sort by

378 publications mentioning hsa-mir-199a-1 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-199a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 500
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-199b, hsa-mir-214, hsa-mir-342
In Sezary Syndrome (SzS) patients (T-cell lymphoma), expression of miR-199a-3p was up-regulated, which in turn inhibited the expression of EVL. [score:10]
However, in fibrotic livers, lowered expression of FXR resulted in elevated miR-199a-3p, which in turn suppressed the expression of its direct target LKB1 [21]. [score:10]
Research on mice with cardiomyocyte-restricted knockout of STAT3 identified the pathophysiological relationship between reduced STAT3 protein levels, increased miR-199a-5p expression, and decreased expression of two direct targets, ubiquitin-conjugating enzymes UBE2G1 and UBE2I. [score:9]
In bladder cancer, miR-199a-3p was down-regulated, and worked as a tumor suppressor by targeting KRT7 [49]. [score:8]
This down-regulation of miR-199a in RCCs was correlated with higher tumor stage and nuclear overexpression of GSK-3β, which was confirmed to be a target of miR-199a [26]. [score:8]
Transgenic mice over -expressing the 3′UTR of versican, a direct target of miR-199a-3p, resulted in increased fibronectin, due to enhanced binding of miR-199a-3p to versican, and thus, reduced binding to its other targets, specifically fibronectin. [score:8]
Following introduction of BMP-2 into murine mesenchymal stem cells (MSCs) to stimulate its differentiation, miR-199a-3p was up-regulated and acted as a negative regulator of early chondrogenesis via its direct target SMAD1, a transcription factor that enhances osteogenesis [25]. [score:8]
In endometriosis affected women, miR-199a was down-regulated and affected the invasive ability of endometrial stromal cells (ESCs), partly through IKKβ/NFκB pathway suppression and reduced IL-8 expression [81]. [score:8]
Studies on steatohepatitis indicated that mice fed with different diets to induce alcoholic or non-alcoholic fatty livers showed different miR-199a-3p profiles, with down-regulation in the former and up-regulation in the latter [65]. [score:7]
Contrary to the down-regulation of miR-199a in HCC in adults, this miRNA showed up-regulation in pediatric hepatoblastoma patients [37]. [score:7]
PODXL was identified as a direct target of miR-199a-5p, knockdown which suppressed cancer invasion [40]. [score:7]
In mice cardiac myocytes, miR-199a-5p was upregulated during cardiac hypertrophy via β-adrenergic receptor (β-AR) stimulation, but downregulated by AKT activation during hypoxia [22]. [score:7]
After spinal cord injury, rats that received cycling exercise showed decreased expression of miR-199a-3p with increased expression of both mRNA and protein of its target mTOR. [score:7]
Besides the heart, the reduced expression of miR-199a-5p during hypoxia was also observed in human pulmonary and brain epithelial cells, with increased expression of its targets FLAP at both mRNA and protein levels [69]. [score:7]
In a study of seven HCC cell lines, in spite of the fact that all cells showed down-regulation of miR-199a-3p only two CD44+ cell lines were sensitive to the anti-proliferation and anti-invasion effects of knockin in expression of pre-miR-199a-3p. [score:7]
Conditioned knockout of Pten led to development of endometrial cancer with reduced expression of miR-199a-3p which targeted COX-2 [61]. [score:7]
The study was extended to mouse breast carcinoma cells, and 3′UTR of versican again decreased the expression of miR-199a-3p, resulting in decreased inhibition on its putative target RB1. [score:7]
Another study in HCC showed that the decrement of miR-199a-3p significantly correlated with poor survival of patients, and it could target tumor-promoting PAK4 to suppress HCC growth through inhibiting the PAK4/RAF/MEK/ERK pathway both in vitro and in vivo [20]. [score:7]
In breast cancer, miR-199a was significantly under-expressed, and the relative expression was correlated with tumor grade and sex hormone receptor expression [41]. [score:7]
It is obvious miR-199a displays extensive variability in its expression during tumorigenesis, in various diseases and from embryonic development to cell differentiation. [score:6]
More than 50% of HCC tissues and cells showed significant down-regulation of miR-199a-5p, with increased expression of the pro-invasion molecule DDR1. [score:6]
In mouse kidney, expression of miR-199a-3p was up-regulated after renal ischemia perfusion injury [88]. [score:6]
The effects of miR-199a in ESCs also include inhibition of adhesion and invasion by directly targeting IKKβ and the inactivation of the NFκB signaling pathway [82]. [score:6]
Although up-regulated in HCV infected livers, in vitro studies showed that miR-199a-3p could inhibit HCV genome replication, suggesting its potential antiviral role [63]. [score:6]
Northern blot analysis in different rat tissues showed that miR-199a was mainly expressed in lung and heart, with dominant expression in cardiomyocytes. [score:5]
There is no evidence of functional correlation between the expression of the dynamin genes and the miR-199a precursors: this may be due to the fact that the expression of the miRNA precursors is controlled by their own promoters. [score:5]
Transfection of bone morphogenic protein 2 (BMP2) into mice mesenchymal fibroblast-like cells showed that expression of miR-199a-3p was significantly inhibited at 5 h (which was the early stage of chondrogenesis), and increased at 24 h and remained high [25]. [score:5]
After 3-nitropropionic acid preconditioning in rat brain, miR-199a showed reduced expression, indicating possible roles in the formation of cerebral ischemic tolerance through its target Sirt1 [85]. [score:5]
Expression of miR-199a in bronchial squamous carcinomas was found to be stage specific, meaning miR-199a was up-regulated in squamous cell carcinoma as compared to severe dysplasia and in situ carcinoma [50]. [score:5]
Disruption of the expression of Dnm3os which induces miR-199a and miR-214 expression in mice resulted in skeletal defects. [score:5]
MiR-199a-3p promoted proliferation and survival of endothelial cells and breast cancer cells by inhibiting its direct target Caveolin-2 [55]. [score:5]
Studies in human MSCs showed induction of miR-199a expression during both osteogenic and adipogenic differentiation, and together with other miRNAs, decreased the expression of LIF [71]. [score:5]
For example, comparison between two forms of primary CNS lymphomas, diffuse large B-cell lymphomas (DLBCL) is associated with lower expression whereas nodal DLBCL had higher expression of miR-199a [18]. [score:5]
The metabolite of oltipraz, a cancer chemopreventive drug, inhibited HIF-1α due to increased expression of pre-miR-199a-5p in colon cancer cells [58]. [score:5]
A detailed study of cell-specific expression of miR-199a in mouse heart, utilizing in situ hybridization and immunohistochemistry, demonstrated increased expression through embryogenesis. [score:5]
Reduced expression of miR-199a-3p led to higher expression of MET and enhanced invasion [56]. [score:5]
Studies in mouse heart cells showed that miR-199a-5p was sensitive to low oxygen levels and rapidly reduced to undetectable levels, thereby releasing its targets from its inhibitory effect. [score:5]
Up-Regulation of miR-199a. [score:4]
Another study of mouse bone marrow stromal cells chondrogenesis gave similar results, with more than 10-fold up-regulation of miR-199a. [score:4]
Studies on Japanese gastric patient samples showed that up-regulation of miR-199a was useful as a progression-related signature [29]. [score:4]
In liver samples from patients with hepatitis C virus (HCV) infection, and mouse fibrosis livers induced by CCL4, both miR-199a-3p and-5p were up-regulated in a fibrosis progression -dependent manner [62]. [score:4]
Aside from the down regulation in HCC, miR-199a also showed reduced expression in other cancers. [score:4]
A similar observation on HCC studies showed that the anti-invasion effect of miR-199a-5p on its direct target DDR1 varied among individuals and cell lines [34]. [score:4]
Upon IL-1β stimulation, expression of miR-199a-3p and COX-2 was inversely affected, indicating that miR-199a-3p might be an important regulator of human cartilage homeostasis and suggested potential therapeutic strategies for the treatment of OA [72]. [score:4]
Comparison between melanoma of young and older adults (>60 years old) showed increased expression of miR-199a which was speculated to regulate the TLR-MyD88-NFκB pathway [47]. [score:4]
As demonstrated by the studies in different mo dels, the expression patterns of miR-199a in different systems are complicated and delicately regulated. [score:4]
In mouse obstructive jaundice liver, both miR-199a-3p and-5p were up-regulated. [score:4]
Phorbal 12-myristate 13-acetate (TPA) -induced differentiation of leukemia HL-60 cells, down-regulated miR-199a-3p [57]. [score:4]
Down-Regulation of miR-199a. [score:4]
For example, HIF-1α is a direct target of both miR-199a-3p and-5p. [score:4]
CD44+ was also shown to be a direct target of miR-199a-3p in HCC cells [33]. [score:4]
In several non-small cell lung cancer (NSCLC), breast cancer (BRC) and colorectal cancer cell lines, miR-199a had a pivotal role in tumorigenesis affecting activities such as tumor growth, migration, invasion and in vivo distant metastasis by directly targeting AXL [12]. [score:4]
The rapid down-regulation of miR-199a-5p during hypoxia preconditioning was controlled by the activation of AKT pathway, which could be counteracted by activation of β-adrenergic signaling [22]. [score:4]
Regulation of miR-199a Expression. [score:4]
Interestingly, a direct target of both miR-199a-5p and-3p, BRM, was found in the various cancer cells. [score:4]
Studies in human osteoarthritis (OA) chondrocytes indicated that miR-199a-3p directly targeted COX-2 mRNA. [score:4]
Again, the down-regulation by AKT of miR-199a-5p was shown to be post-transcriptional [23]. [score:4]
Induction of oral carcinoma by 7,12-dimethyl-benz[a]anthrance treatment in the Syrian hamster resulted in up-regulation of miR-199a [59]. [score:4]
Up-regulation of both miR-199a-3p and-5p predicted a worse prognosis in esophageal adenocarcinoma patients [39]. [score:4]
For example, after differentiation of human embryonic stem cells (hESCs) into pancreatic islet-like cells, miR-199a showed up-regulation [75]. [score:4]
In serous ovarian cancer patient tissues, miR-199a was down-regulated [43] and significantly correlated with a poor prognosis [44] and tumor progression [45]. [score:4]
In addition, miR-199a-5p was significantly up-regulated in the intrahepatic bile duct [80]. [score:4]
Besides embryo development, studies of the implantation process in mice showed that miR-199a-3p exhibits spatiotemporally coincident expression with Cox-2 in the uterus. [score:4]
In osteosarcoma cell lines and tissues, miR-199a-3p showed reduced expression. [score:3]
High expression of miR-199a was also identified in AML patients with isolated trisomy 8 [52]. [score:3]
Since TWIST1 controls miR-199a expression, HIF-1α and TWIST1 may form a loop with miR-199a being an intermediate molecule [89]. [score:3]
Molecules that were affected and which might be targets of miR-199a-3p include MET, mTOR and STAT3 [38]. [score:3]
Cox-2 is a gene critical for implantation and is directly regulated by miR-199a-3p [76]. [score:3]
MiR-199a was frequently downregulated in human hepatocellular carcinoma (HCC) [31]. [score:3]
In addition, miR-199a-3p has multiple targets in different cancer types (especially with cancer cells that are CD44 positive) and appears to play a more dominant role than miR-199a-5p [7]. [score:3]
Expression of miR-199a-3p was also different among different subtypes of breast cancer [54]. [score:3]
MiR-199a-3p was also shown to post-transcriptionally attenuate the expression of Runx1, a key regulator during the megakaryopoiesis process [77]. [score:3]
Apparently hypermethylation in testicular cancer cells caused severely reduced expression of miR-199a [11]. [score:3]
In uveal (ocular) melanoma patients, both miR-199a-3p and-5p significantly discriminated the high metastatic group from the low metastatic group, with higher expression in the former [48]. [score:3]
Studies in ovarian cancer stem cells showed that the two subtypes of epithelial ovarian cancer (EOC) stem cells, type I/CD44+ and type II/CD44-, have a very distinct expression pattern of miR-199a, with type II levels being much higher. [score:3]
Besides MET, its downstream effector ERK2 was also shown to be inhibited by miR-199a-3p, indicating the anti-proliferation, motility and invasive capabilities of the miRNA in these tumor cells [9]. [score:3]
MiR-199a-3p was also down-regulated in streptazotocin-inducd diabetic retinopathy in rats [84]. [score:3]
Later it was shown that both mature forms are expressed in humans, and it was renamed miR-199a-5p and miR-199a-3p, respectively [5]. [score:3]
Besides TWIST1, EGR1, and DNA methylation, other factors have been reported to control expression of miR-199a. [score:3]
Comparing two sets of acute myeloid leukemia (AML) patients, miR-199a was expressed much higher in patients with worse overall and event-free survival. [score:3]
One important observation in studying miR-199a in tumors is that subtypes of one cancer could exhibit different expression patterns of miR-199a. [score:3]
Currently, two mechanisms that control the expression of miR-199a have been discovered. [score:3]
In renal cell cancer (RCC), a decreased expression of miR-199a in eight RCC cell lines and 59% tissues samples (32 of 54) was found. [score:3]
In testicular germ cell tumors, miR-199a (both-3p and-5p) showed reduced expression. [score:3]
Exposure to endocrine disrupting chemical nonylphenol, resulted in decreased expression of miR-199a-5p in mice Sertoli cells [86]. [score:3]
However, in microcystins (MCs) -induced mice with ovarian cancer, miR-199a-3p showed increased expression [53]. [score:3]
MiR-199a-3p has been shown to be one of the miRNAs that targeted MET at mRNA level in several cancer cell lines. [score:3]
There is significantly higher expression of miR-199a-3p in patients with malignant biliary tract cancer than patients with benign tumor [30]. [score:3]
Studies in stroke -dependent brain tissue showed that MRP1 was a protective factor against stroke, and under direct regulation of miR-199a-5p [87]. [score:3]
Some other in vitro studies of knock-in or knock-out of miR-199a in cells revealed more details on its function. [score:3]
Reduced expression of miR-199a-3p in hepatocellular carcinoma was shown to be mediated by histone modification and was independent of DNA methylation [20]. [score:3]
Its two mature forms, miR-199a-3p and-5p, behave differently and have unique targets, probably due to their different seed regions. [score:3]
Expression of miR-199a exhibited differences before and after stem cell differentiation. [score:3]
Extensive research has been done on miR-199a in cancers revealing its diverse expression patterns and functions in different cancer types (Table 1). [score:3]
This phenomenon may offer possible explanations for the variable (high or low) expression of miR-199a-5p and-3p in different cancers. [score:3]
Similar observations were made in human heart hypertrophy and failure studies, and overexpression of miR-199a resulted in elongated myocytes [17]. [score:3]
Drug treatment of cancer cells exhibited expression changes of miR-199a. [score:3]
Correspondingly the expression of miR-199a was higher in normal fibroblasts than cancer cells [9]. [score:3]
Comparing specimens from invasive squamous cell carcinomas to normal cervical squamous epithelial tissues showed over -expression of miR-199a. [score:3]
MiR-199a was expressed at higher levels in gastric cancer tissues than in normal gastric tissues; and higher in metastatic than non-metastatic gastric tissues. [score:2]
MiR-199a shows various expression patterns and functions in different animal mo dels. [score:2]
Analysis of different sources of human MSCs indicated that miR-199a was expressed at a lower level in abdominal adipose tissue MSCs as compared to facially-derived MSCs [73]. [score:2]
In vitro cell mo del studies of liver injury and fibrosis showed that farnesoid X receptor (FXR) could negatively regulate miR-199a-3p at the post-transcriptional level [21]. [score:2]
In addition to stem cell differentiation, miR-199a also exhibited functions in embryo development. [score:2]
2.6. miR-199a in Embryonic Stem Cells Differentiation and Embryo Development. [score:2]
Regardless of these differences, miR-199a played important roles regulating heart functions. [score:2]
This hypothesis requires further validation to enhance our understanding of the regulation of miR-199a. [score:2]
MiR-199a-3p is deregulated primarily during tumorigenesis and hepatitis, while miR-199a-5p appears be related to cardiomyocyte function and hypoxia condition (Figure 2). [score:2]
One is the regulation by transcription factors TWIST1 and EGR1 on Chr1; the other is the methylation status of miR-199a promoters on both Chr1 and Chr19. [score:2]
Another study on gastric cancer showed that patients who remained free of recurrence for at least three years after surgery had significantly lower levels of miR-199a-3p than patients who had a recurrence [28]. [score:1]
Besides research on human patient samples and cells, the biological effects of miR-199a in tumorigenesis have been studied in animal mo dels. [score:1]
How miR-199a was involved is unclear. [score:1]
2.4. miR-199a in Cardiogenesis. [score:1]
As shown in UCSC genome browser, miR-199a-1 located on Chromosome 19 (Chr19) is embedded in the anti-sense strand of intron 15 of Dynamin 2 (DNM2), whereas miR-199a-2 located on Chromosome 1 (Chr1) is embedded in the anti-sense strand of intron 14 of Dynamin 3 (DNM3). [score:1]
That same year, the identity of miR-199a was computationally predicted, based on its conservation among human, mouse and puffer fish [4]. [score:1]
Other Features of miR-199a in Cancer. [score:1]
The two microRNA sequences were named miR-199a and miR-199a* (from the 3′ arm), respectively. [score:1]
2.2. miR-199a in Tumorigenesis. [score:1]
In addition, miR-199a-3p was shown to be a modulator of cell cycle. [score:1]
The most wi dely used cancer mo del in studying miR-199a is liver cancer. [score:1]
As a result, miR-199a and BRM formed a double negative feedback loop through EGR1. [score:1]
