80 publications mentioning ath-MIR156a

Open access articles that are associated with the species Arabidopsis thaliana and mention the gene name MIR156a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

However, the expression pattern of these miRNAs in successive fully expanded leaves (S2C and S2D Fig) and 1 mm LP (Fig 2) is quite similar, indicating that the factors responsible for variation in the expression of miR156/miR157 during shoot development operate at all stages of leaf development.

spl9 completely suppressed the precocious abaxial trichome phenotype and partially suppressed the leaf shape phenotype of mir156a/c, whereas spl13 partially suppressed the effect of mir156a/c mir157a/c on both of these traits (Fig 9).

The abundance of SPL3 is regulated directly by miR156/miR157 via miRNA -induced transcript cleavage, and indirectly by the effect of miR156/miR157-regulated SPL proteins on the expression of miR172, which in turn represses a group of AP2-like genes that repress the transcription of SPL3, SPL4, and SPL5 [3, 9, 23, 35].

In summary, these results provide further evidence that miR156/miR157 regulate the expression of SPL13 primarily by promoting its translational repression, and also demonstrate that SPL13 activity responds non-linearly to changes in the abundance of these miRNAs.

SPL9 and SPL13 are essential for the expression of adult vegetative traitsThe degree to which the abundance of different SPL transcripts changes in response to changes in the level of miR156/miR157 does not necessarily reflect the developmental importance of these SPL genes because miR156/miR157 can mediate both transcript cleavage [3, 38– 40] and translational repression [23– 26].

Whatever the case, these remaining transcripts are functionally active because the phenotype of this pentuple mutant is not as strong as the phenotype of plants over -expressing a miR156 target site mimic [62].

miR156/miR157 are responsible for the temporal expression pattern of most SPL genesBoth the transcripts and the protein products of miR156/miR157-regulated SPL genes increase during shoot development [3, 18, 21, 36, 37].

miR156/miR157 regulate SPL9 and SPL13 by different mechanismsWe studied the mechanism by which miR156/miR157 regulate the expression of SPL9 and SPL13 by comparing the abundance of the SPL9 and SPL13 mRNAs with the abundance of their protein products.

The expression pattern of miR156 in fully-expanded (FE) leaves matched its expression pattern in LP, but miR157 did not decline as dramatically between FE1&2 and FE3&4 as it did between LP1&2 and LP3&4 (S2C and S2D Fig).

miR157 is more abundant than miR156 and is expressed in a similar temporal pattern, but miR156 plays a more important role in vegetative phase change and is a more potent repressor of SPL gene expression.

In contrast, the only way in which miR156/miR157 have been found to regulate the expression of other SPL genes is through a direct interaction with their transcripts.

Lines over -expressing miR156a have significantly more rosette leaves without abaxial trichomes, more total rosette leaves, and more cauline leaves than lines over -expressing miR156d.

miR157 has the same targets as miR156 and produces an over -expression phenotype similar to that of miR156 [20].

We also quantified the effect of varying miR156/miR157 levels on the expression of their SPL targets.

Some SPL genes are expressed at relatively high levels and respond nearly linearly to changes in the level of miR156/miR157, whereas others are expressed at relatively low levels and only respond significantly to a change in the level of miR156/miR157 when these miRNAs are present at very low levels.

miRNAs with a 5’ terminal uridine, such as miR156 and miR157, repress the expression of their targets via their association with AGO1 [33].

For example, SPL3 is highly expressed in vegetative shoots and is more sensitive to miR156/miR157 than any other SPL gene, but the phenotype of spl3 mutations demonstrate that it plays little or no role in vegetative development [21].

Our results demonstrate that miR156 and miR157 have different expression patterns, different activity, and mediate transcript cleavage and translational repression to different extents at different SPL genes.

Although miR156 is present at lower levels in the adult phase than in the juvenile phase, a comparison of the expression patterns of miR156-sensitive and miR156-insensitive SPL reporters suggests that miR156 represses SPL gene expression during both phases, albeit to different extents [21].

To examine the quantitative relationship between miR156 and SPL13 expression in more detail, we took advantage of a transgenic line containing an estrogen-inducible miR156 target-site mimic (Ind-MIM156), which enabled us to decrease the activity of miR156 by exogenous application of β-estradiol.

How much miR156 is required to repress SPL expression?The stoichiometry of a miRNA and its target can influence the mechanism of gene silencing [42].

The expression patterns of miR156/miR157-resistant reporter genes suggest that this increase is largely mediated by miR156/miR157 [21], but whether miR156/miR157 are entirely responsible for the temporal expression pattern of SPL genes is still unknown.

Developmental variation in SPL9 and SPL13 protein levels is mediated primarily by miR156/miR157-directed translational repression.

This combination of direct post-transcriptional regulation by miR156/miR157 and indirect transcriptional regulation via the miR172-AP2 pathway may be responsible for the hypersensitivity of SPL3 transcripts to variation in the abundance of miR156/miR157.

To determine if the mode of action of miR156 is related to the relative abundance of miR156 and its targets, we measured the absolute quantity of several SPL transcripts and miR156 in LP3&4—the leaves in which the translational reporters for SPL3, SPL9, and SPL13 are first expressed [21].

Although it is clear that miR156, and possibly miR157, regulate many of the changes that occur during shoot development, the function of these miRNAs at specific times in development and in specific leaves is poorly understood.

The expression patterns of miR156 and miR157 during leaf and shoot development.

The expression patterns and developmental functions of miR156 and miR157.

Our observation that variation in the abundance of miR156/miR157 produces non-linear changes in the protein level of their targets suggests a molecular mechanism for the qualitative and quantitative changes in leaf morphology that occur during shoot development.

Our comparison of the expression patterns of miR156 and miR157, as well the phenotype of plants lacking one or both of these miRNAs, demonstrates that these miRNAs work together to regulate vegetative phase change, but are not functionally identical.

miR156/miR157 are among the oldest miRNAs in plants, and it is therefore reasonable to conclude that miRNA -induced translational repression is an ancient regulatory mechanism in plants.

Thus, the miR156/SPL transcript ratio cannot explain the difference in the sensitivity of the SPL9 and SPL13 transcripts to miR156-directed translational repression.

We studied the mechanism by which miR156/miR157 regulate the expression of SPL9 and SPL13 by comparing the abundance of the SPL9 and SPL13 mRNAs with the abundance of their protein products.

The increase in SPL9 activity that occurs during shoot development [21] is probably attributable primarily to a reduction in miR156/miR157 -mediated translational repression because the SPL9-GUS protein increases more significantly in response to a decrease in miR156/miR157 than the SPL9-GUS transcript.

The degree to which the abundance of different SPL transcripts changes in response to changes in the level of miR156/miR157 does not necessarily reflect the developmental importance of these SPL genes because miR156/miR157 can mediate both transcript cleavage [3, 38– 40] and translational repression [23– 26].

Leaves produced early in shoot development, which have a relatively high level of miR156/miR157, were less sensitive to these mutations than leaves produced later in shoot development, which have a relatively low level of miR156/miR157 (Figs 3 and 4).

A comparison of the molecular mechanism by which miR156/miR157 regulate the expression of SPL9 and SPL13 will be informative because these genes respond very differently to changes in the level of these miRNAs.

The relationship between the change in miR156 levels and the change in SPL9-GUS and SPL13-GUS expression varied from leaf to leaf.

SPL9 and SPL13 might suggest that translational repression is favored by a relatively low miR156:SPL transcript ratio (SPL13) whereas transcriptional cleavage is favored by a high miR156:SPL transcript ratio (SPL9), this seems unlikely because a 90% reduction in the level of miR156 in mir156a/c produced only a slight increase in the level most SPL transcripts, including SPL9 (Fig 6).

We also show that variation in the level of miR156/miR157 only has a significant effect on SPL gene expression when these miRNAs are present at relatively low levels.

miR156 and miR157 bind to most of their targets with a single mismatch, but this mismatch is located one nucleotide from the cleavage site in the case of miR157 and 3 nucleotides from the cleavage site in the case of miR156.

MIR156D and MIR157A are expressed at a much lower level than these loci, but the ability of mir156d and mir157a to enhance the phenotype of plants mutant for mir156a, mir156c, and mir157c demonstrates that they are functionally significant.

How much miR156 is required to repress SPL expression?.

The 4-fold decrease in miR156 between LP1&2 and LP3&4 was associated with a 3-fold increase in SPL9-GUS activity and a 9-fold increase in SPL13-GUS activity, but subsequent smaller changes in miR156 were associated with disproportionately large increases in the expression of these reporters.

We found that miR156 and miR157 have similar—but not identical—expression patterns, and that miR157 is more abundant, but less effective, than miR156.

Previous studies have shown that miR156—as well as several other plant miRNAs (reviewed in [22])—mediates both transcript cleavage and translational repression [23– 27], but the relative importance of these processes for the activity of miR156 remains to be determined.

1007337.g006 Fig 6(A) The sequence of miR156 and miR157 transcripts and their target site in SPL transcripts.

To determine which genes produce these transcripts, we identified T-DNA insertions in MIR156A, MIR156C, MIR156D, MIR157A, and MIR157C, and used site-directed mutagenesis to produce mutations in MIR156B.

In these later-formed leaves, a small decrease in the abundance of miR156/miR157 produces a disproportionately large increase in SPL activity, primarily as a result of the increased translation of SPL transcripts.

However, the results of this and previous studies [23– 26] indicate that miR156 and several other plant miRNAs act primarily by promoting translational repression [24– 27, 65, 66].

The relative importance of transcript cleavage and translational repression for the activity of miR156/miR157.

mir156a/c mir157a/c had an even more dramatic effect on the expression of SPL9-GUS, producing a 4-fold increase in the SPL9-GUS transcript and an ~36 fold increase in the SPL9-GUS protein (Fig 10D).

Previous studies have shown that this phenomenon is regulated by variation in the abundance of the miRNAs, miR156 and miR157, but how miR156/miR157 produce the changes in leaf morphology that occur during shoot development is not understood.

The phenotype of plants over -expressing miR156 or miR157 reveals that these miRNAs promote the juvenile vegetative phase, but how they specify heteroblastic patterns of leaf morphology, as well as the individual functions MIR156 and MIR157 genes, are unknown.

miR156/miR157 are responsible for the temporal expression pattern of most SPL genes.

Our results suggest that the amount of miR156 and miR157 present in both juvenile and adult leaves is sufficient to almost completely saturate the cleavage machinery at most of their targets.

Finally, it is important to determine the mechanism by which miR156 represses gene expression.

However, the response of different SPL transcripts to miR156/miR157 varies between transcripts, suggesting that the susceptibility of these transcripts to miR156/miR157 -induced cleavage depends on sequences outside the miR156/miR157 target site.

miR156 is 100 times more abundant than its SPL targets.

Both the transcripts and the protein products of miR156/miR157-regulated SPL genes increase during shoot development [3, 18, 21, 36, 37].

The phenotypes of 5 transgenic lines constitutively expressing a genomic fragment containing MIR156A under the regulation of the CaMV 35S promoter, and an equal number of lines containing a similar construct encoding MIR156D [3], were compared under LD conditions.

These results demonstrate that miR156/miR157 repress SPL9 both by destabilizing the SPL9 transcript and by repressing its translation.

In general, the morphological phenotype of mir156/mir157 mutations was correlated with their effect on the abundance of miR156 or miR157.

Although the miR156 and miR157 probes cross-hybridize to some extent, the source of the hybridization signal could by determined by comparing the effect of mir156 and mir157 mutations on these signals.

Our results provide a new view of vegetative phase change in Arabidopsis and the mechanism by which miR156 and miR157 regulate this process.

The effect of mir156 and miR157 mutations on the levels of miR156 and miR157 in 11-day-old seedlings and in 1mm primordia of leaves 1 & 2 is shown in Fig 1. In Col, the miR156 probe hybridized to 20 nt and 21 nt transcripts, with the 20 nt transcripts being more abundant than the 21 nt transcripts (Fig 1A).

SPL9 transcripts are more sensitive to changes in miR156/miR157 than SPL13 transcripts (Fig 7), suggesting that transcript cleavage may play a larger role in the regulation of SPL9 than SPL13.

mir156b-1 was generated by TALEN-directed mutagenesis [70] in a mir156c-1 background, and is a 42 nt- deletion within the MIR156B hairpin sequence (AACAGAGAAAACTGACAGAA—-42 bp deletion—GCGTGTGCGTGCTCACCTCTC) that removes most of the miR156 sequence.

SPL10, SPL11, SPL13 and SPL15 transcripts, whereas the temporal increase in SPL3 transcripts may be partly regulated by factors that operate independently of miR156/miR157.

The effect of miR156 and miR157 mutations on leaf morphology.

Thus, SPL9 is more sensitive than SPL13 to miR156/miR157-directed transcript cleavage.

Additionally, the amount of miR156/miR157 in leaves 1&2 far exceeds the amount that is actually required to determine their identity; mutations that nearly completely eliminate miR156 have a similar effect on leaves 3 and 5, but a much weaker effect on leaf 1. The only genotypes that caused leaf 1 to resemble leaves 3 and 5 were those that reduce miR156/miR157 by 90%.

However, the intensity of the 21 nt band was slightly reduced in mir156d-1 and in genotypes containing this mutation; for example, the 21 nt miR156-hybridizing band was slightly less intense in the mir156a/c/d mir157a/c pentuple mutant than in the mir156a/c mir157a/c quadruple mutant (Fig 1A).

Assuming that the transcription rate of these SPL genes is the same in LP1&2 and LP3&4, we predict that the amount of miR156 in LP1&2 (where all miR156-regulated genes are completely repressed [21]) is approximately 300–600 times greater than the amount of SPL3 and SPL13 transcripts, and approximately 1,500 times greater than the amount of SPL5 and SPL15 transcripts.

S2 Fig(A) of the abundance of miR156 at different stages in the development of leaves 1&2.

miR156/miR157 regulate SPL9 and SPL13 by different mechanisms.

A comparison of the effect of different mutations on the intensity of these bands indicates that the 20 nt transcript is miR156 and the 21 band is primarily miR157, with a small contribution from miR156d.

1007337.g010 Fig 10(A) Developmental variation in miR156, SPL9-GUS mRNA, and SPL9-GUS protein in leaf primordia of Col plants grown in SD.

The developmental and molecular functions of miR156 and miR157.

The effect of mutations in different MIR156 and MIR157 genes on the abundance of miR156 and miR157 demonstrates that MIR156A and MIR156C produce most of the miR156 in the shoot whereas MIR157C produces most of the miR157.

miR156 is the master regulator of vegetative phase change in Arabidopsis [3, 9] and other flowering plants [10– 15].

Previous studies have shown that the juvenile forms of these traits require the activity of miR156/miR157 [9], but the relationship between the abundance of these miRNAs and the changes in leaf morphology that occur during shoot development is still unknown.

The effect of mir156 and mir157 mutations on abaxial trichome production and leaf shape was correlated with abundance of miR156/miR157 in different leaves.

RT-qPCR analysis of the effect of mir156 and mir157 mutations on the abundance of the primary transcripts of the corresponding genes.

This question is of particular interest in light of the observation most SPL transcripts change very little during shoot development, despite the significant decrease in miR156 that occurs during this process [21].

We do not know if the miR156 and miR157 transcripts that remain in the mir156a/c/d mir156a/c mutant are derived from one or more these loci or from other MIR156/MIR157 genes because we cannot be certain that the mutations present in this mutant stock are completely null.

S1 FigRT-qPCR analysis of the effect of mir156 and mir157 mutations on the abundance of the primary transcripts of the corresponding genes.

miR157 is more abundant than miR156 and declines more slowly during shoot development.

1007337.g004 Fig 4The effect of miR156 and miR157 mutations on leaf morphology.

Assuming that the mutations present in this pentuple mutant are null alleles, the amount of miR156/miR157 in this line represents the combined output of MIR156E, F, G, H and MIR157B, D. These six genes therefore contribute relatively little to the production of miR156 and miR157 in seedlings.

Thus, SPL9 and SPL13 both play important roles in miR156 -mediated developmental transitions.

However, plants with multiple mir156 and/or mir157 mutations displayed a significant increase in the level of some SPL transcripts.

Is miR157 less active than miR156?.

Consequently, instead of using this ratio to compare the relative abundance of cleaved SPL9 and SPL13 transcripts, we asked whether the cleavage of these transcripts is differentially sensitive to variation in the level of miR156/miR157.

This cannot be the only reason for the difference in the phenotypes of mir156a/c and mir157a/c because the amount of miR156 and miR157 associated with AGO1 is quite similar.

Northern analysis using a mixed miR156/miR157 probe revealed that the amount of miR156 and miR157 in the mir156a/c/d mir157a/c pentuple mutant is about 10% of the wild-type level (Fig 1A and 1B).

Only genotypes with very low levels of miR156/miR157 (e. g., miR156a/c mir157a/c, mir156a/c/d mir157a/c, 35S:: MIM156) cause these leaves to resemble adult leaves (Figs 3B and 4B).

This was done using known concentrations of SPL transcripts and miR156 as standards, and performing RT-qPCR on these standards in parallel with RNA from LP3&4.

mir156c has a more significant effect on the morphology of leaves 3 and 5 than mir156a (Fig 4B), which is consistent with its slightly larger effect on the abundance of miR156 (Fig 1A).

The phenotype of plants mutant for genes encoding miR156 and miR157.

For example, in the SPL9-GUS line, miR156 declined by about 2-fold between P3&4 and LP9&10, while the amount of SPL9-GUS protein increased 9-fold.

