined the transcription factor profile of miR-155 -overexpressing memory CTL. [score:6]
Importantly, we show that SHIP-1 regulated T-bet expression and promoted the effector responses in miR-155 -overexpressing CTL. [score:6]
Indeed, we report that the modulation of T-bet levels by miR-155 is mediated by miR-155’s direct target SHIP-1. The relationship between SHIP-1 and T-bet has been previously demonstrated by Tarasenko et al. who observed that SHIP-1 -deficient CD8 [+] T cells expressed 60% more T-bet than control CD8 [+] T cells (31). [score:6]
Taken together, these data provide further support that miR-155 modulates T-bet expression via SHIP-1. Figure 6SHIP-1 downregulated by miR-155 in anti-viral CTL. [score:6]
Taken together, these data provide further support that miR-155 modulates T-bet expression via SHIP-1. Figure 6SHIP-1 downregulated by miR-155 in anti-viral CTL. [score:6]
We did not observe any differences in the activation state (as assessed by CD25 and CD69 expression frequency and MFI) of donor OT-I when miR-155 was overexpressed (Figure S1D in). [score:5]
Interestingly, we found that miR-155 -overexpressing T [CM] CTL also increased T-bet expression in the spleen. [score:5]
Overexpression of miR-155 was confirmed by TaqMan miRNA gene expression quantitative real-time polymerase chain reaction (qRT-PCR) (ThermoFisher) and was determined to be ~5-fold increased over control-transduced cells (Figure S1G in). [score:5]
Interestingly, we observed in both T [EM] and T [CM] compartments an increase in T-bet mRNA expression when miR-155 was overexpressed, with the greatest increase observed in the T [CM] compartment (Figure 5A, bottom). [score:5]
We assessed SHIP-1 expression at both the mRNA and protein levels when miR-155 is overexpressed in CTL. [score:5]
Overexpression of miR-155 Promoting Enhanced CD8 [+] T-Cell ResponsesPreviously, we demonstrated that the adoptive transfer of low numbers of miR-155 -overexpressing OT-I cells resulted in increased expansion and increased viral clearance (16). [score:5]
This most likely is due to miR-155 overexpression increasing T-bet expression as T-bet is known to promote T [EM] CTL formation (8, 37). [score:5]
Indeed, we find that the increased effector CTL expansion is induced by miR-155 overexpression and is mediated by T-bet as miR-155 -overexpressing T-bet [+/‒] CTL fail to expand. [score:5]
Furthermore, miR-155 -overexpressing anti-viral CD8 [+] T cells demonstrate increased levels of T-bet, and thus enhanced T-bet expression may be responsible for the augmented effector generation and effector memory phenotype observed. [score:5]
In exploring the mechanistic underpinnings of the effect of miR-155 overexpression, we have revealed an unexpected connection between miR-155 and T-bet expression in virus-specific CD8 [+] T cells, mediated through the SHIP-1-signaling pathway. [score:5]
Since miR-155 -overexpressing CTLs have increased amounts of T-bet, we reasoned that conversely miR-155 -deficient CD8 [+] T cells would express decreased levels of T-bet. [score:5]
This suggested that overexpression of miR-155 could enhance CTL responses to infections and cancer; indeed, we (16) and others (20) have found that overexpressing miR-155 in CD8 [+] T cells causes significant expansion. [score:5]
Intracellular staining and flow cytometry confirmed increased T-bet expression when miR-155 was overexpressed in both T [EM] and T [CM] compartments in the spleen (Figures 5B,C). [score:5]
Previous in vitro studies have indicated that miRNA expression in CTL changes with differentiation (15) and we have shown that in vivo miR-155 expression levels dynamically change during differentiation from naïve to effector to memory CTL (16). [score:5]
T-Bet Expression in CTL Regulated by miR-155. [score:4]
To directly test if increased T-bet in miR-155-OE OT-I cells was responsible for augmenting effector generation of anti-viral CTL, T-bet [+/‒] OT-I or wild-type T-bet [+/+] OT-I CD8 [+] T cells were retrovirally transduced to overexpress miR-155 or the scrambled sequence. [score:4]
We observed that Blimp-1 mRNA expression was modestly increased in miR-155-OE T [EM] OT-I cells, while Bcl-6 mRNA expression was decreased in miR-155-OE T [EM] OT-I cells compared with scrambled ctrl OT-I CD8 [+] T cells (Figure 5A, top). [score:4]
This is consistent with T-bet’s ability to drive T [EM] formation but also suggests that miR-155 overexpression could regulate plasticity of CTL memory phenotypes. [score:4]
T-bet upregulation was necessary for effector CTL augmentation by miR-155. [score:4]
Multiple mechanisms and targets by which miR-155-deficiency can affect CTL responses have been proposed including type-I IFN and STAT1/2 signaling (16), γc chain cytokine signaling (20), and SOCS-1 (14, 17), which suggests that miR-155 regulation of CTL is context dependent (14). [score:4]
These data provide the first evidence that miR-155 regulates T-bet expression in CTL. [score:4]
miR-155 has been shown, by us and others, to control the CTL immune response (14, 16– 20), while the direct targets by which miR-155 affects CTL responses have been suggested to be context dependent (14). [score:4]
Finally, we tested if SHIP-1 directly mediates the effect of miR-155 on T-bet expression. [score:4]
SHIP-1 has previously been identified as a direct target of miR-155 and has been reported to be affected by miR-155 in CTL (16, 20, 26). [score:4]
Because T-bet mRNA 3′UTR lacks a miR-155 seeding sequence and is not a known or predicted target of miR-155, we postulated that this is an indirect effect. [score:4]
miR-155 -overexpressing T-bet [+/‒] OT-I CD8 [+] T cells (T-bet [+/‒] miR-155-OE OT-I) were incapable of expanding to the same capacity as miR-155-OE OT-I at day 10 post-infection in the lungs of influenza virus-infected animals (p = 0.012) (Figures 4A,B). [score:3]
Increasing miR-155 expression in CTL augmented anti-viral effector CTL and skewed memory CD8 [+] T cells toward an effector memory phenotype. [score:3]
We found that T [EM] CTL formation was favored by miR-155 overexpression. [score:3]
We report here that miR-155 overexpression leads to increased effector CTL responses and a skewing of memory CTL toward an effector memory phenotype. [score:3]
Alternatively, the effect of SHIP-1 on CTL that overexpress miR-155 may be due to additional miR-155 -mediated perturbations in other signaling pathways that change the balance between signaling pathways and raise SHIP-1 to a more prominent functional role. [score:3]
We find that miR-155 overexpression also affects memory CTL responses. [score:3]
Overexpression of miR-155 Promoting Enhanced CD8 [+] T-Cell Responses. [score:3]
Overexpression of miR-155 Skewing CD8 [+] T Cells Toward an Effector Memory Phenotype. [score:3]
Indeed, we previously observed that miR-155 was more highly expressed in anti-viral T [EM] versus T [CM] (16). [score:3]
We therefore examined whether miR-155 overexpression in CD8 [+] T cells affected T-bet levels. [score:3]
Figure 1Overexpression of microRNA-155 enhancing anti-viral CD8 [+] T-cell effector expansion. [score:3]
T-bet staining of miR-155 [−/−] OT-I CD8 [+] T cells revealed a 40% (p = 0.0001) reduction in T-bet expression relative to wild-type OT-I CD8 [+] T cells (Figure 3F). [score:3]
Overexpression of miR-155 Skewing CD8 [+] T Cells Toward an Effector Memory PhenotypeBecause miR-155 affected effector CTL responses, we also assessed its effect on memory CTL formation. [score:3]
To further understand the molecular basis of miR-155’s impact on CTL, we retrovirally transduced CD45.1 [+] OT-I CD8 [+] T cells to overexpress miR-155 (miR-155-OE OT-I). [score:3]
Figure 5Overexpression of microRNA-155 altering the transcription factor profile of memory anti-viral CTL. [score:3]
Indeed, overexpression of miR-155 in CTL augmented the response, in agreement with previous reports from us and others (16, 17, 20). [score:3]
These findings demonstrate that increased miR-155 expression is sufficient to promote significant expansion and increased effector cytokine production of CTL during an acute influenza virus infection. [score:3]
However, miR-155 overexpression also increased Blimp-1 and decreased Bcl-6 in memory cells. [score:3]
Figure 2Overexpression of microRNA-155 promoting effector memory formation. [score:3]
However, we did observe an increased expression of CD107a (LAMP-1) (Figure S2D in), which indicated increased degranulation of memory miR-155-OE OT-I CD8 [+] T cells. [score:3]
Previously, we demonstrated that the adoptive transfer of low numbers of miR-155 -overexpressing OT-I cells resulted in increased expansion and increased viral clearance (16). [score:3]
These data demonstrate that T-bet is essential to drive the increased expansion of miR-155 -overexpressing CD8 [+] T cells during influenza virus infection. [score:3]
miR-155, by suppressing SHIP-1 levels, may amplify PI3K and mTOR signaling, thus resulting in more T-bet. [score:3]
Ki-67 staining of donor OT-I cells in the lungs at day 10 post-influenza virus infection showed that a greater frequency of miR-155-OE OT-I cells were Ki-67 [+] compared with scrambled ctrl OT-I cells, indicating that miR-155 overexpression enhanced the proliferation of anti-viral CD8 [+] T cells (p = 0.022) (Figures 1E,F). [score:2]
qRT-PCR of sorted day 9 post-influenza virus infection miR-155-OE OT-I cells showed a 25% decrease in SHIP-1 (Inpp5d) mRNA expression levels (Figure 6A) compared with controls. [score:2]
Intracellular flow cytometry confirmed that miR-155 [−/−] OT-I cells cultured in vitro for 7 days expressed significantly more SHIP-1 compared with wild-type control cells (1.45-fold increase of MFI, p = 0.005) (Figures 7A,B). [score:2]
Previous studies have indicated that miR-155 in CD8 [+] T cells may regulate SOCS-1 and STAT5 in acute and chronic LCMV infection (17) and tumors (17, 20), STAT1/STAT2 and type I IFN signaling in influenza virus infection (16), and c-maf in CD4 [+] T cells (28) depending on the cell type and the environment in which the response is taking place. [score:2]
Future studies examining the PI3K pathway when miR-155 is modulated could address this question. [score:1]
We, and others, have demonstrated that, in the absence of miR-155, effector CTL responses against acute infections with influenza A virus or L. monocytogenes, and tumors are severely diminished (16– 19). [score:1]
We did not observe any differences in the frequency or numbers of donor scrambled ctrl OT-I versus miR-155-OE OT-I cells in the MLN at days 5–6 post-infection indicating similar engraftment of donor cells (Figure S1C in). [score:1]
A higher frequency of miR-155-OE OT-I donor cells produced the effector cytokines IFNγ (60.3 ± 2.0% versus 67.7 ± 1.6%, mean ± SE donor scrambled ctrl OT-I versus miR-155-OE OT-I, respectively, p = 0.008) and TNFα (19.4 ± 2.5% versus 31.9 ± 4.4%, for donor scrambled ctrl OT-I versus miR-155-OE OT-I, respectively, p = 0.02) after peptide stimulation for 6 h (Figures 1G,H). [score:1]
Because miR-155 affected effector CTL responses, we also assessed its effect on memory CTL formation. [score:1]
Furthermore, in the absence of miR-155, the generation of memory CTL is decreased (16). [score:1]
C57BL/6J mice, miR-155 -deficient OT-I mice, and T-bet [+/‒] OT-I mice (on the C57BL/6J background) were kept in a barrier facility (certified by the Association for the Assessment and Accreditation of Laboratory Animal Care) at Drexel University College of Medicine, or in a barrier facility at Erasmus University Medical Center. [score:1]
MicroRNA miR-155 affects antiviral effector and effector Memory CD8 T cell differentiation. [score:1]
We observed a significant increase in the expansion of miR-155-OE OT-I donor cells at day 10 post-infection in the lungs of infected animals in both frequency (Figure 1A) and absolute numbers (Figure 1B), with a 2.8-fold increase in miR-155-OE OT-I donor cells by day 10 (2.1 ± 0.4 × 10 [6] versus 8.6 ± 2.3 × 10 [6], mean ± SE scrambled ctrl OT-I versus miR-155-OE OT-I, respectively, p = 0.017). [score:1]
This demonstrated a trending increase in relative T-bet mRNA levels in miR-155-OE OT-I CD8 [+] T cells (Figure 3A). [score:1]
qRT-PCR analysis of the cytotoxic molecules granzyme A, granzyme B, and perforin assessed in lung donor OT-I cells 9 days post-influenza virus infection showed no difference between scrambled ctrl OT-I and miR-155-OE OT-I (Figure S1E in). [score:1]
To the best of our knowledge, our studies conclusively show for the first time a novel connection between miR-155 and T-bet in CD8 [+] T cells. [score:1]
Unlike at day 10, we did not observe any difference in the frequency of IFNγ- or TNFα-producing donor memory miR-155-OE OT-I CD8 [+] T cells at day 60 (Figure S2D in). [score:1]
Increased expansion of miR-155-OE OT-I CD8 [+] T cells was also observed in the spleen (1.8 ± 0.3 × 10 [6] versus 5.3 ± 1.4 × 10 [6], scrambled ctrl OT-I versus miR-155 OE OT-I, respectively, p = 0.023) and the mediastinal lymph nodes (MLNs) (0.2 ± 0.4 × 10 [5] versus 0.8 ± 0.3 × 10 [5], scrambled ctrl OT-I versus miR-155 OE OT-I, respectively, p = 0.029) 10 days post-infection (Figures 1C,D). [score:1]
We also did not observe differences in the frequencies or absolute numbers of donor memory OT-I CD8 [+] T cells in the lungs, spleens, or MLN (Figure S2A in) when comparing miR-155-OE OT-I CD8 [+] T cells to scrambled ctrl OT-I CD8 [+] T cells. [score:1]
To assess this, splenic miR-155 [−/−] OT-I CD8 [+] T cells were isolated and activated in vitro with plate-bound α-CD3 and α-CD28 antibodies and cultured for 7 days. [score:1]
We similarly observed a significant increase in the frequency and number of miR-155-OE donor OT-I cells in the lungs, but not in the spleen or MLN, at an earlier day 8 timepoint (Figures S1A,B in). [score:1]
The miR-155-encoding region from the MigR1-miR-155-GFP vector (16) was cloned into the MSCV-IRES-Thy1.1 vector (provided by P. Marrack, University of Colorado). [score:1]
Tbx21 (T-bet) mRNA levels were assessed by qRT-PCR in total RNA from scrambled ctrl OT-I and miR-155-OE OT-I cells sorted from the lungs on day 9 post-infection. [score:1]
[1 to 20 of 92 sentences]
6
[+] score: 360
These results implied that miR-155-3p inhibitor promoted MEF2C expression might through inhibiting expression of miR-155-3p. [score:9]
Mmu-miR-155-3p Inhibitor (Invitrogen, 100 nM) and miRNA inhibitors -negative control (Invitrogen, 100 nM) were cloned into the pcDNA3.1 vector to yield pcDNA-miR-155-3p Inhibitor and pcDNA-control, respectively. [score:7]
To detect the effects of miR-155-3p inhibitor on expression of MEF2C, the ESCs were stablely transfected with miR-155-3p inhibitor. [score:7]
Analysis of miR-155-3p expression revealed that miR-155-3p was gradually down-regulated during cardiac differentiation of ESCs (Figure 1A). [score:6]
To test whether miR-155-3p could directly target the 3’-UTR of MEF2C mRNA in a sequence-specific manner, we generated a luciferase construct harbouring a potential binding site for miR-155-3p and produced three mutant constructs with potential target sites (Figure 5B). [score:6]
miR-155-3p inhibited the expression of MEF2C. [score:5]
MiR-155-3p mimic increased the expression of miR-155-3p and miR-155-3p mimic decreased the expression of miR-155-3p (Supplementary Figure 2). [score:5]
miR-155-3p mimic inhibited the expression of MEF2C. [score:5]
However, inhibition of miR-155 using antagomiR improved cardiac function and suppressed cardiac apoptosis induced by lipopolysaccharide in mice. [score:5]
In addition, miR-155-3p inhibition increased KRAS and pERK1/2 expression. [score:5]
In the present study, we indentified that miR-155-3p was expressed in ESCs and the expression level in ESCs was higher than in cardiocytes differentiated from ESCs. [score:5]
To further unveil the biological function of miR-155-3p inhibition in the process of cardiogenesis, the miR-155-3p inhibitor was stably transfected into ESCs and the cardiac differentiation was explored. [score:5]
The results suggested that miR-155-3p inhibition promoted the cardiomyocyte differentiation and increased MEF2C expression. [score:5]
By contrast, miR-155-3p inhibition promoted expressions of KRAS and pERK1/2 (Figure 6A, 6B). [score:5]
miR-155-3p inhibitor promoted expressions of cTnT, Nkx2. [score:5]
Our data showed that miR-155-3p inhibited KRAS and pERK1/2 expression in EBs. [score:5]
Interestingly, miR-155 is the identified miRNA which regulates nucleus pulpous cells degeneration through directly targeting ERK1/2 [49]. [score:5]
Analysis of mRNA expression revealed that miR-155-3p inhibitor significantly improved the mRNA levels of cTnT, Nkx2.5 and Gata4 (Figure 3A). [score:5]
Similarly, we observed that miR-155-3p inhibitor significantly increased the expressions of cTnT, Nkx2.5 and Gata4 protein (Figure 3B). [score:5]
miR-155-3p inhibitor promoted the expressions of cTnT, Nkx2.5 and gata4. [score:5]
In this study, we confirmed that miR-155-3p suppressed MEF2C expression using Real-time PCR and. [score:5]
Our novel understanding of the miR-155-3p inhibition in cardiogenesis could partly enlighten a new therapeutic strategy to heart disease. [score:5]
miR-155-3p inhibitor increased the expression of MEF2C during ESCs differentiation. [score:5]
The results showed that miR-155-3p mimic suppressed both MEF2C mRNA (Figure 2A) and protein (Figure 2D) expressions. [score:5]
By contrast, miR-155-3p inhibition increased KRAS and pERK1/2 expression. [score:5]
miR-155-3p inhibition increased the percentage of EBs beating and facilitated the expressions of MEF2C, GATA4, Nkx2.5, and cTnT. [score:5]
Expressions change of miR-155-3p and MEF2C during ESCs differentiation and effects of miR-155-3p inhibitor on EBs beating and growth. [score:5]
The results showed that miR-155-3p inhibitor increased both MEF2C mRNA and protein expressions. [score:5]
These data suggested that miR-155-3p efficiently suppressed the expressions of MEF2C mRNA and protein. [score:5]
Effects of miR-155-3p mimic and miR-155-3p inhibition on expression of MEF2C. [score:5]
MicroRNA-155 expression is up-regulated and localized primarily in heart-infiltrating macrophages and CD4(+) T lymphocytes during acute myocarditis. [score:5]
In conclusion, our data indicated that miR-155-3p was down-regulated during cardiac differentiation of ESCs. [score:4]
The results suggested that miR-155-3p can repress MEF2C expression through the direct interaction with II or III. [score:4]
MEF2C was a direct target of miR-155-3p. [score:4]
Recently, it is also indentified that miR-155 plays a crucial roles in regulation cardiac disease. [score:4]
By contrast, miR-155-5p is up-regulated [37]. [score:4]
miR-155-3p was down-regulated during ESCs differentiation. [score:4]
Thus, miR-155-3p regulates cardiogenesis maybe through inhibiting MEF2C. [score:4]
In chronic myeloid leukemia cells, miR-155 regulates MAPKs through targeting KRAS or SOS, upstream signaling of MAPKs [46]. [score:4]
The stable clones of pcDNA-miR-155-3p inhibitor and pcDNA-control were generated by growing cells in the presence of G418 at 500 μg/ml for 2 weeks. [score:3]
We found that MEF2C was a predicted target gene of miR-155-3p. [score:3]
However, as the results showed that miR-155-3p inhibitor did not change the diameters of EBs at d10, d12 and d14 (Figure 1F). [score:3]
These data further illustrated that miR-155-3p inhibition promoted the cardiac differentiation of ESCs. [score:3]
These data illustrated that miR-155-3p inhibition promoted cardiac differentiation of ESCs and its mechanisms are involved in RAS-ERK1/2 signaling and MEF2C. [score:3]
Figure 2ESCs were transiently transfected with miR-155-3p mimic or stably transfected with miR-155-3p inhibitor. [score:3]
The percentage of MEF2C, cTnT and Nkx2.5 positive cells in miR-155-3p inhibitor groups were 73.6%±10.2% (43.5%±10.2% in control), 45.6%±8.4% (25.9%±5.6% in control), and 66.0%±12.7% (42.0%±8.7% in control), respectively. [score:3]
Furthermore, miR-155 can decrease the expressions of KRAS protein and mRNA [48]. [score:3]
Figure 5 (A) Sequence alignment of miR-155-3p and its target sites in the 3’-UTR of MEF2C (download from http://www. [score:3]
These findings indentified that miR-155-3p inhibitor promoted the cardiac differentiation of ESCs. [score:3]
miR-155-3p mimic repressed expressions of KRAS and pERK1/2. [score:3]
Effects of miR-155-3p on expressions of KRAS and pERK1/2. [score:3]
Sequence alignment of miR-155-3p and its target sites in the 3’-UTR of MEF2C were listed (Figure 5A). [score:3]
Our data implied that KRAS/pERK1/2 was involved in the miR-155-3p inhibition-triggered cardiomyocyte differentiation. [score:3]
ESCs were transiently transfected with miR-155-3p mimic or stably transfected with miR-155-3p inhibitor. [score:3]
Its mechanisms may be involved in the inhibition of miR-155-3p. [score:3]
These findings reveal the critical role of MEF2C, KRAS, and pERK1/2 in miR-155-3p inhibition-promoted cardiac differentiation. [score:3]
In this study, we explored the expression levels of miR-155-3p during ESC differentiation into cardiomyocyte. [score:3]
The results showed that miR-155-3p inhibitor increased the percentage of MEF2C, cTnT and Nkx2.5 positive cells. [score:3]
The results indicated that miR-155-3p inhibitor significantly increased percentage of EBs beating (Figure 1E). [score:3]
Inhibition of miR-155 represents a novel therapy for septic myocardial dysfunction [35]. [score:3]
We supposed that miR-155-3p in the ESCs and early cardiac differentiation of ESCs would partly prevent the cardiogenesis through inhibition of MEF2C. [score:3]
miR-155-3p inhibitor increased the immunoreactivities of MEF2C, cTnT and Nkx2.5. [score:3]
These results demonstrated that miR-155-3p inhibitor facilitated the EBs beating. [score:3]
By contrast, miR-155-3p increased expressions of KRAS and pERK1/2. [score:3]
CGR8 ESCs transfected with miR-155-3p inhibitor or control were dissociated by 0.25% trypsin-0.01% EDTA and suspended in the differentiation medium (ESCs culture medium without LIF). [score:3]
Schematic diagram showed the possible pathways of miR-155-3p inhibition-triggered cardiomyocyte differentiation of ESCs. [score:3]
Systemic administration of miR-155 mimic attenuates cardiac dysfunction and improves late sepsis survival by targeting JNK associated inflammatory signaling [34]. [score:3]
In vitro differentiationCGR8 ESCs transfected with miR-155-3p inhibitor or control were dissociated by 0.25% trypsin-0.01% EDTA and suspended in the differentiation medium (ESCs culture medium without LIF). [score:3]
miR-155 can reduce cardiac injury by inhibiting NF-kB pathway during acute viral myocarditis [33]. [score:3]
In addition, miR-155-3p inhibitor also increased the MEF2C mRNA (2.05±0.41 fold) and protein (1.95±0.43 fold) levels at d12 (Figure 2C and 2F). [score:3]
The target genes of miR-155-3p were investigated by using online bioinformatic tools targetScan (http://www. [score:3]
Effects of miR-155-3p inhibitor on EBs beating and growth. [score:3]
The expression levels of miR-155-3p were normalized to U6, while levels of MEF2C, cTnT, nkx2.5, and GATA4 were normalized to GAPDH. [score:3]
Thus, KRAS/ERK1/2/MEF2C pathway may be involved in the miR-155-3p inhibition-facilitated cardiomyocyte differentiation from ESCs. [score:3]
Figure 7 The expression profile of miR-155-3p during ESCs differentiation was detected using real-time PCR. [score:3]
The expression profile of miR-155-3p during ESCs differentiation was detected using real-time PCR. [score:3]
The percentage of EBs beating in miR-155-3p inhibitor group at d12 and d14 were 53.77%±5.16% (39.25%±4.99% in control) and 68.61%±5.58% (49.79% ±5.70% in control), respectively. [score:3]
The results showed that miR-155-3p mimic repressed expressions of KRAS and pERK1/2 in EBs at d3. [score:3]
miR-155-3p inhibitor increased the immunoreactivity of MEF2C, cTnT and Nkx2.5. [score:3]
The cells at 60% confluence were transfected with mmu-miR-155-3p mimic (Invitrogen, 50 nM), negative scramble (Invitrogen, 50 nM), pcDNA-miR-155-3p inhibitor or pcDNA-control in serum-free medium by Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's instructions. [score:3]
Here, we focused on whether miR-155-3p inhibition could be used in vitro to induced cardiomyocyte differentiation. [score:3]
MiR-155 is also found to be up-regulated in the plasma of patients with septic cardiac dysfunction. [score:3]
Growing evidence indicates that miR-155 is involved in the regulation of cardiac cell. [score:2]
microRNA-155 knockout mice develop attenuated viral myocarditis [36]. [score:2]
MiR-155-3p is down-regulated in heart of fetal and adult cardiac remo deling, an adaptive alteration that results an altered heart structure and function, when compared to control group. [score:2]
Without any mutation, miR-155-3p repressed 58.4% of luciferase activity of the reporter construct. [score:2]
With the continuous differentiation, the percentage of EBs beating in both miR-155-3p inhibitor and control groups were increased when compared to the corresponding groups at d10. [score:2]
When compared to the scramble groups, the MEF2C mRNA and protein levels in miR-155-3p inhibitor groups were 2.46±0.50 and 2.85±0.92 folds, respectively at d6 (Figure 2B and 2E). [score:2]
When compared to the control group, the percentage of MEF2C, cTnT and Nkx2.5 positive cells in miR-155-3p inhibitor groups were significantly increased (Figure 4). [score:2]
At d10, the percentage of EBs beating in miR-155-3p inhibitor group (27.09%±2.25%) was significant increased as compared to control group (21.38%±2.03%). [score:2]
Taking these data together, miR-155-3p seems to be involved in the regulation of cardiogenesis. [score:2]
The possible pathways of KRAS/pERK1/2 signaling and MEF2C in miR-155-3p inhibition-triggered cardiomyocyte differentiation were showed in Figure 7. Figure 6 (A, B) KRAS and pERK1/2 protein levels were measured by. [score:1]
The possible pathways of KRAS/pERK1/2 signaling and MEF2C in miR-155-3p inhibition-triggered cardiomyocyte differentiation were showed in Figure 7. Figure 6 (A, B) KRAS and pERK1/2 protein levels were measured by. [score:1]
However the role of miR-155 cardiogenesis is still unknown. [score:1]
To evaluate the effect of miR-155-3p inhibition on EBs beating during cardiac differentiation of ESCs, the beating percentage of EBs was counted at d10, d12, and d14. [score:1]
At d14, miR-155-3p kept at low level and there had significant difference between d12 and d14 groups. [score:1]
For miR-155-3p, cDNA was obtained with TaqMan® MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). [score:1]
In the present study, the expression profile of miR-155-3p during cardiac differentiation of ESCs was investigated. [score:1]
It has been shown that miR-155 level in proliferating cardiomyocyte progenitor cells is higher than differentiated cardiomyocyte progenitor [38]. [score:1]
In order to investigate the effects of miR-155-3p mimic on the expression of MEF2C, ESCs were transiently transfected with miR-155-3p mimic. [score:1]
Reduced miR-155, miR-134, miR-373, miR-138, miR-205, miR-181d, miR-181c, and let-7 in CAsE-PE cells correlate with increased KRAS protein [47]. [score:1]
To further investigate the effects of miR-155-3p inhibitor on cardiogenesis of ESCs, the expressions of cardiac specific markers, cTnT, Nkx2.5 and Gata4, were investigated at d14. [score:1]
The role of miR-155-3p inhibition in cardiogenesis in vitro and its potential mechanism were also investigated. [score:1]
Figure 1 (A-C) MEF2C mRNA and miR-155-3p were detected by Real-time PCR. [score:1]
It can be split into two mature microRNAs: miR-155-3p and miR-155-5p. [score:1]
However, there was no report regarding to the potential function of miR-155 in cardiac differentiation. [score:1]
ESCs were co -transfected with the reporter vectors containing the MEF2C-3’UTR-wt or MEF2C-3’UTR-mut and miR-155-3p mimic or scramble by using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). [score:1]
[1 to 20 of 107 sentences]
7
[+] score: 353
Other miRNAs from this paper: hsa-mir-155
While no significant effect in suppressive capacity could be seen in nTregs, the modulation of the expression level of miR-155 in CD4 [+] Th cells clearly demonstrated a crucial role for miR-155 as a ‘sensor’ for nTreg cell -mediated suppression: Increased miR-155 levels in both human and mouse, CD4 [+] Th cells led to a reduced susceptibility to nTreg cell -mediated suppression, whereas decreased miR-155-levels resulted in a more pronounced suppression by nTregs. [score:11]
The remaining 546 predicted miR-155 targets expressed in T cells were divided in regulated genes upon miR-155 expression (300 genes) and genes which showed no regulation upon stimulation (246 genes). [score:9]
miR-155 in CD4 [+] Th cells acts as a ‘sensor’ for nTreg cell -mediated suppressionBIC is known as a proto-oncogene and its over -expression respective the subsequent up-regulation of miR-155 levels are associated with the development of B cell lymphoma [4], [5], [7]. [score:9]
Whereas miR-155 inhibition in conventional CD4 [+] Th cells strengthened nTreg cell -mediated suppression, overexpression of mature miR-155 rendered these cells unresponsive to nTreg cell -mediated suppression. [score:9]
To strengthen the thesis of miR-155 regulated IL2 signalling, we also affirmed a significant down-regulation of IL2 mRNA expression in miR-155 inhibitor transfected human CD4+ Th cells (data not shown). [score:9]
Figure S4 Predicted miR-155 target genes display down-regulated mRNA expression after cell activation. [score:8]
Finally 93 predicted miR-155 target genes were left which displayed a down-regulation after T cell activation and are listed as miR-155 targets (supporting table 2). [score:8]
BIC is known as a proto-oncogene and its over -expression respective the subsequent up-regulation of miR-155 levels are associated with the development of B cell lymphoma [4], [5], [7]. [score:7]
Based on the integration of microRNA databases (miRanda, PicTar, TargetScanS) for in silico prediction [18] of miR-155 targets together with data obtained from the Affymetrix Exon Array profiling, we were able to generate a list of 93 putative miR-155 targets (table S2 & figure S3 for detailed description). [score:7]
mRNA of an time course dependent activation of human CD4+ Th cells were analysed for human miR-155 target gene expression using Taqman RT-PCR: The fold changes of the following selected miR-155 predicted target genes are shown: (A) transcription factor HIVEP2; (B) transcription factor BTB and CNC homology 1 (Bach1); (C) transcriptional repressors MXI1; (D) small Maf family protein K (MafK); (E) repressor Transducin-like enhancer protein 4 (TLE4); (F) transcriptional repressor HMG box transcription factor 1 (HBP1). [score:7]
199 genes out of these 300 regulated miR-155 targets were excluded showing an up-regulation after T cell activation. [score:7]
They affirmed FoxP3 regulates the expression of BIC/miR-155 and that BIC/miR-155 is a direct target of FoxP3 in mice. [score:7]
Studying miR-155 expression in FoxP3 -deficient s curfy mice and performing FoxP3 ChIP-Seq experiments using activated human T lymphocytes, we show that the expression and maturation of miR-155 seem to be not necessarily regulated by FoxP3. [score:6]
In concordance, Cobb et al. [15] found miR-155 to be the most up-regulated microRNA of all analyzed miRNAs expressed in CD4 [+] Th cells activated for 3 days. [score:6]
Confirming that phenotype also in CD4+ Th cells, we were able to show a strong up-regulation of IL-2 expression in murine CD4 [+] Th cells (13-fold) upon transfection of mimic-miR-155 (data not shown). [score:6]
Therefore, we postulate that BIC/miR-155 expression and maturation of miR-155 seem to be not necessarily regulated by FoxP3 in CD4 [+] Th cells, even though human and mouse CD4 [+] Th cells expressed FoxP3 at moderate levels upon activation. [score:6]
According to that phenotype the miR-155 target SOCS1 was indicated to be a regulator for balancing the Th1/Th2 cell differentiation [10] leading to a Th1 cell differentiation blockade by suppression of IL12 and IFN-γ signalling when miR-155 is deleted [26], [27]. [score:6]
All putative miR-155 targets illustrate the strongest down-regulation between 16 h and 24 h after stimulation with anti-CD3 and anti-CD28 antibodies. [score:6]
Overexpression of mature miR-155 rendered murine CD4 [+] Th cells unresponsive to nTreg -mediated suppression. [score:5]
To examine the role of miR-155 in nTreg cell -mediated suppression, we modulated the expression level of this miRNA in primary mouse and human CD4 [+] Th cells, as well as nTregs. [score:5]
Whereas no detectable expression was seen in resting human CD4 [+] Th or nTreg cells, both cell types significantly expressed miR-155 upon 16 h of activation. [score:5]
0007158.g005 Figure 5Overexpression of mature miR-155 rendered murine CD4 [+] Th cells unresponsive to nTreg -mediated suppression. [score:5]
In silico analysis of putative miR-155 mRNA targets in CD4 [+] Th cells revealed 93 genesFor a detailed understanding on how miR-155 acts in CD4 [+] Th cells as a ‘sensory molecule’, it is necessary to know its target genes. [score:5]
In sharp contrast, miR-155 inhibitor -treated CD4 [+] Th cells showed a much higher susceptibility to nTreg -mediated suppression than control -transfected responder CD4 [+] Th cells (Fig. 4A). [score:5]
An in silico predicted miR-155 target gene list was generated by analysis of available microRNA databases (miRanda, PicTar, TargetScanS). [score:5]
In combination with miR-155 mediated elevation of IL-2 expression in CD4 [+] Th cells, we could demonstrate that raised miR-155 levels in human and murine CD4 [+] Th cells not only induces cell proliferation, but moreover renders CD4+ Th cells to become insensitive to nTreg cell -mediated suppression. [score:5]
Interestingly, overexpression of miR-155 resulted in a strongly decreased susceptibility of the CD4 [+] Th cells to nTreg cell -mediated suppression (Fig. 4B). [score:5]
The best predicted miR-155 target with the highest seed match score is the transcription factor BTB and CNC homology 1 (Bach1, Figure S4A), which has been published recently to be regulated by miR-155 [19], [20]. [score:4]
We identified the proto-oncogene BIC that encodes the miRNA-155, among the genes most significantly up-regulated upon activation (Fig. 1B). [score:4]
These results, together with data from the miR-155 knockout mice, which exhibit an enhanced inflammation and onset of autoimmune diseases [8], [9], suggest an important role of miR-155 in T cell function. [score:4]
miR-155 expression is not necessarily regulated by FoxP3. [score:4]
BIC is up-regulated in activated CD4 [+] Th and nTregs and is processed into mature miR-155. [score:4]
We described in detail the transcriptional changes of miR-155 in primary human and murine T lymphocytes and that the expression and maturation of miR-155 seem to be not necessarily regulated by FoxP3 in CD4 [+] Th cells. [score:4]
BIC/miR-155 expression is not necessarily regulated by FoxP3. [score:4]
For confirmation of the in silico prediction, we performed a detailed quantitative Taqman RT-PCR analysis for some genes to monitor their transcriptional down-regulation upon activation of miR-155 (figure S4). [score:4]
Our findings support the results of Lu et al., that miR-155 is involved in T cell proliferation and promoting the fitness of lymphocytes by targeting the IL2-signaling regulator protein SOCS1 [10]. [score:4]
Assuming that miR-155 regulates RNA-targets responsible for keeping CD4 [+] Th cells in a resting state, the potential candidates have to be negatively affected upon activation of CD4 [+] Th cells. [score:4]
The group of intergenic FoxP3 bound miRNA targets (Fig. 3B) confirms the finding of Zheng et al. [16] and Marson et al. [17], that FoxP3 binds the genomic BIC/miR-155 locus in human regulatory T cells. [score:4]
miR-155 is shown to be crucially involved in nTreg cell mediated tolerance by regulating the susceptibility of conventional human as well as murine CD4 [+] Th cells to nTreg cell -mediated suppression. [score:4]
The up-regulation of miR-155 is also observed in primary human and murine T cells from healthy donors as well. [score:4]
DNA-Microarray analyses of human as well as murine conventional CD4 [+] Th cells and nTregs revealed a strong up-regulation of mature miR-155 (microRNA-155) upon activation in both populations. [score:4]
Recently, Lu et al. demonstrated that FoxP3 -dependent regulation of miR-155 maintains the competitive fitness of murine nTregs cells by targeting SOCS1 [10]. [score:4]
However, little is known about the target genes that are regulated by miR-155. [score:4]
Whereas, modulation of miR-155 in nTregs cells did not alter their suppressive capacity (data not shown), as reported by Lu et al. [10]. [score:3]
Post activation (19 h) an increased expression of matured miR-155 was detectable, in both CD4 [+] Th cells of wild type and Scurfy mice. [score:3]
Previous work has shown that a loss of miR-155 in Tregs did not impair their sensitivity to impair Treg cell suppressor function, whereas miR-155 is involved during thymic differentiation by promoting the fitness and the proliferative potential of differentiating nTregs [10]. [score:3]
Thereafter, expression of BIC decreased most likely because it is processed to mature miR-155. [score:3]
In both populations, the expression of BIC returned to basal levels after 77 h. The same approach was used to determine the level of the mature miR-155. [score:3]
Again, increasing the levels of miR-155 in murine or human nTregs did not significantly influence their ability to suppress CD4 [+] Th cells (data not shown). [score:3]
Naturally occurring CD4 [+] Th cells (4×10 [6] CD4+ cells/cuvette) were transfected with 1 µM pre miR-155/BIC (Ambion), 1 µM of the mature mimic miR-155 (Dharmacon) respective 2 µM miR-155 inhibitor miRNA (Dharmacon). [score:3]
Whereas, in C57/BL6 mice the BIC transcript as well as the matured miR-155 was found to be higher expressed in nTregs than in CD4 [+] Th cells (B) and (D) (n = 3). [score:3]
Surprisingly, no binding of FoxP3 to BIC/miR-155 was detectable in CD4+ Th cells, which also express FoxP3 after activation. [score:3]
al [22] studied the interaction miR-155/AID -RNA (activation -induced cytidine deaminase) after finding AID expression was 1.6 fold increased in miR-155 -deficient B cells. [score:3]
miR-155 in CD4 [+] Th cells acts as a ‘sensor’ for nTreg cell -mediated suppression. [score:3]
Figure S3 In silico identification of putative miR-155 mRNA targets in CD4+ Th cells. [score:3]
In addition to its role in B cell proliferation, it was shown that miR-155 acts also as tumor suppressor by reducing potentially oncogenic translocations generated by AID. [score:3]
Modulation of miR-155 levels in CD4+ Th cells influenced the susceptibility to nTreg -mediated suppression. [score:3]
Upon activation, miR-155 is expressed in several types of immune cells, including B- and T-cells [6], [7], macrophages and dendritic cells indicating its important role in the activation of these cells. [score:3]
To further understand the role of FoxP3 in the regulation of BIC/miR-155 expression, we compared the miR-155 levels of resting and activated CD4 [+] Th cells from FoxP3-mutant scurfy mice (scurfy mice lack the functional FoxP3 protein) to those of wt C57/Bl6 mice. [score:3]
Among others, the microRNA155 precursor gene BIC was revealed to be strongly up-regulated upon activation in both human cell types. [score:3]
For a detailed understanding on how miR-155 acts in CD4 [+] Th cells as a ‘sensory molecule’, it is necessary to know its target genes. [score:3]
Analyzing the kinetic of BIC/miR-155 expression RNA was collected using an activation time course experiment. [score:3]
Table S2List of T lymphocyte-specific miR-155 target genes. [score:3]
Suppression assay performed with naïve murine CD4 [+] Th cells and murine nTregs: Th cells transfected with pre miR-155 showed up to 40% decreased susceptibility for nTreg cell -mediated suppression compared to the control -transfected CD4 [+] Th cells. [score:3]
RT-PCR expression analysis of pre-mature BIC transcript and its processed microRNA miR-155 in mice and men. [score:3]
0007158.g004 Figure 4(A) Blocking the biological available miR-155 by transfection of synthetic anti-miR-155 molecules led to an increased sensibility for nTreg -mediated suppression. [score:3]
In silico analysis of putative miR-155 mRNA targets in CD4 [+] Th cells revealed 93 genes. [score:3]
To further corroborate these findings, human CD4 [+] Th cells were transfected with human mimic-miR-155 or its respective human pre-miR-155 (precursor) to analyze whether this evokes the opposite effect, namely rendering CD4 [+] Th cells unresponsive to nTreg cell -mediated suppression. [score:3]
They also showed a 6-fold higher expression of miR-155 in mouse peripheral FoxP3 positive T cells compared to FoxP3 negative T cells. [score:2]
The analysis resulted in two dozen of FoxP3 bound/regulated miRNAs, whereas miR-155 is one of these. [score:2]
It was shown, that miR-155 is required for nTreg cell homeostasis in the presence of limiting amounts of IL-2 because miR-155 is regulating the IL2 signalling repressor SOCS1 [10]. [score:2]
We transfected human primary CD4 [+] Th cells with a human miR-155-specific inhibitor and analyzed the proliferative capacity of these cells in CFSE -based proliferation assays. [score:2]
Murine CD4 [+] Th cells transfected with murine pre-miR-155 showed an up to 40% decreased susceptibility to nTreg cell -mediated suppression compared to the control -transfected CD4 [+] Th cells, underscoring the results obtained with human T cells (Fig. 5). [score:2]
Assuming that miR-155 will be regulated in mice by the transcription factor FoxP3. [score:2]
After transcription into cDNA using the Taqman MicroRNA Reverse Transcription Kit (Applied Biosystems), the expression of miR-155 respective of the normalizer U18 (U5 for mouse miR-155) was quantified with the hsa-miR-155 assay (Applied Biosystems). [score:2]
In 2007, crucial function of miR-155 in the immune system was proven by the miR-155−/− knock out mouse from Rodriguez et al. [8] respective Thai et al. [9]. [score:2]
1 to be regulated by miR-155 after profiling of miR-155 -deficient B cells. [score:2]
In order to address the functional relevance of elevated miR-155 levels, we transfected miR-155 inhibitors or mature miR-155 RNAs into freshly-isolated human and mouse primary CD4 [+] Th cells and nTregs and investigated the resulting phenotype in nTreg suppression assays. [score:2]
Based on this finding, one could argue that CD4 [+] Th cells need miR-155 for proper proliferation, whereas it plays an inferior role in peripheral human nTregs since they are anergic and do not proliferate in vitro. [score:1]
Inhibition of miR-155 had no measurable effect on the proliferation of CD4 [+] Th cells upon polyclonal or allogeneic stimulation. [score:1]
In CD4 [+] Th cells, the miR-155 level increased over time without reaching a plateau even after 120 h of activation (Fig. 2F). [score:1]
As normalizer RNA Pol II (human & mouse BIC) as well as U18 (human miR-155) and 5S (mouse miR-155) were used. [score:1]
As depicted in Fig. 2C (human) and Fig. 2D (mouse), BIC was processed into mature miR-155 in both species. [score:1]
Therefore we addressed the functional consequence of miR-155 elevation on the proliferative capacity of CD4 [+] Th cells. [score:1]
To analyze the kinetics of BIC transcription and subsequent miR-155 maturation upon activation, a time course experiment was performed using human T cells. [score:1]
Similar investigations addressed the role of miR-155 in overexpressing transgenic mice, which leads to pre-B cell proliferation in bone marrow and spleen, followed by high grade B cell neoplasms [21]. [score:1]
Although the precise role of miR-155 in promoting B cell lymphomagenesis is unclear, Dorsett et. [score:1]
CD4 [+] Th cells from Scurfy mice surprisingly revealed the same level of induction of miR-155 upon activation (Fig. 3D) as wild type CD4 [+] Th cells. [score:1]
To determine, if BIC is processed into mature microRNA, murine and human miR-155-specific cDNA was generated and analyzed by Taqman RT-PCR. [score:1]
Among miscellaneous miRNAs the miR-155 is encoded by a small phylogenetically-conserved region of the proto-oncogene BIC, which was first described as a common site of viral DNA integration in virally -induced lymphomas in chicken [4], [5]. [score:1]
Nevertheless, it was shown the tendency of miR-155 -deficient T cells to differentiate into Th2 cells [8], [9]. [score:1]
To this end, miR-155, pre miR-155 as well as control -transfected CD4 [+] Th cells where co-cultured with nTregs at different ratios. [score:1]
In human cells, BIC and the matured form miR-155 were not present in resting cells, but strongly elevated levels were found in Th cells as well as in nTreg cells after TCR activation (A) and (C) (n = 4). [score:1]
[1 to 20 of 93 sentences]
8
[+] score: 337
Western blot analytical results showed that up-regulation of miR-155 reduced Bcl-2 protein expression level while increased Bax, cleaved caspase-3 and cleaved caspase-9 protein expression levels; down-regulation of miR-155 affected these protein expressions resulted in the contrary results (Fig. 4c). [score:13]
Cardoso et al. demonstrated that bacterial endotoxin LPS could also up-regulate the expression of miR-155 in microglia cells; and miR-155 knockdown significantly decreases the production of nitric oxide, as well as the expression of inflammatory cytokines [33]. [score:9]
These findings suggested that up-regulation of miR-155 increased LPS -induced cell injury, whereas down-regulation of miR-155 expression alleviated it. [score:9]
qRT-PCR analytical results showed that up-regulation of miR-155 increased the relative mRNA expression levels of IL-1β, IL-6, IL-8, and TNF-α in the LPS-injured cells, whereas down-regulation of miR-155 showed opposite results (P < 0.05 or P < 0.01, Fig. 4d). [score:9]
qRT-PCR results showed that transfection of miR-155 inhibitor alone in LPS -induced cells decreased the relative mRNA expression levels of IL-1β, IL-6, IL-8, and TNF-α, while transfection with both miR-155 inhibitor and si-RACK1 increased the expression of these pro-inflammatory cytokines (P < 0.05 or P < 0.01, Fig. 6d). [score:9]
a Expression of miR-155 in LPS -treated cells and control cells; b Expression of miR-155 in cells transfected with miR-155 mimic, miR-155 inhibitor, or their correspondingly negative controls (scramble and inhibitor control). [score:9]
It suggested that down-regulation of miR-155 could not protect microglia cells against inflammatory injury if RACK1 expression was suppressed at the same time. [score:8]
As results shown in Fig. 7, miR-155 mimic transfection increased the expression levels of phosphorylated p38, p65, lκBα, mTOR, and p70S6K, whereas miR-155 inhibitor decreased the expression levels of these factors in LPS-injured cells when compared with inhibitor control group. [score:8]
Consistent with these previous findings, our present results suggested that LPS induction increased the expression of miR-155 in microglia cells; and down-regulation of miR-155 increased cell viability, decreased apoptosis, as well as the expressions of pro-inflammatory cytokines. [score:8]
These results suggested that RACK1 might be a directly target of miR-155, and the expression of RACK1 was negatively regulated by miR-155. [score:7]
As shown in Fig. 3b, miR-155 mimic significantly promoted miR-155 expression (P < 0.001) when compared to scramble group, and miR-155 inhibitor transfection significantly decreased miR-155 expression when compared to inhibitor control (P < 0.01). [score:7]
Figure 5b shows that miR-155 mimic transfection significantly decreased the mRNA expression level of RACK1 when compared with scramble control group (P < 0.05), while miR-155 inhibitor transfection increased the mRNA expression of RACK1 when compared with inhibitor control (P < 0.001). [score:7]
BV2 cells were treated with LPS, LPS+ inhibitor control, LPS + miR-155 inhibitor, and LPS+ miR-155 inhibitor + si-RACK1. [score:7]
According to the results in the present experiments, we found that RACK1 might be a directly target of miR-155 in BV2 cells, and the expression of RACK1 was negatively regulated by miR-155. [score:7]
Thus, we transfected miR-155 mimic, miR-155 inhibitor, and their correspondingly controls (scramble and inhibitor control) into BV2 cells to alter miR-155 expressions and detect whether miR-155 was involved in LPS -induced cell damage. [score:7]
Flow cytometry detection results (Fig. 4b) showed that up-regulation of miR-155 significantly increased apoptosis of LPS -treated cells (P < 0.01), whereas down-regulation of miR-155 decreased apoptosis (P < 0.05). [score:7]
These findings suggested that RACK1 knockdown could promote LPS -induced cell injury and inflammation, even if the expression of miR-155 was down-regulated. [score:7]
Fig. 4Down-regulation of miR-155 inhibited LPS -induced cell injury. [score:6]
Cells were co -transfected with the recombinant reporter vector and miR-155 mimic by using Lipofectamine 3000. showed that luciferase activity was significantly decreased in the cells transfected with recombinant reporter vector containing RACK1 promoter and miR-155 mimic, as compared to the negative control group (P < 0.05, Fig. 5a), suggesting miR-155 directly targeted 3’UTR of RACK1, and RACK1 might be a directly target of miR-155. [score:6]
It was suggested that the inflammatory mediators up-regulate the expression of miR-155 in macrophages and monocytes [32]. [score:6]
Down-regulation of miR-155 significantly decreased the elevated expression levels of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6, and IL-8) in LPS-stimulated BV2 cells. [score:6]
GAPDH: glyceraldehyde-3-phosphate dehydrogenase; LPS: lipopolysaccharide; MAPK: mitogen activated protein kinase; NF-κB: nuclear factor kappa B; mTOR: mammalian target of rapamycin The current study showed for the first time that down-regulation of miR-155 protected mouse microglia BV-2 cells against inflammatory injury which was induced by LPS in vitro. [score:6]
The expression level of miR-155 was significantly up-regulated after LPS stimulation in BV2 cells. [score:6]
CCK-8 assay results (Fig. 4a) showed that up-regulation of miR-155 significantly decreased cell viability of LPS -treated cells (P < 0.05), whereas down-regulation of miR-155 increased cell viability of these cells (P < 0.05). [score:6]
In several in vitro and in vivo studies, silencing of miR-155 expression ameliorated the deterioration of the disease and delayed the autoimmune encephalomyelitis and rheumatoid arthritis [19– 22]. [score:5]
MiR-155 mimic, miR-155 inhibitor, RACK1 targeted siRNA and their correspondingly negative controls (NC) were all synthesized by GenePharma Co. [score:5]
However, the down-regulation of miR-155 did not increase cell viability and decrease apoptosis under LPS -treated condition when RACK1 was knocked down (P < 0.05 or P < 0.001). [score:5]
The results in the present study provided the evidence that targeting miR-155 might be a potential therapeutic target for intracranial infection. [score:5]
ELISA test results (Fig. 6e-h) showed that miR-155 inhibitor transfection alone increased the concentrations of these factors, and while both miR-155 inhibitor and si-RACK1 transfection decreased concentrations of IL-1β, IL-6, IL-8, and TNF-α (P < 0.05 or P < 0.01). [score:5]
b Quantitative RT-PCR was performed to measure relative mRNA expression of RACK1 (n = 3), and (c) was performed to measure the protein expressions of RACK1 in cells which were transfected with scramble, miR-155 mimic, inhibitor control, and miR-155 inhibitor. [score:5]
was used to measure the expressions of RACK1, MAPK protein (p38), NF-κB proteins (p65 and lκBα), and mTOR proteins (mTOR and p70S6K) in BV2 cells which were treated with LPS, LPS + scramble, LPS + miR-155 mimic, LPS+ inhibitor control, and LPS + miR-155 inhibitor. [score:5]
Therefore, miR-155 might be a pro-inflammatory miRNA in inflammatory diseases and silencing of its expression might prevent inflammation. [score:5]
Combine with the aforementioned findings of the present study, we conjectured that knockdown of miR-155 protected microglia cells against LPS -induced inflammatory injury via targeting RACK1 and regulating activations of MAPK/NF-κB and mTOR signaling pathways. [score:5]
BV2 cells were administrated with LPS, LPS + scramble, LPS + miR-155 mimic, LPS+ inhibitor control, and LPS + miR-155 inhibitor. [score:5]
Taqman MicroRNA Reverse Transcription Kit and Taqman Universal Master Mix II with TaqMan MicroRNA Assay (Applied Biosystems, Foster City, CA, USA) were used for testing the expression level of miR-155 and mRNAs expressions in cells. [score:4]
Therefore, we speculated that down-regulation of miR-155 rescued BV2 cells from LPS -induced inflammatory injury might be via modulating RACK1. [score:4]
RACK1 was a directly target of miR-155. [score:4]
In addition, down-regulation of miR-155 increased cell viability and decreased cell apoptosis of the LPS-injured cells. [score:4]
Fig. 5RACK1 was a directly target of miR-155. [score:4]
via modulating RACK1To determine the role of RACK1 in miR-155 modulated BV2 cells which were injured by LPS, the expressions of miR-155 and/or RACK1 were knocked down in BV2 cells. [score:4]
Down-regulation of miR-155 rescued BV2 cells from LPS -induced inflammatory injury via modulating RACK1. [score:4]
Knockdown of miR-155 protected mouse microglia BV2 cells from LPS -induced inflammatory injury via targeting RACK1 and deactivating MAPK/NF-κB and mTOR signaling pathways. [score:4]
To determine the role of RACK1 in miR-155 modulated BV2 cells which were injured by LPS, the expressions of miR-155 and/or RACK1 were knocked down in BV2 cells. [score:4]
Down-regulation of miR-155 rescued BV2 cells from LPS -induced inflammatory injury. [score:4]
In conclusion, the present study demonstrated that knockdown of miR-155 protected microglia cells from LPS -induced inflammatory injury via targeting RACK1 and modulating MAPK/NF-κB and mTOR signaling pathways. [score:4]
Down-regulation of miR-155 protected BV2 cells from LPS -induced inflammatory injury via deactivation of MAPK/NF-κB and mTOR pathways. [score:4]
However, knockdown of both miR-155 and RACK1 decreased cell viability, increased apoptosis and the expression of pro-inflammatory cytokines. [score:4]
In our study, knockdown of miR-155 alone increased cell viability, decreased apoptosis and the expression of pro-inflammatory cytokines. [score:4]
It has been reported that the expression of miR-155 is altered in murine glial cells administrated with the bacterial endotoxin lipopolysaccharide (LPS) [23]. [score:3]
Cell viability and apoptosis of cells which were treated with LPS, LPS + NC, LPS + miR-155 inhibitor, or LPS + miR-155 inhibitor + si-RACK1 were measured. [score:3]
ELISA results showed increased concentrations of these inflammatory cytokines in miR-155 mimic transfected cells and decreased concentrations in miR-155 inhibitor transfected cells (P < 0.05, Fig. 4E-H). [score:3]
The mechanistic study showed that these inhibitory effects of miR-155 on BV2 cells were mediated by RACK1 and MAPK/NF-κB and mTOR signaling pathways. [score:3]
As shown in Fig. 6a and b, after LPS administration, miR-155 inhibitor transfection alone significantly increased cell viability and decreased apoptosis (both P < 0.05). [score:3]
Interestingly, miR-155 knockdown did not attenuate LPS -induced inflammatory injury when RACK1 was knocked down. [score:3]
RACK1 was a target of miR-155. [score:3]
LPS increased miR-155 expression during cell injury. [score:3]
LPS administration decreased BV2 cell viability, promoted apoptosis and increased the release of pro-inflammatory cytokines; while miR-155 knockdown rescued BV2 cell from LPS -induced injury. [score:2]
Furthermore, we investigated the underlying mechanisms of which miR-155 down-regulation rescued BV2 cells from LPS -induced inflammatory injury. [score:2]
The mechanistic study indicated that miR-155 knockdown deactivated MAPK/NF-κB and mTOR signaling pathways under LPS -treated conditions. [score:2]