2.5. miR-199a in Osteogenesis, Chondrogenesis and Adipogenesis. [score:1]
For miR-199a-1 on Chr19 there is a predicted CpG island between ~130 and 540 bp upstream of the mature miR-199a sequence [9]. [score:1]
MiR-199a inhibited cell proliferation in both in vitro and in vivo assays [32]. [score:1]
The well-conserved miR-199a, identified by diverse high-throughput screenings in many systems, suggests it may have important and comprehensive functions in different mo dels. [score:1]
MiR-199a was shown to be indispensable in normal skeletal development and body growth in mammals [8]. [score:1]
There are two loci that encode the precursor of miR-199a-5p and-3p in the human genome; one is on Chromosome 1 (miR-199a-2, miRBase Accession MI0000281) and the other on Chromosome 19 (miR-199a-1, miRBase Accession MI0000242). [score:1]
The functions of miR-199a, mostly its-5p mature form in cardiomyocytes has been relatively well studied. [score:1]
The viral replication effects of miR-199a-3p were also demonstrated for hepatitis B virus (HBV) [64]. [score:1]
Other Functions of miR-199a. [score:1]
2. miR-199a: One among Thousands. [score:1]
On the other hand, miR-199a-5p protects cardiomyocyte from being damaged under low oxygen conditions [66]. [score:1]
2.3. miR-199a in Hepatitis, Liver Fibrosis and Its Antiviral Effects. [score:1]
The promptness of the response is vital to reduce cell damage; miR-199a-5p provides a flexible and fast means for controlling the protein level of HIF1α without changing its transcription [23]. [score:1]
Under the effect of miR-199a-3p in liver cancer cells, HIF-1α was found to be involved in cellular proliferation and cancer growth [32]. [score:1]
In 2003, two mature forms derived from the same precursor, miR-199-s (from the 5′ half) and miR-199-as (from the 3′ half), were cloned from human osteoblast sarcoma cells and mouse skin, respectively [1]. [score:1]
[1 to 20 of 136 sentences]
2
[+] score: 384
Therapeutic effect of miR-199a-5p inhibitors in vivoGiven that the dysregulated expression of miR-199a-5p could result in significant changes in the expression of PIAS3 and p27 (Figs 3D and 4D and Fig. S2), we attempted to use miR-199a-5p as a therapeutic target in OS. [score:10]
Additionally, a miR-199a-5p -targeted inhibitor could significantly enhance PIAS3 and p27 expression and ultimately suppress the tumour growth in a xenograft mo del of OS, which represents a potential therapeutic approach that may be valuable for OS therapy. [score:9]
Accordingly, these results revealed that miR-199a-5p could regulate p27 expression only via a translational inhibition mechanism. [score:8]
The above results demonstrated that miR-199a-5p regulated PIAS3 expression only via a translational inhibition mechanism, rather than by affecting its mRNA stability. [score:8]
In conclusion, we identified that miR-199a-5p was significantly up-regulated in OS patient tissues and that its expression was inversely correlated with PIAS3 and p27 protein expression in OS. [score:8]
miR-199a-5p up-regulation suppresses PIAS3 expression and causes STAT3 activation. [score:8]
Given that the dysregulated expression of miR-199a-5p could result in significant changes in the expression of PIAS3 and p27 (Figs 3D and 4D and Fig. S2), we attempted to use miR-199a-5p as a therapeutic target in OS. [score:8]
Compared with the control, the over -expression of miR-199a-5p resulted in a significant decrease in the expression of PIAS3, while the knock-down of miR-199a-5p led to an increase in PIAS3 expression. [score:7]
Representative photographs of tumour-bearing mice and the corresponding tumours from each group are shown in Fig. 5E and F. Moreover, after treatment with the miR-199a-5p AMO, the levels of miR-199a-5p (Fig. 5G), KI-67 and PCNA (Fig. 5I) significantly declined, while the protein levels of p27 and PIAS3 (Fig. 5H) significantly increased, suggesting that an inhibitor targeting miR-199a-5p could remarkably suppress tumour growth in OS. [score:7]
To obtain MNNG/HOS cells stably expressing or inhibiting miR-199a-5p, MNNG/HOS cells were infected with pre/anti-miR-199a-5p-LV (lentivirus carrying either pre-miR-199a-5p precursor or anti-miR-199a-5p inhibitor and an eGFP or mCherry fluorescent tag, respectively) or infected with pre/anti-NC-LV (the corresponding control lentivirus carrying a pre-noncoding/anti-noncoding sequence and an eGFP/mCherry fluorescent tag) (GeneCopoeia, Guangzhou, China) in the presence of 8 μg/ml polybrene (GeneCopoeia) for 12 hours. [score:7]
Compared with the control, the over -expression of miR-199a-5p resulted in a significant decrease in the expression of p27, while the knock-down of miR-199a-5p led to an increase in p27 expression (Fig. 4D). [score:7]
Together, these data indicate that the over -expression of miR-199a-5p could promote the phosphorylation of STAT3 by down -regulating the expression of PIAS3. [score:6]
The over -expression of miR-199a-5p led to an increase in p-STAT3, and the knock-down of miR-199a-5p decreased p-STAT3 expression in Saos-2 or MNNG/HOS cells. [score:6]
Based on the fact that miR-199a-5p was up-regulated in OS patient tissues and cell lines, we concluded that the six genes RAB10, PDPN, CLTC, DBF4, DUSP14 and RBPMS could not be the targets of miR-199a-5p in OS. [score:6]
Through the combination of these bioinformatics prediction methods and a literature review, we found that PIAS3 (a specific inhibitor of activated STAT3) and p27 (a negative cell-cycle regulator) are likely targets of miR-199a-5p. [score:6]
Briefly, Saos-2 or MNNG/HOS cells with over -expression or knocked down -expression of miR-199a-5p were seeded onto 96-well plates at a density of 6 × 10 [3] cells per well. [score:6]
This result was further supported by the findings showing that the over -expression of miR-199a-5p induced tumour growth and the knock-down of its expression had the opposite effect in a nude mouse xenograft mo del of OS. [score:6]
As shown in Fig. 2A, the over -expression of miR-199a-5p significantly promoted cell proliferation, while the knock-down of miR-199a-5p significantly inhibited the proliferation of both Saos-2 and MNNG/HOS cells. [score:6]
These results suggested that the over -expression of miR-199a-5p enhanced the growth of MNNG/HOS cell -induced tumours, while the knock-down of miR-199a-5p inhibited the tumour growth in vivo. [score:6]
Accordingly, the over -expression of miR-199a-5p suppressed approximately 45.5% of the luciferase activity of the PIAS3 3′UTR reporter construct, while the inhibition of miR-199a-5p resulted in a 23.2% increase in reporter activity compared with the control. [score:6]
For example, miR-199a-5p is up-regulated in gastric cancer and melanoma, while it may act as a tumour suppressor in HCC, SCCC and multiple myeloma. [score:6]
As shown in Fig. 4A and B, the over -expression of miR-199a-5p suppressed approximately 43.8% of the luciferase activity of the p27 3′UTR construct, while the inhibition of miR-199a-5p resulted in an 18.2% increase in reporter activity compared with the control. [score:6]
To study the effect of miR-199a-5p targeting PIAS3, we analysed the expression of p-STAT3 and total STAT3 protein using western blotting after transfection with pre/anti-miR-199a-5p. [score:5]
Because cell proliferation is a prerequisite for metastasis, appearing as the most common cause of OS recurrence and death, we speculate that therapies targeting miR-199a-5p might be useful for OS treatment due to the dual targeting of miR-199a-5p to PIAS3 and p27. [score:5]
The result indicated that the expression of miR-199a-5p increased 15.2-fold in pre-miR-199a-5p-LV cells compared with the pre-ncRNA-LV cells, while the level of miR-199a-5p decreased 73.6% in the anti-miR-1992-5p-LV cells compared with the anti-ncRNA-LV cells (Supplementary Fig. S1B), suggesting that the sorted MNNG/HOS cells could be used as stable cell lines expressing or inhibiting miR-199a-5p for the next study in the immunodeficient mouse xenograft tumour mo del. [score:5]
We designed a miR-199a-5p AMO to inhibit miR-199a-5p expression in the nude mouse xenograft mo del of human osteosarcoma. [score:5]
To examine the effect of miR-199a-5p on tumour growth in vivo, we used MNNG/HOS cells to generate stable cell lines expressing or inhibiting miR-199a-5p. [score:5]
The animals were divided equally into 4 groups (7 mice per group) and 1 × 10 [7] viable MNNG/HOS cells stably expressing/inhibiting miR-199a-5p or their control cells were injected subcutaneously into the right flanks of the mice. [score:5]
It was confirmed that PIAS3 could be targeted by miR-199a-5p, while it was not clear whether the predicted p27 could be another target of miR-199a-5p. [score:5]
In this study, our results further revealed that reducing the miR-199a-5p level by biologically stable antisense oligonucleotides of miR-199a-5p significantly inhibited the growth of osteosarcoma tumours in nude mice, indicating that the administration of miR-199a-5p inhibitors could complement or improve current OS therapeutic strategies. [score:5]
In OS, the up-regulation of miR-199a-5p could promote cell proliferation and tumour growth. [score:4]
These results indicated that the dysregulated expression of miR-199a-5p might have an influence on OS tumour growth in vivo. [score:4]
33.43%) was detected after co-transfection of pre-miR-199a-5p and the PCI-p27 plasmid for 48 hours, while the protein level of p27 increased compared with cells transfected with pre-miR-199a-5p plus PCI (Fig. S4), suggesting that the ectopic over -expression of p27 was able to delay the G1-S phase transition of the cell cycle caused by miR-199a-5p over -expression. [score:4]
Based on three bioinformatics analyses, nineteen genes were predicted to be targets of miR-199a-5p, as shown in Supplementary Table 3. The first eight of the nineteen targets, PIAS3, p27, RAB10, DBF4, DUSP14, RBPMS, PDPN and CLTC, were considered to be closely associated with cancer progression after a literature review. [score:4]
miR-199a-5p is up-regulated in human OS tissues and cell lines. [score:4]
QRT-PCR results showed that the mRNA levels of PCNA and KI-67 were increased when miR-199a-5p was over-expressed, while the knock-down of miR-199a-5p reduced the mRNA levels of PCNA and KI-67 (Fig. 2B). [score:4]
In the present study, we demonstrated that miR-199a-5p was up-regulated in OS patient tissues and cell lines and might promote OS cell proliferation. [score:4]
Considering that miR-199a-5p was up-regulated in OS tissues, we next examined the effect of miR-199a-5p on cell proliferation in vitro. [score:4]
Nevertheless, the results in Fig. 4C show that the mRNA levels of p27 were not affected by the over -expression and knock-down of miR-199a-5p. [score:4]
Our results not only suggested an oncogenic role of miR-199a-5p in the development of OS but also provided a potential gene therapeutic target for OS. [score:4]
Next, western blotting was used to examine the p27 protein level after the over -expression and knock-down of miR-199a-5p in Saos-2 or MNNG/HOS cells. [score:4]
Next, we used western blotting to examine the PIAS3 protein level after the over -expression and knock-down of miR-199a-5p in Saos-2 or MNNG/HOS cells (Fig. 3D). [score:4]
miR-199a-5p is up-regulated in human osteosarcoma tissues and cell lines. [score:4]
On the basis of the inverse correlation between the expression of miR-199a-5p and the protein levels of PIAS3 and p27 in OS patient tissues and other evidence, we considered that the pathway of miR-199a-5p targeting both PIAS3 and p27 is a possible mechanism that contributes to tumour growth in OS. [score:4]
However, the mRNA level of PIAS3 did not appear to change in response to the over -expression and knock-down of miR-199a-5p (Fig. 3C). [score:4]
In this study, we found that the fold increases in the expression of miR-18a and miR-21 were similar to that of miR-199a-5p in OS patient tissues (data not shown), but the serum levels of miR-18a and miR-21 in OS patients did not show significant differences 10. [score:3]
Mutagenesis of the predicted miR-199a-5p binding sites restored the luciferase expression. [score:3]
Among the four OS cell lines, Saos-2 and MNNG/HOS expressed a relatively high level of miR-199a-5p (Fig. 1C). [score:3]
Furthermore, we validated that miR-199a-5p could target p27 and affect cell cycle progression in OS. [score:3]
The over -expression of miR-199a-5p led to a 1.2-fold increase in STAT3 -dependent luciferase activity, and the knock-down of miR-199a-5p resulted in an approximately 61.4% reduction of the STAT3 -dependent luciferase activity in MNNG/HOS cells compared with the control cells. [score:3]
Whether miR-18a, miR-21 and miR-199a-5p could convergently target PIAS3 in OS needs further study. [score:3]
Therefore, we performed bioinformatics analyses to search for miR-199a-5p -targeted genes. [score:3]
In each well, cells at 70–80% confluence were transfected with 1 μg of the firefly luciferase reporter plasmid, 0.5 μg of a β-galactosidase expression vector (Promega) and 100 pmol of pre/anti-miR-199a-5p or pre/anti-scramble using Lipofectamine 2000. [score:3]
As shown in Fig. 3F, miR-199a-5p had no obvious effect on the total STAT3 expression; however, it did enhance the phosphorylation of STAT3. [score:3]
Additionally, Klotho and ApoE have been reported as the targets of miR-199a-5p in gastric cancer and melanoma, respectively 23 25. [score:3]
miR-199a-5p targets p27 and induces the G1-to-S cell-cycle transition. [score:3]
Pearson’s correlation scatter plot comparing the fold changes in the expression of miR-199a-5p and the PIAS3 protein in OS patients (right). [score:3]
Therapeutic effects of a miR-199a-5p inhibitor on an immunodeficient mouse OS xenograft mo del. [score:3]
Our data in this study clearly demonstrated that miR-199a-5p could activate STAT3 signalling by targeting PIAS3 and lead to significantly increased levels of PCNA and KI67 in OS. [score:3]
A miR-199a-5p AMO with the sequence of 5′-ACAGGTAGTCTGAACACTGG-3′ was selected due to its good inhibition of miR-199a-5p in vitro. [score:3]
In addition, PIAS3 and p27 were identified as the dual targets of an oncogenic miR-199a-5p in OS. [score:3]
We next examined miR-199a-5p expression in four OS cell lines (Saos-2, MNNG/HOS, MG63 and 143B) as well as in hFOB 1.19 cells by qRT-PCR. [score:3]
miR-199a-5p targets p27 and influences the cell cycle. [score:3]
Therapeutic effect of miR-199a-5p inhibitors in vivo. [score:3]
miR-199a-5p was expressed in all five cell lines, and the levels of miR-199a-5p in the four OS cell lines were higher than that in the hFOB 1.19 cells. [score:3]
The value of R = −0.8082 in Fig. 3E suggested an inverse correlation between the expression of miR-199a-5p and the PIAS3 protein. [score:3]
Together, our data indicate that miR-199a-5p as an oncogenic miRNA can remarkably promote OS progression by targeting both PIAS3 and p27. [score:3]
In addition to miR-199a-5p in OS, other miRNAs that could target PIAS3 in tumours have been reported. [score:3]
Mutagenesis of the predicted miR-199a-5p binding sites restored the luciferase expression, thereby confirming the specificity of the interaction between miR-199a-5p and the PIAS3 3′UTR (Fig. 3A and B). [score:3]
The possible mechanism was further studied in OS cells, and the targeting of PIAS3 and p27 by miR-199a-5p was identified. [score:3]
Previously, we demonstrated that serum miR-199a-5p is up-regulated in OS patients using a high-throughput TaqMan low-density qPCR array (TLDA) and qRT-PCR assays. [score:3]
The value of R = −0.7437 suggested an inverse correlation between the expression of miR-199a-5p and the p27 protein level in OS samples. [score:3]
Pearson’s correlation scatter plot comparing the fold changes in the expression of miR-199a-5p and the p27 protein in OS patients (right). [score:3]
The overall level of miR-199a-5p increased 3.2-fold in all osteosarcoma samples compared with the NAT samples, indicating that the up-regulation of miR-199a-5p is a frequent event in osteosarcoma. [score:3]
In addition, a luciferase reporter construct with STAT3 -dependent transcriptional activity was integrated into MNNG/HOS cells, which were used to further examine the effects of miR-199a-5p targeting PIAS3 (as shown in Fig. 3F). [score:3]
Moreover, rescue experiments were performed to study the effect of miR-199a-5p on the cell cycle in MNNG/HOS cells over -expressing p27. [score:3]
Taken together, these data indicate that miR-199a-5p functions by targeting p27 in OS. [score:3]
Identification of PIAS3 as a target of miR-199a-5p and the activation of STAT3 by miR-199a-5p. [score:3]
As shown in Fig. 3G, the protein level of p-STAT3 was obviously reduced in PIAS3-over -expressing cells (PIAS3-LV) after transfection with pre-miR-199a-5p, compared with their control cells (NC-LV). [score:2]
In the following experiments, we focused attention on the interaction between PIAS3/p27 and miR-199a-5p in the development of OS. [score:2]
How to cite this article: Wang, C. et al. MicroRNA-199a-5p promotes tumour growth by dual -targeting PIAS3 and p27 in human osteosarcoma. [score:2]
Here, we performed qRT-PCR assays on eight pairs of OS and normal adjacent tissue (NAT) samples to quantify the expression of miR-199a-5p. [score:2]
Our findings elucidated that it is likely miR-199a-5p, acting as an oncogenic miRNA, that could lead to the loss of p27 and regulate the cell proliferation and cell cycle in OS. [score:2]
As shown in Figs 4F and S3, transfection with pre-miR-199a-5p in Saos-2 cells for 48 hours resulted in a distinct decrease in the G1-phase cell population (55.44% vs. [score:1]
The anti-tumour activity of the miR-199a-5p AMO was then assessed in vivo. [score:1]
Polyetherimide (PEI, 25 kDa)/miR-199a-5p AMO complexes were prepared as prevously reported 45. [score:1]
A solution of the miR-199a-5p AMO (2 mg/ml) was mixed with an equal volume of a PEI aqueous solution (4 mg/ml) for 30 minutes at room temperature for the following therapeutic experiments. [score:1]
Flow cytometry was used to examine whether miR-199a-5p influences the cell cycle in Saos-2 and MNNG/HOS cells. [score:1]
Nine days after the transplantation, when the tumours had grown to approximately 50 mm [3], the mice were randomized into four groups, a PEI & miR-199a-5p AMO treatment group, PEI & scramble DNA treatment group, or PEI treatment group and a non-treatment (control) group (7 mice per group). [score:1]