SPL2, SPL10 and SPL11 increased 2-fold or less in mir156a/c and mir157a/c, and only about 3-fold in mir156a/c mir157a/c and mir156a/c/d mir157a/c.

The 21 nt band was reduced significantly in mir157a/c, and therefore corresponds primarily to miR157, whereas the 20 nt band was nearly absent in mir156a/c, and therefore corresponds to miR156.

miR157 (21 nt) was more abundant than miR156 (20 nt) in the input fraction, whereas miR156 and miR157 were about equally abundant in the IP fraction from AGO1-FLAG/ ago1-36 plants.

Given that SPL genes are not functionally identical [9, 21, 50], conditions that produce small changes in miR156/miR157, or which elevate the transcription of particular SPL genes above the threshold established by miR156/miR157, could lead to unusual combinations of phase-specific traits.

miR156a/c mir157a/c and mir156a/c/d mir157a/c had a significant effect on the shape of leaves 1, 3, and 5, but rarely produced abaxial trichomes on leaf 2, and never produced abaxial trichomes on leaf 1 (Figs 3 and 4).

miR156d is less effective than miR156a.

In particular, it remains to be determined if miR156 is responsible for the graded changes in leaf morphology that occur during the juvenile phase and, if so, how it produces this variation.

This result demonstrates that MIR156D is less effective than MIR156A, and suggests that the additional 5' U in miR157 is partly responsible for its lower biological activity.

These results demonstrate that abaxial trichome production is more sensitive to miR156/miR157 than leaf morphology, and is strongly repressed by even low levels of these miRNAs.

The 20 nt band was absent in mir156a/c, and thus represents cross hybridization of the miR157 probe with miR156.

MIR156B also makes a minor contribution to the miR156 pool because the intensity of the miR156-hybridizing bands was essentially identical in the mir156a/b/c/d and mir156a/c mutants (Fig 1A), and there was no detectable difference between the intensity of the 20 nt and 21 nt bands in leaf primordia (LP) of the mir156a and mir156a/b mutants (Fig 1B).

The source of miR156 and miR157.

However, this is not the only reason for the difference in their activity because the amount of miR157 associated with AGO1 is not dramatically lower than the amount of miR156 associated with AGO1.

We then examined the amount of miR156 and miR157 in these stocks by hybridizing RNA blots with probes for miR156, miR157, and a combination of both probes.

We found that leaves 1&2 have a significantly more miR156/miR157 than other juvenile leaves, and that the largest absolute as well as relative decrease in these miRNAs occurs between leaves 1&2 and leaves 3&4.

mir156b and mir156d have very minor effects on the abundance of mir156 (Fig 1) and also have minor effects on shoot morphology; mir156b did not significantly enhance the phenotype of mir156a or mir156a/c, and mir156d only produced a significant effect on leaf morphology in combination with mir156a/c and mir157a/c.

The value shown for miR156 is 0.01 of the actual value.

We also found that heteroblastic variation in leaf morphology is correlated with the relative abundance of miR156/miR157, and that different features of leaf morphology are differentially sensitive to the level of these miRNAs.

This result indicates that miR156 is more efficiently loaded onto AGO1 than miR157.

The abundance of SPL3 mRNA is hypersensitive to variation in miR156 and thus serves as a proxy for the abundance of miR156 (Fig 7).

miR156 was present in LP1&2 at a concentration of 1.96 ± 0.1 x 10 [5] copies per ng total RNA, whereas miR157 was present at a concentration of 2.45 ± 0.2 x 10 [5] copies per ng total RNA (Fig 2B).

This combination of quantitative and qualitative changes, as well as the morphological plasticity of late juvenile leaves, can be explained by the relatively low and gradually decreasing level of miR156/miR157 in successive leaves, and by the non-linear response of some SPL genes to changes in the abundance these miRNAs.

We suspect that this extra 5' uracil is primarily responsible for the relatively low activity of miR157 because miR156d also has an extra 5' uracil and is significantly less active than miR156, despite being otherwise identical to miR156.

of SPL transcript levels in 1 mm leaf primordia of Col and mir156/mir157 mutants grown in SD.

1007337.g011 Fig 11 The absolute abundance of miR156 and SPL transcripts in Col LP3&4.

Consistent with previous results [21], a nearly10-fold decrease in the level of miR156 between LP1&2 and LP9&10 was accompanied by very modest (2-fold or less) increase in the level of the SPL9-GUS and SPL13-GUS transcripts (Fig 10A and 10B).

These results provide a foundation for detailed studies of the molecular mechanism of miR156/miR157 activity and their role in shoot morphogenesis.

Small RNAs were then extracted from both the IP and non-IP fractions and subjected to Northern analysis using a mixed miR156/miR157 probe.

In Col, the miR156 and miR157 probes hybridize to 21 and 20 nt bands.

miR156 is more efficiently loaded into AGO1 than miR157.

However, we cannot rule out the possibility that the difference in the activity of miR156 and miR157 is a consequence of the difference in their length, rather than the specific features of the miRNA:SPL duplex.

miR157 is more abundant than miR156 and was therefore expected to play a larger role in vegetative phase change than miR156.

of SPL transcript levels in successive 1 mm leaf primordia of the mir156a/c mir157a/c mutant.

Consistent with our previous analyses of shoot apices [21], miR156 and miR157 decrease significantly from LP1&2 to LP3&4, and then decline more gradually before reaching a relatively constant level around leaf 13 (Fig 2).

Synthetic miR156 and miR157 transcripts were serially diluted in 600ng/μl E. coli RNA, and a standard curve was produced by plotting the concentrations of these miR156 and miR157 standards against 2 [-ct] of the corresponding RT-qPCR reaction.

SPL9 and SPL15 transcripts increased very slightly in mir156a/c and mir157a/c but increased up to 6-fold in mir156a/c mir157a/c and mir156a/c/d mir157a/c.

MIR156A, MIR156C, MIR157A and MIR157C are the major sources of miR156 and miR157.

In the SPL13-GUS line, miR156 declined by only 10% between LP3&4 and LP7&8, while the amount of SPL13-GUS protein doubled.

Another possibility is that the AGO1-miR157 complex is inherently less active than the AGO1-miR156 complex.

Genes contributing to the production of miR156 and miR157 in vegetative shoots.

To determine the molecular basis for the effect of mir156 and mir157 mutations on leaf morphology, we compared SPL transcript levels in LP1&2 and LP3&4 in wild-type and mir156/mir157 mutant plants (Fig 7).

These genes are therefore the major source of the 20 nt miR156 transcripts.

Although miR157 is nearly as old and as highly conserved as miR156, this is not wi dely appreciated because miR157 is frequently annotated as miR156 in small studies and in miRBase (http://www.

The blots were hybridized with 1:1 mixed miR156 and miR157 probes, and the results were quantified as described above.

The absolute abundance of miR156 and SPL transcripts in Col LP3&4.

For example, mir156a, mir157a, mir157c, and mir157a/c caused abaxial trichomes to be produced on leaves 7 and/or 8, but did not affect abaxial trichome production or the shape of leaf 1, 3, and 5. mir156c produced abaxial trichomes on leaves 7 and 8 and significantly reduced the angle of the leaf base in leaves 3 and 5, but had no effect on leaf 1. miR156a/c and mir156a/b/c/d reduced the angle of the leaf blade in leaves 1, 3 and 5, but had a more significant effect on leaves 3 and 5 than on leaf 1; these genotypes only produced abaxial trichomes on leaves 6 and above.

The miR156 and miR157 transcripts used as references were synthesized by IDT, and the SPL transcripts used as references were synthesized by in vitro transcription.

These results are consistent with the results of (Table 1), and demonstrate that miR157 is more abundant than miR156 in young seedlings.

MIR156A, MIR156C, MIR157A and MIR157C are the major sources of miR156 and miR157In Arabidopsis, miR156 is encoded by 8 genes and miR157 is encoded by 4 genes.

miR156 subsequently declined to approximately 2.6 x 10 [4] copies per ng total RNA in LP9, whereas miR157 declined to 6.1 x 10 [4] copies per ng total RNA.

To address this question, we introduced spl9 into a mir156a/c mutant background and introduced spl13 into a mir156a/c mir157a/c mutant background.

Consequently, this result implies that estradiol -treated plants had approximately 50% less active miR156 than mock -treated plants, which is consistent with amount of miR156 detected by RT-qPCR.

However, mir157a/c had a significantly weaker effect on abaxial trichome production and leaf shape than mir156a/c (Figs 3 and 4), even though these double mutants have approximately the same amount of miR157 and miR156, respectively (Fig 1).

This result therefore suggests that greater than a 100-to-200-fold excess of miR156 is required to completely repress SPL genes.

SPL3 transcripts were particularly responsive to a decrease in the level of miR156, increasing about 4-fold in mir156c and 5-to-6-fold in mir156a/c.

Nucleotides that are mis-paired in the miR156/miR157:SPL duplex are shown in different colors.

For example, SPL3 was elevated nearly 20 fold in LP3&4 of the mir156a/c/d mir157a/c pentuple mutant.

SPL transcripts are differentially responsive to miR156/miR157.

Hybridization with a 1:1 mixture of miR156/miR157 probes revealed that 21 nt transcripts are significantly more abundant than 20 nt transcripts in 11 day-old seedlings and in the primordia of leaves 1&2 (Fig 1A and 1B).

mir156c reduces miR156 by about 50% (Fig 1B).

1007337.g008 Fig 8RT-qPCR analysis of SPL transcript levels in successive 1 mm leaf primordia of the mir156a/c mir157a/c mutant.

For this purpose, miR156-sensitive and miR156-resistant SPL9: SPL9-GUS genomic sequences [21] were inserted into the pCAM-NAP:eGPF vector [71] using the restriction enzymes XmaI and SbfI.

miR156 is one of the oldest and most highly conserved miRNAs in plants [51, 52].

miR156 was 100 times more abundant than SPL3 and SPL13, about 200 times more abundant than SPL6 and SPL9, and about 500 times more abundant than SPL5 and SPL15 (Fig 11).

1007337.g007 Fig 7RT-qPCR analysis of SPL transcript levels in 1 mm leaf primordia of Col and mir156/mir157 mutants grown in SD.

a = significantly different from Col; b = significantly different from mir56a and miR156c; c = significantly different from miR15a and miR157c; d = significantly different from miR156a/c and miR157a/c; e = significantly different from miR156a/c mir157a/c; f = significantly different from mir156a/c/d mir157a/c (Student's t test; p < 0.01; n = 18 to 23).

miR157 also has an additional 5' nucleotide (relative to miR156), which is unpaired in the miR157:SPL13 duplex.

Values were normalized to the level in LP1&2, which was set to 1 for SPL9-GUS, and 10 for miR156.

mir156d-1 (hereafter, mir156d) had very little effect on the overall abundance of miR156 in 11 day-old seedlings and leaf primordia (Fig 1).

a = significantly different from Col; b = significantly different from mir156a/c, c = significantly different from miR156a/c mir157a/c.

To compare the sensitivity of the SPL9 and SPL13 transcripts to miR156/miR157 -mediated cleavage, we used a modified form of 5’ RNA Ligase Mediated Rapid Amplification of cDNA Ends (5’ RLM-RACE) [3, 41] to quantify the ratio of un-cleaved/cleaved SPL9 and SPL13 transcripts in wild-type Col and mutants deficient for miR156 and miR157.

The ratio of un-cleaved:cleaved SPL13 transcripts was about 2-fold greater in mir156a/c and mir156a/c mir157a/c than in Col, whereas the ratio of un-cleaved:cleaved SPL9 transcripts was 5-fold greater in mir156a/c and 15-fold greater in mir156a/c mir157a/c than in Col (Fig 10E).

Hybridization with a mixed miR156/miR157 probe revealed that miR157 (21 nt band) was more abundant than miR156 (20 nt band) in the input fraction, but that miR156 was as abundant as miR157 in the IP fraction (Fig 5).

SPL9 and SPL13 contribute to the precocious phenotype of mir156 and mir157 mutants.

In addition to two internal nucleotides, miR157 differs from miR156 in possessing an additional U at its 5' end.

The intensity of the 20 nt and 21 nt bands on the blot probed with a 1:1 mixture of the miR156 and miR157 probes was quantified by normalizing the intensity of each band to t-Met, and then to Col; these data are shown in the table below the figure.

SPL13 transcripts were unaffected in mir157a/c, were elevated about 2-fold in both mir156a/c and mi156a/c mir157a/c, and were only slightly more abundant than this in mir156a/c/d mir157a/c.

The absence of abaxial trichomes on leaves 1 and 2 is attributable to the small amount of miR156/miR157 remaining in these mutants because 35S:: MIM156 consistently produced abaxial trichomes on both of these leaves (Fig 4A).

1007337.g002 Fig 2 (A) of miR156 and miR157 levels in successive leaf primordia of plants grown in SD.

Indeed, we only observed a major increase in SPL transcripts in the mir156a/c mir157a/c quadruple mutant, implying that transcript cleavage does not require high levels of these miRNAs.

We suspect that this phenomenon is attributable to functional differentiation between SPL genes, coupled with variation in their sensitivity to miR156 and miR157.

1007337.g001 Fig 1(A) Northern blot analysis of miR156 and miR157 levels in the shoot apices of 11-day-old wild-type Col and mir156/mir157 mutants grown in LD.

Most species also possess another miRNA, miR157, that differs from miR156 at 3 nucleotides [19].

LP3&4 had approximately 25%, LP9 had 12%, and LP13 had 8% of the amount of miR156 present in LP1&2.

Although the relative abundance of miR156 vs.

The fact that miR157 has been conserved along with miR156 during plant evolution suggests that it is not completely redundant with miR156, and raises the possibility that the relative activity of these miRNAs may differ in different species.

1007337.g009 Fig 9 SPL9 and SPL13 contribute to the precocious phenotype of mir156 and mir157 mutants.

Alternatively, the temporal increase in SPL3 may be attributable to the small amount of miR156/miR157 remaining in this quadruple mutant.

It is also important to determine if miR156 plays a role in shoot morphogenesis during the adult phase.

Thus, the transition between leaves 1&2 and leaves 3&4 is accompanied by a major decline in the level of miR156 and miR157 whereas subsequent changes in leaf morphology are associated with much smaller changes in the abundance these miRNAs.

mir157a/c did not have a significant effect on SPL9-GUS mRNA or protein levels, but mir156a/c produced a 2-fold increase in the SPL9-GUS transcript and a 5-fold increase in the SPL9-GUS protein (Fig 10D).

These findings therefore suggest that the SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 transcripts are differentially sensitive to destabilization by miR156 and miR157.

mir156a and mir156c have a relatively large effect on the level of mir156 (Fig 1) and also have a relatively large effect on shoot morphology.

RT-qPCR (S2A Fig) and Northern analysis (S2B Fig) demonstrate that miR156 and miR157 increase as leaves expand.

The juvenile-to-adult transition occurred during the period when miR156 and miR157 were declining very gradually, and was accompanied by a relatively small change in the abundance of these transcripts.

The 35S:: MIR156A lines produced approximately twice as many leaves without abaxial trichomes and approximately twice as many cauline leaves as the lines transformed with 35S:: MIR156D (Fig 6B).

The 20 nt miR156 transcript is present in the moss, Physcomitrella patens [59, 60], and in virtually all other plants that have been examined to date [51, 52].

The abundance of the 20 nt transcripts was reduced to 62 ± 10% (± SD, n = 4) of wild-type in mir156a-2 (hereafter, mir156a), to 51 ± 8% (± SD, n = 4) of wild-type in mir156c-1 (hereafter, mir156c), and to 11 ± 1% (± SD, n = 3) of wild-type in the mir156a/c double mutant (Fig 1A).

They also reveal that the amount of miR156/miR157 in leaves 1&2 far exceeds the amount required to specify their identity.

In Arabidopsis, miR156 is encoded by 8 genes and miR157 is encoded by 4 genes.

We then determined the absolute amount of these miRNAs in LP by comparing the RT-qPCR results obtained with leaf samples to the results obtained using known quantities of miR156 and miR157.

miR156/miR157 are present at very high levels in the first two rosette leaves, where they act as buffers to stabilize leaf identity.

miR156 and miR157 bind to the SPL2, SPL9, SPL10, SPL11, and SPL15 transcripts with only one mismatched nucleotide, although the position of this nucleotide is different for the two miRNAs (Fig 6A).

miR156- and miR157-related transcripts in 11-day-old FRI FLC and FRI flc-3 seedlings.

The miR156d transcript is identical to the miR156a transcript, except for the presence of an additional 5’U (Fig 6A).

This result suggests that miR156/miR157 are entirely responsible for the temporal increase in the SPL2, SPL9.

Most transcripts increase less than 2-fold between LP1&2 and LP3&4 in Col, and increase 2-fold or less in miR156 and miR157 mutants.

A 1:1 ratio of miR156 and miR157 probes was used for mixed probe hybridizations.

Sequencing of small RNAs from 11-day-old shoot apices (2 replicates of each genotype) revealed an abundant 20 nt transcript that maps to MIR156A, B, C, D, E, and F, an abundant 21 nt transcript that maps to MIR157A, B, and C, a moderately abundant 21 nt transcript that maps to MIR156D, and 3 rare transcripts that map uniquely to MIR156G, MIR157D and MIR156H (Table 1).

We were particularly interested in determining whether SPL9 and SPL13 contribute to the precocious phenotype of mir156/mir157 mutants because SPL9 transcripts increase as miR156/miR157 levels decline, whereas SPL13 transcripts are relatively insensitive to changes in these miRNAs (Fig 7).

This treatment reduced the abundance of miR156 by about 3-fold and produced a 2-fold increase in SPL13-GUS mRNA, but increased the abundance of the SPL13-GUS protein by greater than 15-fold (Fig 10C).