The results showed that the relative expression of miR-155 was significantly increased in the LPS -treated cells compared to the control cells (without LPS treatment) (P < 0.05, Fig. 3a). [score:2]
MiR-155 plays essential roles in autoimmune diseases and inflammatory responses [18]. [score:2]
These findings suggested that RACK1 negatively regulated by miR-155 might decrease the inflammatory injury of cells via deactivating MAPK/NF-κB and mTOR pathways. [score:2]
These data hint us that miR-155 might play a role in LPS -induced cell damage in BV2 cells. [score:1]
Another in vivo study had demonstrated that deficiency of miR-155 ameliorated autoimmune inflammation of systemic lupus erythematosus in mice [18]. [score:1]
MiRNA-155 (miR-155) is derived from the non-coding transcript of the proto-oncogene B-cell integration cluster (bic) [17]. [score:1]
ns, no significance, * P < 0.05, ** P < 0.01 Effect of miR-155 on pro-inflammatory cytokines was determined by qRT-PCR and ELISA. [score:1]
We then measured the effect of LPS on miR-155 expression by qRT-PCR. [score:1]
Consistent with these researchers’ results, the present study also found that miR-155 was related with the activations of MAPK, NF-κB and mTOR signaling pathways, and miR-155 modulated these signaling pathways in a RACK1 -dependent manner. [score:1]
Evidences suggest that miR-155 was involved in many biological processes, including inflammation, immunity and hematopoiesis. [score:1]
Several microRNAs (miRNAs), including miR-155, have been reported to be critical modulators in peripheral and central nervous system inflammation. [score:1]
However, the role of miR-155 in intracranial infection is still unclear. [score:1]
BV2 cells were treated with 10 μg/ml LPS for 5 h. Quantitative RT-PCR was used to measure relative expression of miR-155. [score:1]
ns, no significance, * P < 0.05, ** P < 0.01 Effect of miR-155 on pro-inflammatory cytokines was determined by qRT-PCR and ELISA. [score:1]
The reporter construct (RACK1 promotor) or control vector (U6) were co -transfected into cells with miR-155 mimic or miRNA scramble by using Lipofectamine 3000 (Life Technologies, USA). [score:1]
a Relative luciferase activity of recombinant RACK1 promotor and U6 (control) vectors in BV2 cells which were co -transfected with scramble control or miR-155 mimic (n = 3). [score:1]
Intracranial inflammation miR-155 Inflammation Cell injury Microglia RACK1 Intracranial infection, one of the complications of traumatic brain injury, is relatively uncommon after brain injury, but it is associated with poor neurologic prognosis and cognitive disorder [1]. [score:1]
Luciferase reporter was constructed by inserting the RACK1 3’UTR carrying the putative miR-155 -binding sites into pMiR-report vector. [score:1]
[1 to 20 of 77 sentences]
9
[+] score: 323
In the current study, in addition to showing that miR-155 overexpression dysregulated SOCS1 gene expression at the post-transcriptional level, interestingly, we also showed that miR-155 inhibition not only restored SOCS1 protein expression but actually upregulated its expression. [score:15]
This TNFα-regulated miR-155 overexpression inhibited the expression of the apical junction complex component protein syntheses, ZO-1 and E-cadherin, by downregulating the post-transcriptional expression of RhoA, thereby disrupting the intestinal epithelial barrier (Tian et al., 2013). [score:13]
This not only provided further evidence of the suppression of SOCS1 by miR-155 and the resulting upregulation of the inflammatory response, but also indicated that inhibition of miR-155 not only restored SOCS1 levels but positively upregulated SOCS1 expression. [score:13]
Taken together, these findings indicate that miR-155 expression levels positively correlate with AP disease severity and expression of the miR-155 target, SOCS1, negatively correlates with AP pathogenesis. [score:9]
Interferon regulatory factor 3 inhibits astrocyte inflammatory gene expression through suppression of the proinflammatory miR-155 and miR-155 [∗]. [score:8]
In our study, the suppression of SOCS1 by miR-155 during the initial stages of SAP was found to lead to upregulation of the Th17/Treg ratio and inflammatory cytokine expression levels via a mechanism involving the JAK/STAT pathway, in line with previous findings (Singh et al., 2014; Qu et al., 2017). [score:8]
Our findings confirmed that miR-155 mediated upregulation of the Th17/Treg ratio and inflammatory cytokine expression levels via the suppression of SOCS1 in experimental AP. [score:8]
As shown in Figure 1A, miR-155 expression levels positively correlated with disease severity, with the SAP group of patients displaying the highest miR-155 expression. [score:7]
Taken together, these findings confirmed that inhibition of miR-155 expression decreased the conversion of CD4 [+] T cells to Th17 cells after caerulein induction, thereby decreasing IL-17 production, with a simultaneous increase in SOCS1 expression. [score:7]
To determine whether miR-155 expression levels differed with disease severity, quantitative RT-PCR analyses of miR-155 expression in the serum of patients diagnosed with AP were performed. [score:7]
These findings clearly indicated that miR-155 plays a crucial role in the progression of AP disease via a mechanism that involves the induction of an inflammatory response, regulation of the Th17/Treg ratio, and targeting of SOCS1 via activation of the STAT signaling pathway. [score:6]
Investigations will also be needed to analyze the potential clinical implications of upregulated SOCS1 expression in the absence of miR-155 if this microRNA is to be targeted therapeutically. [score:6]
RT-PCR analysis of SOCS1 in miR-155 -transfected cells confirmed that this miRNA downregulated the expression of SOCS1 in CD4 [+] T cells (P < 0.001 vs. [score:6]
ELISA to detect IL-17 expression levels in the culture supernatants revealed downregulation of IL-17 in the absence of miR-155 in AP -induced cells (P < 0.001 vs. [score:6]
Western blot analysis confirmed downregulation of SOCS1, IL-17, and pSTAT1 in response to miR-155 silencing compared with control mice throughout the course of the disease (Figure 5E). [score:5]
The expression of miR-155 was detected by RT-PCR after transfection with miR-155 mimics for 48 h or miR-155 inhibitor was used to pretreat the purified CD4 [+] T lymphocytes for 24 h before the induction of Th17 polarization with/without caerulein (2 μM) induction (Chen et al., 2015). [score:5]
Furthermore, miR-155 was reported to suppress the expression of SOCS1, triggering cytokine signaling through STAT5 (Dudda et al., 2013). [score:5]
Inhibition of miR-155 Expression Decreased the Conversion of CD4 [+] T Cells to Th17 Cells After Caerulein InductionCaerulein induction is a well-established method of stimulating the pathology of AP. [score:5]
Furthermore, inhibition of miR-155 in a mouse mo del of AP led to better disease outcomes. [score:5]
FIGURE 3Inhibition of miR-155 expression decreased the conversion of CD4 [+] T cells to Th17 cells following caerulein induction. [score:5]
SOCS1 has previously been reported to be a target for suppression by miR-155 (Lu et al., 2009). [score:5]
SOCS1 protein expression was significantly decreased in miR-155 overexpressing cells (P < 0.001 vs. [score:5]
It was proposed that expression of miR-155 induced the proliferation of Treg cells via suppression of SOCS1 (Lu et al., 2009). [score:5]
To examine the effects of miR-155 on inflammatory cytokine expression in the pancreatic tissue of mice, the animals were injected with miR-155 interference lentiviruses followed by 10, 50, or 250 μg/ml caerulein to mo del the AP, MAP and SAP stages of disease severity. [score:5]
Inhibition of miR-155 Expression Decreased the Conversion of CD4 [+] T Cells to Th17 Cells After Caerulein Induction. [score:5]
MiR-155 overexpression upregulated IL-17 levels in the cell supernatants (P < 0.001 vs. [score:5]
To investigate whether miR-155 directly regulates SOCS1 expression, the sequence of the 3 [′]-untranslated region (UTR) of SOCS1 was inserted downstream of a Renilla luciferase open reading frame in the pGL3-CMV vector (Promega, Madison, WI, United States). [score:5]
Overexpressed miRNA-155 dysregulates intestinal epithelial apical junctional complex in severe acute pancreatitis. [score:4]
This suggested that miR-155 may compete with another regulatory factor that positively affects SOCS1 expression, although further studies will be required to confirm this. [score:4]
control group) but not the MUT SOCS1 3 [′]-UTR, indicating that SOCS1 is a direct target of miR-155 (Figure 4B). [score:4]
The percentage of IL-17 [+] cells was significantly increased in those cells in which miR-155 was overexpressed and decreased in cells in which miR-155 was inhibited compared with the control (P < 0.001; Figure 2B), indicating that miR-155 promotes the generation of Th17 cells. [score:4]
To our knowledge, this is the first study to demonstrate that the interaction between miR-155 and SOCS1 plays a role in the disturbed regulation of the Th17/Treg ratio in SAP and demonstrates that this microRNA is therefore a promising candidate biomarker and/or therapeutic target for the treatment of SAP. [score:4]
SOCS1 Is a Direct Target of miR-155. [score:4]
Upregulation of miR-155 in CD4(+) T cells promoted Th1 bias in patients with unstable angina. [score:4]
FIGURE 4SOCS1 is a direct target of miR-155. [score:4]
control), and this trend was not only reversed following pretreatment with the miR-155 inhibitor but SOCS1 protein expression was significantly increased compared with the control (P < 0.001 vs. [score:4]
Dudda et al. (2013) confirmed this, showing that miR-155 plays an important role in promoting CD8(+) T cell immunity, and miR-155 and its target SOCS-1 are key regulators of effector CD8(+) T cells. [score:4]
For example, Dudda et al. (2013) reported that miR-155 and its target SOCS1 were key regulators of effector CD8(+) T cells, thereby affecting cytokine signaling through STAT5. [score:4]
Our findings clearly indicated that miR-155 expression and the inflammatory response correlate positively with the severity of AP, while they correlate negatively with the levels of SOCS1. [score:3]
In this study, SOCS1 was identified as one of the target genes of miR-155, confirming the findings of a previous report (Lu et al., 2009). [score:3]
The expression of this miRNA can be induced by inflammatory cytokines, such as TNFα, that are released into the circulation in the initial stages of a systemic inflammatory response (O’Connell et al., 2007; Sheedy and O’Neill, 2008) and miR-155 is considered a major inflammatory mediator that is crucial in the early stages of AP development (Sheedy and O’Neill, 2008; Kurowska-Stolarska et al., 2011; Nahid et al., 2011; Tarassishin et al., 2011; Piccinini and Midwood, 2012). [score:3]
miR-155 overexpression group. [score:3]
Our findings provide strong evidence that miR-155 is increased in AP patients, and its concentration increases with disease severity. [score:3]
CD4 [+] T cells from AP patients were first pretreated with miR-155 mimics or miR-155 inhibitor for 24 h. (A) Flow cytometric analyses of CD4 [+] T cells after 3 days of induction under Th17-polarizing conditions. [score:3]
In another study, Yao et al. (2012) demonstrated that miR-155 enhanced Treg and Th17 cell differentiation and Th17 cell function by targeting SOCS1. [score:3]
Peripheral blood samples from AP patients were obtained and miR-155 expression levels in serum were detected by qRT-PCR. [score:3]
Foxp3 -dependent microRNA155 confers competitive fitness to regulatory T cells by targeting SOCS1 protein. [score:3]
miR-155 overexpression group). [score:3]
To determine the levels of IL-17 production in response to miR-155 overexpression, ELISA of IL-17 was performed on the culture supernatants of the pretreated CD4 [+] T cells from AP patients (Figure 2C). [score:3]
To analyze the role of miR-155 in the accumulation of IL-17 [+] cells, CD4 [+] T cells isolated from AP patients were pretreated with miR-155 mimics or miR-155 inhibitor for 24 h prior to analysis. [score:3]
This was in line with previous findings for miR-155 in other inflammatory disease or animal mo dels (Dudda et al., 2013; Singh et al., 2014). [score:3]
CD4 [+] T cells were first induced with caerulein (2 μM) to simulate AP for 48 h and were pretreated with or without miR-155 inhibitor. [score:3]
BALB/c mice were injected with miR-155 interference lentiviruses (anti-miR-155) or control lentiviruses (anti-ctrl) followed by 10, 50 or 250 μg/ml caerulein to mo del the AP, MAP and SAP stages of disease severity. [score:3]
miR-155 overexpression group; Figure 2E). [score:3]
Our findings confirm the role of miR-155 as a major inflammatory mediator and offer insight into the mechanism of action of miR-155 in the disease pathology associated with SAP. [score:3]
To investigate the potential target genes of miR-155, bioinformatic analysis was performed using the TargetScan software. [score:3]
This effect was reversed by treatment of the cells with miR-155 inhibitor (P < 0.001 vs. [score:3]
control), and pretreatment with the miR-155 inhibitor reversed this trend (P < 0.001 vs. [score:3]
We were therefore interested in studying whether the interaction between miR-155 and SOCS1 could also play a role in the disturbed regulation of the Th17/Treg ratio in SAP. [score:2]
The miRNA, miR-155, which was the subject of this study, has a range of known biological functions, which include the induction of Toll-like receptor (TLR) activation in monocytes/macrophages and the modulation of TLR signaling, facilitating pro-inflammatory cellular responses (Singh et al., 2014) and initiating systemic inflammatory responses (O’Connell et al., 2007; Tili et al., 2007; Pedersen and David, 2008), as well as regulating Treg cell differentiation, maintenance, and function (Cobb et al., 2006; Lu et al., 2009). [score:2]
Further to this, we provided evidence that miR-155 binds directly to the 3 [′]-UTR of SOCS1. [score:2]
Endogenous control of immunity against infection: tenascin-C regulates TLR4 -mediated inflammation via microRNA-155. [score:2]
Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-alpha stimulation and their possible roles in regulating the response to endotoxin shock. [score:2]
MicroRNA-155 modulates Treg and Th17 cells differentiation and Th17 cell function by targeting SOCS1. [score:2]
Whereas in the mice injected with miR-155 interference lentiviruses, the pathogenic condition was attenuated at all disease stages revealing an improvement in the pathology of the pancreas compared with the control. [score:2]
Here, we performed in vitro assays using CD4 [+] T cells isolated from AP patients and in vivo assays using a mouse mo del of caerulein -induced AP, to analyze the mechanism by which the upregulation of miR-155 contributes to SAP. [score:2]
MiR-155 significantly inhibited the luciferase reporter activity of the WT (P < 0.001 vs. [score:2]
FIGURE 5The effect of miR-155 on histological changes in the pancreas. [score:1]
To examine the regulation of SOCS1 by miR-155, we performed a dual-luciferase reporter assay in CD4 [+] T cells. [score:1]
miR-155 group; Figure 4C). [score:1]
miR-155 group. [score:1]
miR-155 deficiency protects mice from experimental colitis by reducing T helper type 1/type 17 responses. [score:1]
control; Figure 3B), further confirming the role of miR-155 in modulating the Th17 ratio. [score:1]
Similarly, Singh et al. (2014) previously demonstrated the role for miR-155 in facilitating pro-inflammatory cellular responses during experimental colitis in mice by reducing Th1/Th17 responses. [score:1]
To identify the effect of miR-155 on Th17 differentiation, miR-155 mimics were designed and synthesized by GenePharma Company (Shanghai, China) and cell transfection was performed using Lipofectamine 2000 reagent. [score:1]
MicroRNA-155 as a proinflammatory regulator in clinical and experimental arthritis. [score:1]
To investigate the role of miR-155 in modulating Th17 cells, CD4 [+] T cells were pretreated with caerulein (2 μM) for 48 h following treatment with the miR-155 inhibitor, then flow cytometric analyses were performed (Figure 3A). [score:1]
In a mouse mo del of SAP, Tian et al. (2013) reported that miR-155 was significantly overexpressed in the intestinal epithelia, particularly during the initial inflammatory response that is characteristic of SAP (Sheedy and O’Neill, 2008; Kurowska-Stolarska et al., 2011; Nahid et al., 2011; Tarassishin et al., 2011; Piccinini and Midwood, 2012). [score:1]
HEK293T cells were transfected with the pGL3-basic construct along with either the miR-155 mimic or a scrambled control using Lipofectamine 2000 (Invitrogen). [score:1]
The interaction between miR-155 and SOCS1 has previously been reported, as has the resulting perturbation of differentiated T cell populations. [score:1]
MiR-155 Regulates AP Pathogenesis. [score:1]
The Effect of miR-155 on Histological Changes in the Pancreas. [score:1]
Using this approach, an miR-155 binding site was predicted in the 3 [′]-UTR of SOCS1 mRNA (Figure 4A). [score:1]
Cells were co -transfected with wild-type (WT) or mutant (MUT) SOCS1 3 [′]-UTR plasmids, and miR-155 or control miR. [score:1]
[1 to 20 of 84 sentences]
10
[+] score: 322
In the present study, miR-155 over -expression in cardiac fibroblasts significantly suppressed HGF -induced Ski expression, suggesting that Ski/SnoN might be a direct target of miR-155 and therefore exhibits profibrotic response through suppression of Ski/SnoN signaling. [score:12]
Interestingly, BMPC treatment inhibited MI -induced up-regulation of miR-21 (P<0.05; Figure 1A; shown to inhibit fibrosis by targeting sprouty homologue-1 [8] and phosphatase and tensin homologue [25]) and miR-155 (P<0.05; Figure 1B), which has been shown to play a role in cancer, atherosclerosis and immunomodulation [26], [27], [28], [29], [30]. [score:10]
Interestingly, BMPC administration modulates the expression of several fibrosis-related miRNAs after MI, specifically up-regulated miR-29 and miR-133a and down-regulated miR-155 and miR-21. [score:9]
BMPCs release HGF, which inhibits miR-155 leading to de-repression of inhibitors of TGF-β signaling, Ski/SnoN (possible targets of miR-155), thereby inhibiting cardiac fibrosis. [score:9]
0060161.g009 Figure 9 BMPCs release HGF, which inhibits miR-155 leading to de-repression of inhibitors of TGF-β signaling, Ski/SnoN (possible targets of miR-155), thereby inhibiting cardiac fibrosis. [score:9]
Interestingly, miR-155 over -expression abrogated HGF -mediated decrease in fibrosis-related markers like Col1A1, Col3A1 and α-SMA (Figure 8; P<0.01), suggesting that antifibrotic effect of HGF/miR-155 might be working predominantly through suppression of negative feedback inhibitor of TGF-β signaling. [score:7]
Given that microRNAs (miRNAs) modulate pathophysiology of cardiovascular diseases through regulation of gene expression [7], [8], [9], [47], we determined whether BMPCs administration after MI regulates miRNAs (like miR-21, miR-27, miR-29, miR-155, miR-30a and miR-133a) that have been shown to play a role in fibrosis in various tissues/organs [8], [11], [12]. [score:7]
HGF Inhibition Abrogates the Antifibrosis Effect of BMPC after Myocardial Infarction in Diabetic db/db MiceGiven the strong correlation between diabetes and cardiac fibrosis [13], [14], [15], [16], we explored whether BMPC therapy (via HGF secretion) inhibits miR-155 expression and prevents cardiac fibrosis in the infarcted hearts of diabetic mice. [score:7]
However, miR-155 over -expression inhibited expression of Ski and SnoN at both mRNA and protein levels in cardiac fibroblast cells. [score:7]
Saline -treated (control) MI mice showed a significant up-regulation of miR-21 and miR-155 and decrease in miR-29 and miR-133a expression (Figure 1). [score:6]
Interestingly, HGF inhibition using anti-HGF antibodies in BMPC treated mice showed pronounced elevation of miR-155 expression (Figure 3, P<0.05 vs IgG -treated mice) in association with increased myocardial fibrosis (Figure 4; P<0.05), depressed cardiac function (reduced %EF; Figure 5; P<0.05) and increased mRNA expression of fibrotic markers (Figure 6) as compared to IgG treated mice. [score:6]
In contrast, addition of BMPC conditioned media significantly suppressed the diabetic condition induced up-regulation of miR-155 (P<0.05). [score:6]
miR-155 over -expression abrogates HGF -induced inhibition of fibrogenic response in mouse cardiac fibroblasts (CFs). [score:5]
In association with increased miR-155, diabetic conditions significantly increased the mRNA expression of fibrotic markers, including Col1A1, Col3A1 and α-SMA after a 24 hour stimulation (Figures 2B, 2C and 2D; P<0.05) and protein expression of collagen I and α-SMA (Figure 2E) in CFs. [score:5]
BMPC Conditioned Media (BMPC-CM) Inhibits miR-155 Expression in Mouse Cardiac Fibroblasts (CFs) and Fibrogenesis Signaling in a Diabetic milieu, in vitro Cardiac fibrosis significantly contributes to diabetes -induced diastolic dysfunction [9], [32], [33] and TGF-β activation plays a critical role in the process [34], [35], [36]. [score:5]
These data suggest that HGF, which is secreted by BMPC, inhibits diabetic condition -induced miR-155 expression and blocks fibrogenesis activity of cardiac fibroblasts in vitro. [score:5]
We further show that neutralizing hepatocyte growth factor (HGF) signaling, both in vitro and in vivo, inhibits miR-155 expression and Ski/SnoN signaling leading to aggravated fibrogenesis response. [score:5]
Over -expression of miR-155 in cardiac fibroblasts only marginally affected the mRNA expression of TGF-β1 and its type I and type II receptors. [score:5]
miR-155 Over -expression Inhibits HGF -mediated Anti-fibrosis Effect in Mouse Cardiac Fibroblast, in vitro. [score:5]
C), demonstrating that inhibition of HGF signaling reverses the effect of BMPC therapy on miR-155 expression and cardiac fibrosis and function in diabetic mice. [score:5]
miR-155 Over -expression Inhibits HGF -mediated Anti-fibrosis Effect in Mouse Cardiac Fibroblast, in vitro To evaluate the effect of miR-155 on fibrosis signaling, we over-expressed miR-155 in mouse cardiac fibroblasts using miR-155 mimic (pre-miR-155) and determined the effect on HGF -mediated anti-fibrosis signaling. [score:5]
In particular, BMPCs release HGF, which inhibits the miR-155 -mediated profibrosis response leading to inhibition of cardiac fibrosis and improvements in cardiac function. [score:5]
F. Protein expression of Ski and SnoN in cardiac fibroblasts following over -expression of miR-155 was determined by Western blotting. [score:5]
CFs were either transfected with miR-155 mimics (pre-miR-155) to over-express miR-155 or negative control mimics (control) for 72 hrs and mRNA expression of various genes were determined by qRT-PCR. [score:5]
0060161.g007 Figure 7CFs were either transfected with miR-155 mimics (pre-miR-155) to over-express miR-155 or negative control mimics (control) for 72 hrs and mRNA expression of various genes were determined by qRT-PCR. [score:5]
E. Protein expression of collagen I and α-SMA in cardiac fibroblasts with miR-155 over -expression was determined by Western blotting. [score:5]
Given the strong correlation between diabetes and cardiac fibrosis [13], [14], [15], [16], we explored whether BMPC therapy (via HGF secretion) inhibits miR-155 expression and prevents cardiac fibrosis in the infarcted hearts of diabetic mice. [score:5]
miR-155 over -expression (in presence of HGF) did not affect expression of TGF-β (A), TGF-βR1 (B) and TGF-βR2 (C). [score:5]
BMPC Conditioned Media (BMPC-CM) Inhibits miR-155 Expression in Mouse Cardiac Fibroblasts (CFs) and Fibrogenesis Signaling in a Diabetic milieu, in vitro. [score:5]
As compared to control siRNA BMPC treated hearts, inhibition of HGF in transplanted BMPC (siRNA-HGF) significantly increased miR-155 expression in the myocardium (Figure S6. [score:4]
In the present study we demonstrate that bone marrow-derived progenitor cell (BMPC) administration regulates expression of miRs (specifically miR-155) and modulates fibrosis in the infarcted heart in diabetic (db/db) mice. [score:4]
Also, Ski has been shown to be a direct target of miR-155 in melanoma cell lines [29]. [score:4]
TGF-β -treated murine mammary gland (NMuMG) epithelial cells showed significantly elevated miRNA-155 levels and knockdown of miR-155 suppressed TGF-β -induced epithelial-mesenchymal transition (EMT) [28]. [score:4]
Furthermore, inhibition of HGF signaling in vivo by systemically applying antibodies against HGF significantly elevated miR-155 expression and aggravated cardiac fibrosis as compared to BMPC -treated mice (Figure 6). [score:4]
0060161.g002 Figure 2Conditioned media from BMPC regulates miR-155 expression and fibrogenic response in mouse cardiac fibroblasts in vitro. [score:4]
Conditioned media from BMPC regulates miR-155 expression and fibrogenic response in mouse cardiac fibroblasts in vitro. [score:4]
Interestingly, miR-155 over -expression significantly decreased mRNA expression of Ski/SnoN (Figure 7D and 7E; P<0.05) and protein levels (Figure 7F) as compared to control cells. [score:4]
To determine whether BMPCs regulate fibrosis-related miRNAs in infarcted heart, we injected mouse BMPCs in infarcted hearts of C57BLKS/J mice and determined (at 3 days post-MI) the expression of miRNAs (miR-21, miR-27, miR-29, miR-155, miR-30a and miR-133a, which have been shown to play a role in fibrosis [9], [10], [11], [24], [25]). [score:4]
The effect of BMPC conditioned media on miR-155 expression was significantly reversed by a neutralizing antibody directed against HGF (P<0.05 vs IgG treated cells; Figures 2A). [score:4]
BMPC therapy decreased miR-21 (A) and miR-155 (B) and increased miR-29 (C) and miR-133a (D) expression in comparison with saline -treated or sham groups. [score:3]
Figure 1 depicts that saline -treated MI mice showed a significant increase in expression of miR-21 and miR-155 (P<0.01; Figures 1A and 1B) and decrease in miR-29 and miR-133a (P<0.01; Figures 1C and 1D) levels with non-significant reducing trend of miR-27 and miR-30a (Figures S4. [score:3]
Assessment of miR-155 Expression and Fibrogenesis. [score:3]
Based on these data and available literature, we anticipate that targeting miR-155 might serve as a potential therapy against cardiac fibrosis in diabetic heart. [score:3]
BMPC administration reduced the expression of profibrotic miR-155 and fibrosis response in the diabetic hearts. [score:3]
As shown in Figure 2A, diabetic conditions markedly increased the expression of miR-155 after 24 hours (P<0.01). [score:3]
As shown in Figure 7, miR-155 over -expression did not affect TGF β1, TGF-β receptor 1 (TGF-βR1) and TGF-β receptor 2 (TGF-βR2) (Figure 7A,B,C). [score:3]
0060161.g008 Figure 8CFs were either transfected with miR-155 mimics (pre-miR-155) to over-express miR-155 or with negative control mimics (control), treated with or without HGF under diabetic conditions [TGF-β (10 ug/mL+high glucose (25 mM glucose)] and mRNA expression of fibrogenesis markers like col1A1 (A), col3A1 (B) and α-SMA (C) were measured by qRT-PCR. [score:3]
Several studies have reported that miR-155 expression is modulated in a number of physiological and pathological processes such as hematopoiesis, immunity, tumorigenesis [26], [27], [28], [29] and inflammation [49]. [score:3]
Over -expression of miR-155 nullified the effects of HGF. [score:3]
However, miR-155 was most efficiently suppressed by BMPC treatment and its role in fibrosis is not known and has been shown to play an important role in acute viral myocarditis, cancer, inflammation and immunomodulation [26], [27], [28], [29], [30]. [score:3]
Expression of miR-155 in infarcted hearts (day 3) of db/db mice receiving BMPC intramyocardial. [score:3]
0060161.g003 Figure 3Expression of miR-155 in infarcted hearts (day 3) of db/db mice receiving BMPC intramyocardial. [score:3]
Additionally, in a subset of mice, administration of recombinant HGF decreased miR-155 expression and reduced fibrosis and improved LV function (Figure S5, P<0.05 vs saline -treated mice). [score:3]
Interestingly, miR-155 was most efficiently suppressed by BMPC treatment in the present study. [score:3]
miR-155 Over -expression in Cardiac Fibroblasts (CF). [score:3]
To explore the potential intracellular molecular mechanism by which miR-155 promotes fibrosis response in diabetes, we examined the effect of miR-155 over -expression in cardiac fibroblasts on TGF-β, TGF-β receptors -I & -II and co-repressor of TGF-β signaling like Ski/SnoN. [score:3]
Given that diabetes is associated with chronic inflammatory response; and that miR-155 plays an important role in cancer, inflammation and immunomodulation [26], [27], [28], [29] and limited literature is available regarding its role in cardiac fibrosis especially in the setting of diabetes and BMPC therapy, we further elucidated the significance of this miRNA in BMPC -mediated inhibition of fibrosis. [score:3]
miR-155 over -expression modulates fibrosis-related signaling in mouse cardiac fibroblasts (CFs). [score:3]
Furthermore, inhibition of miR-155 attenuated cardiac inflammatory response and myocardial damage in acute viral myocarditis in mice [27]. [score:3]
Furthermore, computational analysis (using TargetScan database) shows that Ski lodges a complimentary sequence for miR-155. [score:3]
Next, we determined whether miR-155 over -expression affects HGF -mediated antifibrogenic response in cardiac fibroblasts under diabetic milieu (to stimulate fibrogenesis response). [score:3]
Figure S2 miR-155 over -expression in adult mouse cardiac fibroblasts. [score:3]
CFs were either transfected with miR-155 mimics (pre-miR-155) to over-express miR-155 or with negative control mimics (control), treated with or without HGF under diabetic conditions [TGF-β (10 ug/mL+high glucose (25 mM glucose)] and mRNA expression of fibrogenesis markers like col1A1 (A), col3A1 (B) and α-SMA (C) were measured by qRT-PCR. [score:3]
To determine whether BMPC may inhibit miR-155 expression in a paracrine manner, we evaluated the effect of conditioned medium derived from cultured BMPC on cardiac fibroblasts (CFs) exposed to diabetic milieu (to activate fibrogenesis signaling). [score:3]
Several miRNAs in the myocardium are modulated after MI including those that have been implicated in the regulation of fibrosis like miR-21, miR-29, miR-30, miR-133 and miR-155 [8], [9], [10], [11], [12]. [score:2]
For assessing miR-155 expression (24 hr after treatment), total RNA was isolated using miRNeasy kit (Qiagen) and miRNA was analyzed by Taqman MicroRNA assay kits (Applied Biosystems, Carlsbad, CA) in accordance with the manufacturer’s protocol. [score:2]
Together, these data demonstrate that BMPC-derived HGF regulates cardiac miR-155 and therefore fibrosis in the infarcted heart. [score:2]
miR-155 expression (determined by qRT-PCR) was increased in cardiac fibroblasts transfected with miR-155 mimics (pre-miR-155) for 72 h as compared to cells transfected with negative control mimics (control). [score:2]
As compared to saline treated mice, BMPC transplantation reduced miR-155 expression (albeit not significant, Figure 3) in the myocardium at 3 days after MI and showed decrease in cardiac fibrosis (Figure 4; P<0.05 vs saline -treated mice) and improved LV function (increased %EF; Figure 5; P<0.05 vs saline treated mice) at 28 days after MI. [score:2]
Together, these data demonstrate that BMPC-derived HGF regulates cardiac miR-155 and therefore modulates fibrosis in the infarcted heart. [score:2]
Along with the progression of fibrosis, the expression of miR-155 was significantly elevated after MI in the hearts of db/db mice that received BMPC transfected with siRNA against HGF, as compared to control siRNA BMPC treated hearts. [score:2]
Pre-miR-155 transfection significantly increased miR-155 expression as compared to mimic control transfected cells (P<0.01; Figure S2, supporting information). [score:2]
We further evaluated miR-155 effect on inhibitors of TGF-β signaling like Sloan-Kettering Institute proto-oncogene (Ski) and Ski-related novel gene, non-Alu-containing (SnoN). [score:1]
Recent study has shown that increased circulating miR-155 was predictive for cardiac death in post-AMI patients. [score:1]
However, the findings in the present study illustrate the potential of confining Smad activity using anti-miR-155 as an effective strategy for blocking cardiac fibrosis. [score:1]
High levels of miR-155 were detected in synovial fibroblasts from rheumatoid arthritis patients, an autoimmune disorder associated with high inflammation [51]. [score:1]
To evaluate the effect of miR-155 on fibrosis signaling, we over-expressed miR-155 in mouse cardiac fibroblasts using miR-155 mimic (pre-miR-155) and determined the effect on HGF -mediated anti-fibrosis signaling. [score:1]
Recent study has shown that a subset of circulating miRNAs (specifically, increased serum miR-155 and miR-380) are predictive for cardiac death in human patients after hospital discharge for acute myocardial infarction [31]. [score:1]
BMPC therapy marginally (although not significantly) decreased MI -induced miR-155 expression (measured by qRT-PCR) in comparison with saline -treated group. [score:1]
In a mouse mo del of lung fibrosis, miR-155 has been shown to be increased in response to several inflammatory mediators in different cell types [50]. [score:1]
To determine the effects of BMPC-CM on cardiac fibroblast miR-155 expression and fibrosis signaling in vitro, we exposed cardiac fibroblasts to diabetic milieu to activate fibrogenesis signaling and evaluated the effect of conditioned medium derived from cultured BMPC. [score:1]
To enable detailed study of miR-155 effects on fibrosis-related genes in cardiac fibroblasts, we transfected cardiac fibroblasts with either pre-miR-155 (miR mimics) or negative control mimics. [score:1]
However, functions of miR-155 in cardiac fibroblasts and its role in fibrogenesis response have not yet been documented. [score:1]
[1 to 20 of 83 sentences]
11
[+] score: 320
KLF2 over -expression significantly decreased the expression of miR-155 (Fig 5B) but increased its target gene SOCS-1 (Fig 4C and 4E) in association with a high level of expression of the inflammatory cytokine genes (MCP-1, IL-6) but a lower level of expression of anti-inflammatory cytokine genes (IL-10) in the aortic arches of apoE-/- mice after 18 weeks of a HFD (Fig 4D and 4F). [score:11]
We also found that the increased expression of miR-155, monocyte chemoattractant protein (MCP-1) and interleukin (IL)-6 and the decreased expression of the suppressor of cytokine signaling (SOCS)-1 and IL-10 in ox-LDL -treated macrophages were significantly suppressed by KLF2. [score:9]
Most interestingly, restoration of miR-155 levels in KLF2 over -expressing macrophages increased MCP-1 and IL-6 but reduced IL-10 expression, indicating that over -expression of miR-155 could partly reverse the suppressive effects of KLF2 on the macrophage inflammatory response induced by ox-LDL (Fig 3A and 3B). [score:9]
Most interestingly, restoration of miR-155 levels in KLF2 over -expressing macrophages increased MCP-1 and IL-6 but reduced IL-10 expression, indicating that the over -expression of miR-155 could partly reverse the suppressing effects of KLF2 on the macrophage inflammatory response induced by ox-LDL (Fig 3A and 3B, # p<0.05 for the indicated comparisons). [score:9]
Mechanistically, even though a consensus KLF2 binding sequence in the promoters of miR-155 has not yet been identified, the KLF2-regulated transcriptome probably contains a large number of indirect targets as well because KLF2 has been reported to regulate the expression of over a thousand genes [32, 33]. [score:8]
In agreement with a recently published study [27, 28], we also showed that the exposure of macrophages to ox-LDL led to a marked up-regulation of miR-155 expression, which was positively correlated with the expression of pro-inflammatory cytokines (Fig 1D–1F). [score:8]
Because KLF2 is known to exert anti-inflammatory effects, we undertook over -expression studies to gain insight into the role of KLF2 in the regulation of miR-155 and the expression of its targeting gene SOCS-1 in macrophages. [score:8]
By using both gain-of-function and loss-of-function approaches, our above data strongly suggest that miR-155 and its targeted gene SOCS-1 expression in macrophages are regulated by KLF2 and are correlated with the expression of inflammatory cytokines. [score:8]
Peritoneal macrophages from wild-type (WT) C57Bl/6 mice were transfected with either recombinant adenovirus vector expressing KLF2 (Ad-KLF2) or siRNA targeting KLF2 (KLF2-siRNA) for 24 h–48 h, then stimulated with oxidized low-density lipoproteins (ox-LDL, 50 μg/mL) for 24 h. Quantitative real-time polymerase chain reaction showed that KLF2 markedly reduced the expression of miR-155 in quiescent/ox-LDL-stimulated macrophages. [score:7]
We also showed that the exposure of macrophages to ox-LDL led to marked up-regulation of miR-155 but down-regulation of SOCS-1 (Fig 1B and 1C, p<0.05). [score:7]
These results indicate that the KLF2 inhibition of the pro-inflammatory activation of macrophages is at least partly due to KLF2 -mediated suppression of the expression of miR-155. [score:7]
Although the molecular basis of the KLF2 -mediated inhibition of miR-155 in macrophages remains unknown, our study raises the interesting possibility that the ability of KLF2 to regulate various biological processes may be related to its ability to directly regulate gene transcription activity as well as indirectly modulate cellular miRNA. [score:7]
Recent studies have shown that several transcriptional factors, including AP-1, C-myb, and NF-κB, up-regulate the expression of miR-155 in the immune system [35, 36, 37] but the transcriptional repressors of miR-155 remain unknown. [score:6]
To further confirm a possible role of miR-155 in the KLF2 -mediated inhibition of macrophage inflammatory responses, we transfected anti-miR-155 (inhibitor) into KLF2 knockdown macrophages and exposed the transfected cells to ox-LDL after 24 hours. [score:6]
The suppression of miR-155 activity in KLF2 knockdown macrophages with anti-miR-155 significantly overcame the pro-inflammatory properties associated with KLF2 knockdown (Fig 3C and 3D, # p<0.05 for the indicated comparisons). [score:5]
Most importantly, the ox-LDL -induced increase in miR-155 decreased the expression of SOCS-1 protein associated with a rise in MCP-1 and IL-6 and a decline in IL-10 in macrophages that were significantly suppressed by KLF2 (Fig 1D–1F, # p<0.001 and * p<0.05 for the indicated comparisons). [score:5]
0139060.g001 Fig 1 The effects of KLF2 over -expression on miR-155 expression in macrophages (mø) cultured alone or activated by ox-LDL were examined. [score:5]
To further confirm the regulation of macrophage miR-155, its targeting gene SOCS-1 and inflammatory cytokines by KLF2, small interfering RNA -mediated (siRNA-KLF2) knockdown studies were also undertaken. [score:5]
The suppression of miR-155 activity in KLF2-knockdown macrophages with anti-miR-155 significantly overcame the pro-inflammatory properties associated with KLF2 knockdown (Fig 3C and 3D). [score:5]
Moreover, the effect of recombinant adenovirus -mediated KLF2 significantly attenuated diet -induced atherosclerotic lesion formation in apoE [-/-] mice and was associated with a significant decrease in the expression of miR-155 and the inflammatory cytokine genes (MCP-1, IL-6) as well as increased expression of the anti-inflammatory cytokine gene (IL-10) in the aortic arches and macrophages of pro-atherogenic mice (Fig 4). [score:5]
The effects of KLF2 over -expression on miR-155 expression in macrophages (mø) cultured alone or activated by ox-LDL were examined. [score:5]
In the current study, we observed that the expression of the inflammation -associated miR-155 was significantly suppressed by KLF2 in unstimulated/ox-LDL-stimulated macrophages (Fig 1A). [score:5]
Conversely, the increased levels of MCP-1 and IL-6 but decreased level of IL-10 induced in macrophages by ox-LDL were suppressed by inhibition of miR-155. [score:5]
To further confirm a possible role of miR-155 in the KLF2 -mediated inhibition of the macrophage inflammatory response, we found by using gain-of-function and loss-of-function approaches that the increased levels of MCP-1 and IL-6 but decreased level of IL-10 in macrophages induced by ox-LDL were further enhanced by over -expression of miR-155. [score:5]
The effects of miR-155 over -expression on MCP-1 and IL-6 expression in ox-LDL-stimulated macrophages were examined (A). [score:5]
Conversely, the suppression of miR-155 in KLF2 knockdown macrophages significantly overcame the pro-inflammatory properties associated with KLF2 knockdown. [score:5]
Most importantly, over -expression of miR-155 could partly reverse the suppressive effects of KLF2 on the inflammatory response of macrophages. [score:5]
Consistent with the results of our over -expression studies, our data showed that miR-155 was increased by KLF2 knockdown in un-stimulated and ox-LDL-stimulated macrophages (Fig 2A, p<0.05). [score:4]
It has been reported that SOCS-1, a negative regulator of the TLR4 -mediated inflammation pathway, is a miR-155 target protein. [score:4]
The expression of KLF2 was increased in the peritoneal macrophages of Ad-KLF2- and HFD -treated apoE-/- mice compared with the peritoneal macrophages from HFD -treated apoE-/- mice (Fig 5A), which was accompanied by a significantly decreased miR-155 (Fig 5B) but increased SOCS-1 expression level (Fig 5C). [score:4]
In macrophages, several miRNAs, including miR-155, miR-146, miR-125b, have been found to be substantially up-regulated by Toll-like receptor (TLR) ligands [8, 9]. [score:4]
Ox-LDL -induced miR-155/SOCS-1 and pro-inflammatory responses in macrophages are regulated by KLF2 over -expression. [score:4]
We found a much higher miR-155 (Fig 5B) but lower SOCS-1 (Fig 5C) expression level in the peritoneal macrophages of HFD -treated apoE-/- mice that was associated with a reduced KLF2 (Fig 5A) expression level compared with the macrophages from WT mice. [score:4]
KLF2 knockdown increased ox-LDL -induced pro-inflammatory activation of macrophages by increasing miR-155 and decreasing SOCS-1 expression (Fig 2B–2F). [score:4]
Although the functional relevance of macrophage miR-155 expression is unclear, studies have indicated that miR-155 shows both anti- and pro-inflammatory effects by regulating TAB2 and SOCS-1, respectively [10, 11, 12]. [score:4]
Because KLF2 and miR-155 play key roles in regulating the function of macrophages in inflammation, additional studies aimed at identifying the relationship between KLF2 expression and miRNA levels in macrophages are warranted. [score:4]
However, ox-LDL can also up-regulate miR-125a-5p and miR-155, which reduces the accumulation of lipids and the secretion of cytokine in macrophages [25, 26]. [score:4]
Because KLF2 is known to exert anti-inflammatory effects and inhibit the pro-inflammatory activation of monocytes, we sought to identify how inflammation -associated miR-155 is regulated by KLF2 in macrophages. [score:4]
The impact of miR-155 over -expression on IL-10 expression in ox-LDL-stimulated macrophages was evaluated (B). [score:3]
We then examined the expression of KLF2, miR-155, SOCS-1 and cytokine genes by RT-PCR and Western blotting analysis and the formation of atherosclerotic lesions in the aortic arch sections by staining with H&E, as described previously [16, 17, 18]. [score:3]
The mRNA expression levels of KLF2 (A), miR-155 (B), SOCS-1 (C) and cytokines (D) in these cells were determined by RT-PCR (n = 5; #, *, and δ indicate p<0.001, p<0.05 and p>0.05, respectively, for the indicated comparisons). [score:3]
The expression of KLF2, miR-155, SOCS-1 and the production of cytokines in macrophages was determined by RT-PCR. [score:3]
Effects of KLF2 on miR-155/SOCS-1 and cytokine gene expression and the formation of atherosclerotic lesions in the aortic arches of apoE -deficient mice. [score:3]
The miRNA mimics and miRNA inhibitors for miR-155 were obtained from Ambion. [score:3]
KLF2 -mediated suppression of miR-155 reduced the inflammatory response of macrophages. [score:3]
Interestingly, the treatment of macrophages with ox-LDL appears to suppress several miRNAs induced after inflammatory stimulation such as miR-146a, miR-155, and miR-21 [23, 24]. [score:3]
0139060.g003 Fig 3 To further confirm the role of miR155 in the KLF2 -induced inhibition of macrophage inflammatory responses, WT macrophages and macrophages infected with EV or with viruses containing Ad-KLF2, siRNA-KLF2, or nonspecific control siRNA (NS) were cultured for 24 h. Using Lipofectamine 2000, mimic-miR-155 or anti-miR-155 was transfected into macrophages. [score:3]
0139060.g002 Fig 2 The effects of silencing KLF2 on miR-155 expression in macrophages cultured alone or activated by ox-LDL were examined. [score:3]
Finally, Ad-KLF2 significantly attenuated the diet -induced formation of atherosclerotic lesions in apolipoprotein E -deficient (apoE [-/-]) mice, which was associated with a significantly reduced expression of miR-155 and its relative inflammatory cytokine genes in the aortic arch and in macrophages. [score:3]
The results show that KLF2 markedly reduced the expression of miR-155 in unstimulated macrophages (Fig 1A, p<0.05). [score:3]
In contrast, silencing of KLF2 markedly increased miR-155 expression in un-stimulated/ox-LDL-stimulated macrophages (Fig 2A). [score:3]
To further confirm the role of miR155 in the KLF2 -induced inhibition of macrophage inflammatory responses, WT macrophages and macrophages infected with EV or with viruses containing Ad-KLF2, siRNA-KLF2, or nonspecific control siRNA (NS) were cultured for 24 h. Using Lipofectamine 2000, mimic-miR-155 or anti-miR-155 was transfected into macrophages. [score:3]
Our results showed that increased levels of MCP-1 and IL-6 in macrophages stimulated by ox-LDL were further enhanced by the over -expression of miR-155. [score:3]
Mø from WT C57BL/6 mice were infected with either empty virus (EV) (as a control) or virus containing Ad-KLF2 for 24–48 h and then stimulated with ox-LDL (50 μg/ml) for 24 h. Total RNA was extracted and subjected to RT-PCR analysis to determine miR-155 mRNA expression levels. [score:3]
Macrophages from WT C57BL/6 mice were infected with either viruses containing a nonspecific control siRNA (NS) or viruses containing siRNA-KLF2 for 24–48 h and then stimulated with ox-LDL (50 μg/ml) for 24 h. Total RNA was extracted and subjected to RT-PCR analysis to determine miR-155 mRNA expression levels. [score:3]
The effects of silencing miR-155 on MCP-1 and IL-6 expression in ox-LDL stimulated macrophages were assessed (C). [score:3]
The effect of KLF2 on miR-155/SOCS-1, cytokine gene expression and atherosclerotic lesion formation in the aortic arches of apoE -deficient mice. [score:3]
KLF2, miR-155, and SOCS-1 expression in the aortic arch were analyzed by RT-PCR, and the areas of atherosclerotic lesions in aortic arch regions were detected by hematoxylin–eosin staining. [score:3]
The impact of silencing miR-155 on IL-10 expression in ox-LDL stimulated macrophages was examined (D) (# and δ indicate p<0.05 and p>0.05, respectively, for the indicated comparisons). [score:3]
Role of miR-155 in the KLF2 -induced inhibition of macrophage activation. [score:3]
The effects of silencing KLF2 on miR-155 expression in macrophages cultured alone or activated by ox-LDL were examined. [score:3]
To demonstrate the functional relationship between miR-155 and KLF2, mimic- miR-155 or mimic-miR-155 control was transfected into KLF2 over -expressing peritoneal macrophages using Lipofectamine 2000. [score:3]
Role of miR-155 in KLF2 -mediated inhibition of macrophage activation. [score:3]
Given that both KLF2 and miR-155 play key roles in regulating the function of macrophages in the activation of inflammation, we sought to investigate how miR-155 is regulated by KLF2 and might be responsible for mediating the suppression of the pro-inflammatory activation of macrophages by KLF2. [score:3]
The effect of KLF2 on miR-155/SOCS-1 and the expression of cytokine genes in pro-inflammatory macrophages. [score:3]
The effects of KLF2 on miR-155/SOCS-1 and cytokine gene expression in pro-inflammatory macrophages. [score:3]
Ox-LDL induced miR-155/SOCS-1 and the pro-inflammatory responses of macrophages are regulated by KLF2. [score:2]
MiR-155, a typical multi-functional miRNA, is emerging as a novel regulator involved in the inflammation signaling pathway in the pathogenesis of atherosclerosis. [score:2]
Ox-LDL -induced miR-155/SOCS-1 and pro-inflammatory responses in macrophages are regulated by the silencing of KLF2. [score:2]
Additionally, the aortic arches of apoE-/- +HFD mice expressed higher levels of miR-155 (Fig 4B) but lower levels of SOCS-1 (Fig 4C and 4E) compared with WT mice. [score:2]
However, the function of miR-155 in ox-LDL-stimulated inflammation and atherosclerosis remains unclear. [score:1]
However, the role of miR-155 in the pathogenesis of atherosclerosis remains unclear. [score:1]
However, we were unable to detect the presence of the KLF2 transcription binding site in the promoters of miR-155. [score:1]
Macrophages from WT C57Bl/6 mice transfected with either EV or Ad-KLF2 for 24 h–48 h were then stimulated with ox-LDL (50 μg/mL) for 24 h. RT-PCR was performed to quantify the levels of miR-155, SOCS-1 and the cytokines MCP-1, IL-6, and IL-10. [score:1]
Indeed, two recent studies have shown opposite results regarding the effects of bone marrow cells with miR-155 deficiency on the process of atherosclerosis. [score:1]
The expression of miR-155 was detected according to the manufacturer’s instructions using the miScript PCR System (Qiagen, Valencia, CA) and miScript Primer Assays (Cat# MS00001701 for murine miR-155). [score:1]
Bar graphs indicate relative mRNA levels for KLF2 normalized to GAPDH mRNA levels (A); miR-155 normalized to U6 mRNA levels (B); SOCS-1 normalized to GAPDH mRNA levels (C); and cytokine genes (MCP-1, IL-6, and IL-10) normalized to GAPDH mRNA levels (D). [score:1]
One report showed that bone marrow cells with miR-155 deficiency increased atherosclerosis in low-density lipoprotein receptor (LDLR) [−/−] mice fed a high-fat diet by generating a more pro-atherogenic immune cell profile and a more pro-inflammatory monocyte/macrophage phenotype, indicating that miR-155 is atheroprotective in that mo del[13] whereas another report showed that miR-155 promoted atherosclerosis in apoE [-/-] mice by repressing B-cell lymphoma 6 protein in macrophages, thus enhancing vascular inflammation, suggesting that miR-155 is proatherogenic [14]. [score:1]
Bar graphs indicate relative miR-155 mRNA levels normalized to U6 mRNA levels (A). [score:1]
[1 to 20 of 79 sentences]
12
[+] score: 319
Furthermore, ectopic expression of miR-155-3p resulted in downregulated expression of endogenous FBXW7 protein and mRNA, while targeted knockdown of miR-155-3p increased the expression of FBXW7 protein and mRNA. [score:13]
These results suggest that miR-155-3p may directly bind to FBXW7 mRNA and regulates the FBXW7 expression via translational inhibition. [score:9]
In addition, overexpression of miR-155-3p is correlated with decreased levels FBXW7 mainly through inhibiting the expression of FBXW7. [score:7]
We found that FBXW7 was downregulated in the miR-155-3p overexpressed cells both in mRNA and protein levels (Fig.   8a and b), whereas FBXW7 was increased by the miR-155-3p specific inhibitor compared with that observed in the control cells (Fig.   8d and e). [score:7]
b Gene set enrichment analysis was carried out using ConceptGenTo confirm that FBXW7 is a target of miR-155-3p in BEL-7405 and HepG2 cells, the mRNA and protein levels of FBXW7 were analyzed by and western blot in overexpressed miR-155-3p BEL-7405 cells and inhibited miR-155-3p HepG2 cells. [score:7]
Our results suggest that upregulation of miR-155-3p may play an essential role in the development of HCC and may be employed as a prognosis marker and therapeutic target of HCC. [score:7]
We herein demonstrated that miR-155-3p promotes HCC tumorigenesis via reducing the expression of FBXW7 by inhibiting translation. [score:7]
b Gene set enrichment analysis was carried out using ConceptGen To confirm that FBXW7 is a target of miR-155-3p in BEL-7405 and HepG2 cells, the mRNA and protein levels of FBXW7 were analyzed by and western blot in overexpressed miR-155-3p BEL-7405 cells and inhibited miR-155-3p HepG2 cells. [score:7]
We demonstrated that miR-155-3p upregulating was a frequent event in HCC tissues and could be a potential targets for HCC patients. [score:6]
Our findings show that ectopic expression of miR-155-3p in HCC cells could facilitate clone formation and proliferation, and upregulation of miR-155-3p can promote clone formation and proliferation in HCC cells. [score:6]
These results suggest that inhibition of FBXW7 expression induced by miR-155-3p is responsible for clone formation and proliferation ability in HCC cells. [score:5]
Upregulation of miR-155-3p may enhance the clone formation and proliferation of a variety of cancer cells, and in turn, stimulate the development of tumors. [score:5]
We established BEL-7405 cells overexpressing miR-155-3p by introducing precursor-miR-155-3p using lentivirus vectors because the miR-155-3p expression level in BEL-7405 cell was the lowest among the several HCC cell lines analyzed and lentivirus vectors can be efficiently transfected into this cell line. [score:5]
To determine the prognostic impact of miR-155-3p expression in HCC, we categorized HCC patients into two groups based on miR-155-3p expression levels. [score:5]
Downregulation of miR-155-3p can strongly inhibit cell proliferation (Fig.   5b) and significantly restrains colony formation compared to control cells (Fig.   5c and d). [score:5]
A total of 200nM of microRNA Hairpin Inhibitor and its negative control (Thermo Scientific Dharmacon, Lafayette, CO, USA) were employed to transiently inhibit miR-155-3p and transfected 48 h prior to seeding with Oligofectamine (Invitrogen). [score:5]
Functional manipulation of miR-155-3p expression revealed its important role in regulating Th17 development. [score:5]
a Supervised hierarchical clustering of the genes differentially expressed after miR-155-3p overexpression in BEL-7405 cells. [score:5]
results indicated that a list of genes expression significantly changed after overexpression of miR-155-3p (Fig.   7a). [score:5]
In conclusion, FBXW7 is a direct target of miR-155-3p. [score:4]
The detection of a luciferase activity revealed that miR-155-3p significantly suppressed the activity of luciferase combined with wild-type FBXW7 3’-UTR in the BEL-7405 miR-155-3p cells (Fig.   9c) and increase FBXW7 3’-UTR in the HepG2 miR-155-3p cells, whereas no differences were observed following treatment with the control luciferase and FBXW7 3’-UTR possessing a mutation in the putative miR-155-3p binding site (Fig.   9d). [score:4]
We used the microarray, miRNA target prediction program and a luciferase report assay to demonstrate that miR-155-3p directly down regulates FBXW7 by binding its 3’-UTR. [score:4]
Fig. 5Downregulation of miR-155-3p reduce tumorigenesis in vitro and in vivo. [score:4]
Here we demonstrated that upregulation of miR-155-3p was common in HCC tissues and could serve as an independent prognosis predictor for HCC patients. [score:4]
a Establishment of downregulation of miR-155-3p in HepG2 cells. [score:4]
Previous studies found that miR-155-3p is also strongly upregulated in T cells. [score:4]
MiR-155-3p reduces the protein levels of FBXW7 by inhibiting translation. [score:4]
In addition, we observed significant inverse correlations between miR-155-3p and FBXW7 expression levels in vivo, which supports the regulation of miR-155-3p on FBXW7 observed in vitro. [score:4]
We found that miR-155-3p was remarkably upregulated both in HCC tissue and cell lines. [score:4]
Fig. 9FBXW7 is a direct target of miR-155-3p. [score:4]
Fig. 6Downregulation of miR-155-3p reduce tumorigenesis in vivo. [score:4]
Furthermore, our data in 45 paired HCC tissues showed that the expression of miR-155-3p was significantly elevated in cancerous tissues compared with juxta cancerous tissues, revealing a clear correlation between miR-155-3p expression and HCC malignancy. [score:4]