After intratumoural treatment with PEI and miR-199a-5p AMO complexes when the tumour volumes reached a size of approximately 100 mm [3] in the OS xenograft mo del, the mice showed greatly attenuated tumour growth, reduced tumour volume, and decreased tumour weight, while no significant differences in tumour growth were observed between the mice treated with PEI and scrambled DNA complexes or PEI alone and the control group (Fig. 5C and D). [score:1]
The excised tumours from the pre-miR-199a-5p-LV group were 1.57-fold heavier than those from the pre-ncRNA-LV group at 30 days post-implantation, whereas the tumours from the anti-miR-199a-5p-LV group weighted 56.5% less than those from the anti-ncRNA-LV group (Fig. 2C). [score:1]
As shown in Fig. 5D, the tumour weight in the PEI & miR-199a-5p AMO group was 54.0% less than that in the PEI & scramble DNA group. [score:1]
The effects of miR-199a-5p on cell proliferation and tumour growth in OS. [score:1]
As shown in Fig. 1A and B, the qRT-PCR analysis revealed that the miR-199a-5p level was significantly increased in OS samples. [score:1]
Furthermore, the level of miR-199a-5p in sorted MNNG/HOS cells was detected by qRT-PCR. [score:1]
miR-199a-5p promotes OS cell proliferation in vitro and tumour growth in vivo. [score:1]
miR-199a-5p could stimulate osteosarcoma cell proliferation and tumour growth in vitro and in vivo. [score:1]
Saos-2 or MNNG/HOS cells were transfected with 100 pmol of pre-scramble, pre-miR-199a-5p, anti-scramble or anti-miR-199a-5p. [score:1]
Thereafter, we performed rescue experiments to investigate the effect of miR-199a-5p in MNNG/HOS cells stably over -expressing PIAS3. [score:1]
In addition, the mRNA levels of the proliferation markers PCNA and KI-67 were used to assess the growth of Saos-2 or MNNG/HOS cells after transfection with pre-/anti-miR-199a-5p. [score:1]
In contrast, in anti-miR-199a-5p -transfected cells, an increase in the G1-phase cell population (52.33% vs. [score:1]
Anti-tumour effects of an anti-miR-199a-5p oligonucleotide (miR-199a-5p AMO) in vivo. [score:1]
Interestingly, miR-199a-5p exerts diverse and conflicting biological effects in several cancers depending on the specific cell type and context. [score:1]
The correlation between miR-199a-5p and p27 was further examined in OS tissues. [score:1]
After 4 groups of nude mice (7 mice/group) were subcutaneously implanted with the sorted cells, we observed that the size of tumours in the pre-miR-199a-5p-LV group was significantly larger than those in the pre-ncRNA-LV group at each time point, whereas the size of tumours in the anti-miR-199a-5p-LV group exhibited the opposite trend (Fig. 2C). [score:1]
[1 to 20 of 105 sentences]
3
[+] score: 383
Consistent with c-MYC representing a functional downstream target of miR-199a-3p, knocking down endogenous c-MYC using 3 individual c-MYC -targeting siRNAs (Supplementary Figure 3B) or inhibiting c-MYC expression using JQ1 [36] (Supplementary Figure 3C) both inhibited PC3 cell viability (Figure 7C-7D). [score:12]
Interestingly, miR-199a-3p overexpression did not reduce CD44 mRNA levels in PCa cells (Figure 6D), suggesting that miR-199a-3p likely targets CD44 in PCa cells by causing translational inhibition. [score:9]
Of note, either overexpression (data not sown) or knockdown of c-MYC (Supplementary Figure 3E–3F) had no effect on miR-199a-3p expression, although c-MYC was reported to modulate the expression of a number of miRNAs involved in the cell cycle and apoptosis [11, 37]. [score:8]
To test this possibility, we employed 8 different target-prediction programs, 3 of which (i. e., RNA22, TargetMiner, and TargetScan) simultaneously identified a putative binding site of miR-199a-3p at the CD44 3′-UTR (Figure 6A-6B). [score:7]
These discussions, together with the fact that miR-199a-3p was significantly underexpressed in CD44 [+] PCa cells [15] (Figure 1A), raise the possibility that miR-199a-3p exerts its PCa -inhibitory effects via targeting, at least partly, CD44. [score:7]
Regardless, by simultaneously targeting a cohort of pro-oncogenic molecules, miR-199a-3p manifests powerful PCa-suppressing effects, mainly through inhibiting cell proliferation (Figure 7I). [score:7]
Since our preceding experiments have shown that miR-199a-3p suppressed PCa primarily by inhibiting cell-cycle progression and cell proliferation, we subsequently focused our efforts on 3 mitogenic molecules important for regulating PCa cell proliferation, i. e., c-MYC, cyclin D1, and EGFR. [score:6]
The fact that 3 tumor-suppressive miRNAs, i. e., miR-34a [9], miR-708 [28], and miR-199a-3p (this study), simultaneously target 5 different sites at the CD44 3′-UTR (Figure 6A), highlights the critical importance of CD44 in regulating CSC properties [6– 10]. [score:6]
Mechanistically, we find that like miR-34a, which is also under-expressed in CD44 [+] PCSCs [9], miR-199a-3p directly targets CD44 in several PCa cell types. [score:6]
We have shown that overexpression of miR-199a-3p greatly inhibits proliferation and clonal and sphere-forming capacities of CD44 [+] as well as bulk PCa cells. [score:5]
Expression of miR-199a-3p inhibits cell proliferation. [score:5]
Notably, our present study has provided evidence that miR-199a-3p may also exert tumor-suppressive functions via modulating several novel targets, i. e., c-MYC, cyclin D1, and EGFR. [score:5]
Notably, miR-199a-3p inhibited secondary sphere formation in PC3 cells (Figure 2F), suggesting that miR-199a-3p may inhibit PCSC self-renewal in vitro. [score:5]
Taken together, the above experiments indicate that miR-199a-3p inhibits prostate tumor regeneration and growth by inhibiting cell proliferation without causing cell death. [score:5]
These results indicate that reduced expression of c-MYC facilitates the inhibitory effect of miR-199a-3p in PCa cells such as PC3. [score:5]
Taken together, these observations indicate that enforced expression of miR-199a-3p inhibits PCa cell cell-cycle progression and proliferation without affecting cell death or senescence. [score:5]
Impressively, miR-199a-3p expression inhibits both tumor initiation and tumor growth in several PCa xenograft mo dels. [score:5]
miR-199a-3p suppresses prostate tumor regeneration in vivomiR-199a-3p has been shown to inhibit peritoneal dissemination of ovarian carcinoma cells in a xenograft mo del [23]. [score:5]
Strikingly, miR-199a-3p overexpression completely inhibited tumor regeneration from bulk DU145 cell (Figure 4D, b). [score:5]
miR-199a-3p inhibits PCa cell proliferation in vitromiR-199a-3p has been reported as a tumor suppressive miRNA in several tumor types. [score:5]
miR-199a-3p overexpression by oligo transfection also inhibited tumor regeneration in PPC-1 and PC3 cells (data not shown). [score:5]
At 10,000 injections, miR-199a-3p inhibited both tumor incidence and tumor growth (Figure 4A; note that miR-199a-3p overexpressing CD44 [+]DU145 cells regenerated tumors that were only 1/10 of the tumors derived from NC -transfected CD44 [+]DU145 cells). [score:5]
We also show that miR-199a-3p exerts its PCa suppressive functions via targeting CD44 and several mitogenic molecules including c-MYC, cyclin D1 and EGFR. [score:5]
We wondered what other molecules miR-199a-3p might also target in PCa cells, either directly or indirectly. [score:5]
In contrast, mutations in the miR-199a-3p binding site at CD44 3′-UTR abolished the luciferase -inhibitory effects of miR-199a-3p in both cell types (Figure 6C). [score:4]
These results indicate that miR-199a-3p regulates cyclin D1 and EGFR expression in PC3 cells. [score:4]
Of note, miR-199a-3p downregulated exogenous c-MYC protein derived from a c-MYC-encoding cDNA construct in both PC3 and DU145 cells (Figure 7A; lanes 6 and 10 vs. [score:4]
CD44 is a direct target of miR-199a-3p. [score:4]
Kinose et al reported that miR-199a-3p was downregulated under hypoxia and decreased the clonal capacity in ovarian cancer cells [23]. [score:4]
The results revealed significant under -expression of miR-199a-3p in all three CD44 [+] PCa cell populations (Figure 1A). [score:3]
To explore the therapeutic potential of miR-199a-3p in PCa, we set out to test its tumor -inhibitory effects in a pre-established PCa xenograft mo del. [score:3]
Finally, miR-199a-3p was reported to target CD44 in HCC cells [19]. [score:3]
miR-199a-3p suppresses prostate tumor regeneration in vivo. [score:3]
Finally, consistent with previous reports that miR-199a-3p also targets other oncogenic molecules such as mTOR [18, 20], we observed reduced mTOR protein levels in DU145 cells transfected with miR-199a-3p oligos (Figure 7H). [score:3]
C. Schematic showing miR-199a-3p expressing vector pGIPZ-199A based on GIPZ lentiviral shRNA backbone (pGIPZ-Ctrl). [score:3]
miR-199a-3p inhibits clonal and clonogenic properties of HPCa cells. [score:3]
To uncover the potential mechanisms underlying the PCa cell “growth -inhibitory” effects of miR-199a-3p, we assessed cell proliferation by BrdU incorporation and cell-cycle (i. e., DNA content) analysis, cell death by Annexin V and PI staining, and cell senescence by senescence -associated β-galactosidase staining. [score:3]
miR-199a-3p inhibits PCSC properties. [score:3]
miR-199a-3p also targets c-MYC and several other mitogenic signaling molecules. [score:3]
Figure 5 A. Schematic of inducible miR-199a-3p expressing lentiviral vector. [score:3]
Most miR-199a-3p related studies are in hepatocellular carcinoma (HCC), in which it is reported to induce apoptosis or to suppress cell proliferation by delaying G1/S transition [18– 20]. [score:3]
lanes 5 and 9, respectively), suggesting that miR-199a-3p might target c-MYC coding sequence. [score:3]
We first processed the raw data using the ΔCt method, by which the expression level of miR-199a-3p in each sample was normalized to that of RNU48. [score:3]
I. A schematic summarizing downstream targets of miR-199a-3p in PCa cells. [score:3]
miR-199a-3p has been shown to inhibit peritoneal dissemination of ovarian carcinoma cells in a xenograft mo del [23]. [score:3]
miR-199a-3p has been reported as a tumor suppressive miRNA in several tumor types. [score:3]
In fact, miR-199a-3p has been shown to suppress, in addition to CD44 [19], several other molecules including MET, mTOR, and PAK4 [18, 20]. [score:3]
To that end, we first constructed a doxycycline (Dox) inducible lentiviral system to overexpress miR-199a-3p (lenti-199a), in which primary miR-199A1 sequence was cloned downstream from the RFP reporter (Figure 5A). [score:3]
Bulk HPCa cells with miR-199a-3p overexpression demonstrated much lower sphere-forming (Figure 3A-3B) and clonal (Figure 3C-3D) capacities than the corresponding HPCa cells transfected with NC oligos. [score:3]
Note that the miR-199A1 lentivector did encode miR-199a-5p; however, the miR-199a-5p levels in both DU145 and LAPC9 cells were much lower than miR-199a-3p levels (Figure 4D-4E), suggesting that the PCa-suppressive effects we observed were largely ascribed to miR-199a-3p. [score:3]
It seems that miR-199a-3p may target a different cohort of molecules in different PCa cell types. [score:3]
A. Schematic of inducible miR-199a-3p expressing lentiviral vector. [score:3]
Consistent with the cell-cycle analysis, miR-199a-3p inhibited BrdU incorporation in PC3 (Figure 1I) and DU145 (Figure 1J) cells. [score:3]
In some experiments, bulk or purified CD44 [+] cells were infected with empty (pGIPZ-Ctrl) or miR-199a-3p expressing lentivirus (pGIPZ-199A) at MOI (multiplicity of infection) of 10-20 for 72 h. pGIPZ-199A vector was established from the backbone of GIPZ lentiviral shRNA (GIPZ-Ctrl) (GE Dharmacon), in which pre-miR-199A1 and its frank sequences were cloned into XhoI and MluI sites (Supplementary Figure 1A). [score:3]
miR-199a-3p inhibits PCa cell proliferation in vitro. [score:3]
So how did miR-199a-3p exert its PCa-suppressive effects? [score:3]
These results indicate that miR-199a-3p also manifests inhibitory effects in primary PCa cells. [score:3]
Interestingly, exogenous miR-199a-3p did not significantly suppress the endogenous c-MYC protein levels in DU145 cells (Figure 7A), suggesting that c-MYC may not be the primary mediator of the miR-199a-3p effects in DU145 cells. [score:3]
Interestingly, miR-199a-3p is one of the miRNAs most dramatically underexpressed in the CD44 [+] PCa cell populations uncovered in our miRNA library screening [15]. [score:3]
Our previous study suggested that miR-199a-3p is underexpresssed in several PCa stem/progenitor cell populations, especially in CD44 [+] PCa cells [9, 15]. [score:3]
Figure 1 A. Relative expression levels of miR-199a-3p. [score:3]
miR-199a-3p suppresses clonogenic and sphere-forming properties in PCa cells. [score:3]
In both cases, we observed, in miR-199a-3p overexpressing tumors, reduced cellularity (Figure 4F-4G; compare panels a vs. [score:3]
To further investigate the tumor -inhibitory effects of miR-199a-3p, we constructed a lentiviral expression vector that encodes human miR-199A1 (Figure 4C; Supplementary Figure 1A). [score:3]
Cells were plated in six-well plate at indicated cell numbers and spheres scored on day 6. F. WB of cyclin D1 and EGFR in PC3 cells expressing miR-199a-3p (15 nM or 30 nM; 72 h). [score:3]
miR-199a-3p showed similar inhibitory effects in PC3 and LACP9 cells (Figure 2E-2G). [score:3]
As shown in Figure 4A, at 100,000 cell injections, miR-199a-3p significantly inhibited tumor growth as manifested by reduced tumor sizes. [score:3]
Nevertheless, miR-199a-3p overexpression still reduced tumor incidence and weight in LAPC9 cells (Figure 4E, b). [score:3]
Dox addition induced RFP reporter expression and increased miR-199a-3p levels (Figure 5B). [score:3]
miR-199a-3p inhibits xenograft tumor regeneration. [score:3]
Evidence that miR-199a-3p also targets c-MYC, cyclin D1, and EGFR in PCa cells. [score:3]
A. Relative expression levels of miR-199a-3p. [score:3]
miR-199a-3p was initially uncovered from our miRNA library screening for miRNAs differentially expressed in tumorigenic PCa cell subpopulations [9, 15]. [score:3]
In PCa, miR-199a-3p expression is found to be negatively associated with tumor staging and differentiation [17]. [score:3]
These results suggest that in 3 PCa cell types, miR-199a-3p overexpression causes G1 cell-cycle arrest with concomitant decrease in S or G2/M phase cells. [score:3]
miR-199a-3p overexpression significantly reduced colony formation of the CD44 [+] HPCa219 cells (Figure 3F, right). [score:3]
Overexpression of miR-199a-3p has also been reported to result in caspase -dependent and -independent apoptosis in lung cancer [21] and G1 phase cell-cycle arrest in osteosarcoma cells [22]. [score:3]
miR-199a-3p demonstrates inhibitory effects in primary human PCa (HPCa) cells. [score:3]
The miR-199a-3p expression level is generally decreased in cancers in comparison to their normal counterparts [18, 20, 22, 26]. [score:3]
We then compared the relative expression levels of miR-199a-3p (and/or miR-199a-5p) in different experimental groups (e. g., CD44 [+] vs. [score:2]
Bulk DU145 cells were also dramatically suppressed by miR-199a-3p in all of the abovementioned three assays (Figure 2B-2D). [score:2]
MiR-199a-3p is an under-studied miRNA, especially in PCa, with only one report so far showing miR-199a-3p underexpression in PCa compared to benign tissues [17]. [score:2]
Further luciferase reporter assays confirmed that miR-199a-3p partially targeted c-MYC in PC3 cells (Figure 7B). [score:2]
Figure 7 A. Western blotting (WB) showing the protein levels of c-MYC in LAPC9, PC3 and DU145 cells transfected with NC or miR-199a-3p (lanes 1-4 and 7-8) or co -transfected with pCDH-MYC vector (lanes 5-6 and 9-10) for 72 h. B. Luciferase assays showing the activity of WT or mutant MYC 3′UTR in PC3 cells expressing miR-199a-3p. [score:2]
Collectively, these observations demonstrate that miR-199a-3p negatively regulate PCSC properties. [score:2]
To determine whether miR-199a-3p possesses tumor -inhibitory effects in PCa, we carried out limiting-dilution assays (LDAs) in immunocompromised mice by monitoring tumor latency, incidence and endpoint weight. [score:2]
A. Western blotting (WB) showing the protein levels of c-MYC in LAPC9, PC3 and DU145 cells transfected with NC or miR-199a-3p (lanes 1-4 and 7-8) or co -transfected with pCDH-MYC vector (lanes 5-6 and 9-10) for 72 h. B. Luciferase assays showing the activity of WT or mutant MYC 3′UTR in PC3 cells expressing miR-199a-3p. [score:2]
As presented in Figure 5C (right), Dox induction in the lenti-199a group slowed down tumor growth (for unknown reasons, the lenti-199a group of tumors in the absence of Dox, without leakage of miR-199a-3p expression (data not shown)), also showed slightly slower growth compared to the corresponding lenti-Ctrl group). [score:2]
Collectively, these results suggest that c-MYC is regulated by miR-199a-3p in certain PCa cells. [score:2]
In this study, we present evidence for tumor suppressive functions of miR-199a-3p in both purified CD44 [+] and bulk PCa cells based on in vitro clonogenic and in vivo tumor regeneration assays as well as therapeutic experiments. [score:2]
G. Luciferase assays showing the activity of WT or mutant cyclin D1 or EGFR 3-UTR in PC3 cells expressing miR-199a-3p. [score:2]
Notably, mutation in the 3′-UTR of the miR-199a-3p binding site also restored luciferase activities to levels higher than in cells transfected with the WT 3-‘-UTR construct (Figure 7B). [score:2]
We transfected miR-199a-3p mimics or negative control (NC) oligos into either purified CD44 [+] (Figure 1B-1C) or bulk (Figure 1D-1F) PCa cells. [score:1]
miR-199a-3p reduced the live cell numbers in both purified CD44 [+] (Figure 1B-1C) and bulk (Figure 1D-1F) PCa cells. [score:1]
Preliminary studies have also revealed therapeutic efficacy of miR-199a-3p in retarding the growth of established xenograft tumors. [score:1]
miR-199a-3p exhibits therapeutic potential in a PCa xenograft mo dels. [score:1]
B. Predicted duplex formed between miR-199a-3p and 3′-UTR of CD44 by the RNA22 program. [score:1]
For example, in PC3 cells, the G1-phase cells increased from ~60% in the NC group to ~67% in the miR-199a-3p group (Figure 1G; Supplementary Figure 1D). [score:1]
Impressively, in two independent experiments, miR-199a-3p nearly completely abolished tumor regeneration from bulk DU145 cells (Figure 4B). [score:1]
First of all, we transfected miR-199a-3p and NC oligos into freshly purified CD44 [+] DU145 cells and subcutaneously implanted them into NOD/SCID mice. [score:1]