1007337.g003 Fig 3(A) Rosettes of three-week-old Col, and miR156 and miR157 single and multiple mutant plants grown in SD.

The miR156-sensitive and miR156-resistant SPL13-GUS reporter lines used in this study were described previously [21].

In contrast, SPL3 transcripts were relatively insensitive to a decrease in miR157, except in genotypes that were also deficient for miR156.

SPL transcripts are differentially responsive to miR156/miR157To determine the molecular basis for the effect of mir156 and mir157 mutations on leaf morphology, we compared SPL transcript levels in LP1&2 and LP3&4 in wild-type and mir156/mir157 mutant plants (Fig 7).

This observation demonstrates that miR157 is less important for vegetative phase change than miR156, and suggests that it may be less active than miR156.

2

Inappropriate expression of any one of these genes early in shoot development results in the precocious expression of traits that are normally expressed later in development, while the combined loss of these genes prolongs the expression of juvenile traits, and produces a phenotype that is essentially indistinguishable from that of plants constitutively expressing miR156.

During this latter phase, miR156 may act to fine-tune the expression of some of its targets (e. g. SPL3, SPL9, SPL13 and SPL15), and to set a threshold for the expression of other targets (e. g. SPL2, SPL10 and SPL11).

Here we describe the temporal and spatial expression patterns of the transcripts of miR156-regulated SPL genes, the expression patterns of miR156-sensitive and miR156-resistant translational reporters for these genes, and the phenotypes loss-of-function mutations in these genes, individually, and in combination.

miR156/miR157 are expressed at high levels in organs produced early in shoot development, where they repress the expression of their targets, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) transcription factors [3, 5– 9].

The phenotype of plants over -expressing miR156 demonstrates that these genes control many aspects of plant development and physiology, but the functions of individual miR156-regulated SPL genes, and how their expression is regulated by miR156, are largely unknown.

miR156 is thought to repress floral induction by repressing the expression of miR172 [7], thus elevating the expression of miR172-regulated AP2-like transcription factors, which repress the expression of floral activators, such as FT and SOC1 [48– 50].

We interpret the relatively small increase in SPL transcript levels as evidence that miR156 regulates the expression of most of its targets primarily through its effect on translation, rather than via its effect on transcript stability.

A summary of the role of miR156-regulated SPL genes in flowering is shown in Fig 9. Many studies have focused on the role of SPL3, SPL4 and SPL5 in floral induction because these genes are strongly up-regulated during floral induction and cause early flowering when expressed under the regulation of the constitutive CaMV 35S promoter [3, 11, 32, 51, 55, 56, 58].

We found that elevated levels of miR156 have no effect on adventitious root production in the hypocotyl, but reducing miR156 activity inhibits this process, implying that SPL proteins inhibit adventitious root production, just as they inhibit lateral root production in the primary root [31].

To determine if these mutations affect the function of SPL4, we took advantage of the observation that plants over -expressing an SPL4 transcript without a miR156 target site (35S:: SPL4Δ) are early flowering [3].

While the miR156-sensitive constructs for these genes are expressed at very different levels during vegetative development, the miR156-resistant constructs for SPL2, SPL9, SPL10, SPL11 and SPL13 are expressed at roughly the same level in the shoot apex.

However, this latter explanation implies that variation in the abundance of miR156 is functionally irrelevant because it does not produce a change in gene expression, and this is not the case; GUS expression from the miR156-sensitive reporters for SPL3, SPL9, and SPL13 increased substantially during shoot development in a miR156 -dependent fashion.

sSPL3, sSPL9, and sSPL13 were not expressed in leaves 1 and 2, but were expressed in all subsequent rosette leaves, although at a much lower level, and for a shorter time in leaf development than the rSPL reporters; this latter observation suggests that the abundance of miR156 increases as leaves expand, as has been reported in rice [35].

Our results demonstrate that the effect of miR156 on shoot development can be largely, if not completely, explained by its effect on the expression of the 10 SPL genes that have targets sites for this miRNA.

Over -expression and under -expression of miR156 affects the response of Arabidopsis to heat stress [21] and salt stress [22, 64], and it may be that SPL3 regulates these physiological processes rather than shoot morphogenesis.

We conclude that miR156-targetted SPL genes inhibit adventitious root development.

miR156 completely represses the expression of all of these genes in leaves 1 and 2, and represses their expression to varying degrees later in shoot development.

In any case, these results suggest that in addition to directly targeting the transcripts of SPL3, SPL4 and SPL5, miR156 represses the transcription of these genes by elevating the expression of AP2-like transcription factors.

SPL genes are translationally repressed during vegetative development by miR156The level of miR156 decreases dramatically in the shoot apex of Arabidopsis seedlings early in development [34].

We found that miR156 is expressed at very high levels in leaves 1 and 2 and completely blocks the expression of all SPL genes in these leaves.

Our results reveal the unique and shared functions of the members of this gene family, and demonstrate that miR156 plays different roles in the regulation of SPL gene expression at different times in development.

These results are consistent with the expression patterns of the transcripts these proteins (Fig 1), and indicate that most miR156-regulated SPL genes are transcribed throughout the vegetative phase of development in similar patterns, but are strongly and constitutively repressed during this phase by miR156.

In particular, the evidence that AMP1 promotes miRNA -mediated translational repression [65] raises the possibility that the effect of amp1 on juvenile leaf number could be attributable to the effect of this mutation on miR156 activity, rather than being an indirect effect of the accelerated rate of leaf initiation in this mutant.

miR156-regulated SPLs repress adventitious root developmentmiR156-regulated SPL genes have been reported to repress lateral root development in Arabidopsis [31].

The phenotype of transgenic plants constitutively over -expressing miR156 reveals that, as a group, these genes control many aspects of Arabidopsis development and physiology, including the timing of vegetative phase change and floral induction, the rate of leaf initiation, shoot branching, anthocyanin and trichome production on the inflorescence stem, stress responses, carotenoid biosynthesis, and shoot regeneration in tissue culture and lateral root development [3, 6, 7, 16– 28].

This could either mean that miR156 represses SPL expression primarily by translational repression, or that the amount of miR156 is sufficient to maximally induce the cleavage of most SPL transcripts, even when this miR156 is present at relatively low levels.

To obtain a comprehensive picture of the expression pattern of these SPL genes and the contribution of miR156 to this pattern, we produced transgenic plants expressing miR156-sensitive (sSPL) and miR156-resistant (rSPL) fusion proteins tagged with ß-glucoronidase (GUS).

miR156 represses SPL gene expression by cleaving SPL transcripts [3, 59– 61] and by promoting their translational repression [8, 62, 63], but the relative importance of these activities is still unknown.

Vegetative phase change is initiated by a decline in the expression of miR156/157 and the consequent increase in the expression of SBP genes in newly formed organs [7].

The phenotype of plants expressing 35S:: MIR156A reveals the overall contribution of miR156-regulated SPL genes to flowering time.

miR156-resistant constructs were generated by introducing mutations at the miR156 target site that did not alter the amino acid sequence (S1 Table).

We focused on SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 because the phenotype of plants expressing miR156-resistant versions of these genes indicated that they have a significant role in vegetative development.

The phenotype of plants expressing miR156-resistant SPL genes reveals the processes that these genes are capable of regulating, but does not necessarily reveal the processes in which they are actually involved because these transgenes may not be transcribed in a completely normal pattern or at a completely normal level due to their position in the genome or the presence of multiple T-DNAs at each insertion site [36, 37].

In addition to defining the developmental functions of miR156, we show that translational repression is more important for the function of miR156 than previously thought.

We addressed these questions by determining the phenotypes of loss-of-function mutations in these genes individually and in combination, and by comparing the expression patterns and the phenotypes of miR156-sensitive and miR156-resistant reporters for these genes.

SPL genes are translationally repressed during vegetative development by miR156.

In contrast, the only miR156-sensitive constructs that were expressed in the root were sSPL6, sSPL9 and sSPL11.

Arabidopsis has 16 SBP-LIKE (SPL) genes, 10 of which are targeted by miR156 [3, 5, 11– 14].

This is at odds with the conclusions of several previous studies [3, 32, 51, 55, 56], which employed transgenic lines constitutively expressing miR156-resistant versions of these genes.

-regulated SPL genes in floweringIn Col, miR156-regulated genes are less important for floral induction than they are for vegetative phase change.

On the other hand, the effect of amp1 on vegetative phase change is inconsistent with its proposed role in miRNA -mediated translational repression, at least with respect to miR156.

S1 TableSequence of the miR156 target site in miR156-sensitive and miR156-resistant SPL-GUS.

The miR156-sensitive versions of these constructs had a much more restricted expression pattern.

Thus, most SPL genes are transcribed in roots but their expression is strongly repressed by miR156 for at least two weeks after germination.

miR156, and the closely related miRNA, miR157, are the master regulators of the transition from the juvenile to the adult phase of vegetative development (vegetative phase change) [3, 4].

Expression of miR156-sensitive (sSPL) and miR156-resistant (rSPL) SPL-GUS fusion proteins in transgenic plants.

This observation suggests that the differential expression of these genes is due to their differential sensitivity to miR156.

This indicates that other targets of miR156 also have important functions in vegetative phase change.

Sugar was omitted from the medium because it affects the expression of miR156 [90, 91].

miR156-regulated SPL genes have been reported to repress lateral root development in Arabidopsis [31].

As the level of miR156 declines in subsequent leaves, the expression of some SPL genes increases significantly while others remained strongly repressed.

These results provide a detailed picture of the function of miR156-regulated SPL genes in Arabidopsis and the role of miR156 in their regulation.

Phylogenetic analysis demonstrates that miR156-targetted SPL genes in Arabidopsis fall into 5 clades: SPL3/SPL4/SPL5, SPL2/SPL10/SPL11, SPL9/SPL15, SPL6, and SPL13 [26, 33, 39] (Fig 4).

In Arabis alpina and Cardamine flexuosa [70, 71], FLC acts together with miR156 to repress flowering; plants in which both of these factors are expressed at high level are extremely late flowering.

However, miR156 could regulate this process indirectly, by ensuring that floral induction only occurs under appropriate environmental conditions.

During this latter phase, factors that promote the expression of SPL genes, such as GA [54, 56] or floral inductive signals [11, 58], are capable of increasing SPL activity above the threshold set by miR156, enabling phase transitions to occur.

miR156-regulated SPLs repress adventitious root development.

The function of miR156-regulated SPL genes in vegetative development.

Adventitious root production is increased in plants with elevated levels of miR156, such as the Teopod/Corngrass mutants of maize [86] or tobacco transformed with 35S:: miR156 [87], suggesting that SPL genes normally inhibit this process.

Sequence of the miR156 target site in miR156-sensitive and miR156-resistant SPL-GUS.

These observations suggest that miR156 plays a minor role in the regulation of SPL activity during and after the floral transition, and that SPL15 is important for floral induction and/or the floral meristem identity transition, but not for later stages of inflorescence development.

In Arabidopsis, miR156 acts by repressing the expression of 10 SQUAMOSA PROMOTOR BINDING PROTEIN-LIKE (SPL) genes.

miR156 modulates the level of miR172 through its effect on the expression MIR172B [51].

This is not surprising because miR156 is already present at very high levels in young seedlings, and SPL gene expression is strongly repressed during this phase (Fig 2).

Because miR156-resistant transgenes and lack-of-function mutations in SPL3, SPL4, and SPL5 did not have obvious phenotypes, we only conducted detailed analyses of the spl3-1 spl4-1 spl5-1 (spl3/4/5) triple mutant.

The phenotype of loss-of-function alleles of miR156-regulated SPL genes in LD.

To determine how this decrease affects the abundance of the transcripts of individual SPL genes, we used qRT-PCR to measure the level of miR156 and its direct targets in shoot apices over a 5-week period.

In Col, miR156-regulated genes are less important for floral induction than they are for vegetative phase change.

It is therefore significant that the steep decline in miR156 levels early in shoot development is not accompanied by a corresponding increase in SPL transcripts.

The function of individual SPL genes has been investigated primarily by characterizing the phenotypes of plants expressing miR156-resistant versions of these genes under the regulation of their own promoter, or the constitutively expressed Cauliflower Mosaic Virus 35S promoter.

This result suggests that the duplication in Columbia is relatively recent, and also suggests that the basal number of miR156-regulated SPL genes in Arabidopsis is 10, not 11, as is commonly reported.

Consistent with their sequence similarity, the spl9 spl15 double mutant has a stronger phenotype than either single mutant, although this phenotype is relatively mild compared to the phenotype of plants over -expressing miR156 [33].

The level of miR156 decreases dramatically in the shoot apex of Arabidopsis seedlings early in development [34].

Arabidopsis ecotypes with functional alleles of FRI have relatively high levels of FLC [72, 73] and it will be important to determine if miR156-regulated SPL genes are more important for floral induction in these ecotypes.

The abundance of miR156-regulated SPL transcripts in the shoot apices of wild-type Col grown in SD.

As we were generating these stocks we discovered that spl2-1 is semi-sterile in heterozygous but not homozygous condition, and could not be recombined with spl4-1. This behaviour is characteristic of reciprocal translocations, and suggests that spl2-1 contains a translocation with breakpoints near SPL2 on chromosome 5 and SPL4 on chromosome 1. miR156-regulated SPLs have overlapping as well as distinct roles in vegetative phase changePhylogenetic analysis demonstrates that miR156-targetted SPL genes in Arabidopsis fall into 5 clades: SPL3/SPL4/SPL5, SPL2/SPL10/SPL11, SPL9/SPL15, SPL6, and SPL13 [26, 33, 39] (Fig 4).

The function of miR156-regulated SPL genes in flowering.

Other miR156-regulated SPL genes are required for both floral induction and floral meristem identity (Fig 9).

miR156-regulated SPLs have overlapping as well as distinct roles in vegetative phase change.

S3 TableThe phenotype of loss-of-function alleles of miR156-regulated SPL genes in LD.

Mutations that interfere with the activity of miR156, such as ago1, sqn and suo, reduce the number of juvenile leaves [62, 66, 67], whereas amp1 has the opposite phenotype [57].

miR156-regulated SPLs have distinct roles in flowering time and the specification of floral meristem identity.

1006263.g001 Fig 1The abundance of miR156-regulated SPL transcripts in the shoot apices of wild-type Col grown in SD.

We focused on the roles of miR156-regulated SPL genes in shoot and root morphogenesis, but these genes are involved in many other aspects of plant biology as well.

Our results indicate that miR156 does not play a direct role in floral induction because the abundance of miR156 does not change significantly during this process.

However, spl3/4/5 consistently produced approximately 1 extra cauline leaf (Table 1, Experiment 2) and spl2/9/11/13/15 and other genotypes containing these mutations produced two extra cauline leaves in LD (Table 1, Experiment 4; Fig 5C), which was identical to the effect of 35S:: MIR156A.

Indeed, the phenotype of amp1 is more consistent with an increase in miR156 activity than with a decrease in miR156 activity.

This difference is unlikely to be attributable to variation in the strength of the 35S:: MIR156 transgenes used in these experiments because the phenotype of our 35S:: MIR156 line was nearly identical to the spl2/9/10/11/13/15 mutant, implying that this 35S:: MIR156 transgene completely, or nearly completely, eliminates SPL activity.

Six of the rSPL lines (rSPL2, rSPL9, rSPL10, rSPL11, rSPL13 and rSPL15) had a phenotype that resembled the phenotype of plants with reduced levels of miR156, demonstrating that these GUS-fusion proteins are functional (Fig 3A and 3B).

Quantification of miR156 and miR172 was performed according to [97].

To determine the normal functions of miR156-regulated SPL genes we therefore characterized the phenotypes of loss-of-function mutations in these genes (Fig 4).

miR156-resistant SPLs accelerate vegetative phase changeSix of the rSPL lines (rSPL2, rSPL9, rSPL10, rSPL11, rSPL13 and rSPL15) had a phenotype that resembled the phenotype of plants with reduced levels of miR156, demonstrating that these GUS-fusion proteins are functional (Fig 3A and 3B).

Many genotypes displayed small and sometimes statistically significant differences in flowering time relative to Col (Table 1, Experiments 2, 3 and 4), but is difficult to know if these differences are meaningful because we have observed similar variation between different stocks of Col; furthermore, some single and multiple mutant lines flowered earlier than Col, which is the opposite of the expected effect and is inconsistent with the phenotype of higher order mutant combinations and 35S:: MIR156A.

Adding spl11 to the spl2/9/13/15 quadruple mutant (i. e. spl2/9/11/13/15) produced a further increase in juvenile leaf number and rosette leaf number, and adding both spl10 and spl11 (spl2/9/10/11/13/15) produced a vegetative phenotype that was more severe than that of 35S:: MIR156A (Table 1, Experiment 4).

The initial abundance of miR156 was arbitrarily set to 10.

This variability suggests that the effect of 35S:: MIR156 on flowering time under SD is strongly dependent on environmental factors other than photoperiod, such as light quantity and quality, temperature, water availability etc.

Both we and Wang et al [18] found that 35S:: MIR156 had a relatively small effect on flowering time SD, whereas Schwab et al [6] reported that 35S:: MIR156 flowers at about 7 months in SD.

The level of miR156 decreased by about 90% from 1 week to 3 weeks, and declined very little after this time (Fig 1A).

spl2 interacted more strongly with spl9/13/15: the spl2/9/13/15 quadruple mutant produced significantly more juvenile leaves and rosette leaves than spl9/13/15 in both LD and SD, although its phenotype was still much less severe than 35S:: MIR156A (Table 1, Experiments 3 and 4).