Fig. 11Reduced FBXW7 expression enhances the colony formation and proliferation phenotype of HepG2-Anti-miR-155-3p cells. [score:3]
The presence of a mature-miR-155-3p expression was confirmed by (Fig.   5a). [score:3]
Furthermore, our findings also showed that ectopic expression of miR-155-3p could accelerate clone formation and proliferation ability of HCC cells. [score:3]
c miR-155-3p expression levels are significantly increased in patients of stage III-IV in comparison to the stage I-II. [score:3]
a Expression profile of miR-155-3p in Hepatocellular carcinoma cell lines. [score:3]
Fig. 3The overexpression of miR-155-3p enhances tumorigenesis in vitro. [score:3]
Fig. 8FBXW7 is the potential target of miR-155-3p. [score:3]
The overexpression of miR-155-3p in BEL-7405 cells enhances tumorigenesis in vitro and in vivo. [score:3]
b miR-155-3p expression levels are significantly elevated in Hepatocellular carcinoma in comparison to normal tissues. [score:3]
A significant reduces in tumor weight was observed in the miR-155-3p downregulated HepG2 cells compared with that noted in the controls in the nude mice subcutaneous tumor mo del (Fig.   6b). [score:3]
Elevated expression of miR-155-3p in human hepatocellular carcinoma tissues and cell lines. [score:3]
b Western blot analysis was performed to detect the expression of FBXW7 and internal control β-actin in BEL-7405-miR-155-3p and its control cells. [score:3]
b Establishment of BEL-7405 -expressing miR-155-3p cells. [score:3]
a The expression of FBXW7 mRNA was analyzed by in BEL-7405-miR-155-3p and its control cells. [score:3]
One siRNA lentiviruse against FBXW7 (Sigma-Aldrich) and non -targeting siRNA (Sigma-Aldrich) were transfected into HepG2-Anti-miR-155-3p cells in 48-well plates according to the manufacturer’s instructions. [score:3]
d The expression of FBXW7 mRNA was analyzed by in HepG2-anti-miR-155-3p and its control cells. [score:3]
Inhibition of miR-155-3p in HepG2 cells reduces tumorigenesis in vitro and in vivo. [score:3]
In addition, we further identified FBXW7 as a functional target of miR-155-3p and demonstrated FBXW7 involve in the effects of increased miR-155-3p on promoting clone formation and proliferation. [score:3]
In addition, we further identified FBXW7 as a functional target of miR-155-3p and demonstrated an involvement of FBXW7 in the effects of increased miR-155-3p on promoting clone formation and proliferation. [score:3]
The presence of a mature-miR-155-3p expression was confirmed by using (Fig.   3b). [score:3]
Overexpression of miR-155-3p. [score:3]
Such exploration is likely to provide important information regarding the miR-155-3p signature and their target genes at a very early stage of liver tumorigenesis and their relationship to the miRNA signature of primary human HCC that can be used in the diagnosis and prognosis of liver cancer. [score:3]
In order to investigate whether the miR-155-3p expression is correlated with the HCC tumorigenesis, we examined miR-155-3p expression levels in a panel of 45 human HCC tissues (Fig.   1a). [score:3]
Precursor- miR-155-3p was transfected into BEL-7405 using the BLOCK-iT™ Lentiviral miR RNAi Expression System (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol, as previously described. [score:3]
Correspondingly, miR-155-3p expression levels are consistently elevated in HCC cell lines. [score:3]
Fig. 4The overexpression of miR-155-3p enhances tumorigenesis in vivo. [score:3]
Furthermore, gene set enrichment analysis indicated that FBXW7 gene signature was significantly enriched in miR-155-3p overexpression cells (Fig.   7b). [score:3]
The search for miRNA-155-3p target genes highlighted transcripts of two heat shock protein 40 genes, Dnaja2 and Dnajb1 [24]. [score:3]
Fig. 1The expression of miR-155-3p is elevated in Hepatocellular carcinoma tissues. [score:3]
e Western blot analysis was performed to detect the expression of FBXW7 and internal control β-actin in in HepG2-anti-miR-155-3p and its control cells. [score:3]
To investigate the clinical value of elevated miR-155-3p expression in HCC, we assessed the association between miR-155-3p expression levels and clinical significance in HCC tissues samples. [score:3]
Furthermore, our findings also showed that ectopic expression of miR-155-3p could accelerate clone formation and proliferation ability in HCC cells. [score:3]
These results suggested that miR-155-3p regulates HCC cells proliferation may be mediated by FBXW7. [score:2]
A significant increase in tumor weight was observed in the BEL-7405 cells with miR-155-3p overexpression compared with that noted in the controls in the nude mice subcutaneous tumor mo del (Fig.   4a). [score:2]
b Knockdown of FBXW7 in HepG2-Anti-miR-155-3p cells facilitates the proliferation ability of HepG2-Anti-miR-155-3p cells. [score:2]
a Knockdown of FBXW7 in HepG2-Anti-miR155-3p cells, the results of immunoblotting for FBXW7 and β-actin are shown. [score:2]
One potential binding site for miR-155-3p was found in the 3’-UTR region of FBXW7 mRNA and FBXW7 3’-UTR possessing a mutation in the putative miR-155-3p binding site (Fig.   9a and b). [score:2]
In this study, we aimed to investigate whether miR-155-3p is an oncomir in human HCC and identify the direct target correlated with the malignant phenotype of HCC. [score:2]
Since miR-155-3p is overexpressed in human HCC tissues and cancer cell lines, we considered whether miR-155-3p functions as an oncomir. [score:2]
c Knockdown of FBXW7 in HepG2-Anti-miR-155-3p cells increases colony formation. [score:2]
Patients with tumors displaying high miR-155-3p expression levels had significantly shorter percent survival compared with those with low miR-155-3p (Fig.   2). [score:2]
b FBXW7 3’-UTR possessing a mutation in the putative miR-155-3p binding site. [score:2]
miR-155-5p and miR-155-3p, two different miRNA strands, produced from the miR-155 host gene produces,. [score:1]
Furthermore, miR-155 has been reported as an oncomir in various human cancers, including colorectal [17], glioma [18], esophageal [19], liver [20], oral squamous [21] and lymphatic system [22]. [score:1]
b BEL-7405-miR-155-3p transfected with FBXW7 show a significant reduction in proliferation in comparison to control cells. [score:1]
Six-week-old BALB/c nude mice were injected subcutaneously into their flanks with 2 × 10 [7] BEL-7405 mock or BEL-7405 miR-155-3p cells bilaterally in 200 μl of normal culture medium. [score:1]
a miR-155-3p expression in Hepatocellular carcinoma in comparison to normal tissues was measured by. [score:1]
Together with the in vitro findings showing that increased miR-155-3p promotes clone formation and proliferation in HCC cell lines, these results further confirmed the roles of miR-155-3p in clone formation and proliferation of HCC cells. [score:1]
miR-155-3p RNA levels relative to normal liver cell line THLE-3 were determined by. [score:1]
a The potential binding site for miR-155-3p in 3’UTR of FBXW7 mRNA. [score:1]
Our studies suggest that miR-155-3p plays an important role in the pathogenesis of HCC and implicates its potential applications in the treatment of HCC cancer. [score:1]
In this study, we employed BEL-7405 and HepG2 cells to explore how miR-155-3p exerts its function and modulates the clone formation and proliferation of HCC cells. [score:1]
These findings demonstrate that miR-155-3p induces a more aggressive phenotype of HCC. [score:1]
FBXW7 Hepatocellular carcinoma miR-155-3p Hepatocellular carcinoma (HCC) is one of most common malignant tumor worldwide and ranks third of mortality rate, with about 500,000 new cases annually [1]. [score:1]
Among the known oncomirs, miR-155 stands out as an important entity. [score:1]
c The expression of FBXW7 protein was measured by immunohistochemical analysis in BEL-7405-miR-155-3p and its control cells in vivo tumor samples. [score:1]
In the present study, we analyzed the role miR-155-3p plays in Hepatocellular carcinoma (HCC), which has been reported participation in some other types of cancer. [score:1]
a BEL-7405-miR-155-3p were transfected FBXW7, the results of immunoblotting for FBXW7 and β-actin are shown. [score:1]
and miR-155-3p inhibitor were transfected into HCC cell lines to investigate its role in HCC. [score:1]
MiR-155-3p expression levels are significantly elevated in patients of stage III-IV in compared with the stage I-II (Fig.   1c). [score:1]
c The luciferase activity after transfection in BEL-7405-miR-155-3p and its control cells of the indicated 3’-UTR -driven reporter constructs. [score:1]
We found that the level of miR-155-3p was elevated in most of the malignant HCC tissues by 1.5 to 6 fold as expected (Fig.   1b). [score:1]
The miR-155-3p mediated tumorigenic effects were confirmed in an in vivo mo del. [score:1]
Our data suggest a fundamental role for miR-155-3p in clone formation and HCC cells proliferation, and implicate the potential application of miR-155-3p in prognosis prediction therapy of liver cancer. [score:1]
miR-155-3p levels were determined by two-step real time-PCR. [score:1]
These findings demonstrate that miR-155-3p can promote HCC cell proliferation in vitro and in vivo. [score:1]
Our data suggest that miR-155-3p may play a fundamental role for in clone formation and proliferation of HCC cells, and implicate the potential application of miR-155-3p in cancer prognosis prediction and therapy. [score:1]
The miR-155-3p mediated tumorigenic effects were confirmed in an in vivo mo del (Fig.   6a). [score:1]
f The expression of FBXW7 protein was measured by immunohistochemical analysis in in HepG2-anti-miR-155-3p and its control cells in vivo tumor samples. [score:1]
d The luciferase activity after transfection in HepG2-anti-miR-155-3p and its control cells of the indicated 3’-UTR -driven reporter constructs. [score:1]
FBXW7 lentiviruse (Sigma-Aldrich) was transfected into BEL-7405-miR-155-3p cells in 48-well plates according to the manufacturer’s instructions. [score:1]
c BEL-7405-miR-155-3p transfected with FBXW7 reduces colony formation. [score:1]
[1 to 20 of 104 sentences]
13
[+] score: 314
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-146a, mmu-mir-146b, mmu-mir-145b
Elevated miR-155 expression was also shown to correlate with multiple kinds of cancers, as well as autoimmune and diseases neurologic disorders such as Alzheimer’s disease 47– 51. [score:7]
Our work also emphasizes the importance of the interaction of the two miRNAs because of miR-146a -mediated regulation of miR-155 expression, and the dominant role miR-155 expression has on the development of chronic inflammation. [score:7]
These results indicate that miR-146a functions as a negative regulator of miR-155 expression and the innate inflammatory response, and that miR-155 expression is essential for the inflammatory phenotype observed in miR-146a [−/−] mice, which can lead to enhanced myeloid proliferation at later stages. [score:6]
Analyzing miR-155-predicted targets, we found upregulation of several genes in miR-155 [−/−] cells, including Pu. [score:6]
To further elucidate the genetic hierarchy between miR-155 and miR-146a in the regulation of NF-κB and the inflammatory response, and to understand whether miR-155 expression is sufficient to drive the inflammatory response observed in miR-146a deficient mice, we examined the effects of enforced expression of miR-155, miR-146a, or both miR-155 and miR-146a (dmiR) on myeloid proliferation and the inflammatory response. [score:6]
It also sheds light on the molecular hierarchy and interaction of these two miRNAs during an inflammatory response, where miR-146a is essential for downregulating miR-155, preventing the deleterious effects of its constant elevated expression. [score:6]
It is known that expression of both miR-155 and miR-146a is dependent on NF-κB activity 12, 54, but we now show that there is a temporal separation in their expression dynamics, which enables this specific regulatory architecture. [score:6]
The rapid attenuation of miR-155 levels enables upregulation of SHIP1 and SOCS1 expression, enforcing the repression of NF-κB activity and the inflammatory response, ensuring resolution (Fig.   7e). [score:6]
In macrophages, it has been previously shown that miR-155 directly regulates the expression of Ship1 and Socs1, two negative regulators of the macrophage inflammatory response. [score:6]
These results indicate that miR-146a is a major controller of miR-155 expression during the inflammatory response, and that elevated and prolonged expression of miR-155 correlates with an elevated inflammatory response and chronic macrophage activation. [score:5]
Interestingly, overexpression of both miR-146a and miR-155 led to enlarged spleens and myeloproliferation similar to miR-155 expressing mice (Fig.   3a, b). [score:5]
We have shown that miR-146a -deficient (miR-146a [−/−]) mice serve as a genetic mo del for low grade, chronic inflammation because they have supraphysiological levels of serum autoantibodies and interleukin (IL)-6 with age, and develop myeloproliferative disorders and cancers 13, 17. miR-155 expression, on the other hand, has been shown to be essential for T-cell, B-cell and myeloid cell development and function 14, 15, 19– 21. miR-155 was originally discovered as its primary transcript, BIC, which was deregulated in B-cell malignancies and leukaemia [22]. [score:5]
The dynamic expression of miR-155, miR-146a, and the NF-κB targets IL-1β and IL-6 at different time points after LPS (a) and Pam3CSK4 (b) stimulation. [score:5]
Similarly, overexpression of both miR-146a and miR-155 resulted in increased NF-κB activity and IL-6 serum levels, comparable to miR-155 overexpression (Fig.   3d, e). [score:5]
The rapidly and highly transcribed miR-155 represses the expression of SHIP1 and SOCS1 (among other potential targets), amplifying NF-κB activity and enabling a proliferative state for robust and strong macrophage activation. [score:5]
Peripheral blood from mice 3 months after reconstitution showed elevated NF-κB activity in CD11b [+] macrophages expressing miR-155 and dmiR, and slightly lower NF-κB activity in miR-146a expressing mice compared to WT (Fig.   3c). [score:4]
Our results indicate that miR-155 expression levels are regulated by miR-146a, and that elevated miR-155 levels can overcome miR-146a -mediated repression of NF-κB activity, suggesting that miR-155 acts downstream of miR-146a in the NF-κB signalling cascade. [score:4]
Both miR-146a and miR-155 are regulated through the activity of the NF-κB transcription factor [12], and since miR-146a attenuates NF-κB activity, we wished to determine whether miR-155 expression is affected by miR-146a repression. [score:4]
Together, these results indicate that miR-155 and miR-146a form a combined positive and negative regulatory loop controlling NF-κB activity, where inflammatory stimuli activate NF-κB, which rapidly activates miR-155 expression. [score:4]
miR-146a overexpression led to attenuated NF-κB activity in CD11b [+] macrophages and serum IL-6 levels, while miR-155 overexpression led to increased and longer-lasting NF-κB activity and IL-6 serum levels compared to control mice. [score:4]
These results were also replicated in BMMs stimulated with LPS for up to 48 h in vitro, showing elevated and prolonged IL-6 and IL-1β mRNA expression, and elevated CD80 and MHC-II cell surface expression in miR-146a [−/−] BMMs compared to WT, miR-155 [−/−], and D KO mice. [score:4]
Ship1 downregulation by miR-155 enhances NF-κB activity, at least in part, by alleviating the repression on PI3K-AKT signalling. [score:4]
Both miR-146a and miR-155 are transcriptionally regulated by NF-κB and induced in macrophages following Toll-like receptor (TLR) activation 12, 16. miR-146a functions as an anti-inflammatory regulator in various immune cell types by repressing NF-κB and AP1 signalling [17], and has been shown to be involved in the regulation of the acute inflammatory response and endotoxin tolerance [18]. [score:4]
Marcucci G Clinical role of microRNAs in cytogenetically normal acute myeloid leukemia: miR-155 upregulation independently identifies high-risk patientsJ. [score:4]
With time, miR-146a levels rise to negatively regulate NF-κB activity, leading to attenuation of miR-155 expression and resolution of the inflammatory response (Fig.   7e). [score:4]
Similarly to what is observed in miR-146a [−/−] mice, enforced expression of miR-155 in the bone marrow compartment causes myeloproliferation and cancers [23]. [score:3]
Together, we show that miR-155 functions as a positive regulator, while miR-146a functions as a negative regulator of NF-κB activity and the inflammatory response. [score:3]
To examine whether Ship1 or Socs1 play a role in miR-155 regulation of NF-κB activity in vivo, we knocked down either Ship1 or Socs1 in WT, miR-155 [−/−], miR-146a [−/−] and D KO bone marrow cells using short hairpin RNAs (shRNAs). [score:3]
This orchestrated dynamics in the temporal expression of miR-146a and miR-155 with NF-κB activity during TLR activation present a defined time frame for optimal macrophage inflammatory response and its resolution. [score:3]
These results imply that miR-146a functions at later stages following inflammatory stimulation, and that miR-155 expression may contribute to maintaining prolonged, high levels of miR-146a. [score:3]
This constant expression of miR-155 contributes, with time, to the low-grade inflammatory status found in miR-146a [−/−] mice. [score:3]
For in vivo miR-155, miR-146a overexpression and SHIP1 as well as SOCS1 shRNA experiments, the mature miR-155 and miR-146a, or SHIP1 and SOCS1 shRNA sequence was synthesized in the miRNA-155 loop-and-arms format [59] and cloned into the MSCV-eGFP (MG) or MSCV-IRES- Th1.1 vectors. [score:3]
g– h Time course expression profile of miR-155 of WT and miR-146a [−/−] (g) and miR-146a of WT and miR-155 [−/−] BMMs (h) after LPS stimulation (100 ng/mL) were quantified by qPCR. [score:3]
For that, we quantified miR-155 expression dynamics in BMMs of WT and miR-146a [−/−] mice following a single dose of LPS. [score:3]
We found that the dynamics of miR-155 and miR-146a expression correlated with the acute response after exposure to high levels of LPS or Pam3CSK4, whereby miR-155 levels rose rapidly, reaching peak levels at 12 h and gradually decreased from 24 to 48 h post stimulation. [score:3]
These results indicate that miR-155 expression plays a dominant role over miR-146a at steady state, leading to a myeloid bias. [score:3]
We also show that dysregulated levels of miR-146a and miR-155 can cause a suboptimal immune response following low doses of inflammatory stimuli, or to the development of chronic inflammation, which in turn may lead to the induction of myeloproliferation and extramedullary haematopoiesis. [score:3]
This interdependency between miR-146a and miR-155 implies that they co-participate in the regulation of the inflammatory response and that miR-155 plays a dominant positive role in this regulation. [score:3]
miR-155, in turn, represses the expression of SHIP1 and SOCS1 and prevents their repression of the inflammatory response. [score:3]
We show that miR-155 and miR-146a coordinately regulate the macrophage inflammatory response by forming a combined negative and positive regulatory loop that alters NF-κB activity. [score:3]
Together, these results imply that in our experimental setting, both Socs1 and Ship1 are primary targets of miR-155. [score:3]
miR-155 overexpression enhances NF-κB activity. [score:3]
Gene ontology analysis of genes upregulated in these cells revealed an enrichment in genes involved in cytokine-related activity, phagocytosis, cytokine production and the innate immune response when compared to WT, miR-155 [−/−] and d KO BMMs (Fig.   4b, Supplementary Data  1). [score:3]
In summary, our data suggest that miR-155 and miR-146a form a unique regulatory network motif to ensure a precise macrophage inflammatory response via regulation of NF-κB activity. [score:3]
Lethally irradiated mice were reconstituted with WT bone marrow cells transduced with control (MG), miR-155, miR-146a or dmiR expressing vectors. [score:3]
O’Connell RM Sustained expression of microRNA-155 in hematopoietic stem cells causes a myeloproliferative disorderJ. [score:3]
By contrast, miR-155 [−/−] and D KO BMMs express higher SHIP1 levels and have a mild reduction in pAKT, pIKKα/β and phosphorylated p65 when stimulated with LPS (Fig.   4d). [score:3]
a, b * p < 0.05, using two-way ANOVA We next examined the temporal expression of miR-146a and miR-155 during an inflammatory response using BMMs from WT mice. [score:3]
Indeed, several targets for both miR-155 and miR-146a have been described, depending on the cell type and condition 23, 24, 44, 51, 53, 58. [score:3]
NF-κB-GFP donor bone marrow cells were transduced with virus expressing miR-146a, miR-155, dmiR or control, and reconstituted into lethally irradiated WT mice. [score:3]
a, b * p < 0.05, using two-way ANOVA We next examined the temporal expression of miR-146a and miR-155 during an inflammatory response using BMMs from WT mice. [score:3]
We next quantified miR-146a expression dynamics in WT and miR-155 [−/−] BMMs. [score:3]
Similar to miR-146a deficiency, we have shown that enforced miR-155 expression induces myeloproliferative disorders, as well as extramedullary haematopoiesis [23]. [score:3]
c qPCR quantification of potential miR-146a and miR-155 targets in BMMs 24 h after LPS stimulation. [score:3]
As shown in Fig.   2h, in WT BMMs, miR-146a levels rise slower, starting at 8 h post stimulation, peak at 24 h and maintains peak levels until 48 h. In miR-155 [−/−] BMMs, miR-146a expression dynamics followed that of WT BMMs with a slight attenuation starting 36 h after stimulation. [score:3]
e– h were reconstituted with bone marrow from WT, miR-155 [−/−], miR-146a [−/−] or d KO mice transduced with GFP expressing control (MG), SHIP-1 or SOCS-1 shRNA vectors. [score:3]
Kluiver J BIC and miR-155 are highly expressed in Hodgkin, primary mediastinal and diffuse large B cell lymphomasJ. [score:3]
As expected, mice reconstituted with miR-155 -expressing bone marrow displayed CD11b [+] myeloproliferation and enlarged spleens by 4 months post reconstitution (Fig.   3a, b). [score:3]
Notably, aged D KO mice did not present any of the phenotypes found in miR-146a [−/−] mice, and phenocopied WT and miR-155 [−/−] mice, thus implying that miR-155 expression is required for miR-146a pathology (Fig.   1a–f). [score:3]
This regulatory network of NF-κB, miR-155 and miR-146a can therefore be utilized in different cell types and different conditions, potentially resulting in different consequences. [score:2]
To better understand miR-155 function in the regulation of the macrophage acute inflammatory response, we stimulated BMMs with low levels of LPS (10 ng/mL) or Pam3csk4 (5 ng/mL), which are closer to endogenous levels during sepsis [40]. [score:2]
Because miR-146a [−/−] mice demonstrated an elevated acute inflammatory response to Listeria challenge and miR-146a has been shown to participate in the regulation of endotoxin tolerance [18], we examined the interplay of miR-146a and miR-155 in this phenomenon. [score:2]
To determine the roles of Ship1 and Socs1 regulation by miR-155 in the acute inflammatory response in vivo, we serially injected 1 mg/kg LPS every 24 h for 3 days and monitored peripheral blood CD11b [+] macrophage activation 4 h after each injection. [score:2]
Infection with live Gram -negative bacteria had led to an elevated inflammatory response in miR-146a [−/−] BMMs, manifested by elevated CD80 and MHC-II cell surface expression compared to WT, miR-155 [−/−] and D KO BMMs, which displayed similar response. [score:2]
Importantly, attenuating Ship1 expression in D KO leads to an even higher myeloid bias compared to miR-155 [−/−] or WT donors, which resembled miR-146a [−/−] Ship1 attenuation (Fig.   4h). [score:2]
Interestingly, SHIP1 and SOCS1 protein levels were slightly but significantly lower in miR-146a [−/−] BMMs compared to WT, in line with the higher expression of miR-155 in these cells (Supplementary Fig.   5A; Fig.   2g). [score:2]
a– c Eight to ten-week-old WT, miR-155 [−/−], miR-146a [−/−] and double knock out (D KO) mice were infected with Listeria monocytogenes. [score:2]
Vigorito E Kohlhaas S Lu D Leyland R miR-155: an ancient regulator of the immune systemImmunol. [score:2]
miR-155 then acts as an amplifier and positive regulator to ensure robust and strong NF-κB activity. [score:2]
WT, miR-155 [−/−], miR-146a [−/−] and double knock out (D KO) BMMs were stimulated with low levels of LPS (10 ng/mL) (a) or Pam3CSK4 (5 ng/mL) (b). [score:2]
On the other hand, when mice were reconstituted with the Ship1 shRNA vector, both miR-146a [−/−] and D KO presented significantly higher activation markers compared to miR-155 [−/−] and WT control mice, showing that Ship1 is a key target of miR-155 during the inflammatory response (Fig.   5b, d, f). [score:2]
We found that with low levels of inflammatory stimuli, miR-155 -deficient BMMs express lower levels of inflammatory cytokines compared to WT controls (Fig.   6a, b). [score:2]
We next set out to decipher miR-155 and miR-146a’s role in the regulation of the macrophage inflammatory response, and to characterize their targets in this cell type. [score:2]
WT, miR-155 [−/−], miR-146a [−/−] and double knock out (D KO) bone marrow cells transduced with control (MG) (left) or SHIP1 shRNA (right) were reconstituted into recipient mice. [score:2]
mRNA from BMMs of WT, miR-155 [−/−], miR-146a [−/−] and double knock out (D KO) mice before and 8 h after LPS stimulation was subjected to RNA sequencing. [score:2]
To determine the miR-155 and miR-146a genetic hierarchy at steady state, we followed wild-type (WT), miR-155 [−/−], miR-146a [−/−], and miR-155 [−/−] miR-146a [−/−] (double knockout (D KO)) mice for up to 12 months. [score:2]
miR-155 and miR-146a combined regulation of NF-κB activity. [score:2]
Primers used for qPCR are listed in Supplementary Table  2. The quantification of miR-146a and miR-155 targets following complementary DNA (cDNA) synthesis was done using qScript cDNA SuperMix (Quanta cat: 95048-100) and detection with PerfeCTa qPCR Fastmix with ROX (Quanta cat: 95119-012) as per manufacturer’s instructions. [score:2]
Doxaki C Kampranis SC Eliopoulos AG Spilianakis C Tsatsanis C Coordinated regulation of miR-155 and miR-146a genes during induction of endotoxin tolerance in macrophagesJ. [score:2]
We therefore focused on the myeloid lineage, and tried to decipher the interplay between miR-155 and miR-146a in the regulation of acute and chronic inflammation. [score:2]
e A suggested mo del for the miR-146a and miR-155 regulatory loop during inflammatory stimulation. [score:2]
It was shown that miR-155 has an epistatic function over miR-146a during T-cell antitumour responses and T-follicular helper cell development 24, 25. [score:2]
a, b Twelve-month-old WT, miR-155 [−/−], miR-146a [−/−] and double knock out (D KO) mice were analysed for serum IL-6 levels (a), spleen mRNA levels of IL-1b, IL-6 and TNF (b). [score:2]
SHIP1 and SOCS1 repression by miR-155 regulates inflammation. [score:2]
In addition, we observed minor changes in the inflammatory response of miR-155 -deficient mice and BMMs when stimulated with LPS (Fig.   2), which indicate that this positive regulator plays a minor role in the strength of the inflammatory response in saturated stimulation conditions. [score:2]
miR-155 is required for miR-146a [−/−] pathology in aged miceTo determine the miR-155 and miR-146a genetic hierarchy at steady state, we followed wild-type (WT), miR-155 [−/−], miR-146a [−/−], and miR-155 [−/−] miR-146a [−/−] (double knockout (D KO)) mice for up to 12 months. [score:2]
miR-155 functions as an amplifier, providing a strong initiation of a response even in the face of noise, different kinds of stimuli and various concentrations, as well as a general amplification in suboptimal stimulus conditions. [score:1]
Interestingly, although Traf6 and Irak1 levels are high in D KO mice, these mice do not show NF-κB elevation or myeloid activation, emphasizing the critical role of miR-155 in producing these effects. [score:1]
c TNF and phospho-p65 (P-p65) protein expression of BMMs from WT (grey), miR-155 [−/−] (blue), miR-146a [−/−] (red) and d KO (green) 4 h after stimulation with low levels of LPS (10 ng/mL) as measured by FACS using intracellular staining. [score:1]
c– e reconstituted with bone marrow from NF-κB reporter mice, transduced with control (MG), miR-155, miR-146a or dmiR were analysed 3 months after reconstitution. [score:1]
miR-155 levels diminish within 24 h after stimulation, while miR-146a levels remain high and stable for the entire duration of the response. [score:1]
The knockdown levels of both Ship1 and Socs1 were about 50%, similar to the levels of repression achieved in WT mice compared to miR-155 [−/−] and D KO BMMS (Supplementary Fig.   5B and Fig.   4c, d). [score:1]
As shown in Fig.   2g, in WT BMMs, miR-155 reaches a peak level by 12–24 h and returns to near basal levels by 48 h. In miR-146a [−/−] BMMs, miR-155 rises more rapidly and declines more slowly; miR-155 stays at what would be peak WT levels even after 48 h, a time when WT macrophages have returned to baseline. [score:1]
We infected cohorts of WT, miR-155 [−/−], miR-146a [−/−] and D KO mice with a low, sublethal dose of an attenuated strain of Listeria monocytogenes (strain 10,403 serotype 1, 10E5 c. f. u. ). [score:1]
Eis PS Accumulation of miR-155 and BIC RNA in human B cell lymphomasProc. [score:1]
The raw sequencing data of WT, miR-146 [−/−], miR-155 [−/−] and D KO BMMs before and 8 h after LPS stimulation have been deposited in GEO database under the accession number GSE88791. [score:1]
miR-155 is required for miR-146a [−/−] pathology in aged mice. [score:1]
BMMs from WT, miR-155 [−/−], miR-146a [−/−] and D KO were cultured and treated as described above. [score:1]
C57BL/6 WT, LyzM-Cre miR-146a [fl/fl], miR-146a [−/−], miR-155 [−/−] and D KO as well as NF-κB reporter mice were bred and housed in the Caltech Office of Laboratory Animal Resources facility in specific pathogen-free conditions. [score:1]
d Protein from BMMs of WT, miR-155 [−/−], miR-146a [−/−] and d KO mice was subjected to western blot analysis 24 h after LPS stimulation. [score:1]
Aged miR-155 [−/−] mice were comparable to WT mice with a slight but significant reduction in spleen CD11b [+]F4/80 [+] macrophages (Fig.   1e). [score:1]
a, b reconstituted with bone marrow transduced with GFP and control (MG), miR-155, miR-146a or both miR-155 and miR-146a (dmiR) were analysed 4 months after reconstitution for (a) CD11b [+] peripheral blood macrophages and (b) spleen weight. [score:1]
Indeed, both Ship1 and Socs1 mRNA and protein levels are higher in miR-155 [−/−] and D KO BMMs after LPS stimulation (Fig.   4c, d). [score:1]
For that, we utilized RNA-sequencing on samples derived from BMMs of WT, miR-146a [−/−], miR-155 [−/−] and d KO mice at steady state and 8 h after LPS stimulation. [score:1]
h CD11b [+] peripheral macrophage percentage comparison between WT, miR-155 [−/−], miR-146a [−/−] and d KO mice transduced with SHIP1 shRNA vector. [score:1]
Fig. 4Molecular characterization of miR-146a and miR-155 KO BMMs reveal SHIP1 and SOCS1 as the major miR-155 targets. [score:1]
miR-155 is required for miR-146a [−/−] acute inflammatory phenotypes. [score:1]
Eight to ten-week-old WT, miR-155 [−/−], miR-146a [−/−] and D KO mice received 1 mg/kg LPS every 24 h for 3 days via IP injections. [score:1]
We show that an inflammatory stimulus leads to the activation of NF-κB, which in turn activates miR-155 transcription. [score:1]
miR-155 [−/−] macrophages were similar to WT macrophages, but still presented a differential gene response to LPS, mainly with genes related to cell motility and cell migration (Supplementary Data  1). [score:1]
WT, miR-155 [−/−] and D KO mice displayed similar bacterial loads and weight indices. [score:1]
Taken together, these results now show that miR-155 acts as an inflammatory amplifier in suboptimal stimuli, enabling a robust innate response in a wide range of concentrations and stimulations. [score:1]
NF-κB activity is therefore reduced, leading to abrogation of the transcription of inflammatory genes as well as miR-155. [score:1]
dmiR vector was constructed by inserting miR-146a and miR-155 in the pre-miR-17-92 cluster sequence. [score:1]
IL-6 serum levels in miR-155 [−/−] mice were slightly but significantly lower than in WT and D KO mice (Fig.   2c). [score:1]
c– f Twelve-month-old WT, miR-155 [−/−], miR-146a [−/−], D KO and LyzM-Cre miR-146a [fl/fl] mice were analysed for spleen weight (c), relative macrophage percentage in peripheral blood (d) and spleen (e), as well as extramedullary haematopoiesis by HSC quantification in spleen (f). [score:1]
Gatto G Epstein-Barr virus latent membrane protein 1 trans-activates miR-155 transcription through the NF-kappaB pathwayNucleic Acids Res. [score:1]
We show that when miR-146a is ablated, miR-155 levels are elevated during the inflammatory response as well as in steady-state conditions (Supplementary Fig.   6C). [score:1]
[1 to 20 of 118 sentences]
14
[+] score: 311
Other miRNAs from this paper: mmu-mir-146a
YFP [+] cells represent Cre expressing and once expressed cells, which were divided into two populations, DTR -expressing cells (low miR-155-5p expression) and DTR-non -expressing cells (high miR-155-5p expression). [score:13]
Expression of miR-155 changes dynamically during immune responses and its overexpression is linked to various diseases ranging from hematological malignancies, cancer, viral infections and autoimmune diseases [15]. [score:9]
In miR-155-5p high -expressing cell, miR-155-5p binds to target mRNAs and inhibits or degrades protein translation. [score:9]
Based on the stability of the 5’ end, one strand (passenger miR-155) of the miRNA duplex is released and degraded while the other strand (guide strand or mature miR-155), is retained and loaded into the RNA -induced silencing complex (RISC) which binds to target mRNAs as well as regulates gene expression by either repressing protein translation or inducing mRNA degradation. [score:8]
It was shown that effector T cells have higher miR-155-5p expression level than naïve cells and effector memory (T [EM]) cells by maintaining miR-155-5p at a higher level, while central memory (T [CM]) cells downregulate miR-155-5p expression to the same level in naïve cells, suggesting that miR-155-5p might indeed play a functional role in CD8 [+] memory differentiation. [score:8]
The two founders revealed a distinctive expression pattern of DTR with two populations, DTR- expressing (miR-155-5p [low]) Treg cells and DTR- non -expressing (miR-155-5p [high]) Treg cells (Fig 5A). [score:7]
To generate pmirGLO Dual-Luciferase miR-155-5p target expression vector (pmirGLO-4×miR-155-5pT), 4xmiR-155-5pT-pUC57 cloning vector was digested with EcoRI and HindIII to transfer 4×miR-155-5p target sequence into the EcoRI and HindIII site of pBluescript II SK+ phagemide (Stratagene, La Jolla, CA). [score:7]
Approximately 90% of Treg cells from Foxp3-GFP-Cre x R26-YFP × R26-DTR mice lacking miR-155-5p target were depleted whereas two founders 47 and 84 carrying miR-155-5p target had 55% and 25% of eliminated Treg cells, respectively, which were consistent with the number of DTR- expressing Treg cells (Fig 5C). [score:7]
The miR-155-5p target was initially validated by a conventional luciferase reporter assay in transfected HEK293T cells with a pmirGLO carrying miR-155-5p target and vector expressing miR-155 or miR-146a (as a miRNA control). [score:6]
TGF-beta conditions intestinal T cells to express increased levels of miR-155, associated with down-regulation of IL-2 and itk mRNA. [score:6]
In addition, it could offer the possibility to manipulate a particular cell population according to the expression pattern of miR-155-5p in the distinctive -expressing cells. [score:5]
miR-155 is differentially expressed in Treg subsets, which may explain expression level differences of miR-155 in HIV-1 infected patients. [score:5]
However, in case of miR-155-5p low -expressing cell, the overall concentration of miR-155-5p has no significant effect upon the translation process. [score:5]
Inhibition of miR-155-5p rapidly releases DTR expression. [score:5]
Moreover, decreased DTR expression can be partial recovered by inhibition of endogenous miR-155-5p activity. [score:5]
However, DTR expression from R26-DTR-155T mice was inversely correlated with miR-155-5p expression in most of the cell types. [score:5]
Flow cytometry analysis showed that the expression of DTR was increased significantly once miR-155-5p was inhibited (Fig 3). [score:5]
The expression of DTR in naïve cells and effector cell of conv CD4+ and Treg cells from CMV-Cre x R26-DTR-155T mice was inversely correlated with the expression level of miR-155 in those cells from Foxp3-GFP-Cre x R26-YFP mice detected by qRT-PCR. [score:5]
To study miR activity in vivo, we generated a novel miR-155-5p transgenic mouse line by inserting miR-155-5p target sequence downstream of a ubiquitous expressing reporter comprising DTR and BFP based on miR-OFF system. [score:5]
Surprisingly, exFoxp3 cells still maintained high level of miR-155-5p activity even after they lost Foxp3 expression (Fig 5B), which is inconsistent with previous study that continuous Foxp3 expression is indispensable for the maintenance of high amounts of miR-155-5p in Treg cells [10]. [score:5]
Since founder 47 was much lower in expressing the DTR reporter than founder 84 (Fig 2C), it might indicate that different copy numbers or integration sites of the transgene into the chromosome resulted in unequal yield of miR-155-5p target reporter mRNA [30, 31]. [score:5]
Inhibition of miR-155-5p with antagomir-155 rapidly releases DTR expression. [score:5]
Further studies would be required for confirming whether DTR expression from the miR-155-5p transgenic mice is only regulated by miR-155-5p, and it can be achieved by crossing the miR-155 deficient mice or miRNA -deficient mice with R26-DTR-155T mice. [score:4]
It has been reported that miR-155 is highly expressed in effector or memory Treg cells compared to lower expression levels in both naïve Treg cells and naïve conventional CD4 cells [33]. [score:4]
After 2 min at 50°C, the DNA polymerase was activated at 95°C for 15 min, followed by 45 cycles at 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s. U6 primer was used to normalize target miR-155 expression. [score:4]
Figure on the right represents endogenous expression levels of miR-155 in indicated cells (in naïve conv CD4 (CD4+ CD62L [high] YFP-), effector conv CD4 (CD4+ CD44 [high] YFP-), in naïve Treg (CD4+ CD62L [high] YFP+, effector Treg (CD4+ CD44 [high] YFP+)), effector Treg (CD4+ CD44 [high] YFP+)) of Foxp3-GFP-Cre x R26-YFP mice detected by qRT-PCR. [score:3]
miR-155 KO mice, in which the exon2 of bic/miR-155 gene was replaced by lacZ reporter gene, also allow to study the pri-miR-155 expression in vivo [14]. [score:3]
Right panel-R26-DTR-155T-BAC containing 4×miR-155-5p target sequence in the 3’-UTR of DTR-BFP fusion gene. [score:3]
To test whether the low DTR expressing cells was the effect of high level of miR-155-5p activity, we carried out experiments with the transduction of antagomiR-155 also known as anti-miR-155, which was used to silence endogenous miR-155-5p. [score:3]
In addition, using R26-DTR-155T mice as a miR-155-5p activity sensor, we showed that effector cells defined by CD44 [high] or CD62L [low] cells express higher level of miR-155-5p than naïve cells. [score:3]
The final BAC constructs were microinjected into pronuclei of fertilized B6×DBAF1 mouse oocytes to generate R26-DTR-BFP-miR-155-5p target mice (R26-DTR-155T mice) or R26-DTR-BFP mice (R26-DTR mice). [score:3]
The miR-155-5p/DTR-BFP target-reporter gene module was further placed downstream of the LoxP-STOP-LoxP cassette driven by Rosa26 (R26) promoter. [score:3]
However, the expression level of miR-155-5p is reported to be ~20–200 fold higher than that of miR-155-3p [5]. [score:3]
Relative expression levels for miR-155 were determined using the 2 [-ΔΔCt] method. [score:3]
It has been reported that miR-155 promotes autoimmune diseases in experimental autoimmune encephalomyelitis (EAE) mo del [37– 39]. [score:3]
Figure on the right represents endogenous expression levels of miR-155 in indicated cells detected by qRT-PCR. [score:3]
Since Treg cells express the highest level of miR-155-5p activity, we respectively crossed two founders (47 and 84) of R26-DTR-155T mice with Foxp3-GFP-Cre x R26-YFP mice to produce triple transgenic mice (Foxp3- GFP-Cre x R26- YFP × R26- DTR-155T mice). [score:3]
The linear relationship between miR-155-5p level and DTR expression was found to be correlated (R [2] = 0.8969), with varying concentration of miRNA ranging from 0 to 2.5 nM (Fig 1D). [score:3]
Left panel-R26-DTR-BAC lacking miR-155-5p target sequence. [score:3]
In consistent with the results in conventional T cells, we found that miR-155-5p activity was significantly high in effector T reg (eTR) cells, which express CD62L [low] and CD44 [high] cells (Fig 4B and 4D). [score:3]
The relative activity of miR-155-5p will be inversely proportional to the expression level of DTR or BFP. [score:3]
When examine with flow cytometry, the activity of miR-155-5p will be inversely proportional to the expression level of DTR or BFP reporter protein (Fig 2B). [score:3]
miR-155-5p target gene (Accession no. [score:3]
To further determine sensitivity of the miR-155-5p-OFF system in response to expression of miR-155-5p, HEK293T cells were transfected with pDTR. [score:3]
FACS analysis showed that miR-155-5p was able to knock down the BFP reporter signal leading to decrease in expression level of BFP in dose dependent assays (Fig 1B). [score:3]
These results indicated that the expression level of DTR was significantly influenced by the level of endogenous miR-155-5p activity. [score:3]
The 4×miR-155-5p target (118 bp in length) fragment was subsequently digested with restriction enzymes EcoRI and NotI and cloned into the pDTR. [score:3]
Furthermore, R26-DTR-155T mice also provided tissue-specific sensing of miR-155 activity by selection of a tissue-specific promoter driven Cre expression. [score:3]
These methods represent miR-155 expression at RNA level and do not reflect the real-time function of miR-155 activity in living cells. [score:3]
Next, we constructed the miR-155-5p sensor by inserting the 4×miR-155-5p target sequence into the 3’-UTR of a DTR. [score:3]
In this study, we generated novel miR-155-5p sensor transgenic mice, namely R26-DTR-155T, based on a combination of BAC transgenic approach and a Cre-Lox system by inserting miR-155-5p target sequence into 3’-UTR of DTR-BFP reporter gene. [score:3]
Relative difference of DTR expression in R26-DTR-155T mice reflects miR-155-5p activity in different cell lineages. [score:3]
In conclusion, we propose that the R26-DTR-155T mice might prove to be efficient in vivo mo del for studying distinctive miR-155-5p expressing cell subsets. [score:3]
In addition, miR-155 regulates IFN-γ production in natural killer cells [9], controls differentiation of CD4 T helper cell subsets into Th1, Th2, and Th17, as well as promotes development of Treg cells [10, 11]. [score:3]
R26-DTR mouse carrying an identical transgene with the exception of miR-155-5p target sequence was used as control (Fig 2A). [score:3]
These results demonstrated that R26-DTR-155T mice provided cell ablation in distinctive miR-155-5p expressing cells. [score:3]
For the miR-155-5p target reporter assay by flow cytometry, HEK293T cells were placed at 1×10 [5] cells/well in 24-well plates and co -transfected with pDTR. [score:2]
The Bulge-Loop miRNA qPCR Primer Set (RiboBio, China) was then used to detect miR-155 expression by qRT-PCR using QuantiTect SYBR Green PCR +UNG Kit (QIAGEN,204163). [score:2]
DTR expression in both conventional (conv) CD4 cells and Treg cells from two founders of miR-155-5p sensor transgenic mice was significantly lower compared to the control. [score:2]
In CD8 cells, miR-155 is important for the development of T effector function and the memory cytotoxic lymphocyte (CTL) formation. [score:2]
The results showed that the miR-155-5p target was responsible for overall miR-155-5p interaction leading to decreased luciferase signals compared to HEK293T cells transfected with miR-146a (Fig 1A). [score:2]
To construct the miR-155 expression vector (pEF-BOS-EX-miR-155), mouse miR-155 gene was amplified using the following primers: F 5’-CGGGATCCTGAACCGTGGCTGTGTTAAA-3’ and R 5’-GCTCTAGAAGAATGGCCGTCCTGAATTT-3’. [score:2]
Although miR-155 was initially described as an oncogenic miRNA [6], the generation of knockout mice lacking BIC/miR-155 highlights the critical role of miR-155 in both innate and adaptive immunity [7]. [score:2]
Regulation of the MIR155 host gene in physiological and pathological processes. [score:2]
It has now become clear that miR-155-5p levels are increased after stimulation of cells through multiple cellular signaling pathways and the activation of T cells is a tightly regulated process to maximize protective immune responses to pathogens while minimizing damage to self-tissues [40]. [score:2]
To determine miR-155-5p activity in Treg cell subsets, the R26-DTR-155T mice were crossed with Foxp3-GFP-Cre x R26-YFP mice to achieve Foxp3-GFP-Cre x R26-YFP x R26-DTR-155T mice. [score:1]
The R26-DTR-155T mice were crossed with CMV-Cre mice (Tg(CMV-Cre)1Cgn) to obtain CMV-Cre x R26-DTR-155T mice for screening the DTR reporter protein and were used for determining miR-155-5p activity in distinct cell lineages. [score:1]
In addition, we expect that these mice would be useful tools for tracking miR-155-5p activity in activated cells in several different experimental contexts. [score:1]
Moreover, miR-155 is essential for normal production of isotype-switched, high-affinity antibodies in B cells [12– 14]. [score:1]
BFP-155T-N1 plasmid with increasing concentrations (0, 1.25, 2.5, 5, 10, 20, and 40 nM) of synthetic miR-155 or miR control. [score:1]
miR-155: on the crosstalk between inflammation and cancer. [score:1]
Activity of miR-155-5p in Treg cell subsets. [score:1]
EX-miR-155, pEF. [score:1]
The role of miR-155-5p activity after cell activation is unclear, suggesting that these new miR-155-5p transgenic mice may prove to be useful tools based on tissue-specific miR-155-5p activity sensor. [score:1]
Currently, we do not know a threshold level of miR-155-5p activity that is required for playing a critical role in cell lineage differentiation and immune responses to control physiological and pathological processes. [score:1]
Thus, both OX40 and Nur77 reporter mice are suitable to study miR-155-5p activity in activated CD4 [+] T cells, Treg cells, and activated B cells respectively, by crossing with our miR-155-5p transgenic mice. [score:1]
0128198.g004 Fig 4(A) miR-155-5p activity in specific cell types of interest. [score:1]
Antagonism of miR-155 function. [score:1]
BFP-155T-N1 along with varying amounts of synthetic precursor miR-155 ranging from 0 to 40 nM (Fig 1C). [score:1]
Next, we took advantage of CMV-Cre x R26-DTR-155T and CMV-Cre x R26-DTR control mice to determine the activity of miR-155-5p in conv CD4 (CD4+Foxp3-), Treg (CD4+Foxp3+), CD8, and B cells under homeostatic condition (Fig 4A). [score:1]
DTR staining for determining miR-155-5p activity. [score:1]
Validation of miR-155-5p-OFF system in vitro. [score:1]
pmirGLO-4×miR-155-5pT and pEF. [score:1]
MicroRNA-155 (miR-155) is processed from the non-protein coding transcript of the BIC (B cell Integration Cluster) gene located on chromosome 21 in human and chromosome 16 in mice [1, 2]. [score:1]
miR-155-5p target reporter assay by luciferase assay was performed in 24-well plates. [score:1]
Our results indicated that R26-DTR-155T transgenic mice may serve as useful tools to uncover miR-155-5p activity and its function in various cell-subsets in vivo. [score:1]
Thus, this new miR-155-5p transgenic mouse line could be used to track miR-155-5p activity in vivo in specific cell types of interest. [score:1]
Both arms of pre-miR-155 can develop into mature miR-155-5p or miR-155-3p based on the selection of either 5’ or 3’ strand respectively [4]. [score:1]
The pre-miR-155 is then exported into the cytoplasm and is further processed by Dicer leading to 23 nucleotides long duplex miRNA [3]. [score:1]
0128198.g001 Fig 1Validation of miR-155-5p-OFF system in vitro. [score:1]
BFP-155-N1 was inversely correlated with increasing amounts of synthetic miR-155. [score:1]
Validation of miR-155-5p-OFF system in vitro. [score:1]
These results demonstrate the response by CMV-Cre x R26-DTR-155T mice to distinct levels of miR-155-5p activity, which implies that effector cells have higher level of miR-155-5p activity than naïve cells. [score:1]
To determine miR-155-5p activity in effector cells, we used CD44 and CD62L as marker to define them. [score:1]
With potential to deplete naïve cells and central memory cells, miR-155-5p transgenic mice might be used to monitor the fate of effector and effector memory CD8 [+] T cells. [score:1]
These results suggested that miR-155-5p can be induced through other signaling molecules such as T-cell receptor [34]. [score:1]
Detection of miR-155-5p activity by R26-DTR-155T mice in distinct cell lineages. [score:1]
Current approaches for miR-155 detection are mainly based on quantitative reverse transcription PCR (qRT-PCR), microarray, and deep sequencing [16, 17]. [score:1]
To assess the specificity of the miR-155-5p-OFF system, miR-155-5p target was evaluated by inserting four tandem copies of a 23-bp sequence with perfect complementarity to miR-155-5p into the 3’-UTR of the firefly luciferase gene. [score:1]
miR-155, like other microRNAs (miRNAs), is transcribed by RNA polymerase II to generate primary transcripts (pri-miR-155) that is processed in the nucleus to generate miRNA precursors (pre-miR-155). [score:1]
155T-N1 along with increasing amounts of miR-155-5p mimic or miR control mimic (RiboBio, China) in the presence of Lipofectamine 2000 (Invitrogen). [score:1]
Using this approach, the level of miR-155-5p activity could be effectively determined in these transgenic mice. [score:1]
With an aim to generate miR-155-5p sensor transgenic mouse providing tissue specific determination and ablation, the 1463 bp long DTR. [score:1]
For construction of miR-155-5p sensor vector (pDTR. [score:1]
To gain both efficiency and sensitivity, we chose BAC transgenic approach to generate our miR-155-5p transgenic mouse line, termed as R26-DTR-155T. [score:1]
Validation of miR-155-5p-OFF system in vitro miR-155-5p target reporter assay by luciferase assay was performed in 24-well plates. [score:1]
After pathogen clearance, it is known that most of the specific T cells undergo apoptosis and some develop into memory cells but we know little about the role of miR-155-5p in memory fate decision. [score:1]
The role of miR-155-5p in activated CD8 [+] T cells was studied in the context of antiviral T cell responses in vivo [12]. [score:1]
One drawback of R26-DTR-155T mice is the relative long half-life of DTR-BFP (S1 Fig), which might not be suitable for monitoring dynamic processes of miR-155-5p. [score:1]
Moreover, miR-155 -deficient dendritic cells have been reported to lose efficiency during antigen presentation [8]. [score:1]
Silencing microRNA-155 ameliorates experimental autoimmune encephalomyelitis. [score:1]
EF-miR155 or pEF. [score:1]
Thus the R26-DTR-155T mice might be useful to address this question by using adoptive transfer of cells with distinct level of miR-155-5p activity into recipient mice. [score:1]
[1 to 20 of 113 sentences]
15
[+] score: 311
Other miRNAs from this paper: mmu-mir-221, mmu-mir-222
Further, microarray analysis revealed the downregulation of Ces3 expression in the liver of Rm155LG/Alb-Cre mice (Fig. 7B), while qRT-PCR analysis demonstrated that Ces3 mRNA levels in the liver of Rm155LG/Alb-Cre mice were significantly down-regulated (Fig. 7C), and ectopic expression of miR-155 in BEL-7402 (Fig. 7D) and BEL-7404 (Fig. 7E) human hepatocellular carcinoma cell lines resulted in significant reduction of endogenous Ces3. [score:11]
Against the background, transgenic mice (i. e., Rm155LG mice) for the conditional overexpression of mouse miR-155 transgene mediated by Cre/lox P switching expression system were successfully generated in this study, while Rm155LG mice were further crossed to Alb-Cre mice to realize the liver-specific overexpression of mouse miR-155 transgene in Rm155LG/Alb-Cre double transgenic mice, which will be employed to explore the effects of the overexpression of miR-155 in the transgenic mouse livers on the expression profiling of hepatic genes associated with lipid metabolism, and on blood and hepatic lipid contents. [score:11]
Furthermore, LXRa was identified as a direct target gene of miR-155, and LXRa upregulation in the absence of repression by miR-155 in the liver of miR-155 [-/-] mice fed HFD resulted in upregulation of LXR-responsive genes (i. e., Fasn, Cd36, Lpl) and excessive TG and TC accumulation in liver, thereby contributing to fatty liver of miR-155 [-/-] mice fed HFD [10]. [score:10]
In vitro, TNF-α treatment resulted in the up-regulation of miR-155 and this overexpression of miR-155 inhibited adipogenesis by down -regulating early adipogenic transcription factors [6]. [score:9]
The enforced expression of miR-155 in the liver of transgenic mice is able to induce a general downward trend in the expression profile of hepatic genes involved lipogenesis, fatty acid metabolism, triacylglycerol metabolism, cholesterol metabolismn and bile acid biosynthesis, etc, thereby causing the decreased hepatic lipid content by decreasing adipogenic and lipogenic gene expression in liver, which reduces blood lipid concentration. [score:7]
During the adipogenic program of both immortalized and primary hMSCs, the expression of miR-155, miR-221, and miR-222 decreased, however, ectopic expression of these miRNAs significantly inhibited adipogenesis [7]. [score:7]
0118417.g008 Fig 8The enforced expression of miR-155 in the liver of transgenic mice is able to induce a general downward trend in the expression profile of hepatic genes involved lipogenesis, fatty acid metabolism, triacylglycerol metabolism, cholesterol metabolismn and bile acid biosynthesis, etc, thereby causing the decreased hepatic lipid content by decreasing adipogenic and lipogenic gene expression in liver, which reduces blood lipid concentration. [score:7]
Additionally, inhibition of miR-155 expression significantly induced lipid uptake, whereas miR-155 overexpression decreased lipid uptake in PMA-differentiated THP-1 cells and dendritic cells [11]. [score:7]
Moreover, the liver-specific miR-155 overexpression in Rm155LG/Alb-Cre mice down-regulated cholesterol transporter protein Apoa4 in liver and significantly reduced serum TC and HDL levels. [score:6]
In addition, hepatic miR-155 expression was increased in murine non-alcoholic fatty liver diseases (NAFLD) [9, 10], and miR-155 might play a protective role in the development of non-alcoholic hepatosteatosis in mice [10]. [score:6]
Carlo M. Croce generated Eμ-miR155 transgenic mice in which the expression of mmu-miR-155 (mouse miR-155) is under the control of a VH promoter-Ig heavy chain Eμ enhancer, which becomes active at the late pro-B cell stage of the B cell development [12], while in 2013, transgenic mice (i. e., miR155TG mice) overexpressing miR-155 under control of the ubiquitous phosphoglycerate kinase (PGK) promoter were generated [8]. [score:6]
Our data derived from miR-155 gain of function study demonstrated that Rm155LG/Alb-Cre mice exhibited decreased levels of serum TC, TG and HDL, and hepatic lipid, TG, HDL and FFA, which was accompanied by a general downward trend in the expression of hepatic genes (e. g., Acly, Fasn, Elovl5, Elovl6, Ucp2, Acss2, Acsl5, Ces3, Fabp4, Mvk, Mvd, Insig1, Ppap2a, Dgat2, Ppap2c, Pcsk9, Lpl, Gk2, Apoa4, Cd36 and Ldlr) involved in lipogenesis, lipid transport, lipid storage, bile acid biosynthesis, fatty acid synthesis, fatty acid oxidation, fatty acid catabolism, cholesterol biosynthesis, cholesterol transport, cholesterol homeostasis and triglyceride synthesis, indicating that the decreased expression of hepatic genes involved in lipid metabolism might be responsible, or contribute to the altered hepatic and serum lipid profiles (Fig. 8). [score:5]