Altogether, results presented herein provide a rational for developing miR-199a-3p into anti-PCa replacement therapeutics. [score:1]
miR-199a-3p, lenti-Ctrl vs. [score:1]
NC or miR-199a-3p transfected cells (numbers indicated) were plated in 6-well plates and holoclones enumerated on day 12 (for A) and 14 (for B), respectively. [score:1]
However, studies on in vivo functions of miR-199a-3p in human cancers are generally very limited. [score:1]
Tumor pieces were quickly processed and epithelial HPCa cells were purified out (see Materials & Methods) and transfected with miR-199a-3p or NC oligos. [score:1]
Indeed, exogenously introduced miR-199a-3p reduced the CD44 protein levels in both PC3 and DU145 PCa cells (Figure 6E). [score:1]
CD44 [+] DU145 (B) and PC3 (C) cells, or bulk DU145 (D), PC3 (E), and VCaP cells (F) were transfected with 30 nM of NC or miR-199a-3p oligos and plated (20,000 cells/well) at day 0 and live cells counted at indicated days under microscope. [score:1]
pGIPZ-199A infection of LAPC9 cells for a short period of time (i. e., 48 h) led to only ~100 fold increase in miR-199a-3p levels (Figure 4E, a, right), much lower than in puromycin-selected DU145 cells (Figure 4D, a, right). [score:1]
The y-axis represents the miR-199a-3p levels in CD44 [+] cell population relative to its levels in CD44 [−] population. [score:1]
F-G. HE and IHC staining for tumors generated in NC or miR-199a-3p transfected CD44 [+] DU145 (F) and pGIPZ-Ctrl or pGIPZ-199A transduced LAPC9 (G) cells. [score:1]
400 TROP2 [+]CD44 [+] cells (purity 96.7%, below) were plated in triplicate and holoclones scored on day 9. Cells transfected with NC or miR-199a-3p (3p) oligos at 30 nM were used in above experiments (n=2-3 for each experiment). [score:1]
Importantly, CD44 protein levels were also reduced in the endpoint tumors derived from CD44 [+]DU145 cells transfected with miR-199a-3p oligos (Figure 6F), LAPC9 cells infected with the pGIPZ-199A (Figure 6G), and DU145 cells infected with the Dox-inducible lenti-199A (Figure 6H). [score:1]
In general, bulk or freshly purified CD44 [+] PCa cells and HPCa cells were transfected with NC miRNA or miR-199a-3p mimics (3p) using lipofectamine RNAiMAX (Invitrogen, Life Technology). [score:1]
Similar to c-MYC, miR-199a-3p also reduced the protein levels of cyclin D1 and EGFR in PC3 cells (Figure 7F). [score:1]
In the present study, we started by re-evaluating miR-199a-3p expression in the CD44 [+] cell population, freshly purified from DU145 cultures and two xenografts, i. e., LAPC9 and VCaP. [score:1]
Consistent with our earlier observations (Supplementary Figure 1C), transduction of DU145 cells with miR-199A1 did not cause appreciable cell death but led to significantly increased amount of miR-199a-3p (Figure 4D, a). [score:1]
We performed site-specific mutagenesis by mutating several nucleotides at the miR-199a-3p binding site on CD44 3′-UTR (Figure 6B). [score:1]
In the forgoing sections, we set out to determine the biological functions of miR-199a-3p in two AR [+]/PSA [+] (i. e., LAPC9 and VCaP) and three AR [−]/PSA [−] PCa cell line (DU145, PC3, and PPC-1) and xenograft (LAPC9 and VCaP) mo dels. [score:1]
These results, collectively, reveal a therapeutic potential of miR-199a-3p in PCa. [score:1]
When we transfected miR-199a-3p oligos into LAPC9 and PC3 cells, endogenous c-MYC protein levels decreased (Figure 7A; lanes 2 and 4 vs. [score:1]
In contrast, both DU145 and LAPC9 tumors showed very little apoptotic (i. e., lamin A [+]) cells and there were no differences between control and miR-199a-3p tumors (Figure 4F-4G; compare panels e vs f). [score:1]
The relative expression levels of miR-199a-3p and miR-199a-5p were measured by RT-qPCR. [score:1]
H. mTOR, phosphorylated AKT and AKT were determined by WB in DU145 cells treated with NC or miR-199a-3p (10 nM, 72 h). [score:1]
Neither miR-199a-3p nor NC induced appreciable cell senescence in the 3 PCa cell types (date not shown). [score:1]
Indeed, we identified a potential miR-199a-3p binding site in the c-MYC CDS (Supplementary Figure 3A). [score:1]
miR-199a-3p exhibits therapeutic potential in PCa cells. [score:1]
G-H. DNA content analysis in bulk PC3 (G) or DU145 (H) cells transfected with miR-199a-3p or NC (30 nM, 48 h). [score:1]
Consequently, we studied the biological functions of miR-199a-3p in 4 HPCa specimens with ~100% tumor involvement (Supplementary Figure 2A-2D). [score:1]
In silico analysis identified a putative miR-199a-3p binding site at the 3′-UTR of CCND1 and EGFR, respectively (Supplementary Figure 3A). [score:1]
For therapeutic experiments, DU145 cells were infected with negative control (lenti-Ctrl) and miR-199a-3p lentivirus (lenti-199A) and subcutaneously implanted into NOD/SCID female mice. [score:1]
Interestingly, accompanying the increase in G1-phase cells, miR-199a-3p reduced S-phase cells in PC3 (Figure 1G; Supplementary Figure 1D) but reduced G2/M-phase cells in DU145 (Figure 1H; Supplementary Figure 1D) and PPC-1 (Supplementary Figure 1B; Supplementary Figure 1D) cells. [score:1]
D-E. mRNA (D) and protein (E) of CD44 in NC or miR-199a-3p transfected DU145 and PC3 cells. [score:1]
In contrast, no significant difference was observed between NC and miR-199a-3p treated PCa cells in early apoptotic, late apoptotic or late necrotic cells (Supplementary Figure 1E). [score:1]
We observed that miR-199a-3p treatment increased the % of G1-phase cells in PC3, DU145, and PPC-1 cultures (Figure 1G and 1H; Supplementary Figure 1B-1D). [score:1]
Cells were transfected with NC or miR-199a-3p oligos at 30 nM. [score:1]
B. qPCR analysis of miR-199a-3p after Dox treatment for 72 h (left panel). [score:1]
[1 to 20 of 136 sentences]
4
[+] score: 360
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-199b, hsa-mir-191
Contrary to the down-regulation of miR-199a in TGCTs, expression of miR-199a was up-regulated in gliomas (Figure 2C), and the elevated expression may be due to the hypomethylation of the promoter in Chr1 but not in Chr 19 (Fig 1C and 2B). [score:11]
One potential target, MAFB, was selected for further validation because: 1) Both expression array and qPCR revealed its reduced expression upon miR-199a-5p transfection; 2) Expression of MAFB was high in HT cells but much lower in NT2 cells (Figure S3); 3) The fact that MAFB occupies a central location in the pathway map generated suggests that it is likely to be a “master” in controlling other genes and act as a key regulator to exhibit functions of miR-199a-5p (Figure 5B). [score:10]
The regulatory function of REST upon miR-199a expression was demonstrated by the up-regulation of both miR-199a-3p and-5p upon reduced expression of REST in NT2 cells (Figure 3D). [score:9]
A number of genes showed significant differential expression between the two groups (Table S2), with more genes showing down-regulation than up-regulation in miR-199a-5p transfected cells, consistent with the repression function of microRNA. [score:9]
Genes were selected for validation by qPCR according to the following criteria (Figure 5A): 1) Genes with significant reduced expression after miR-199a-5p transfection; 2) Genes predicted to be direct target of miR-199a-5p by prediction programs (e. g. Pictar, TargetScan, MiRanda). [score:8]
Western Blot showing reduced expression of PODXL, a confirmed direct target of miR-199a-5p in TGCTs after miR-199a-5p overexpression. [score:8]
The correlations between MAFB expression and miR-199a-3p or-5p expression, MAFB expression and tumor malignancy were analyzed by Spearman's rank correlation. [score:7]
In addition, we demonstrated MAFB to be a direct target of miR-199a-5p with reduced expression of both mRNA and protein (Figure 5A, 6A) both in cells and in testis tissues (Figure 6A, 7A, 7B, 7D), and the direct binding between miR-199a-5p and the 3′-UTR of MAFB through luciferase receptor assay (Figure 6B). [score:6]
Here, we showed that the anti-proliferation function of miR-199a-5p may be realized through its target MAFB, as knock-down of MAFB expression in NT2 cells could significantly reduce the growth rate of cells (Figure 7C). [score:6]
Since the functions of miRNAs could only be realized through its targets, we identified MAFB as a direct target under miR-199a-5p in TGCTs and explained the anti-proliferation effect of miR-199a-5p in TGCTs. [score:6]
Among the selected and q-PCR verified genes with reduced expression upon miR-199a-5p expression, we performed pathway analysis and identified MAFB as a “master” regulator (Figure 5B). [score:6]
All these genes were potential direct targets of miR-199a-5p according to prediction programs, e. g. Targetscan and MiRanda. [score:6]
Expression of miR-199a could be down-regulated by epigenetic changes like DNA methylation [10], [11] and histone modification [12]. [score:6]
For example, miR-199a is involved in cardiomyocytes protection by rapid down-regulation under hypoxic conditions and prompts HIF1a expression [15]. [score:6]
Since miR-199a-2 resides within the DNM3OS gene and sometimes the expression of miR-199a-2 is regulated through the effects of transcription factor on DNM3OS [13], however, in the two cancer systems we studied here, we did not observe a correlation between DNM3OS and miR-199a expression (negative data not shown). [score:6]
Since the functions of a microRNA could only be exhibited through its targets, we tried to identify the direct target(s) of miR-199a-5p in order to understand its biological roles. [score:6]
Since the functions of a miRNA could only be realized through its targets, besides the upstream regulation of miR-199a, we aimed to understand its biological roles by studying its downstream targets. [score:6]
*, p<0.05 miR-199a-3p expression of GBM samples comparing to normal brain; **, p<0.05 miR-199a-5p expression of GBM samples comparing to normal brain. [score:5]
Reduced expression of REST resulted in increased expression of both miR-199a-3p and-5p in NT2 cells (Amount of siRNA of REST transfected: 30 nM). [score:5]
Expression of miR-199a-5p was statistically significantly reverse-correlated with expression of MAFB in testis tissues (Spearmen ranking correlation factor = −0.276, p = 0.005). [score:5]
In this report, we examined the dysregulation of miR-199a in two different types of tumors, testicular germ cell tumors (TGCTs) and glioblastomas (gliomas), and revealed its opposite expression patterns and different regulatory mechanisms. [score:5]
A previously identified target of miR-199a-5p in TGCTs, PODXL [23], showed reduced protein expression in miR-199a-5p transfected cells by Western blot (Figure 4B). [score:5]
We identified PODXL and MAFB as putative targets of miR-199a-5p in TGCTs and explained the anti-invasion and anti-proliferation effects of the miRNA mediated by these targets. [score:5]
In addition, we showed that reduced expression of REST could increase the expression of miR-199a (Figure 3D). [score:5]
By studying the mechanisms that control the expressions of miR-199a and its various downstream targets, we hope to use miR-199a as a mo del to illustrate the complexity of miRNA biology. [score:5]
However, in gliomas tissues, these two genes did not show expression correlations with miR-199a-5p (Figure S4), indicating that they may not be targets of miR-199a in gliomas. [score:5]
Therefore, unlike the simultaneous regulation in TGCTs, the expressions of miR-199a in the two chromosomes were regulated differently in gliomas. [score:5]
Direct interaction between miR-199a-5p and MAFB was demonstrated by reduced luciferase report activity when miR-199a-5p and the recombinant plasmid of 3′-UTR of MAFB linked to the 3′-end of firefly luciferase reporter (MAFB-pGL) were co-expressed in NT2 cells comparing to cells transfected with scrambled control (Figure 6B). [score:4]
Its anti-invasion effect was demonstrated to be realized through the direct target of miR-199a-5p, PODXL [23]. [score:4]
MAFB knockdown suppresses tumor cell growth in vitro Our previously studies showed anti-proliferation effect of miR-199a in TGCTs [23]. [score:4]
Here we identified another direct target of miR-199a-5p, MAFB (v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian)), to explain its anti-proliferation effect. [score:4]
As a result, there may be different regulatory mechanisms for the two chromosomes that control the expression of miR-199a under different circumstances, making the biological behaviors of miR-199a diverse and complicated. [score:4]
Because brain tissues, especially normal brain tissues, are very hard to come by, we assayed all the brain tissues we could manage to get, and the evidence did point to, at least within a subgroup of gliomas, a possible relationship between methylation and expression of miR-199a in the brain tissues In order to understand the regulation of DNA methylation of miR-199a promoters in both Chr1 and Chr19, we searched for possible regulator(s) for both loci. [score:4]
These results indicated that MAFB could be a direct target of miR-199a-5p in TGCTs in vitro. [score:4]
A) Western blot showing expression decreased at protein level of MAFB after miR-199a-5p transfection; B) demonstrated direct binding between MAFB and miR-199a-5p. [score:4]
Table S2 Dysregulated genes list after miR-199a-5p over -expression in NT2 cells. [score:4]
To examine the regulation of expression in both TGCTs and glioblastomas, the methylation status of the promoter of miR-199a in chromosome 1 (Chr1) (Figure 1A) and chromosome 19 (Chr19) (Figure 2A) was interrogated with bisulfite sequencing. [score:4]
Because brain tissues, especially normal brain tissues, are very hard to come by, we assayed all the brain tissues we could manage to get, and the evidence did point to, at least within a subgroup of gliomas, a possible relationship between methylation and expression of miR-199a in the brain tissuesIn order to understand the regulation of DNA methylation of miR-199a promoters in both Chr1 and Chr19, we searched for possible regulator(s) for both loci. [score:4]
0083980.g006 Figure 6 A) Western blot showing expression decreased at protein level of MAFB after miR-199a-5p transfection; B) demonstrated direct binding between MAFB and miR-199a-5p. [score:4]
Validation of MAFB to be a direct target of miR-199a-5p in NT2 cells. [score:4]
MAFB was further confirmed as a direct target of miR-199a-5p by studies with testis tissues. [score:4]
D) Scatter plots of miR-199a-5p and miR-199a-3p expression against MAFB level. [score:3]
Expression of miR-199a-5p, but not-3p, correlates negatively with MAFB level (Negative: n = 12; Weak: n = 31; Moderate: n = 24; Strong: n = 26; miR-199a-5p: Spearman correlation = −0.276, p = 0.005; miR-199a-3p: Spearman correlation = −0.027, p = 0.791). [score:3]
qPCR showing more than four thousand fold changes of miR-199a-5p expression levels after transiently transfection of mimic of miR-199a-5p into NT2 cells comparing to NT2 cells transfected with scrambled control RNA. [score:3]
Upon de-methylation with 5-aza, expression of miR-199a was restored [10]. [score:3]
Identification of dysregulated genes after knock-in of miR-199a-5p in NT2 cells. [score:3]
Identification of MAFB as a putative target of miR-199a-5p in TGCTs. [score:3]
miR-199b-5p has identical targets, e. g. HIF1a, PODXL, DDR1, etc, as miR-199a-5p, probably because their sequences are almost identical with only two different base pairs (miR-199a-5p: cccaguguucagacuaccuguuc; miR-199b-5p: cccaguguuuagacuaucuguuc) [37], [38]. [score:3]
RNA from miR-199a-5p transfected cells and scrambled control transfected cells were isolated and purified for transcriptome studies by microarray expression chips (Figure 4C). [score:3]
Most studies of miRNAs only focus on a single system or disease mo del, which is neither thorough nor broad enough, especially for a sophisticated miRNA like miR-199a. [score:3]
*, p<0.05 miR-199a-3p expression in NT2 cells with siREST transfection compared with control; **, p<0.05 miR-199a-5p expression in NT2 cells with siREST transfection compared with control. [score:3]
Select group of genes with significantly repressed expression after miR-199a-5p transfection were subjected for pathway analysis using IPA program. [score:3]
In addition, in order to study the relationship between the expression of miR-199a-5p and MAFB, RNA isolated from the testis tissue arrays used for MAFB staining was subjected to Taqman qPCR. [score:3]
Western blotting showed that miR-199a-5p expression resulted in reduced MAFB protein level (Figure 6A). [score:3]
The biological roles of miR-199a are further complicated by its various targets in different systems. [score:3]
Elevated expression of miR-199a versus hypomethylation of miR-199a-2 promoter in Chr1 in glioma. [score:3]
3′-UTR of MAFB containing miR-199a-5p targeting site (MAFB) was cloned to the 3′-end of firefly luciferase (pGL vector). [score:3]
miR-199a is well-conserved through different species [8], [9], and has been identified by diverse high-throughput screenings in many mo dels and diseases. [score:3]
Previously we showed that expression of miR-199a was significantly lower in TGCTs comparing to normal testis cells. [score:3]
MAFB is highly expressed in malignant testicular tumor and negatively correlated with miR-199a-5p. [score:3]
Over -expression of miR-199a-5p was achieved by transfection of miR-199a-5p mimics into NT2 cells (Figure 4A). [score:3]
These assays provided the evidence for a regulatory mechanism on miR-199a expression through REST binding to its promoters, and the possible relations of REST to DNA methylation. [score:3]
Together with the anti-invasion effect mediated by the action of PODXL, miR-199a serves as a tumor-suppressor in TGCTs. [score:3]
In order to study the functions of miR-199a in TGCTs, we over-expressed miR-199a-5p in TGCT cells (NT2 cells) and examined the changes in transcriptome by microarray analysis. [score:3]
Heatmap showing hierarchical clustering of differently expressed genes after miR-199a-5p transfection (Fold change>1.2, FDR<0.6). [score:3]
Previously in TGCTs, we showed that miR-199a behaved as a tumor-suppressor with anti-proliferation and anti-invasion effects [23]. [score:3]
Therefore, the increased expression of miR-199a in gliomas could be a consequence of hypomethylation of the promoter of the allele in Chr1. [score:3]
Using miR-199a as an example, the two genomic loci that give rise to mature miR-199a could be regulated simultaneously as in TGCTs, or could be regulated differently as in gliomas. [score:3]
