Mmu-mir-155 is a type of microRNA that has been studied in various contexts [PMC8387184]. One study found that GLGZD treatment significantly suppressed the upregulation of mmu-mir-155 and increased the expression of SOCS1, SMAD1, SHIP1, and TAB2 mRNA induced by OGD [PMC8387184]. Another study observed that mmu-mir-155 was significantly up-regulated in the mid-phase of infection [PMC3692539]. In terms of miRNA expression analysis, mmu-mir-155 was reverse transcribed from RNA using a Taqman miRNA Reverse Transcription kit [PMC8368181]. These findings suggest that mmu-mir-155 may play a role in various biological processes and could be a potential target for therapeutic interventions [PMC8387184][PMC3692539][PMC8368181[PMC3692539][PMC8368181]. However, further research is needed to fully understand the functions and mechanisms of mmu-mir-155 in different contexts [PMC8387184][PMC3692539][PMC8368181[PMC3692539][PMC8368181].
U U A uu gcc cugUUAAUGCUAAU G G UAGGGGUu g u |||||||||||||| | | |||||||| | gaCAAUUACGAUUG C C AUCCUCag c c U - - -u agu
Accession | MIMAT0000165 |
Description | Mus musculus mmu-miR-155-5p mature miRNA |
Sequence | 4 - UUAAUGCUAAUUGUGAUAGGGGU - 26 |
Evidence |
experimental
cloned [1,3], Illumina [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0016993 |
Description | Mus musculus mmu-miR-155-3p mature miRNA |
Sequence | 43 - CUCCUACCUGUUAGCAUUAAC - 63 |
Evidence |
experimental
454 [4], Illumina [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|