Our studies suggested that Ces3 is a direct target negatively regulated by miR-155 in mouse liver. [score:5]
The pLuc- Ces3–3’-UTR-wt plasmid was co -transfected into mouse NIH3T3 cells with the miR-155 mimics, mimics control, miR-155 inhibitor or inhibitor control using Lipofectamine 2000 Reagent (Invitrogen), respectively. [score:5]
As shown in Fig. 4A, Fig. 5B, D, S6 Table and S8 Table, liver-specific overexpression of mouse miR-155 transgene led to the generally decreased expression of hepatic genes involved in fatty acid synthesis (Acly, Fasn, Dgat2, Elovl5, Elovl6, Sc4mol, Fdftl and Fads2), fatty acid oxidation (Ucp2, Pex7, Hacl1, Hadhb and Adipor1) and fatty acid catabolism (Acly, Acss2, Acsl3, Acsl5 and Acad9). [score:5]
Thus, although there may be more miR-155 targets, such as NR1H3 (liver X receptor α, LXRa) [10], that likely contribute to lipid metabolism, herein we show, for what we believe is the first time, that repression of Ces3 expression in the liver of Rm155LG/Alb-Cre mice does represent a plausible mechanism by which the hepatic and blood phenotypes (i. e., TG lowering) are induced (Fig. 7G). [score:5]
Collectively, liver-specific overexpression of miR-155 transgene in transgenic mice results in a general downward trend in the expression profile of hepatic genes involved in fatty acid, cholesterol and triglyceride metabolism, which is likely at least partially responsible for the serum cholesterol and triglyceride lowering observed in these mice. [score:5]
Thus, we speculate that the reduced expression of LXR-responsive genes (i. e., Cd36 and Lpl) induced by the enforced miR-155 expression is likely at least partially responsible for hepatic and serum lipid lowering observed in Rm155LG/Alb-Cre mice. [score:5]
In this study, we found that hepatic-specific overexpression of miR-155 transgene in mice led to the reduced hepatic and serum TG concentrations, accompanied by the deceased expression of Ces3 in Rm155LG/Alb-Cre mouse liver. [score:5]
To analyze the expression of miR-155 transgene in mouse liver, we crossed heterozygous Rm155LG transgenic mice with homozygous Alb-Cre mice in which Cre is under the control of the liver-specific albumin (Alb) promoter [19] to generate Rm155LG/Alb-Cre double transgenic mice in which miR-155 and Luc transgene expression was expected to be activated in liver-restricted manner (Fig. 2A), as determined by qRT-PCR and the noninvasive in vivo bioluminescence imaging, respectively. [score:5]
Ces3/TGH, a regulator of lipid metabolism, is a direct target of miR-155 in liver. [score:5]
A direct evidence that miR-155 is involved in B-cell lymphoma had been obtained experimentally in Eμ-miR155 transgenic mice harboring mouse miR-155 transgene (under the control of a VH promoter) that is specifically over-expressed in B-cell lineage [12], whereas until now, the a direct evidence that miR-155 as oncomiR can also cause the mentioned-above solid tumors is not obtained experimentally in transgenic mice. [score:5]
Furthermore, liver-specific overexpression of miR-155 transgene in Rm155LG/Alb-Cre mice resulted in significantly reduced levels of serum TG, TC and HDL, as well as remarkably decreased contents of hepatic lipid, TG, HDL and FFA, which was accompanied by a general downward trend in the expression profile of hepatic genes involved lipid metabolism (e. g., lipogenesis, fatty acid synthesis, cholesterol biosynthesis and triglyceride synthesis) (Fig. 8). [score:5]
In summary, Rm155LG transgenic mice for Cre -mediated miR-155 conditional overexpression will constitute a very powerful tool to further dissect the multiple functions of miR-155 in vivo, which will facilitate studies on the roles of miR-155 in developmental, physiological, and pathological processes. [score:4]
On the other hand, Ces3 levels in the liver of miR-155 [-/-] mice were significantly up-regulated (Fig. 7F). [score:4]
Therefore, miR-155 negatively regulates Ces3 expression in mouse liver. [score:4]
To realize the above-mentioned purposes and attain further insight into the cell/tissue-specific and/or developmental stage-specific roles of miR-155 in vivo, we want to produce transgenic mice that could conditionally overexpress mouse miR-155 transgene mediated by Cre/lox P system (Fig. 1A). [score:4]
Finally, as mentioned above, miR-155 is a typical multifunctional miRNA involved in various physiological and pathological processes such as haematopoietic lineage differentiation, immunity, inflammation, cancer, and cardiovascular diseases [3], Rm155LG transgenic mice will be combined with miR-155 knockout mice [34] to further insight into the roles of miR-155 in the aforementioned processes. [score:4]
More importantly, these aforementioned results suggest that Ces3 is a direct target of miR-155. [score:4]
Altogether all these results suggest that Ces3/TGH is a direct miR-155 target gene that is likely at least partially responsible for serum and hepatic TG lowering observed in Rm155LG/Alb-Cre mice (Fig. 7G). [score:4]
Since hepatic-specific overexpression of miR-155 in transgenic mice reduced hepatic and serum lipid profiles (Fig. 3, Fig. 4 and Fig. 5), we next tested whether miR-155 is connected to HFD -induced development of hepatic steatosis. [score:4]
In addition, hepatic miR-155 expression was increased in murine NAFLD [9], murine mo dels of diet -induced obesity [10, 42] and ob/ob mice on normal chow versus their respective controls [10], which appears to contradict a protective role of miR-155 in the development of non-alcoholic hepatosteatosis described above. [score:4]
These databases predicted that carboxylesterase 3/triacylglycerol hydrolase (Ces3/TGH) is a potential target of miR-155. [score:3]
We further performed luciferase reporter assay to determine whether miR-155 can directly target the 3’-UTR of Ces3. [score:3]
In the absence of Cre -mediated recombination, only mRFP will be transcribed, while miR-155 and Luc transgene expression is prevented by STOP sequence flanked by lox P sites. [score:3]
5. Liver-specific overexpression of miR-155 transgene resulted in altered hepatic and serum lipid profiles. [score:3]
There are several lines of evidence that miR-155 was found to be overexpressed in lymphoma, leukemia and several solid tumors [i. e., nasopharyngeal carcinoma (NPC), breast cancer, lung cancer, colon cancer, cervical cancer, pancreatic ductal adenocarcinoma (PDAC), thyroid carcinoma, and head and neck squamous cell carcinomas] [3, 32, 33], indicating that it might play a significant role in the process of carcinogenesis, acting predominantly as an oncomiR. [score:3]
0118417.g007 Fig 7 (A) Ces3 is a target gene of miR-155. [score:3]
These aforementioned results clearly indicated that Rm155LG/Alb-Cre mice (this study) and miR-155 [-/-] mice [10] exhibited the opposite change tendency in hepatic lipid metabolism gene expression, liver lipid content, and hepatic TG and TC levels. [score:3]
In this study, we explored the influences of liver-specific overexpression of miR-155 transgene in Rm155LG/Alb-Cre transgenic mice on lipid metabolism. [score:3]
Therefore, a loss of repression of LXRa expression in miR-155 [-/-] mice does represent a plausible mechanism by which the above-mentioned hepatic phenotypes are induced [10]. [score:3]
Liver-specific overexpression of mouse miR-155 in transgenic mice mediated by Cre/ lox P system. [score:3]
The available experimental evidence indicates that miR-155 is abnormally expressed in a variety of human tumor tissues, and has been found to be associated with cancer initiation, progression, metastasis and prognosis [3, 4]. [score:3]
A proposed mo del on miR-155 overexpression reducing hepatic and blood lipid profiles. [score:3]
The enforced expression of miR-155 in the liver of Rm155LG/Alb-Cre mice did not alter the final body weight and liver weight of Rm155LG/Alb-Cre mice at different ages (Fig. 3A, B, C and Table 1). [score:3]
0118417.g002 Fig 2Liver-specific overexpression of mouse miR-155 in transgenic mice mediated by Cre/ lox P system. [score:3]
Identification of Ces3/TGH as a miR-155 target gene. [score:3]
Taken together, these results indicate that liver-specific overexpression of miR-155 in transgenic mice improves HFD -induced steatotic phenotype in the liver. [score:3]
php) to realize the cell/tissue/organ-specific overexpression of miR-155 and Luc transgenes. [score:3]
In this study, we generated a novel conditional Rm155LG transgenic mouse line expressing a mouse miR-155 transgene using Cre/lox P system. [score:3]
As a typical multifunctional miRNA, miR-155 plays a crucial role in various physiological and pathological processes, such as haematopoietic lineage differentiation, immunity, inflammation, cardiovascular diseases and cancer [3, 4]. [score:3]
Next, we confirmed that the expression of miR-155 transgene in Rm155LG transgenic mice could be induced in a Cre -dependent manner. [score:3]
9. Overexpression of miR-155 in transgenic mouse liver ameliorated HFD -induced fatty liver. [score:3]
Enforced expression of miR-155 in the liver of Rm155LG/Alb-Cre mice improved HFD -induced hepatic steatosis. [score:3]
In this study, we demonstrated the liver-specific over -expression of the miR-155 and Luc transgenes in Rm155LG/Alb-Cre mice using Alb-Cre mice. [score:3]
4. Liver-specific overexpression of miR-155 transgene in transgenic mice mediated by Cre/lox P system. [score:3]
In vivo, overexpression of miR-155 in transgenic mice causes the reduction of brown adipose tissue mass and impairment of brown adipose tissue function [8]. [score:3]
Thus, liver-specific overexpression of miR-155 transgene leads to the altered hepatic and serum lipid profiles. [score:3]
Thus, putative miR-155 targets involved in these above-mentioned functions of miR-155 were predicted by using common databases, such as microRNA. [score:3]
In contrast, inhibition of miR-155 enhances brown adipocyte differentiation and induces a brown adipocyte-like phenotype ('browning') in white adipocytes [8]. [score:3]
To help elucidate the mechanism of serum cholesterol and triglyceride lowering (Table 1) caused by liver-specific overexpression of miR-155 transgene in vivo, cDNA microarray and qRT-PCR experiments were performed. [score:3]
When Cre -mediated recombination occurs in mouse liver, the floxed mRFP + 3×PolyA is excised, and miR-155 and Luc transgene expression is activated in a liver-restricted pattern in Rm155LG/Alb-Cre double transgenic mice. [score:3]
Furthermore, the levels of serum VLDL/LDL (very low-density lipoprotein/low-density lipoprotein) cholesterol, and liver TG and TC were significantly higher in HFD-fed miR-155 [-/-] mice vs WT, accompanied by increased expression of hepatic genes involved in fatty acid uptake (Cd36) and lipid metabolism (Fasn, Fabp4, Lpl, Abcd2 and Pla2g7) [10]. [score:3]
The aforementioned findings suggest that hepatic miR-155 expression might regulate the biological processes of lipid metabolism, which remains to be fully characterized. [score:2]
Other details as in Fig. 3. Next, we further explored the direct molecular mechanisms underlying such pleiotropic effects of miR-155 in liver. [score:2]
In subcutaneous adipose tissue, miR-155 was significantly higher expression in normal glucose tolerance group as compared to the type 2 diabetes group [5]. [score:2]
In summary, these results derived from gain-of-function study of miR-155 suggest that miR-155 plays pivotal roles in regulating material metabolism in liver. [score:2]
Mice lacking endogenous miR-155 that were fed HFD for 6 months developed increased hepatic steatosis compared to WT controls, accompanied by the significant increase in liver lipid droplets, hepatic TG and TC levels, and serum VLDL/LDL cholesterol levels [10], while in the present study, liver-specific overexpression of miR-155 transgene in Rm155LG/Alb-Cre mice led to decreased hepatic and serum lipid levels, and alleviated HFD -induced fatty liver. [score:2]
These findings suggest that although miR-155 is involved in the regulation of lipid metabolism, miR-155 has little effect on body weight of mice fed chow or HFD. [score:2]
These results suggest a protective role of miR-155 in the development of non-alcoholic hepatosteatosis in mice. [score:2]
A 318bp fragment containing the precursor sequence of the mmu-miR-155 was amplified by PCR from pEμ-mmu-miR155 plasmid [12], and then directionally cloned into the Mlu I and Sac I sites of the pRLG plasmid [13, 14], designated as pRm155LG, followed by identification of PCR, enzyme digestion analysis and sequencing (data not shown). [score:2]
Moreover, miR-155 negatively regulates lipid uptake in oxLDL(oxidized low-density lipoprotein)-stimulated dendritic cells/macrophages [11]. [score:2]
Further study showed that in WT mice fed HFD for 24 weeks, miR-155 expression was higher in CD11b [+] macrophages compared to the CD11b [-] fraction, comprising of all other hepatic cell lineages [10]. [score:2]
Therefore, the combinational uses of Rm155LG transgenic mice and various cell/tissue-specific Cre mouse lines will be able to provide us with a powerful approach to uncover whether miR-155 as oncomiR can also initiate the mentioned-above solid tumors in transgenic mice. [score:1]
miR-155: On the Crosstalk Between Inflammation and Cancer. [score:1]
Additionally, the weight of epididymal fat pads did not differ between WT and miR-155 [-/-] mice fed chow or HFD, indicating a selective effect on liver [10]. [score:1]
These will be helpful studies in evaluating the prospects for therapeutical miR-155 overexpression by using miR-155 mimics to lower TG, TC and HDL in humans in addition to improving hepatosteatosis. [score:1]
On the other hand, there are several lines of evidence that miR-155 is involved in adipocyte differentiation, adipogenesis and obese [5– 8], indicating that it might play a significant role in the process of lipid metabolism. [score:1]
As described in section, miR-155 is involved in adipocyte differentiation, adipogenesis and obese [5– 8], suggesting that miR-155 might be involved in lipid metabolism. [score:1]
Miller et al pointed out that increased hepatic expression of miR-155 in mo dels of NAFLD likely plays a critical homeostatic role designed to prevent excessive lipid accumulation in livers that can ultimately lead to liver damage [10], which warrants further investigation. [score:1]
In this study, Rm155LG/Alb-Cre mice exhibited the significantly decreased levels of blood TG, TC and HDL, suggesting that gain of miR-155 function can produce a beneficial effect on serum TG, TC and HDL-cholesterol. [score:1]
Although much more work is needed to understand all the roles of miR-155 in liver biology, lipid metabolism, hepatosteatosis, hepatic fibrosis, obesity and metabolic syndrome, and related molecular mechanisms, these results portend the mentioned-above therapeutic potential of miR-155 modulation. [score:1]
qRT-PCR using RNA extracted from the liver of Luc -positive and Luc -negative mice (shown in Fig. 2D) exhibited a significant increase in the levels of miR-155 transgene (Fig. 2G). [score:1]
Secondly, as both Luc and miR-155 transgenes can be “switched-on” simultaneously in a Cre -dependent manner in the same cells, tissues or organs of Rm155LG transgenic mice, Rm155LG transgenic mice enable bioluminescence imaging to noninvasively monitor tumor initiation, growth, progression, regression, relapse and therapeutic response in vivo with a noninvasive in vivo bioluminescence imaging approach, as strongly supported by other findings [25– 31]. [score:1]
A potent, ubiquitous CMV/β-actin promoter in the vector pRm155LG was used to drive a series of cassettes, including a floxed mRFP followed by a triple transcription-stopping polyA sequence (3×PolyA) and a downstream internal ribosome entry site (IRES) -based bicistronic transcript, including open-reading frames of mouse miR-155 and a multifunctional marker consisting of firefly Luc fused to eGFP with a transmembrane-localizing domain (Luc-TMeGFP). [score:1]
The dual luciferase reporter gene plasmid (i. e., pLuc-Ces3–3’-UTR-wt) containing the putative miR-155 binding site at the 3’-UTR of Ces3 mRNA was purchased from Kangbio (Shenzhen, China). [score:1]
These data suggest that homeostatic effects of miR-155 in liver are likely mediated by macrophages/Kupffer cells, and not by hepatocytes [10]. [score:1]
The 3’-UTR of Ces3 mRNA contains a complementary site for the seed region of miR-155 (Fig. 7A). [score:1]
[1 to 20 of 88 sentences]
16
[+] score: 305
However, in the study of Babar et al. just mentioned above, the disease being “cured” was initiated solely by miR-155 overexpression whereas LAT-KI disease results from LAT mutation and downstream miR-155 overexpression, presumably in addition to many other alterations in gene expression. [score:12]
Because the transcription factor FOXO3 is a direct target of miR-155, miR-155 can directly regulate its expression and thus that of BIM [16, 17]. [score:8]
Therefore in those studies and in our study, depletion of miR-155 levels resulted in less disease, i. e. lymphoma or lymphoproliferative disease, as defined by regression or prevention of disease, respectively. [score:7]
Therefore, to mimic the effect of miR-155 deficiency on mTOR activity, we employed inhibitor and siRNA approaches to downregulate mTOR activity in Jurkat T cells. [score:6]
Here we conclude that miR-155 does indeed regulate LAT-KI lymphoproliferative disease as the disease was dramatically reduced in DM mice. [score:6]
Other pathways to lymphoproliferative disease not dependent on miR-155 exist though, as evidenced by development of lymphoproliferative disease in older DM mice. [score:6]
Retroviral expression of miR155 in mouse CD4 [+] T cellsThe retroviral expression vector pMSCV-miR155 was made by inserting an approximately 200 bp EcoR1-XhoI PCR fragment containing the miR155 stem loop region into the MSCV-IRES-GFP vector (gift of Robert Lewis, University of Nebraska). [score:5]
Although we do not know the mechanism whereby miR-155 is overexpressed in LAT-KI T cells, a number of transcription factors that control miR-155 expression have been identified and may be hyper-activated in LAT-KI T cells [10]. [score:5]
In these contexts (low miR155 expression), PAK1 overexpression could favor the PAK1/JNK pathway and apoptosis. [score:5]
In our system, LAT-KI T cells expressing high miR-155 levels favor a PAK1/ERK/proliferation pathway and DM T cells that do not express miR-155 favor a PAK1/JNK/apoptosis pathway. [score:5]
Because we hypothesized that the contribution of miR-155 expression to apoptosis was key to controlling lymphoproliferative disease in LAT-KI mice, we extensively studied molecular mechanisms leading to apoptosis in LAT-KI and DM T cells. [score:5]
AKT can be negatively regulated by the action of SHIP-1, a direct target of miR-155, and by phosphorylation by mTORC2 and PDK1. [score:5]
We first asked if the effect of miR-155 on PAK1 was phenocopied by SHIP-1 overexpression to see if the effect was through SHIP-1. We tested the effect of SHIP-1 overexpression on PAK1 levels in Jurkat T cells, which are deficient for SHIP-1 [37]. [score:5]
For example, the breast cancer cell line MDA-MB-175 has high miR-155 expression [61], PAK1 genomic amplification and PAK1 mRNA overexpression. [score:5]
In addition phosphorylation of MEK1 at the site of phosphorylation by PAK1 (S298) [43, 44] was decreased with miR-155 overexpression whereas RAF-1 and ERK phosphorylation were not much affected by miR-155 overexpression. [score:5]
Forced overexpression of miR-155 in B cells in mice led to the development of B cell lymphomas [65]. [score:4]
PAK1 is not predicted to be a direct target of miR-155 [34]. [score:4]
To summarize our results, miR-155 acts through its direct targets SHIP-1 and FOXO3. [score:4]
In addition to direct regulation, we defined several linked pathways downstream of miR-155 in T cells that converge to regulate the nuclear translocation and activation of FOXO3 (Fig 8). [score:4]
In a previous screen of miRNAs expressed in LAT-KI T cells, we observed overexpression of miR-155 in LAT-KI CD4 [+] T cells compared to WT CD4 [+] T cells proliferating in response to infection by H. polygyrus or in response to transfer to an immunodeficient host [8]. [score:4]
SHIP-1 is a direct target of miR-155. [score:4]
The results also suggest that an upstream mitochondrial pro-apoptotic factor may be up-regulated upon miR-155 deletion and that the action of this factor may lead to enhanced apoptosis in the LAT-KI background. [score:4]
Downregulation of miR-155 in cancer patients may become possible with future technological advances. [score:4]
FOXO3 protein levels can be downregulated by miR-155 [16, 17], resulting in a decrease in BIM activity. [score:4]
Of the miRNAs identified, miR-155 has been implicated in a variety of physiological and pathological processes including immune and inflammatory responses, breast cancer, cardiovascular disease, lymphomas and leukemias [10]. [score:3]
Collectively, these studies point to a critical role for miR-155 in some lymphoproliferative diseases and lymphomas. [score:3]
We observed but cannot explain why the LAT-KI mutation and the miR-155 null mutation have synergistic effects on active Caspase 3 and 9 levels. [score:3]
To determine whether miR-155 influences lymphoproliferative disease in LAT-KI mice or was simply a marker of T cell activation, we interbred miR-155 [-/-] mice with LAT-KI mice to yield double mutant LAT-KI/miR155 [-/-] (DM) mice. [score:3]
In this study we show that LAT-KI lymphoproliferative disease is highly dependent on miR-155. [score:3]
To test for a potential role of miR-155 in LAT-KI lymphoproliferative disease, we crossed LAT-KI mice to miR-155 null mice yielding DM mice. [score:3]
Proposed pathways mediating miR-155 control of lymphoproliferative disease in LAT-KI CD4 [+] T cells act through BIM. [score:3]
A second well known target of miR-155 is the phosphatidylinositide phosphatase SHIP-1 [19]. [score:3]
In a study investigating the role of miRNAs in this disease mo del, we observed that miR-155 was overexpressed in LAT-KI CD4 [+] T cells [8]. [score:3]
On the other hand, HeLa cells and Jurkat T cells do not express miR-155 [17, 63]. [score:3]
miR-155 deficiency delays lymphoproliferative disease in LAT-KI mice. [score:3]
BIM -mediated apoptosis was enhanced in LAT-KI T cells upon miR-155 deletion and less lymphoproliferative disease was observed in LAT-KI miR-155 null double mutant mice. [score:3]
Paradoxically, miR-155 deletion delayed LAT-KI lymphoproliferative disease despite causing an increase in ERK activation. [score:3]
Because BIM is essential for control of immune system homeostasis and BIM levels critically determine CD4 [+] T cell fate by regulating the balance between cell survival and cell death, we hypothesized that loss of miR-155 regulation of a FOXO3/BIM pathway might be responsible for increased apoptosis in DM compared to LAT-KI T cells and decreased lymphoproliferative disease in DM compared to LAT-KI mice. [score:3]
FL indicates full length, C3 Caspase 3 and C9 Caspase 9. Among known targets of miR-155 potentially involved in apoptosis, the forkhead transcription factor FOXO3 was of interest because it induces transcription of the pro-apoptotic factor Bim/ Bcl2l11 [14, 30– 32]. [score:3]
FOXO3 activity was influenced directly by miR-155 and indirectly through SHIP-1 and AKT. [score:3]
We hypothesize that miR-155 (most likely indirectly) regulates PAK1. [score:3]
C. miR-155 was overexpressed in mouse CD4 [+] T cells by retroviral infection. [score:3]
S5 FigBIM deficiency increases lymphoproliferative disease in LAT-KI x miR-155 [-/-] mice. [score:3]
miR-155 deficiency delays Th2 lymphoproliferative disease. [score:3]
Therefore miR-155 deficiency resulted in increased PAK1 levels and phosphorylation whereas miR-155 overexpression resulted in decreased PAK1 levels and activity. [score:3]
miR-155 deficiency curtails LAT-KI lymphoproliferative disease. [score:3]
miR-155 overexpression has been correlated with various types of cancers, including lymphomas [10, 11]. [score:3]
In addition, overexpression of miR-155 in WT CD4 [+] T cells decreased both FOXO3 and BIM levels (Fig 4D) confirming a downstream effect of miR-155 on FOXO3 and BIM. [score:3]
Among known targets of miR-155 potentially involved in apoptosis, the forkhead transcription factor FOXO3 was of interest because it induces transcription of the pro-apoptotic factor Bim/ Bcl2l11 [14, 30– 32]. [score:3]
Overexpression of miR-155 in these cells resulted in a decrease in PAK1 levels and phosphorylation. [score:3]
0131823.g008 Fig 8Proposed pathways mediating miR-155 control of lymphoproliferative disease in LAT-KI CD4 [+] T cells act through BIM. [score:3]
The retroviral expression vector pMSCV-miR155 was made by inserting an approximately 200 bp EcoR1-XhoI PCR fragment containing the miR155 stem loop region into the MSCV-IRES-GFP vector (gift of Robert Lewis, University of Nebraska). [score:3]
Therefore although lymphoproliferative disease does develop in DM mice (in the absence of miR-155), it does so at a greatly reduced rate. [score:3]
AKT action can be influenced by the phosphoinositide (PI) phosphatase SHIP-1, a primary target of miR-155 [19]. [score:3]
We propose that miR-155 deletion in LAT-KI mice causes a decrease in lymphoproliferative disease based on this increased BIM -mediated apoptosis. [score:3]
miR-155 negatively regulates the transcription factor FOXO3, which positively regulates the pro-apoptotic factor BIM. [score:3]
Retroviral expression of miR155 in mouse CD4 [+] T cells. [score:3]
BIM deficiency increases lymphoproliferative disease in LAT-KI x miR-155 [-/-] mice. [score:3]
miR-155 levels regulate PAK1 and downstream JNK activity. [score:2]
In lymphocytes in particular, miR-155 has been shown to regulate function in B cells, CD8 [+] T cells, and in several subsets of CD4 [+] T cells [11]. [score:2]
Levels of FOXO1, a forkhead transcription factor that is not known to be regulated by miR-155 [34], were unchanged by miR-155 deletion in the LAT-KI background. [score:2]
Regulation of the MIR155 host gene in physiological and pathological processes. [score:2]
Multiple pathways mediated miR-155 regulation of BIM -mediated apoptosis in LAT-KI T cells. [score:2]
We also uncovered new signaling pathways that mediate miR-155 regulation in T cells and cross talk between them. [score:2]
Regulation of the miR-155/FOXO3/BIM pathway by PAK1/JNK. [score:2]
Thus in addition to the direct effect of the loss of miR-155 on increasing FOXO3 levels, the loss of SHIP-1 repression of AKT can also have a parallel or added effect on increasing FOXO3 levels. [score:2]
miR-155 can have an indirect effect on BIM -mediated apoptosis. [score:2]
We discuss how miR-155 can affect the balance between the pro-apoptotic PAK/JNK/FOXO3/BIM pathway and the pro-proliferative PAK1/RAF/MEK/ERK pathway to control T cell expansion and death resulting in the regulation of lymphoid organ size and function. [score:2]
Regulation of the miR-155/FOXO3/BIM pathway by SHIP-1/AKT. [score:2]
The ages of the mice were 10 wks (WT), 9 wks (miR155 [-/-]), 9 wks (LAT-KI), 16 wks (LAT-KI-old), 9 wks (DM), and 20 wks (DM-old). [score:1]
In this study we explored the possibility that miR-155 could contribute to the pathologic expansion of CD4 [+] T cells in LAT KI mice by influencing the balance between proliferation and apoptosis that contributes to homeostatic equilibrium of T cells. [score:1]
In cells exhibiting high miR-155 levels, the strong pro-survival PAK1/ERK pathway (as well as other pathways leading to ERK activation) could dominate the depressed PAK1/JNK apoptotic pathway and miR-155 could act as an oncomir. [score:1]
Ages of the mice were 11 wks (WT, LAT-KI) and 14 wks (miR155 [-/-]). [score:1]
LAT-KI T cells also had low levels of Caspase 3. In the LAT-KI background, miR-155 deficiency resulted in large increases in the levels of active Caspases 3 and 9 and in the levels of cleaved PARP, a Caspase 3 substrate commonly used as a marker of apoptosis. [score:1]
In LAT-KI T cells, PAK1 protein levels were high and did not increase with miR-155 deletion. [score:1]
Accordingly we asked whether JNK activation was affected by miR-155 deficiency in WT and LAT-KI backgrounds. [score:1]
pMSV-miR155 was transfected into Eco Phoenix cells (National Gene Vector Biorepository) using calcium phosphate transfection for production of viral particles as previously described [22]. [score:1]
To further investigate a potential role for miR-155 in controlling PAK1 levels and phosphorylation, we overexpressed miR-155 in WT CD4 [+] T cells using retroviral infection (S2 Fig). [score:1]
Ages of the mice were 11 wks (WT), 9 wks (miR155 [-/-]), 10 wk (LAT-KI), 10 wks (DM) and 19 wks (DM-old). [score:1]
We found that miR-155 is elevated in LAT-KI T cells as well as it is in many cancers and especially lymphomas. [score:1]
Ages of the mice were 10 wks (WT, miR155 [-/-]), 11 wks (LAT-KI), and 12 wks (DM). [score:1]
miR-155 deficiency activates PAK1 and a PAK1-nucleated apoptotic pathway (JNK/FOXO3/BIM/Caspase 9). [score:1]
A miR-155/FOXO3/BIM proapoptotic pathway. [score:1]
Transfection of Jurkat T cells with SHIP-1 resulted in increased levels of PAK1 (Fig 7A), similar to the effect of miR-155 deletion in WT mouse T cells. [score:1]
This study provides the first evidence that miR-155 modulates ERK activation. [score:1]
Our data suggest that miR-155 affects the balance between proliferation and apoptosis in T cells. [score:1]
Ages of the mice were 11 wks (WT), 10 wks (miR155 [-/-]), 11 wks (LAT-KI), and 12 wks (DM). [score:1]
Low levels of active Caspases 3 and 9 were detected in miR-155 -deficient CD4 [+] T cells. [score:1]
However, it is important to bear in mind that loss of miR155 leads to a decrease in tumor-fighting ability by CD8 [+] T cells, macrophages, and dendritic cells [71– 73]. [score:1]
We next studied possible mediators of apoptosis in miR-155 -deficient T cells. [score:1]
miR155 -deficient mice were strain B6. [score:1]
miR-155 deletion in the WT background (miR155 KO vs WT) resulted in an elevation of PAK1 levels. [score:1]
Furthermore, we used LAT-KI mice as a discovery tool to probe signaling pathways downstream from miR-155. [score:1]
apoptosis may depend on miR-155 levels. [score:1]
0131823.g001 Fig 1(A) Photographs of spleens and axillary, brachial and inguinal lymph nodes from WT (C57BL/6), miR155 [-/-], LAT-KI and DM (LAT-KI/miR155 [-/-]) mice. [score:1]
Here we propose that miR-155, PAK1 and JNK are part of a common pathway to apoptosis in T cells. [score:1]
Phospho-PAK1 levels were enhanced by miR-155 deficiency in both WT and LAT-KI backgrounds. [score:1]
Although miR155 KO CD4 [+] T cells showed more MAPK activation upon soluble anti-TCR stimulation than WT CD4 [+] T cells, their ex vivo CD5 and CD69 levels (Fig 2A) and their in vivo proliferative capacities (Fig 2B) were similar to WT. [score:1]
We next determined if decreasing levels of pAKT would also lead to an increase in PAK1 levels to see if the miR-155 effect on PAK1 was through SHIP-1 and AKT. [score:1]
In both WT and LAT-KI backgrounds, BIM levels were increased as a result of miR-155 deficiency (Fig 4C). [score:1]
JNK protein levels were not substantially affected by miR-155 deletion. [score:1]
We investigated SHIP-1, AKT, and PDK1 expression and phosphorylation in CD4 [+] T cells from miR155 -deficient mice in WT and LAT-KI backgrounds (Fig 5). [score:1]
These paradoxical observations led us to attempt to characterize signaling pathways downstream of miR-155 that might affect lymphoproliferative disease. [score:1]
In contrast, nanoparticle delivery of anti-miR-155 nucleic acids led to the regression of the lymphomas in those mice. [score:1]
miR-155 deficiency results in increased basal apoptosis in LAT-KI T cells. [score:1]
Ages of the mice were 9 wks (WT), 12 wks (miR155 [-/-], LAT-KI), and 14 wks (DM). [score:1]
However, phospho-JNK levels were increased by miR-155 deletion in both backgrounds (Fig 6A). [score:1]
More specifically, we speculate that PAK1 activation is more likely to lead to survival in the presence of high levels of miR-155. [score:1]
In the absence of miR-155, elevated PAK1 activates JNK leading to phosphorylation of FOXO3 and its nuclear translocation and activation, and thus enhanced BIM -mediated apoptosis. [score:1]
Deletion of miR-155 in the LAT KI background restored FOXO3 to wild-type levels and BIM to greater than wild-type levels. [score:1]
Ages of the mice were 11.5 wks (WT), 34 wks (miR155 [-/-]), 11.5 wks (LAT-KI) and 11 wks (DM). [score:1]
As expected, miR-155 deficiency resulted in increased SHIP-1 levels in both backgrounds. [score:1]
miR-155 deficiency decreases signaling in the PI3K/mTOR pathway. [score:1]
miR-155 deficiency results in increased basal CD4 [+] T cell activation and proliferation in LAT-KI mice. [score:1]
We used LAT-KI mice to define T cell signaling pathways, this time downstream from miR-155. [score:1]
In miR-155 -deficient DM CD4 [+] T cells, SHIP-1 levels are elevated, AKT levels are depressed, and mTOR levels would be predicted to be down. [score:1]
These data suggest that low AKT activity correlates with increased PAK1 levels and that the effect of miR-155 on PAK1 is through SHIP-1 and AKT. [score:1]
As summarized in Fig 8, we found that SHIP-1/AKT and PAK1/JNK signaling pathways contribute to BIM -mediated apoptosis downstream from miR-155 and that mTOR links the SHIP-1/AKT and PAK1/JNK pathways. [score:1]
In CD4 [+] T cells from age-matched animals, percentages of AnnexinV [+]/7AAD [-] cells were higher in DM than in LAT-KI mice, suggesting that miR-155 plays a role in preventing programmed cell death in the LAT-KI background (Fig 3A). [score:1]
Therefore, deletion of miR-155 would be predicted to sequentially increase SHIP-1 levels, decrease AKT and PDK1 activity, and increase nuclear FOXO3 activity, leading to more BIM -mediated apoptosis. [score:1]
FAS levels were lower in LAT-KI and DM CD4 [+] T cells than in WT and miR155 [-/-] CD4 [+] T cells, but FASL levels remained low in all four genotypes. [score:1]
A summary of the interacting pathways thought to be impacted by miR155 deletion in CD4 [+] T cells is presented in Fig 8B. [score:1]
Gray arrows indicate relative action caused by miR-155 deficiency. [score:1]
miR-155 deficiency resulted in increased RAF, MEK and ERK activation in both WT and LAT-KI backgrounds (Fig 2C). [score:1]
[1 to 20 of 124 sentences]
17
[+] score: 304
Other miRNAs from this paper: hsa-mir-155
Luciferase expression constructs harboring the wt Jarid2 3′UTR (JARID2), or variants in which target site 1 (JARID2 m1) or target site 2 (JARID2 m2) or both target sites (JARID2 m1+2) had been mutated were co -transfected with expression vectors for kshv-miR-K12-11, hsa-miR-155 or the irrelevant miRNA kshv-miR-K12-7. are shown normalized to kshv-miR-K12-7. C) Jarid2 protein levels are reduced when hsa-miR-155 or kshv-miR-K12-11 are expressed. [score:13]
C-myb was recently shown to be subject to regulation by miR-155 via two target sites in its 3′-UTR [72], and was earlier suggested as a target of kshv-miR-K12-11 due to its downregulation in BJAB-cells that express the viral miRNA [24]. [score:11]
We have confirmed downregulation of two of the above genes (c-myb and fos) as well as of Jarid2 in kshv-miR-K12-11and hsa-miR-155 expressing BM cells, an observation which supports the idea that miR-155 may contribute to the silencing of these targets during B-cell development (it should be pointed out, however, that the marked repression very likely also involves other mechanisms that may directly act on the transcriptional level). [score:10]
Additionally, we show downregulation of known miR-155 and/or kshv-miR-K12-11 targets in miRNA -expressing BM cells in vivo and confirm Jarid2 as a novel target of kshv-miR-K12-11. [score:10]
It is well possible that co -expression of these factors, or even expression of the viral miRNA alone at levels that are higher than those which were used here, would lead to the development of proliferative disease such as has been observed in other mouse mo dels of forced miR-155 expression. [score:10]
To confirm that expression of hsa-miR-155 or kshv-miR-K12-11 also leads to repression of protein expression from an authentic Jarid2-encoding mRNA transcript, we made use of an IMAGE Consortium Clone that expresses a shorter Jarid2 transcript variant containing target site 1 of the prototypical 3′-UTR (GenBank accession BC046246). [score:9]
Since miR-155 expression is furthermore frequently deregulated in lymphoma, leukemia and breast cancer [28]– [31], and since forced miR-155 expression has been found to induce proliferative disease in mice [28], [32], it has been proposed that mimicry of miR-155 functions by kshv-miR-K12-11 may contribute to the development of KSHV -associated tumors [21], [24]. [score:9]
Collectively, the above data confirm Jarid2 as a shared target of hsa-miR-155 and kshv-miR-K12-11 which, consistent with its downregulation in hsa-miR-155 and kshv-miR-K12-11 expressing BM cells, may be one of the factors contributing to the observed phenotypes in vivo. [score:8]
Decreased expression levels of miR-155 and kshv-miR-K12-11 target transcripts in miRNA expressing BM cells. [score:7]
Taken together, our data thus support previous notions of kshv-miR-K12-11 having evolved to mimic miR-155 functions, confirm observations made in other mouse mo dels of forced kshv-miR-K12-11/miR-155 expression [42], and suggest that Jarid2 is one of the factors that is targeted by kshv-miR-K12-11 during viral infection as well as in KSHV -associated disease. [score:7]
Additionally, we validate Jarid2 as a novel target of kshv-miR-K12, and for the first time demonstrate that hsa-miR-155 as well as kshv-miR-K12-11can efficiently suppresses protein expression from an authentic Jarid2-encoding transcript. [score:7]
To evaluate the expression status of known or suspected hsa-miR-155 and kshv-miR-K12-11 targets in miRNA expressing cells, we performed RT-PCR to detect mRNA transcripts of the fos, c-myb and jarid2 genes Fos and c-myb were chosen because both genes are targeted by hsa-miR-155 and also have previously been reported to play important roles in B cell differentiation. [score:7]
Target site 2 is more diverse by comparison, yet all nucleotides that are predicted to pair with miR-155 and kshv-miR-K12-11 in regions that are critical for target recognition [16] are conserved (Figure 6A, lower panel). [score:5]
However, in striking contrast to this earlier study, we saw no evidence of pre B-cell leukemia, most likely reflecting different expression levels of miR-155, or the fact that not all pre B-cells express miR-155 in our system. [score:5]
BCBL-1 and Raji were used as positive and normalization controls for kshv-miR-K12-11 or hsa-miR-155 expression, respectively, and relative expression levels in these cell lines was set to 1. All experiments were done in triplicate. [score:5]
Although the observation of substantially (6.3-fold) higher hsa-miR-155 expression in LCL 721 relative to Raji cells was in general accord with previous observations of high level expression particularly in LCL cells [51]– [55], one study had reported a significantly larger difference between Raji and LCL cells (20- to 30-fold, [54]). [score:5]
Collectively, the above results suggest that constitutive expression of hsa-miR-155 or miR-K12-11 results in the accumulation of B-cells in the spleen, whereas the T-cell lineage may be disfavored when either miRNA is expressed. [score:5]
These observations suggested that differentiation towards the myeloid line is disfavored when kshv-miR-K12-11 is ectopically expressed, and that a similar trend might exist in hsa-miR-155 expressing cells. [score:5]
The Jarid2 expression construct was introduced into 293T cells, along with expression construct for hsa-miR-155 or miR-K12-11. [score:5]
As this nucleotide is not involved in base pairings at canonical microRNA target sites [16], and since relevant microRNA target sites tend to be well conserved across species, we reasoned that hsa-miR-155 is very likely to remain fully functional in a murine background. [score:5]
As shown in the left columns of Figure 6B, consistent with previous reports [39], we observed repression of luciferase expression by approximately 40% when a hsa-miR-155 expression construct was co -transfected. [score:5]
To study the effects of constitutive microRNA expression on the differentiation of hematopoietic progenitor cells we generated gamma-retroviral vectors that express GFP as well as the precursor hairpins (pre-miRNAs) of kshv-miR-K12-11 or hsa-miR-155 under the control of the viral promoter in the 5′ long terminal repeat (LTR) (Fig. 1B). [score:5]
As an additional point of reference, we also analyzed hsa-miR-155 expression in an EBV -positive lymphoblastoid cell line (LCL 721), since such lines have previously been shown to express very high levels of this miRNA [36], [50]– [56]. [score:5]
293T cells were co -transfected with a Jarid2 expression vector (GenBank accession BC046246) and expression constructs for kshv-miR-K12-11, hsa-miR-155 or the irrelevant control miRNAs kshv-miR-K12-7 or ebv-miR-BART5. [score:5]
Our findings indicate that forced expression of kshv-miR-K12-11 indeed re-capitulates important aspects of hsa-miR-155 expression. [score:5]
Likewise, fos has been shown before to be a direct target of both miR-155 and kshv-miR-K12-11 [19], [24]. [score:4]
Indeed, several studies have found that kshv-miR-K12-11 and miR-155 regulate an overlapping set of target genes [19], [21], [24]. [score:4]
Jarid2 is a member of polycomb repressor complexes, has been shown to be subject to miR-155 regulation in human and mouse cells [28], [39], [57], and was of particular interest since it had also emerged as a potential target of kshv-miR-K12-11 in one of our earlier screens (data not shown). [score:4]
Consequently, Raji cells express hsa-miR-155 at levels which are similar to those previously reported for kshv-miR-K12-11 in BCBL-1 cells. [score:3]
Further support for this hypothesis comes from the observation that the oncogenic Marek's disease virus type 1 (MDV-1), an alphaherpesvirus that induces T-cell lymphoma in birds, also encodes a miRNA with an identical seed as miR-155 and loses its oncogenic potential in vivo when the miRNA is mutated [33], [34]. [score:3]
As hsa-miR-155 is strongly induced by the viral LMP-1 gene product [50], [56], variable levels of LMP-1 expression may well be responsible for the observed differences. [score:3]
The full-length 3′UTR of the prototypic Jarid2 transcript was cloned downstream of a luciferase gene in the pMIR-report vector, and was co -transfected with expression constructs for hsa-miR-155, miR-K12-11. [score:3]
Additionally, Epstein-Barr Virus (EBV) and reticuloendotheliosis virus strain T (REV-T), two oncogenic viruses that do not encode their own miR-155 mimics, induce expression of the host miR-155 during infection [35]– [39] To investigate to what extend kshv-miR-K12-11 may mimic miR-155 functions in vivo, we have explored phenotypic consequences of seed sharing by constitutively expressing physiological levels of each miRNA in the hematopoietic system of C57BL/6 mice, using retroviral transduction and hematopoietic stem cell transplantation technology. [score:3]
To verify that Jarid2 is a direct target gene of hsa-miR-155 as well as kshv-miR-K12-11, we first performed a luciferase reporter assay. [score:3]
As shown in Figure 6C, expression of hsa-miR-155 as well as kshv-miR-K12-11, but not empty vector or the control miRNAs lead to a marked repression of Jarid2 protein levels. [score:3]
Ectopic hsa-miR-155 and kshv-miR-K12-11 expression results in increased pre-B-cell populations in the bone marrow of engrafted mice. [score:3]
Our stem-loop PCR for hsa-miR-155 was also specific and revealed that transduced 3T3 cells expressed the cellular miRNA at levels that were only slightly higher as those seen in Raji (approximately 1.7-fold, see Figure 1C, right panel), but below those observed in LCL 721 cells. [score:3]
Although the increase in GC numbers within the kshv-miR-K12-11 cohort did not pass the statistical significance threshold, the observed p-values were nevertheless low (0.073), suggesting that kshv-miR-K12-11, like hsa-miR-155, may enhance germinal center formation under conditions of constitutive expression. [score:3]
A number of miR-155 targets with important roles in B-cell differentiation, including Bach1, fos, c-myb, Pu. [score:3]
This scenario is furthermore supported by several studies that have reported induction of pro-survival pathways upon expression of miR-155 [59], [60]. [score:3]
Although the effect was only moderate, the consistent increase of cells in the total B-cell population was in line with the notion that differentiation towards the myeloid lineage might be disfavored in kshv-miR-K12-11 (and potentially also hsa-miR-155) expressing cells, and suggested to us that more pronounced differences might exist among specific B-cell sub-populations. [score:3]
C) The number of T-cells is decreased in the miRNA -expressing mice cohorts, as indicated by flow cytometry analysis of the T-cell marker CD3 (control gfp: n = 15; kshv-miR-K12-11: n = 19; hsa-miR-155: n = 16). [score:3]
Right: dot plots of all analyzed mice (control gfp: n = 15; kshv-miR-K12-11: n = 23; hsa-miR-155: n = 15) reveal a significant shift towards the B-cell population miRNA -expressing mice. [score:3]
Jarid2 is targeted by hsa-miR-155 and kshv miR-K12-11. [score:3]
Figure S1 Quantification of hsa-miR-155 expression levels in EBV -positive B cell lines. [score:3]
We therefore set out to study the impact of constitutive hsa-miR-155 and kshv-miR-K12-11 expression on hematopoietic stem cells in C57BL/6 mice. [score:3]
Expression levels were determined by real-time stem-loop RT-PCR [49] and normalized to the levels observed in the KSHV -positive PEL cell line BCBL-1 for miR-K12-11, or the KSHV -negative/EBV -positive Burkitt's lymphoma cell line Raji for hsa-miR-155. [score:3]
These data are in line with observation made by Croce and colleagues in an Eμ-mmu-miR155 transgenic mouse mo del [32] and suggest that ectopic expression of host as well as viral miRNAs increase the survival and/or proliferation rates of early pre B-cells. [score:3]
As shown in Figure 6A, the Jarid2 3′-UTR contains 2 binding sites for hsa-miR-155 that are predicted to also represent functional target sites for kshv-miR-K12-11. [score:3]
As shown in the graphs to the right, the shift towards CD19 [+] B-cells in the miRNA -expressing mice was significant in the kshv-miR-K12-11 mouse cohort, with 72% (+/−19%) CD19 [+] cells, and highly significant in hsa-miR-155 mice with 75% (+/−12%) CD19 [+] cells, relative to 55% (+/−14%) CD19 [+] cells in the control mice. [score:3]
28 O'Connell R, Rao D, Chaudhuri A, Boldin M, Taganov K, et al (2008) Sustained expression of microRNA-155 in hematopoietic stem cells causes a myeloproliferative disorder. [score:3]
Generation of recombinant retroviruses for ectopic expression of kshv-miR-K12-11 and hsa-miR-155. [score:3]
Although a murine background would not be suitable to study heterologous viral miRNAs that do not represent analogs of conserved cellular miRNAs, we reasoned that such a system would offer distinct advantages to investigate a suspected host miRNA mimic: If kshv-miR-K12-11 has indeed evolved to phenocopy miR-155, it should also retain its ability to target evolutionary conserved miR-155 target sites and thus remain fully functional in murine cells. [score:3]
As for CD19, the percentage of B220 [+] splenocytes was significantly increased in both miRNA -expressing mice cohorts (75%+/−18% and +/−14% in the kshv-mIR-K12-11 and hsa-miR-155 cohorts, respectively, vs. [score:3]
Taken together, the observation of similar phenotypes in hsa-miR-155 and kshv-miR-K12-11 expressing mice strongly suggests that seed sharing is indeed sufficient to mimic hsa-miR-155 functions. [score:3]
As shown in Figure S1, quantification of northern blotting signals suggested 6-fold higher expression of hsa-miR-155 in the LCL cells, a value which is in perfect accord with our stem-loop PCR data. [score:3]
In this regard, the KSHV-encoded miR-K12-11 is an especially interesting case: miR-K12-11 shares its seed with the cellular miR-155, a miRNA that plays important roles during hematopoiesis and the regulation of germinal center responses [25]– [27]. [score:2]
GFP [+] gated BM cells from miRNA -expressing mice reveal a slight increase of B-lineage cells compared to GFP control mice (B220 [+] (left graph; (control gfp: n = 13; kshv-miR-K12-11: n = 11; hsa-miR-155: n = 16)) and CD19 [+] (right graph; (control gfp: n = 10; kshv-miR-K12-11: n = 9; hsa-miR-155: n = 13)). [score:2]
Thus, we cannot fully exclude the possibility that, e. g. as a result of selectional processes, differences in the total abundance of kshv-miR-K12-11 and hsa-miR-155 may have contributed to some of the variability seen in our system. [score:1]
The finding that hsa-miR-155 as well as kshv-miR-K12-11 support B-cell expansion in the spleen is in accord with another study that was published while our work was in progress [42]. [score:1]
Therefore, we sought to confirm our comparative results by northern blotting, and additionally determined absolute copy numbers of hsa-miR-155 in Raji and LCL 721 cells. [score:1]
The basic hypothesis of our study was that the viral kshv-miR-K12-11 has evolved to mimic the host microRNA miR-155, thus the human orthologue of this microRNA (hsa-miR-155) was used as a positive control. [score:1]
Shown are alignments of the human and mouse 3′-UTR sequences, and their predicted pairing with hsa-miR-155 and kshv-miR-K12-11. [score:1]
As shown in the left panel of Figure 1C, the viral miRNA was readily detectable in kshv-miR-K12-11 transduced NIH-3T3 cells, but not the GFP-only controls or cells that had received hsa-miR-155. [score:1]
The precursor hairpins of kshv-miR-K12-11 and hsa-miR-155 are placed downstream of the GFP gene and transcribed from the LTR (long terminal repeat) promoter. [score:1]
Right: dot plots of all analyzed mice (control gfp: n = 16; kshv-miR-K12-11: n = 25; hsa-miR-155: n = 16) reveal an expansion of B-cells among the GFP [+] splenocytes. [score:1]
A recent study by Thai and colleagues demonstrated that miR-155 influences GC reactions by controlling cytokine production [25], and we suspect that similar mechanisms may be responsible for the observations we made in the hsa-miR-155 and kshv-miR-K12-11 mouse cohorts. [score:1]
0049435.g006 Figure 6 A) The 3′UTR of the prototypical human and mouse Jarid2 transcripts (GenBank accession numbers NM_004973 and NM_001205043, respectively) contains two seed match sites for kshv-miR-K12-11 and hsa-miR-155. [score:1]
A) The 3′UTR of the prototypical human and mouse Jarid2 transcripts (GenBank accession numbers NM_004973 and NM_001205043, respectively) contains two seed match sites for kshv-miR-K12-11 and hsa-miR-155. [score:1]
As shown in the rightward columns of Figure 6B, we found each site to contribute roughly 50% to the observed repression by hsa-miR-155 as well as kshv-miR-K12-11. [score:1]
Regarding Jarid2, three recent studies showed that miRNA-155 decreases Jarid2 mRNA levels in human and mouse cells [28], [39], [57], and one of these studies additionally demonstrated repression of heterologous luciferase reporters bearing the Jarid2 3′-UTR by miR-155 [39]. [score:1]
We also observed a weak overall reduction of myeloid cells in hsa-miR-155 mice (35%; +/−13%), however the extend of this reduction was not statistically significant. [score:1]
Right: dot plots of all analyzed mice (control gfp: n = 10; kshv-miR-K12-11: n = 9; hsa-miR-155: n = 13). [score:1]
The hsa-miR-155 mice showed 29% (+/−16%) CD19 [+] cells among the GFP [+] BM cells. [score:1]
B) Detection of hsa-miR-155 in Raji, LCL 721 and Jijoye cells by northern blotting (left panel). [score:1]
Nucleotides that are conserved between hsa- and mmu-miR-155 are shown on dark gray background, and nucleotides that are identical in two or more miRNAs are highlighted in light gray. [score:1]
At the time when this study was initiated, strong experimental and circumstantial evidence had suggested that seed sharing between hsa-miR-155 and kshv-miR-K12-11 represents a case of high biological significance, yet in vivo mo dels were still lacking. [score:1]
Shown is an alignment of human (hsa) and murine (mmu) miR-155 orthologues, the KSHV-encoded miR-K12-11 and the MDV-encoded miR-M4. [score:1]
GC numbers and relative GC areas were determined across an entire splenic section from each of 15 GFP control, 18 kshv-miR-K12-11 and 12 hsa-miR-155 mice, using the Pixel Classifier software as per the manufacturer's instructions. [score:1]
hsa-miR-155 and kshv-miR-K12-11 mediate B-cell expansion in the spleen. [score:1]
Taken together, our data strongly support previous studies that have suggested that kshv-miR-K12-11has evolved to mimic host miR-155. [score:1]
The fact that EBV does not encode its own miR-155 mimic, but instead induces cellular miR-155 via LMP-1 [50], [65] supports the notion that kshv-miR-K12-11may play an important role during this process. [score:1]
A) Determination of absolute copy numbers of hsa-miR-155 per cell in Raji and LCL 721 cultures. [score:1]
Absolute copy numbers of hsa-miR-155 per cell were determined to be in the range of 11,000–13,000 and 1,900–2,400 for LCL 721 and Raji cultures, respectively. [score:1]
A caveat is that, in contrast to hsa-miR-155, the increase in GC number/area was not statistically significant for kshv-miR-K12-11 (however, the p-value for increased GC numbers was 0.073 and thus barely missed the significance mark). [score:1]
Interestingly, we observed increased GC numbers as well as enlarged GC areas in hsa-miR-155 and kshv-miR-K12-11 mice. [score:1]
As shown in Figure 3A, hsa-miR-155 as well as kshv-miR-K12-11 mice showed a significant increase of CD19 [+] B-cells among the GFP [+] splenocytes. [score:1]
The graph represents flow cytometry results of GFP [+] gated BM cells (total number of mice: control gfp: n = 12; kshv-miR-K12-11: n = 16; hsa-miR-155: n = 13). [score:1]
As shown in Fig. 1A, the mature human microRNA differs from its murine counterpart (mmu-miR-155) in only a single nucleotide exchange at position 12 (see Fig. 1A). [score:1]
[1 to 20 of 89 sentences]
18
[+] score: 300
Expression was normalized to RHO-GDIα, n = 2. (F) qPCR of MCF-7-vector and miR-155 cells for downstream mTORC2 regulated gene PKCα, normalization was to β-actin and vector designated as 1, n = 3. We previously demonstrated that miRNA expression was a target of IGF/AKT signaling [23] suggesting a potential for miRNA crosstalk in the regulation of mTOR signaling. [score:9]
While previous studies have demonstrated miR-155 to be an inhibitor of mTORC1 signaling through the suppression of Rheb in macrophages [41], we do not see loss of Rheb expression in our breast cancer cell line and instead see an inhibition of mTORC2 signaling components. [score:9]
Expression was normalized to RHO-GDIα, n = 2. (F) qPCR of MCF-7-vector and miR-155 cells for downstream mTORC2 regulated gene PKCα, normalization was to β-actin and vector designated as 1, n = 3. We previously demonstrated that miRNA expression was a target of IGF/AKT signaling [23] suggesting a potential for miRNA crosstalk in the regulation of mTOR signaling. [score:9]
The MDA-MB-157 breast cancer cell line demonstrated the highest levels of miR-155 expression (Additional file 4: Figure S2B), so we chose this cell line and transfected a doxorubicin inducible red fluorescent protein (RFP)-miR-155sponge designed to inhibit miR-155 expression. [score:7]
Given that the TCGA tumor data demonstrated an inverse relationship between the loss of Rictor expression and miR-155HG expression in relation to ERα status and that Rictor expression was repressed in our MCF7-miR155 cell line, we next sought to determine the effects of miR-155 on mTOR signaling. [score:7]