Upon co-transfection of REST expression vector into HEK-293T cells, the higher luciferase activities of the methylated group compared to the un-methylated group indicated a higher binding of REST on methylated promoters for both miR-199a-1 and -2 (Figure 3C). [score:2]
miR-199a offers an excellent example to illustrate the complexity of the miRNA regulation and action [4]. [score:2]
Among the gliomas patient samples examined, three out of five showed significantly elevated expression of both forms of mature miR-199a (miR-199a-3p and-5p) when compared to normal human brain (Figure 2B). [score:2]
Dysregulation of miR-199a in tumors were controlled by DNA methylation. [score:2]
This is the first time miR-199a was studied with a broader and more diverse approach in order to understand its regulation and function. [score:2]
In order to further establish the methylation status of miR-199a promoters versus the degree of REST binding and its potential effects on miR-199a expression, we performed in vitro methylation assay by simultaneous insertion of either methylated or un-methylated miR-199a promoter sequences in a luciferease reporter vector. [score:2]
qPCR showing increased expression of both miR-199a-3p and-5p in three out of five glioma patients compared with normal brain. [score:2]
*, p<0.05 miR-199a-5p expression compared miR-199a-5p mimics transfection in NT2 cells with control. [score:2]
Chromatin immunoprecipitation (ChIP) confirmed the direct binding of transcription factor REST on both promoters of miR-199a in Chr1 and Chr19 in NT2 and HT cells. [score:2]
Here we demonstrated the directed binding of REST to both miR-199a-1 and -2 promoters in testis cells and in brain tissues by ChIP (Fig. 3A, 3B), and the degree of binding is related to the degree of methylation. [score:2]
To understand the biological roles of miR-199a in tumor, we compared the expression of miRNA-199a in TGCTs with that in malignant (grade IV) glioblastomas tissues in male patients. [score:2]
Similarly in brain tissues, both non-gliomas brain and gliomas tissues showed hypermethylation of miR-199a-1 promoter, therefore a high REST binding. [score:1]
Hypermethylation of miR-199a-1 promoter was found in both normal brain DNA, Normal Brain 340 and glioma patient samples (GBM 27, 30, 69 and 70). [score:1]
The functions of miR-199a are quite complicated in different systems. [score:1]
Promoters of miR-199a-1 in Chr19 and miR-199a-2 in Chr1 were methylated in vitro and ligated into pGL3 luciferase vector (199A1-methylated and 199A2-methylated). [score:1]
Hypermethylation (95%) of miR-199a-1 promoter was found in testicular germ cell tumor cells (NT2 cells) comparing to unmethylation in normal testis fibroblasts (HT cells). [score:1]
Methylation status of miR-199a-1 promoter in Chr19 in tumors. [score:1]
miR-199b locates in Chromosome 9, being antisense of one intron of DNM1 while miR-199a-1 locates in Chromosome 19 and is within an intron of DNM2 and miR-199a-2 locates in Chromosome 1 and is within an intron of DNM3. [score:1]
miR-199a-5p mimics and miRNA scrambled control were purchased from Ambion. [score:1]
In addition to its two mature forms, there are two loci that encode the precursor of miR-199a-3p and-5p in the human genome; one in Chromosome 1 (miR-199a-2 in Chr1, miRBase Accession MI0000281) and the other in Chromosome 19 (miR-199a-1 in Chr19, miRBase Accession MI0000242). [score:1]
Here we showed that not only miR-199a-2 on Chr1, but also miR-199a-1 on Chr19 showed hypermethylation in NT2 cells. [score:1]
Function of REST on DNA methylation of miR-199a promoters. [score:1]
There is another miRNA, miR-199b, highly homologous to miRNA-199a [33]. [score:1]
After cleavage from its precursor and formation of the double stranded miRNA [5], [6], unlike most cases where the guide strand remains while the passenger strand is degraded, both strands from pre-miR-199a can form mature and functional miRNAs, namely miR-199a-3p and miR-199a-5p, respectively [7]. [score:1]
Our previously studies showed anti-proliferation effect of miR-199a in TGCTs [23]. [score:1]
Therefore, the anti-proliferation effect of miR-199a may be realized through its repression of MAFB in TGCTs. [score:1]
The plasmids were co -transfected with miR-199a-5p mimics (5p) or scrambled miRNA control. [score:1]
The binding of REST to miR-199a promoters in brain tissues was also consistent with their DNA methylation status. [score:1]
Lower panel showed the seed binding region between miR-199a-5p and 3′-UTR of MAFB (adapted from MiRanda database). [score:1]
Briefly, promoters regions of miR-199a were restriction-cut from pGL3 construct, gel-purified and in vitro methylated by CpG methyltransferase M. SssI (New England Biolabs, Ipswich, MA, USA). [score:1]
Transcriptome changes upon miR-199a-5p in TGCTs. [score:1]
Cloning of miR-199a promoter and in vitro methylation. [score:1]
The promoter region of miR-199a-1 (46:−670) and miR-199a-2 (+4:−370) were amplified by PCR and ligated to luciferase reporter vector pGL3-Basic (Promega). [score:1]
We confirmed the binding of REST on the two promoters of miR-199a in both testis cells and brain tissues by ChIP (Figure 3A, 3B, Figure S2). [score:1]
Cloning of miR-199a promoter and in vitro methylationThe promoter region of miR-199a-1 (46:−670) and miR-199a-2 (+4:−370) were amplified by PCR and ligated to luciferase reporter vector pGL3-Basic (Promega). [score:1]
Figure 1B showed that the promoter of miR-199a-1 in Chr19 was hypermethylated in NT2 cells comparing to HT cells (95% comparing to 8%). [score:1]
Promoter of miR-199a-1 (+5:−628) embedded in intron-15 of DNM2 is indicated with relative locations of all CpG sites (lolipops). [score:1]
From UCSC genome browser (NCBI36/hg18), we discovered a common binding factor for both miR-199a-1 and miR-199a-2 promoters, named REST, from ENCODE transcription factor ChIP-seq results. [score:1]
S1, S2 and S3 are three consecutive segments of miR-199a promoters in Chr1 and Chr19 (Figure S1). [score:1]
A volume of 100 ng of pGL-MAFB vector or empty pGL vector was co -transfected with miR-199a-5p or scrambled control into NT2 cells (24-well format, six replicates for each combination). [score:1]
[1 to 20 of 108 sentences]
5
[+] score: 342
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-199b
Importantly, we showed that enforced expression of miR-199a-5p significantly down-regulated the expression of HIF-1α in hypoxia -induced MM cells. [score:8]
In summary, our results revealed that hypoxia down-regulates the expression of miR-199a-5p in MM via activation of AKT in order to allow the up regulation of HIF-1α and pro-angiogenic genes. [score:7]
miR-199a-5p targets and suppresses HIF-1α expression into hypoxic MM cells. [score:7]
Notably, we observed that enforced expression of miR199a-5p into hypoxic MM cells strongly suppressed nuclear HIF-1α protein expression (Fig. 2A). [score:7]
These data indicate the occurrence of a negative feedback loop between miR-199a-5p and AKT pathway where miR-199a-5p negatively regulates AKT expression, while activation and functional AKT represses miR-199a-5p expression (Supplemental Fig. 4A). [score:6]
As shown in Fig. 7A, over -expression of AKT1 induced down-regulation of miR-199a-5p. [score:6]
It has been reported that miR-199a-5p is down-regulated in hypoxic conditions and specifically targets the 3'-UTR region of HIF-1α [55]. [score:6]
Among miRNAs deregulated in MM, miR-199a-5p is of relevant interest because directly targets HIF1-α, a prominent transcription factor which regulates angiogenesis, predominantly via induction of VEGF transcription [41- 43]. [score:6]
Consistent with the previously reported findings, the over -expression of miR-199a-5p in MM cells caused a decrease of bFGF expression, an important pro-angiogenic factor involved also in endothelial cell migration [60- 63]. [score:5]
miR-199a-5p expression in myeloma cells and hypoxic-effect on miR-199a-5p expression in MM cells. [score:5]
As shown in Figure 6A, enforced expression of miR199a-5p decreased cell growth in all MM cell lines analyzed; in particular, cell growth inhibition was more evident 72 hours after transfection. [score:5]
Furthermore, addition of normoxic conditioned medium from MM cells over -expressing miR-199a-5p to the endothelial monolayer reduced the expression of cell-cell adhesion molecules such as VCAM-1 and ICAM-1 (Fig. 3D). [score:5]
Although the precise molecular mechanisms underlying miR-199a-5p/Akt in MM needs to be fully elucidated, these results provide insights on miR-199a-5p-Akt pathway cross-talk in MM indicating the occurrence of a regulatory negative loop where miR-199a-5p downregulates functional AKT which, in turn, represses miR-199-5p [70]. [score:5]
Importantly, miR-199a-5p is down-regulated in a variety of malignancies including MM where its deregulation seems to be correlated with chromosomal aberrations [54, 56]. [score:5]
In our study we found that repression of DDR1 protein upon enforced expression of miR-199a-5p occurred together with a reduced cellular migration and reduced expression of the matrix metalloproteinase MMP2. [score:5]
Hypoxic MM cells were transfected with miR-199a-5p and, once HIF-1α was blocked, we observed the inhibition of Snail expression and higher levels of E-cadherin. [score:5]
Furthermore, when MM cells were treated with the PI3-K/AKT inhibitor LY294002, we observed restoration of miR-199a-5p expression (Fig. 7B). [score:5]
This experiment was performed in three different cell lines expressing different levels of miR199a-5p and we found that miR-199a-5p expression was increased only in the two cell lines where its levels are low (Supplemental Figure 5A). [score:5]
Here, we demonstrated that functional AKT1 overexpression is sufficient in repressing miR-199a-5p expression while AKT1 depletion results in an increase of miR-199a-5p. [score:5]
Accordingly, we found a strong reduction of Sirt1 expression, another miR-199a-5p predicted target required for HIF-1α accumulation [55, 57]. [score:5]
miR-199a-5p targets HIF-1α and reduces HIF-1α and SIRT1 protein expression in hypoxic MM cells. [score:5]
miR-199a-5p regulates DDR1 expression and decreases chemotaxis of MM cells. [score:4]
In particular, AKT induces downregulation of miR-199a-5p, which is required for de-repression of Hif-1α [45, 55]. [score:4]
Taken together, these data suggest that i) miR199a-5p has a role in regulating tumor dissemination induced by hypoxia, and that ii) miR-199a-5p modulates tumor cell migration, at least in part by targeting DDR1. [score:4]
Our findings indicate that treatment with demethylating agent can induce a restoration of miR-199a-5p expression in MM cells even if we can rule out, at least in our experimental conditions, a direct correlation with the methylation status of its promoter. [score:4]
To investigate the molecular mechanism of miR-199a-5p down-regulation in hypoxic MM cells, we over-expressed AKT1 in MM cells and we evaluated for the miR-199a-5p expression. [score:4]
Recent findings indicate that miR-199a expression is finely regulated also by promoter methylation on both Chr1 and Chr19, where its gene is located. [score:4]
Furthermore, it has been demonstrated that hypoxia induces down-regulation of miR-199a-5p, probably through activation of the AKT pathway [44, 45]. [score:4]
miR-199a-5p regulates DDR1 expression and decreases migration of MM cells. [score:4]
Taken together, these results indicate that miR-199a-5p directly inhibits the synthesis of angiogenic factors by MM cells and interferes with the MM/endothelial cell loop which promotes the basic events in the angiogenic response. [score:4]
In contrast, no differences were observed in cells where miR199a-5p is not down-regulated. [score:4]
In addition, we validated HIF-1α as a direct target of miR-199a-5p in myeloma cells. [score:4]
To assess whether miR-199a-5p directly affects the expression of HIF-1-α in MM cells, we evaluated the effect induced by enforced expression of synthetic miR-199a-5p mimics on HIF-1-α protein levels in cells exposed to hypoxic culture conditions. [score:4]
These results indicate that hypoxia in MM cells down-regulate miR-199a-5p and this effect is further strengthened by an hypoxic huBMM. [score:4]
Consistent with these observations, we found a deregulated expression of miR-199a-5p in myeloma cell lines. [score:4]
Here, we focused on the role of miR-199a-5p in both normoxic and hypoxic MM cells, because HIF-1α is predicted to be a potential target of miR-199a-5p [54]. [score:3]
Notably, miR-199a-5p induced also a reduction of total and phosphorylated AKT proteins expression. [score:3]
Notably, miR-199a-5p expression was further decreased when MM cells where co-cultured with hypoxic BMSCs (Fig. 1D). [score:3]
In parallel, we analyzed the expression of miR-199a-5p in response to hypoxia in MM cells. [score:3]
The discoidin domain receptor-1 (DDR1) is a predicted target of miR-199a-5p [41]. [score:3]
In addition, BMSCs exposed to conditioned medium of miR-199a-5p -transfected MM cells showed impaired expression of IL6 and IL8. [score:3]
miR-199a-5p overexpression increases adhesion of MM cells to a monolayer of BMSCs under hypoxic conditions. [score:3]
miR-199a-5p expression in human MM cell lines and hypoxic-response of MM cells. [score:3]
Furthermore, we demonstrated that the enforced expression of miR-199a-5p triggers anti-proliferative and pro-apoptotic effects in hypoxic MM cells. [score:3]
We analyzed DDR1 expression in both normoxic and hypoxic MM cells transfected with miR-199a-5p. [score:3]
We first evaluated its expression in a panel of MM cell lines and then we studied the biological effect induced in vitro by enforced expression of synthetic miR-199a-5p mimics in both normoxic and hypoxic conditions. [score:3]
Among cell lines analyzed by qRT-PCR, we found that miR-199a-5p is significantly down-regulated in 4 (OPM2, U266, KMS11, MM1S) out of 10 lines as compared to normal PCs (Fig. 1A). [score:3]
Another mechanism that control the expression of miR-199a is the methylation status of its promoters on both Chr1 and Chr19 [42, 46]. [score:3]
These results suggest that the increase of miR-199a-5p expression following treatment with 5-AZA does not involve the de-methylation of mir199a-5p promoters thus suggesting an alternative as yet unidentified epigenetic mechanism. [score:3]
Notably, this effect was associated to a significantly decreased expression of cell-cell adhesion molecules in endothelial cells such as VCAM-1 and ICAM-1. All together, these results suggest that restoration of miR-199a-5p has an important effect on myeloma -induced angiogenesis, acting on the production of pro-angiogenic factors by cells of the hypoxic microenvironment. [score:3]
On the basis of these findings, we attempted to restore the miR-199a-5p expression in MM cells in order to evaluate its activity on the expression of pro-angiogenic factors. [score:3]
All together these findings provide evidence that enforced expression of miR-199a-5p exert antitumor activity in conditions that recapitulate the MM hypoxic huBMM. [score:3]
In addition, we silenced transiently AKT1 in MM cells and we found an increase of miR-199a-5p expression (Fig. 7C). [score:3]
In order to further verify if the demethylation of miR-199a promoters was dose -dependent, we treated U266 cell line with either 5μM 5-azacytidine or with trichostatin A, a histone deacetylase inhibitor with demethylating activity. [score:3]
miR-199a-5p inhibits the hypoxic induction of pro-angiogenic factors and reduces endothelial cells migration. [score:3]
In parallel, miR-199a-5p reduces the expression of CXCR4 in hypoxic conditions. [score:3]
We believe that our results disclose a relevant role of miR-199a-5p in MM-angiogenesis and provide the rationale for the design of innovative miRNA -based therapeutic approach in this disease. [score:3]
AKT control of miR-199a-5p expression in hypoxic MM cells. [score:3]
We provide the first evidence, at our knowledge, that enforced expression of miR-199a-5p increases the percentage of hypoxic MM cells adherent to a monolayer of hypoxic BMSCs. [score:3]
Using these cells, we found a reduction of miR-199a-5p expression in both cells exposed to hypoxic conditions and co-cultured with hypoxic BMSCs. [score:3]
A highly significant (P<0,05) inhibition of tumor growth was detected following 6 injections (3 days apart) of miR-199a-5p formulated in NLE particles in NCI-H929 xenografts (Fig. 8A). [score:3]
miR-199a-5p overexpression reduces proliferation and promotes apoptosis in hypoxic MM cells. [score:3]
miR-199a-5p inhibits the hypoxia-induction of pro-angiogenic factors and reduces endothelial cells migration. [score:3]
Importantly, all our observations translated in a significant in vivo activity of formulated synthetic miR-199a-5b delivery which add potential clinical significance to our study. [score:3]
Several studies suggested a potential role of DDR1 in tumor cell migration and invasion, usually mediated by extracellular matrix degradation; in addition, also DDR1 mRNA is predicted to be a potential target of miR-199a-5p [41]. [score:3]
We indeed found that enforced expression of miR199a-5p mimics significantly reduced VEGF-A, IL-8 and bFGF mRNA, both in normoxic as well as in hypoxic cells (Fig. 3A). [score:3]
Figure 8 In vivo anti-tumor activity of miR-199a-5p after intratumoral delivery in MM mouse-mo dels(a) In vivo tumor growth of NCI-H929 xenografts intratumorally -treated with NLE (MaxSuppressor™ In Vivo RNA-Lancer II)-miR-199a-5p or miR-NC. [score:3]
As shown in Fig. 2C, miR-199a-5p indeed reduced Sirt1 protein expression. [score:3]
3.1-HA-myr-AKT dominant active construct (AKT) or the empty vector pcDNA3.1 (vector) and 48 hours later analyzed for miR-199a-5p expression levels by quantitative RT–PCR. [score:3]
Conversely, we showed that the enforced expression of miR-199a-5p reconstituted the adhesion capacity of hypoxic MM cells to a monolayer of hypoxic BMSCs (Fig. 5A). [score:3]
Interestingly, among the pro-angiogenic genes directly regulated by HIF-1α in MM cells, VEGF-A and IL-8 were strongly reduced after miR-199a-5p transfection, mainly in hypoxic conditions [11, 58, 59]. [score:3]
Moreover, hypoxic MM cells transfected with miR-199a-5p expressed higher levels of E-cadherin and lower levels of Snail mRNA (Fig. 5B-C). [score:3]
To assess the effect of miR-199a-5p expression on the migration of MM cells, we performed a chemotaxis assay on hypoxic and normoxic MM cells. [score:2]