Plants transformed with 35S: MIR156A, as well as hypocotyls of the spl2/9/11/13/15 mutant, produced the same number of adventitious roots as wild-type plants (Fig 8B).

The function of miR156.

In SD, spl9/13 produced the same number of cauline leaves as Col, but 35S:: MIR156A and other multiple mutants only produced 5 cauline leaves—4 less than the number of cauline leaves in Col (Table 1, Experiment 4).

The inflorescence of an spl2/9/10/11/13/15 plant is shown to demonstrate that the cauline leaves in this genotype subtend co-florescence buds, as is also the case for the 35S:: MIR156A line.

The addition of spl2, spl10 and spl11 to spl9/13/15 (spl2/9/10/11/13/15) produced a delay in flowering time equal to that of 35S:: MIR156A (Table 1, Experiment 4).

The reporter lines and mutant stocks described here will be useful for defining the full range of their function, and the role of miR156 in sculpting their activity.

Under LD, 35S:: MIR156A and spl2/9/10/11/13/15 plants only flowered 8 days later than normal but produced 22 additional juvenile leaves; under SD, they also flowered 8 days later than normal but produced more than 60 additional juvenile leaves.

miR156-regulated SPLs have distinct roles in flowering time and the specification of floral meristem identityLeaf number cannot be used to measure flowering time in spl mutants because most of these mutations accelerate the rate of leaf initiation (Fig 5A) [17].

We then used in situ hybridization to examine the spatial distribution and the relative abundance of these SPL transcripts in the shoot apices of 3-week-old plants grown in SD, when the level of miR156 was near its minimum.

Flowering was only consistently delayed in SD in the spl2/9/10/11/13/15 hextuple mutant, which flowered later than 35S:: MIR156A in both LD and SD.

Thus, SPL2, SPL9, SPL10, SPL11, SPL13, and SPL15 all promote floral induction, and together explain the effect of 35S:: MIR156A on this process.

Together, these 6 genes account for the effect of miR156 on vegetative phase change.

miR156-resistant SPLs accelerate vegetative phase change.

The miR156-sensitive and miR156-resistant SPL-GUS fusion lines were constructed by placing the GUS gene from pCAMBIA3301 or the GUS+ gene from pCAMBIA1305, at the 5' or 3' end of the coding sequence of different SPL genes (S1 Fig).

3

Detailed molecular evolutionary analyses of miR156/miR529-target sequence showed that loss of miR529 in core eudicots, such as Arabidopsis, is correlated with a more relaxed selection of the miRNA529 specific target element, while miRNA156-specific target sequence is under stronger selection, indicating that these two target sites might be under distinct evolutionary constraints.

MiR156 targets, besides SPL9 and SPL15, exclusively other eight SPL family members [15] and these were shown to be down-regulated in AtMIR156b -overexpressing plants [17].

Additionally, we showed that A. thaliana plants overexpressing MIR529 precursor from a monocot, but not from a basal eudicot, display similar phenotypes as the spl9;spl15 mutant due to the specific down-regulation of these miR156/529 -targeted SPLs.

For instance, A. thaliana has at least 10 MIR156 loci and 10 miR156 -targeted SPLs, whereas rice has at least 12 MIR156 loci, two MIR529 loci, and eight miR156 -targeted and four miR156/miR529 -targeted SPLs [28].

Moreover, overexpression of the MIR529 precursor from Aguilegia in A. thaliana led to the down-regulation not only of AtSPL9 and AtSPL15 genes (which contain both miR156 and miR529 response elements; Fig.   1), but also other SPL genes (Fig.   3b).

In this study, through phylogenic reconstruction of miR156/529 target sequences from several taxonomic groups, we have found that specific eudicot SPLs, despite miRNA529 loss, retained the corresponding target site.

Loss of miR529 function in eudicots is correlated with a more relaxed selection of the miRNA529-specific target element, while miRNA156-specific target sequence is under stronger selection.

Moreover, levels of miR156 transcripts were similar in Col-0 and 35S::OsMIR529b plants (Fig.   5b), suggesting that the accentuated reduction in SPL9 and SPL15 expression in OsMIR529b overexpressors is most likely due to the accumulation of rice miR529b transcripts.

are given in Additional file 1 Overexpression of a basal eudicot microRNA529 precursor in A. thaliana phenocopies miR156 overexpressorAlthough miR156 is highly conserved, being present in all plant species assessed thus far, miR529 seems to be restricted to particular taxonomic groups [12].

Overexpression of a basal eudicot microRNA529 precursor in A. thaliana phenocopies miR156 overexpressor.

Interestingly, sites for miR156 reside in coding as well as untranslated regions of target sequences, whereas miR529 binding sites are chiefly located in coding regions and overlap with miR156 sites [24, 25].

The 5′-ends of the SPL15 cleavage products preferentially map to miR156In line with the observed phenotypes and expression analyses, RACE analysis of SPL15 cleavage sites demonstrated that transcripts are chiefly targeted by miR156 in 35S::AqcMIR529 plants (Fig.   3c).

The 5′-ends of the SPL15 cleavage products preferentially map to miR156 In line with the observed phenotypes and expression analyses, RACE analysis of SPL15 cleavage sites demonstrated that transcripts are chiefly targeted by miR156 in 35S::AqcMIR529 plants (Fig.   3c).

Importantly, over -expression in Arabidopsis of MIR529 precursor from a monocot, but not from a basal eudicot, demonstrates specific miR529 regulation of AtSPL9 and AtSPL15 genes, which contain conserved responsive elements for both miR156 and miR529.

In comparison with spl9;spl15 double mutant and 35S::OsMIR529b lines, 35S::MIR156a line displays more severe, aberrant vegetative and reproductive phenotypes (Table  1; [35]), which is likely due to the fact that additional miR156 -targeted SPL genes act redundantly to regulate leaf initiation and phase change [43].

As expected, several SPL genes were down-regulated in the 35S::MIR156a plants (Fig.   5b).

Interestingly, both miRNAs target sequences overlap in some members of the SQUAMOSA promoter -binding protein like (SPL) family, raising important questions regarding the diversification of the miR156/miR529 -associated regulatory network in land plants.

In this study, we extended our knowledge regarding evolutionary and functional divergences between miR529 and miR156 regulation on their conserved targets.

MiR156 and miR529 show overlapping expression patterns during rice vegetative development.

In contrast to miR156, the effects of over -expressing or down -regulating miR529 have yet to be examined in transgenic/mutant monocot plants.

Another possibility is that the combinatory action of miR156 and miR529 leads to the regulation of distinct targets in specific lineages, such as in Physcomitrella patens [27].

In line with this observation, the percentage of nucleotide identity within the “target site” block (including both miR156 and miR529 response elements) is lower among eudicot SPL genes (58.7 %) than among monocot and bryophyte ones (81.3 and 86.7 %, respectively) (Fig.   2).

This analysis indicated that SPLs containing miR156/529 target sites have a common origin in land plants (Fig.   1b).

It is possible that the interplay between miR156 and miR529 regulation of specific SPLs be important to fine-tune flower architecture development in monocots, particularly in grasses [26, 37].

c Spatiotemporal expression patterns of miR529 and miR156 in rice shoot apical meristem (SAM).

are given in Additional file 1 To further explore the evolutionary relationship of miR156/529 common targets, phylogenetic inference of SBP-box genes containing the miR156/529-responsive element was estimated using maximum-likelihood (ML) and Bayesian inference methods.

This suggests that, whereas MIR529 and MIR156 genes have undergone distinct evolutionary fates [25], their mutual targets (which contain the miR156/529-responsive element) have been more conservative even in species which apparently have lost MIR529 genes.

Amino acids coded by miR156/529 target site are shown.

Group I included known miR156/529 SPL targets in bryophyte, whereas group II contained various monocot and core eudicot SPLs harboring conserved binding sites for miR156/529.

c Target sites for miR156 and miR529 in A. thaliana SPL9 and SPL15 and A. lyrata SPL transcripts.

Fig. 4Expression patterns of miR529 and miR156 in Oryza sativa.

Transgenic A. thaliana plants transformed with the Aquilegia -overexpressing construct had phenotypes similar to 35S::MIR156a plants, such as a high number of smaller, more rounded rosette leaves (Fig.   3a).

To further elucidate the evolutionary fates of eudicot SPLs containing the miR156/529-responsive element, we analyzed two blocks in SPL sequences: “SBP domain” block, which contains nucleotides of the SBP domain [16] plus few nucleotides upstream/downstream, and “target site” block, which contains nucleotides that comprise both miR156/529-responsive elements (see ).

In contrast, such drastic changes did not occur for the nucleotides specifying miR156 target site (Fig.   2).

In line with the observations of Schwarz and co-workers [29], we also observed that the double mutant spl9;spl15 showed an intermediate behavior between Col-0 and miR156 overexpressor (Table  1).

are given in Additional file 1 To further explore the evolutionary relationship of miR156/529 common targets, phylogenetic inference of SBP-box genes containing the miR156/529-responsive element was estimated using maximum-likelihood (ML) and Bayesian inference methods.

Additional file 1: Predicted SBP/SPL targets from eudicot, monocot, and bryophyte species that contain miR156/529-responsive element.

Fig. 2DNA Alignments of miR156 and miRNA156/529 Target Sites.

A broader evolutionary analysis of MIR156 and MIR529 genes and their targets including eudicot species should offer valuable insight into this issue.

In plant lineages containing both miRNA genes, differential expression of miR156 and miR529 in vegetative and reproductive organs/tissues might have favored lineage-specific retention of miR156/529 sequence variants in their genomes [26].

Based on these observations and given that AqcMIR529 precursor is more conserved with MIR156-like precursors (Additional file 3), we propose at least two non-exclusive possibilities: (1) the predicted AqcMIR529 precursor is more likely paralogous to AqcMIR156a and b genes and would produce a miRNA156-like small RNA; (2) AqcMIR529 precursor might have accumulated mutations in the miR529 sequence as recently proposed [25], leading to a loss of miR529 biogenesis and/or function.

Parallel analysis of RNA end (PARE) signatures that are derived from rice degradome and that only mapped to the pre-miRNAs can give additional evidences of roles of miR156 and miR529 in rice development.

miR156 miR529 Evolution Arabidopsis Eudicots MicroRNAs (miRNAs) are small RNAs important to transcriptional and post-transcriptional regulation in animals, plants, and viruses.

Our data support the notion that particular miRNA156 family members might have compensated for the loss of miR529 regulation in eudicot species, which concomitantly may have favored diversification of eudicot SPLs.

SPL genes can be roughly separated into two major groups–long and short–the latter containing responsive elements for miR156 and, in some species, for miR156 and miR529.

Surprisingly, we found SPL genes from several species that retain a highly conserved and overlapping responsive element (25 nt in length) for both miRNAs (namely miR156/529-responsive element; Fig.   1a and Additional file 1), independently of the presence of MIR529 genes in their genomes.

To get a better view of the MIR156/529 gene evolution, the phylogenetic relationship of these miRNAs was accessed using the maximum-likelihood (ML) approach.

For phylogenetic analyses, we included MIR156 and MIR529 precursors from Physcomitrella patens, monocot species (Oryza sativa, Zea mays, Brachypodium distachyon, and Sorghum bicolor), a basal eudicot (Aquilegia coerulea), and precursors of MIR156 genes from Arabidopsis thaliana.

These observations raised the question of whether this MIR precursor of Aquilegia defined as MIR529 is indeed a MIR156 homolog.

Sequences of MIR156 and MIR529 precursors (pre-miRNAs) were retrieved from miRBase v. 21 (http://www.

Importantly, our data imply that the miR529-responsive element is conserved and functional in Arabidopsis SPL9 and SPL15 genes, likely due to the selective constraint on the amino acid or RNA secondary structure of the region surrounding miR156/529-responsive element.

Similarly to monocot SPLs, eudicot SPL genes containing the miR156/529-responsive element appear to be under evolutionary constraints distinct from those containing only the miR156-responsive element.

Harpin structure predictions of MIR529 and MIR156 precursors were estimated using MFOLD3.2 algorithm [60].

It is also possible that new miR156 family member(s) have replaced miR529 functions in eudicots.

It is conceivable that other core rosids and/or closely related species of A. thaliana share similar miR156/miR529/SPL evolutionary history, though such confirmation requires future studies.

a Alignments of the 25-nt miR156/529-response element were done using ClustalW (http://www.

For instance, miR156 is conserved in all Angiosperms studied thus far.

are given in Additional file 1 Although miR156 is highly conserved, being present in all plant species assessed thus far, miR529 seems to be restricted to particular taxonomic groups [12].

Probes of 3′ -labelled LNA -modified oligonucleotides detecting miR156 and miR529 as described [38] were hybridized with longitudinal sections of the SAM from 25-DAG rice seedlings.

b Rooted ML phylogenetic tree depicts the relationship between SPLs containing the miR156/529-response element from representative species.

Distinct from the basal eudicot Aquilegia, it is well documented that monocot species retained both MIR156 and MIR529 precursors in their genomes [12, 26, 37], raising the question of whether miR529 regulation has been retained in monocot species because it is essential or it is just a classical case of redundancy reflecting subfunctionalization in which miR529 has a limited effect as compared with miR156.

Group I comprised MIR156 precursors from different species, while group II contained MIR529 precursors from monocots and moss.

Thus, 35S::AqcMIR529 lines showed a stronger tendency toward the phenotype of 35S::MIR156a plants (Fig.   3a).

Accordingly, both SPL9 and SPL15 as well as their orthologs retained the miR156/529-responsive element (Fig.   1b and c).

Transgenic plants 35S::MIR156a and the double mutant spl9-1;spl15-2 were described [35].

b Stem–loop pulsed RT-PCR to detect OsMIR529b precursor, OsmiR529b, miR156, and AtSPL transcripts in Arabidopsis leaf tissues.

a Morphology of 25-day-old plants (Col-0 or wild type, 35S::MIR156a, spl9;spl15, and 35S::AqcMIR529).

Based on available data, it seems that rice MIR156 and MIR529 precursors are differentially processed, which may lead to differential miRNA accumulation across rice tissues/organs (Fig.   4 and Additional file 5).

As Arabidopsis does not have miR529, perhaps particular miR156 family members (such as miR156h.

Interestingly, the predicted MIR529 precursor from the basal eudicot A. coerulea [33] was grouped into group I, with A. thaliana MIR156h and Aquilegia MIR156a and b precursors, indicating a common origin of these miRNAs (Additional file 3A).

Fig. 1Alignment and phylogeny of SPLs containing the miR156/miR529-response element.

a Morphology of six-week-old (upper pannel) and 25-day-old (lowerpannel) plants (Col-0 or wild type, 35S::MIR156a, spl9;spl15 mutant, 35S::OsMIR529b).

For instance, miRNA529 is evolutionarily related to miRNA156 (a highly conserved miRNA in land plants), but it is lost in Arabidopsis thaliana.

Under our long-day (LD) growing conditions the 35S::MIR156a line produced 2.8 times more juvenile leaves than Col-0 (wild type), similarly to data previously reported [17], whereas 35S::OsMIR529b and spl9;spl15 plants produced, on average, only 1.4 times more.

We have shown that, although MIR529 genes have been lost in Arabidopsis and perhaps in all eudicot species, particular SPL genes in these species retained the miR529-responsive element, possibly due to the maintenance of synonymous codons for efficient miR156 binding and proper function [10].

Interestingly, miR156 is correlated at the nucleotide level with miR529, sharing 14–16 nt [12].

Accordingly, in such species, transcripts of a subset of SPL family have responsive elements for both miR156 and miR529 [24].

For instance, the miR156/529-responsive element in eudicot SPLs resides only in coding regions, similarly to what is observed in monocots and bryophytes (Additional file 1; [24]).

Our data suggest that miR156 and miR529 families experienced dynamic duplications and losses across embryophytes, through which clade- or species-specific miRNA gene subgroups have arisen or were eliminated.

4

Tissue-specific expression of miR156, miR172, and miR156 -targeted SPL genes in alfalfaTo gain an insight into how miR156 and its target genes are regulated in alfalfa, we evaluated the expression of miR156, its target SPL genes, and miR172 in four tissue types at different developmental time points from the juvenile stage (10 day-old rooted cuttings) to just before flowering.

Our transcriptomic analysis, showed that overexpression of miR156 can affect some similar categories of downstream genes; genes differentially expressed in both genotypes, and which may affect similar phenotypes, but different miR156 expression levels could also affect expression of some unique genes in each genotype, which may affect the degree of phenotypic change relative to WT control.

To gain an insight into how miR156 and its target genes are regulated in alfalfa, we evaluated the expression of miR156, its target SPL genes, and miR172 in four tissue types at different developmental time points from the juvenile stage (10 day-old rooted cuttings) to just before flowering.

Fig. 7Developmental and tissue-specific expression profiles of miR156, miR172, and miR156 -targeted SPL genes in M. sativa.

Genes that are commonly downregulated in both A17 and A11a genotypes include four additional miR156 -targeted SPL genes (MsSPL2, MsSPL3, MsSPL4 and MsSPL9), in addition to the previously reported ones (MsSPL6, MsSPL12 and MsSPL13) [4].

Given the diversity of traits affected by overexpression of miR156 in alfalfa, it is critical to identify and characterize its downstream target genes, especially SPL genes and genes that are regulated by SPLs, as well as understand the functions and behaviours of SPL genes and their target genes by solidly linking each to one or more phenotypes exhibited by miR156OE plants.

In addition, overexpression of AtSPL9 in hyponastic leaves1 mutants - which have lower miR156 expression - caused complete loss of the juvenile phase [52].