To better understand the relationship between miR-155 expression and the mTOR signaling cascade, we uploaded all miR-155 predicted targets using Pathway Interaction Database (PID) [24] and obtained network maps for predicted miR-155 target genes and pathways (Table  1). [score:7]
miR-155 inhibition of PgR expression is regulated through mTORC1 activation. [score:6]
We extend previous studies by showing that miR-155 expression alters hormone receptor signaling and expression of the ERα regulated gene, PgR, through alterations in the mTOR signaling pathway. [score:6]
Figure 2 Overexpression of miR-155 selectively alters estrogen stimulated gene expression of ER-regulated genes in vitro. [score:6]
Collectively, the data indicated that miR-155 induced regulation of mTORC1 activity in MCF-7-miR-155 cells inhibited PgR expression. [score:6]
Since PgR was the only E2 responsive gene that remained significantly repressed and mTOR is a known mediator of ER signaling both directly and indirectly, we next set out to further define the effects of miR-155 expression on mTOR/ERα crosstalk by evaluating ERα expression levels and PgR protein levels and function. [score:5]
qPCR was performed and results demonstrated an increase (p < 0.06) in Rictor expression levels following miR-155 inhibition (Additional file 4: Figure S2C). [score:5]
As miR-155 expression correlated an ERα [−] phenotype and Rictor expression correlated with ERα [+] tumors, we next investigated whether the observed high levels of miR-155 expression in ERα [−] breast cancers was a driving force for the repression of Rictor. [score:5]
miR-155 augments E2-stimulated proliferation in vitroand in vivoBecause miR-155 altered basal ERα -mediated gene expression (Figure  2A and Figure  2B) and maintained suppression of the E2 responsive gene PgR (Figure  2C), we sought to determine the biological consequence of miR-155-altered E2 stimulation. [score:5]
Based on these results, we conclude that overexpression of miR-155 in ERα [+] breast cancer cells disrupted E2 signaling but did not completely inhibit the cellular response to hormone. [score:5]
Furthermore we observed that miR-155 enhanced mTORC1 signaling (observed through western blot for increased phosphorylation on mTOR S2448) and induced inhibition of mTORC2 signaling (evident through repressed Rictor and tuberous sclerosis 1 (TSC1) gene expression). [score:5]
This striking divergent expression of ERα-regulated genes suggested that miR-155 acts as a possible regulator of estrogen -mediated signaling. [score:5]
RAD001 treatment of SCID/CB17 mice inhibited E2 -induced tumorigenesis of the MCF7 miR-155 overexpressing cell line. [score:5]
The miRNAs (miR-203, miR-194, miR-98, let-7 g, and miR-155) predicted to have seed sites in the 3’UTR of Rictor were stably over expressed in the ERα [+] MCF-7 cell line and screened by qPCR for Rictor expression levels. [score:5]
Additionally our study shows miR-155 expression induces increased phosphorylation of downstream mTORC1 proteins associated with translation but not through the classically activated mTOR/p70s6k pathway. [score:5]
Through miR-155 overexpression in the ER [+] MCF-7 breast cancer cell line we demonstrate alterations in the mTOR signaling cascade can result in the loss of PgR expression without prior growth factor stimulation. [score:5]
Co-treatment of MCF7 breast cancer cells stably overexpressing miR-155 with RAD001 and E2 restored E2 -induced PgR gene expression. [score:5]
Of these five miRNAs, only miR-155, a miRNA well known for playing various roles in cancer, was capable of significantly inhibiting Rictor expression (Additional file 4: Figure S2A). [score:5]
were divided into treatment groups of five mice each: MCF-7 control vector, MCF-7 control vector plus E2, MCF-7 cells transduced to overexpress mature miR-155, MCF-7 cells transduced to overexpress mature miR-155 plus E2. [score:5]
miR-155 has recently be shown to target multiple aspects of the mTOR signaling cascade, including mTORC2 component Rictor; however, our results are the first to demonstrate miR-155 induced mTOR/ER crosstalk through enhanced mTOR signaling and Rictor suppression [42]. [score:5]
Because miR-155 altered basal ERα -mediated gene expression (Figure  2A and Figure  2B) and maintained suppression of the E2 responsive gene PgR (Figure  2C), we sought to determine the biological consequence of miR-155-altered E2 stimulation. [score:5]
Deep sequencing data obtained from TCGA data portal was analyzed with respect to ERα (either ERα positive or negative) status for expression of (A) mTOR associated gene sets (mTOR, TSC1, TSC2, Rheb, Rictor, Raptor, Rheb) and (B) miR-155 host gene (HG) expression. [score:5]
In opposition to Rictor expression, the miR-155HG, which encodes the mature miR-155 sequence, correlated with an ERα [−] status in TCGA breast tumor samples and mature miR-155 expression correlated with an ERα [−] status in breast cancer cell lines (Figure  1B and Additional file 4: Figure S2B). [score:5]
mTORC2 is known to enhance PKCα expression, so we next evaluated PKCα gene expression and saw repressed expression of PKCα in the MCF-7-miR-155 cell line (Figure  1F). [score:5]
demonstrate that in MCF-7-miR-155 cells, significantly increased p70s6 kinase expression was observed (Figure  1C), and significantly decreased expression of the mTOR repressor Deptor was seen (Figure  1C). [score:5]
While these studies have demonstrated activation of mTORC1 signaling by IGF as a regulatory mechanism for PgR repression, our results suggest that both miR-155 and Rictor may be important mediators of mTORC1 activity and PgR expression irrespective of growth factor stimulation. [score:4]
miR-155 -mediated mTOR signaling resulted in deregulated ERα signaling both in cultured cells in vitro and in xenografts in vivo in addition to repressed PgR expression and activity. [score:4]
Basal expression levels of BCL2 and SERPINA3 were significantly increased in MCF-7-miR-155 cells and E2 treatment further induced expression of both genes compared to MCF-7-vector cells (Figure  2E and Figure  2F respectively). [score:4]
Additionally it has recently been demonstrated by Zhang et al. that E2 is a positive regulator of miR-155 expression in the MCF-7 breast cancer cell line [37]. [score:4]
Given the loss of functional PgR in MCF7-miR155 cells compared to -vector and no observed increase in phospho-ERα (S167) in the MCF-7-miR-155 cell line, we suggest that miR-155 -induced ERα signaling regulation was due to the loss of Rictor expression rather than direct ERα-mTORC1 cascade interactions with ERα. [score:4]
Colonies were pooled and verification of mature miR-155 overexpression was confirmed using qPCR for mature miR-155. [score:3]
Our data and others demonstrate increased miR-155 expression correlates with an ERα [−] status in human breast tumor subtypes as well as breast cancer cell lines [30, 39, 40]. [score:3]
Additionally like others, we demonstrate a link too receptor status and miR-155 expression [30]. [score:3]
miR-155 enhances mTOR activity by targeting members of AKT/mTOR signaling pathway. [score:3]
Stable expression of miR-155 disrupts ERα signaling in MCF-7 breast cancer cells. [score:3]
Taken together this suggests miR-155 inhibition and activation of mTOR components to be cell line specific. [score:3]
qPCR results revealed a significant increase in PgR expression in MCF-7-miR-155 cells following the combined RAD001/E2 treatment and PgR levels were equal to that of MCF-7-vector cells treated with E2 only (Figure  3C). [score:3]
miR-155 mTOR breast cancer miRNA Estrogen receptor An important downstream mediator of growth factor signaling is mammalian target of rapamycin (mTOR). [score:3]
The combined loss of Rictor (a critical mTORC2 component) and TSC1an mTORC2 activator and mTORC1 suppressor) suggests that miR-155 induced mTOR signaling through the mTORC1 complex. [score:3]
Determines probability that miR-155 targets are biased towards a particular pathway. [score:3]
MCF-7-vector and MCF-7-miR-155 cells were treated with the mTORC1 specific inhibitor RAD001. [score:3]
These results together demonstrated in vivo and in vitro that miR-155 expression enhances estrogen response. [score:3]
Aberrant basal expression of ERα-regulated genes was observed in the MCF7-miR-155 cell line compared to vector. [score:3]
Strikingly, many of these pathways were mediated by PI3K signaling or growth factors, which have been shown to crosstalk with mTOR signaling and indeed many components of both mTOR signaling complexes (mTORC1 and 2) were, predicted targets of miR-155 (Table  1) [25]. [score:3]
qPCR analysis was conducted after treatment of MCF-7-miR-155 with 1 nM E2 and the mTORC1 specific inhibitor RAD001 (20 nM). [score:3]
Through increased microRNA-155 (miR-155) expression in the ERα [+] breast cancer cells we demonstrate repression of Rictor enhanced activation of mTOR complex 1 (mTORC1) signaling with both qPCR and western blot. [score:3]
Basal expression of SDF-1 was also significantly lower in our MCF-7-miR-155 cell line (Figure  2D). [score:3]
The inhibitory effect of RAD001 was apparent by day 10 post injections, MCF-7-miR-155 tumors in vehicle -treated animals increased to 364.15% ± 65.07% mm3 at Day 25 from Day 7 (100%). [score:3]
E2 stimulation failed to increase PgR expression levels in MCF-7-miR-155 cell line to that of basal levels observed in the MCF-7-vector cell line. [score:3]
In order to investigate the relationship between miR-155, mTOR, and ERα signaling; we used the ER [+] MCF-7 cell line transfected with miR-155 as this cell line demonstrated repressed Rictor expression levels and expressed levels of miR-155 equivalent to that of ER [−] cell lines (Additional file 4: Figure S2A and S2D respectively). [score:3]
Expression normalized to RHO-GDIα, n ≥ 3. (E) MCF-7-vector and miR-155 cells were harvested for western blot analysis for phosphorylation of downstream mTORC1 associated proteins p-eIF4B (S422), p-S6 ribosomal protein (S235/236), p-p70s6 kinase (Thr389), p-eEF2K (S366). [score:3]
To better evaluate a role for miR-155 expression with respect to mTOR signaling and the ERα gene signature, we next analyzed expression of the miR-155 host gene (miR-155HG) across TCGA tumor data. [score:3]
As anticipated, phosphorylation of 4E-BP1 was decreased and Akt, which is inhibited by mTORC1 activity, was increased in MCF-7-miR-155 cells following treatment with RAD001 (Additional file 6: Figure S4). [score:3]
Schematic for miR-155 induced regulation of mTOR/ER crosstalk. [score:2]
miR-155 induced mTOR/ERα crosstalk is not through direct mTOR induced phosphorylation of ERα. [score:2]
miR-155 is a frequently deregulated miRNA in human breast cancers and increases cellular proliferation in breast cancer cell lines [38]. [score:2]
Figure 5 mTORC1 induced repression of PgR is regulated by miR-155 independently of growth factor stimulation. [score:2]
5ug pre-mir-155 or vector plasmid was added to 100 ul serum free opti-MEM then 15 ul Lipofectamine was added. [score:1]
Treatment with E2 stimulated proliferation of both the MCF-7-vector and MCF-7-miR-155 cell lines (Figure  3A); however, E2-stimulated proliferation was significantly greater in MCF-7-miR-155 cells versus MCF-7-vector cells (52 ± 11.94% versus 12.8 ± 2.62%). [score:1]
Each cell line was normalized to the respective vehicle control, n = 4. (B) Tumor volume for ovariectomized CB-17 SCID female mice injected bilaterally with 5X10 [^6] MCF-7-vector cells or MCF-7-miR-155 cells, n = 5 animals/group. [score:1]
miR-155 augments E2-stimulated proliferation in vitroand in vivo. [score:1]
By combining our in-house Seedfinder program (identifies isoform specific seedsites across the genome for miR-155) with previously published deep sequencing data for MCF-7 cells and the UCSC Genome Browser [26, 27]. [score:1]
Ct values were normalized to β-actin and MCF-7-vector cells designated as 1. * p < 0.05 for n ≥ 3. (D) MCF-7-vector and –miR-155 cells were harvested for western blot analysis for total and phospho-mTOR (S2448) and mTOR associated proteins Rictor, Raptor, TSC1, and p-70 s6 kinase. [score:1]
MCF-7 cells were transfected with pre-mir-155 or vector plasmid using Lipofectamine 2000 at 1ug/ul OPTI-MEM (Invitrogen, Grand Isles, NY) as per manufacturer’s protocol. [score:1]
Taken together, our data demonstrate a role for a miR-155-mTOR-ERα signaling axis in the progression of breast carcinomas towards a hormone independent phenotype evident through the loss of PgR (Figure  5). [score:1]
MCF-7-vector and MCF-7-miR-155 cells grown in 5% phenol free DMEM for 24 hours and then plated in 48 well plates (7000 cells per well) for 24 hours prior to a one time treatment with 1 nM E2 or DMSO. [score:1]
Given that miR-155 induced enhanced E2 stimulated tumorigenesis and proliferation while simultaneously repressing PgR we next set out to investigate whether miR-155 activation of mTORC1 leads to the suppression of PgR. [score:1]
of MCF-7-miR-155 for p-4E-BP1 and p-Akt S473 following 6hrs treatment with RAD001 (20 nM) or vehicle (DMSO). [score:1]
MCF-7-vector and –miR-155 cells grown 10% FBS DMEM supplemented. [score:1]
MCF-7-vector and -miR-155 cells were transfected with a PRE-luciferase construct and treated with progesterone in a dose dependent manner. [score:1]
MCF-7-miR-155 + E2 given placebo, n = 7. Points represent normalized tumor volume ± SEM. [score:1]
MCF-7-miR-155 and –vector cells were serum starved for 48 hours prior to stimulation with 1 nM E2 for 72 hours. [score:1]
To determine if the enhanced E2 response increased tumorigenesis in vivo, ovariectomized CB-17/SCID female mice were inoculated with either MCF-7-vector or -miR-155 cells in the mammary fat pad (MFP) in the presence of exogenous E2 (0.72 mg pellet, 60 day release) versus placebo. [score:1]
further confirmed increased mTOR activity demonstrated through the increased total and phospho-mTOR (S2448) in MCF-7-miR-155 cells (Figure  1D). [score:1]
Appropriate miR-155 targets were chosen for further investigation based on evaluation of isoforms with 3’UTR being expressed in MCF-7 cell line (Table  2). [score:1]
Additionally, induction of PgR in MCF-7-miR-155 cells by RAD001 and E2 was significantly greater than E2 only treatment (Figure  3C). [score:1]
For generation of miR-155 sponge, miR-155 sponge sequence was taken from pMSCV-puro-GFP-miR155SPONGE as previously described [46] and inserted downstream from the RFP sequence in the TRIPz-RFP vector backbone. [score:1]
Figure 3 miR-155 enhanced E2 stimulated proliferation is mediated through altered mTOR signaling in vivo and in vitro. [score:1]
To test this CB-17/SCID ovariectomized mice were inoculated with MCF-7-miR-155 cells in the presence of E2 (0.72 mg pellet, 60 day release). [score:1]
As mTOR signaling is known to require E2 induced proliferation we next sought to determine if mTOR signaling was involved in the heightened E2 induced tumorigenesis observed in our MCF-7-miR-155 cells. [score:1]
MCF-7-vector and MCF-7-miR-155 cells were harvested for total RNA extraction using Qiagen RNeasy RNA purification system or for microRNA miRNeasy purification system per manufacturer’s protocol (Qiagen, Valencia, CA). [score:1]
miR-155 and vector plasmid were generated as previously described[45]. [score:1]
However, since MCF-7-miR-155 cell line maintained an ERα [+] phenotype with altered ERα signaling (evident through loss of PgR and high levels of TFF1, Figure  2A and Figure  2B), we next sough to determine the correlation between Rictor and PgR in a luminal B tumor subtype. [score:1]
PRE-activity in MCF-7-miR-155 cells was similar to that of basal unstimulated levels of MCF-7-vector cells for the 100 nM, 1 μM, 10 μM doses of progesterone. [score:1]
Following qPCR, there was no difference in basal ERα mRNA or protein levels observed between the MCF-7-miR-155 cells versus control (Additional file 5: Figure S3A and S3B respectively). [score:1]
Stimulation of PgR with 10 nM E2 for 24 hours prior to treatment with progesterone was similar to progesterone alone, with MCF-7-miR-155 cells demonstrating a loss of PgR activity (Additional file 5: Figure S3E). [score:1]
In addition, decreased Rictor and TSC1 protein levels were observed in MCF-7-miR-155 cells (Figure  1D). [score:1]
Taken together these results further support a role for miR-155 induced mTOR-ERα crosstalk in vitro and in vivo. [score:1]
[1 to 20 of 93 sentences]
19
[+] score: 297
We measured RNA expression levels of cytokine/chemokines including CXCL5, 9,11 and IL-4,6,10, which are shown to be up-regulated in Figure 3C-H. As shown in Figure 4A-F, over -expression of miR-155 mimic in both cells dramatically decreased the expression of the cytokines, although the relative basal level was low for some cytokines (e. g., CXCL9 in MCF10A). [score:8]
Finally, we confirmed that the up-regulation of IL-6 and CXCL9 expression mediated by miR-155 inhibition is dependent on C/EBP-β. [score:8]
In order to confirm our results that miR-155 dependent C/EBP-β up-regulation in cancer cells mediates cytokine up-regulation and MDSC infiltration (Figure 3, Figure 5), we analyzed the LLC1 xenograft mo del in more detail. [score:7]
Taken together, these results demonstrate that C/EBP-β is, at least in part, responsible for the up-regulation of cytokine/chemokines induced by miR-155 inhibition. [score:6]
Loss of miR-155 stimulates MDSC migration and up-regulates cytokine/chemokine expressions. [score:6]
We knocked down C/EBP-β by siRNA treatment, which reduced IL-6 and CXCL9 expression induced by miR-155 inhibition in two breast cancer cell lines (Figure 5H-5K). [score:6]
Although most of these new targets remain to be validated, the existence of such many potential targets suggests that miR-155 has multiple functions that might be dependent on cellular context. [score:5]
Finally, because miR-155 is an important therapeutic target, our findings suggest that its systemic inhibition as an antitumor therapy can have detrimental effects due to increased MDSC infiltration. [score:5]
H-K. C/EBP-β knockdown abolish miR-155 mediated IL-6 and CXCL9 up-regulation in two breast cancer cell lines, MDA-MB-436 (H, I) or MDA-MB-231 cells. [score:5]
We observed significant reduction in the levels of the two cytokines by miR-155 over -expression (miRH155) whereas inhibition of the miR-155 (miRZIP155) increased cytokine production (Figures 4G and H). [score:5]
Therefore, we hypothesized that a transcription factor regulating the genes encoding these cytokine/chemokines might be targeted by miR-155. [score:4]
Collectively, these results indicate that CEB/P-β is a direct target of miR-155. [score:4]
In addition, we observed up-regulated luciferase activity in miR-155 [ko/ko] cells when C/EBP-β 3′UTR reporter plasmids were introduced into three independent miR-155 [ko/+] or miR-155 [ko/ko] cell lines (Figure 5B). [score:4]
Considering the oncogenic role of miR-155 and its up-regulation in BRCA1 -deficient tumors [20] we reasoned its inactivation might increase the tumor latency or reduce the tumor incidence. [score:4]
Using this indirect co-culture system and a PCR array, we examined the cytokine/chemokine expression changes in 3T3-L1 derived-adipocytes and miR-155 [ko/ko] and miR-155 [+/ko] tumor cells separately. [score:4]
Taken together, these results demonstrate a novel function of miR-155 in the tumor and its microenvironment, which is mediated by C/EBP-β and its regulatory function on cytokine expression that in turn results in altered MDSC infiltration into the tumor (Summarized in Figure 6H). [score:4]
Moreover, it is known as a direct target of miR-155 in macrophage [29]. [score:4]
The miR-155 target site in the C/EBP-β 3′ UTR was mutated by deleting the 8 nt miR-155 seed match sequence (AGCAUUAA at nucleotide positions 554–561 in the C/EBP-β 3′ UTR) using the QuikChange Site-Directed Mutagenesis kit according to manufacturer's instructions (Stratagene, CA, USA). [score:4]
C/EBP-β is regulated by miR-155 in breast cancer cell and mediates chemokine/cytokine expression. [score:4]
Real time PCR analysis confirmed up-regulation of these factors (Figure 3C– 3I) in co-cultured miR-155 [ko/ko] cells. [score:4]
Among them, the myeloid derived suppressor cells (MDSC) are known to be regulated by miR-155 via SHIP-1 [16]. [score:4]
G, H. ELISA results of culture supernatant from the indicated cancer cells infected with miR-155 over -expression (miRH155) or miR-155 knockdown (miRZIP155) lentiviruses. [score:4]
Many studies have shown that miR-155 is up-regulated in multiple types of cancer including lymphoid, breast, colon, lung and pancreas [3– 5]. [score:4]
miR-155 knockdown or overexpression. [score:4]
There are at least 150 validated targets (from MirTar Base) of miR-155. [score:3]
For miR-155 overexpression, the MCF7 and MCF10A cells were transfected with 30 nM miR-155 mimic or scrambled miRNA by G-fectin (Genolution, Seoul, Republic of Korea) First strand cDNA for qPCR was synthesized using the RT2 First Strand cDNA Kit (SABiosciences, MD, USA). [score:3]
Over -expression of miR-155 induces cytokine changes in human breast cell lines. [score:3]
In addition, we showed that ‘miR-155 mimic significantly inhibited the luciferase activity of the CEB/P-β 3′UTR reporter but did not affect CEB/P-β 3′UTR reporter with mutated miR-155 binding sites (Mut). [score:3]
More recently, an Ago-CLIP-Seq study using WT or miR-155 -deficient T-cells revealed 250 targets [7]. [score:3]
However, analysis using TargetScan and PicTar prediction tool resulted in no miR-155 binding sites in the UTR of these genes (data not shown). [score:3]
Functional studies using knockout mouse mo dels have revealed that miR-155 is involved in B and T-cell development as well as germinal center formation [8, 9]. [score:3]
Cytokine array analysis revealed dynamic changes in cytokine/chemokine expression in the absence of miR-155. [score:3]
The regulation of C/EBP-β by miR-155 is further confirmed by a C/EBP-β UTR reporter assay in MDA-MB436 and MDA-MB-436-miRZIP155 (miR-155 knock-down cells) or in MCF7/MCF7-miRZIP155 cells, showing miR-155 dependent UTR regulation (Figure 5C and 5D left panel). [score:3]
A number of studies have been undertaken to identify the targets of miR-155 [6, 7]. [score:3]
Finding such cells and understanding how the elegant interplay among these immune cells can affect tumor growth will be critical for developing better therapeutic strategies to target miR-155. [score:3]
We observed a clear ChIP signal in all two promoters with marked increase upon the inhibition of miR-155 (miRZIP155) in IL-6 and CXCL9 promoters. [score:3]
In the past few years several studies have been published describing the role of mir-155 in tumor progression that suggest its dual role as an oncogene as well as a tumor suppressor [32– 34]. [score:3]
The implications of our findings on the use of miR-155 as a therapeutic target are discussed. [score:3]
We next examined whether miR-155 -deficient tumor cells are better adapted to attracting MDSCs than the tumor cells expressing miR-155. [score:3]
Consistent with our previous findings, we observed a significant up-regulation of miR-155 in tumors from Brca1 [cko/cko];Trp53 [cko/cko];K14-Cre mice compared to EMT6 mammary cancer cells and primary mouse embryonic fibroblasts (MEF) (Figure 1B). [score:3]
The cytokine regulation by miR-155 was further confirmed by ELISA assay for IL-6 and CXCL9 by over expressing miR-155 in MCF7 and MCF10A (low endogenous miR-155) and silencing miR-155 in MDA-MB-231 and MDA-MB-436 (high endogenous miR-155). [score:3]
However, considering the known oncogenic role of miR-155 in breast cancer cell as well as its tumor suppressive effects via normal immune activation[14, 22], it is possible that the two opposing effects might compensate each other. [score:3]
We hypothesized that certain tumor cell driven factor can be differentially expressed in miR-155 [ko/ko] cells that can aid in the recruitment of more MDSCs, which in turn will create a favorable microenvironment for tumor cell growth. [score:3]
The results described above strongly suggest a tumor suppressive role of miR-155 in the tumor microenvironment via C/EBP-β mediated cytokine production and MDSC infiltration. [score:3]
Differential expression was measured as fold expression relative to the miR-155 [ko/ko] cells. [score:3]
To understand how the absence or inhibition of miR-155 induces a set of cytokines/chemokines, we examined the possibility that miR-155 could bind to the UTR of the cytokine/chemokine genes. [score:3]
Loss of miR-155 in MDSCs is reported to exert increased migration and immune suppressive potential [17]. [score:3]
Of note, the level of C/EBP-β is increased not only by the miR-155 inhibition, but also by grafting cells into the miR-155 [ko/ko] mice, suggesting that there are host -driven factors that induce C/EBP-β. [score:3]
Increased cytokine expression and MDSC infiltration is caused by the loss of miR-155 in both cancer cell and tumor microenvironment. [score:3]
LLC1 and LLC1-miR-155 knockdown (miRZIP155) pair cells were introduced into either miR-155ko/+ (KO/+) or miR-155ko/ko (KO/ KO) recipient mice. [score:2]
miR-155 dependent cytokine/chemokine regulation in human breast cancer cells. [score:2]
miR-155 mutation was genotyped as described previously[9]. [score:2]
Growth defect of miR-155-knockdown cells are restored in miR-155ko/ko recipient mice. [score:2]
Figure 4 A-F. Real-time PCR results of chemokines and cytokines from the human breast cells with miR-155 mimic (in miR-155- low MCF10A or MCF7) or lentivirus mediated miR-155 knockdown (in miR-155 high MDA-MB-231 or MDA-MB-436). [score:2]
We next examined if miR-155 -mediated cytokine/chemokine regulation also occurs in human breast cancer cells. [score:2]
Another study revealed that miR-155 knockdown in myeloid cells accelerated tumor growth [14]. [score:2]
Second, we have used an allograft mo del to examine the growth of LLC1 cells with stable knockdown of miR-155 in miR-155 [ko/+] or miR-155 [ko/ko] mice. [score:2]
A-F. Real-time PCR results of chemokines and cytokines from the human breast cells with miR-155 mimic (in miR-155- low MCF10A or MCF7) or lentivirus mediated miR-155 knockdown (in miR-155 high MDA-MB-231 or MDA-MB-436). [score:2]
First, we have utilized a well-characterized Brca1 [cko/cko];Trp53 [cko/cko]; K14-Cre mouse mo del because miR-155 is upregulated in BRCA1 -deficient tumors [19]. [score:2]
For knockdown of miR-155, lentiviral constructs containing anti-miR-155 sequence (miRZIP155) was used. [score:2]
We identified a number of tumor -driven cytokines/chemokines that are differentially regulated in the absence of miR-155 (Table 2). [score:2]
To test this hypothesis, we generated Lewis Lung carcinoma cells (LLC1) with stable knockdown of miR-155 and injected the cells into isogenic (C57BL/6) miR-155 [ko/+] or miR-155 [ko/ko] mice and monitored tumor growth (Figure 6A and B, Supplementary Figure 5A). [score:2]
miR-155 heterozygous (miR-155 [ko/+]) or knockout (miR-155 [ko/ko]) primary cancer cells were isolated from tumor tissues using modified MEC (mammary epithelial cell) isolation procedure described previously[19]. [score:2]
Mutant reporter was generated by site-directed mutagenesis within the miR-155 seed match region. [score:2]
These results support our findings from the mouse mo del and demonstrate that the miR-155 -mediated cytokine regulation occurs in human cells as well. [score:2]
More importantly, our findings reveal that the miR-155 deficient tumor cells also contribute to the MDSC infiltration (Figure 3A and Figure 6E; compare 1 [st] and 2 [nd], 3 [rd] and 4 [th] bar). [score:1]
Figure 5 A. of C/EBP-β and phospho-C/EBP-β in breast cancer cells from miR-155 [ko/+] (KO/+) or miR-155 [ko/ko] (KO/ KO) mice. [score:1]
Surprisingly, we found the tumor free survival of Brca1 [cko/cko];Trp53 [cko/cko];K14-Cre mice was not significantly changed in miR-155 [ko/ko] and miR-155 [+/ko] genetic backgrounds (Figure 1A). [score:1]
Bars 1-3 represent breast cancer cells that are miR-155 [ko/+] (KO/+) and 4-6 represent miR-155 [ko/ko] (KO/ KO) cells. [score:1]
A. Tumor free survival of Brca1 [cko/cko];Trp53 [cko/cko];K14-Cre on miR-155 [ko/+] (Cre; KO/+) or miR-155 [ko/ko] (Cre; KO/ KO) genetic backgrounds. [score:1]
Interestingly, another recent study revealed the loss of miR-155 in MDSCs enhanced its recruitment and function in solid tumor [18], suggesting that the role of miR-155 may vary depending on the tumor type and the mo del system. [score:1]
Therefore, it is likely that MDSC infiltration is maximized when both of the tumor and MDSCs lack miR-155. [score:1]
C. The level of miR-155 in the xenograft tumors harvested at the end. [score:1]
Our results suggest a dual role for miR-155 in the tumor and the tumor microenvironment. [score:1]
We found a marked increase in C/EBP-β and its phosphoylated form in miR-155 [ko/ko] cells relative to miR-155 [+/ko] cells (Figure 5A). [score:1]
A. of C/EBP-β and phospho-C/EBP-β in breast cancer cells from miR-155 [ko/+] (KO/+) or miR-155 [ko/ko] (KO/ KO) mice. [score:1]
This idea is supported by the observation that germ-line inactivation of miR-155 did not affect tumor formation in Brca1 [cko/cko];Trp53 [cko/cko];K14 Cre;miR-155 [ko/ko] mice (Figure 1A). [score:1]
To examine the possibility, we crossed miR-155 [ko/ko] mice with well established Brca1 [cko/cko];Trp53 [cko/cko];K14-Cre mouse mo del and monitored a cohort of Brca1 [cko/cko];Trp53 [cko/cko];K14-Cre; miR-155 [ko/ko] and Brca1 [cko/cko];Trp53 [cko/cko];K14-Cre; miR-155 [ko/+] mice for tumor incidence [21]. [score:1]
Based on these observations, we concluded that the MDSCs are more efficiently recruited to the tumor sites in the miR-155 [ko/ko] mice. [score:1]
al. showed that the loss of miR-155 in host animal results in faster xenograft growth due to increased response of T cells to interferon gamma [13]. [score:1]
This increase is further enhanced when the cells are introduced into miR-155 [ko/ko] mice (compare red with purple bars in Figure 6E). [score:1]
Our results show that loss of miR-155 in the host animal allows more MDSCs to infiltrate into the tumor (Figure 6E, compare 1 [st] and 3 [rd], 2 [nd] and 4 [th] bar). [score:1]
miR-155 is a well-known oncogenic microRNA encoded by the BIC (B-Cell Insertion cluster) gene [1]. [score:1]
In this report, we analyzed a Brca1/Trp53 -based spontaneous breast cancer mo del with genetic loss of miR-155. [score:1]
First, we detected increased C/EBP-β and phospho-C/EBP-β levels in miR-155 KD LLC1 cells (Figure 6D, Supplementary Figure 5B for confirmation and 5C for quantitation). [score:1]
We also observed increased CD4 positive and decreased CD8 positive cells in the miR-155 [ko/ko] tumors but the differences were not significant due to high variability observed in the tumors. [score:1]
Even though we show only MDSC is significantly enriched in miR-155 -deficient tumor microenvironment in the breast cancer mo del, we expect other immune effector cells to also differentially infiltrate in human cancer when miR-155 is inactivated by therapeutic agents, such as chemically modified AntagomiR. [score:1]
The level of miR-155 in tumors was confirmed by real time PCR (Figure 6C). [score:1]
Figure 1Effect of miR-155 on the tumor free survival of Brca1 [cko/cko];Trp53 [cko/cko];K14-Cre mice A. Tumor free survival of Brca1 [cko/cko];Trp53 [cko/cko];K14-Cre on miR-155 [ko/+] (Cre; KO/+) or miR-155 [ko/ko] (Cre; KO/ KO) genetic backgrounds. [score:1]
When we measured MDSCs from the dissected tumors by FACS, we found the inhibition of miR-155 in tumor cells increase MDSC infiltration ratio (Figure 6E Blue and Red bars, Supplementary Figure 5D and E, Supplementary Table 2). [score:1]
These findings are consistent with other reports showing increased MDSC infiltration in the absence of miR-155 [18]. [score:1]
The mice were further breeded with miR-155 [ko/ko] (Jackson Laboratory, Bar Harbor, USA) to obtain Brca1 [cko/cko];Trp53 [cko/cko];K14-Cre; miR-155 [ko/ko] and Brca1 [cko/cko];Trp53 [cko/cko];K14-Cre; miR-155 [ko/+] mice. [score:1]
miR-155 is also shown to be required for tumor associated macrophage (TAM) mediated antitumor function [14, 15]. [score:1]
In a line with this finding, MDSCs was shown to require miR-155 to facilitate tumor growth [17]. [score:1]
BIC transcribes a 1.5kb noncoding RNA, which is processed to generate mature miR-155[2]. [score:1]
This suggested that some unknown tumor derived factor(s) from miR-155 [ko/ko] tumor cells were attracting more MDSCs. [score:1]
In this study, miR-155 found to modulate IFN gamma production in T cells. [score:1]
Germ-line inactivation of miR-155 does not affect the tumor free survival of Brca1/Trp53 mutant mice. [score:1]
Interestingly, the growth of miRZIP155 LLC1 cells in miR-155 [ko/ko] mice was comparable to the growth of control LLC1 cells in miR-155 [ko/+] mice (Figure 6B, compare blue and purple lines). [score:1]
However, the latter report showed the loss of host miR-155 overall promoted antitumor activity, which is not consistent with the results of other studies. [score:1]
We transfected MCF7 and MCF10A cells that have low levels of endogenous miR-155 with miR-155 mimic. [score:1]
Control or miRZIP155-containing the lentivirus particles were infected into MDA-MB-436, MDA-MB-231 and three mouse miR-155 [ko/+] primary cells. [score:1]
These observations provide strong evidence to suggest a compensatory effect of miR-155 in the tumor and the tumor microenvironment, which may explain why we did not observe any significant difference in the tumor growth in Brca1 [cko/cko];Trp53 [cko/cko];K14 Cre mice in miR-155 [ko/+] and miR-155 [ko/ko] backgrounds (Figure 1A). [score:1]
The cells were differentiated into adipocytes as described above and then co-cultured with miR-155 [ko/+] or miR-155 [ko/ko] cells or cancer cell lines for 24, 48, and 72 hours. [score:1]
We have examined the effect of miR-155 loss on tumorigenesis by germ-line inactivation of miR-155. [score:1]
H. Schematic diagram of the dual roles of miR-155 in tumor and tumor microenvironment. [score:1]
It is possible that this contributes to the tumor growth in miR-155 -deficient background (Figure 1A). [score:1]
Effect of miR-155 on the tumor free survival of Brca1 [cko/cko];Trp53 [cko/cko];K14-Cre mice. [score:1]
Lav624, 670, 704, 714 and 748 cells are from miR-155 KO/+ tumors. [score:1]
Red/blue bar represent the portion of each group from miR-155 [ko/+] (KO/+, blue) or miR-155 [ko/ko] (KO/ KO, red) mammary tumors. [score:1]
More importantly, the growth defect of miRZIP155 LLC1 cells was restored when they were introduced into the miR-155 [ko/ko] mice (Figure 6B, compare purple line with red line). [score:1]
These data suggest that loss of miR-155 in the tumor as well as in the tumor microenvironment contribute to the increased MDSC infiltration into the tumor. [score:1]
In the spleen, we observed no difference in the number of MDSCs between the two genotypes, suggesting that the generation of MDSCs in the tumor bearing mice is not affected by the presence or absence of miR-155 (Figure 2C). [score:1]
al. demonstrated that miR-155 promotes expansion of functional MDSCs suggesting that loss of miR-155 might negatively affect MDSC proliferation [16]. [score:1]
We observed that when injected into miR-155 [ko/+] mice, the knockdown of miR-155 (indicated as miRZIP155) in LLC1 cells slowed down tumor growth compared to the control vector (Figure 6B; compare red line with blue line). [score:1]
Indeed, an in vitro migration experiment using normal MDSC and conditioned medium from miR-155 [ko/ko] and miR-155 [+/ko]. [score:1]
Tumor cells showed that the miR-155 [ko/ko] conditioned medium induced much more MDSC migration than miR-155 [+/ko] (Figure 3A). [score:1]
In contrast, previous findings have demonstrated an oncogenic role of miR-155 in tumor cells [32, 33]. [score:1]
Subsequently, miR-155 was identified in the transcript and shown to be responsible for the oncogenic nature of this locus [2]. [score:1]
al. revealed that miR-155 deficiency enhances the recruitment and functions of MDSCs [17], which is beneficial to the tumor. [score:1]
In contrast, we found an increase in the MDSC population in the tumors from miR-155 [ko/ko] mice (Figure 2D). [score:1]
A study using EL4 and B16F10 melanoma cell lines in a allograft mo del reported that the absence of miR-155 in recipient mice resulted in faster tumor growth [13]. [score:1]
Lav705, 733 and 759 are from miR-155 [ko/ko] (KO/ KO), and Lav788 from miR-155 [ko/+] (KO/+) mouse. [score:1]
al. where the loss of miR-155 enhanced antitumor T cell activity and reduced MDSC infiltration into the tumor [18]. [score:1]
These results suggest that germline inactivation of miR-155 does not affect the tumor free survival of Brca1 [cko/cko];Trp53 [cko/cko];K14-Cre mice. [score:1]
F. Representative picture of Immunofluorescence staining of MDSC infiltrated in miR-155 [ko/+] (KO/+) and miR-155 [ko/ko] (KO/ KO) tumors, using Gr1 and CD11b antibodies. [score:1]
Increased MDSC infiltration in miR-155 -deficient tumor microenvironment. [score:1]
The pMiR-C/EBP-β-3′UTR (Wt or Mut) was co -transfected into MCF7 cells either with scramble miRNA or miR-155 mimic using Lipofectamine2000 (Invitrogen, CA, USA) according to the transfection procedures. [score:1]
However, when we scored the degree of the infiltration using an arbitrary four tier grading system (−, +, ++ and +++), we observed that the tumors from miR-155 [ko/ko] mice have higher degree of the MDSC infiltration (Figure 2G, Table 1). [score:1]
B. Real-time PCR -based quantification of miR-155 in Brca1 [cko/cko];Trp53 [cko/cko];K14-Cre tumors. [score:1]
For miR-155 quantization, miScript ll RT Kit (Qiagen, Hilden, Germany) and miScript SYBR Green PCR Kit (Qiagen) were used. [score:1]
To address some of the inconsistencies in previous studies and dissect the diverse role of miR-155 in breast cancer, we have examined its function in two different contexts. [score:1]
Increased MDSC infiltration in miR-155 -deficient tumors. [score:1]
In these mice, miR-155 is deficient in both the tumor as well as the tumor microenvironment. [score:1]
Therefore, we hypothesized that these two opposing roles might compensate each other in vivo, when the miR-155 is lost in both compartments. [score:1]
Therefore, we first examined whether MDSCs play a role in tumorigenesis in Brca1 [cko/cko];Trp53 [cko/cko];K14 Cre; miR-155 [ko/ko] mice as well. [score:1]
Some of our results support the notion that loss of miR-155 in MDSC is beneficial for tumor growth. [score:1]
Opposing roles of miR-155 inactivation in cancer cells and the tumor microenvironment on tumor growth. [score:1]
[1 to 20 of 138 sentences]
20
[+] score: 296
Other miRNAs from this paper: hsa-mir-155
Dexamethasone mediated suppressions of Socs1, Socs3, Fgf7, and Olfml3 mRNA expressions are not via endogenous miR-155Since dexamethasone treatment led to a robust decrease in the mRNA expressions of Socs1, Socs3, Fgf7, and Olfml3 in differentiating preadipocytes, and we showed that this reduction was inhibited by the GR antagonist RU486, we asked whether this reduction occurred via miR-155. [score:9]
In other cell types, such as murine microglia and human macrophages, overexpression of miR-155 suppressed the expression of Socs1 and these responses were normalized when miR-155 was inhibited 32, 33. [score:9]
The finding that miR-155 was upregulated by dexamethasone is particularly interesting since synthetic glucocorticoids are typically used in the clinic as anti-inflammatory agents [20], and therefore one may anticipate that they would downregulate miR-155 expression. [score:9]
Interestingly, overexpression of miR-155 also did not suppress the expression of Socs1 and Socs3 in these cells. [score:7]
Figure 5Dexamethasone treatment suppressed the expression of miR-155 putative targets in differentiating preadipocytes. [score:7]
Nonetheless, Liu et al. and others have shown that ectopic expression of miR-155 inhibits gene expression of adipogenic markers in differentiating preadipocytes and mature adipocytes 13– 15. [score:7]
In this study we show no effects of endogenous miR-155 upregulation on mRNA expression of adipogenic markers, however effects on protein levels cannot be ruled out. [score:6]
The mRNA expression of other miR-155 putative targets such as fos-like antigen 2 (Fosl2), Cd47, and epithelial membrane protein 2 (EMP2) were all down regulated by dexamethasone treatment (Supplementary Fig.   S2a,b and e). [score:6]
The same study suggested that ectopic expression of miR-155 inhibited mouse 3T3-L1 preadipocytes. [score:5]
Dexamethasone decreases the mRNA expression of miR-155 putative targets in differentiating preadipocytes. [score:5]
Since dexamethasone treatment led to a robust decrease in the mRNA expressions of Socs1, Socs3, Fgf7, and Olfml3 in differentiating preadipocytes, and we showed that this reduction was inhibited by the GR antagonist RU486, we asked whether this reduction occurred via miR-155. [score:5]
At day 6 of differentiation, we assessed the mRNA expression levels of adipogenic markers by real time-qPCR in the cells differentiated with MID in the presence or absence of the miR-155 inhibitor. [score:5]
However, in the present study although Fgf7 was inhibited by dexamethasone, it was not inhibited by miR-155. [score:5]
Dexamethasone mediated suppressions of Socs1, Socs3, Fgf7, and Olfml3 mRNA expressions are not via endogenous miR-155. [score:5]
Moreover, our GR inhibition studies demonstrated that that miR-155 is indeed a transcriptional target of GR (Fig.   2b). [score:5]
A previous study reported that exogenous overexpression of miR-155 in 3T3-L1 preadipocytes inhibited adipogenesis of the 3T3-L1 cells [13]. [score:5]
However, miR-155 overexpression did not mirror the effects of dexamethasone, except for Olfml3, which was reduced when the cells overexpressed miR-155. [score:5]
Cells overexpressing miR-155 were treated with MI, whereas cells transfected with miR-155 inhibitor were treated with MID. [score:5]
We found that inhibition of dexamethasone -mediated endogenous miR-155 enhancement did not affect the mRNA expression of adipogenic markers in differentiated 3T3-L1 adipocytes (Fig.   4b). [score:5]
The miR-155 inhibitor did not restore the reduced mRNA expression of these genes (Fig.   6b–e). [score:5]
We showed that this dexamethasone mediated miR-155 increase does not affect adipogenesis despite previous reports that ectopic overexpression of miR-155 has an inhibitory role in adipogenesis. [score:5]
Glucocorticoids also were shown to suppress miR-155 expression in livers of a lipopolysaccharides (LPS) -induced sepsis mouse mo del in a dose dependent manner [23]. [score:5]
For example, glucocorticoids have been reported to suppress the expression of miR-155 in activated and pro-inflammatory immune cells such as macrophages and T-cells 21, 22. [score:5]
Nevertheless, PPARγ may supress the expression of miR-155 indirectly through transrepression as has been shown for example for nuclear factor-κB [24]. [score:4]
Taken together, these results suggest that miR-155 upregulation is mediated through GR transactivation in differentiating 3T3-L1 preadipocytes. [score:4]
Dexamethasone is a wi dely used adipogenic inducer both in murine and human cultures; therefore, we asked whether dexamethasone -mediated endogenous upregulation of miR-155 has a role in adipogenesis. [score:4]
Therefore, it is plausible that rosiglitazone may be able to supress the dexamethasone -mediated miR-155 upregulation. [score:4]
Figure 4Dexamethasone mediated miR-155 up-regulation does not affect adipogenesis. [score:4]
To directly assess whether dexamethasone mediated endogenous miR-155 enhancement has a role in adipogenesis we induced 3T3-L1 preadipocytes to differentiate under MID conditions with either miR-155 inhibitor or negative control. [score:4]
Dexamethasone -mediated endogenous miR-155 up-regulation does not affect adipogenesis. [score:4]
After 24 hours, miRNA was isolated, and the expression levels of miR-155 were quantified by real-time qPCR. [score:3]
Murine 3T3-L1 preadipocytes were transfected with miR-155 mimic, miR-155 inhibitor, or negative controls. [score:3]
After 8 hours miRNA was isolated and, real-time qPCR quantified the expression levels of miR-155. [score:3]
The miRNA screen resulted in a number of false positive changes in miRNA expression in response to dexamethasone as confirmed by real time-qPCR (Supplementary Table  S1 and Fig.   S1) and only miR-155 was confirmed. [score:3]
In this study we also showed in differentiating preadipocytes that overexpression of miR-155 reduced the mRNA levels of Olfml3. [score:3]
Taken together these results once more may point to a differential role for endogenous versus exogenous sources of miR-155 in differentiating preadipocytes, and that GR may supress the expression of these genes independently of miR-155. [score:3]
Murine 3T3-L1 preadipocytes were transfected with miR-155 inhibitor or negative control. [score:3]
Here we show that dexamethasone but not rosiglitazone increased the expression of miR-155 in the 3T3-L1 cells. [score:3]
org) to generate a list of potential candidate genes that have miR-155 target sites in the 3′-UTR of their mRNA. [score:3]
To examine this possibility, 3T3-L1 preadipocytes were transfected with miR-155 mimic, miR-155 inhibitor, or respective negative controls. [score:3]
At each time point, miRNA was isolated, and the expression levels of miR-155 were quantified by real-time qPCR. [score:3]
Others have shown induction of miR-155 expression in murine 3T3-L1 preadipocytes and adipocytes but only when cells were exposed to the proinflammatory cytokine, TNF-α 13, 14. [score:3]
Another study using human mesenchymal stromal cells (hMSCs) showed that over -expression of miR-155 reduced the extent of differentiation into adipocytes 13, 15. [score:3]
As such, these results indicate that Socs1, Socs3, and Fgf7 mRNA are not targets of miR-155 in differentiating preadipocytes, and further, that miR-155 does not mediate the dexamethasone reduction of all four genes. [score:3]
We also found that with a PPARγ agonist (rosiglitazone) treatment the expression of miR-155 was reduced in differentiating preadipocytes (Fig.   1b). [score:3]
In addition, the results show that Olfml3 is a target of both miR-155 and dexamethasone; however, these responses are independent of each other. [score:3]
After 48 hours, miRNA was isolated, and the expression levels of miR-155 (a), Socs1 (b), Socs3 (c), Fgf7 (d) and Olfml3 (e) were quantified by real-time qPCR. [score:3]
Dexamethasone, but not rosiglitazone, induces miR-155 expression in differentiating preadipocytes. [score:3]
Dexamethasone mediated miR-155 induction is inhibited by a GR antagonist in differentiating preadipocytes. [score:3]
MiR-155 has been previously reported to be upregulated in a variety of cell types under inflammatory conditions 13, 14, 18, 19. [score:3]
As previously mentioned, miR-155 expression is wi dely associated with inflammation in various cell types and studies assessing the role of glucocorticoids on miR-155 levels have done so primarily in the context of inflammation. [score:3]
To the best of our knowledge, we are the first to show that glucocorticoids increase the expression of endogenous miR-155 in 3T3-L1 preadipocytes and that this induction is dependent on GR transactivation. [score:3]
As such, the role of miR-155 in adipogenesis has been mainly studied either under inflammatory conditions or by ectopic over -expression. [score:3]
This group also reported that TNF-α mediated endogenous miR-155 induction in 3T3-L1 preadipocytes led to inhibition of adipogenesis [13]. [score:3]
Perhaps as a secreted factor from other cell types in the adipose tissue, miR-155 would inhibit adipogenesis whereas endogenous miR-155 in differentiating preadipocytes may have other roles, which are still to be discovered. [score:3]
Although the effect of each differentiation inducer on miR-155 levels was not separately assessed, it may be plausible that the addition of a PPARγ agonist in the differentiation cocktail used for the hMSC-Tert20 cells could suppress a potential glucocorticoid mediated increase in miR-155. [score:3]
The mRNA expression of Olfml3 has been shown to be decreased by miR-155 in a porcine kidney epithelial cell line [41]. [score:3]
Cells were then transfected with miR-155 mimic (1.5 pmol), miR-155 inhibitor (15 pmol), or negative controls using Lipofectamine reagent (all from Life Technologies, Burlington, ON, Canada) following the manufacturer’s instructions. [score:3]
Socs1 and Socs3 are known targets of miR-155 in various cell-types 30– 34. [score:3]
A well-cited paper reported that TNF-α mediated endogenous miR-155 induction in 3T3-L1 preadipocytes led to inhibition of adipogenesis. [score:3]
Taken together, these data suggest that the role of miR-155 in modulating Socs1 and Socs3 expression may be species and cell type specific. [score:3]
We then compared the two lists and generated a short list of 9 candidate genes that were both putative targets of miR-155 and were found to be decreased with dexamethasone treatment in the microarray analysis. [score:2]
These data suggest once more that the role of miR-155 in modulating gene expression may be distinct in 3T3-L1 preadipocytes compared to other cell types. [score:2]
Fgf7 mRNA is reported to be a target of miR-155 as assessed by luciferase assays in murine and human lung fibroblasts systems [38]. [score:2]
Indeed, we show that after 24 hours miR-155 levels were increased under MID conditions (2.4-fold compared to basal MI levels) and this enhancement was abolished in the MID with the miR-155 inhibitor condition (Fig.   4a). [score:2]
Also, as expected the levels of miR-155 in MID conditions increased by 2.7-fold compared to MI, and this increase was abolished almost entirely by the miR-155 inhibitor (Fig.   6a). [score:2]
One study reported that under normal 3T3-L1 differentiation protocol, using insulin, IBMX, and dexamethasone, miR-155 levels were not altered as compared to preadipocytes; and that only TNFα- could induce miR-155 expression in preadipocytes [13]. [score:2]
Furthermore, it has been shown that levels of miR-155 were increased both in preadipocytes and adipocytes when cells were treated with tumor necrosis factor (TNF) α 13, 14. [score:1]
To the best of our knowledge, the effects of PPARγ agonists on miR-155 levels in differentiating preadipocytes have not been previously reported. [score:1]
Further, using the TRANSFAC® 7.0 software we identified two glucocorticoid responsive elements in the 5Kb sequence up-stream of miR-155. [score:1]
However, we showed that dexamethasone mediated decrease in Socs1 and Socs3 mRNA in differentiating preadipocytes was not via endogenous miR-155. [score:1]
Levels of miR-155 were normalized to RNU6 and data were analysed using the comparative CT (ΔΔCT) method. [score:1]
In their study TNF-α increased the levels of endogenous miR-155 in differentiating preadipocytes to similar levels as dexamethasone did in our study. [score:1]
Using insulin, IBMX, dexamethasone and a PPARγ agonist, one study reported that levels of miR-155 were decreased during differentiation of the human bone marrow-derived stromal cell line, hMSC-Tert20 [15]. [score:1]
After 24 hours the levels of miR-155 were measured by real time-qPCR in these cultures to validate that miR-155 enhancement in MID conditions was inhibited. [score:1]
In animal mo dels of obesity, miR-155 has been shown to be involved in promoting inflammation and insulin resistance [11]. [score:1]
Further, the MI -mediated miR-155 increase was attributed to the IBMX and not insulin (Fig.   1c). [score:1]
These data and our findings indicate that the effects of miR-155 on differentiating preadipocytes may be dependent on the source of miR-155 and the critical dose. [score:1]
Next, we investigated whether GR activation is required for dexamethasone mediated miR-155 increased expression in differentiating preadipocytes. [score:1]
Taken together these data and our findings in the present study suggest that glucocorticoid -mediated modulations of miR-155 levels may not only be cell-type dependent but also dependent on the presence of inflammatory factors in the local microenviroment of the cell. [score:1]
Our results show that the dexamethasone mediated increase in endogenous miR-155 did not affect adipogenesis. [score:1]
Taken together, these results suggest that dexamethasone -mediated miR-155 induction may not be related to adipogenesis since both rosiglitazone and dexamethasone treatments resulted in the same levels of differentiation, even though miR-155 was increased only by dexamethasone and was even decreased by rosiglitazone (Fig.   1a and b). [score:1]
To further elucidate the dexamethasone -mediated temporal expression of miR-155 induction in differentiating preadipocytes we measured miR-155 levels at 4 and 8-hours post treatment. [score:1]
Similarly, miR-155 reduced Socs3 levels in human oligodendrocytes [34]. [score:1]
To understand whether this dexamethasone -mediated miR-155 induction was part of the adipogenic process we also assessed the effects of another adipogenic inducer, rosiglitazone, a peroxisome proliferator-activated receptor (PPAR) γ agonist [16], on miR-155 levels during induction of differentiation. [score:1]
The glucocorticoid mediated miR-155 increase we show in this study was detected in differentiating murine 3T3-L1 preadipocytes. [score:1]
Figure 6Dexamethasone induced mRNA reductions of Socs1, Socs3, Fgf7, and Olfml3 are not mediated by miR-155 in differentiating preadipocytes. [score:1]
In addition, in leptin deficient and diet induced obese mice levels of miR-155 were increased in visceral fat pad (epididymal), suggesting that miR-155 may have a role in adipogenesis [12]. [score:1]
Since we demonstrated that miR-155 levels increased with dexamethasone, but they were decreased by rosiglitazone in differentiating preadipocytes (Fig.   1a and b), we asked whether there was a difference in the adipogenic potential of dexamethasone versus rosiglitazone in this mo del system. [score:1]
Furthermore, we found that the dexamethasone mediated reduction of Fgf7 mRNA was not via miR-155 in differentiating 3T3-L1 preadipocytes. [score:1]
However, we further showed that the observed dexamethasone mediated reduction of Olfml3 mRNA levels was not via endogenous miR-155. [score:1]
Since endogenous glucocorticoid -induced miR-155 appeared to have no role in adipogenesis, we assessed other possible responses that could be mediated by glucocorticoids via miR-155. [score:1]
Since we established that dexamethasone -mediated miR-155 induction at the onset of differentiation might not be involved in adipogenesis, we next asked whether this miR-155 enhancement may have other roles. [score:1]
In the present study we show that the synthetic glucocorticoid, dexamethasone, increased endogenous miR-155 levels in differentiating preadipocytes. [score:1]
One of these studies suggested that TNF- α mediated increase in endogenous miR-155 supressed 3T3-L1 adipogenesis [13]. [score:1]
[1 to 20 of 95 sentences]
21
[+] score: 291
Other miRNAs from this paper: mmu-mir-150
ITK original sequence:GGATATGTCCTCATTCCATAG AGCATTAGAAGCTGCCACCAGCCCAGG ITK mutated sequence (M):GGATATGTCCTCATTCCATAG AGC GG TAGAAGCTGCCACCAGCCCAGG Primers used for mutation:ITKS 5′-GTCCTCATTCCATAG AGCGGTAGAAGCTGCCACCAGITKAS 5′-CTGGTGGCAGCTTCTA CCGCTCTATGGAATGAGGAC ETS original target site 1:GGACTTAATGTTGAGCTAAGA AGCATTAAGTCTTTGAACTGAATGTATTTTGCATCCC ETS mutated target site 1 (M1):GGACTTAATGTTGAGCTAAGAAGC GGTAAGTCTTTGAACTGAATGTATTTTGCATCCC Primers used for mutation: ETS1S5′-GGACTTAATGTTGAGCTAAG AAGCGGTAAGTCTTTGAACTGAATG ETS1AS5′-CATTCAGTTCAAAGACTTA CCGCTTCTTAGCTCAACATTAAGTCC ETS original target site 2:GGAGATGAACACTCTGGGTTTTAC AGCATTAACCTGCCTAACCTTCATGGTG ETS mutated target site 2 (M2):GGAGATGAACACTCTGGGTTTTACAGC GGTAACCTGCCTAACCTTCATGGTG Primers used for mutation of target site 2 (M2):ETS2S 5′-GAACACTCTGGGTTTTAC AGCGGTAACCTGCCTAACCETS2AS 5′-GGTTAGGCAGGTTA CCGCTGTAAAACCCAGAGTGTTCThe miR-Control and miR-155 were purchased from Life Technologies (catalog number AM17110 and PM12601, respectively). [score:11]