AKT pathway regulates miR-199a-5p activity in hypoxia. [score:2]
miR-199a-5p expression was normalized on RNU44 (Applied Biosystems, Assay Id 001094). [score:2]
Here we investigated if its expression was regulated by miR-199a-5p in MM cells. [score:2]
Taken together, these data support the development of miR-199a-5p mimics as a new potential therapeutic agents in the treatment of MM. [score:2]
On the basis of this finding demonstrating a role for miR-199a-5p in MM angiogenic response and control of cell growth and survival, we investigated the molecular mechanism responsible of the miR-199a-5p downregulation in MM. [score:2]
In our study, we first validated HIF-1α as direct target of miR-199a-5p and then we evaluated if miR-199a-5p restoration in MM cells could have a role in the mechanism described above. [score:2]
In order to clarify if down-regulation of miR-199a-5p in MM cell lines specifically depend by hypermethylation of its two promoter regions in chromosome 19 (1a) and in chromosome 1 (2a), respectively, the methylation levels of CpG sites located within these regions were evaluated by Sequenom MassARRAY EpiTYPER. [score:2]
We observed a significant decrease of miR-199a-5p expression in hypoxic MM cells as compared to normoxic counterpart (Fig. 1C). [score:2]
We therefore conclude that miR-199a-5p by intratumoral delivery is highly effective against MM xenografts and significantly prolongs host survival. [score:1]
1×10 [6] cells were electroporated with scrambled (miR-NC) or synthetic pre-miR-199a-5p (miR-199a-5p) at a final concentration of 100nM, using Neon Transfection System (Invitrogen), with 1050 V, 30ms, 1 pulse. [score:1]
Conversely, we found a decrease in metalloproteinase MMP2 also, at mRNA and protein level, both in normoxic and hypoxic MM cells transfected with miR-199a-5p, although these latter effects were mainly detectable in hypoxic conditions (Fig. 4A-B). [score:1]
In vivo anti-tumor activity of formulated miR-199a-5p against MM xenografts. [score:1]
Figure 1(a) Quantitative RT-PCR analysis of miR-199a-5p using total RNA from 10 MM cell lines and 1 MM patient sample. [score:1]
In vitro transfection of MM cells with synthetic mir-199a-5p. [score:1]
Figure 6(a) Cell growth curves of OPM2 and U266 transfected with synthetic miR-199a-5p (miR-199a-5p) or scrambled oligonucleotides (NC). [score:1]
Again we did not observe demethylation of miR-199a-5p (Supplemental Fig. 5C) of both promoter regions. [score:1]
To evaluate the effects induced by enforced expression of miR-199a-5p on MM cell growth, we analyzed cell proliferation, cell cycle and apoptosis. [score:1]
We observed that miR-199a-5p mimics produced a relevant decrease in the number of endothelial migrating cells in normoxic condition (Fig. 3C). [score:1]
Taking in account that secretion is increased in hypoxic MM cells, we investigated whether enforced expression of miR-199a-5p in hypoxic MM cells was able to reduce VEGF-A protein secretion. [score:1]
Figure 4C shows that miR-199a-5p transfection reduces the percentage of MM migrating cells both in normoxic and in hypoxic conditions. [score:1]
Figure 3B shows that miR-199a-5p transfection in myeloma cells significantly decreased VEGF-a protein secretion Figure 3 (a) Quantitative RT-PCR of VEGF-A, IL-8 and b-FGF in both normoxic and hypoxic OPM2 cells transfected with synthetic miR-199a-5p (miR-199a-5p) or scrambled oligonucleotides (NC). [score:1]
Briefly, OPM2 cells (1×10 [5]/well) transfected with either scrambled (miR-NC) or synthetic pre-miR-199a-5p (miR-199a-5p) were washed and resuspended in RPMI 1640 medium supplemented with 1% FBS. [score:1]
To this end, we used MM cell lines with different basal levels of miR-199a-5p in standard conditions. [score:1]
We observed that the methylation status of the promoter regions remained basically unchanged, (Supplemental Fig. 5B) despite that the azacytidine treatment increased miR-199a-5p levels in OPM2 and U266 MM cells (data not shown). [score:1]
Taken together these findings demonstrate that miR199a-5p is able to reverse the invasive phenotype induced by hypoxic BM microenvironment. [score:1]
miR-199a-5p or miR-NC were administered with NLE particles, a formulation specifically designed for the delivery of oligonucleotides in vivo. [score:1]
Huvec (7×10 [3] cells/well) were resuspended in serum free RPMI 1640 medium supplemented with 0.1% BSA in transwell chemotaxis (BD Biosciences) above 8 um pore filters and exposed to conditioned medium from multiple myeloma cells transfected with either scrambled (miR-NC) or synthetic pre-miR-199a-5p (miR-199a-5p). [score:1]
To investigate possible epigenetic mechanisms involved in the down-modulated expression of miR-199a-5p, we treated MM cells with the DNA demethylating agent 5-aza-dC [47]. [score:1]
miR-199a-5p induces adhesion to hypoxic BMSCs. [score:1]
In vivo anti-tumor activity of miR-199a-5p after intratumoral delivery in MM mouse-mo dels. [score:1]
OPM2 cells (0.5×10 [6] cells/well) transfected with either scrambled (miR-NC) or synthetic pre-miR-199a-5p (miR-199a-5p) were added to each well and incubated for 4 hours at 37°C-5%CO [2]. [score:1]
miR-199a-5p decreases cell proliferation and increases apoptosis in hypoxic conditions. [score:1]
Furthermore, flow cytometry demonstrated that miR-199a-5p induced apoptosis only in hypoxic MM cells (Fig. 6C). [score:1]
MM cells were electroporated as above described using 10µg of the firefly luciferase reporter; for each plate, 100 nM of the synthetic miR-199a-5p or miR-NC were used. [score:1]
Moreover, we investigated the effect induced on the mammalian class-III protein deacetylase of the sirtuin family (Sirt1), a putative target of miR-199a-5p which plays an important role in stabilizing HIF-1α. [score:1]
Interestingly, after miR-199a-5p transfection in MM cells, we found a reduction of total and phosphorylated AKT1 protein levels (Fig. 7D). [score:1]
Figure 2 (a) Western blotting analysis of HIF-1α 24 hours after transfection with synthetic miR-199a-5p (miR-199a-5p) or scrambled oligonucleotides (NC) in U266 and OPM2 cell lines treated for 4 hours with 100µM/L of the hypoxia -mimicking Cobalte Chloride. [score:1]
Figure 3B shows that miR-199a-5p transfection in myeloma cells significantly decreased VEGF-a protein secretion Figure 3 (a) Quantitative RT-PCR of VEGF-A, IL-8 and b-FGF in both normoxic and hypoxic OPM2 cells transfected with synthetic miR-199a-5p (miR-199a-5p) or scrambled oligonucleotides (NC). [score:1]
In fact, miR-199a-5p transfected MM cells reduced the migration of endothelial cells. [score:1]
Consistent with these results, conditioned medium by miR-199a-5p -transfected hypoxic cells impaired IL-6 secretion by BMSCs. [score:1]
Western blot analysis revealed that miR-199a-5p -induced apoptosis was associated to activation of pro-apoptotic proteins caspase 3/7 and cleaved poly ADP-ribose polymerase (PARP), as well as reduction of the anti-apoptotic BCL-2 protein (Fig. 6D). [score:1]
Cell-cycle analysis showed that miR-199a-5p induced only a slight increase in G1 and a decrease in S-G2 phases under hypoxic conditions (Data not shown). [score:1]
Moreover, we studied the anti-tumor potential of in vivo delivered of miR-199a-5p against human MM xenografts in mice. [score:1]
Palpable subcutaneous tumor xenografts were treated every 3 days (indicated by arrows) for a total of six injections, with 20 µg of formulated miR-199a-5p or miR-NC. [score:1]
Figure 5 (a) of hypoxic OPM2 cells transfected with synthetic miR-199a-5p (miR-199a-5p) or scrambled oligonucleotides (NC) and seeded on to hypoxic BMSCs monolayer (right panel); OPM2 cells treated as in (a) and observed at contrast phase microscopy (left panel) *P<0,05. [score:1]
Figure 4 (a) Western blotting analysis of DDR1 and MMP2 24 hours after transfection with synthetic miR-199a-5p (miR-199a-5p) or scrambled oligonucleotides (NC) in OPM2 cells treated for 4 hours with 100µM/L of the hypoxia -mimicking Cobalte Chloride. [score:1]
Briefly, OPM2 cells (1×10 [6] cells/well) transfected with either scrambled (miR-NC) or synthetic pre-miR-199a-5p (miR-199a-5p) were added to each well in RPMI supplemented with 1% FBS and cultured in both normoxic and hypoxic conditions. [score:1]
[1 to 20 of 120 sentences]
6
[+] score: 303
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-497, hsa-mir-506
Our experimental results confirmed our speculation that downregulation of miR-199a-3p and upregulation of YAP1 existed in HCC cells, and miR-199a-3p inhibited cell proliferation and induced apoptosis partly by targeting YAP1. [score:11]
miR-199a-3p targets YAP1, downregulates Jagged1 and suppresses the Notch signaling to inhibit HCC cell proliferation and promote apoptosis. [score:10]
Based on these findings, we speculated that miR-199a-3p might suppress HCC growth by targeting YAP1, downregulating Jagged1 and suppressing the Notch pathway. [score:10]
Therefore, we speculated that miR-199a-3p might regulate HCC cell proliferation and apoptosis in part by targeting YAP1, downregulating Jagged1 and suppressing the Notch pathway. [score:9]
analysis presented that efficient upregulation of miR-199a-3p and inhibition of YAP1 reduced expression of Jagged1 protein (Fig.   4a and b). [score:8]
These data indicated that upregulation of miR-199a-3p and inhibition of YAP1 suppressed cell proliferation and promoted apoptosis, whereas, Jagged1 could relieve these effects on HCC cells. [score:8]
analysis showed that miR-199a-3p overexpression and YAP1 knockdown in Huh7 cells reduced expression of Notch intracellular domain (NICD) and the Notch target gene Hes-1, indicating diminished the Notch pathway activity (Fig.   5a and b). [score:8]
We determined the expression of miR-199a-3p and YAP1 by quantitative Real-Time PCR (qRT-PCR) and western blot assays, respectively, and found downregulation of miR-199a-3p and upregulation of YAP1 in HCC cell lines. [score:8]
Furthermore, to confirm that miR-199a-3p can regulate YAP1 expression, qRT-PCR and western blot assays were performed to determine the expression of YAP1 mRNA and protein in response to the alteration of miR-199a-3p expression in Huh7 cells. [score:7]
miR-199a-3p was downregulated and YAP1 was upregulated in HCC cell lines. [score:7]
Hou et al. [16] reported that miR-199a/b-3p target PAK4 to inhibit the growth of HCC through suppressing PAK4/Raf/MEK/ERK pathway. [score:7]
By bioinformatics -based target prediction analysis with DIANA, TargetScan and PicTar tools, we found that CD44, PAK4 and YAP1 were potential targets of miR-199a-3p. [score:7]
Our experiments also confirmed our speculation that miR-199a-3p inhibits HCC cell proliferation and induces apoptosis in part by targeting YAP1 and suppressing Jagged1-Notch signaling. [score:7]
We used DIANA, TargetScan and and PicTar to perform target prediction analysis, and found that Yes associated protein 1 (YAP1) is a potential target of miR-199a-3p. [score:7]
In this study, we investigated whether miR-199a-3p targets YAP1 to downregulate Jagged1 and inhibit the Notch pathway, thereby regulating HCC cell proliferation and apoptosis. [score:7]
Taken together, our data strongly suggest that YAP1 is a target of miR-199a-3p, and miR-199a-3p regulates proliferation and apoptosis of HCC cells, at least partially, by directly targeting YAP1. [score:7]
We searched potential targets of miR-199a-3p with DIANA, TargetScan and PicTar tools, and found that YAP1 is one of the potential targets. [score:7]
Jagged1 relieved the effects of upregulation of miR-199a-3p and inhibition of YAP1 on HCC cells. [score:6]
Based on these findings, we speculated that miR-199a-3p might regulate HCC cell proliferation and apoptosis in part by targeting YAP1 and suppressing Jagged1-Notch signaling. [score:6]
Overexpression of miR-199a-3p and knockdown of YAP1 inhibited proliferation and promoted apoptosis in HCC cells. [score:6]
c and d qRT-PCR and western blot analyses shows that miR-199a-3p overexpression signigficantly downregulates mRNA and protein levels of YAP1. [score:6]
The results showed that overexpression of miR-199a-3p reduced the luciferase activity of the luciferase reporter containing wild type 3’UTR of YAP1 but not mutant reporter (3’UTR-MUT) vector (the sequences of YAP1 3’UTR-WT/MUT shown in Fig.   3a), which indicated that YAP1 is indeed a direct target of miR-199a-3p (Fig.   3b). [score:6]
Thus, upregulation of miR-199a-3p and YAP1 deletion had the same effects on proliferation and apoptosis of HCC cells, which inhibited HCC cell proliferation and promoted apoptosis. [score:6]
Fig. 2Overexpression of miR-199a-3p and knockdown of YAP1 inhibit proliferation and induce apoptosis in HCC cells. [score:6]
Taken together, our results, for the first time, illustrated the miR-199a-3p-YAP1-Jagged1-Notch signaling in HCC, in which miR-199a-3p targets YAP1 and regulates the Jagged1-Notch signaling to inhibit the tumorigenesis of HCC. [score:6]
a and b High expression of miR-199a-3p and YAP1 silencing significantly inhibit protein level of Jagged1. [score:5]
a Bioinformatics -based target prediction analysis represents that YAP1 is a potential target of miR-199a-3p and the putative binding sequence is in the 3’-UTR of YAP1 mRNA. [score:5]
In summary, our results, for the first time, illustrated the miR-199a-3p-YAP1-Jagged1-Notch signaling in HCC, in which miR-199a-3p targets YAP1 and represses the Jagged1-Notch signaling to inhibit the tumorigenesis of HCC. [score:5]
miR-199a-3p was significantly downregulated in the majority of human hepatocellular carcinoma (HCC) tissues and HCC cell lines. [score:4]
a and d The effects of overexpression of miR-199a-3p and knockdown of YAP1 on Huh7 cell proliferation are detected by. [score:4]
Therefore, we speculated that miR-199a-3p might target YAP1 to regulate HCC cell proliferation and apoptosis. [score:4]
assay showed an obvious reduction of YAP1 expression after overexpression of miR-199a-3p (Fig.   3d). [score:4]
e– g MTT, flow cytometry ands show that the upregulation of YAP1 partially reverses miR-199a-3p’s effect on the proliferation and apoptosis of Huh7 cells. [score:4]
Furthermore, we verified that miR-199a-3p can directly target YAP1. [score:4]
miR-199a-3p was of interest to us because it was downregulated in several HCC studies [18, 28]. [score:4]
In view the inhibitory effects of miR-199a-3p and YAP1 knockdown on Jagged1 expression in Huh7 cells, we further investigated whether miR-199a-3p and YAP1 silencing had the same effects on the function of Jagged1. [score:4]
Proliferation (MTT) and apoptosis (flow cytometry and Caspase 3/7 activation) assays showed that the upregulation of YAP1 partially reversed miR-199a-3p's effect on the proliferation and apoptosis of Huh7 cells (Fig.   3e–g). [score:3]
YAP1 was identified as a functional target of miR-199a-3p. [score:3]
Henry et al. [19] reported that miR-199a-3p represses proliferation of CD44 positive HCC cell lines by targeting CD44. [score:3]
Proliferation assay showed that high expression of miR-199a-3p and knockdown of YAP1 significantly reduced proliferation in Huh7 cells at 48 h, while the proliferation rate in pcDNA-Jagged1 co -transfected cells was obviously increased (Fig.   4d and h). [score:3]
Recently, miR-199a-3p, a cancer -associated miRNA, is wi dely reported to be deregulated in many malignant tumors and its role in tumor development is controversial. [score:3]
Fig. 1The expression levels of miR-199a-3p and YAP1 in HCC cell lines. [score:3]
In HCC, miR-199a-3p has been reported to be downregulated compared to corresponding nontumor liver tissues [16– 19]. [score:3]
The examination of apoptosis showed that apoptosis was induced in Huh7 cells with miR-199a-3p overexpression or YAP1 deletion, inversely, less apoptosis was observed after cells were co -transfected with pcDNA-Jagged1 vector (Fig.   4e, f, i and j). [score:3]
Fig. 3YAP1 is a functional target of miR-199a-3p in HCC cells. [score:3]
The results showed that the expression of miR-199a-3p in HCC cell lines was very lower than that in HL-7702 cells (Fig.   1a). [score:3]
While overexpression of YAP1 fails to fully restore miR-199a-3p's effect on proliferation and apoptosis, probably due to a sufficiently high endogenous level of YAP1 already existing in Huh7 cells. [score:3]
d– f Overexpression of miR-199a-3p reduces cell proliferation and induces apoptosis, however, Jagged1 relieves these effects in Huh7 cells. [score:3]
Cell proliferation and apoptosis assays showed that miR-199a-3p suppresses HCC cell proliferation and promotes apoptosis, and knockdown of YAP1 has similar role. [score:3]
These findings provide new insights into the mechanism by which miR-199a-3p suppresses HCC cell proliferation and induces apoptosis. [score:3]
b and e The effects of overexpression of miR-199a-3p and knockdown of YAP1 on Huh7 cell apoptosis are assessed by flow cytometry assay. [score:3]
miR-199a-3p expression was determined in five human HCC cell lines (MHCC97H, Hep3B, Huh7, SMMC-7721 and HepG2) and a normal liver cell line (HL-7702) by qRT-PCR. [score:3]
a Comparing differences in the expression levels of miR-199a-3p between HCC cell lines and normal liver cell line HL-7702. [score:3]
Mutant YAP1 3’UTR (3’UTR-MUT) which the mutations occur in the conserved binding sites for miR-199a-3p, was generated by using overlapping extension PCR. [score:2]
from qRT-PCR revealed that miR-199a-3p markedly reduced the expression of YAP1 mRNA compared with the control group (Fig.   3c). [score:2]
miR-199a-3p and YAP1 regulated proliferation and apoptosis of HCC cells through Jagged1-Notch signaling. [score:2]
As measured by, upregulation of miR-199a-3p led to an obvious decrease of cell proliferation rate in HCC cells (Fig.   2a). [score:2]
We further determined the effects of miR-199a-3p and YAP1 on the Notch signaling. [score:1]
a and b Huh7 cells transfected with miR-199a-3p mimics and si-YAP1 show signigficantly lower protein levels of NICD and Hes-1 than control cells. [score:1]
First, we transfected Huh7 cells with following reagents: miR-control, miR-199a-3p mimic, miR-199a-3p mimic + pcDNA-NC (miR + pcDNA-NC), miR + pcDNA-Jagged1, si-control, si-YAP1, si-YAP1 + pcDNA-NC, si-YAP1 + pcDNA-Jagged1. [score:1]
The sequence of 3’UTR-WT of YAP1 included the putative binding sites of miR-199a-3p, while the sequence of 3’UTR-MUT of YAP1 not. [score:1]
c– e Huh7 cells treated by miR-199a-3p mimic and DAPT have an obviously lower cell proliferation rate and a significantly higher apoptosis rate than the cells treated by miR-control and DAPT. [score:1]