This is the first report of changes in global gene expression in response to miR156 overexpression in alfalfa.

The discovered miR156 -targeted SPL genes belonging to different clades indicate miR156 plays fundamental and multifunctional roles in regulating alfalfa plant development.

Tissue-specific expression of miR156, miR172, and miR156 -targeted SPL genes in alfalfa.

To illustrate changes in global gene expression induced by miR156 overexpression in alfalfa, we conducted (RNA-Seq) on two miR156OE alfalfa genotypes (A11a and A17) generated in our previous study, and which showed reduced plant height and stem thickness; increased branching (main and lateral branches) and node numbers, as well as increased trichome density in leaves [4].

In summary, this is the first report on the effect of miR156 overexpression on global gene expression in alfalfa.

Expression analysis showed that miR156 was primarily expressed in the leaves, with the highest levels observed at the earliest time point, 10 days (Fig.   7a).

The predicted miR156 target sequence (highlighted in yellow) was located in the 3’ untranslated region of (a) MsSPL2, (b) MsSPL3, and (c) MsSPL4 and (d) the open reading frame region of MsSPL9.

The multitude of traits affected in alfalfa by miR156 overexpression could be explained by the fact that its SPL targets, i. e. MsSPL2/3/4, MsSPL6, MsSPL9, MsSPL12 and MsSPL13, belong to clades VI, IV, VIII, V and VII, respectively (Fig.   6a).

A d e novo assembled alfalfa transcriptomeIn order to illustrate the role of miR156 in alfalfa plant development, WT and the two most prominent miR156OE genotypes A11a and A17 [4] were selected for Next Generation Sequencing at the transcriptome level to detect differentially expressed genes (DEGs).

In Lotus japonicus, miR156 -targeted genes, SPLs and WD40, can prolong developmental phase transition, delay flowering time and enhance shoot branching [24].

In addition, three SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL) genes (MsSPL6, MsSPL12, and MsSPL13) were found to be downregulated via transcript cleavage by miR156 in alfalfa [4].

MiR156 and its SPL target genes play crucial roles in regulating different aspects of plant growth and development [6– 10].

The Student’s t test was used to analyze the significant differences of each of the tested genes between WT and miR156OE genotypes A11a and A17 (* p < 0.05, ** p < 0.01) In order to illustrate the role of miR156 in alfalfa plant development, WT and the two most prominent miR156OE genotypes A11a and A17 [4] were selected for Next Generation Sequencing at the transcriptome level to detect differentially expressed genes (DEGs).

The height of the letter (amino acid) at each position represents the degree of conservation MsmiR172 is downregulated in miR156OE alfalfa plants MiR156 and miR172 signals are integrated at the SPL3, SPL4, SPL5 and SPL9 genes in the mo del plant Arabidopsis [36, 37].

Among the twenty clones sequenced for each gene, transcript cleavage was detected in all four SPLs outside of their predicted miR156 target sites: 54 bp upstream in nine MsSPL2 clones (Fig.   5a), 42 bp downstream in sixteen MsSPL3 clones (Fig.   5b), 143 bp upstream in eleven clones and 130 bp upstream in one clone of MsSPL4 (Fig.   5c), and 350 bp upstream in seven MsSPL9 clones (Fig.   5d).

Based on the phylogenetic tree analysis, all the current detected SPL genes in the miR156OE plants belong to five different clades, indicating that miR156 plays fundamental and multifunctional roles in regulating alfalfa plant development.

The present analysis investigates whether additional SPL genes are targeted for transcript cleavage by miR156, and what other genes are differentially expressed in miR156OE alfalfa plants.

Under short day conditions, the three genes (AtSPL3/4/5) are negatively regulated by miR156 in an age -dependent manner, and are positively regulated by SOC1 through the GA pathway [36, 46].

In general, MsSPL6 and MsSPL13 had an opposite expression pattern to miR156, with the highest transcript levels observed in the leaves at 40 days (Fig.   7c, e).

These genes are thus potential targets for transcript cleavage by miR156 in alfalfa.

Novel SPL targets of miR156 in alfalfa.

b Length distribution of de novo assembled transcripts As miR156 overexpression affects a number of traits in alfalfa plants [4], we set out to identify DEGs that may be responsible for such traits.

However, unlike findings in Arabidopsis [13], cleavage sites for MsSPL2/3/4 and MsSPL9 in alfalfa were not detected within the predicted miR156 target region.

The Student’s t test was used to analyze the significant differences of each of the tested genes between WT and miR156OE genotypes A11a and A17 (* p < 0.05, ** p < 0.01) We previously generated six alfalfa genotypes (A16, A8a, A8, A11, A17 and A11a) with increased miR156 expression [4].

Transgenic alfalfa plants overexpressing a precursor of alfalfa microRNA156 (MsmiR156) were recently generated by our group.

Four additional SPLs (MsSPL2/3/4 and MsSPL9) were discovered to be targeted for silencing by miR156 in alfalfa.

Recently, we overexpressed a precursor of miRNA156 (MsmiR156) in alfalfa, and this led to up to a 2-fold increase in biomass yield, delayed flowering time, enhanced cellulose content and reduced lignin, producing an overall improvement in biomass quality [4].

Fig. 4Validation of the miR156 targeted SPL genes in miR156OE plants using qRT-PCR.

Clades I, II and III represent SPL genes that are not targeted by miR156 (not highlighted with colour in Fig.   6a), while genes from clades IV, V, VI, VII and VIII can undergo cleavage by miR156.

Among the differentially expressed SPL genes, we hypothesize that MsSPL2/3/4 (clade VI) may perform similar functions as AtSPL3/4/5 in Arabidopsis (Fig.   6a), because both of these two groups of SPLs are relatively small in size (420–550 bp) and contain complementary sequences of miR156 in the 3’ UTR.

Many of these GO terms could reflect some traits affected by miR156 overexpression.

Therefore, it appears that diverse levels of miR156 expression may affect alfalfa traits differently.

These seven SPL genes belong to genes phylogeny clades VI, IV, VIII, V and VII, which have been reported to be targeted by miR156 in Arabidopsis thaliana.

MsSPL9, discovered in this study, to be regulated by miR156 in alfalfa, belongs to clade VIII.

The student t test was used to analyze the significant differences of each tested gene between WT and miR156OE genotypes A11 and A17 (* p < 0.05, ** p < 0.01) To investigate whether miR156 directly targets the four newly discovered SPL genes, we identified their predicted miR156 recognition sites using sequence alignment and used a modified 5’-RACE technique [4] to test for transcript cleavage.

In Arabidopsis, miR156 regulates 10 out of 16 Arabidopsis SPL genes that belong to the same clades as those silenced by miR156 in alfalfa [13, 39].

The student t test was used to analyze the significant differences of each tested gene between WT and miR156OE genotypes A11 and A17 (* p < 0.05, ** p < 0.01)To investigate whether miR156 directly targets the four newly discovered SPL genes, we identified their predicted miR156 recognition sites using sequence alignment and used a modified 5’-RACE technique [4] to test for transcript cleavage.

Two of the genotypes, A17 and A11a (with a 1600- and 3400-fold increase in miR156, respectively), were chosen for RNA-Seq analysis.

The transcript levels of miR156 and miR172 were analyzed by stem loop qRT-PCR [58] and SPL genes by normal qRT-PCR using a CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad).

Fig. 5Validation of the miR156 cleavage sites in MsSPL2/3/4 and MsSPL9 transcripts and prediction of the Nuclear Localization Signal.

Detection of miR156 cleavage sites in MsSPL2, MsSPL3, MsSPL4, and MsSPL9 transcriptsThe cleavage sites in alfalfa SPL genes were detected using a modified 5’ rapid amplification of cDNA end (5’-RACE) as previously reported [62].

The height of the letter (amino acid) at each position represents the degree of conservation MiR156 and miR172 signals are integrated at the SPL3, SPL4, SPL5 and SPL9 genes in the mo del plant Arabidopsis [36, 37].

It will be crucial to validate the functions of each SPL gene belonging to different clades to more fully understand the functions of miR156 in determining alfalfa traits.

To further illustrate the molecular mechanisms underlying the effects of miR156 in alfalfa, two miR156OE genotypes (A11a and A17) were subjected to Next Generation RNA Sequencing with Illumina HiSeq.

Relative gene transcript levels of (a) miR156, (b) miR172, (c) MsSPL6, (d) MsSPL12, (e) MsSPL13, (f) MsSPL2, (g) MsSPL3, (h) MsSPL4 and (i) MsSPL9 were analyzed by the 2 [-∆CT] method.

This is consistent with our results, which showed relatively high SPL transcript levels were detected in roots where miR156 transcript was undetectable.

A recent publication reported that AtSPL3, AtSPL9 and AtSPL10 were involved in the repression of lateral root growth, and that miR156/SPLs module participates in lateral root primordia progression [55].

In addition, repression of AtSPL2 and AtSPL11 by miR156 is also required for heat stress memory [12].

Detection of miR156 cleavage sites in MsSPL2, MsSPL3, MsSPL4, and MsSPL9 transcripts.

5

The transcript levels of SPL3 and SPL9, direct target genes of miR156, were also expressed in similar level in all the axillary shoot apices (Fig.   5C).

These results indicate that the level of miR156 expression in axillary shoot apices is irrelevant to the developmental stages of axillary branches in the annual A. thaliana Sy-0. Therefore, our results demonstrate that the developmental fate of all the axillary branches from the same Sy-0 plant is synchronized at a molecular level.

In primary shoot apices, the relative expression levels of pre-miR156a, b, c, and d were gradually decreased upon aging, especially the expression levels of pre-miR156a and c were dramatically reduced from 2 to 3-week (Figure  S5).

Relative expression levels of primary miR156a, b, c and d were normalized to PP2A expression.

miRNA156 levels in all the axillary shoot apices of A. thaliana Sy-0 are similar independent of developmental stagesTo see if asynchronous expression of miR156 precursors in the axillary shoots of A. alpina is a unique feature of perennial plant, we compared the expression with that in a close annual relative, A. thaliana.

Since miR156 is a general key player in phase transitions of plants and MIR156B -overexpressing Pajares fails to flower even after long-term cold exposure [19], such asynchronous expression of miR156 in the axillary branches of Pajares seems to be the basis of maintenance of vegetative shoots after winter.

Since expression levels of miRNA precursors reflect mature miRNA levels in several plant species 17, 25, 26, we analyzed quantities of six miR156 precursors by qRT-PCR, which amplifies the precursor sequences covering the target binding site (131 to 276 bp).

The expression levels of pre-miR156a and b were gradually decreased according to progressive development from 8WS1 to 8WS5 stages.

To see if asynchronous expression of miR156 precursors in the axillary shoots of A. alpina is a unique feature of perennial plant, we compared the expression with that in a close annual relative, A. thaliana.

In Arabidopsis, 11 of 17 genes encoding SPL transcription factors are revealed as targets of miR156, while direct upstream factors of miR156 remain to be discovered [12].

Next, we examined relative expression levels of miR156 precursors in the axillary shoot apices, which are in various developmental stages, developed from 8-week-old Pajares.

Such differential expression of miR156 precursors depending on the developmental stages of axillary apices was observed even after primary shoots were in flowering phase (Fig.   3).

MicroRNA156 expression levels in axillary shoot apices are variable depending on the developmental stages in A. alpina PajaresAge -dependent decrease of miR156 level is conserved in diverse plant species [18].

The other miR156 precursors were expressed too low to compare their values (Figure  S6).

In Pajares, pre-miR156b, c, and d showed relatively weak expression compared to pre-miR156a, thus we focused on pre-miR156a level in the axillary shoots of winter annual Arabidopsis ecotype, Sy-0. In contrast to rapid cycling accessions of Arabidopsis such as Columbia (Col) and Landsberg erecta (L er), Sy-0 shows acropetal development of axillary shoots subtended by cauline leaves.

In contrast, winter annuals of A. thaliana showed synchronized expression of pre-miR156 in all the axillary branches.

For expression analysis of miR156 precursors in various stages of axillary branches of Arabis alpina Pajares, S1 to S5 stages of axillary shoot apices were harvested from 8-week old Pajares before and after vernalization (Figs  2 and 3).

After vernalization, some axillary shoot apices expressing high levels of pre-miR156s in A. alpina maintain vegetative phaseTo make it clear whether miR156 expression levels of primary and axillary shoot apices are related to floral transition, we investigated the transcript levels of pre-miR156a, b and c before and after vernalization.

The expression level of miR156 is higher at seedling stage and is gradually decreased according to age.

Such quantitative results of pre-miR156a levels in axillary shoot apices from different ages, the time from germination, and different developmental stages indicate that the molecular behavior of axillary branches is influenced by both their ages when branching started and their developmental stages when harvested.

Figure 2Expression levels of miR156 precursors in the primary and axillary shoot apices during vegetative growth of A. alpina.

A wide range of transgenic plant species including Arabidopsis, rice, maize, poplar hybrid tree overexpressing miR156 produce excessive number of juvenile leaves and flower extremely late 13, 22.

Figure 3Expression levels of miR156 precursors in the primary and axillary shoot apices of A. alpina after vernalization.

Sampling of axillary shoot apices in Arabis alpina Pajares and Arabidopsis thaliana Sy-0For expression analysis of miR156 precursors in various stages of axillary branches of Arabis alpina Pajares, S1 to S5 stages of axillary shoot apices were harvested from 8-week old Pajares before and after vernalization (Figs  2 and 3).

Expression levels of miR156 in juvenile Pajares plants, younger than 3-week old, are almost unchanged during vernalization, whereas the levels drop rapidly after returning to warm environment [19].

The VS1 and VS2 branches, which were mostly generated during vernalization period, expressed prominently high levels of pre-miR156a and b. Such levels of pre-miR156a and b were higher than the levels detected from the primary shoot apices in juvenile phase, i. e, younger than 3 weeks old primary shoots (Fig.   3).

To elucidate whether developmental stage -dependent expressions of miR156 are completely independent from the physical age of their primary shoot apices, levels of miR156 precursors were compared among S1 branches harvested from 4, 5, 6, 7, and 8 weeks old plants.

The most urgent question is the molecular mechanism behind the synchronous and asynchronous expression of miR156 in the axillary branches in annuals and perennials.

In Pajares, the expression levels of pre-miR156s are maintained during vernalization [19], whereas in Arabidopsis Sy-0, miR156 levels are decreased if vernalized at younger ages but increased if vernalized at old ages (Fig.   6A).

Thus, our study to compare the molecular differences in miR156 expressions and vernalization responses between the perennial Arabis alpina and the close relative annual Arabidopsis thaliana will be useful for future study.

MicroRNA156 expression levels in axillary shoot apices are variable depending on the developmental stages in A. alpina Pajares.

To decide whether juvenility is also an important factor for vernalization response in winter annuals of Arabidopsis, we checked vernalization effect according to the expression levels of pre-miR156a and the ages of Sy-0. Transcript levels of pre-miR156a from the 7-day old Sy-0 was dramatically reduced to 35.0% after 6 weeks of vernalization, as opposed to juvenile Pajares which maintains high levels of pre-miR156a during vernalization [19].

Therefore, we propose that variable expression of miR156 in axillary branches confers polycarpic perenniality to A. alpina.

To test if miR156 level is also decreased according to developmental progress in axillary branches of A. alpina Pajares, we cloned six homologs of miR156 precursors using A. alpina database [34] and designated them as pre-miR156a, b, c, d, f and g depending on the phylogenic analysis and prediction of secondary structure (Figures  S3 and S4).

Xie K Wu C Xiong L Genomic organization, differential expression, and interaction of SQUAMOSA promoter -binding-like transcription factors and microRNA156 in ricePlant Physiol.

miRNA156 levels in all the axillary shoot apices of A. thaliana Sy-0 are similar independent of developmental stages.

A post-transcriptional regulatory module, microRNA156 - SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL), is highly conserved in various plant species and acts as an age -dependent timer regulating phase transitions 13– 21.

Such reports suggest that miR156 has functions promoting juvenile phase and delaying developmental phase transition.

In contrast to this, pre-miR156a levels in the axillary branches from the same Sy-0 were similar irrespective of developmental stages, thus synchronized (Fig.   5C).

As developmental stages were progressed from VS1 to VS5, the transcript levels of pre-miR156a and b were steadily reduced similar to the pattern observed in the primary shoots.

Thus, it is noteworthy that all the S1 axillary shoot apices from plants with diverse ages show higher levels of pre-miR156a than 5-week old primary shoot apices and would not reduce the level below than 3-week old primary shoot apices.

Age -dependent decrease of miR156 level is conserved in diverse plant species [18].

To obtain the information of nucleotide sequences of miR156 precursors in Arabis alpina Pajares, BLAST tool of NCBI (ftp://ftp.

Although the transcript levels of pre-miR156a were dramatically reduced from 4WS1 to 6WS1, the levels from 6WS1 to 8WS1 were not reduced further and maintained that quantity, which was similar level observed in 3 weeks old primary shoot apices.

The transcript levels of pre-miR156a among S1 branches were declined according to the age of plants.

To make it clear whether miR156 expression levels of primary and axillary shoot apices are related to floral transition, we investigated the transcript levels of pre-miR156a, b and c before and after vernalization.

Gray bars, miR156 precursor levels in the primary shoot apices from 3-week to 8-week old (3W~8W) plants.

The transcript level of pre-miR156a was examined in these vegetative S1~S3 and primary shoot apices from 14-week old Sy-0. All stages of axillary shoot apices showed similar levels of pre-miR156a.