ITK original sequence: GGATATGTCCTCATTCCATAG AGCATTAGAAGCTGCCACCAGCCCAGG ITK mutated sequence (M): GGATATGTCCTCATTCCATAG AGC GG TAGAAGCTGCCACCAGCCCAGG Primers used for mutation: ITKS 5′-GTCCTCATTCCATAG AGCGGTAGAAGCTGCCACCAG ITKAS 5′-CTGGTGGCAGCTTCTA CCGCTCTATGGAATGAGGAC ETS original target site 1: GGACTTAATGTTGAGCTAAGA AGCATTAAGTCTTTGAACTGAATGTATTTTGCATCCC ETS mutated target site 1 (M1): GGACTTAATGTTGAGCTAAGAAGC GGTAAGTCTTTGAACTGAATGTATTTTGCATCCC Primers used for mutation: ETS1S 5′-GGACTTAATGTTGAGCTAAG AAGCGGTAAGTCTTTGAACTGAATG ETS1AS 5′-CATTCAGTTCAAAGACTTA CCGCTTCTTAGCTCAACATTAAGTCC ETS original target site 2: GGAGATGAACACTCTGGGTTTTAC AGCATTAACCTGCCTAACCTTCATGGTG ETS mutated target site 2 (M2): GGAGATGAACACTCTGGGTTTTACAGC GGTAACCTGCCTAACCTTCATGGTG Primers used for mutation of target site 2 (M2): ETS2S 5′-GAACACTCTGGGTTTTAC AGCGGTAACCTGCCTAACC ETS2AS 5′-GGTTAGGCAGGTTA CCGCTGTAAAACCCAGAGTGTTC The miR-Control and miR-155 were purchased from Life Technologies (catalog number AM17110 and PM12601, respectively). [score:11]
Interestingly, despite the dramatic consequences of miR-155 over -expression in B cells, none of the Lck- miR-155 tg mice under our observation developed thymomas or peripheral malignancies, suggesting that miR-155 regulates different targets in B and T lymphocytes, and that the targets in T cells might not necessary be tumor suppressor genes. [score:10]
Mutation of miR-155 target site on the Itk transcript also impaired the miR-155 downregulating effects on the Luciferase-Itk-3′UTR expression (Figure 6B). [score:9]
In the wt setting, Ets1 and Itk up-regulation along iNKT cell thymic maturation is paralleled by a concomitant decrease in miR-155 levels (Figure 1B); in tg iNKT cells, which over-express miR-155 (Figure 1B), expression of Ets1 and Itk is instead consistently down-modulated at least in Stage 3. These results strongly suggest the existence of a regulatory function exerted by miR-155 over Ets1 and Itk in iNKT cell maturation. [score:9]
In Treg, miR-155 is directly regulated by FoxP3 and targets suppressor of cytokine signaling 1 (SOCS1), leading to increased sensitivity of IL-2R to IL-2 (14, 15). [score:7]
miR-155 over -expression also significantly reduced the expression of Luciferase-Ets1-3′UTR-M1 and Luciferase-Ets1-3′UTR-M2 constructs, each containing a single mutated miR-155 site, suggesting that each of the miR-155 target site in the Ets1 clone is functional. [score:7]
To determine whether the iNKT cell developmental defect caused by miR-155 over -expression is instead cell autonomous, we verified whether the development of miR-155 over -expressing iNKT cells could be rescued by wt thymocytes in mixed BM chimeras. [score:7]
To dissect the mechanisms by which miR-155 over -expression impairs iNKT cell differentiation, we first ruled out that miR-155 over -expression might somehow affect thymic expression of CD1d, the major presenting molecule involved in iNKT cell generation. [score:7]
Defective maturation of thymic NKT cells from Lck- miR-155 tg mice is cell intrinsicTo dissect the mechanisms by which miR-155 over -expression impairs iNKT cell differentiation, we first ruled out that miR-155 over -expression might somehow affect thymic expression of CD1d, the major presenting molecule involved in iNKT cell generation. [score:7]
To assess whether the regulation of miR-155 along iNKT cell maturation in the thymus is relevant for the development of these cells, we analyzed the effects of a sustained and prominent expression of miR-155 on iNKT cells development, taking advantage from the Lck- miR-155 transgenic (tg) mice (19). [score:6]
Although the over -expression of miR-155 in Lck- miR-155 mice does not cause a neoplastic transformation, several studies highlighted the importance of a regulated expression of this microRNA in both CD4 [+] and CD8 [+] T lymphocytes (28). [score:6]
The miR-155 target sites present on ITK-3′ -UTR and ETS1-3′ -UTR target site 1 and target site 2 (underlined) were mutated as indicated below (underlined and bold) using the shown corresponding primers. [score:6]
Figure 5iNKT cells over -expressing miR-155 fail to up-regulate Ets1 and Itk upon maturation. [score:6]
Our study reveals for the first time a novel mechanism of control in iNKT cell maturation process, which involves the physiological decrease of miR-155, such to ensure the up-regulation of its targets (Itk and Ets1), and therefore proper iNKT lymphocyte maturation. [score:6]
TGF-beta conditions intestinal T cells to express increased levels of miR-155, associated with down-regulation of IL-2 and Itk mRNA. [score:6]
Lck- miR-155 tg iNKT cells fail to up-regulate Ets1 and Itk upon maturationThe search for the potential miR-155 targets in iNKT cells identified Ets1 and Itk (inducible T cell kinase) molecules as the most likely candidates. [score:6]
Altogether, these data demonstrate that miR-155 directly targets Ets1 and Itk transcripts, and further establish miR-155 as a key regulator of iNTK differentiation. [score:5]
Surprisingly, we found that miR-155 over -expression deeply impacts iNKT cell development, a result that stresses the importance of tight regulation of miRNAs for their correct functioning. [score:5]
In contrast, in iNKT cells from Lck- miR-155 tg mice, Stage 1 cells have a four to sixfold higher expression of both transcripts compared to the wt counterparts, but their expression decreases upon maturation, resulting in a severe reduction of Ets1 and Itk expression in Stage 3 cell compared to wt cells. [score:5]
Lck- miR-155 tg mice thus represent the ideal mo del to study the significance of miR-155 down-regulation in iNKT cell development. [score:5]
Although in different cell types, both Ets1 (21) and Itk (22) have been shown to represent direct targets of miR-155 regulation. [score:5]
In conclusion, our study supports a novel regulatory role for miR-155 in the unique developmental program of iNKT cells and suggests that a dynamic regulation of miR-155 levels is critical for the physiology of these immunoregulatory cells. [score:5]
Compared to their wt counterparts, Stage 1 iNKT cells from Lck- miR-155 tg mice expressed sevenfold more miR-155, and expression was maintained at the same levels in Stage 2 and 3 (Figure 1B, gray bars). [score:4]
In conventional T cells, miR-155 is expressed at higher levels by CD4 [+] and CD8 [+] single positive (SP) cells than by CD4 [−]CD8 [−] double negative (DN) and CD4 [+]CD8 [+] DP thymocytes (Figure S1A in) and (20), indicating a different regulation exerted on and by miR-155 in iNKT and T cell subsets. [score:4]
Ets1 and Itk are direct miR-155 targets in iNKT cells. [score:4]
Lck- miR-155 tg iNKT cells fail to up-regulate Ets1 and Itk upon maturation. [score:4]
Figure 6Ets1 and Itk are direct targets of miR-155. [score:4]
Ets1 and Itk are direct miR-155 targets in iNKT cellsFunction and immune response activities of miR-155 are conserved in both mouse and human (27). [score:4]
As shown in Figure 4A, DP, CD4 [+], and DN thymocytes from Lck- miR-155 tg and wt mice expressed similar levels of CD1d. [score:3]
A moderate increase of miR-155 levels has been observed in many types of malignancies of B cell or myeloid origin, and some of us have shown that transgenic over -expression of miR-155 in mice results in cancer (18). [score:3]
Representative stainings and histograms summarizing iNKT cell frequency, absolute number, and NK1.1 [+] expression in liver (A), spleen (B) and bone marrow (C) of wt and Lck- miR-155 tg mice. [score:3]
It is also highly probable that the levels of miR-155 transgene expression under the Lck promoter did not reach the high levels reached by Eμ promoter in B cells. [score:3]
These effects were abolished when both putative miR-155 target seed sites were mutated on the Luciferase-Ets1-3′UTR (Figure 6A). [score:3]
miR-155 is processed by Dicer from BIC, a non-coding transcript highly expressed in B and T cells and in monocytes/macrophages. [score:3]
These results indicate that miR-155 over -expression in T cells arrests iNKT cell maturation at Stage 2 in the thymus and in the peripheral compartments, which results in an overall reduction of iNKT cells in periphery. [score:3]
We show that abundant and sustained expression of miR-155 in immature and mature T cells results in a dramatic defect in late-stage maturation of iNKT cells, and accordingly reduced number of iNKT cells in the peripheral compartments. [score:3]
Figure 4 miR-155 over -expression intrinsically affects iNKT cell maturation in Lck- miR-155 tg mice. [score:3]
In particular, it was demonstrated that in CD4 [+]Foxp3 [+] regulatory T cells, miR-155 regulate SOCS1, intervening in the loop that, starting from FoxP3 and through SOCS1, leads to a sustained IL-2R signaling, necessary for Treg homeostasis (14). [score:3]
We determined the expression of Ets1 and Itk transcripts in Stage 1, 2, and 3, iNKT cells isolated from wt and Lck- miR-155 tg mice. [score:3]
Figure 1 miR-155 expression in Stage 1, 2, and 3 wt and Lck- miR-155 tg iNKT cells. [score:3]
In these mice, the over -expression of miR-155 under the Eμ promoter caused uncontrolled pre-B cell proliferation followed by high-grade lymphoma/leukemia (18). [score:3]
The search for the potential miR-155 targets in iNKT cells identified Ets1 and Itk (inducible T cell kinase) molecules as the most likely candidates. [score:3]
These mice express miR-155 at high levels in T lymphocytes beginning at the DN stage (Figure S1B in), including iNKT cells. [score:3]
Our data from Lck- miR-155 tg mice phenocopy those obtained in Itk KO mice, and show opposite expression levels of miR-155 and ITK in developing iNKT cells. [score:3]
We identified two targets of miR-155 in iNKT cells: Ets1 and Itk. [score:3]
As determined by BrdU incorporation in vivo, miR-155 over -expression did not modify the proliferation of thymic iNKT cell in comparison with the wt counterpart (Figure S2 in). [score:3]
Moreover, in both Itk KO and Lck- miR-155 tg mice, CD8 SP cells display reduced CD1d expression; this finding has probably no functional meaning, but constitutes an additional indication of the actual interaction between miR-155 and Itk in thymocytes. [score:3]
On the contrary in miR-155 tg iNKT, the expression of both transcripts is impaired. [score:3]
Thus, impaired iNKT cell maturation caused by miR-155 over -expression could not be rescued by wt thymocytes; in addition, iNKT cells derived from wt BM developed correctly in the thymic stroma of Lck- miR-155 tg mice. [score:3]
For ETS1, the double mutant clone (ETS-1-M1, 2) was prepared on the clone were the first miR-155 target site was previously mutated. [score:3]
As iNKT cells are positively selected by DP thymocytes and no existing data prove a relevant role for CD8 [+] thymocytes in the selection and maturation of iNKT cells, we have reasons to believe that iNKT cell generation is not affected by impaired CD1d expression in CD8 [+] thymocytes in Lck- miR-155 tg mice. [score:3]
Interestingly, tg thymi were normal in total cell numbers (Figure 2A), but displayed alterations in the relative distribution of thymocytes in the DN, DP, and SP compartments (not shown), reasonably caused by miR-155 deregulation in developing tg thymocytes. [score:2]
Thymic and peripheral iNKT cell maturation is impaired in Lck- miR-155 miceWe then assessed miR-155 involvement in iNKT cell development by comparing thymus and peripheral organs of 8 weeks old wt and Lck- miR-155 tg mice, in terms of iNKT cell frequency, numbers, and phenotype. [score:2]
Along wt iNKT development both Ets1 and Itk are up modulated, mirroring the down-modulation of miR-155. [score:2]
The search for the relevant individual microRNA involved in Treg development and function identified micro -RNA155 (miR-155) as a key factor for Treg maintenance. [score:2]
The crucial role exerted by miR-155 in regulating lymphocyte biology was demonstrated in a B cell restricted miR-155 transgenic mouse mo del. [score:2]
The relative expression of miR-155 (compared to endogenous control small nuclear RNA U6) was higher in Stage 1, and decreased progressively in Stage 2 and Stage 3 iNKT cells (Figure 1B, white bars). [score:2]
We then assessed miR-155 involvement in iNKT cell development by comparing thymus and peripheral organs of 8 weeks old wt and Lck- miR-155 tg mice, in terms of iNKT cell frequency, numbers, and phenotype. [score:2]
Therefore, miR-155 critically regulates iNKT cell differentiation program. [score:2]
Function and immune response activities of miR-155 are conserved in both mouse and human (27). [score:1]
miR-155 is down-modulated along thymic iNKT cell maturationTo evaluate the expression of miR-155 in thymic iNKT cells at different stages of maturation, we sorted Stage 1, Stage 2, and Stage 3 iNKT cells from 8 weeks old wild-type (wt) C57BL/6 mice, according to PBS-57 -loaded CD1d-tetramers, TCRβ, NK1.1, and CD44 staining. [score:1]
Figure 2iNKT cells from Lck- miR-155 tg thymi display an immature phenotype. [score:1]
Lck- miR-155 tg mice were generated as previously described (19) and were provided by Dr. [score:1]
In light of these observations, we extended the study of miR-155 to iNKT lymphocytes. [score:1]
miR-155 is down-modulated along thymic iNKT cell maturation. [score:1]
To further validate that miR-155 modulates iNKT cell maturation through the targeting of Ets1 and Itk transcripts, the 3′UTRs of Ets1 and Itk were cloned downstream of Renilla luciferase gene and the effects of miR-155 were assayed on luciferase reporter assays. [score:1]
Lethally irradiated Lck- miR-155 tg mice were reconstituted with an equal mixture of BM cells derived from CD45.1 wt mice and CD45.2 Lck- miR-155 tg mice. [score:1]
Thymic and peripheral iNKT cell maturation is impaired in Lck- miR-155 mice. [score:1]
The defective down-modulation of Ets1 and Itk at the Stage 1 and 2 of miR-155 tg iNKT cells might be due to the presence of a shorter isoform of their 3′UTR that may occur during differentiation/maturation (26). [score:1]
Defective maturation of thymic NKT cells from Lck- miR-155 tg mice is cell intrinsic. [score:1]
Figure 3iNKT cells are reduced in peripheral organs of Lck- miR-155 tg mice. [score:1]
Lck- miR-155 recipient mice were lethally γ irradiated with 1000 cGy (given as a split dose 500 + 500 cGy with a 3-h interval). [score:1]
Beyond the above-described role in Treg function, miR-155 has gained attention for its role in cancer. [score:1]
MEG-01 cells were co -transfected with luciferase reporter constructs containing either the wild-type or the mutated (A) ETS1-, and (B) ITK1-3′UTRs and with either miR-155 or miR-Control (ctr) and assessed for luciferase activity (RLU) 48 h after the transfection (n = 10). [score:1]
Invariant natural killer T cells pooled from thymocytes from wt and Lck- miR-155 tg mice were sorted using a FACSaria (Becton Dickinson) as: HSA [−]TCRβ [+]tetramer [+]CD44 [lo]NK1.1 [−] Stage 1 cells,HSA [−]TCRβ [+]tetramer [+]CD44 [hi]NK1.1 [−] Stage 2 cells,HSA [−]TCRβ [+]tetramer [+]CD44 [hi]NK1.1 [+] Stage 3 cells. [score:1]
These data indicated that miR-155 is down-modulated along iNKT cell maturation, suggesting that miR-155 may be important for early events in iNKT cell lineage instruction, but becomes irrelevant or even detrimental for further maturation. [score:1]
As the effects of the microRNAs are often dose dependent this might explain the lack of leukemogenesis in Lck- miR-155 tg mice. [score:1]
White bars represent wt iNKT cells, gray bars represent Lck- miR-155 tg iNKT cells. [score:1]
In contrast, iNKT cells derived from the CD45.2 Lck- miR-155 BM cells mostly displayed an immature NK1.1 [-] phenotype. [score:1]
We propose that miR-155 acts in itself as a modulator of TCR strength signaling by modulating the levels of Itk and Ets1 and consequently modulating iNTK cell maturation. [score:1]
AB, PP, CC, and MC designed the study, AB, PP, ET, and AR performed research, SC generated the Lck- miR-155 tg mice. [score:1]
To evaluate the expression of miR-155 in thymic iNKT cells at different stages of maturation, we sorted Stage 1, Stage 2, and Stage 3 iNKT cells from 8 weeks old wild-type (wt) C57BL/6 mice, according to PBS-57 -loaded CD1d-tetramers, TCRβ, NK1.1, and CD44 staining. [score:1]
Collectively, these results indicate a cell-autonomous role for miR-155 in the control of iNKT cell differentiation. [score:1]
Cells from Lck- miR-155 tg mice were mixed at 1:1 ratio with CD45.2 wt cells. [score:1]
[1 to 20 of 85 sentences]
22
[+] score: 289
We performed in silico analysis of predicted and validated conserved mouse and human miR-155 targets (TargetScan and miRTarBase) along with targets expressed in lungs or described in respiratory or fibrotic diseases (Ingenuity Pathway Analysis database). [score:11]
ZNF652 was upregulated by hypoxia in IPF but not in normal lung fibroblasts (Fig E9, F) and in contrast to LXRα, the expression of ZNF652 correlated negatively with miR-155 expression (Fig E9, G), suggesting that under hypoxic stress, miR-155 may be preferentially bound by the increased ZNF652 leading to derepression of LXRα in IPF fibroblasts. [score:8]
miR-155 [−/−] fibroblasts had higher expression levels of Arg2 than did WT fibroblasts (Fig 3, I), and specific inhibition of Lxrα by siRNA restored Arg2 expression in miR-155 [−/−] fibroblasts to the normal levels of WT fibroblasts. [score:7]
LXRα expression and activity are increased in miR-155 [−/−] mice with lung fibrosisCompared with WT mice given PBS, the expression of Lxrα mRNA in lung tissue of WT mice given bleomycin was upregulated on day 1 and had normalized by day 7 (Fig 2, C). [score:7]
Upregulated Arg2 in miR-155 [−/−] macrophages and fibroblasts is normalized by inhibition of Lxrα by siRNA, or its activity by metabolic antagonism. [score:6]
miR-155 [−/−] mice developed exacerbated lung fibrosis, increased collagen deposition, collagen 1 and 3 mRNA expression, TGF-β production, and activation of alternatively activated macrophages, contributed by deregulation of the miR-155 target gene the liver X receptor (LXR)α in lung fibroblasts and macrophages. [score:6]
IPF lung fibroblasts also have constitutively more LXRα protein (and upregulated LXRα and ABCA1: IPF data repositories GSE2052 [33] and GEOD-24206 [34]), and greater LXR -dependent profibrotic activation that was normalized by miR-155 overexpression, LXRa gene silencing, or metabolic antagonism of LXRα activity using 22(S)HC. [score:6]
To investigate the factors that might regulate these changes, we established that bleomycin incubated in vitro with WT murine primary lung fibroblasts was sufficient to dose dependently downregulate the expression of precursor miR-155 at 8 hours (Fig 1, F) and mature miR-155 at 24 hours (see, A, in this article's Online Repository at www. [score:5]
This integrated approach identified target mRNAs (Table E2), including hypoxia and TGF-β pathways, 2, 21 among which we validated increased expression of Hif1a, Tgfβr2, and Smad1 mRNA in lung tissue of miR-155 [−/−] mice given bleomycin (see in this article's Online Repository at www. [score:5]
TGF-β, Transforming growth factor β. Expression of miR-155 is rapidly and transiently reduced in WT mice after bleomycin, associated with transient reciprocally increased Lxrα expression and protein, and the remo deling is self-limiting. [score:5]
The increased bronchoalveolar lavage cell counts in bleomycin -treated miR-155 [−/−] mice (Table E1) were predominantly macrophages with the repair -associated, alternatively activated (M2) phenotype (Fig 1, D) confirmed by increased arginase 2 (Arg2), chitinase, and IL-13 receptor α2 expression, whereas the expression of the classically activated macrophage (M1) phenotype marker, inducible nitric oxide synthase (Nos2), remained unchanged. [score:5]
Expression of miR-155 in mice given PBS remained constant, whereas in response to bleomycin, miR-155 expression decreased at day 1, increased at day 7, and normalized by day 18. [score:5]
[7] To test this hypothesis, we evaluated the expression of a validated miR-155 target ZNF652 [32] that contains 7 miR-155 binding sites (HumanTargetScan v7.0) in normal and IPF fibroblasts cultured in normoxia and hypoxia. [score:5]
Healthy human monocyte–derived macrophages were transfected with control siRNA or LXRα siRNA, each with miR-155 inhibitor or control inhibitor (Fig E5, C). [score:5]
The LXR agonist–induced increase in ARG2 expression was further increased by inhibition of miR-155, and this increase was restored to normal by LXRα-specific siRNA (see in this article's Online Repository at www. [score:5]
[31] Compared with normoxia, miR-155 expression was increased by hypoxia in both healthy and IPF fibroblasts (Fig E9, C); however, LXRα and ABCA1 expression was increased by hypoxia only in IPF fibroblasts (Fig E9, D), suggesting selective deregulation of LXRα function. [score:5]
• In the absence of miR-155 epigenetic control, LXRα activity is deregulated in mouse primary lung fibroblasts facilitating increased collagen and TGF-β production, and in macrophages enhancing alternative activation, each inhibited by LXR antagonism, LXRα gene silencing, or exogenous miR-155 mimic. [score:4]
• Primary IPF lung fibroblasts had constitutively raised LXRα, deregulated from miR-155, and their profibrotic phenotype was inhibited by LXR antagonism, LXRα gene silencing, or exogenous miR-155 mimic. [score:4]
The mechanism of this deregulation may be due to increased competitive miR-155 binding by other mRNA targets that contain multiple miR-155 seed-region binding sites. [score:4]
This deregulation might be mediated by several mechanisms, [38] including competition for available miR-155 by other targets with the AGCAUUAA seed-region [7] as validated in cancer cells. [score:4]
This suggested that there was tight posttranscriptional control of LXRα expression by homeostatic miR-155 in response to a stressor such as hypoxia in normal fibroblasts that was lost in IPF fibroblasts, potentially contributing to the deregulated LXRα activity. [score:4]
We describe herein a molecular pathway comprising miR-155 and its epigenetic LXRα target that when deregulated enables pathogenic pulmonary fibrosis. [score:4]
LXR may also exert profibrotic effects by similarly regulating TGF-β expression, and the excessively high concentrations of TGF-β produced in vitro by miR-155 [−/−] and IPF fibroblasts were normalized by LXR antagonism. [score:4]
B, miR-155 [−/−] fibroblasts show downregulation of LXRα protein after transfection with miR-155 mimic. [score:4]
The constitutive miR-155 expression in IPF fibroblasts was similar to that of control lung fibroblasts (Fig E9, B); therefore, we investigated whether the increased LXRα expression and activation in IPF fibroblasts was due to a deregulated interaction between miR-155 and LXRα. [score:4]
Together, these data demonstrate that the lack of epigenetic homeostatic regulation in miR-155 [−/−] mice was associated with a sustained increase in Lxrα expression and activity in response to bleomycin. [score:4]
This may reflect the dynamism of miR-155 expression in experimental IPF. [score:3]
MicroRNA-155 lung fibrosis liver X receptor fibroblasts alternatively activated macrophages Arg2, Arginase 2 Col, Collagen IPF, Idiopathic pulmonary fibrosis LXRα, Liver X receptor alpha miR-155, MicroRNA-155 3′UTR, 3-Prime untranslated region 22(S)HC, 22(S)-hydroxycholesterol WT, Wild-type Bleomycin -induced lung fibrosis was induced in miR-155 [−/−] and control mice as described. [score:3]
The relative expression levels of LXRα and miR-155 in normal and IPF lung fibroblasts cultured under normoxic conditions showed no significant correlation (Spearman ρ and 95% CI): normal fibroblasts r = 0.263 (−0.310 to 0.69) and IPF fibroblasts r = 0.439 (−0.072 to 0.767). [score:3]
miR-155 [−/−] fibroblasts produced higher concentrations of TGF-β than did WT fibroblasts and this increase was inhibited either by LXR antagonism (Fig 3, G) or by restoring miR-155 by transfection (Fig 3, H; see, B). [score:3]
Endogenous miR-155 targets human LXRα. [score:3]
We demonstrated that this increased Arg2 expression in miR-155 [−/−] macrophages was restored to normal by Lxrα-siRNA (Fig 2, K; see, A, in this article's Online Repository at www. [score:3]
Expression of Lxrα (G) and Abca1 (H) in lungs of WT and miR-155 [−/−] mice on day 18. [score:3]
Identifying mRNA targets under the epigenetic control of miR-155 was our strategy to identify cryptic pathways involved in lung fibrosis. [score:3]
Collagen (F) and TGF-β production (G and H) by miR-155 [−/−] fibroblasts was inhibited by 22(S)HC (Fig 3, G) and by miR-155 mimic (Fig 3, H). [score:3]
Bleomycin -induced lung fibrosis in wild-type and miR-155 [−/−] mice was analyzed by histology, collagen, and profibrotic gene expression. [score:3]
LXRα expression and activity are increased in miR-155 [−/−] mice with lung fibrosis. [score:3]
Prediction analysis identified LXRα as an miR-155 target in the lung. [score:3]
This in vivo expression pattern of Lxrα was reciprocal to that of miR-155 (Fig 1, E) in WT mice. [score:3]
Because constitutively increased LXRα expression (Fig 5, A) and activity contributed to IPF fibroblast phenotype, we investigated whether this was caused by altered serum concentrations of LXRα oxysterol ligands in patients with IPF or by altered miR-155 expression. [score:3]
We identified that in contrast to LXRα, its increased expression negatively correlated with miR-155 in IPF fibroblasts, suggesting that ZNF652 mRNA competitively bound miR-155 leading to derepression of LXRa. [score:3]
C and D, miR-155 [−/−] fibroblasts had greater migration capacity; partially inhibited by 22(S)HC, and (E) produced more collagen than did WT fibroblasts. [score:3]
[42] One strong miR-155 candidate target mRNA is ZNF652, which has 7 seed-region binding sites. [score:3]
Similarly, enforced expression of miR-155 reduced the profibrotic phenotype of IPF and miR-155 [−/−] fibroblasts. [score:3]
The mechanism of LXRα deregulation in IPF fibroblasts may be due to ineffective regulation by miR-155, which becomes apparent under hypoxic stress equivalent to the IPF lung environment. [score:3]
To explore the dynamics of the interaction between miR-155 and LXRα, we correlated the ratio of their relative expressions in normal and IPF lung fibroblasts. [score:3]
Fig 4Inhibition of LXR ameliorates lung fibrosis in miR-155 [−/−] mice. [score:3]
The expression of Col1a1, Col3a1, and Arg2 in lung tissues (C) and Arg2 (D) in BAL cells in miR-155 [−/−] mice was reduced by 22(S)HC. [score:3]
Under hypoxic conditions, the expression levels of miR-155 correlated negatively with LXRα in control lung fibroblasts, implying tight epigenetic control, whereas there was no equivalent engagement between miR-155 and LXRα in IPF fibroblasts, thus enabling continued LXRα autoactivation [41] and profibrotic behavior. [score:3]
The miR-155 [−/−]–associated increased lung tissue Col1a1, Col3a1, and Arg2, and the bronchoalveolar lavage cell Arg2 mRNA expression were also attenuated by 22(S)HC (Fig 4, C and D). [score:3]
[31] IPF and control lung fibroblasts had similar miR-155 expression when cultured under normal oxygen tensions. [score:3]
There was no change in response to IL-33, IL-25, or HMGB-1 (Fig E2, B), but IL-1α increased miR-155 expression (Fig E2, C). [score:3]
Thus, the dynamic expression of miR-155 in vivo may reflect a homeostatic role in inflammation and repair in response to tissue injury. [score:3]
Expression of miR-155 has been identified as increased [43] or reduced, [44] and serum miR-155 levels were normal [45] in IPF. [score:3]
[22] To confirm that endogenous miR-155 targets human LXRα mRNA, we used an MS2-TRAP RNA affinity purification assay. [score:2]
Consistent with the homeostatic molecular interaction between miR-155 and Lxrα mRNA, miR-155 [−/−] mice given bleomycin maintained higher levels of lung Lxrα expression compared with WT mice (Fig 2, G). [score:2]
Compared with WT cells, miR-155 [−/−] fibroblasts and macrophages had greater and constitutive expression of the LXR a reporter gene, Abca1 (Fig 2, I), suggesting that the LXRα pathway itself was constitutively activated. [score:2]
LXRα is deregulated from miR-155 in IPF lung fibroblasts. [score:2]
Together, these data suggest that LXRα -dependent regulation of ARG2 was governed by miR-155 in human and mouse macrophages. [score:2]
E, miR-155 is dynamically regulated by bleomycin in WT mice. [score:2]
org), suggesting that collagen synthesis, as the prime exemplar of the LXRα -dependent profibrotic function of IPF fibroblasts, can be regulated by miR-155. [score:2]
Fig 6Deregulation of the miR-155/LXRα axis contributes to exacerbated pulmonary fibrosis. [score:2]
To test whether the LXRα -dependent collagen production by IPF fibroblasts was regulated by miR-155, control and IPF fibroblasts were transfected with miR-155 and stimulated by synthetic LXR agonist GW3965 in vitro. [score:2]
Mouse mo dels and IPF lung fibroblasts had constitutively increased LXRα transcription when deregulated from homeostatic miR-155, associated with LXR -dependent excessive fibrotic phenotype mediated by increased TGF-β, arginase, and collagen production that could be mitigated by LXR antagonist (Fig 6). [score:2]
To extend this to human cells, we investigated the regulatory interrelationship between LXRα and miR-155 in the expression of ARG2 in human macrophages. [score:2]
Fig 2LXRα is regulated by miR-155. [score:2]
[40] The cryptic involvement of LXRα in fibrosis became apparent when deregulated in miR-155 [−/−] mice plus the stressor of bleomycin. [score:2]
F, Precursor (pre-)miR-155 is decreased in lung fibroblasts of WT mice (pooled n = 5) cultured with bleomycin. [score:1]
miR-155 [−/−] fibroblasts produced approximately 40-fold increased concentration of soluble collagen in culture than did WT fibroblasts in response to 3% FSC (Fig 3, E), which was normalized in a dose -dependent manner by 22(S)HC to concentrations produced by WT fibroblasts (Fig 3, F). [score:1]
We found no differences between any of the known LXRα ligands, 25, 26 suggesting that the increased activation of the Lxrα pathway in miR-155 [−/−] mice was due to normal activation of more available LXRα. [score:1]
[15] In contrast, miR-155 [−/−] mice have constitutively increased Lxrα and an exacerbated lung fibrosis, and this difference may provide novel insight into mechanisms of relentless lung remo deling. [score:1]
[17] Bleomycin or control PBS was given to miR-155 gene- deleted (miR-155 [−/−]) mice and WT controls. [score:1]
These observations indicate that excessive production of soluble collagen by miR-155 [−/−] fibroblasts may be due to an LXR -dependent increase in TGF-β and increased arginase -driven production of hydroxyproline. [score:1]
49, 50 This reflects the dual role of miR-155 driving chronic inflammation–associated pathologies and resolving fibrosis that we found aberrant in IPF. [score:1]
A, miR-155 binds to human LXRα. [score:1]
miR-155 [−/−] lung fibroblasts and macrophages have an LXR -dependent profibrotic phenotype. [score:1]
Fig 1Deficiency of miR-155 exacerbates experimental mo del of pulmonary fibrosis. [score:1]
Together, these data demonstrate that miR-155 deficiency exacerbated the pulmonary fibrotic response to bleomycin. [score:1]
The exacerbated bleomycin -induced lung fibrosis in miR-155 [−/−] mice is LXR -dependentTo test the involvement of LXR in experimental lung fibrosis, miR-155 [−/−] and WT mice were given bleomycin or control PBS, and treated with the LXR antagonist 22(S)HC or control cyclodextrin excipient. [score:1]
To mimic the effect of exposure to cytokines generated in the damaged lung, 17, 18 miR-155 expression was measured in WT murine primary lung fibroblasts incubated with exogenous alarmins IL-33, [17] IL-25, [19] IL-1α, [18] or High mobility group box 1 (HMGB-1) [20] released in response to injury. [score:1]
HEK293 were transfected with either empty vector (pmiRGLO-MS2BD) or miR-155 sponge (pmiRGLO-MS2BD-miR155Sp) or 3′UTR-LXRα (pmiRGLO-MS2BD-LXRα WT), or MS2 mutated in MRE 3′UTR-LXRα (pmiRGLO-MS2BD-Lxrα-MT), and miR-155 captured in the immunoprecipitate quantified by quantitative PCR. [score:1]
I, Arg2 was higher in miR-155 [−/−] than in WT fibroblasts and this was reduced by LXRα siRNA. [score:1]
B, Lung collagen deposition (turquoise staining) in miR-155 [−/−] mice (n = 8). [score:1]
To test the involvement of LXR in experimental lung fibrosis, miR-155 [−/−] and WT mice were given bleomycin or control PBS, and treated with the LXR antagonist 22(S)HC or control cyclodextrin excipient. [score:1]
•The exacerbated bleomycin -induced pulmonary fibrosis in miR-155 [−/−] mice was mitigated in vivo by LXR antagonism. [score:1]
[16] Experimental interventions included transfecting cells with miR-155 mimic or LXRα siRNA, or incubating with LXR agonist/antagonist or various alarmins. [score:1]
The subsequent loss of body weights for miR-155 [−/−] and WT mice is shown on different panels for clarity in Fig 4, A. The exacerbated bleomycin -induced weight loss in miR-155 [−/−] mice was mitigated by treatment with 22(S)HC to the weight loss seen in WT mice given bleomycin, as was the exacerbated lung tissue collagen deposition (Fig 4, B), and the inflammatory bronchoalveolar lavage cytology (see in this article's Online Repository at www. [score:1]
A, miR-155 [−/−] fibroblasts showed higher proliferation in response to FCS (%S) than did WT fibroblasts (pooled lungs of 4 mice). [score:1]
C, miR-155 [−/−] bleo mice show an increase in lung Col1a1 and Col3a1 mRNA. [score:1]
The empty vector and a construct containing a tandem of 9 miR-155 binding sites (ie, an miR-155 “sponge”) were used as negative and positive controls, respectively. [score:1]
These data demonstrate that the exacerbated inflammatory and fibrotic response to bleomycin in miR-155 [−/−] mice is at least partly dependent on LXRα and tractable in vivo by LXR antagonism. [score:1]
B, LXR antagonist 22(S)HC reduced the proliferation of miR-155 [−/−]. [score:1]
LXRα has a conserved 3′UTR seed-region sequence (GCAUUAA) complementary to miR-155; therefore, we highlighted this as a potential novel pathway to pathogenic fibrosis and this provides the basis of our study. [score:1]
• Deficiency of miR-155 exacerbates bleomycin -induced experimental pulmonary fibrosis. [score:1]
Weight loss (A) and collagen deposition (B) (turquoise) in miR-155 [−/−] mice was mitigated by 22(S)HC. [score:1]
After 24-hour culture, cytosolic LXRα protein concentrations (Fig 2, B) were reduced 60% by miR-155. [score:1]
We next investigated the kinetics of lung tissue miR-155 expression in WT mice given bleomycin (Fig 1, E). [score:1]
miR-155 [−/−] fibroblasts displayed greater proliferation to serum supplementation than did WT fibroblasts (Fig 3, A), which was restored to the normal proliferation observed in WT cells by the LXR antagonist 22(S)HC in a dose -dependent manner (Fig 3, B). [score:1]
14, 15 Mouse lung fibroblasts and macrophages were derived from wild-type (WT) and miR-155 [−/−] mice by lung digestion followed by fluorescence-activated cell sorting. [score:1]
Together, these findings support a functional interaction between miR-155 and LXRa mRNA. [score:1]
The exacerbated bleomycin -induced lung fibrosis in miR-155 [−/−] mice is LXR -dependent. [score:1]
[24] We showed previously that miR-155 [−/−] mice have higher serum cholesterol concentrations while on a high fat diet [22]; therefore, to test whether different oxysterol concentrations in miR-155 [−/−] mice treated with bleomycin were responsible for the Lxra activation and exacerbated lung fibrosis, we profiled serum oxysterols using mass spectrometry (Table E3). [score:1]
To confirm and extend this observation, we reintroduced miR-155 into miR-155 [−/−] murine lung fibroblasts by transfection with a synthetic miR-155 mimic. [score:1]
In miR-155 [−/−] macrophages, this was associated with an increased profibrotic (M2) phenotype characterized by increased expression of Arg2, a key enzyme controlling the bioavailability of hydroxyproline for collagen synthesis [27] (Fig 2, J). [score:1]
Fig 3The phenotype of miR-155 [−/−] lung fibroblasts is driven by LXR. [score:1]
We next explored whether miR-155 influenced the profibrotic function of fibroblasts in an LXRα -dependent manner. [score:1]
Because the consequence of LXR a deregulation resulting in exacerbated lung fibrosis became apparent in miR-155 [−/−] mice only when stressed with bleomycin, we compared the dynamic interaction between miR-155 and LXRα in control and IPF fibroblasts cultured under the hypoxic stress (1% O [2]) that mimics the lung environment in IPF. [score:1]
The pathogenesis and clinical features of the autoimmune and inflammation -driven lung pathology of systemic sclerosis differs from IPF [48] and 2 recent studies describe a pathogenic role for miR-155 in the experimental skin and lung fibrosis associated with systemic sclerosis. [score:1]
Experimental pulmonary fibrosis is exacerbated by miR-155 deficiency. [score:1]
Manipulation of the miR-155/LXR pathway may have therapeutic potential for IPF. [score:1]
[1 to 20 of 110 sentences]
23
[+] score: 288
Four chimera groups were generated: WT → WT (WT cells expressing CD45.2 into WT mice expressing CD45.1), miR-155 [−/−] → WT (miR-155 [−/−] cells expressing CD45.2 into WT mice expressing CD45.1), WT → miR-155 [−/−] (WT cells expressing CD45.1 into miR-155 [−/−] mice expressing CD45.2), and miR-155 [−/−] → miR-155 [−/−] (miR-155 [−/−] cells expressing CD45.2 into miR-155 [−/−] mice expressing CD45.2). [score:17]
Assuming that miR-155 deficiency increases the expression of its direct targets, we compared the expression of 84 miR-155 target genes in colon tissues after establishment of DSS colitis. [score:9]
As miR-155 is a well-studied miRNA with a plethora of targets identified, we used a candidate approach to identify its target genes in macrophage polarization, with the following criteria: (1) prediction or experimental validation as targets of miR-155; and function as (2) negative regulator of M2 and positive regulator of M1. [score:9]
The expressions of 84 target genes of miR-155 were determined by the Mouse miR-155 Targets RT [2] Profiler PCR Array (Qiagen). [score:7]
C/EBPβ knockdown (Figure S12A in) in miR-155 [−/−] BMDMs led to substantially reduced M2 gene expression and modestly increased M1 gene expression (Figure 6D). [score:6]
From the perspective of evolution, the miR-155 gene may have evolved as protection against infectious disease, fitting with its related upregulation in modern-day organisms. [score:6]
It has also been shown that miR-155 may aggravate colitis (13) by directly inhibiting Th17 cell differentiation in CD4 [+] T cells (14) or by regulating IL-10-producing B cells (15). [score:5]
At 48 h after the antagomir-155 injection, miR-155 expression was efficiently silenced in intestinal tissues and colon immune cells (Figure 7B); meanwhile, C/EBPβ and SOCS1 protein expression was increased in the colon (Figure 7C). [score:5]
Notably, there might be a positive link between miR-155 and IL-10 in macrophages, as IL-10 inhibits miR-155 induction (46), while miR-155 suppresses IL-10 production (47). [score:5]
Notably, many of these regulatory mechanisms are fine-tuned by the multifaceted regulator miR-155, which is expressed in a variety of immune cell types. [score:5]
C/EBPβ, a direct target of miR-155 in macrophages and a key regulator of M2 polarization (30), was among the most increased genes in miR-155 [−/−] mice after DSS exposure (vs WT; Figure 3A), implicating macrophages and their M2 polarization in miR-155 deletion -mediated protection. [score:5]
We found that miR-155 [−/−] BMDMs showed reduced expression of M1 genes and strongly increased expression of M2 genes (vs WT; Figure 6A). [score:5]
miR-155 [−/−] Macrophages Inhibit Inflammatory Cells and Establish a Th1/Th17-Suppressive Environment. [score:5]
miR-155 [−/−] Macrophages Inhibit Inflammatory Cells and Establish a Th1/Th17-Suppressive EnvironmentWe next examined how miR-155 [−/−] macrophages influence the pathogenesis of colitis. [score:5]
In IBD, miR-155 is upregulated in inflamed lesions of patients with active UC (10, 11). [score:4]
This is probably due to the differential role of DCs and macrophages (17) in colon mucosal immunity or to the distinguished regulatory mechanisms and targets (44) of miR-155 in DCs and macrophages. [score:4]
Two genes (SOCS-1and SHIP-1) met the criteria, and both were up-regulated in the miR-155 [−/−] BMDMs (Figure 6E). [score:4]
miR-155 [−/−] Intestinal Macrophages Are Prone to M2 Phenotype in DSS-Induced ColitisPrompted by the sharp upregulation of the M2 polarization -associated transcription factor, C/EBPβ, in colon of miR-155 [−/−] mice with acute colitis, we hypothesized that the alternative activated M2 phenotype might represent the predominant macrophages in miR-155 [−/−] colon. [score:4]
To further determine whether macrophages in the miR-155 deficient mice were sufficient to achieve protection similar to that seen in miR-155 global knockout in DSS -induced colitis, miR-155 [−/−], or WT BMDMs were adoptively transferred into WT recipients, and disease severity was examined. [score:4]
Prompted by the sharp upregulation of the M2 polarization -associated transcription factor, C/EBPβ, in colon of miR-155 [−/−] mice with acute colitis, we hypothesized that the alternative activated M2 phenotype might represent the predominant macrophages in miR-155 [−/−] colon. [score:4]
Colon lamina propria macrophages (CD11b [+]CD11c [−/low]) sorted from DSS challenged miR-155 [−/−] mice showed significantly upregulated C/EBPβ (vs WT; Figure 6C). [score:4]
While in the absence of miR-155, two target genes C/EBPβ and SOCS1 in Ly6C [hi] monocytes are unregulated and functional. [score:4]
We next examined whether small interfering (si)RNA -mediated knockdown of C/EBPβ expression could rescue the phenotype of miR-155 [−/−] macrophages under M1-like condition (CBA/IFN-γ treatment). [score:4]
The colonic explants from miR-155 [−/−] mice expressed significantly lower amounts of inflammatory cytokines and increased amounts of anti-inflammatory cytokines (Figures S5A,B in). [score:3]
At the molecular level, we identified C/EBPβ and SOCS1 as two primary functional targets of miR-155 in macrophage polarization in inflamed conditions. [score:3]
Thus, SOCS-1 is another miR-155 target involved in macrophage polarization, and it might primarily serve to mediate inaction of M1 genes. [score:3]
In conclusion, our study, which used a rational approach based on anti-mir-155, suggests that specific targeting of macrophages may achieve ideal therapeutic effects in intestinal inflammation. [score:3]
Bone marrow cells were harvested by flushing femurs and tibias from WT and miR-155 [−/−] mice that expressed either CD45.1 or CD45.2. [score:3]
To determine their role in miR-155 [−/−] mice colitis, we generated bone marrow chimeras to assess the target cell type of miR-155 function. [score:3]
We further identified more targets of miR-155 involved in macrophage polarization. [score:3]
Reduced Innate and Adaptive Immunity in Colon of miR-155 [−/−] in Acute ColitismiR-155 expression was significantly increased in mouse colon tissues, IECs and LPMCs (Figure S1A–C in) during DSS -induced colitis, as well as in human UC colon tissue (Figure S1D in). [score:3]
These data suggest that miR-155 [−/−] macrophages can establish a Th1/Th17-suppressive environment. [score:3]
Accordingly, just as a double-edged sword, miR-155 can be harmful in inflammatory diseases, such as colitis. [score:3]
Generation of Bone Marrow ChimericBone marrow cells were harvested by flushing femurs and tibias from WT and miR-155 [−/−] mice that expressed either CD45.1 or CD45.2. [score:3]
miR-155 expression was significantly increased in mouse colon tissues, IECs and LPMCs (Figure S1A–C in) during DSS -induced colitis, as well as in human UC colon tissue (Figure S1D in). [score:3]
Our data demonstrated that the colon of miR-155 [−/−] mice displayed promoted M2 genes and reciprocally inhibited M1 genes in DSS colitis. [score:3]
Figure S1Expression level of miR-155 is increased in colon tissue of UC patients and mice treated with dextran sulfate sodium (DSS). [score:3]
Indeed, PEG2 phosphorylation (48) of CREB leads to increased transcription of C/EBPβ, a primary functional target of miR-155 in M2 polarization. [score:3]
miR-155 is frequently expressed in multiple immune cell types and has pronounced effects on each cells’ functions and phenotypes. [score:3]
Cytokine PCR Array and miR-155 Target Array. [score:3]
Figure 3Macrophages play a critical role in miR-155 deficiency -mediated suppression of dextran sulfate sodium (DSS) -induced colitis. [score:3]
To determine the mechanism underlying the proclivity of miR-155 [−/−] macrophages to M2 polarization in this context, we first examined the protein levels of C/EBPβ, which is a target of miR-155 in M2 polarization (38). [score:3]
Thus, C/EBPβ is a key target of miR-155 in macrophage polarization, but is only partially responsible for miR-155 effects. [score:3]
However, mice that received adoptively transferred miR-155 [−/−] BMDCs or WT BMDCs exhibited a similar degree of decreased disease activity following DSS exposure (Figures 3H–I). [score:3]
Figure 5miR-155 [−/−] macrophages inhibit inflammatory cells and shape Th1/Th17 polarization (A,B) WT (n = 5) mice with dextran sulfate sodium (DSS) colitis were adoptive transferred with miR-155 [−/−] BMDMs or WT BMDMs (5 million/mouse) as schematic protocol indicated. [score:3]
miR-155 Knockdown In Vivo by Antagomir. [score:2]
Indeed, recipients of miR-155 [−/−] BMDMs showed significantly reduced disease activity compared to mice that received WT BMDMs (Figures 3E–G). [score:2]
We previously demonstrated that miR-155 in IECs acts as a negative regulator of intestinal innate tolerance during weaning transition (41). [score:2]
Moreover, in vitro assays showed that miR-155 [−/−] macrophages exerted a great inhibitory effect on T cell proliferation (Figure 5E). [score:2]
Thus, the colonic M2 macrophages of miR-155 [−/−] mice might differentiate directly from circulating Ly6C [hi] monocytes in DSS -induced colitis. [score:2]
miR-155 Knockdown In Vivo by Antagomir Antagomirs are single-stranded oligonucleotides used to silence endogenous miRNAs. [score:2]
We observed in naïve CD4 [+] T cells that adding supernatants from miR-155 [−/−] led to decreased frequency of Th17 and Th1 cells compared to that from WT (Figure 5F), indicating that miR-155 [−/−] BMDMs secrete factors to suppress CD4 [+] T cells polarized toward IFN-γ- producing Th1 cells and IL-17-producing Th17 cells. [score:2]
In adaptive immune responses, miR-155 regulates the differentiation and functions of Treg, Th17, CD8 [+] T cells (4), and T follicular helper cells (5) intrinsically. [score:2]
We found that miR-155 functions as a strong regulator of macrophage polarization in colitis and that its deficiency can lead to a shifting from M1 to M2. [score:2]
Thus, in the miR-155 [−/−] mice, blood Ly6C [hi] monocytes might be recruited to the colon and differentiated toward an M2 phenotype through PEG2 in DSS -induced colitis. [score:1]
In both conditions, the differentiated cells from miR-155 [−/−] monocytes showed higher M2-like phenotype (vs cells from WT; Figure S10 in). [score:1]
In DCs, miR-155 has been characterized as a negative regulator of innate immune responses (6, 7), while in macrophages, miR-155 functions as a pro-inflammatory regulator by affecting NF-κB signaling (8) or by promoting M2 polarization (9). [score:1]
Collectively, these observations suggest that in DSS -induced colitis, miR-155 [−/−] in mice results in reductions in both innate immunity and adaptive immunity in the intestine. [score:1]
Next, peripheral blood Ly6C [hi] monocytes of miR-155 [−/−] mice were depleted in vivo via i. v. injection of anti-CCR2 MC21 depleting mAbs. [score:1]
Thus, these results indicate that miR-155 deficient in mucosal immune cells that were derived from hematopoietic cells rather than in non-hematopoietic cells, accounted for the observed reduction in colonic inflammation in the miR-155 [−/−] mice. [score:1]
We observed that prostaglandin E2 (PEG2; an M2 polarization inducer) (33, 34) was markedly elevated in serum of both WT and miR-155 [−/−] mice from DSS challenge day 2 (Figure 4E). [score:1]
Figure 1Attenuated dextran sulfate sodium (DSS) -induced colitis in miR-155 [−/−] mice is dependent on commensal bacteria. [score:1]
Cg-Mirn155tm1.1Rsky/J (miR-155 [−/−]), and CD45.1 [+] B6 mice were purchased from Jackson Laboratory and housed under specific pathogen-free conditions. [score:1]
However, in the absence of miR-155, they might differentiate into cells with an anti-inflammatory M2-like phenotype, with function similar to tissue-resident macrophages (17). [score:1]
Yet, others have reported that miR-155 [−/−] mice have more resistance to DSS -induced colitis. [score:1]
Anti-miR-155 Treatment Ameliorates DSS-Induced Acute Colitis In Vivo. [score:1]
WT (n = 10) or miR-155 [−/−] (n = 10) mice were given 3% dextran sulfate sodium (DSS) in drinking water for 5 days, followed by regular drinking water for 6 days (DSS condition) or regular drinking water for 11 days (water condition). [score:1]
The BMDMs were detached using 10 mmol/L EDTA in PBS, washed 3 times with saline, and intravenously injected at 5 million cells/mouse into WT or miR-155 [−/−] mice at indicated time points. [score:1]
WT (n = 3) or miR-155 [−/−] (n = 3) mice were given 3% DSS in drinking water for 5 days, followed by regular drinking water for 6 days. [score:1]
Recipient mice were sublethally irradiated twice (8 Gy, 2 h apart), then bone marrow cells (2 million cells/mouse) were tail vein -injected into WT and miR-155 [−/−] mice. [score:1]
Moreover, DSS -treated miR-155 [−/−] mice showed a lower frequency of Th17 and Th1 cells in the lamina propria (vs DSS -treated WT; Figures 1I,J). [score:1]
Body weight changes (F) and DAI (G) of WT mice with transferred WT or miR-155 [−/−] BMDMs were monitored throughout the study. [score:1]
Effects of miR-155 During Acute Colitis Are Predominately Attributed to Its Function in Macrophages. [score:1]
These data, together with the indicated central role (Figure 8) of macrophages in miR-155 -mediated protection of acute colitis, collectively support the therapeutic potential of anti-miR-155 based treatment in colitis. [score:1]
Lack of miR-155 in Hematopoietic Cells, Rather Than in Non-Hematopoietic Cells, Recapitulates the Phenotype of Global miR-155 Deletion. [score:1]
In both conditions, (A) WT or miR-155 [−/−] mice were fed with FITC-dextran, and FITC-dextran amounts in serum were determined 3 h later. [score:1]
Bone marrow cells isolated from femurs and tibias of WT and miR-155 [−/−] mice were depleted of erythrocytes and seeded in petri dishes (2 × 10 [5]/mL). [score:1]
Collectively, we highlight the role of M2 macrophages in miR-155 -mediated orchestration of the intestinal immune response and intestinal inflammation. [score:1]
Researchers who produced miR-155 [−/−] mice observed that a proportion of miR-155 [−/−] mice develop spontaneous enteric inflammation (12), implying that miR-155 [−/−] mice are more susceptible to colitis. [score:1]
miR-155 [−/−] Intestinal Macrophages Are Prone to M2 Phenotype in DSS-Induced Colitis. [score:1]
The miR-155 [−/−] mice showed significant protection from DSS -induced colitis (vs WT mice), according to body weight loss, survival, rectal bleeding, colon length and histopathology (Figures 1A–E, respectively). [score:1]
Thus, these results suggest that miR-155 [−/−] macrophages can dampen the proliferation of immune cells that contribute to colitis. [score:1]
Thus, miR-155 activity in macrophages is primarily responsible for its effect in reducing severity of DSS -induced acute colitis. [score:1]
In contrast, in the miR-155 [−/−] mice, when macrophages were depleted via clodronate-liposomes, the cell numbers increased (Figures 5C,D). [score:1]
To examine the effect of miR-155 [−/−] macrophages on T cell differentiation, OT-II CD4 [+] T cells labeled with carboxyfluorescein succinimidyl ester (commonly known as CFSE) were incubated in vitro and added to cell culture supernatants of BMDMs from WT and miR-155 [−/−] mice, respectively. [score:1]
Figure S4No significant difference in epithelial permeability, epithelial cell proliferation or apoptosis between WT and miR-155 [−/−] mice. [score:1]
miR-155 [−/−] mice had lower number of LPMCs (CD45 [+]) (Figure 1G), in which CD4 [+] and CD8 [+] T cells were reduced and macrophages (CD11b [+]CD11c [−/low]) and DCs (CD11c [+]CD11b [−]) were not significantly affected (Figure 1H). [score:1]
, and Enterobacteriaceae) [25] in stool of WT and miR-155 [−/−] mice were similar between the mice (Figure S3 in). [score:1]
Figure 8The proposed mechanism of miR-155 in the pathogenesis of dextran sulfate sodium (DSS) -induced colitis. [score:1]
The representative FACS shows the frequency of F4/80 [+] positive macrophages from both WT and miR-155 [−/−] mice. [score:1]
We next examined whether the phenotype in miR-155 [−/−] mice was dependent on commensal bacteria. [score:1]
Indeed, M2 -associated genes (Arg1, IL-10, Fizz1, and Mrc1) were increased and M1 -associated genes (IL-1β, IL-6, IL-12, and TNF-α) were decreased in colons of DSS colitis miR-155 [−/−] mice (Figures 4A,B). [score:1]
Moreover, absolute quantification of the amount of M2 and M1 gene products (represented by the secreted cytokines IL-10 and IL-12, respectively) by using ELISA showed that, even under M1-like polarization condition, BMDMs from miR-155 [−/−] mice can produce higher M2-related factors but with lower M1-related factors (vs WT; Figure 6B). [score:1]
We found that pre-depletion of microbiota by broad-spectrum antibiotics abolished the observed phenotype of miR-155 [−/−] mice (becoming comparable to that of WT), as assessed by body weight loss and DAI (Figure 1F). [score:1]
ns (miR-155 [−/−] BMDCs → WT) vs (WT BMDCs → WT) (Student’s t-test). [score:1]
WT mice (n = 12) and miR-155 [−/−] (n = 13) mice and were subjected to rectal injection of TNBS and body weight (A) and survival (B) were monitored. [score:1]
Anti-miR-155 Treatment Ameliorates DSS-Induced Acute Colitis In VivoThe phenotypic observations in miR-155 [−/−] mice indicated the prophylaxis potential of anti-miR-155 in acute colitis; thus, we further examined the role of anti-miR-155 in the therapeutic context by using antagomirs (39) (Figure 7A). [score:1]
To determine whether the anti-inflammatory M2 macrophages in miR-155 [−/−] mice were derived from this precursor cell type, the blood Ly6C [hi] monocytes (CD45 [+]CD115 [+]Ly6G [-]Ly6C [hi]) (32) (Figure S9 in) were sorted and differentiated into M1 (via 10 µg/mL CBA (26) and 20 ng/mL IFN-γ) and M2 (via 15 ng/mL IL-4) populations in vitro. [score:1]
The miR-155 deficiency forced M2-like dominant macrophages in lamina propria to shape the colon environment and condition the proliferation and polarization of T cells, which facilitated the maintenance of intestinal homeostasis and resolved the pathogenesis of DSS -induced colitis. [score:1]
Figure S3Analysis of microbiota composition in WT and miR-155 [−/−] mice. [score:1]
Since our data show that miR-155 is required for circulating monocytes to differentiate into pro-inflammatory macrophages, we speculate that in acute colitis, monocytes recruited to the colon differentiate into inflammatory phenotypes under inflamed conditions. [score:1]
Stool genomic DNA of 8-week-old WT and miR-155 [−/−] mice was extracted and numbers of total bacteria, Enterobacteriaceae bacteria (Ent), the E. rectale–C. [score:1]
The LPMCs were isolated from colon tissues of DSS -treated WT (n = 12) and miR-155 [−/−] (n = 15) mice, then the total number of LPMCs (CD45 [+]) (G), T cells (CD4 [+] and CD8 [+]), DCs (CD11c [+]CD11b [−]) and macrophages (CD11b [+]CD11c [−/low]) (H) were counted by flow cytometry. [score:1]
In Vitro Induction of BMDMs or MonocytesWT and miR-155 [−/−] mature adherent BMDMs or sorted Ly6C [hi] monocytes were primed with fresh medium and then treated with 10 µg/mL cecal bacterial antigen (CBA) and 20 ng/mL interferon (IFN)-γ or 15 ng/mL recombinant IL-4 (Peprotech) for 10 h. CBA was prepared using C57Bl6 mice as previously described, with minor modifications (26). [score:1]