The wild-type 3’UTR (3’UTR-WT) of YAP1 containing the miR-199a-3p binding sites was obtained by PCR. [score:1]
Huh7 cells were transfected with miR-199a-3p mimic, small interfering RNA for YAP1 (si-YAP1), pcDNA3.1 vectors containing the cDNA of YAP1 (pcDNA-YAP1), pcDNA-Jagged1, si-Jagged1 and their respective controls (Ribobio, Guangzhou, China) by using Lipofactamine 2000 (Invitrogen) according to the manufacturer’s instructions. [score:1]
Hepatocellular carcinoma miR-199a-3p Yes associated protein 1 Jagged1 Notch signaling Hepatocellular carcinoma (HCC) is one of the most common malignant tumor in the word, particularly in East Asia and South Africa [1, 2]. [score:1]
We transfected Huh7 cells with miR-199a-3p mimic and mimic control, respectively. [score:1]
Then the psiCHECK-2 vectors with 3’UTR-WT or 3’UTR-MUT regions of YAP1 were transfected into Huh7 cells containing miR-199a-3p mimics or miR-control, respectively. [score:1]
Then luciferase reporter assay was performed on Huh7 cells to identify whether miR-199a-3p directly interacted with the 3’UTR of YAP1 mRNA. [score:1]
Restoration of miR-199a-3p decreased HCC cell invasion and proliferation [30]. [score:1]
The data suggested that Huh7 cells treated by miR-199a-3p mimic and DAPT had an obviously lower cell proliferation rate and a significantly higher apoptosis rate than the control cells treated by miR-control and DAPT, which indicated that miR-199a-3p could increase HCC cell sensitivity to DAPT (Fig.   5c–e). [score:1]
miR-199a-3p was also decreased in alcohol induced steatohepatitis, a known precursor to HCC [29]. [score:1]
[1 to 20 of 71 sentences]
7
[+] score: 263
Other miRNAs from this paper: hsa-mir-199a-2
Accordingly, treatment of breast cancer cells with miR-199a-5p blunted IGF-I signaling and inhibited breast cancer cell proliferation and migration in response to IGF-I. MiRNAs are endogenous 18–24 nucleotide single-stranded RNA molecules that regulate posttranscriptional gene expression by inhibiting protein translation or inducing mRNA degradation [31]. [score:10]
In order to further dissect the mechanisms underlying DDR1 upregulation, we found that IGF-I, via activation of the PI3K/AKT pathway, induced miR-199a-5p downregulation, which, in turn, increased DDR1 protein expression. [score:9]
IGF-I induces DDR1 protein upregulation by inhibiting miR-199a-5p expression. [score:8]
In order to demonstrate that DDR1 downregulation by miR-199a-5p is relevant also in cells expressing myr-AKT or autocrine IGF-II, MCF-7 and MDA-MB-231 cells stably expressing either myr-AKT or autocrine IGF-II were transfected with miR-199a-5p. [score:8]
IGF-I induces DDR1 upregulation and increases DDR1 3′UTR activity by inhibiting miR-199a-5p expression. [score:8]
However, our observation that IGF-I upregulates DDR1 through miR-199a-5p downregulation via the PI3K/AKT pathway is novel and not previously reported. [score:7]
AKT activity is directly involved in DDR1 upregulation and inhibition of miR-199a-5p. [score:7]
Indeed, transfection of breast cancer cells with miR-199a-5p markedly downregulated DDR1 protein while miR-199a-5p antagomir upregulated it. [score:7]
Collectively, these data confirm that active AKT plays a key role in regulating the inhibition of miR-199a-5p and consequent DDR1 upregulation. [score:7]
Cells transfected with myr-AKT showed a significant upregulation of DDR1 protein (Figure 5A–5B) and DDR1 mRNA (Figure 5C–5D), which were associated with a marked decrease in miR-199a-5p expression levels (Figure 5E–5F). [score:6]
miR199a-5p inhibits DDR1 up-regulation induced by myr-AKT or autocrine IGF-II. [score:6]
Moreover, stable transfection of breast cancer cells with the IGF-II gene resulted in constitutively activated AKT, reduced miR-199a-5p levels, and markedly upregulated DDR1 expression. [score:6]
AKT activation through paracrine/autocrine IGFs induces miR-199a-5p inhibition, which in turn causes DDR1 upregulation. [score:6]
Taken together, these data indicate that miR-199a-5p suppression via autocrine/paracrine IGFs and AKT activation causes upregulation of DDR1, which enhances IGFs signaling and biological responses, thereby delineating a new mechanism by which IGFs enhance their own biological responses (Figure 10). [score:6]
For instance, transfection of miR-199a-5p in hepatoma cells significantly down-regulated DDR1 protein but did not induce changes in DDR1 mRNA expression [29]. [score:6]
In order to identify the mechanism by which IGF-I regulates miR-199a-5p expression, MCF-7 cells cultured in the presence of 50 nM IGF-1 were incubated for 24 h with various kinase inhibitors, and miR-199a-5p expression levels measured. [score:6]
Figure 10AKT activation through paracrine/autocrine IGFs induces miR-199a-5p inhibition, which in turn causes DDR1 upregulation. [score:6]
Data of expression correlation between miR-199a-5p and genes from the IGF system were retrieved from starBase Pan-Cancer Platform by analysis of expression profiles of 14 cancer types from TCGA Data Portal [PMID: 24297251]. [score:5]
As expected, transfection with anti-miR-199a-5p almost completely inhibited miR-199a-5p expression (Figure 4F). [score:5]
MCF-7 cells were transfected with 100nM of anti-miR or negative control (scramble) for 48 h. qRT-PCR analysis showed strong inhibition of miR-199a-5p expression. [score:5]
As shown in Figure 8, transfection with miR-199a-5p determined a strong inhibition of DDR1 expression levels in those cells. [score:5]
MiR-199a-5p expression was increased in the presence of inhibitors of both the PI3K and AKT. [score:4]
Data obtained in cardiac myocytes suggest that hypoxia-depend miR-199a-5p downregulation does not require transcriptional activity [35]. [score:4]
Previous work has reported that in leukemia [28] and in hepatoma cells [29] decreased miR-199a-5p was associated with DDR1 upregulation. [score:4]
IGF-I decreases miR-199a-5p and upregulates DDR1 through the PI3K/AKT pathway. [score:4]
Collectively, these data strongly support our in vitro data and provide strong evidence that IGF-IR activity may induce DDR1 upregulation through decrease of miR-199a-5p in vivo human breast cancer. [score:4]
Indeed, transfection of MCF-7 and MDA-MB-231 cells with pre-miR-199a-5p significantly downregulated DDR1, and reduced the activation of both the AKT and ERK1/2 cascades in response to IGF-I (Figure 9A, 9B). [score:4]
However, this effect of miR-199a-5p is significantly reduced by IGF-I stimulation Interestingly, miR-199a-5p downregulation caused by cell exposure to IGF-I was associated with significant changes of DDR1 protein but limited changes of DDR1 mRNA. [score:4]
Indeed, in breast cancer cells, exposure to IGFs induced upregulation of DDR1 protein through a PI3K/AKT/miR-199a-5p signaling cascade. [score:4]
Nevertheless, our data are in accordance with the results of Rane et al. indicating that activated AKT is sufficient to downregulate miR-199a-5p in cardiac myocytes [32]. [score:4]
We hypothesize that the activation of the AKT/miR-199a-5p/DDR1 pathway may represent one of these mechanisms of resistance and that it could be a suitable target in malignancies associated with dysregulated IGF system. [score:4]
Accordingly, transfection with pre-miR-199a-5p completely blocked IGF-I -induced upregulation of DDR1 protein levels (Figure 4F), which were instead increased by transfection with anti-miR-199a-5p (Figure 4G). [score:4]
Previously, DDR1 has been reported to be a target gene of miR-199a-5p, which shows only partial complementarity to the 3′UTR of DDR1 mRNA [29]. [score:3]
Figure 8MCF-7 and MDA-MB-231 cells, stably transfected with either pcDNA3.1HA-myr-AKT, control pcDNA3.1HA (A– B), or with c-Myc tagged IGF-II expression construct or the relative empty vector (C–D), were starved for 24 h and then transfected with 100 nM miR199a-5p or scramble oligonucleotides for 48 h. Cells were then evaluated by western blotting for DDR1 expression with a polyclonal antibody against the C-terminus of DDR1. [score:3]
Schematic representation of the positive feedback involving IGF-IR expression and function through the AKT/miR-199a-5p/DDR1 pathway. [score:3]
Indeed, StarBase Pan-Cancer analysis showed a significant inverse correlation between miR-199a-5p and DDR1 expression in 8/14 cancer histotypes. [score:3]
In cell transfected as above, miR-199a-5p expression levels significantly decreased. [score:3]
MCF7 cells cultured in complete medium were transfected with 100 nM of pre-miR-199a-5p or scrambled oligonucleotides, as negative control, for 48 h. (A) DDR1 protein expression was determined by western immunoblotting using a polyclonal antibody against the C-terminus of DDR1. [score:3]
Laboratories (Paisley, UK), scramble (miR-NC), synthetic pre-miR-199a-5p (miR-199a-5p), and mirVana miR-199a-5p inhibitor were purchased from Ambion (Applied Biosystems, CA, USA), fibronectin from Sigma-Aldrich (Saint Louis Missouri, USA). [score:3]
Indeed, IGF-I exposure for 24 h caused a significant reduction of miR-199a-5p expression levels, as assessed by qRT-PCR analysis (Figure 4C). [score:3]
Moreover, miR-199a-5p inversely correlated with DDR1 expression in several tumors including cancers from breast, lung, ovary, thyroid, endometrium and acute myeloid leukemia. [score:3]
Importantly, both in MCF-7 and MDA-MB-231 cells autocrine IGF-II production determined a significant increase in DDR1 protein (Figure 7A–7B) and mRNA levels (Figure 7C–7D), which were associated with decreased miR-199a-5p expression levels (Figure 7E–7F). [score:3]
MiR-199a-5p downregulation itself may also play a role in EMT by causing E-cadherin loss [40]. [score:3]
In breast cancer cells miR-199a-5p inhibits IGF-I signaling, and cell proliferation and migration. [score:3]
MCF-7 and MDA-MB-231 cells, stably transfected with either pcDNA3.1HA-myr-AKT, control pcDNA3.1HA (A– B), or with c-Myc tagged IGF-II expression construct or the relative empty vector (C–D), were starved for 24 h and then transfected with 100 nM miR199a-5p or scramble oligonucleotides for 48 h. Cells were then evaluated by western blotting for DDR1 expression with a polyclonal antibody against the C-terminus of DDR1. [score:3]
Both in MCF-7 (Figure 9C, 9E) and in MDA-MB-231 cells (Figure 9D, 9F) pre-miR-199a-5p also significantly inhibited proliferation and cell migration through fibronectin-coated filters in response to IGF-I. Figure 9(A–B) IGF-I signaling in cells transfected with pre-miR199a-5p. [score:3]
Figure 4(A–B) MiR-199a-5p downregulates DDR1. [score:3]
MiR-199a-5p expression was normalized against RNU6B expression (Assay ID 001093, Applied Biosystems). [score:3]
Anticorrelations of expression between miR-199a-5p and DDR1 and IGF-IR across 14 cancer types from TCGA. [score:3]
Both in MCF-7 (Figure 9C, 9E) and in MDA-MB-231 cells (Figure 9D, 9F) pre-miR-199a-5p also significantly inhibited proliferation and cell migration through fibronectin-coated filters in response to IGF-I. Figure 9(A–B) IGF-I signaling in cells transfected with pre-miR199a-5p. [score:3]
Taken together, these data strongly suggest that paracrine/autocrine IGFs production in cancer may result in increased DDR1 expression through the activation of a PI3K/AKT/miR-199a-5p pathway. [score:3]
In order to assess whether miR-199a-5p targeted DDR1 at its 3′UTR, and whether this action was affected by IGF-I, we co -transfected MCF-7 cells with pre-miR-199a-5p and a wild type DDR1 3′UTR–luciferase construct. [score:3]
Therefore, it is likely that miR-199a-5p regulation by the IGF-IR/AKT pathway is also posttranscriptional and involves miRNAs' processing and/or stability. [score:2]
Thus, AKT activation seems a nodal upstream regulator of the miR-199a-5p - DDR1 pathway common to both IGF-I and hypoxia. [score:2]
MiR-199a-5p inhibits proliferation and migration of breast cancer cells. [score:2]
Therefore, our present data may suggest that the activation of the IGF-IR/AKT/miR-199a-5p/DDR1 pathway may play a relevant role in cancer EMT, cell stemness, invasion and metastasis. [score:1]
Hypoxia has been also been reported to reduce miR-199a-5p, possibly by inducing AKT activation through the integrin-linked kinase, ILK [33, 34]. [score:1]
For microRNA experiments, cells were transfected with a mixture containing OptiMEM, RNAimax and either 100 nM miR-199a-5p or scramble oligonucleotides. [score:1]
These data confirm the biological relevance of this IGF-IR/AKT/miR-199a-5p/DDR1 axis. [score:1]
Here we confirm that, in breast cancer cells, miR-199a-5p reduces the activity of a luciferase construct containing the 3′-UTR of the DDR1 mRNA. [score:1]
In addition, miR-199a-5p also inversely correlated with IGF-IR in 2/14 cancer types (Table 2). [score:1]
MCF-7 cells were co -transfected with a firefly luciferase construct containing the 3′UTR of DDR1 and with pre-miR-199a-5p or control scrambled oligonucleotides (scr). [score:1]
In view of our previous results indicating that DDR1 and IGF-IR form a complex that enhances IGF-I effects in cancer cells [18], our present findings suggest that the IGF-IR/AKT/miR-199a-5p/DDR1 pathway is an important feed-forward mechanism for enhancing IGF-IR effects (Figure 10). [score:1]
In cells transfected as above, miR-199a-5p expression levels were also measured by qRT-PCR analysis and normalized against RNU6B as housekeeping control gene. [score:1]
IGF-I increased the DDR1 3′UTR luciferase activity while miR-199a-5p blocked both basal and IGF-I stimulated luciferase activity (Figure 4E). [score:1]
MCF-7 and MDA-MB-231 cells were transfected with 100 nM of pre-miR-199a-5p, or negative control for 24 h, starved for 24 h and then stimulated with 50 nM of IGF-I for 5 min. [score:1]
Our present results are in agreement with previous work demonstrating an inverse relationship between DDR1 and miR-199a-5p. [score:1]
Twenty-four hours after transfection, cells were incubated with fresh medium and transfected with 100 nM of the synthetic miR-199a-5p or scramble oligonucleotides using Lipofectamine 2000. [score:1]
We first established that transfection of MCF-7 cells with pre-miR-199a-5p causes a significant reduction of DDR1 protein (Figure 4A) and mRNA (Figure 4B). [score:1]
[1 to 20 of 69 sentences]
8
[+] score: 231
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-199b
Phenotype experiments showed that overexpression of miR-199a-3p significantly impaired the migratory, invasive, and tumorigenic capabilities of ovarian cancer cells as well as enhanced cisplatin resistance through inhibiting DDR1 expression. [score:7]
Apoptosis assays indicated that miR-199a-3p inhibitor antagonized the cisplatin induced cell apoptosis while elimination of DDR1 by shRNA abrogated the suppressive effect of miR-199a-3p inhibitor on apoptosis (Fig. 5d-f). [score:6]
Taken together, miR-199a-3p decreases the expression of DDR1 by directly targeting the 3’UTR of DDR1 mRNA in ovarian cancer cells. [score:6]
In line with this, we found that the expression of miR-199a-3p significantly increased while DDR1 were intensively downregulated after 5-Aza-dC addition, suggesting a hypermethylation mediated loss of miR-199a-3p in ovarian cancer (Fig. 3e and f). [score:6]
The same pre-miR-199a is encoded by two loci in the human genome, miR-199a-1 in chromosome 19 and miR-199a-2 in chromosome 1. miR-199a-3p functions as a tumor suppressor and inhibits tumor metastasis by repressing various oncogenes, such as mTOR,aurora kinase A, and c-MET [12– 14]. [score:5]
Therefore, our study indicates that aberrant methylation status in ovarian cancer breaks the inhibitory effect of miR-199a-3p on DDR1 expression and consequently promotes the malignant phenotypes of ovarian cancer. [score:5]
However, unlike the hypermethylation -dependent silence of miR-199a described in the present study, a recent work by Matà et al. demonstrated that IGF-I suppressed miR-199a-5p via activating PI3K/AKT signaling and consequently increased DDR1 expression in breast cancer [21]. [score:5]
a-c The viability of S KOV3 cells with knockdown of DDR1 (a), HO-8910 cells with knockdown of DDR1 (b), and S KOV3 cells with stable knockdown of DDR1 or miR-199a-3p inhibitor treatment (c) for 48 h were determined by the CCK-8 assay under different concentrations of cisplatin. [score:5]
Previous analysis have indicated that miR-199a-3p expression is inhibited in various cancer types [15, 16]. [score:5]
Similarly, cell invasion assays indicated that miR-199a-3p inhibitor resulted in an increased invasion rate of S KOV3 cells compared with the control; while the invasion induced by miR-199a-3p inhibitor was impeded following inhibition of DDR1 (Fig. 4c and d). [score:5]
Interestingly, previous findings suggested that miRNA-199a-5p directly regulated the expression of DDR1 in hepatocellular carcinoma [20]. [score:5]
Below, we discovered DDR1 as a target of miR-199a-3p, a tumor-suppressor miRNA, which was silenced by hypermethylation in ovarian cancer. [score:5]
Furthermore, in vitro experimental results confirmed that miR-199a-3p decreased the expression of DDR1 via targeting the 3’UTR of DDR1 mRNA. [score:5]
miR-199a-3p reduces DDR1 expression via targeting the 3’UTR of DDR1 mRNA in ovarian cancer cells. [score:5]
Furthermore, deprivation of DNMT3A restored the expression of miR-199a-3p and resulted in a reduced DDR1 expression in ovarian cancer cells (Fig. 3i and j). [score:5]
Further analysis suggest that downregulation of miR-199a-3p in ovarian cancer is resulted from the promoter hypermethylation of miR-199a gene. [score:4]
d Cleaved PARP and caspase 3 in the S KOV3 cells with stable knockdown of DDR1 or miR-199a-3p inhibitor treatment were detected 48 h after 10 μM cisplatin addition. [score:4]
Interestingly, knockdown of DNA methyltransferase 3A (DNMT3A) notably increased miR-199a-3p level and then attenuated the expression of DDR1 in ovarian cancer cells, which suggested that DNMT3A was responsible for the miR-199a promoter hypermethylation. [score:4]
Because of promoter hypermethylation, the reduction of miR-199a-3p may induce the upregulation of DNMT3A, which in turn enhances the hypermethylation. [score:4]
However, stable knockdown of DDR1 weakened the promotive effect of miR-199a-3p inhibitor on wound healing (Fig. 4a and b). [score:4]
Contrast with DDR1, miR-199a-3p was dramatically downregulated in ovarian cancer tissues (Fig. 1d). [score:4]
Consistently, miR-199a-3p inhibitor was found to promote the tumorigenicity of ovarian cancer cells, however, which was disrupted by DDR1 knockdown (Fig. 4e and f). [score:4]