For instance, pre-miR156a level in 4WS1, S1 axillary shoot apices from 4-week old Pajares, was 1.9 fold and 4.6 fold higher than 5WS1 and 6WS1 respectively (Fig.   2B).

Transcript levels of pre-miR156a, b and c were checked in the plants treated with 12 weeks of vernalizartion after 8-week growth in long days.

Therefore, our results clearly demonstrate that variation of miR156 levels in axillary branches of Pajares confers polycarpic perenniality but synchronous reduction of miR156 levels in the axillary branches of Sy-0 confers monocarpic traits.

On the contrary, Sy-0 shows holistic flowering, because it cannot maintain vegetative growth due to low levels of pre-miR156a (Fig.   5B and C).

Based on the genomic sequences, we cloned six homologs of miR156 precursors which are highly similar with miR156 precursors in Arabidopsis.

Black bars, miR156 precursor levels in the S1 axillary shoot apices from 4-week to 8-week old (4WS1~8WS1) plants.

Nucleotide sequences of miR156 precursors in A. alpina Pajares are annotated (Table  S4).

Therefore, the transcript levels of pre-miR156a at the end of 6-week vernalization were considerably different in each age (Fig.   6A).

6

In long-day conditions, LOM1 overexpression delayed flowering time (Figure 5A and Figure S3B– S3E) and consistently down-regulated the expression of the MADS-box gene, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1), which was under the direct control of miR156-tageted SPLs [2]; by contrast, SOC1 was up-regulated in lomt mutant along with earlier flowering (Figure 5A and 5B).

Because up-regulation of LOMs (35S::LUC-rLOM1) and down-regulation of SPLs (35S::MIR156F) both reduced TCL1 and TRY expression and triggered ectopic trichomes, we wondered if miR171-LOMs induced trichome formation through affecting the miR156 -targeted SPLs.

The miR156 -targeted SPLs up-regulate trichome negative factors TRY and TCL1 to repress trichome production on stem and inflorescence, whereas miR171 -targeted LOMs counteract the SPLs through protein-protein interaction.

By dissecting molecular mechanisms that control Arabidopsis trichome distribution, we found that the miR171 -targeted LOMs directly interact with the miR156 -targeted SPL9 and SPL2, leading to inhibition of the SPL activities.

The miR156 and its targets, such as SPL9, show reverse expression patterns [2]– [4], whereas miR171 and LOMs have a congruous temporal expression pattern (Figure S7).

Taken chlorophyll content as an example, miR156 overexpression suppresses chlorophyll biosynthesis and this suppression is LOM -dependent (Figure S8A and S8B).

Except promoting the expression of miR172, SPLs positively regulate miR156 expression as well [3].

A recent report showed that overexpression of miR171 (Hvu-pri-miR171a) in barley up-regulated miR156 and repressed vegetative phase transitions [49], which is in contrast with the opposite effects of the two miRNAs in Arabidopsis described herein and reported by others [26], [29], [50].

Taken together, these results demonstrate that the miR171 -targeted LOMs physically interact with the miR156 -targeted SPL9 and SPL2 and may result in attenuation of the SPL function such as regulating trichome patterning.

Although 35S::MIR171B repressed trichome formation on stem in wild-type plants, it did not change the ectopic trichome distribution induced by 35S::MIR156F (Figure 3A–3D), suggesting a requirement of miR156 -targeted SPLs in miR171 -mediated trichome suppression.

Based on the facts that miR156 and miR171 are conserved in plant kingdom and excessive miRNAs cause opposite phenotypes, the interaction between the two miRNA targets coordinate many developmental and morphogenesis events beyond trichome formation.

Because both miR156 and miR171 are timing regulators, the interaction between their targets shed a new light on the endogenous network of plant aging.

Acting downstream of miR156 -targeted SPLs, miR172 also plays roles in developmental timing of Arabidopsis [3].

MicroRNA (miRNA) was first identified as the regulator of the juvenile-to-adult transition in Caenorhabditis elegans [1], and a similar function was later assigned to plant miRNA: miR156 and its target SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL) genes define an endogenous aging and flowering pathway [2], [3].

But this phenotype became less evident with plant aging (Figure S8C– S8E) when the SPL level was increasing, suggesting a possibility that the miR156 -targeted SPLs enhance chlorophyll biosynthesis at least partially through negatively regulating the LOM activity.

In Arabidopsis the miR156 -targeted SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL) transcription factors play important roles as an endogenous age cue in programming phase transition and phase -dependent morphogenesis, including trichome patterning.

Since the miR156 -targeted SPLs function as a key endogenous age cue and SPL9 is one of the highly active SPL members, the LOM-SPL interaction has a profound contribution to programming plant life.

We previously reported that the miR156 -targeted SPLs temporally repress trichome distribution on stem and inflorescence through activating TCL1 and TRY [23].

The miR156 -targeted SPLs can be divided into four clades based on their protein structures, and the clades composed of SPL3/4/5 and SPL9/15 both promote phase transition [2]– [4].

Remarkably, miR156 and miR171 function antagonistically in regulating many aspects of plant growth and development, including but far beyond the age -dependent trichome formation.

In Arabidopsis there are 17 SPL genes, 11 of which contain a miR156 target site.

Although slightly higher in 20-day-old 35S::LUC-rLOM1 plants, the miR156 level was not altered in the stem of lomt or LUC-rLOM1OE plants (Figure 6B), neither was SPL9 expression (Figure S5).

Plants overexpressing miR156 developed ectopic trichomes on the stem and floral organs, whereas plants with elevated SPLs produced fewer trichomes after bolting [23].

The miR156 overexpression delays phase transition and startup of flowering.

DELLAs are degraded in response to gibberellin [37]– [39], resulting in release of the factors they bind, and the SPL-DELLA interaction integrates the hormone signals to the miR156-SPL pathway in regulating plant flowering [5].

Since miR156-SPLs define a major endogenous age cue, this provides a straightforward mechanism that connects plant phase transition with trichome development.

A mo del for miR171-LOM and miR156-SPL interaction in regulating trichome formation and other biological events.

Mining of genome data revealed that both miR156 and miR171 are highly conserved in land plants from moss (Physcomitrella patens) to flowering plants of both monocots and dicots [45], and in crop plants they control important agronomic traits [46], [47].

1 was set to 1. (D) The mature miR171 level was increasing with age, and the miR156 showed an opposite accumulation pattern.

Thus it is unlikely that LOMs have a significant effect on miR156 abundance.

However, the miR171-LOM module is different from the miR156-SPL.

Under long-day conditions, the miR156 accumulation was similar in 10-day-old seedlings (Figure 6A).

7

In line with previous findings on stress-regulated miRNAs in Arabidopsis and rice [17, 34], the up-regulated expression of miR156 and miR159 may lead to the repression of their predicted target TFs which would lead to the activation of defense pathways in response to LPS perception.

The sequencing analysis showed that in both callus and leaf tissues, various stress regulated-miRNAs were differentially expressed and real time PCR validated the expression profile of miR156, miR158, miR159, miR169, miR393, miR398, miR399 and miR408 along with their target genes.

In both callus and leaf tissues, four miRNAs (miR156, miR169, miR398 and miR408) were up-regulated, two miRNAs (miR158, and miR393) were down-regulated with two other miRNAs (miR159 and miR396) only found in the callus tissue (Figure  5A, B).

In callus and leaf tissues, miR408 showed the highest relative expression contrary to the sequencing analysis which indicated that the most abundant up-regulated miRNAs was miR156.

The sequencing revealed that miR156 was up-regulated with a 3.9 fold change in the treated callus tissue and without any expression change in the leaf tissue (Tables  1 and 2).

In total about 86 targets genes were predicted among which most of them encode transcription factors (TFs) targeted by miR156, miR159, miR165, miR166, miR169, miR319, miR408, miR829, miR2934, miR5029 and miR5642.

The expression data was then compared against the H-T sequencing data analysis which revealed that five (miR156, miR169, miR398, miR399 and miR408) of the nine miRNAs in callus tissue and six (miR158, miR159, miR169, miR393, miR396 and miR408) of the nine miRNAs in leaf tissue showed expression patterns that were similar to those observed with the H-T sequencing data.

To validate the sequencing results with the bioinformatics -based analysis and based on their key function in gene regulation, the following mature miRNA were selected for expression profile analysis: miR156, mi158, miR159, miR169, miR393, miR396, miR398, miR399 and miR408.

This indicates that the up-regulation of miR156, leading to lower levels of SPL, would enhance the A. thaliana response to LPS.

This was also the case in the leaf tissue for miR156, miR159, miR399 with their corresponding target genes; squamosa promoter -binding-like protein, Myb domain protein 101 and ubiquitin-protein ligase respectively.

Experimental studies in Arabidopsis and other plants have shown that abiotic and biotic stresses induce differential expression of a set of miRNAs such as: miR156, miR159, miR165, miR167, miR168, miR169, miR319, miR393, miR395, miR396, miR398, miR399, and miR402 [7, 18- 23].

The most differentially expressed miRNA with a highest fold change in the callus tissue was miR156 and in leaf tissue, miR167.

are regulated by the identified miR156, miR159, miR165, miR166, miR169, miR319, miR408, miR829, miR2934, miR5029 and miR5642 (Tables  3 and 4).

8

Above a threshold concentration, the circadian fluctuations of glucose, one of the final outputs of starch degradation (Stitt and Zeeman, 2012) that is regulated by starch and Tre6P (Martins et al., 2013) promotes GA biosynthesis (Cheng et al., 2002; Yu et al., 2012; Paparelli et al., 2013) and blocks HXK1 activity, resulting in downregulation of miR156 expression (Yang et al., 2013; Yu et al., 2013).

Gibberellin regulates the Arabidopsis floral transition through miR156 -targeted SQUAMOSA promoter binding-like transcription factors.

One possibility is that HXK1 controls juvenility and floral signal transduction by regulating the expression of miR156 (Yang et al., 2013).

Sugar promotes vegetative phase change in Arabidopsis thaliana by repressing the expression of MIR156A and MIR156C.

The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis.

Interestingly, the Tre6P pathway controls the expression of SPL3, SPL4, and SPL5 at the SAM, partially via miR156, and partly independently of the miR156 -dependent pathway via FT (Wahl et al., 2013).

The fact that glucose, fructose, sucrose and maltose, partially, reverse this effect (Wang et al., 2013; Yu et al., 2013), indicates that photosynthetically derived sugars are potential components of the signal transduction pathway that repress miR156 expression in leaf primordia.

In this scenario, HXK1 that is largely dependent on ABA biosynthesis and signaling components (Zhou et al., 1998; Arenas-Huertero et al., 2000) promotes miR156 expression under low sugar levels.

miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana.

The Tre6P-miR156 regulatory module.

The HXK1-miR156 regulatory module.

miR172 signals are incorporated into the miR156 signaling pathway at the SPL3/4/5 genes in Arabidopsis developmental transitions.

Recent studies have shown that metabolic enzymes, ABA, GA and Tre6P may integrate into the miR156/ SPL-signaling pathway.

The microRNA156-SQUAMOSA PROMOTER BINDING PROTEIN-LIKE3 module regulates ambient temperature-responsive flowering via FLOWERING LOCUS T in Arabidopsis.

Vegetative phase change is mediated by a leaf-derived signal that represses the transcription of miR156.

The juvenile-to-adult phase transition is accompanied by a decrease in microRNA156 (miR156A/miR156C) abundance and a concomitant increase in abundance of miR172, as well as the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL3/4/5) transcription factors (TFs; Wang et al., 2009; Wu et al., 2009; Jung et al., 2011, 2012; Kim et al., 2012).

Therefore, from a molecular perspective juvenility can be defined as the period during which the abundance of antiflorigenic signals such as miR156/miR157 is sufficiently high to repress the transcription of FT and SPL genes (Matsoukas, 2014).

Interestingly, defoliation experiments (Yang et al., 2011, 2013; Yu et al., 2013) show that removing the two oldest leaves results in increased miR156 levels at the SAM and a prolonged juvenile phase length.

9

Many SPL members were targeted by the miR156/157, and the miR156/SPL module plays important roles in diverse developmental processes in Arabidopsis, including shoot development, the phase change from vegetative growth to reproductive growth, and tolerance to abiotic stresses 3– 5. Various functions of SPL genes were also reported in other plant species, including governing yield-related traits in hexaploid wheat [6], redundantly initiating side tillers and affecting biomass yield of energy crop in switchgrass [7], regulating floral organ size and ovule production in cotton [8], and regulating ovary and fruit development in tomato [9].

Wu G Poethig RSTemporal regulation of shoot development in Arabidopsis thaliana by miR156 and its targetSPL3.

Interestingly, motif 7 was existed in those SPLs, and it is a potential target site for the miR156/miR157.

11 of 19 SPLs in rice [45], 18 of 28 SPLs in Populus [20], 17 of 41 SPLs in soybean [11] were reported to be potential targeted by certain miR156.

In this study, we also found that 31 of 59 identified SPLs were potentially targeted by miR156 in upland cotton, which are from 6 different orthologs (GhSPL2, GhSPL6, GhSPL9, GhSPL10 and GhSPL13).

In Arabidopsis and rice, motif contains miR156 recognition element was also reported in all miR156 -targeted SPLs 4, 25, 45.

Thus, SPL gene function analysis mainly through significantly represses the SPL transcriptions by over -expression of miR156/miR157.

Motif 7 contained the miR156/miR157 recognition element as a target site for the miR156/miR157 in 3′ UTR.

2015.01.008 25617719 5. Xu MDevelopmental functions of miR156-Regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes in Arabidopsis thalianaPLoS Genet.

Among 17 SPLs in Arabidopsis, 10 were putative targets of miR156/157 4, 44.

Xie K Wu C Xiong L Genomic organization, differential expression, and interaction of SQUAMOSA promoter -binding-like transcription factors and microRNA156 in ricePlant Physiol.

10

Beyond miR156 and miR172, miR164 targets genes encoding NAM proteins, and may be involved in regulating ear development (Table  3), similar to how miR164 is postulated to regulate NAC-domain targets in Arabidopsis [58].

Interestingly, some target transcripts were regulated by pairs of miRNAs: both miR156 and miR529 targeted five members of the same SBP family, and the miR159/319 pair regulated three MYB domain transcription factors.

zma-miR156 targeted 13 unique genes including SPL genes and zma-miR529 targeted 18 unique genes including ZCN19 (a possible maize FT ortholog) (Table  3), indicating that these two families might play key roles in ear development [31, 54].

miR156a-l probably targets several SPL genes during the juvenile-to-adult phase transition in maize (Figure  4a, Tables  2 and 3), and is postulated to indirectly activate miR172 via SPL[31].

The six most abundantly expressed miRNA families were miR166, miR168, miR167, miR156, miR159, and miRs6.

Among the conserved miRNA families, zma-miR156 and zma-miR529 had the highest number of gene targets.

Previous studies showed that miR156 and miR172 function throughout flower development from the earliest stages (floral induction, stage I) to very late stages (floral organ cell-type specification, stage IV) [31- 34].

Figure 4 miR156 and miR172 in maize flower development (Adapted from Poethig (2009).

Of these, 45 miRNAs aligned with 59 members of 21 maize miRNA families, while the others corresponded to members of miRNA families from three other plant species, including rice (osa-miR156/162/164/168/396/529) Arabidopsis (ath-miR156/164/167) and sorghum (sbi-miR396).

The levels of miR156 and miR172 are conflicting during phase transition (Figure  4b).

11

The up-regulation of tae-miR156 and down-regulation of its putative target SPL genes Ta3711 and Ta7012 were also validated in wheat (Xin et al., 2010).

AGO1 acting through miR156 and its target SPLs appears to mediate the adaptation to recurring heat stress (HS memory) by inducing the expression of HS memory–related genes (Stief et al., 2014).

In Arabidopsis, miR156 isoforms are highly induced after heat stress and target SQUAMOSA-PROMOTER BINDING-LIKE (SPL) transcription factor genes (especially SPL2 and SPL11) that are master regulators of developmental transitions (Stief et al., 2014).

mes-miR156a, 159a, 160a, 397a, and 408 were down-regulated by heat and drought stresses in cassava (Ballen-Taborda et al., 2013).

However, the roles of the down-regulated miR156 in rice (Sailaja et al., 2014) and cassava (Ballen-Taborda et al., 2013) remain unknown.

The miR156-SPL pathway in rice also functions in other stresses such as cold, salt and drought stress, suggesting a vital role of miR156 in modulating plant development and responses to abiotic stress (Cui et al., 2014).

The miR156-SPL9-DFR pathway coordinates the relationship between development and abiotic stress tolerance in plants.

Arabidopsis miR156 regulates tolerance to recurring environmental stress through SPL transcription factors.

The involvement of AGO1 and the miR156-SPL pathway has been demonstrated to maintain the short memory of acquired thermotolerance in the adaptation to recurring heat stress at the physiological and molecular level in Arabidopsis (Stief et al., 2014).

Some members of the miR156 family are induced by heat in Arabidopsis (Zhong et al., 2013; Stief et al., 2014), Brassica rapa (Yu et al., 2012b), and wheat (Xin et al., 2010; Kumar et al., 2014), but are repressed by heat in rice (Sailaja et al., 2014) and cassava (Ballen-Taborda et al., 2013).

Several miRNA families seem to be responsive to heat in at least four species, including miR156, 160, 167, 168, 169, 171, 395, 398, 408, and 827 families (Table 2).

12

SPL genes from A. lyrata, O. sativa, Populus trichocarpa, Physcomitrella patens, Ricinus communis, Sorghum bicolor, Vitis vinifera, and Z. mays are targeted by the miR156 family.