The body weight loss and DAI features of macrophage -depleted miR-155 [−/−] mice (by clodronate-liposome treatment, Figure S8 in) (31) in colitis were similar to those in WT mice (Figures 3B–D), demonstrating that macrophage depletion abrogates the effects of miR-155 in acute colitis. [score:1]
We next examined how miR-155 [−/−] macrophages influence the pathogenesis of colitis. [score:1]
PBMCs of the chimeric mice stained with anti-CD45.1-APC (for WT mice) and anti-CD45.2-FITC (for miR-155 [−/−] mice) detected by FACS. [score:1]
WT and miR-155 [−/−] mature adherent BMDMs or sorted Ly6C [hi] monocytes were primed with fresh medium and then treated with 10 µg/mL cecal bacterial antigen (CBA) and 20 ng/mL interferon (IFN)-γ or 15 ng/mL recombinant IL-4 (Peprotech) for 10 h. CBA was prepared using C57Bl6 mice as previously described, with minor modifications (26). [score:1]
To determine, in DSS -induced colitis, whether the observed decline in total numbers of LPMCs in miR-155 [−/−] mice (vs that in WT mice) were ascribable to M2 gene induction, we performed adoptive transfer of miR-155 [−/−] BMDMs into WT mice with DSS colitis and found that the total number of inflammatory cells was markedly reduced (vs WT BMDMs transfer; Figures 5A,B). [score:1]
We found the MC21 -treated miR-155 [−/−] mice showed more severe DSS colitis (vs untreated; Figure 4D). [score:1]
The M2 macrophage phenotype caused by miR-155 deficiency is able to further dampen intestinal inflammation by affecting adaptive effectors cells in colon lamina propria. [score:1]
Total RNA from the colons of WT and miR-155 [−/−] mice (n = 3) was prepared using the TRIzol reagent (Invitrogen). [score:1]
Besides, we also carefully monitored the colitis symptoms of miR-155 [−/−] mice throughout their life, under long-term SPF and dirty conditions, without observing spontaneous enteric inflammation (12). [score:1]
Reduced Innate and Adaptive Immunity in Colon of miR-155 [−/−] Mice in Acute Colitis. [score:1]
Irradiated C57BL/6 mice were transplanted with bone marrow from WT (WT → WT) or miR-155 [−/−] (miR-155 [−/−] → WT), and irradiated miR-155 [−/−] mice were transplanted with that from WT (WT → miR-155 [−/−]) or miR-155 [−/−] mice (miR-155 [−/−] → miR-155 [−/−]), respectively (Figure 2A). [score:1]
ns, not significant, miR-155 [−/−] → WT mice vs miR-155 [−/−] → miR-155 [−/−]. [score:1]
We speculated that a mixture of polarization phenotypes co-exists in the colon under M1-like conditions of DSS -induced colitis, and that miR-155 deficiency renders the dynamic equilibrium shift to M2 (Figure 8). [score:1]
In spite of PGE2 contributing to the initiation of M2 macrophage polarization, we speculate that Th2 cytokines, such as IL-4, may further facilitate M2 polarization in the late stage of colitis in miR-155 [−/−] mice, as miR-155 [−/−] CD4+ T cells were intrinsically more prone to polarize toward Th2 cells with amplified Th2 cytokine production (12). [score:1]
WT or miR-155 [−/−] mice were given 3% DSS in drinking water for 5 days, followed by regular drinking water for 6 days. [score:1]
The similar results obtained from the 2,4,6-trinitrobenzene sulfonic acid colitis mo del excluded a mo del-specific effect of miR-155 in acute colitis (Figure S2 in). [score:1]
The phenotypic observations in miR-155 [−/−] mice indicated the prophylaxis potential of anti-miR-155 in acute colitis; thus, we further examined the role of anti-miR-155 in the therapeutic context by using antagomirs (39) (Figure 7A). [score:1]
The miR-155 [−/−]→ WT mice with hematopoietic miR-155 deficiency showed attenuated severity of DSS -induced colitis similar to miR-155 [−/−] → miR-155 [−/−] mice, based on body weight loss, DAI, colon length and pro-inflammatory cytokine levels in the colon (Figures 2B–E, respectively, and Figure S7 in). [score:1]
However, neither permeability nor apoptosis or proliferation (Figure S4A–C in) was observed to differ significantly, suggesting that miR-155 may not contribute to DSS -induced colitis through non-immune mechanisms. [score:1]
PEG2, rather than IL-4 or IL-13, was found in this study to play a critical role in potentiating the anti-inflammatory M2 phenotype in the early stage of colitis in miR-155 [−/−] mice. [score:1]
However, the role of miR-155 in colitis is controversial. [score:1]
In contrast, the WT → miR-155 [−/−] mice, having miR-155 deficiency in non-hematopoietic cells, developed more severe colitis than the miR-155 [−/−]→ miR-155 [−/−] mice based on the same parameters. [score:1]
In innate immunity, the role of miR-155 is conflicting. [score:1]
Thus, the miR-155 -mediated colitis phenotype is driven by microbiota but not via alteration of its composition. [score:1]
[1 to 20 of 128 sentences]
24
[+] score: 284
Similar results (IL-6, TNF-α) were obtained from LPS-activated DCs after miR-155 knockdown [32] also several other studies showed that miR-155 has a pro-inflammatory role in microglia and is necessary for the progression of the immune response through the modulation of SOCS-1 (suppressor of cytokine signalling 1) an inducible negative feedback inhibitor of JAK/STAT signaling pathway [33], [34] also Ana L. Cardoso found that F. n. induces miR-155 expression and leads to down-regulation of SHIP (one of the key regulators the PI3K/Akt pathway), resulting in enhanced pro-inflammatory responses. [score:12]
To determine if miR-155 specifically attenuates MAP3K10 expression, the endogenous MAP3K10 mRNA levels were measured through qPCR after the transfection of miR-155 inhibitor or mimic in PMA -induced THP-1. The inhibition of miR-155 expression with miR-155 inhibitor increased, whereas miR-155 expression with miR-155 mimic decreased MAP3K10 mRNA levels relative to those of the control cells transfected with a non-specific miRNA (Fig. 5B). [score:11]
The results showed that the miR-155 inhibitor significantly up-regulated, and its mimic down-regulated the p38, ERK1/2, and JNK phosphorylation pathways stimulated by oxLDL in macrophages (Figs. 4A and B). [score:9]
PMA -induced THP-1 cells were transfected with miRNA mimic/inhibitor, and then incubated with oxLDL for 24 h. TNF-α and IL-6 expression levels were regulated after miR-155 mimic and inhibitor incubation. [score:8]
0046551.g002 Figure 2PMA -induced THP-1 cells were transfected with miRNA mimic/inhibitor, and then incubated with oxLDL for 24 h. TNF-α and IL-6 expression levels were regulated after miR-155 mimic and inhibitor incubation. [score:8]
Interestingly, the down-regulation of MAP3K10 resulted in similar effects as the miR-155 up-regulation in oxLDL-stimulated macrophages. [score:7]
In contrast, these effects were inactivated after the up-regulation of miR-155 expression. [score:6]
Consistent with the microarray result, Huang et al. [21] revealed that miR-155 expression was significantly up-regulated in oxLDL-activated THP-1 cells. [score:6]
We then concluded that miR-155 can at least partly down-regulate inflammatory responses in oxLDL -induced macrophages, and that MAP3K10 is indeed a functional target gene of miR-155 that is involved in the miR-155 -mediated anti-inflammatory effect on oxLDL-stimulated macrophages. [score:6]
Some studies also suggest that the JNK pathway is involved in the up-regulation of miR-155 expression in response to poly(I:C) or TNF-α. [score:6]
Meanwhile we have found that the miR-155 inhibitor -mediated pro-inflammatory effect was rescued after inhibiting MAP3K10 with siRNA. [score:5]
[35], here we confirmed again with those results, verified that miR-155 can exert a major inhibitory role in fine-tuning the inflammatory response, but the most intriguing founding is the mechanism discover for the relationship between new target MAP3K10 and MAPK pathway and miR-155, meanwhile we use the special mo del for in the AS pathological process both in vitro and in vivo, further confirmed the positive role of miR-155 in AS inflammatory response. [score:5]
Moreover, the overexpression of miR-155 inhibited the activation of p38, ERK1/2, and JNK in vivo (Figs. 4C and 4D). [score:5]
Detection the miR-155 expression after transfection with miR-155 mimics and miR-155 inhibitor by TaqMan PCR. [score:5]
To evaluate further the biological role of miR-155 up-regulation on AS development and progression, miR-155 was over-expressed via tail-vein injection of cholesterol -modified agomiR-155. [score:5]
Furthermore, the miR-155 inhibitor -mediated effect on the inflammatory response was counteracted through the inhibition of MAP3K10 by siMAP3K10 on oxLDL-stimulated macrophages (Figs. 6C–6F). [score:5]
This result suggested that miR-155 directly targets MAP3K10. [score:4]
Given the evidence of MAP3K10 regulation by miR-155 at the levels of both RNA and protein presented above, and considering the reported inflammatory effect of MAP3K10, we speculated that MAP3K10 could be a functionally important target of miR-155. [score:4]
Given that miR-155 regulates the expression of inflammatory factors in oxLDL-activated macrophages, we hypothesized that there is an association between the MAPK signaling pathway and the miR-155 effect. [score:4]
MiR-155 regulates cytokines by targeting C/EBPB, which is a positive regulator of IL-6 capable of transcribing a large number of cytokine-encoding genes [31]. [score:4]
Prevention of in vivo AS development and progression by miR-155 overexpression. [score:4]
In addition, MAP3K10 mRNA and protein expression in macrophages and ApoE [−/−] mice were capable of being regulated by miR-155, as determined by both gain- and loss-of-function approaches. [score:4]
MAP3K10 is a direct target of miR-155. [score:4]
In the present study, the RT-PCR assay confirmed that miR-155, miR-146a, and miR-9 were aberrantly up-regulated in ApoE knockdown mice. [score:4]
Verification of the potential target genes (MAP3K10) of miR-155 by luciferase reporter assay coincidental with mRNA and protein expression levels. [score:4]
Inflammation is also thought to be a major contributor to atherogenesis; hence we believed that the up-regulation of miR-155 in CAD patients contributed to the stressed inflammatory environment of AS and AMI. [score:4]
miR-155 was also found to mediate the inflammatory response and mitogen-activated protein kinase (MAPK) pathway by targeting mitogen-activated protein kinase kinase kinase 10. miR-155 contributes to the prevention of AS development and progression. [score:4]
Based on the findings from our previous study that some miRNAs were up-regulated by oxLDL -treated human primary monocytes and on a survey of previously reported miRNA profiling results [10], [17]– [19], five miRNAs (miR-155, miR-146a, miR-125a-5p, miR-29a, and miR-9) were selected in the present study. [score:4]
To elucidate the potential mechanism of miR-155 in the regulation of the AS inflammatory response, the putative targets of miR-155 were first identified. [score:4]
miR-155 inhibits the MAPK pathway in oxLDL -induced macrophages and ApoE knockdown mice. [score:4]
In line with this, evidence that the three major classes of MAPKs (ERK1/2, p38, and JNK pathways) were all activated in oxLDL -induced macrophages by the miR-155 inhibitor was provided in the present study. [score:3]
The immunofluorescence signal was detected by an Odyssey infrared imaging system (Li-cor, USA) The THP-1 cells were cotransfected with a p-MAP3K10 UTR and mut-MAP3K10 UTR miRNA luciferase reporter vector and miR-155 inhibitor using Lipofectamine 2000 (Invitrogen). [score:3]
The miR-155 inhibitor -mediated inflammatory effect was rescued in oxLDL -induced macrophages via small interference RNAs for MAP3K10 (C), (D), (E), and (F). [score:3]
Recent data have indicated that miR-155, a typical multifunctional miRNA, plays a crucial role in immunity, inflammation and cardiovascular diseases [9]. [score:3]
In conclusion, the results of the present study strongly indicate that one major mechanism underlying the anti-atherogenic effect of miR-155 could be an anti-inflammatory effect by targeting MAP3K10. [score:3]
These tools gave evidence that MAP3K10 is the possible target gene of miR-155. [score:3]
On the other hand, the miR-155 inhibitor increased their secretions both in the protein and mRNA levels. [score:3]
To study further the potential molecular mechanism of miR-155 therapy in AS, an in silico search of potential targets was performed with the help of currently available bioinformatics. [score:3]
The effects of miR-155 on the inflammatory response and the potential mechanisms between miR-155 and its target MAP3K10 were further explored. [score:3]
Some miRNAs (miR-125a-5p, miR-9, miR-146a, miR-29a, and miR-155) were aberrantly expressed after oxLDL treatment. [score:3]
Consistent with these changes in mRNA levels, the level of MAP3K10 protein was also altered by the miR-155 inhibitor and mimic (Figs. 5C and 5D). [score:3]
Maurizio et al. [20] reported that the p38 MAPK pathway is involved in miR-155 inhibition. [score:3]
Moreover, miR-155 is highly expressed in activated B cells, T cells, macrophages, and DCs [8]. [score:3]
Three days after the administration of agomiR-155, TaqMan reverse transcriptase (RT)-PCR analysis showed a dramatic induction of miR-155 expression in vascular tissues, plasma, and BMMCs (Fig. S3). [score:3]
MAP3K10 is a functional target gene involved in the miR-155 -mediated inflammatory effect on oxLDL -induced macrophages. [score:3]
MAP3K10 as a functional gene target involved in the miR-155 -mediated inflammatory effect. [score:3]
To elucidate further the in vivo effects of miR-155 on inflammatory response, miR-155 was over-expressed via a single tail-vein injection of cholesterol -modified agomiR-155. [score:3]
Our results suggested that miR-155 can be a potential marker for predicting the prognosis of CAD patients, moreover, the observed changes in miRNA of PBMCs were more notable than in the plasma, because there are a lot of different kinds of cells in the plasma, but for PBMC, the component partare relative pure, only the mononuclear cells, also this result indicate that miRNAs in PBMC may be sensitive signature for monitoring of cardiovascular diseases. [score:3]
miR-155 suppresses atherosclerotic plaque progression, reduces macrophage accumulation, as well as decreases TNF-a and IL-6 levels in the thoracic aorta of ApoE [−/−] mice. [score:3]
The miR-155 mimic and inhibitor were transfected into PMA -induced THP-1 macrophages using the fast transfection protocol recommended for the Hiperfect transfection reagent (Qiagen) at a final concentration of 50 nM. [score:3]
Figure S2 The expression of miR-155 after transfection. [score:3]
Figure S3 The expression of miR-155 after injection with agomir in vivo. [score:3]
Among the above miRNAs, miR-155 was significantly up-regulated both in the vessel tissues and mononuclear cells of AS mo del mice compared with the normal mo del. [score:3]
Regulation of inflammatory cytokine secretion by miR-155 in vitro and in vivo. [score:2]
We propose that MAP3K10 may be the target of miR-155 and it was verified by luciferase reporter assay. [score:2]
Detection of the miR-155 level in the BMMC, plasma and thoracic aorta of APOE knockdown mice injected by agomir control and agomir-155 (n = 5), miRNAs was detected by TaqMan PCR. [score:2]
To determine if the regulation of MAP3K10 by miR-155 was specifically mediated by the miRNA mechanism, the 3′-UTR of the MAP3K10 gene containing the miR-155 recognition site was cloned by inserting it downstream to a luciferase reporter. [score:2]
miR-155 was found to regulate the release of IL-6 and TNF-α both in vivo and in vitro. [score:2]
Therefore, miR-155 could exert regulatory activity, which would limit the over-production of inflammatory cytokines and the signaling pathways of oxLDL -mediated macrophages. [score:2]
As expected, miR-155 expression was found to be increased by about 50%–200% in the CAD patients compared with the healthy control. [score:2]
The effect of miR-155 inhibition was then assayed. [score:2]
Two MAPK cascades (p38 and JNK) had been to reported to be involved in miR-155 regulation [9]. [score:2]
miR-155, miR-146a, and miR-29a were deregulated in patients with CAD. [score:2]
A mismatched miR-155 agomiR was also synthesized as a control. [score:1]
0046551.g005 Figure 5(A) Effects of miR-155 on the transcript level of MAP3K10 in cultured THP-1 cells. [score:1]
Hence, the critical protective role of miR-155 in atherogenesis is revealed. [score:1]
The functional role of miR-155 in the atherosclerotic path physiological process was also observed in vivo and in vitro. [score:1]
However, the role of miR-155 in AS inflammatory response has not been systematically studied in depth. [score:1]
For delivery of cholesterol-conjugated miR-155 agomiR, 10 nmol miR-155 agomiR and mismatched miR-155 agomiR in 0.1 ml saline buffer were tail vein -injected once every 3 d and lasted for 2 weeks, respectively. [score:1]
The results showed that the miR-155 level was the most significantly elevated both in AS mice and CAD patients relative to the normal control. [score:1]
0046551.g004 Figure 4Effects of miR-155 on the activity of the MAPK signaling pathways in oxLDL-stimulated macrophages and in the thoracic aorta of ApoE [−/−] mice. [score:1]
To investigate the possible role of miR-155 in the inflammatory response of AS, the chemically synthesized miR-155 inhibitor or mimic was used, the tranfect efficiency was shown as FigureS2. [score:1]
The reporter gene assay showed that compared with the pGL3-MAP3K10-3UTR plasmid cotransfected cells, there was a statistically significant increase and decrease in the activity of the cells cotransfected with the miR-155 inhibitor and mimic, respectively (Fig. 5A, P<0.01). [score:1]
Data are presented as mean ± SD, n = 3; * P<0.05 compared with the siRNA control and [#] P<0.05 compared with the pure miR-155 inhibitor group. [score:1]
As shown in Figs. 2A and 2B, the miR-155 mimic decreased some of the inflammatory cytokine (IL-6 and TNF-α) secretions of oxLDL -induced macrophages. [score:1]
These activities reflect the protective roles that miR-155 may play in AS. [score:1]
The miR-155 agomiR was chemically modified and cholesterol conjugated. [score:1]
Therefore, the involvement of the MAPK pathway in the anti-inflammatory effect of miR-155 was interesting to determine. [score:1]
Hence, the p38, ERK1/2, and JNK signaling pathways are required to enable the effects of miR-155. [score:1]
This result indicated that miR-155 transfection affects the inflammatory response of oxLDL -treated macrophages. [score:1]
miR-155 was found to be strongly induced by a broad range of inflammatory stimuli [8]. [score:1]
To investigate the biological importance of MAP3K10 as a target of miR-155, PMA -induced THP-1 were depleted of MAP3K10 protein and incubation with oxLDL. [score:1]
Effects of miR-155 on inflammatory cytokine secretion. [score:1]
miR-155 was found to be slightly induced in the AMI group both in PBMC (52.8%, P<0.05) and plasma (50%, P<0.05). [score:1]
The present study revealed for the first time the anti-atherogenic effect of miR-155 both in vitro and in vivo. [score:1]
Therefore, the data suggested the essential role for MAP3K10 as a mediator of the biological effects of miR-155 on oxLDL -treated macrophages. [score:1]
This result indicated that miR-155 was induced in the AS mo del. [score:1]
These data demonstrated that miR-155 maybe reduce atherosclerotic plaque progression consistent with an anti-inflammatory effect. [score:1]
In the present study, increased circulating levels miR-155 mildly reduces atherosclerotic burden in ApoE [−/−] mice. [score:1]
Effects of miR-155 on the activity of the MAPK signaling pathways in oxLDL-stimulated macrophages and in the thoracic aorta of ApoE [−/−] mice. [score:1]
The observations suggested that miR-155 is a part of a negative feedback loop, which down-modulates inflammatory cytokine production and decreases AS progression. [score:1]
To observe the in vivo relationship of miR-155 and MAP3K10, changes in the MAP3K10 levels in agomiR-155 -injected ApoE knockdown mice were analyzed and compared with the the agomiR control. [score:1]
These findings are similar with the effects of the miR-155 mimic on oxLDL -treated macrophages. [score:1]
[1 to 20 of 93 sentences]
25
[+] score: 281
Other miRNAs from this paper: mmu-mir-122
While vimentin is not a direct target of miR-155, C/EBPβ, a well-established miR-155 target [5] plays a role in EMT in various cancers [33, 34]. [score:6]
Here, we show increased miR-155 expression in the livers of MCD diet-fed mice throughout the progression of the disease, with a peak at 6 weeks (Fig 1D). [score:5]
In summary, miR-155 deficiency in MCD diet-fed mice affected Adrp, Dgat2, Fasn, Cpt1a, Fabp4, Hmgcr and Ppara expression, while in MCS diet-fed controls Ldlr expression was significantly attenuated. [score:5]
While we found no significant difference between genotypes (WT and miR-155 KO) in the expression of Acc1 (Fig 3C) (a gene involved in fatty acid synthesis) the MCD diet induced significant reduction of Fasn expression that was rescued by mir-155 deficiency (Fig 3D). [score:5]
miR-155 is abundantly expressed in immune cells [8], however, low expression is also present in hepatocytes [5, 10]. [score:5]
Finally, we propose that miR-155 affects fibrosis at multiple levels, via direct and indirect targets, including PDGF, Smad3 and C/EBPβ in NASH. [score:5]
MicroRNA-155 (miR-155), a master regulator of inflammation, enhances the translation of TNFα, a pro-inflammatory cytokine induced during innate immune responses by Toll-like receptor (TLR) ligands [8, 9]. [score:4]
miR-155, a master regulator of inflammation, is induced by TLR ligands and enhances the translation of TNFα [11]; a pro-inflammatory cytokine identified in the pathogenesis of metabolic syndrome and steatohepatitis [6]. [score:4]
In some ways, this data is not surprising since miR-155 targets several negative and positive regulators of the inflammatory pathways [16]. [score:4]
Alcohol increased miR-155 in macrophages via NF-κB activation, and up-regulation of miR-155 was induced by the TLR4 ligand, lipopolysaccharide (LPS) in ALD [11, 12]. [score:4]
PPARα can regulate Ldlr transcription [28], and here we found that the MCD diet induced a significant increase in Ppara expression, which was prevented by miR-155 deficiency. [score:4]
Therefore, our findings suggest that miR-155 targets critical steps in the fatty acid uptake/TG synthesis/VLDL secretion, most likely indirectly, rather than the fatty acid synthesis, since we did not find significant differences between genotypes in the latter one. [score:4]
0129251.g008 Fig 8 Putative direct miR-155 targets are in italics. [score:4]
Putative direct miR-155 targets are in italics. [score:4]
Increased miR-155 has been found in the liver in a mouse mo del of alcoholic liver disease (ALD) in hepatocytes [10] and in Kupffer cells [11]. [score:3]
Hepatic miR-155 expression also showed a positive correlation with TNFα mRNA in the WT livers (Fig 5E). [score:3]
We show that there is an increased miR-155 expression in both parenchymal and non-parenchymal cells in MCD diet-fed livers and we demonstrate that miR-155 deficiency attenuates steatosis in the MCD mo del. [score:3]
In contrast to the report on miR-155 deficiency in HFD [15], we did not find an increased expression of the transcription factor Nr1h3 (LXRα) in miR-155 KO mice (Fig 3I). [score:3]
Adrp, a lipid droplet protein that promotes fatty acid storage in form of triglycerides and inhibits VLDL secretion [22] and Dgat2, another protein facilitating triglyceride synthesis [23] were increased in WT MCD fed mice and this increase was prevented in miR-155 deficient mice (Fig 3A and 3B). [score:3]
miR-155 expression was detected by qPCR in total livers (n = 5-8/group) (D). [score:3]
Steatosis and expression of genes involved in fatty acid metabolism were attenuated in miR-155 KO mice after MCD feeding. [score:3]
Increased miR-155 expression has been reported in both the choline -deficient-amino acid defined (CDAA) and the high fat diet (HFD) NASH mo dels [5, 15]. [score:3]
While TGFβ mRNA levels were comparable between genotypes, there are several genes in TGFβ signaling that are putative mir-155 targets. [score:3]
In our experiments there was no significant difference in TGFβ mRNA expression between WT and miR-155 KO mice both in the control and MCD groups (Fig 7A). [score:3]
We found increased miR-155 expression in LMNCs (107% increase over MCS) and in hepatocytes (36% increase over MCS) in MCD diet -induced steatohepatitis (Fig 1E). [score:3]
The SMA protein expression was significantly increased only in WT mice and not in miR-155 KO mice after MCD diet (Fig 4E). [score:3]
miR-155 deficiency attenuates Smad3 and vimentin expression and enhances C/EBPβ nuclear binding in MCD-steatohepatitis. [score:3]
More importantly, we found a significantly decreased vimentin expression in the miR-155 KO mice. [score:3]
miR-155* expression was determined in total livers (F). [score:3]
However, the drastic reduction of Smad3, a miR-155 target and downstream signaling protein of TGFβ suggests impaired TGFβ signaling, rather than impaired TGFβ levels in the miR-155 KO mice. [score:3]
The complementary strand miR-155* expression was also increased in the livers of MCD diet-fed mice (Fig 1F). [score:3]
Here we found that miR-155 deficiency attenuated PPARα expression, a transcription factor involved in lipid metabolism [28]. [score:3]
Further studies are needed to clarify the exact pathomechanism via which miR-155 targets genes in the lipid metabolism. [score:3]
N. D. = not detectable or score = 0. The different effect of miR-155 deficiency on steatosis between MCD and MCS diet-fed control mice suggests that miR-155 might have different role/s in fat accumulation in normal and diseased conditions, and its effect might depend on the major pathogenetic steps of steatosis, such as increased fatty acid influx and / or synthesis vs. [score:3]
miR-155 is induced by Toll-like receptor (TLR) ligands and it enhances the translation of tumor necrosis factor alpha (TNFα), a pro-inflammatory cytokine identified in the pathogenesis of the metabolic syndrome and steatohepatitis [9]. [score:3]
Similarly, PDGF expression was also attenuated in the miR-155 KO animals. [score:3]
miR-155 deficiency attenuated Ldlr expression in both MCS and MCD groups, however in the latter, it did not reach statistical significance (p = 0.07) (Fig 3G). [score:3]
LPS induces miR-155 and TNFα expression in hepatic immune cells. [score:3]
C/EBPβ is a target of miR-155 and recent studies have suggested a role of C/EBPβ in EMT [33, 34]. [score:3]
Overall these results suggest that miR-155 targets lipid metabolism via multiple mechanisms and it might vary depending on the mo del of steatohepatitis. [score:3]
Primary murine hepatocytes (n = 7/group), Kupffer cells (n = 6, pooled data, 2 datapoints/group) and liver mononuclear cells (LMNC; n = 3-4/group) were isolated from a subset of mice after 6 weeks of MCS or MCD diet feeding and cell-specific miR-155 expression was determined and represented as 1/dCt (E). [score:3]
The different effect of miR-155 deficiency on steatosis in the MCD and MCS diets and the discrepancy between the MCD and HF diets suggest that miR-155 might have different roles in fat accumulation in healthy livers and in the various stages of diseased conditions. [score:3]
N. D. = not detectable or score = 0. The different effect of miR-155 deficiency on steatosis between MCD and MCS diet-fed control mice suggests that miR-155 might have different role/s in fat accumulation in normal and diseased conditions, and its effect might depend on the major pathogenetic steps of steatosis, such as increased fatty acid influx and / or synthesis vs. [score:3]
Similarly, Hmgcr, the rate limiting enzyme in cholesterol synthesis was increased in the MCD diet-fed WT mice, and miR-155 deficiency attenuated Hmgcr expression, which reached statistical significance in the MCD diet-fed group (Fig 3H) [27]. [score:3]
Increased miR-155 expression has been reported in choline -deficient-amino-acid-defined (CDAA) and in high fat diet mo dels of steatohepatitis [5, 15], but little is known in MCD diet -induced steatohepatitis. [score:3]
MCD diet -induced steatohepatitis is associated with increased miR-155 expression in parenchymal and non-parenchymal cells in the liver. [score:3]
This data suggests that the lack of miR-155 expression promotes C/EBPβ activation in steatohepatitis. [score:3]
The miR-155 target TNFα has been shown to enhance hepatic stellate cell activation and promote fibrosis in some studies [51]. [score:3]
MCD diet resulted in steatohepatitis and increased miR-155 expression in total liver, hepatocytes and Kupffer cells. [score:3]
In contrast, miR-155 deficiency failed to attenuate inflammatory cell infiltration, nuclear factor κ beta (NF-κB) activation and enhanced the expression of the pro-inflammatory cytokines tumor necrosis factor alpha (TNFα) and monocyte chemoattractant protein-1 (MCP1) in MCD diet-fed mice. [score:3]
MCD diet -induced steatohepatitis is associated with increased miR-155 expression in parenchymal and non-parenchymal cells. [score:3]
miR-155 deficiency alters expression of genes in the lipid metabolism. [score:3]
miR155 and TNFα mRNA expression was determined (n = 5-6/group, total 32) and correlation was plotted (E); correlation coefficient is shown. [score:3]
Here we report novel findings on the dual role of miR-155 on regulating steatosis and fibrosis in the methionine-choline deficient (MCD) mo del of steatohepatitis. [score:2]
The regulation of steatosis by miR-155 varies depending on the steatohepatitis mo del; involving genes in TG and VLDL synthesis in methionine-choline deficiency. [score:2]
The regulation of fibrosis by miR-155 likely occurs at multiple levels, and it is not restricted to NASH-fibrosis; for example, we also found a reduction of carbon-tetrachloride induced-fibrosis in miR-155 deficient mice [56]. [score:2]
In addition, we found attenuation of platelet derived growth factor (PDGF), a pro-fibrotic cytokine; SMAD family member 3 (Smad3), a protein involved in transforming growth factor-β (TGFβ) signal transduction and vimentin, a mesenchymal marker and indirect indicator of epithelial-to-mesenchymal transition (EMT) in miR-155 KO mice. [score:2]
IL-1β, a pro-inflammatory and pro-fibrotic cytokine that is a putative miR-155* target, was reduced at mRNA level in miR-155 KOs compared to WTs on MCD diet (Fig 6C upper panel). [score:2]
We hypothesized that deficiency of miR-155, a master regulator of inflammation, attenuates steatohepatitis and fibrosis. [score:2]
Here, we found increased cleaved (active) caspase-3 expression in the MCD diet-fed WT mice compared to MCS controls and it was significantly attenuated in the miR-155 KOs on MCD diet (Fig 4G). [score:2]
Our findings also revealed that despite of the significant inflammation, miR-155 deficiency attenuates steatosis and fibrosis in NASH suggesting that miR-155 regulates fibrosis, at least partially, independent of inflammation in the liver. [score:2]
The potential fibrotic mechanisms identified in our mo del include regulation of apoptosis (caspase-3), Smad3, PDGF and C/EBPβ by miR-155. [score:2]
Genes related to fibrosis, such as collagen 1a (Fig 4B), tissue inhibitor of metalloproteinase 1 (TIMP-1) (Fig 4C) and αSMA (Fig 4D) were reduced in the miR-155 deficient mice compared to the WTs after MCD feeding. [score:2]
Our findings reveal that miR-155 regulates fibrosis at least partially independent of inflammation in NASH, since miR-155 deficiency attenuated MCD diet -induced fibrosis despite of sustained significant inflammation and liver injury. [score:2]
miRNA-155 (miR-155) is a master regulator of inflammation that affects both innate and adaptive immunity [8]. [score:2]
While there was no significant difference in the E-cadherin levels between the genotypes (data not shown), vimentin mRNA expression was significantly attenuated in the miR-155 KO mice compared to WTs after MCD diet feeding (Fig 7E). [score:2]
Here we hypothesized that miR-155 has a role in the development and progression of nonalcoholic steatohepatitis and fibrosis. [score:2]
Notably, genes in fatty acid synthesis, such as Fasn, are under LXRα regulation [15], which was not affected by miR-155 deficiency in our mo del. [score:2]
An in vitro challenge with the TLR4 ligand LPS, induced a significantly higher miR-155 expression and TNFα secretion in isolated liver mononuclear cells (LMNCs) or Kupffer cells (KCs) in MCD-steatohepatitis compared to MCS controls (Fig 5A: LMNCs–miR-155, Fig 5B: LMNCs–TNFα; Fig 5C: KCs–miR-155, Fig 5D: KCs–TNFα). [score:2]
Finally, our data also underline the importance of the negative regulatory role of miR-155 in the inflammation pathways in NASH. [score:2]
Since cholesterol levels correlate with the intrahepatic fat content [29], it is tempting to speculate that the higher cholesterol levels might potentially contribute to the development of steatosis in the miR-155 deficient MCS diet-fed mice. [score:2]
While here we found reduced DGAT2 expression in miR-155 KO mice, there was no increase in oxidative stress compared to the WTs making this a less likely explanation in our mo del. [score:2]
This shows the complex role of miR-155 in the inflammatory pathways and also emphasizes the importance of its negative regulatory role in inflammation. [score:2]
miR-155 deficient (knock out/ KO) mice with the appropriate control groups were fed with MCD or MCS diet for 5 weeks (n = 6–10). [score:2]
The regulation of fibrosis is independent of overall liver injury in MCD-steatohepatitis and to a certain extent is detached from inflammation, since miR-155 deficiency did not attenuate hepatic injury, inflammatory cell infiltration or TNFα production. [score:2]
Nuclear binding of CCAAT enhancer binding protein β (C/EBPβ) a miR-155 target involved in EMT was significantly increased in miR-155 KO compared to WT mice. [score:2]
miR-155 regulates Smad3 and C/EBPβ activation in steatohepatitis induced liver fibrosis. [score:2]
Furthermore, it appears that MCD diet-fed WT animals had more 4-HNE adducts (black arrows) than the MCD diet-fed miR-155 KOs suggesting a potential role of oxidative stress in fibrosis. [score:1]
miR-155 KO mice were purchased from Jackson laboratory (Bar Harbor, Maine, USA) and breeding colony was maintained in the animal facility of UMMS. [score:1]
miR-155 deficiency attenuates liver steatosis but does not prevent liver injury in MCD -induced steatohepatitis. [score:1]
0129251.g002 Fig 2 Wild type (WT) and miR-155 deficient (KO) mice were fed with methionine-choline deficient (MCD) or supplemented (MCS) control diet for 5 weeks. [score:1]
This might be related to the baseline IL-1β level in the miR-155 KO MCS control group. [score:1]
Our novel data demonstrate that miR-155 deficiency can reduce steatosis and fibrosis without decreasing inflammation in steatohepatitis. [score:1]
0129251.g004 Fig 4 Wild type (WT) and miR-155 deficient (KO) mice were fed with methionine-choline deficient (MCD) or supplemented (MCS) control diet for 5 weeks. [score:1]
0129251.g006 Fig 6 Wild type (WT) and miR-155 deficient (KO) mice were fed with methionine-choline deficient (MCD) or supplemented (MCS) control diet for 5 weeks. [score:1]
Key molecules in cholesterol metabolism, Ldlr (LDL uptake / clearance) and Hmgcr (rate-limiting enzyme in cholesterol synthesis) were attenuated by miR-155 deficiency in HFD mo del [15]. [score:1]
Thus, next we evaluated some of the downstream signaling molecules of TGFβ such as the miR-155 target Smad2 [32] and Smad3 (www. [score:1]
However, despite the positive correlation between miR-155 and TNFα levels, we found that overall, hepatic inflammation was not attenuated in the miR-155 deficient mice (Fig 2). [score:1]
N. D. = not detectable or score = 0. Wild type (WT) and miR-155 deficient (KO) mice were fed with methionine-choline deficient (MCD) or supplemented (MCS) control diet for 5 weeks. [score:1]
Wild type (WT) and miR-155 -deficient (KO) mice were fed methionine-choline -deficient (MCD) or -supplemented (MCS) control diet for 5 weeks. [score:1]
miR-155 deficiency does not prevent liver injury, but attenuates liver steatosis in MCD-steatohepatitis. [score:1]
Despite comparable liver injury and inflammation, (Fig 2A) we found significantly reduced liver fibrosis in the miR-155 deficient mice after MCD diet feeding indicated by the Sirius Red staining and fibrosis score (Fig 4A). [score:1]
Similarly to the cytokines, NF-κB nuclear binding was increased in both WT and miR-155 KO mice after MCD feeding (Fig 6D) suggesting a comparable level of inflammation in both genotypes. [score:1]
However, here we found attenuation of steatosis, but not liver injury or inflammation in the miR-155 KO animals. [score:1]
In addition to miR-155, numerous other microRNAs can affect liver fibrosis, including miR-122. [score:1]
Genes related to fatty acid uptake, storage and VLDL synthesis, including Adrp and Dgat2, as well as Cpt1a and Fabp4, all under potential PPARα regulation [40, 41, 42, 43], were significantly reduced in miR-155 KO mice on MCD diet compared to WTs. [score:1]
miR-155 deficiency attenuates liver fibrosis in MCD-steatohepatitis. [score:1]
We found decreased steatosis at 5 weeks in MCD diet-fed miR-155 KO mice where liver fibrosis was also present. [score:1]
Overall, these suggest that miR-155 might contribute to liver fibrosis via activation of hepatic stellate cells in our mo del. [score:1]
miR-155 deficiency attenuates liver fibrosis in MCD -induced steatohepatitis. [score:1]
In the HFD mo del, hepatic steatosis was significantly enhanced by miR-155 deficiency [15]. [score:1]
Interestingly, here we found attenuated hepatic steatosis in the miR-155 deficient mice after the MCD diet. [score:1]
miR-155 deficiency does not prevent inflammation in MCD -induced steatohepatitis. [score:1]
0129251.g007 Fig 7 Wild type (WT) and miR-155 deficient (KO) mice were fed with methionine-choline deficient (MCD) or supplemented (MCS) control diet for 5 weeks. [score:1]
Thus next we studied hepatic inflammation and evaluated the role of TLR activation in miR-155 and TNFα expression. [score:1]
Liver inflammation and injury indicated by histology inflammation score, necrosis score (Fig 2A), and serum ALT (Fig 2C) were not significantly attenuated by miR-155 deficiency in MCD diet -induced steatohepatitis. [score:1]
Fabp4, an adipokine that links lipid metabolism and inflammation [25], was increased by MCD diet in WT mice, and was attenuated by miR-155 deficiency (Fig 3F). [score:1]
Summary figure: Role of miR-155 in experimental MCD induced steatohepatitis. [score:1]
In conclusion, here we show novel data that miR-155 deficiency attenuates liver steatosis and fibrosis, but not liver injury and inflammation in the MCD mo del of steatohepatitis (Fig 8). [score:1]
Our novel data show that miR-155 deficiency promotes inflammation, and increases some inflammatory cytokines/chemokines such as TNFα and MCP1 in MCD-steatohepatitis. [score:1]
To study the biological role of miR-155 in steatohepatitis in vivo we used miR-155 deficient mice. [score:1]
Since a loss of C/EBPβ promotes EMT in mammary epithelial cells [33], it is tempting to speculate that augmentation of C/EBPβ in miR-155 KO mice, as we have found, might also contribute to an attenuation of fibrosis in our mo del. [score:1]
This suggests less apoptotic cell death in the miR-155 KO animals, despite the overall comparable liver injury. [score:1]
However, here we found comparable inflammatory cell infiltration between genotypes and the TNFα and MCP1 protein levels were higher in the miR-155 KO mice. [score:1]
There was a 40% increase in miR-155 expression in KCs as well, but statistical significance could not be calculated due to pooled samples resulting in a small sample size (Fig 1E). [score:1]
However, PDGF, another pro-fibrogenic factor, was significantly attenuated in miR-155 deficient mice compared to WT mice both at the mRNA and protein levels (Fig 7B: mRNA and Fig 7C: protein) suggesting a potential role in the fibrosis development. [score:1]
In concordance with previous studies, Cpt-1a, a key rate-limiting enzyme in the fatty acid oxidation [24] was increased in MCD-steatohepatitis in WT mice and not in miR-155 KO mice (Fig 3E). [score:1]
miR-155 expression (A: LMNCs, C: KCs) and TNF-α protein secretion (B: LMNCs, D: KCs) were measured in the cells and in the supernatant, respectively (n = 8-10/group). [score:1]
Thus, we evaluated the cell-specific expression of miR-155 in isolated hepatocytes, liver resident macrophages (Kupffer cells [KCs] and liver mononuclear cells (LMNCs), the latter containing monocytes, lymphocytes and dendritic cells. [score:1]
Parallel with the MCD diet -induced enhanced oxidative stress, we found evidence of increased apoptosis in both WT and miR-155 KO mice on the MCD diet. [score:1]
miR-155 deficiency does not attenuate hepatic inflammation in MCD-steatohepatitis. [score:1]
miR-155 deficiency significantly attenuated the Ldlr levels in the MCS control group, and to a lesser extent in the MCD diet-fed mice. [score:1]
Other genes that were affected by mir-155 deficiency in the HFD mo del (CD36, Cebpa, Pck1), have not changed in our MCD mo del. [score:1]
Monocyte chemoattractant protein (MCP1), one of the key chemokines was also comparable between the genotypes at the mRNA level, and higher protein levels were found in the miR-155 deficient mice (Fig 6B, mRNA upper panel, protein lower panel). [score:1]
Furthermore, miR-155 is enhanced TNFα production in Kupffer cells in ALD [11]. [score:1]
0129251.g003 Fig 3 Wild type (WT) and miR-155 deficient (KO) mice were fed with methionine-choline deficient (MCD) or supplemented (MCS) control diet for 5 weeks. [score:1]
However, we found a drastic reduction of Smad3 protein levels in the miR-155 KO animals (Fig 7D) suggesting that dysfunctional TGFβ signaling might contribute to the attenuated fibrosis in miR-155 KO mice. [score:1]
miR-155 deficiency did not reduce TNFα mRNA or protein levels (Fig 6A, mRNA upper panel, protein lower panel), and TNFα protein levels were higher in the miR-155 KO mice (Fig 6A lower panel). [score:1]
PPARα, another transcription factor involved in lipid metabolism [28], was highly induced by MCD diet in WT mice, and the increase was completely prevented in the miR-155 KOs (Fig 3J). [score:1]
Wild type (WT) and miR-155 deficient (KO) mice were fed with methionine-choline deficient (MCD) or supplemented (MCS) control diet for 5 weeks. [score:1]
[1 to 20 of 130 sentences]
26
[+] score: 273
Other miRNAs from this paper: mmu-mir-92a-2, mmu-mir-92a-1, mmu-mir-92b
Error bars represent mean ± SDTo test for an active suppressor function for ALK on miR-155, we inhibited ALK with the small molecule inhibitor crizotinib in the ALK [+] Karpas-299 cell line and measured growth and miR-155 expression at three different time points (4, 8 and 24 h). [score:7]
Error bars represent mean ± SD To test for an active suppressor function for ALK on miR-155, we inhibited ALK with the small molecule inhibitor crizotinib in the ALK [+] Karpas-299 cell line and measured growth and miR-155 expression at three different time points (4, 8 and 24 h). [score:7]
In contrast, when we analysed the tumours of the mice, we found high levels of the miR-155 targets SOCS1 and C/EBPβ and low pY-STAT3 levels in anti-miR-155 -treated tumours, suggesting long-term target regulation. [score:6]
Interestingly, patient 5, who had unusually low miR-155 expression for an ALCL ALK [−] case, displayed enhanced SOCS1 and C/EBPβ expression, in line with our observed regulation of these genes by miR-155. [score:6]
Figure 6C depicts representative IHC images from patients 8, 1 and 2. In summary (Figure 6D), we propose that in ALCL ALK [−] cells miR-155 suppresses its direct targets SOCS1 and C/EBPβ and induces IL-22. [score:6]
Figure 1Expression of miR-155 in ALCL tissue and regulation of its target proteins C/EBPβ and SHIP1. [score:6]
Next, we examined expression levels of the miR-155 targets C/EBPβ, SOCS1, SHIP1 and FOXO3a in ALCL cell lines (see supplementary material, Figure S1A). [score:5]
We next determined whether transfection of ALCL cell lines expressing low basal miR-155 (SR786, Karpas-299) with pre-miR-155 is able to actively alter the level of its target proteins. [score:5]
Analysing potential miR-155 target proteins in ALCL, we found that C/EBPβ and SOCS1 are suppressed upon miR-155 re-introduction in ALCL ALK [+] cell lines. [score:5]
To study more closely the mechanism by which anti-miR-155 mimetics reduce tumour growth, we assessed expression of miR-155 and its targets, C/EBPβ and SOCS1, in the murine tumours. [score:5]
Levels of C/EBPβ were inversely correlated with miR-155 expression of cell lines, although the other described targets showed no correlation when basal levels were monitored. [score:5]
Following the re-introduction of miR-155 into these cell lines, we observed a reduction in expression levels of the miR-155 targets C/EBPβ to 38% and 36%, and SOCS1 to 41% and 42%, of control levels. [score:5]
miR-155 expression is inhibited by ALK-independent promoter methylation in ALCL ALK [+] cell lines. [score:5]
Basal expression of miR-155 targets in ALCL cell lines and number of detectable miRNAs in the Ago2 IP fractions Figure S2. [score:5]
miR-155 expression in response to ALK inhibition Figure S3. [score:5]
miR-155 expression in response to ALK inhibition. [score:5]
Basal expression of miR-155 targets in ALCL cell lines and number of detectable miRNAs in the Ago2 IP fractions Figure S2. [score:5]
We showed high miR-155 expression in four of five ALK [−] and low miR-155 expression levels in six of six ALK [+] samples (Figure 6A). [score:5]
Using bisulphite conversion, RNAse cleavage and MALDI–TOF mass spectroscopic analysis, we analysed the methylation status of these regions in two ALCL ALK [−] cell lines with high miR-155 expression levels (Mac1, Mac2a) and three ALCL ALK [+] cell lines with low miR-155 expression levels (Karpas-299, SR786, SUP-M2). [score:5]
Despite no difference in miR-155 expression (see supplementary material, Figure S3B), immunohistochemical analysis of C/EBPβ and SOCS1 showed significantly higher expression in tumours obtained from mice grafted with the anti-miR155 -transfected Mac1 cells (Figure 4C; p < 0.01). [score:5]
We extended these findings by also showing suppression of the miR-155 target SOCS1 in ALCL ALK [−]. [score:5]
miR-155 expression in response to ALK inhibition Figure S3. [score:5]
Basal expression of miR-155 targets in ALCL cell lines and number of detectable miRNAs in the Ago2 IP fractions. [score:5]
Therefore, we assessed the effect of miR-155 over -expression on the expression and secretion of a cytokine subset (IL-8, IL-10, IL-21 and IL-22) described in ALCL [20, 38, 39]. [score:5]
We show active regulation of interleukin production by miR-155 and that inhibition of miR-155 leads to reduced growth of ALCL ALK [−] tumours in murine engraftment mo dels. [score:4]
Consistently, basal levels of IL-8 were low in ALCL ALK [−] cell lines (which have high miR-155 expression levels), as compared to ALCL ALK [+] cell lines (with low miR-155 expression; see supplementary material, Figure S5B). [score:4]
Despite the expected growth-reducing effect of crizotinib, no significant increase in miR-155 was observed, suggesting no direct link between ALK kinase activity and miR-155 expression (Figure 3B, C). [score:4]
miR-155 re-introduction or down-regulation was verified on the day of injection by qRT–PCR. [score:4]
These data are consistent with those from ALCL cell lines, whereby miR-155 expression was assessed in three ALK [−] and three ALK [+] ALCL cell lines and CD3-purified primary human T cells; miR-155 was expressed 7-, 10- and 42-fold higher in ALK -negative DL-40, Mac1 and Mac2a ALCL cell lines, respectively, as compared to normal CD3 purified T cells (Figure 1B). [score:4]
SOCS1 suppression may lead to pY-STAT3 activation in a significant subset of ALCL ALK [−] patients Employing an independent cohort of ALCL patient tumours, we show that miR-155 expression is significantly higher in ALK [−] (n = 11) as compared to ALCL ALK [+] tumours (n = 15, p < 0.001) or normal lymph node and CD3 [+] T cells, corroborating our previous results (Figure 1A) [28]. [score:4]
These data are in keeping with the primary patient tumour data, whereby miR-155 expression is more prevalent in ALCL ALK [−] cases. [score:3]
The functional consequences of miR-155 depletion were demonstrated in ALCL mouse mo dels that highly expressed miR-155, but not NPM–ALK, in their tumours. [score:3]
At the level of non-coding RNAs, the miR-17-92 cluster is more highly expressed in ALCL ALK [+], whereas miR-155 is elevated in ALCL ALK [−] [28]. [score:3]
miR-155 is over-expressed in ALCL patient tumours and ALCL cell lines lacking ALK translocations. [score:3]
IL-8 and IL-22, but not IL-10 and IL-21, are expressed in a miR-155 -dependent manner in ALCL. [score:3]
miR-155 and cytokine expression in ALCL cell lines Table S1. [score:3]
So, in a del6q21 situation as found in 58% of ALCL ALK [−] cases, BLMP1 loss may contribute to high miR-155 expression in ALCL ALK–. [score:3]
miR-155 and cytokine expression in ALCL cell lines. [score:3]
ALCL ALK [+] cell lines Karpas-299 and SR786 were transfected with pre-miR155 -mimics (+) or non -targeting control RNA (−). [score:3]
Therefore, we concluded that, in the context of ALCL, C/EBPβ and SOCS1 are the main targets of miR-155, consistent with the data presented in Figure 1C. [score:3]
miR-155 and cytokine expression in ALCL cell lines Table S1. [score:3]
C/EBPβ, SOCS1 and pY-Stat3 IHC expression levels were quantified using HistoQuestTM software (TissueGnostics) [36] Because of the described role of miR-155 in the immune system, we assumed that miR-155 might modulate the tumour environment via cytokines [37]. [score:3]
Accordingly, in this study, we demonstrated that miR-155 is able to induce IL-22 and is expressed at much higher levels in ALCL ALK [−] primary tissue and cell lines (Figure 1A). [score:3]
miR-155 targets in primary ALCL tissue. [score:3]
Notably, the tumours obtained from cells transfected with anti-miR-155 displayed higher levels of cleaved caspase 3, suggestive of miR-155 -induced cell survival signals, or at least inhibition of apoptosis (see supplementary material, Figure S4). [score:3]
C/EBPβ levels correlated inversely with miR-155 expression in ALCL cell lines. [score:3]
In four of five ALCL ALK [−] cases, we could see an inverse correlation of SOCS1 to pY-STAT3, which suggests that miR-155 suppresses STAT3 activation via SOCS1 in a significant subgroup of ALCL ALK [−] cases. [score:3]
When we analysed interleukins IL-8, IL-10, IL-21 and IL-22, which have been reported to play a role in autocrine or paracrine stimulation of ALCL, we found that IL-8 is reduced and IL-22 is induced by miR-155 over -expression; IL-10 and IL-21 levels remained unchanged. [score:3]
Importantly, miR-155 was enriched 79-fold (compared to total lysate; red dot, Figure 2C) and the most abundant microRNA in the Ago2 complex, suggesting active regulation of target proteins (Figure 2D; see also supplementary material, Table S1). [score:3]
When BLIMP1-regulated genes were analysed, it was found that miR-155 and interferon regulatory factor 4 (IRF-4) are repressed by BLMP1 [26]. [score:3]
In contrast, the ALCL ALK [+] cell lines Karpas-299, SR786 and SUP-M2 expressed miR-155 at < 5% of the level observed in CD3-purified T cells. [score:3]
Due to the delayed effect of ALK inhibition on miR-155 promoter methylation, we also included a 120 h time point (see supplementary material, Figure S2). [score:3]
In all five ALCL cell lines analysed, promoter methylation was inversely correlated to expression of miR-155. [score:3]
Deciphering the role of miR-155 in JAK–STAT signalling in ALCL ALK [−] may be the basis for the introduction of more targeted therapeutics in mature T cell lymphomas, which to date have a dire prognosis. [score:3]
In the Mac1 and Mac2a cell lines, low levels of promoter methylation were present (0–5%), whereas the Karpas-299, SR786 and SUP-M2 promoters were highly methylated (70–100%) at all four regions analysed, suggesting that promoter methylation contributes to miR-155 regulation in ALCL (Figure 3A). [score:2]
Employing an independent cohort of ALCL patient tumours, we show that miR-155 expression is significantly higher in ALK [−] (n = 11) as compared to ALCL ALK [+] tumours (n = 15, p < 0.001) or normal lymph node and CD3 [+] T cells, corroborating our previous results (Figure 1A) [28]. [score:2]
In particular, miR-155 is expressed nine-fold higher in ALCL ALK [−] as compared to ALCL ALK [+] cells. [score:2]
Interestingly, tumour growth was directly related to miR-155 levels in the injected cells. [score:2]
In line with our findings, it was shown that miR-155 knock-out mice have impaired Th17 polarization, resulting in reduced levels of IL-22 secretion after stimulation with anti-CD3 antibody [42, 43]. [score:2]
In order to elucidate how miR-155 is regulated in ALCL, we analysed DNA methylation of the promoter of the miR-155 host gene. [score:2]
Figure 3 Regulation of miR-155. [score:2]
Injected cell lines had been treated with antisense miRNA mimics, control RNA, pre-miRNA mimics for miR-155 (Ambion) and cultured for 3 days to achieve complete knockdown. [score:2]
miR-155 represses the DNA binding protein JARID2, which closely interacts with polycomb repressing complex 2 (PRC2) in Th17 cells, thereby leading to derepression of Th17 typical cytokines, such as IL-22 [40]. [score:1]
Despite the effective proliferation-reducing effect of crizotinib (p = 0.0043), only a small increase in miR-155 levels was observed, which was not significant (p = 0.0643); error bars represent mean ± SD Figure S3. [score:1]
In this case, the mice transplanted with anti-miR-155 -transfected cells developed tumours that were only 10% of the size of tumours in the control group, thus supporting the potent anti-tumour effect of anti-miR-155 in this ALCL mo del system (p = 0.006; Figure 4B). [score:1]
The latter has been corroborated by a recent study that used RNA-ISH to detect miR-155 in ALCL specimens and, in addition, found colocalization with neoplastic lymphoma cells [29]. [score:1]
miR-155 and mRNAs coding for CEBPβ and SOCS1 are part of the Ago2 complex. [score:1]
In this paper, we propose miR-155 as a tumour driver in the majority of ALCL ALK [−] cases and demonstrate its functions in ALCL cell lines. [score:1]
Indeed, pY-STAT3 levels were highest in the pre-miR-155 -transfected group and low in the control group, suggesting an active miR-155–SOCS1–pYSTAT3 axis in these tumours (Figure 4C). [score:1]
miR-155 levels in cell lines used for the murine engraftment experiments Figure S4. [score:1]
When Karpas-299 and SR786 cells were transduced with pre-miR-155, IL-8 transcript levels were reduced by 80% in both cell lines (Figure 5A). [score:1]
Figure 4Abrogation of miR-155 reduces tumour growth in an ALCL ALK [−] mouse mo del. [score:1]
A recent study has highlighted a mechanism by which miR-155 induces IL-22. [score:1]
miR-155 levels in cell lines used for the murine engraftment experiments. [score:1]
Similarly, IL-8 protein levels in the growth medium were reduced after miR-155 transfection in the Karpas-299 cell line (see supplementary material, Figure S5A). [score:1]
In parallel, miR-155 levels were assessed by qRT–PCR. [score:1]
Mice that received cells treated with anti-miR-155 had the smallest detectable tumours, whereas mice that received pre-miR-155 treated cells had much larger tumours (p = 0.038, Figure 4A). [score:1]
Before engraftment, the cells were treated with an anti-miR-155 mimic, control RNA or pre-miR-155 mimic. [score:1]
Cells (2.5 × 10 [5]) were transfected with miRNA mimics (pre-miR-155, PM12601, anti-miR-155, AM12601; Ambion) or negative control oligonucleotides using Lipofectamine 2000 (Invitrogen), according to the manufacturer's instructions. [score:1]
In all cases analysed, we could see an inverse correlation of miR-155 with C/EBPβ and SOCS1 (Figure 6A, B). [score:1]
In addition, we probed for mRNA levels of genes with miR-155 binding sites in their 3′-UTRs (C/EBPβ, SOCS1, SHIP1 and FOXO3a), as well as controls without (IL-8, IL-22 and GAPDH) in the Ago2 IP complex. [score:1]