Among the 16 genes in this family, CDSs of eight paralogs have been targeted by miR156a: AT1G27360 (SPL11), AT1G27370 (SPL10), AT1G69170 (SPL6), AT2G42200 (SPL9), AT3G57920 (SPL15), AT5G43270 (SPL2), AT5G50570 (SPL13), and AT5G50670 (SPL13).

Binding of the miR156 Family with the mRNAs of SPL Orthologs SPL genes from A. lyrata, O. sativa, Populus trichocarpa, Physcomitrella patens, Ricinus communis, Sorghum bicolor, Vitis vinifera, and Z. mays are targeted by the miR156 family.

For example, about half of the SPL family genes are targets for the miR156 family.

Binding of the miR156 and miR157 Families with the mRNAs of SPL Paralogs.

Binding of the miR156 Family with the mRNAs of SPL Orthologs.

The sequences of miR156g, miR156h, miR156i, and miR156j differ from the miR156a–f sequence by one or two nucleotides; however, miR156a–j bind to the same site within each of the SPL paralog mRNAs, which is specific for the miR156 family.

The miR157d sequence differs by one nucleotide from the miR156h sequence and by two nucleotides from miR156a sequence.

The SPL3 and SPL5 mRNA -binding sites for miR156a are located in the 3′UTR, and their nucleotide sequences have significant conservation with those in the CDS.

The miR156 family consists of 10 miRNAs (miR156a–j), and miR156a–f have identical nucleotide sequences (miRBase).

miR156 family members are predicted to be associated with the mRNAs of genes encoding the DNA -binding proteins SPL1–SPL16 with varying degrees of prediction reliability.

According to the miRBase database, ath-miR156a–j and ath-miR157a–d belong to different families.

The mRNAs of the SPL3 orthologous genes in A. lyrata and P. trichocarpa have miR156a -binding sites in the 3′UTR.

This variability may indicate the importance of the GU dinucleotide in enhancing the binding of miR156a with the mRNAs.

For all of the studied genes, the GUGCUCUCUCUCUUCUGUCA polynucleotide is completely conserved in the ath-miR156a -binding sites within the mRNA (Figure 2(a)).

Binding of the miR156 and miR157 Families with the mRNAs of SPL ParalogsWe found that, among 328 miRNAs in A. thaliana, the miR156 and miR157 families are shown to have strong binding sites within the squamosa promoter binding protein-like (SPL) gene family of transcription factors.

The miR156a -binding sites within the SPL mRNAs are identical and consist of the conserved nucleotides GUGCUCUCUCUCUUCUGUCA.

For example, Oryza sativa and Zea mays have only the miR156 family and not the miR157 family (miRBase).

The maximal interaction energy (Δ G [m]) for miR156, miR157, miR170, miR171, and their families was equal to the binding energy of perfectly complementary sequences.

We found that, among 328 miRNAs in A. thaliana, the miR156 and miR157 families are shown to have strong binding sites within the squamosa promoter binding protein-like (SPL) gene family of transcription factors.

miR157a–d bind to the mRNAs of the SPL family at the same site as miR156a–j (Table 2).

The SPL5 mRNAs from P. patens and Z. mays have miR156a-interaction sites within the CDS.

Therefore, we suggest that the miRNAs of the miR156 and miR157 families belong to the same family.

The miR157a–c sequences differ from the miR156a sequence by one nucleotide at the 5′-end.

The Δ G/Δ G [m] value for the miR156a -binding sites ranged from 90.2% to 91.4%, which indicates a strong interaction between this miRNA and the mRNAs of the SPL gene family (Table 2).

The SPL5 mRNA from A. thaliana and V. vinifera also has miR156a -binding sites in the 3′UTR.

It is likely that ath-miR156a–j and ath-miR157a–d are members of the same family.

13

It has been reported similar saccharification improvement in switchgrass that over-express miRNA156, a strong inhibitor of the progression to flowering (Chuck et al., 2011).

Weak miRNA156 over -expressing lines of switchgrass had better saccharification yield from starch than strongly expressing lines, probably because their growth was less impaired.

In addition to CO and SPL/miRNA156, post-translational regulation of starch synthesis enzymes by reactive oxygen species (Lepisto et al., 2013) and T6P signaling through the stress integrating kinase SnRK1 regulate starch levels (Baena-González et al., 2007; Mattos Martins et al., 2013).

In switchgrass, down-regulation of SPL3-5 by miRNA156 promotes late flowering and improvement of saccharification yield by both amylolytic and cellulolytic treatments, without modulation of CO/FT ortholog transcripts (Chuck et al., 2011), supporting the idea that CO and SPL/miRNA156 are parallel pathways in leaves that impact flowering time (Wahl et al., 2013).

For example, in switchgrass engineered to over-express miRNA156, young nodes accumulated more starch than WT mature nodes (Chuck et al., 2011).

Starch saccharification yield was increased by over -expressing miRNA156 (Chuck et al., 2011), a factor downstream of the trehalose-6-phosphate (T6P) carbon flux sensing machinery (Wahl et al., 2013).

Overexpression of miRNA156 promoted starch accumulation in switchgrass but not in Arabidopsis, maize or tobacco (Chuck et al., 2011).

The expression of all these transcripts was similar to that of WT plants suggesting independent activity from SPL/miRNA156.

However, miRNA156 is a repressor of vegetative-reproductive transition through a CO parallel pathway that was recently shown to be connected to T6P (Wahl et al., 2013; Yang et al., 2013), a repressor of starch catabolism through KIN10 signaling (Baena-González et al., 2007; Delatte et al., 2011).

14

Consistent with this, plants overexpressing non -modified versions of miR156 and miR319 target genes show much milder phenotypes than plants expressing the corresponding target mimics [18], [29], [30].

This phenotype is similar to what is seen in plants carrying non-targetable versions of SPL9 or SPL10, two of the miR156/157 targets, and opposite of plants overexpressing miR156b or spl9 spl15 double mutants [10], [40]– [42].

Increased accumulation of miR156 (lower band in the blot) was observed upon expression of a resistant version of a miR156 target (consistent with what observed for miRNA156a precursor levels in [39]) or inhibition of miRNA activity in the ago1-27 mutants.

Conversely, some miRNA families have very similar sequences and overlapping in vivo targets (e. g., miR159/319, miR156/157 and miR170/171a), and artificial target mimics might not be able to unambiguously discriminate between different miRNAs.

The decrease in miR156 levels in MIM156 plants is then not an indirect consequence of increased SPL transcript levels.

The few rosette leaves were characterized by serrated margins, indicating adult leaf identity, consistent with a role of miR156 and its targets in controlling phase change [30].

15

According to Willmann [8], multiple miR156 -targeted SPL genes may redundantly regulate the same targets.

In our study, the sequencing material consisted of total RNA pools collected from each stage of somatic embryogenesis, the detailed expression of a given miRNA at a certain developmental stage could not be identified, but some miRNA families exhibited dominant place in family members and copy reads, they presumably played an important role in this process, such as miR156 and miR166.

Our speculation was in accordance with miRNA research in Arabidopsis which showing that miR156 is active throughout early embryogenesis, and it is a key medium in the repression of precocious gene expression and pattern formation during embryogenesis [7].

For example, miR156 targets the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE(SPL) family [50].

In early-stage SEs, ltu-miR156 had the most family members and sequencing reads, and each family member also had a high level of expression in the microarray hybridization (Figure 7B ).

These miRNAs targeted SPL family members (SPL3, SPL5, SPL10, and SPL11), and each ltu-miR156 family member was considered likely to be involved in DNA binding (Table S4).

MiR156 represses the zygotic expression of both SPL10 and SPL11 during early embryogenesis in Arabidopsis, which are key repression factors of transcription during the transition from the premature to maturation phase [7].

The reads of different members within a given family were not evenly distributed: miR156 with 13 family members had 47 to 4,750,907 reads; miR166 with 6 members had 10 to 216,840 reads; miR390 with 3 members had 5 to 2,768 reads.

As miR156 and miR397 detected in our study, they showed conservation with Arabidopsis, P. trichocarpa, O. sativa and V. vinifera (Figure 3 ).

Among these families, the miR156 family had the most family members (13), with 93.7% of all conserved miRNA reads, followed by miR166 (6), miR168 (5), miR167 (4), miR397 (4), miR390 (3), and miR399 (3) etc.

In the 64 predicted conserved miRNAs, 20 miRNA sequences including 9 miRNA families' (miR894, miR156, miR159, miR2118, miR397, miR1511, miR535, miR529 and miR396) average signal intensity were higher than 1000.

16

Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3.

Gradual increase of miR156 regulates temporal expression changes of numerous genes during leaf development in rice.

Overexpression of miR156 in switchgrass (Panicum virgatum L. ) results in various morphological alterations and leads to improved biomass production.

MiR156 promotes juvenile development, while miR172 promotes reproductive development.

Over -expression of sly-miR156a in tomato results in multiple vegetative and reproductive trait alterations and partial phenocopy of the sft mutant.

Intriguingly, tsh4 is targeted by miR156, which as mentioned above plays a fundamental role in the juvenile to adult transition.

For example, the dominant maize mutant Corngrass1 (Cg1) overexpresses miR156 and extends the juvenile phase.

17

Supplementary Figure S1 depicts the regulatory network of miR156a consisted of its TFs, direct targets and indirect targets.

Notably, the negative correlation of expression levels between miR156a and its targets is observed.

By using ‘Targets’ function in AtmiRNET, 13 putative targets of ath-miR156a are identified.

The functional enrichment analysis of GO terms reveals that miR156a may be relative to DNA binding, development and regulation of vegetative phase change.

In 2013, Yang et al. (36) indicated that vegetative phase change is initiated by a decrease in miR156, and miR156a and miR156c were found to play dominant roles in this transition.

Two case studies, the involvement of miR167c in the crosstalk between ABA and auxin-signaling pathways and miR156a in vegetative phase change, are demonstrated to reveal the potency of AtmiRNET and the fulfillment of the unmet demand in plant miRNA research.

Repression of ath-miR156a and miR156c triggers vegetative phase change in Arabidopsis.

This evidence supports the inference of miR156a functions in AtmiRNET (also for miR156c).

18

A complete loss of pollen production in the anthers of all formed flowers is obtained when the spl8 mutant is combined with a 35S:MIR156 transgene that is able to down-regulate the expression of a set of miR156 -targeted SBP-box genes.

As we have reported previously, the Arabidopsis spl8 mutant is semi-sterile, and an additional down-regulation of other, miR156 -targeted, SPL genes results in fully sterile plants [11, 12].

Other SBP-box genes such as miR156 -targeted SPLs, with functional redundancy to SPL8 [12], might also join the same pathway to regulate early anther development.

Thus, SPL8 and other miR156 -targeted SPL genes might join the BR signaling via a link with BIM1 in regulating the early events of anther development.

19

The major proportion of the identified microRNAs target transcription factors, with 63 reads (16%) for miR156/157 (targeting SPL family), 38 reads (9.6%) for miR172 (targeting AP2 family) and 26 reads (6.6%) for miR159 (targeting MYB/TCP family).

Given the presence of miRs targeting transcription factor families such as SPL (miR156/miR157), MYB/TCP (miR159, miR319), ARF (miR160, miR167), AP2 (miR172), and GRF (miR396) there can be no doubt that miRs modulate the expression of many transcription factors during later stages of pollen development.

The relative abundance of each miRNA within mature pollen sample was estimated by comparing the Ct value difference between the highly expressed miRNA (miR156).

MicroRNA expression levels (as determined by 454 sequencing and Q-RT-PCR) were normalized to that of miR156 - the most abundant microRNA.

We performed qRT-PCR on a subset of 17 microRNAs, ranging from those frequently detected (miR156 and miR161, with respectively 59 and 45 reads) to singletons (miR162, miR171a, miR171bc, and miR773), and including those showing 1 or 2 sequence mismatches (miR162, miR165, miR173 and miR773, see Additional file 1: Table S1).

The relative abundance of all other miRNAs was normalized to miR156 for both miRNA Q-RT-PCR and sequencing data (Figure 1).

Nevertheless, quantification revealed that the most abundant miRNA in our 454 dataset, miR156, was also detectable by Q-RT-PCR.

20

It was found that target sites for conserved miRNAs in this plant were similar or functionally related to validated plant miRNA targets e. g. most members of the Squamosa Promoter Binding Protein Like (SPL) transcription factor family are targeted by miR156 in plants [8].

In stevia miR156 was among the lowly expressed miRNAs but usually miR156 represents one of the highly abundant miRNA families in diverse plant species e. g. Arachis hypogea[29], Brachypodium[27] and early maize seedlings [36].

For instance, miR156 targets 11 of the 17 SPL genes in Arabidopsis.

Similarly, in stevia miR156 has been found to target SPL.

miR156, miR159, miR167, miR319, miR396 and miR172 possessed 5, 8, 10, 8, 7 and 6 members respectively whereas other miRNA families such as miR157, miR160, miR169, miR858, miR894, miR2111 etc.

Most of the miRNA families were found to be conserved in a variety of plant species e. g. using a comparative genomics based strategy homologs of miR319, miR156/157, miR169, miR165/166, miR394 and miR159 were found in 51,45,41,40,40 and 30 diverse plant species respectively [38].

This was also the case for some other miRNA families, such as miR156 (from 3 read to 124 reads) miR167 (from 13 reads to 9,637 reads) and miR394 (from 2 reads to 1,554 reads).

In addition, miR167 and miR394 were found to have some thousands to tens of thousands of redundancies while miR319, miR166 and miR156 had more than one hundred redundancies.

The abundance of miR172 was 20 times low as compared to miR156 in our dataset which is consistent with the previous finding that these two miRNAs are conversely regulated [36].

21

While the expressions of 14 families (miR156/miR157, miR158, miR160, miR162, miR165/miR166, miR168, miR169, miR171, miR390, miR393, miR394, miR396, miR398, and miR399) were dramatically reduced, 3 families (miR159, miR167, and miR172) were up-regulated in CsCl -treated seedlings.

Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3.

Specifically, the miR156 family consists of 10 genes (miR156a—miR156j) and targets 10 members of the SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL) transcription factors [29, 30], thereby controlling developmental timing.

As shown in Fig 6A, pri-miR156 and pre-miR156 fragments can be observed in an RNA blot analysis.

Several miRNA families were significantly lower in both CsCl -treated and KCl -treated seedlings (miR156, miR169, miR170/miR171, and miR399).

A. The processing pattern of pri-miRNA156.

The expression of these miR156 genes was measured at a total 2536, 871, and 1918 reads per TPTM in the control, CsCl -treated and KCl -treated seedlings, respectively (Fig 3B, number 1).

0125514.g006 Fig 6 A. The processing pattern of pri-miRNA156.

In the case of KCl treatment, the miRNA counts of 4 families (miR156/miR157, miR169, miR394, and miR399) were reduced, whereas 9 families (miR159, miR164, miR165/miR166.

22

Expression of MIR156 was also tested (data not presented), but average deviation from WT was only 30% (down-regulated).

The microRNA miR156 is an inhibitor of SPLs, and MIR156 expression decreases with age [23].

A particular microRNA, miR156, is known to promote the juvenile phase in Arabidopsis and maize and inhibit flowering [13].

Since these genes can act downstream of FT and FD we tested SPL3 and MIR156 expression in the pp2a mutants.

SPL3 and miR156, which can influence flowering by an endogenous pathway acting downstream of the floral integrator were also tested.

The miR156/SPL pathway may act also downstream of FT on flowering, hence forming a pathway independent of the important FT (florigen) gene [24].

In conclusion, the SPL3/miR156 pathway could hardly explain early flowering time in pp2a-b55 mutants.

Recently, a new autonomous pathway was pointed out where MIR156 and SPL3 play important roles [24].

23

The miR156/157 family is a highly conserved miRNA family, which targets SQUAMOSA PROMOTER LIKE BINDING (SPL) genes that are crucial for development (Gandikota et al. 2007).

All members of the miR156/157 family are predicted to target members of the SPL transcription factor family, which control development.

Despite overlapping predicted targets, it has recently been reported that miR156 and miR157 family members do mediate differential cleavage of specific SPL transcripts (Meng et al. 2012).

The senescence repression of miR157 in leaves without any change in miR156 therefore may be a fine-tuning mechanism to control expression of specific SPLs as senescence progresses in leaves.

Stage selection and abbreviation as described in Fig.   1. (a) miR156/157 family members' expression level was examined via northern blotting.

Both miR156 and miR157 had different expression patterns in siliques compared with leaves, where they both increased strongly in late senescence.

However, members of the miR156/157 family and miR396a-3p have not been shown to change significantly under nutrient starvation.

Intriguingly, miR157 showed a slight decrease during senescence in leaves while its close relative, miR156 was unchanged (Fig.   3a).

24

In contrast, miR172 was repressed by N starvation (Table 2), which is consistency with the fact that miR156 negatively regulated the expression of miR172.

The miR156 family contains three different mature miRNAs, all of which were up-regulated under N -deficient conditions.

The miR156 family was the most abundant (∼1,400,000 reads), although many miRNAs were expressed at low frequencies (read count fewer than 10).

miR156 and miR172 can prolong and promote the expression of juvenile vegetative traits in Arabidopsis, respectively [37], implying that N-starvation delays the transition of Arabidopsis from the vegetative to the reproductive phase by modulating the their abundance.

For miR156, miR160, miR169, miR171, miR172, miR395, miR397, miR398, miR399, miR408, miR775, miR780.1, miR827, miR842, miR846, miR857, and miR2111, their targets have been predicted and most of them were validated previously (Table 2).

The fold-change of miR156h was the greatest, suggesting that there may be spatial and/or temporal differences in the functions of different miR156 members.

Similar trends were observed for other miRNA families, such as miR156, miR169, and miR172.

Recently, several miRNAs were identified to be responsive to N limitation in Arabidopsis, which includes miR156, miR167, miR169, and miR398 [13], [17].

25

MiRNA156 has been shown to be involved in floral development and phase change by targeting members of squamosa promoter binding protein like (SPL) plant-specific transcription factors.

In Arabidopsis, miR156a, located on chromosome 2, targets 10 mRNAs that code for the squamosa promoter -binding protein (SBP) box, which is involved in leaf morphogenesis [39, 40].

Recent results indicated that overexpression of miR156 affects phase transition from vegetative growth to reproductive growth, including the quickly initiation of rosette leaves, a severe decrease in apical dominance, and a moderate delay in flowering [58].

MiR156a was also found to be highly expressed in Medicago truncatula [39].

Not only the miRNA166 and miRNA156 families were abundant during this stage of seed germination, but also they had more family members than other miRNA families, suggesting the importance of these two miRNA families at this very early stage of seed germination.

The largest miRNA family size identified was miR166 that consisted of 14 members and miR156, miR169 and miR167 possessed 12, 12 and 10 members, respectively; whereas other miRNA families such as miR162, miR529, miR827 and miR1432 had only one member detected in this period.

For example, miR156/157, miR159/319, miR166, miR169, and miR394 have been found in 51, 45, 41, 40 and 40 plant species, respectively [36- 38].

In comparison to other plant species, tae-miR169b in wheat and osa-miR169 in rice are the most frequently sequenced miRNAs while miR156 in rice and wheat exhibits low abundance [32].

For example, the abundance of miR156 family varied from 261 reads (zma-miR156j) to 409,637 reads (zma-miR156d) in the deep sequencing.

In our datasets, miRNA166 showed the highest abundance followed by miRNA156 and miRNA528, respectively, during the very early stage of seed germination.

The abundance of zma-miR172 was extremely low compared to that of zma-miR156 in our dataset, which was consistent with previous finding that these two miRNAs are conversely regulated.

For example, the majority of maize miRNAs were only sequenced less than 1,000 times, and some rare miRNAs were detected less than 10 times, whereas zma-miR167a, zma-miR166a, and zma-miR156a were detected 27,634, 300,503 and 374,492 times respectively (Additional file 2).

26

We analysed the expression of SPL3 (SQUAMOSA PROMOTER BINDING PROTEIN LIKE3) (Fig.   4h), SPL9 (Fig.   4i) and SPL10 (Fig.   5a), which are the targets of both miR156/157.

This inverse correlation of miR156/157 and its target SPLs indicate their post-transcriptional regulation.

Among the ten SPLs in Arabidopsis, we chose SPL3 (Fig.   4h), SPL9 (Fig.   4i) and SPL10 (Fig.   5a), since they are the targets of both miR156 and miR157.

In both of the cases, we observed highest level of expression at 24 h/4 °C (2 fold in miR156 and ~5 fold in miR157).

According to the previous report, miR156 and its closely related miR157 [33] are the principal regulators of transition from juvenile to adult phase.

Earlier studies also indicated the role of miR156 in the dynamic seed germination process of maize [20] and Nelumbo nucifera [22].

27

SPL3 and SPL9 are direct and indirect activators of FT, and both of them are targeted by miR156, whose expression declines in an age -dependent manner [82– 84].

Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3.

The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis.

The microRNA156-SQUAMOSA PROMOTER BINDING PROTEIN-LIKE3 module regulates ambient temperature-responsive flowering via FLOWERING LOCUS T in Arabidopsis.

28

Under short-day conditions, all three SPL genes are negatively regulated in an age -dependent manner by the microRNA miR156, and are positively regulated by SUPPRESSION OF OVEREXPRESSION OF CONSTANS 1 (SOC1) (Wu and Poethig 2006; Gandikota et al. 2007; Wang et al. 2009; Yamaguchi et al. 2009; Jung et al. 2012).

In accordance with the overexpression results, miR156-regulated silencing of multiple SPL genes (including AtSPL3/4/5) delays phase transitioning, but maintains apical dominance (Wu and Poethig 2006).

Although atspl3 mutants have no aberrant phenotypes, overexpression of AtSPL3 lacking the miR156 -binding site accelerates juvenile to adult phase change, and results in precocious flowering without affecting the rate of leaf development (Wu and Poethig 2006; Gandikota et al. 2007; Schwarz et al. 2008; Wang et al. 2008, 2009; Yamaguchi et al. 2009).

Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production.

29

The high expression of miR156 indirectly positively regulates the expression of anthocyanin pathway genes.

The SQUAMOSA PROMOTER BINDING PROTEIN- LIKE (SPL) transcription factor targeted by miR156 has been demonstrated to negatively regulate the acropetal accumulation of anthocyanins in the inflorescent stem [100].

Another example of small RNA involved in the regulation of anthocyanin biosynthesis is miR156.

30

Of these, the work of Nodine and Bartel [53] demonstrated that miR156 and two of its target genes SPL10 and SPL11 play a major role in early embryo patterning and in preventing the precocious expression of maturation genes.

We only observed loss of leaf GUS activity in miR166 and miR156 overexpressing lines.

While our studies have established miR165/166 and implicated miR156 as players in the repression of the seed maturation program in vegetative development, two recent studies have also revealed important roles of miRNAs in regulating the morphogenesis-to-maturation phase transition [53], [54].

miR156 may also play a role in the process, possibly by repressing SPL10 and SPL11, based on this work and that of Nodine and Bartel [53].

31

Development 131:3357-3365 9 Gandikota M, Birkenbihl RP, Höhmann S, Cardon GH, Saedler H et al. (2007) The miRNA156/157 recognition element in the 3' UTR of the Arabidopsis SBP box gene SPL3 prevents early flowering by translational inhibition in seedlings.

Notably, miRNA156 inhibits the transcription of miRNA172b via SPL9 and, redundantly, SPL10 [11].

Also, several microRNAs (miRNAs) participate in these pathways to maintain homeostasis and accurate flowering time, i. e., miRNA159 in the phytohormone pathway [8], miRNA156 in the autonomous pathway [9, 10], and miRNA172 in the photoperiod pathway.

32

There are one or two nucleotide differences between miR169 species, implying that different miR169 mature sequences may have different target genes, as described in a recent study, which confirmed that miR157d, but not other species of the miR156/157 family, mediated the cleavage of the HY5 mRNA 55.

Recently, miR156, which mediates juvenile-to-adult phase transition, was confirmed to be suppressed by the addition of sucrose 42.

It implies that C status directly affects the abundance of miR156.

Correspondingly, we found that miR156 (except for miR156 h) was specifically induced by the depletion of sucrose.

In all four libraries, the miR156 family was the most abundant, followed by the miR167 and miR166 families.

33

Overexpression of miR156 reduces the level of target SPL genes and causes a late-flowering phenotype [12, 13].

A recent study also found that the miRNA156-SPL3 module regulates ambient temperature-responsive flowering via FT in Arabidopsis [14].

The main players are the miR156, miR159 and miR172 families.

Kim J. J. Lee J. H. Kim W. Jung H. S. Huijser P. Ahn J. H. The microRNA156-SQUAMOSA PROMOTER BINDING PROTEIN-LIKE3 module regulates ambient temperature-responsive flowering via FLOWERING LOCUS T in Arabidopsis Plant Physiol.

34

Moreover, overexpression of miR156 inhibited flowering in switchgrass (Panicum virgatum; Fu et al., 2012).

Overexpression of miR156 in switchgrass (Panicum virgatum L. ) results in various morphological alterations and leads to improved biomass production.

35

As expected, miR156 accumulation declined as development progressed confirming that both sets of samples were developmentally equivalent (Fig 1C) [17, 19].

The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis.

Levels of the developmental timer miR156 were used to validate the equivalence of the samples collected at the two different growth conditions [30– 32].

36

To test whether SPL suppression of LAS expression has biological relevance to AM initiation, we analyzed AM initiation in the spl9-4 spl15-1 mutant and in a pSPL9::rSPL9 line containing mutations in the target sites for miR156 and miR157 (Wu & Poethig, 2006; Wang et al, 2008; Li et al, 2012).

37

The T-DNA (SALK_018797) causing knockout mutation in CVY1 (At2g39360) is also present in MIR156A (At2g25095) gene that targets SPL3.

However, we ruled out the possibility of cvy1 mutant phenotypes being caused by a plausible insertion on MIR156A gene because homozygous mir156A mutant does not have distorted trichome phenotype and the overall phenotypic complementation tests (trichome phenotype, flowering time, seed production and hypocotyl gravitropism) excluded the implication of MIR156A mutation in the observed/described curvy1 phenotypes (Table  4).

38

SPL8 and miR156 -targeted SPL genes redundantly regulate Arabidopsis gynoecium differential patterning.

These include miRNA156 and members of the SPL family, which – when misexpressed – can alter fruit shape (Xing et al., 2013).

39

Yu et al. [66] showed that miR156 family control plant development by regulating the trichome growth in Arabidopsis.

The miR156 family targets the MYB transcription factor mRNAs, and by cleaving these transcription factors they positively control the trichome growth.

40

Overexpression of miR156 and miR159 resulted in late-flowering [21, 24], and overexpression of miR160 resulted in increased lateral rooting [25].

Similarly, miRNAs responsive to bacterial (miR160, miR167, miR393, miR396, miR398 and miR825) and viral infections (miR156 and miR164) were not altered in the OE lines [33- 35].

41

Moreover, targets of miR156 (SPL2 and SPL11) were down-regulated by heat stress (Fig. 4C–E).

42

For example, overexpression of miRNA156 in maize prolongs juvenile development while expression of miR172 promotes the transition to the adult phase of growth [30], [32].

43

Genes AT4G12080, AT1G53160 and AT2G03750 had target sites for the miR156/miR157 in their 3′ UTRs.

This gene has been identified in our analysis, and from previous studies, to be regulated by the miR156 21 22.

44

Although miRNAs in plants predominantly operate through transcript cleavage, several studies on miRNAs such as miR156, miR172, miR398, miR164 and miR165/6 show that transcript cleavage as well as translation repression may act upon the same targets [53, 54].

45

For example, analysis of the MIR156, MIR159, and MIR166 families revealed differences in the spatial and temporal expression of genes within these families, which suggests that expression diversification occurred after gene duplication [17].

46

Nature 327, 617– 618 Wu G Poethig RS 2006 Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3.

47

A probe (TGTGCTCACTCTCTTCTGTCA) detecting the abundantly expressed miRNA, miR156 [28], was used as a control.

The membrane was then washed with 2× SSC/1% SDS and kept moist until hybridization solution with the miR156 probe was added and miR156 detection carried out as above.

Detection of miR156 served as an internal control and loading marker.

48

We found that At2g33810 in the At2g33810/At2g33815 pair was a target of miR156 and At1g53230 in the At1g53230/At1g53233 pair was a target of miR319.

49

On the contrary, miR156, miR158, miR164, miR165, miR400, miR5654, miR775, miR829, miR838 and miR852 were down-regulated by TCV infection.

50

Negative regulation of anthocyanin biosynthesis in arabidopsis by a miR156 -targeted SPL transcription factor.

51

An miRNA cascade involving miR156 and miR172 and their respective targets SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL), and APETALA2 (AP2)-like genes modulates flowering induction in Arabidopsis through the regulation of FT and other flowering-related genes (Khan et al., 2014; Spanudakis and Jackson, 2014).

52

First such report was published in 2011, which disclosed the role of miR156 in regulating the amount of anthocyanin by targeting the SPL genes [40].

53

and found only two homologous pairs based on our test: ath-MIR156a–157a and ath-MIR165a–166a.

As a positive case, we classify the three miR172a miRNAs from Arabidopsis, Oryza, and Populus as homologs (the same is true for miR156a—no other similar cases were explored).

In Arabidopsis, only the miR171 family is divided in two families, and the following miRBase families are pairwise grouped together: MIR319–MIR159, MIR156–MIR157, MIR165–MIR166, and MIR170–MIR171.

As a negative test case, we took 21 Arabidopsis “a” precursors (ath-MIR156a, ath-MIR157a, etc. )

54

SPL5 and two closely related transcription factors (SPL3 and SPL4) have target sites for MicroRNA miR156, and these three genes have overlapping functions in regulating vegetative phase change and floral induction in Arabidopsis (Wu et al. 2009; Wu and Poethig 2006).

55

Our genome-wide H3K27me3 profiling data also reveal that BRM is involved in the regulation of a number of other important developmental genes including, most noticeably, members of the miR166 and miR156 families (S2 Dataset).

56

Sugars, through HEXOKINASE1 -dependent signaling, repress microRNA156 at transcriptional and post-transcriptional levels which release the inhibition of key regulators of juvenile-to-adult and vegetative-to-reproductive phase transition like SQUAMOSA PROMOTER BINDING PROTEIN-LIKE transcriptional factors [66, 67].

57

Sugar promotes vegetative phase change in Arabidopsis thaliana by repressing the expression of MIR156A and MIR156C.

58

Although only a few cleavage targets of the highly accumulated RC-miRNAs were detected, several RC-miRNAs were shown to possess great potential to guide DNA methylation in both Arabidopsis (RC_ath-miR2112, RC_ath-miR391, RC_ath-miR781, RC_ath-miR782, and RC_ath-miR847) and rice (RC_osa-miR156, RC_osa-miR159, RC_osa-miR169, RC_osa-miR1846, RC_osa-miR2118, and RC_osa-miR535) (Figure 4 and Table S6).

59

In support of our findings, [71] have proposed HWS as a regulator of miRNA function in their screening studies for negative regulators of MIR156 activity.

60

The late-flowering phenotype of the embryo-rescued tps1 null mutant is due to near loss of FLOWERING LOCUS T expression in the leaves, while perturbation of trehalose metabolism in shoot apical meristem cells leads to precocious flowering, acting via the miR156/SPL pathway (Wahl et al., 2013).

61

The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis.

62

In total, we have predicted 10 potential target mimics of Pi starvation responsive miRNAs (miR399, miR156 and miR169).

63

The involvement of miRNAs as key regulators of flowering time (miR159, miR172, miR156, and miR171), hormone signaling (miR159, miR160, miR167, miR164, and miR393), or shoot and root development (miR164), was reviewed by (Wang and Li, 2007).

64

We examined certain miRNAs (miR156, miR171a, miR390b, and miR168a) because they had previously been shown to be expressed in leaves (Yang et al, [2006]; Zhan et al, [2012]).

65

miR156 and miR529 initiate TAS6, which targets an mRNA that encodes a zinc finger protein [11].

66

Regulation of flowering time by the miR156 -mediated age pathway.

67

miR156 probe was used as a control to confirm that mature microRNAs in general have decreased levels or are absent in hen1-1. U6 probe was used as a loading control.

Membranes containing low molecular weight RNA were probed with U6 small nucleolar RNA, miR169 and miR156 oligonucleotides (Table S8) end-labeled in the presence of [γ- [32]P] ATP.

68

miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana.

69

In Arabidopsis, AT1G53160.2-2 (represents the 2 [nd] intron of the transcription form AT1G53160.2 of the gene AT1G53160) was regulated by ath-miR156 and ath-miR157 (Figure  1A).

70

The partial results are shown in Table  5, and the complete results are available in Additional file 5. Table 5 Top 5 prediction results for miRNAs responding to high-salt conditions and TMV-Cg stress Stress miRNA Score High-salt ath-miR418 0.932 ath-miR166 0.929 ath-miR160 0.908 ath-miR841 0.892 ath-miR169 0.816 TMV-Cg ath-miR165 1.000 ath-miR156 0.939 ath-miR418 0.932 ath-miR160 0.908 ath-miR8177 0.899 To our knowledge, most of the existing methods mentioned previously have not been implemented as publicly available software packages.

We also predicted several new miRNAs that are likely to respond to the TMV-Cg virus, including miR165 [36, 37], miR156 [34, 38], miR418, miR160 [36, 38], and miR393 [36, 37, 39].

71

Wang JW Czech B Weigel D 2009 miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana.

72

For miRNAs, each of the two display modes mentioned above can be used to show the search result, and miRNA name (such as ath-miR156a) or miRNA family name (such as ath-miR156 or miR156) can be taken as search keyword.

73

The microRNA156-SQUAMOSA PROMOTER BINDING PROTEIN-LIKE3 Module Regulates Ambient Temperature-Responsive Flowering via FLOWERING LOCUS T in Arabidopsis.

74

Indeed, research data in the past twenty years indicate that 21 miRNA families, such as miR156 and miR399, are conserved in sequence across monocots and dicots 25.

75

In Arabidopsis, miR156, miR158, miR159, miR165, miR167, miR168, miR169, miR171, miR319, miR393, miR394 and miR396 are drought-responsive.

76

A probe detecting mir156 was used as a control.

77

The microRNA156-SQUAMOSA PROMOTER BINDING PROTEIN-LIKE3 module regulates ambient temperature-responsive flowering via FLOWERING LOCUS T in Arabidopsis.

78

In addition, experiments by Vaucheret and data from other studies also reveals evidence of long miRNA variants; for example, careful examination of previously published miRNA northern blots found the presence of double bands for some miRNAs, such as for ath-miR169, ath-miR156 and ath-miR172 [31].

79

During post-germination stages, miR156 and miR172 mediate the emergence of vegetative leaves, a stage of transition to autotrophic growth [40, 41].

80

In Arabidopsis, the LFY, FUL and AP1 genes are activated by SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 3 (SPL3) (Figure 1) which is regulated by FT and microRNA156 [100].