To study the role of miR-155 in ALCL without ALK translocation, we used the cutaneous ALCL ALK [−] cell line Mac1, which was transfected with either an antisense miRNA-155 mimic, control RNA or a pre-miRNA-155 mimic. [score:1]
Antagonists of miR-155 reduce tumour growth in murine xenograft mo dels of ALCL ALK [−]To study the role of miR-155 in ALCL without ALK translocation, we used the cutaneous ALCL ALK [−] cell line Mac1, which was transfected with either an antisense miRNA-155 mimic, control RNA or a pre-miRNA-155 mimic. [score:1]
Antagonists of miR-155 reduce tumour growth in murine xenograft mo dels of ALCL ALK [−]. [score:1]
The analysed regions (14, 15, 16, 18; primers in Table S2) were chosen to cover the miR-155 promoter CpG island and the adjacent regulatory regions [34]. [score:1]
The final concentrations of anti-miR-155 and the miRNA mimic in the transfection mix were 250 and 50 n m, respectively. [score:1]
miR-155 levels in cell lines used for the murine engraftment experiments Figure S4. [score:1]
At the time point when tumours were harvested, miR-155 levels could not be differentiated between the groups, indicating dilution of miRNA mimics during tumour growth. [score:1]
Consistent with this finding, mice carrying the Mac2a cells transfected with anti-miR-155 also had significantly lower IL-22 levels than the control mice (p = 0.002, Figure 5F). [score:1]
Moreover, microRNA-155 was the first microRNA (miRNA) to be shown to cause lymphoma in mouse mo dels in two independent studies [31, 32]. [score:1]
The function of miR-155 in ALCL ALK [−] and other mature T cell lymphomas remains unexplored, but it is known that miR-155 is essential for T cell differentiation and immunity. [score:1]
These data suggest that IL-22 is a miR-155-modulated tumour growth -associated cytokine in ALCL. [score:1]
Mice that received control RNA -transfected cells had intermediate tumour sizes, which indicates that miR-155 provides a tumour growth-promoting function. [score:1]
The ALCL ALK [−] cell lines Mac1 (A) and Mac2a (B) were transfected with either with anti-miR-155, control -RNA or pre-miR-155 oligonucleotides. [score:1]
To determine steady-state levels, we monitored IL-22 mRNA in a panel of ALCL cell lines and correlated it to miR-155 levels (Figure 5C). [score:1]
[1 to 20 of 95 sentences]
27
[+] score: 272
We conclude that at 7 days after dMCAO, miR-155 inhibition may suppress cytokine signaling via its direct targets SOCS-1 and SHIP-1. At 14 days following dMCAO, there was a reversal in the STAT-3 activation, with now increased phospho-STAT-3 levels in the inhibitor group (Fig.   3b). [score:10]
miR-155 direct targets SOCS-1, SOCS-6, and SHIP-1 inhibit cytokine signaling, using multiple suppression mechanisms [50, 51]. [score:8]
Together, these data indicate that at 7 days post-dMCAO, miR-155 inhibition potentially suppresses STAT-3- and PI-3K -mediated cytokine signaling via its direct targets SOCS-1 and SHIP-1 activity. [score:8]
We speculate that miR-155 inhibition -associated upregulation of SOCS-1 and SHIP-1 could suppress number of different cytokines, without affecting their mRNA or protein levels. [score:8]
miR-155 mediates the inflammatory response through negative targeting of its direct target proteins including Src homology 2-containing inositol phosphatase 1 (SHIP-1) [15, 22], suppressor of cytokine signaling molecules SOCS-1 and SOCS-6 [19, 23, 24], and transcription factor CCAAT/enhancer binding protein beta (C/EBP-β) [25]. [score:8]
In addition, we examined the expression of direct miR-155 targets, including cytokine signaling suppressors SOCS-1, SOCS-6, SHIP-1, and C/EBP-β. [score:8]
We proposed that increased blood flow and improved vascular integrity could be mainly attributed to miR-155 inhibition -induced stabilization of tight junction (TJ) protein ZO1, via the upregulation of miR-155 target protein Rheb. [score:8]
These temporal changes correlated with altered expression of miR-155 target proteins SOCS-1, SHIP-1, and C/EBP-β and phosphorylation levels of cytokine signaling regulator STAT-3. showed decreased number of phagocytically active peri-vascular microglia/macrophages in the inhibitor samples. [score:8]
Right panel of Fig.   3a demonstrates that the expression of another STAT regulator SOCS-6 was not substantially affected by miR-155 inhibition, although high molecular weight (82 kDa) isoform of this protein was increased ~1.7-fold in the inhibitor samples, as compared to controls. [score:7]
Analysis of the phenotypic marker expression at different time points after dMCAO demonstrates that miR-155 inhibition induces temporal shift in the expression of CD45 and CD68 markers. [score:7]
The functional efficiency of the in vivo miR-155 inhibition was verified by profiling miR-155 target gene and protein expressions [26]. [score:7]
Error bars: SEM In order to examine possible molecular mechanisms underlying the effect of miR-155 inhibition on cytokine profiles, we evaluated the expression of key cytokine signaling regulator proteins, in the lesioned hemispheres of the animals from the inhibitor and control groups, at 7, 14, and 21 days after dMCAO. [score:6]
Seven days time point was also accompanied by significant upregulation of miR-155 -targeted proteins. [score:6]
Since miR-155 is implicated in the regulation of macrophage differentiation and polarization toward anti-inflammatory phenotype, we expected that miR-155 inhibition would lead to an increased expression of the anti-inflammatory phenotype marker CD206. [score:6]
This process could be mediated via the changes in temporal expression of direct miR-155 target proteins. [score:6]
In summary, we found that in vivo inhibition of miR-155 following mouse experimental stroke significantly affects the time course of the expression of major cytokines and inflammation -associated molecules during a subacute phase after dMCAO. [score:5]
Effect of miR-155 inhibition on the expression of phenotypic markers. [score:5]
Sustained increase in expression of IL-10 in the inhibitor -injected animals is in agreement with recent investigations demonstrating suppression of this cytokine by miR-155 [55]. [score:5]
In addition, miR-155 inhibition after distal middle cerebral artery occlusion (dMCAO) resulted in alterations of several cytokine/chemokine gene expression [26], prompting our interest to possible role of miR-155 in post-ischemic inflammation. [score:5]
RT-PCR detected ~50 % inhibition of miR-155 expression, which lasted for 7 days after the last injection. [score:5]
Experimental groups included sham-operated mice, mice subjected to dMCAO and specific miR-155 inhibitor injections (inhibitor group), and mice subjected to dMCAO and control (scrambled) (control group). [score:5]
Based on our data, we propose that miR-155 inhibition at 48 h after stroke results in suppression of early transient harmful actions of the activated M/Ms at 7 days, followed by enhancement of their protective and reparative actions at 14 days after dMCAO. [score:5]
The same injection procedures were performed in the present study: one group of the dMCAO animals received intravenous injections of specific miR-155 inhibitor (inhibitor group), another group—control scrambled oligonucleotide (control group), at 48 h after dMCAO. [score:5]
In conclusion, at 7 days after dMCAO, miR-155 inhibition resulted in de-activation of STAT-3, which signifies suppression of STAT-3 -mediated cytokine signaling. [score:5]
This is in agreement with our findings that in vivo miR-155 inhibition lasts for 10 days after the inhibitor injections, meaning that the microRNA levels were restored by 14 days after dMCAO. [score:5]
Another miR-155 target C/EBP-β promotes the expression of anti-inflammatory cytokines (including IL-10) and contributes to injury repair and neuroprotection [52, 53]. [score:5]
All these miR-155 -targeted factors control the inflammatory response via suppression of cytokine transcription and signaling. [score:5]
Based on our findings, we propose that in vivo miR-155 inhibition following mouse stroke significantly alters the time course of the expression of major cytokines and inflammation -associated molecules, which could influence inflammation process and tissue repair after experimental cerebral ischemia. [score:5]
miR-155 target protein C/EBP-β was significantly increased in the samples collected from the inhibitor -injected animals. [score:5]
miR-155 inhibition after dMCAO has a long-term effect on cytokine expression profile. [score:5]
Here, we hypothesized that, in addition to this possible mechanism, downregulation of pro-inflammatory miR-155 could improve stroke outcome by significantly influencing a post-stroke inflammation. [score:4]
In our previous studies, we demonstrated that in vivo inhibition of miR-155 promotes functional recovery after mouse experimental stroke. [score:3]
Immunofluorescence analysis of the brain sections from 7 days after dMCAO also confirmed decreased expression of leukocyte/ macrophage marker CD45 and active phagocytosis marker CD68 in the anti-miR-155 -injected group. [score:3]
In the present study, we explored if this beneficial effect is associated with miR-155 inhibition -induced alterations in post-stroke inflammatory response. [score:3]
Therefore, we proposed that systemic in vivo inhibition of miR-155 could significantly affect the post-stroke inflammatory response. [score:3]
In our previous study, we found that specific in vivo inhibition of miR-155 after experimental mouse ischemia supports brain microvasculature in the peri-infarct area, reduces brain tissue damage, and improves the animal functional recovery. [score:3]
Our previous analysis showed significant (34 %) reduction of infarct size in miR-155 inhibitor -injected animals at 21 days after dMCAO. [score:3]
Error bars: SEM; Student’s t test, * p < 0.05 In our previous study on the in vivo inhibition of miR-155 after mouse dMCAO, we detected that the vascular support achieved by anti-miR-155 injections at 7 days after the experimental stroke played a critical role in the prevention of delayed neuronal loss in the peri-infarct area at the later stages. [score:3]
Multifunctional miRNA miR-155 is among the miRNAs with expression profiles significantly affected by cerebral ischemia [10– 12]. [score:3]
In contrast, at 14 days after dMCAO, there was an activation of STAT-3 in the miR-155 inhibitor -injected animals. [score:3]
These findings contribute to understanding of the molecular mechanisms underlying a positive effect of miR-155 inhibition on the overall post-stroke recovery reported in our previous studies. [score:3]
Taken together all these findings, we concluded that miR-155 -induced suppressed cytokine signaling at 7 days, accompanied by decreased M/M phagocytic activity, could contribute to preservation of TJs observed at 7 days after dMCAO. [score:3]
Since miR-155 inhibition is known to have an anti-inflammatory action, we aimed to avoid influencing the acute phase of post-stroke inflammation as an initiator of constructive events, such as activation of microglia and astrocytes, vascular remo deling, and activation of endogenous stem cells. [score:3]
Initially, we investigated the effect of miR-155 inhibition on the expression of genes encoding pro- and anti-inflammatory factors, at 7 days following dMCAO. [score:3]
We demonstrated that miR-155 inhibition supported capillary integrity and prevented prolonged neuronal death in the peri-infarct area [26]. [score:3]
Based on these data, we assumed that vascular support achieved by miR-155 inhibition played a critical role in the prevention of neuronal loss in the peri-infarct area and, thus, in the improvement of functional outcome after stroke. [score:3]
Intravenous injections of a specific miR-155 inhibitor were initiated at 48 h after mouse distal middle cerebral artery occlusion (dMCAO). [score:3]
Specific anti-miR-155 miRCURY™ LNA inhibitor (Exiqon) probes crossed BBB and were identified both in the blood vessels and brain tissue. [score:3]
miR-155 is expressed in hematopoietic cells (including B cells, T cells, monocytes, and granulocytes), endothelial cells, microglia, and astrocytes [17, 23, 27]. [score:3]
miR-155 inhibition results in the impaired cytokine signaling. [score:3]
Based on the literature and our previous studies, miR-155 inhibition could potentiate IL-10/STAT-3 -mediated AIR, which could significantly contribute to improved post-stroke recovery reported in our previous study [26]. [score:3]
We therefore investigated the effect of in vivo miR-155 inhibition on the expression of several M/M phenotypic markers, at different time points after dMCAO. [score:3]
Ultrastructural changes associated with miR-155 inhibition. [score:3]
Error bars: SEM; Student’s t test, * p < 0.05 Initially, we investigated the effect of miR-155 inhibition on the expression of genes encoding pro- and anti-inflammatory factors, at 7 days following dMCAO. [score:3]
miR-155 has been implicated in regulating various physiological and pathological processes including immunity and inflammation [13, 14]. [score:2]
Microglia -mediated immune response associated with several pathological states is regulated by miR-155 [17– 19]. [score:2]
Recent investigations identified miR-155 as a potent regulator of the neuroinflammatory response in Japanese encephalitis and Alzheimer’s disease [15, 16]. [score:2]
Original magnifications: a– l ×1500–7000 and m, n ×800 miR-155 is known to regulate a differentiation process in microglia and macrophages [19, 45]. [score:2]
MicroRNA miR-155 is implicated in modulation of the inflammatory processes in various pathological conditions. [score:1]
MicroRNA miR-155 dMCAO Post-stroke inflammation Microglia/macrophages Ischemic stroke triggers complex, multipart cascade of events leading to irreversible brain damage and dysfunction of the neurovascular network in the ischemic core [1]. [score:1]
Injections of specific anti-miR-155 miRCURY LNA™ (Product#4101082-001, https://www. [score:1]
In our previous study, we characterized miR-155 inhibition efficiency following intravenous injections after mouse dMCAO. [score:1]
The present investigation focuses on the long-lasting effect of miR-155 inhibition on the inflammatory response. [score:1]
[1 to 20 of 63 sentences]
28
[+] score: 264
The contrasting expression of CCR2 and CCR7 between RA blood monocytes with enforced expression of miR-155 and miR-155–deficient mouse monocytes suggests a potential evolutionarily conserved role for miR-155 in regulation of the expression of these receptors. [score:8]
MiR-155 [−/−] BMMOs constitutively expressed a significantly higher level of CCR2 and showed downregulation of CCR7 expression (Fig. 4C). [score:7]
A negative regulatory role for miR-155 in the expression of this receptor was supported by the phenotype of miR-155 [−] [/] [−] monocytes, which showed upregulation of many pro-inflammatory chemokine receptors, including CCR2. [score:7]
The assessment of chemokine production and mRNA expression, and chemokine receptor mRNA expression was tested only in cultures where the transfection efficiency was >60% and showed an increase in miR-155 expression (supplementary Fig. S2, available at Rheumatology Online). [score:7]
Fig. 5 Schematic representation of the role of miR-155 in migration and retention of inflammatory cells in synovial tissueIn the RA synovium, Toll-like receptor ligands and a direct contact with activated T cells strongly upregulated miR-155 expression in monocytes/macrophages, and this led to production of pro-inflammatory cytokines and chemokines. [score:7]
Functionally, we discovered that miR-155 in RA monocytes is induced more robustly by inflammatory challenge than control monocytes, and that miR-155 enhanced chemokine production and downregulated the expression of the pro-inflammatory chemokine receptor, CCR2. [score:6]
Fig. 2 miR-155 was upregulated by RA synovial fluid and co-culture with autologous T cells(A) Peripheral blood (PB) monocytes were incubated with RA SF (n = 3) for 24 h and expression of miR-155 evaluated by relative expression to RNU1A. [score:6]
Simultaneously, high expression of local miR-155 leds to downregulation of CCR2 chemokine receptors on synovial monocytes/macrophages and facilitated their retention in the synovium. [score:6]
Stimulation with SF or contact with activated memory T cells upregulated miR-155 transcript expression in these monocytes/macrophages (Fig. 2). [score:6]
Consistent with protein expression (Fig. 3), mRNA transcript levels for these chemokines were upregulated in both RA and healthy monocytes transfected with miR-155 (supplementary Fig. S5, available at Rheumatology Online). [score:6]
Fig. 4 miR-155 regulated chemokine receptor expressionChemokine receptor mRNA expression in PB CD14+ monocytes from (A) RA patients (n = 8), (B) healthy controls (n = 8) transfected with miR-155 mimic or control mimics. [score:6]
This could include the signalling pathways mediated by validated miR-155 targets SHIP-1 [21] and SOCS-1 [22], which are inhibitors of myeloid cell activation. [score:5]
However, the quantitative expression of miR-155 in purified blood CD14 [+ ]monocytes and its relation to disease activity has not been elucidated. [score:5]
Further studies are required to establish the mechanism by which miR-155 regulates the balance between chemokine, cytokine and chemokine receptor expression. [score:4]
miR-155 copy-number analysis in monocytes revealed the differential expression of miR-155 between blood and the synovial compartment, suggesting an important role for miR-155 in the regulation of this process. [score:4]
No studies, however, have addressed the potential role for miR-155 beyond this to the regulation of chemokine or chemokine receptor expression. [score:4]
The supernatant concentrations of CCL2, CCL7, CCL21, CCL22, CXCL1, CXCL5, CXCL7, CXCL8, CXCL10 and CX [3]CL1 were low or unchanged, the latter suggesting that miR-155 did not regulate their expression (data not shown). [score:4]
We provide herein systematic evidence that miR-155 increased production of the inflammatory chemokines CCL3, CCL4, CCL5 and CCL8, and regulated CCR2 and CCR7 chemokine receptor expression in RA PB monocytes. [score:4]
RA SF and a direct contact with T cells increased miR-155 expression. [score:4]
To examine the role of miR-155 in chemokine production in vitro, we replicated the high expression levels of miR-155 in synovial CD14 [+ ]by transfecting blood CD14 [+ ]monocytes of HCs and RA patients with a functional miR-155 mimic (miR-155m) or CM and assessed the levels of chemokine production and mRNA expression by multiplex ELISA (14 chemokines; n = 15 healthy, n = 16 RA) and TaqMan low-density array (22 chemokines; n = 8 for both HCs and RA) assays, respectively. [score:4]
Our results collectively imply that miR-155 can act as an important epigenetic regulator of chemokine and chemokine receptor expression and is a key factor in the clinical manifestation of RA and its pathogenesis. [score:4]
miR-155 regulated chemokine receptor expression in monocytes. [score:4]
Patients in remission showed comparable levels of miR-155 to HCs (Fig. 1D), while patients with high disease activity demonstrated the highest copy-number compared with those with moderate disease activity (P = 0.018) or remission state (P = 0.015) and HCs (P = 0.0025). [score:4]
In addition, the impact of miR-155 on monocyte function could be influenced by the presence of other post-transcriptional regulators of the inflammatory response, including miR-146 [23] or lincRNA-Cox2 [24], which can lead to a variation in the miR-155–mediated chemokine/chemokine receptor expression between healthy subjects and RA patients. [score:4]
Thus, we speculate that some inflammatory monocytes expressing high levels of miR-155 and CCR7 can give rise to inflammatory DCs that are directed to ectopic lymphoid structures in synovium (Summary Fig. 5). [score:4]
miR-155 is a master regulator of cytokine production by human monocytes and macrophages, and its induced expression mimics pro-inflammatory activation of cells [6, 7]. [score:4]
High expression levels of miR-155 triggered, at transcriptional and protein levels, increased CCL3 (a ligand for CCR1, CCR3 and CCR5), CCL4 (a ligand for CCR5), CCL5 (a ligand for CCR1 and CCR5) and CCL8 (a ligand for CCR2), which have been asserted as mediating monocyte and T cell recruitment into inflamed joints [15, 16]. [score:3]
Thus, we suggest that miR-155 induced by endogenous TLR ligands in the synovial milieu or by contact with other inflammatory cells [6, 18] exists at high copy-number in RA SF monocyte/macrophages and mediates chemokine production that in turn leads to recruitment of blood monocytes and T cells into the joint space; this then attenuates the expression of inflammatory chemokine receptors, retaining these activated cells in the synovium. [score:3]
Analysis of the influence of drug therapy on miR-155 copy-number expression revealed no difference between the conventional DMARDs– and the biologics -treated groups. [score:3]
Fig. 3 In vitro chemokine production in response to enforced expression of miR-155Spontaneous 48 h in vitro chemokine production by peripheral blood (PB) CD14 [+] monocytes from (A) RA patients (n = 16) and (B) healthy controls (n = 15) after transfection with miR-155 mimic (miR-155m) or control mimic (CM), or by untransfected monocytes (M). [score:3]
Less is known about the expression and function of miR-155 in RA peripheral blood (PB) monocytes. [score:3]
There was no correlation between the miR-155 copy-number in PB CD14 [+ ]cells and the patient’s age or disease duration (Table 1). [score:3]
The full range of chemokine receptor expression on miR-155 [−/− ]BMMOs is shown in supplementary Fig. S7, available at Rheumatology Online). [score:3]
Therefore, we investigated the impact of miR-155 on the expression of chemokine receptors by enforced expressing of miR-155 in CD14 [+ ]blood monocytes from RA and healthy subjects. [score:3]
Bone marrow monocytes were FACS-sorted from wild-type and miR-155 [−] [/] [−] mice based on the expression of CD11b, CD115, Ly6C and lack of Ly6G as described [9]. [score:3]
This suggested that RA monocytes were epigenetically programmed at the periphery; with blood monocytes from active RA primed to robustly increase miR-155 expression in response to re-stimulation. [score:3]
Active RA blood monocytes expressed higher copy-numbers of miR-155 upon LPS stimulation than healthy monocytes. [score:3]
In some cultures, monocytes from healthy donors were incubated with RA SF (n = 3) and expression of miR-155 quantified. [score:3]
Future studies will be required to determine whether miR-155 can serve as a useful biomarker of RA disease activity, perhaps included as part of a poly-factorial algorithm. [score:3]
In some experiments, the expression of miR-155 is presented as a relative value: 2 [−] [Δ] [C] [t] where Δ C [t] = Cycle threshold for RNU1A minus Ct for miR-155. [score:3]
In addition, PB CD14 [+ ]monocytes of HCs and RA patients were cultured alone (HC n = 22, RA in remission n = 5, active RA n = 19) or in the presence of different doses of lipopolysaccharide (LPS) (2 ng/ml; HC n = 18, RA in remission n = 5, active RA n = 17) or (10 ng/ml; HC n = 9, RA in remission n = 0, active RA n = 16) for 24 h to determine the effect of inflammatory challenge on miR-155 expression. [score:3]
Among the 15 chemokine receptors tested, miR-155 transfected into RA CD14 [+ ]blood monocytes stimulated an increase in transcript levels of CCR7 and decreased expression of CCR2 (Fig. 4A). [score:3]
This did not correlate significantly with the miR-155 copy number in SF monocytes (r = 0.431, P = 0.186), suggesting that additional local factors present at the site of inflammation effected an extremely high expression of miR-155 in SF cells. [score:3]
This is reflected by a tight positive correlation of miR-155 copy-number in PB monocytes with disease activity. [score:3]
We, and others, have shown an increased relative expression of miR-155 in RA peripheral blood mononuclear cells (PBMCs) [10], synovial biopsies, synovial fibroblasts and SF-derived CD14 [+ ]cells [6, 7]. [score:3]
Thus, miR-155 manipulation might have had an impact only in cells expressing high levels of CCR2. [score:3]
The combination of these phenotypic manifestations implicates miR-155 in co-ordinating leucocyte recruitment and retention at the joint spaces in inflammatory disease. [score:3]
Upon stratification of RA patients into RA in remission and active RA, the constitutive miR-155 expression in RA patients in remission was similar to that of HC subjects, and responded to the similarly low-dose LPS found in HC subjects (supplementary Fig. S3, available at Rheumatology Online). [score:3]
It is likely that miR-155 impacts the pro-inflammatory signalling pathways implicated in differential chemokine and chemokine receptor system expression. [score:3]
Blood monocytes from active RA appear to be imprinted to disproportionately increase miR-155 expression upon Toll-like receptor 4 (TLR4) engagement. [score:3]
Commensurate with this, CCR2 was up regulated in miR155 [−] [/] [−] monocytes. [score:2]
These data indicate that the RA synovial environment (mediators or cells) may be responsible for an additional increase in the expression of miR-155 in RA SF CD14 [+ ]as compared with blood CD14 [+]. [score:2]
In addition, CCR3 and CXCR4 expression was increased in miR-155–transfected healthy monocytes compared with CM -transfected cells (Fig. 4B). [score:2]
Prior studies have implicated miR-155 in the regulation of cytokines in macrophages of synovial origin [6, 14]. [score:2]
The mechanism of miR-155 regulation of chemokines and chemokine receptors is currently unknown. [score:2]
We hypothesized that blood and synovial monocytes from RA patients exhibit miR-155 -dependent chemokine and chemokine receptor regulation that determines their potential for recruitment to the joint. [score:2]
There was an increased expression of miR-155 copy-number in monocytes from patients positive for ACPA compared with ACPA -negative patients (P = 0.033) (Fig. 1E). [score:2]
MiR-155 copy-number in RA PB monocytes was elevated over normal donors and correlated with disease activity. [score:2]
Given the differential expression of miR-155 in RA monocytes from PB and synovial compartments, we investigated the contribution of miR-155 to epigenetic regulation of the chemokines and chemokine receptors that govern migration of monocytes from blood to sites of inflammation. [score:2]
In addition, our data indicate that CCR7 is positively regulated by miR-155. [score:2]
We report here that compared with healthy blood CD14 [+ ]monocytes, CD14 [+ ]monocytes from RA patients have a higher copy-number of miR-155, and this was correlated with RA disease activity. [score:2]
This is commensurate with the highest expression levels of miR-155, which occur in SF CD14 [+ ]cells situated in a strongly pro-inflammatory environment (compared with the blood compartment of healthy subjects and RA patients). [score:2]
Endogenous control of immunity against infection: tenascin-C regulates TLR4 -mediated inflammation via microRNA-155. [score:2]
Enforced expression of miR-155 in CD14 [+ ]blood monocytes from RA and healthy subjects stimulated the production of TNF-α (supplementary Fig. S4, available at Rheumatology Online) consistent with previous observations [6, 11], but in addition, stimulated the production of the chemokines CCL3, CCL4, CCL5 and CCL8 in RA and CCL3 in healthy monocytes compared with controls transfected with CM (Fig. 3). [score:2]
To investigate which soluble and cellular factors upregulate miR-155 in monocytes in the RA synovial compartment, healthy blood monocytes were cultured with RA SFs, or monocyte-derived macrophages co-cultured with autologous activated memory T cells. [score:2]
Quantifying miR-155 copy-number. [score:1]
Next, we investigated whether RA monocytes express disproportionately elevated copy-numbers of miR-155 upon inflammatory stimulus. [score:1]
Known copy numbers of synthetic miR-155 mimic (Dharmacon) and plasmid with cloned housekeeping control RNU1A were used as standards. [score:1]
Orange colour indicates double -positive CD68 and miR-155 cells. [score:1]
Moreover, no studies have investigated the role of miR-155 at the level of absolute copy-number in monocytes and its clinical significance for disease activity. [score:1]
In accord with this observation and with other described pro-inflammatory activities of miR-155, the copy-number of miR-155 in blood-derived monocytes tightly correlated with rheumatoid arthritis clinical markers including DAS28, Total /swollen joint counts and ESR. [score:1]
In Situ hybridization combined with immunohistochemistry for CD68 was performed using a lock nucleic acid (LNA) microRNA in situ hybridization Optimization Kit, LNA 5′- and 3′-digoxigenin -labelled scramble (GTGTAACACGTCTATACGCCCA) and miR-155–specific (TATCACGATTAGCATTAA) probes (all from Exiqon), as described previously [6]. [score:1]
We found no difference in miR-155 copy-number in PB CD14 [+ ]cells between patients treated with conventional DMARDs or biologics (Fig. 1F). [score:1]
These data suggest that miR-155 supports pro-inflammatory chemokine production. [score:1]
miR-155 increased pro-inflammatory chemokine production by monocytes. [score:1]
In contrast to monocytes from RA patients and mouse BMMOs, CCR2 seemed not to be affected by miR-155 in monocytes from healthy donors. [score:1]
The miR-155 copy-number correlated with DAS28 (based on ESR) [Pearson’s R (95% CI) R = 0.728 (0.460, 0.874), P < 0.001 (Fig. 1B)] and with ESR [R = 0.546 (0.183, 0.778), P = 0.006 (Fig. 1C)]. [score:1]
The copy-numbers of miR-155 transcripts in purified PB (P < 0.009) and SF CD14 [+ ]monocytes (P < 0.0001) of RA patients were significantly higher than the CD14 [+ ]monocytes of HCs (Fig. 1A). [score:1]
PB CD14 [+ ]monocytes (0.35 × 10 [6] per well of a 24-well plate) were either transfected with miR-155 (functionally mature miR-155 mimic), control miR mimic or fluorescent control mimic (CM) Dy547 to demonstrate transfection efficiency (at 20 nM; Dharmacon), using the N-TER transfection reagent (Sigma), or were left untransfected as a control. [score:1]
Fig. 1 Copy-number of miR-155 in RA monocytes(A) miR-155 in CD14+ of RA peripheral blood (PB) (n = 24), SF (n = 11) and healthy controls (HCs; n = 22). [score:1]
The miR-155 copy-number in PB CD14 [+ ]cells positively correlated with total joint [R = 0.631 (0.306, 0.824), P < 0.001] and swollen joint [R = 0.503 (0.125, 0.753), P = 0.012] counts (Table 1). [score:1]
Of particular relevance in the context of joint inflammation in RA is miR-155. [score:1]
This hypothesis was tested by quantifying the copy-number of miR-155, which then allowed direct comparison between blood and synovial monocytes; we then used this knowledge to investigate the role of miR-155 in the regulation of chemokine and chemokine receptors expression as measures of monocyte migratory potential. [score:1]
After 6 days T cells were added to monocyte-derived macrophages at a ratio of 8:1 for 24 h as described, and in situ hybridization for miR-155 in macrophages was performed [8]. [score:1]
The addition of LPS dose -dependently increased the copy-number of miR-155 in CD14 [+ ]monocytes, and this was exacerbated in RA patients (Fig. 1G). [score:1]
The miR-155 copy-number was constitutively increased in RA monocytes. [score:1]
To investigate whether a high copy number of miR-155 in SF CD14 [+ ]cells is associated with the disease activity in these patients, we did a correlation analysis comparing copy number with DAS28 (ESR). [score:1]
To validate these data in the context of definitive miR-155 deficiency, we performed a comparative study using miR-155 gene–deficient mice. [score:1]
Furthermore, the miR-155 copy-number was higher again in RA SF CD14 [+ ]cells. [score:1]
Together these data suggest that an elevated miR-155 is present in RA PB monocytes prior to establishment at sites of inflammation. [score:1]
These data suggest that an elevated miR-155 copy-number in monocytes contributes to inflammatory cell recruitment (by increasing local chemokine production) and to the retention of cells in RA joints by reducing their migratory chemokine receptors. [score:1]
To investigate the relationship between miR-155 in purified blood monocytes and disease parameters, the miR-155 copy-number in PB CD14 [+ ]was correlated against a variety of clinical indices and laboratory biomarkers. [score:1]
We quantified the copy-number of miR-155 in monocytes from HC subjects and RA patients before and after treatment with different doses of LPS (2 and 10 ng/ml) (Fig. 1G). [score:1]
[1 to 20 of 93 sentences]
29
[+] score: 263
Other miRNAs from this paper: hsa-mir-15a, mmu-mir-15b, hsa-mir-15b, mmu-mir-15a, hsa-mir-155
Over -expression of miR-155 brought about morphological changes in the neurospheres, arrested cell proliferation and suppressed self-renewal genes, whereas treatment with miR-155 -inhibitor ameliorated the IL-1β -induced effects on self-renewal by relieving suppression of Msi1, Hes1 and Bmi1. [score:9]
Transfection of an miR -mimic for hsa-miR-155, decreased expression levels of C/EBPβ, MSI1, HES1 and Bmi1, whereas these genes were upregulated by transfection of an miR -inhibitor to hsa-miR-155. [score:8]
Over -expression of miR-155 leads to suppression of the self-renewal genes Msi1, Hes1 and Bmi1 and inhibition of self-renewal. [score:7]
How to cite this article: Obora, K. et al. Inflammation -induced miRNA-155 inhibits self-renewal of neural stem cells via suppression of CCAAT/enhancer binding protein β (C/EBPβ) expression. [score:7]
To examine whether expression levels of C/EBP family members are affected by miR-155, we observed expression levels of C/ebpα, β, γ, δ, and ε in NSCs transfected with an miR-155 over -expression plasmid. [score:7]
To independently confirm the effect of miR-155 over -expression on NSC self-renewal, we produced NSCs possessing a cumate inducible miR-155 system and observed target gene expression after cumate supplementation. [score:7]
Although direct evidence linking miR-155 upregulation and stem cell dysfunction have not been observed previously, production of pro-inflammatory cytokines and overexpression of the markers for early neurons such as TUC-4 and DCX have been observed in AD patients 75. [score:7]
However, Further studies targeting miR-155 may provide new prospects in discovering the causative factors involved in disease pathogenesis and reveal novel strategies for managing incurable neurodegenerative diseases. [score:7]
For miRNA inhibition experiment, we used an miRNA inhibitor for miR-155 (mirVana [®] miRNA inhibitor to mmu-miR-155, MH13058 and to hsa-miR-155, MH12601, both from Thermo Fisher Scientific) with Lipofectamine [®] RNAiMAX (Thermo Fisher Scientific) following the manufacturer’s instructions. [score:7]
Butovsky et al. found that peripheral injection of miR-155 inhibitor reverses abnormal molecular signature of spinal cord in the mo del mice, delays diseased onset and extends survival by restoring microglia dysregulation 35. [score:6]
To directly examine the effect of miR-155 on expression of Msi1, Hes1 and Bmi1, we over-expressed miR-155 using a plasmid encoding the pri-miR-155 cDNA sequence in the 3′UTR of the GFP gene. [score:6]
Therefore, we hypothesized that regulation of Msi1, Hes1 and Bmi1 by miR-155 occurs indirectly via suppression of common transcription factors. [score:5]
Furthermore, human iPS-derived NSCs transfected with the miR155 inhibitor displayed increased expression levels of C/EBPβ, MSI1, HES1 and BMI1 relative to hsa-miR-155 -mimic -treated cells and control cells (Fig. 5A and C). [score:5]
Suppression of target genes by miR-155 is conserved in human NSCs derived from human iPS cells. [score:5]
As observed with mouse NSCs, treatment of human iPS-derived NSCs with miR-155 mimic suppressed expression of C/EBPβ, MSI1, HES1 and BMI1. [score:5]
C/EBPβ, MSI1, HES1 and BMI1 are regulated by miR-155 in human NSCsFinally, we demonstrated that miR-155 -induced regulation of target genes involved in self-renewal through C/EBPβ is conserved in human NSCs differentiated from human iPS cells generated using episomal plasmids. [score:5]
These results clearly demonstrate that miR-155 inhibits NSC self-renewal, and the effects of miR-155 over -expression mimicked those observed for IL-1β treatment. [score:5]
Using miR-qPCR to detect the mature form of the target miRNA, we observed a significant increase in expression of miR-155 after 12 and 24 hours of 1 ng/ml IL-1β treatment (Fig. 2A). [score:5]
To describe the mechanism of miR-155 regulation of stem cell self-renewal, we examined the possibility that a common transcriptional factor serves as an intermediary for transcriptional regulation of Msi1, Hes1 and Bmi1, since these genes lack target sequence for miR-155. [score:5]
We found that only C/ebpβ was suppressed by miR-155 over -expression in NSCs. [score:5]
To determine if inhibition of miR-155 could ameliorate the IL-1β effect on NSCs, we pretreated the NSCs with an miR -inhibitor to mmu-miR-155-5p 24 hours before IL-1β stimulation. [score:5]
Induction of miR-155 by cumate resulted in suppression of Msi1, Hes1 and Bmi1 (Fig. 3E), accompanied by morphological changes in the neurospheres and inhibition of cell proliferation (Fig. 3D and F). [score:5]
IL-1β significantly induced miR-155 expression 12 hours after administration, with high expression levels maintained for an additional 12 hours. [score:5]
The NSCs were treated with hsa-miR-155 mimic oligonucleotide (Mimic) or inhibitor to hsa-miR-155 (Inhibitor). [score:5]
Woodbury et al. reported that miR-155 is the most highly elevated miRNA in primary microglia stimulated with lipopolysaccharide (LPS), which is a driver of acute inflammation 3. Since miR-155 and its target genes are highly conserved across species, we hypothesized that miR-155 could be involved in stem cell maintenance and regulation of differentiation. [score:4]
Interestingly, concomitant upregulation of miR-155 and reduction of C/EBPβ have also been observed in brains of Down’s syndrome patients 34. [score:4]
In ALS, miR-155 is the most highly upregulated miRNA 35. [score:4]
Our results are consistent with these observations and reveal that a molecular axis consisting of miR-155, C/EBPβ and stem cell regulatory genes may be involved in the pathogenesis of these diseases. [score:4]
Moreover, mice carrying a null mutation of miR-155 display defective immune responses because of alterations in cytokine expression 51 52. [score:4]
To obtain the relative expression, the Ct (threshold cycle) values of miR-155 were normalized by expression of U6 (ΔCt = Ct [miR−155] − Ct [U6]) and compared with a calibrator using the “ΔΔCt method” (ΔΔCt = ΔCt [sample] − ΔCt [control]). [score:4]
MiR-155 attenuates NSC-related gene expression through suppression of C/ebpβ. [score:4]
Guedes et al., observed upregulation of miR-155 in a transgenic Alzheimer mo del mice, as well as in Aβ-activated microglia and astrocytes 73. [score:4]
Finally, we demonstrated that miR-155 -induced regulation of target genes involved in self-renewal through C/EBPβ is conserved in human NSCs differentiated from human iPS cells generated using episomal plasmids. [score:4]
Taken together, these data suggest that at least three important human genes for NSC self-renewal MSI1, BMI1 and HES1 are regulated by the common transcription factor C/EBPβ and that they are indirectly regulated by miR-155. [score:4]
Koval et al. also demonstrated that treating SOD1 mutant mice with anti-miR-155 significantly extends survival reduces disease duration 32. [score:3]
We then described a mechanism for inflammation -induced inhibition of self-renewal involving miR-155. [score:3]
In NSCs transfected with the miR-155 plasmid, only C/ebpβ was significantly suppressed among four C/ebp family members (Fig. 4A and B). [score:3]
A WB for Caspase-3 indicated that over -expression of miR-155 did not affect NSC viability (Fig. 3C). [score:3]
miR-155 is involved in IL-1β -induced suppression of self-renewal genes. [score:3]
The NSCs were then transfected with miR-plasmids, siRNAs, miRNA inhibitors or pPBQM-miR-155 plasmid using a CUY21 electroporator (NEPA Gene, Tokyo, Japan). [score:3]
Therapeutics using miR-155 inhibitors have also been developed for lung cancer 81. [score:3]
To examine the possibility that miR-155 mediates the IL-1β -induced suppression of stem cell self-renewal, we measured expression levels of miR-155 in NSCs. [score:3]
Based on these previous studies, it is possible that over-expressed miR-155 forces NSCs to differentiate and depletes the stem cell pool. [score:3]
Also in MS, miR-155 expression is significantly increased in brain 67, peripheral monocytes, parenchymal microglia 33 and plasma cells 68. [score:3]
Induction of miR-155 was monitored by presence of GFP co-expressed by IRES sequence (Fig. 3D). [score:3]
However, excessive or chronic inflammations and subsequent miR-155 over -expression may disrupt the homeostasis including attenuation of C/EBPβ and its downstream genes. [score:3]
and an mmu-miR-155-5p precursor expression plasmid (MmiR3427-MR04, GeneCopoeia, Inc. [score:3]
Although the detailed target genes of miR-155 in ALS remain to be elucidated, an observed increase of GFAP -positive and PSA-NCAM -positive neuroprogenitors in the subventricular zone (SVZ) suggests activation of NSCs in response to ALS 66. [score:3]
Over -expression of miR-155 disrupts NSC self-renewal. [score:3]
Therefore, we examined miR-155 involvement in the IL-1β -induced suppression of stem cell self-renewal and measured expression of three central molecules involved in NSC maintenance. [score:3]
Enhancement of miR-155 has been demonstrated in various inflammation associated CNS disorders such as ALS 32, MS 7, Alzheimer diseases (AD) and Down’s syndrome 34. [score:3]
For example, sustained expression of miR-155 in mice causes polyclonal expansion of pre-leukemic pre-B cells 49. [score:3]
In this study, we confirmed our results using NSCs derived from human iPS cells to demonstrate that the molecular cascade consisting of miR-155, C/EBPβ and its targets MSI1, HES1 and BMI1 is conserved in human cells. [score:3]
A direct link between NSCs and miR-155 has not been shown in MS, but close associations between inflammation and neurodegeneration in all lesions of multiple sclerosis have been suggested 70. [score:2]
MiR-155 is involved in IL-1β -induced suppression of self-renewal genes. [score:2]
This finding is inconsistent with other evidence including our data that show that C/EBPβ is negatively regulated by miR-155, which is strongly induced by inflammatory molecules. [score:2]
The importance of the miR-155 in the stem cell regulation has been shown in the hematopoietic and immune systems. [score:2]
In addition, it has been reported that miR-155 induces irregular differentiation in neuroprogenitor cells in mice 3. However, it remains to be elucidated how miR-155 regulates stem cell fate. [score:2]
do), we identified CCAAT/enhancer binding protein (C/ebp) as potential miR-155-regulated mediators of NSC self-renewal genes. [score:2]
C/EBPβ, MSI1, HES1 and BMI1 are regulated by miR-155 in human NSCs. [score:2]
In experimental autoimmune encephalomyelitis (EAE) mice, miR-155 promotes inflammation and demyelination through activation of Th17 and Th1 differentiation 68 69. [score:1]
To observe the effect of miRNA on NSC proliferation, we used the pPBQM-miR-155 plasmid (a gift from Dr. [score:1]
Martin Lotz of The Scripps Research Institute, CA, USA), which consists of the precursor sequence of mmu-miR-155 controlled by a cumate-gene switch, an EF1-CymR repressor cassette and a piggyback transposon backbone. [score:1]
C/EBPβ is involved in miR-155 -mediated attenuation of the stem cell self-renewal genes in NSCs. [score:1]
However, Msi1, Hes1 and Bmi1 do not possess well-matched miR-155 binding sequences when examined by predictive software. [score:1]
Involvement of miR-155 in inflammatory reactions has been described previously in many tissues including the brain. [score:1]
To observe the effects of high-doses of miR-155 in the human cells, we used miRNA mimic (MC12601, Thermo Fisher Scientific). [score:1]
In this system, the induction of miR-155 transcription relies on the addition of cumate, which is a non-toxic water-soluble small molecule 36. [score:1]
Real-time RT-PCR analysis for mature miR-155. [score:1]
[1 to 20 of 69 sentences]
30
[+] score: 252
Other miRNAs from this paper: mmu-mir-20a
In the present study, we show that (i) QKI is indeed a target of miR-155 in B cells; (ii) the expression of QKI is lower in B-cells from CLL patients compare to B cells from healthy donors, and acts as TSG also in CLL; (iii) Qki is a target of LPS signaling, and its expression is downregulated following LPS challenge of macrophages; (iv) Qki modulates downstream LPS signaling in return; particularly p38 MAPK activation and IL-10 production, thus presenting with anti-inflammatory properties. [score:12]
QKI is downregulated at the onset of the innate immune response to LPSWe have previously shown that the expression of miR-155 is upregulated in mouse RAW-264.7 macrophages treated with LPS [8]. [score:9]
We propose that miR-155 and QKI form a critical regulatory component downstream of TLR4 in target hematopoietic cells, and that miR-155 exerts its pro-inflammatory and oncogenic activities at least in part through the downregulation of QKI expression. [score:9]
QKI is downregulated in B cells of CLL patientsQKI being a target of miR-155 at least in certain conditions, we would expect its expression to be reduced in leukemias presented with high miR-155 levels, such as CLL or AML [27– 30, 5]. [score:8]
QKI is a direct target of miR-155 in U937 cellsHuman QKI-3′-UTR contains three putative miR-155 target sites, the first one being conserved among eutherian mammals but absent in muridae and in some human isoforms, the second highly conserved across vertebrates, and the third one primate-specific (targetscan. [score:8]
org), and that the expression of miR-155 is upregulated in glioblastomas [20– 21], the above-mentioned facts suggested that miR-155 might carry out its oncogenic and pro-inflammatory functions at least in part by targeting QKI. [score:8]
Finally, the Luciferase activity also decreased when U937 cells were first transfected with constructs containing the WT, but not the mutant, miR-155 site and then challenged with LPS (Figure 2C), giving a further evidence that QKI downregulation at the onset of the innate immune response to LPS results from its direct targeting by miR-155. [score:7]
Qki expression decreased 2-fold within 4 hours, while the expression of miR-155 as well as that of Tnf, both immediate downstream targets of LPS signaling, increased significantly (Figure 1A– 1C). [score:7]
We have previously shown that the expression of miR-155 is upregulated in mouse RAW-264.7 macrophages treated with LPS [8]. [score:6]
To determine whether miR-155 could directly target QKI transcripts, we prepared three Luciferase reporter constructs from human QKI-3′-UTR, each containing one miR-155 target site (Figure 2A). [score:6]
Accordingly, an antisense miR-155 inhibitory RNA (155- I) protected Qki transcript from downregulation only during the first 4 hours of LPS challenge, while remaining without effects later on (Figure 1D). [score:6]
As human QKI 3′-UTR contains three miR-155 target site, the third one being present only in apes, where QKI came to represent the first most probable target of miR-155, one can expect miR-155-QKI cross-regulatory interactions to have gained a critical importance in this group. [score:6]
Human QKI-3′-UTR contains three putative miR-155 target sites, the first one being conserved among eutherian mammals but absent in muridae and in some human isoforms, the second highly conserved across vertebrates, and the third one primate-specific (targetscan. [score:5]
The oncogenic and pro-inflammatory effects of miR-155 have been attributed at least in part to its targeting of many transcripts encoding tumor suppressors and/or anti-inflammatory factors, especially Ship1 [10– 12], Socs1 [13]. [score:5]
Similarly, low miR-155 expression at the early phase of dendritic cells maturation enables the activation of the p38 pathway, thus favoring IL-1 expression and signaling cascade [35]. [score:5]
As Qki is a potential target of miR-155, we monitored the expression of Qki, using a probe spanning exons 4 and 5 that recognizes all Qki isoforms, as well as of miR-155 and Tnf in mouse RAW-264.7 macrophages following LPS stimulation. [score:5]
Our results further show an inverse correlation between QKI and miR-155 expression in CLL and Burkitt's cell lines, and establish that QKI might render B cells prone to cell death by increasing Caspase3/7 signaling and FAS expression, suggesting that QKI may behave as a TSG in B cells. [score:5]
Finally, miR-155 overexpression in MCF7 breast cancer cells increases the levels of some of its target transcripts through the progressive shortening of their 3′-UTR, including p38 MAPK [37]. [score:5]
Targeted expression of miR-155 in B cells results in pre-B cell acute leukemia/high-grade lymphoma [6]. [score:5]
QKI being a target of miR-155 at least in certain conditions, we would expect its expression to be reduced in leukemias presented with high miR-155 levels, such as CLL or AML [27– 30, 5]. [score:5]
miR-155 also targets QKI in human leukemic B lymphocytesThe expression of miR-155 is high in B-CLL-derived cell lines as well as in CLL patients [27– 30], but low in B-cell Burkitt's lymphomas [31]. [score:5]
As QKI is the first most probable target of miR-155 in apes and human (targetscan. [score:5]
miR-155 is an oncogenic pro-inflammatory microRNA (miRNA) that is up-regulated in a number of solid tumors and liquid malignancies [1– 3]. [score:4]
Figure 2 QKI is a direct target of miR-155 in human U937 monocytes A. Schematic (not-to-scale) representation of human QKI-3′-UTR. [score:4]
This may possibly result from miR-155 targeting immune factor(s) that bind to this particular region of Qki-3′-UTR, given that the stability of several immune transcripts is regulated by the fixation of RNA binding proteins on their 3′-UTR, and that we observed a similar phenomenon in RAW264.7 macrophages, but not in HEK-293 kidney cells (not shown). [score:4]
QKI is a direct target of miR-155 in U937 cells. [score:4]
However, QKI levels in MEC1, Daudi and Raji cells suggest that QKI expression at the protein level is also regulated by other, non- miR-155 -dependent mechanisms. [score:4]
QKI is a direct target of miR-155 in human U937 monocytes. [score:4]
D. RAW-264.7 cells transfected with either a Control -RNA (Control) or an antisense miR-155 inhibitory RNA (155-I) were challenged with LPS 24 hours later. [score:3]
Importantly, QKI expression was low in CLL patients, known to have high levels of miR-155 [27– 30], as well as in leukemic B cells isolated from the spleens of Eμ-miR-155 mice, results further supported by data available in public databases. [score:3]
As the reduction of Qki levels only took place at the first hours of the immune response, we hypothesize that miR-155 targeting of Qki is restricted only at the beginning of the response, to allow p38 MAPK required activation following LPS challenge. [score:3]
Burkitt's and CLL cell lines display different levels of QKI and miR-155 expression. [score:3]
miR-155 also targets QKI in human leukemic B lymphocytes. [score:3]
The expression of miR-155 is high in B-CLL-derived cell lines as well as in CLL patients [27– 30], but low in B-cell Burkitt's lymphomas [31]. [score:3]
Our findings suggest that when QKI- miR-155 reciprocal regulation becomes dysfunctional, enhanced miR-155 activity drives tumor development and evasion of the immune response. [score:3]
We found that QKI and miR-155 expression well discriminate Burkitt's cell lines, all with lower miR-155 and higher QKI levels, from CLL cell lines, all with higher miR-155 but lower QKI levels (Figure 4A). [score:3]
Intriguingly, mutating the miR-155 target site of QKI-UTR-1 increased the Luciferase activity produced following miR-155 transfection beyond that of the Control (Figure 2B, 2C). [score:3]
In hematopoietic cells, the expression of miR-155 is controlled by several immune signals [1– 3]. [score:3]
In conclusion, while miR-155 is critical for mounting an effective immune response, its prolonged expression under chronic inflammatory conditions drives immune pathologies and leukemias. [score:3]
Later on, the miR-155 targeting of Qki transcript was impaired. [score:3]
Nevertheless, miR-155 mimic reduced QKI expression in BJAB and PH3R1 Burkitt's cells, but not in MEC2 CLL cells (Figure 4C). [score:3]
B. Cells were co -transfected with either QKI-UTR-1, QKI-UTR-2 or QKI-UTR-3, each containing either a wild type (WT) or a mutated (Mut) miR-155 target site, along with either pre-miR-Control (Control) or pre-miR-155 (n = 12). [score:3]
Thus, LPS induces miR-155 expression in macrophage/monocytic cell lines of both mouse and human origin [8– 9]. [score:3]
As miR-155 expression is elevated in neuro-inflammatory pathologies such as MS or ALS [41, 42], our data further suggest that a lack of QKI anti-inflammatory input may result in the deleterious dominance of miR-155 activity, therefore, miR-155-QKI interactions could prove to be significantly important for future therapies aimed at neuro-degenerative pathologies presented with high levels of miR-155. [score:3]
Of note, 30% of the 100 transcripts, most significantly affected by siQKI in MEC2 cells were predicted targets of miR-155 (Supplementary Table 2), versus 23% in BJAB cells (Supplementary Table 3). [score:3]
Altogether, these results indicate that QKI is also a target of miR-155 in B cells. [score:3]
The sequences of miR-155 consensus target sites (highlighted) present in the three QKI-3′-UTR Luciferase reporter constructs are shown. [score:3]
Altogether, the above results suggest that, in RAW-264.7 macrophages, Qki transcripts are potentially targets of miR-155 at the onset of LPS signaling only. [score:3]
B. Qki expression in B cells purified from the spleens of wild type or Eμ-miR-155 transgenic mice was analyzed by Western blotting. [score:3]
Therefore, a better understanding of miR-155/QKI functions and their control of expression in immune cells should allow to design new miR-155 -based cancer immunotherapies. [score:3]
We found that Qki levels are reduced at the onset of immune response to LPS, when miR-155 levels are on the rise, positioning Qki as an immune factor and a target of miR-155. [score:3]
Altogether, these results suggest that QKI, miR-155, p38 and IL-10 [39] are involved in a common regulatory circuitry in B cells and macrophages, and that QKI may represent a new factor of hematopoietic cell transformation. [score:2]
These results suggest that the disruption of cross-regulations between QKI, miR-155 and factors implicated in the immune response, may generally be associated with B cell leukemic transformation. [score:2]
Spleens from Eμ-miR-155 mice were: pre-leukemic (1 and 2); and leukemic (3 and 4). [score:1]
Furthermore, overexpression of miR-155 in lymphoid tissues results in disseminated lymphoma characterized by a clonal, transplantable pre-B-cell population of neoplastic lymphocytes “addicted” to miR-155-activity [7]. [score:1]
Finally, Qki levels were also lower in B cells of Eμ -miR-155 transgenic mice at the most advanced stage of leukemia (Figure 6B). [score:1]
Eμ-miR-155 transgenic mice were previously described [6]. [score:1]
Beyond 12 hours, Qki transcripts progressively returned to their initial level at 2-days, while miR-155 level kept increasing. [score:1]
A miR-155 mimic co -transfected in U937 cells with each of these constructs decreased the Luciferase activity produced from the constructs containing a WT, but not a mutant, miR-155 site (Figure 2B). [score:1]
Each miR-155 site was subsequently mutated using the Quick-Exchange Mutagenesis kit (Agilent; Santa Clara, CA, USA). [score:1]
B. * miR-155 different from Control, P < 0.00052. [score:1]
Alternatively, Qki 3′-UTR might act as a sponge for miR-155. [score:1]
High levels of miR-155 often correlate with a poor prognosis [4– 5]. [score:1]
It is thus very likely that during the first hours of LPS signaling, dose -dependent effects take pla