Promoter hypermethylation leads to downregulation of miR-199a-3p in ovarian cancer. [score:4]
As expected, the hypermethylation was closely related with decreased miR-199a-3p and upregulation of DDR1 in the ovarian cancer specimens (Fig. 3b). [score:4]
These data indicate that miR-199a-3p may influence the migratory, invasive, and tumorigenic capabilities of ovarian cancer cells via regulating DDR1 expression. [score:4]
Next, we examined whether knockdown of DDR1was able to override the cisplatin resistance induced by miR-199a-3p inhibitor in ovarian cancer cells. [score:4]
Ectopic low levels of miR-199a-3p accompanied with increased DDR1 expressions are detected in ovarian cancer cells or tissues. [score:3]
In the present work, we found that RNAi mediated depletion of DNMT3A restored miR-199a-3p expression through the reversal of DNA hypermethylation. [score:3]
Furthermore, a miR-199a-3p binding site located at the 3’UTR of DDR1 mRNA was predicted using the software “TargetScanHuman 7.1” (Fig. 2c). [score:3]
Hypermethylation mediated silence of miR-199a-3p is confirmed to promote DDR1 expression, which is associated with a poor prognosis in patients with ovarian cancer. [score:3]
In the present study, loss of miR-199a-3p was found to cause the ectopic high expression of DDR1 in ovarian cancer. [score:3]
Bioinformation analysis revealed a conserved site at the 3’UTR of DDR1 mRNA, which was targeted by miR-199a-3p. [score:3]
Interestingly, DNMT3A was identified as another target of miR-199a-3p [27]. [score:3]
In this study, we found that DDR1 not only functioned as a target of miR-199a-3p but also mediated the malignant phenotypes induced by miR-199a-3p loss. [score:3]
Fig. 2The mRNA of DDR1 is a target of miR-199a-3p in ovarian cancer cells. [score:3]
More importantly, the luciferase reporter vector of DDR1 3’UTR containing a wild miR-199a-3pbinding site or a corresponding mutant site was constructed to experimentally validate the target prediction (Fig. 2c). [score:3]
In conclusion, these results suggest that the loss of miR-199-3p expression in ovarian cancer is due to promoter hypermethylation which is enhanced by DNMT3A. [score:3]
The low expression of miR-199a-3p has been previously detected in ovarian carcinoma and is significantly correlated with a poor prognosis [17]. [score:3]
a and b The expression levels of miR-199a-3p (a) and DDR1 (b) in two ovarian cancer cell lines, S KOV3 and HO-8910, and a normal ovarian cell line, IOSE386. [score:3]
In addition, miR-199a-3p inhibitor displayed a promotive effect on the mRNA and protein level of DDR1 in IOSE386 cells (Fig. f and g). [score:3]
a Photographs of the scratch wound assay after stable knockdown of DDR1 or treatment with an anti-miRNA inhibitor specific for miR-199a-3p or negative control in S KOV3 cells. [score:3]
In this work, a negative correlation between DDR1 and a tumor suppressor miRNA, miR-199a-3p, was observed in ovarian cancer tissues. [score:3]
The viability assay revealed that miR-199a-3p inhibitor enhanced the cisplatin resistance of S KOV3 cells without silence of DDR1 but had no evident effect on the viability of S KOV3 cells with stable knockdown of DDR1 following cisplatin treatment (Fig. 5c). [score:3]
Transfection of miR-199a-3p mimic greatly attenuated the luciferase activity of DDR13’UTR reporter in S KOV3 cells; while miR-199a-3p inhibitor strengthened the luciferase activity in IOSE386 cells (Fig. 2h and i). [score:3]
These data show a poor prognosis of the ovarian cancer patients with high DDR1 expression and a negative correlation between DDR1and miR-199a-3p in ovarian cancer. [score:3]
Consistently, transfection of miR-199a-3p mimic was shown to decrease the expression of DDR1 at both mRNA and protein level in S KOV3 cells (Fig. 2d and e). [score:3]
Overactivation of miR-199a-3p/DDR1 pathway was observed in the clinical specimens of ovarian cancer, as described by highly expressed miR-199a-3p and DDR1 (Fig. 1). [score:3]
Luciferase reporter assay also confirmed that, as a receptor tyrosine kinase, DDR1 was strictly regulated by the tumor suppressor miRNA, miR-199a-3p. [score:3]
In summary, our findings highlight a miR-199a-3p/DDR1 pathway, the dysregulation of which leads to the migration, invasion, and chemoresistance of ovarian cancer. [score:2]
Dysregulation of miR-199a-3p/DDR1 pathway confers the cisplatin resistance in ovarian cancer. [score:2]
These findings demonstrate a critical role of miR-199a-3p/DDR1 pathway in ovarian cancer development. [score:2]
As expected, mutation in the miR-199a-3p binding site evidently weakened the response of luciferase activity to miR-199a-3p mimic (Fig. 2j). [score:2]
Fig. 5Dysregulation of miR-199a-3p/DDR1 pathway confers the cisplatinresistance in ovarian cancer. [score:2]
Compared with IOSE386, higher expression of DDR1 accompanied with lower miR-199a-3p level was detected in S KOV3 and HO-8910 cells (Fig. 2a and b). [score:2]
Therefore, diverse mechanisms may be employed for regulating miR-199a/DDR1 pathway on the different cellular context. [score:2]
In this study, miR-199a-3p is revealed as an upstream regulator of DDR1 which confers the malignance and cisplatin resistance of ovarian cancer. [score:2]
The results of wound healing assays showed that S KOV3 cells transfected with miR-199a-3p inhibitor presented a faster closing of scratch wound, compared with the control cells. [score:1]
d and e The DDR1 mRNA (d)and protein (e) levels after the transfection with miR-199a-3p mimics or negative control in S KOV3 cells. [score:1]
Mature human miR-199a contains two derivatives: miR-199a-5p and miR-199a-3p. [score:1]
Considering that miR-199a is encoded by two loci in the human genome, miR-199a-1 in Chr 19 and miR-199a-2 in Chr 1, the promoters of miR-199a at both loci were analyzed using the software ‘CpGplot’. [score:1]
A negative correlation between DDR1 and miR-199a-3p in clinical ovarian cancer tissues. [score:1]
To explore the mechanisms for miR-199a-3p silence in ovarian cancer, the methylation status of the miR-199a promoter was analyzed in ovarian epithelial or cancer cells by methylation-specific PCR and bisulphite sequencing. [score:1]
So we want to elucidate whether silencing miR-199a-3p promotes the malignant phenotypes of ovarian cancer via induction of DDR1. [score:1]
However, based on our results which were limited to in vitro phenotypes, the effects of miR-199a-3p and DDR1 on ovarian cancer metastasis in vivo still remain unverified. [score:1]
Furthermore, our study provides a detailed insight into the mechanism for the miR-199a-3p loss in ovarian cancer. [score:1]
d The hypermethylation levels of miR-199a gene promoters in IOSE386, S KOV3, and 5-Aza-dC treated S KOV3 cells were determined by bisulphite DNA sequencing showing eight independent clones from each group. [score:1]
Importantly, an inverse correlation between DDR1 and miR-199a-3p was found (Fig. 1e). [score:1]
Fig. 1A negative correlation between DDR1 and miR-199a-3p was observed in clinical ovarian cancer tissues. [score:1]
e Relative level of miR-199a-3p in S KOV3 and HO-8910 cells after 5-Aza-dC treatment. [score:1]
DDR1 functions as a downstream effector of miR-199a-3p on the migration, invasion, and tumorigenicityof ovarian cancer cells. [score:1]
Due to that the loci of miR-199a were identified at different chromosomes, the two promoters of miR-199a were firstly analyzed by bioinformation software to detect the potential CpG islands. [score:1]
Thus, a positive feedback loop may display a critical role in maintaining hypermethylation status and silence of miR-199a-3p in ovarian cancer. [score:1]
A CpG-rich region was identified upstream the transcription start site of miR-199a-1 gene located at Chr 19. [score:1]
However, no classical CpG islands were found in the proximal promoter of miR-199a-2 which is located at Chr 1. Therefore, we focused on the methylation status of miR-199a-1 promoter in this study. [score:1]
Taken together, miR-199a-3p/DDR1pathway is crucial for the resistance to cisplatin in ovarian cancer. [score:1]
Considering that DNMT3A is primarily responsible for the 5mC maintenance, we examined the role of DNMT3A in the methylation of miR-199a promoter in ovarian cancer cells. [score:1]
A region (−404/−272) with high CG composition was detected upstream the transcription start site of miR-199a-1 (Fig. 3d). [score:1]
Therefore, more investigations are needed to explore the potential of miR-199a-3p and DDR1 as novel therapeutic targets for ovarian cancer. [score:1]
Ovarian cancer miR-199a-3p Discoidin domain receptor 1 (DDR1) Cisplatin As one of the most common gynecological malignant tumors, ovarian cancer has become a serious problem for female healthy because of its high morbidity and mortality. [score:1]
As expected, the miR-199a promoter was hypermethylated in ovarian cancer cells but not in normal ovarianepithelial cells. [score:1]
Fig. 4DDR1 functions as a downstream effector of miR-199a-3p on the migration, invasion, and tumorigenicityof ovarian cancer cells. [score:1]
[1 to 20 of 81 sentences]
9
[+] score: 214
In vitro experiment, miR-199a-5p mimics inhibited the protein expressions of WNT2 and WNT4, decreased the c-myc expression and dramatically increased the Sm-MHC expression in HASMCs. [score:9]
In this study, we confirmed miR-199a-5p could inhibit WNT2/4 expression accompanied by decreased c-myc expression and increased Sm-MHC expression in human airway smooth muscle cells. [score:9]
The other possible candidate is SIRT1, which is a validated miRWalk 2.0 target of miR-199a-5p that was also downregulated in endothelial cells treated with a miR-199a-5p mimics [42]. [score:6]
This study identified upregulation of miR-199a-5p expression in plasma and induced sputum of patients with the neutrophilic phenotype of asthma. [score:6]
Expression of miR-199a-5p in the plasma of asthmatic patients positively correlated with sputum miR-199a-5p expression (r = 0.511, p = 0.021). [score:5]
Expression of circulation miR-199a-5p was increased in asthma patients with a neutrophil phenotype, which suggests that miR-199a-5p actively contributes to disease pathogenesis by modulating the proinflammatory process and pulmonary function. [score:5]
miR-199a-5p expression in the plasma of asthmatic patients positively correlated with expression in sputum (Fig 2B Spearman ' s rank correlation coefficient, r = 0.511, p = 0.021). [score:5]
miR-199a-5p inhibited WNT expression in HASMCs. [score:5]
We used the TargetScan, miRanda and PicTar databases to predict the target genes of miR-199a-5p and selected the common genes. [score:5]
In silico analysis predicted the validated and high score miR-199a-5p target genes and implicated the WNT, mTOR and hippo signaling pathways as the major miR-199a-5p-regulated pathways. [score:4]
Bioinformatics predictions of the validated and high scores of miR-199a-5p targets genes implicated the WNT, mTOR and hippo signaling pathways as the major miR-199a-5p-regulated pathways. [score:4]
As shown in Fig 7A, after transfection of miR-199a-5p mimics for 48 hours, the protein expressions of both WNT2 and WNT4 were inhibited in HASMCs compared to that of the negative control. [score:4]
The strong associations between circulation miR-199a-5p expression, inflammatory parameters and pulmonary function in patients with neutrophil phenotype asthma indicate that miR-199a-5p may contribute to the development of innate immunity and transfer the signal from inflammatory cells to structural cells in these asthma patients. [score:4]
Therefore, we detected sputum miR-199a-5p and compared plasma expression and airway sputum expression of miR-199a-5p. [score:4]
miR-199a-5p expression levels from different cells following LPS stimulation. [score:3]
Overview of the GO(A) and KEGG(B) pathways that contain at least 1 of the genes targeted by miR-199a-5p. [score:3]
The correlation of miR-199a-5p expression with clinical parameters was analyzed using multiple linear regression analysis. [score:3]
Human peripheral blood neutrophils from healthy controls were treated with LPS with/without IL-4 for 24 h. The results demonstrated increased miR-199a-5p expression in response to LPS (p = 0.005) and LPS combined with IL-4 (p = 0.003), but not IL-4 alone (Fig 4A). [score:3]
Some reports indicated that circulation miRNAs did not necessarily parallel expression of local miRNAs [8], but the present study demonstrated that plasma miR-199a-5p was highly related with sputum miR-199a-5p. [score:3]
miR-199a-5p expression following LPS stimulation in peripheral blood and BEAS-2B cells. [score:3]
In silico analysis predicted the target genes and signaling pathway of miR-199a-5p. [score:3]
Plasma miRNA-199a-5p correlated with the sputum miRNA-199a-5p expression profile. [score:3]
Plasma miR-199a-5p was increased in neutrophilic asthma and negatively correlated with pulmonary function, which suggests that miR-199a-5p actively contributes to disease pathogenesis by modulating the inflammatory process and transferring the signal from inflammatory cells to structure cells. [score:3]
We demonstrated that miR-199a-5p expression is increased in patients with neutrophilic asthma and associated with pulmonary function reduction, which suggests that plasma miR-199a-5p contributes to inflammation and mechanical processes in patients with neutrophilic asthma. [score:3]
miR-199a-5p expression levels were normalized to U6. [score:3]
Multiple linear regression analysis of the factors related with miR-199a-5p expression. [score:3]
0193502.g002 Fig 2 (A) Normalized miR-199a-5p expression levels in sputum from different inflammatory phenotypes and healthy controls. [score:3]
Further research of the interactions between miR-199a-5p and airway smooth muscle cells may provide potential therapeutic targets for lung diseases characterized by neutrophilia and airway obstruction. [score:3]
To our knowledge, this study is the first report to describe a link between circulation miR-199a-5p expression in plasma and patients with neutrophilic asthma. [score:3]
Increased miR-199a-5p expression in smooth muscle cells increases the synthesis of contractile and structural proteins and leads to smooth muscle cell hypertrophy. [score:3]
The miR-199a-5p expression levels were normalized to U6. [score:3]
None of the included patients were treated with inhaled or oral corticosteroids in the past three months to avoid the influence of steroids on the neutrophil counts and miR-199a-5p expression. [score:3]
miR-199a-5p expression levels in PB-derived neutrophils isolated from healthy subjects and asthmatic patients. [score:3]
miR-199a-5p expression increased in response to LPS (p = 0.005) and LPS combined with IL-4 (p = 0.003), but not IL-4 alone. [score:3]
0193502.g003 Fig 3 (A-C) miR-199a-5p expression levels in PB-derived macrophages (A), lymphocytes (B) and neutrophils (C) isolated from three healthy subjects treated or untreated with LPS (100 ng/mL) for 24 hours. [score:3]
0193502.g005 Fig 5 (A-F) Spearman correlation between expression of miR-199a-5p in plasma and eosinophils in peripheral blood (A), serum IgE levels (B), FeNO levels (C), FEV1 (D), FVC (E), and PEF (F). [score:3]
Normalized miR-199a-5p expression levels in the plasma of different inflammatory phenotypes and healthy controls. [score:3]
However, peripheral neutrophils from eosinophilic asthma patients did not respond to LPS with increased miR-199a-5p expression (n = 5, p > 0.05) in contrast to the significant response from neutrophilic patients (n = 4, p < 0.0001). [score:3]
0193502.g004 Fig 4 (A) miR-199a-5p expression levels in PB-derived neutrophils isolated from four healthy subjects treated with LPS (100 ng/mL) and/or IL-4 (10 ng/mL) for 24 hours. [score:3]
Plasma miRNA-199a-5p expression profiles in different phenotypes of asthmatic patients. [score:3]
0193502.g006 Fig 6. Overview of the GO(A) and KEGG(B) pathways that contain at least 1 of the genes targeted by miR-199a-5p. [score:3]
We further clarified the relationships between expression of plasma miR-199a-5p with the blood eosinophil count, serum IgE level, FeNO, FEV [1], FVC and PEF between asthmatic cases using Spearman correlation analysis (Fig 5). [score:3]
For miR-199a-5p overexpression, 50nM of miR-199a-5p mimics or negative miRNA control (Riobio, Guangzhou, China) were transfected into cells using Lipofectamine 3000 (Life Technologies, Carlsbad, CA, USA). [score:3]
0193502.g001 Fig 1 Normalized miR-199a-5p expression levels in the plasma of different inflammatory phenotypes and healthy controls. [score:3]
miR-199a-5p modulates the WNT signaling pathway and increases mRNA expression of Sm-MHC. [score:3]
The increased miR-199a-5p level was strongly related with impaired pulmonary function, which suggests that smooth muscle cell function was likely regulated by miR-199a-5p secreted from neutrophils. [score:2]
Peripheral blood cells were separated and treated with LPS for 24 h. Changes in miR-199a-5p expression in response to LPS for each individual’s peripheral blood cell subsets and BEAS-2B cells were compared to its own untreated control. [score:2]
Further research is needed to unravel the mechanism of miR-199a-5p regulation of the function and remo deling of airway smooth muscle in asthma. [score:2]
Previous reports also demonstrated that the regulation of miR-199a-5p in muscle cells participated in cardiac remo deling and bladder organ remo deling [40, 41]. [score:2]
On the contrary, the expression of Sm-MHC mRNA of HASMCs significantly increased in the miR-199a-5p mimics group compared with the negative control (Fig 7B), indicating miR-199a-5p may modulate the hypertrophy and over contraction of HASMCs. [score:2]
In silico analysis indicated that the identified miR-199a-5p may regulate pathways related to the inflammation response and muscle cell hypertrophy. [score:2]
The results demonstrated that the quantitative expression of miRNA-199a-5p in sputum was significantly higher in patients with neutrophilic asthma compared to healthy controls (Fig 2A). [score:2]
In the meantime, the protein expression of the cell growth protein c-myc decreased in the miR-199a-5p mimics group compared with the negative control. [score:2]
Plasma miR-199a-5p was negatively correlated with FEV [1,] FVC and PEF (r = -0.377, p = 0.026; r = -0.419, p = 0.012; r = -0.392, p = 0.024, respectively). [score:1]
Transfection of miR-199a-5p mimics in human airway smooth muscle cells (HASMCs) was performed in vitro. [score:1]
We detected sputum miRNA-199a-5p using qRT-PCR. [score:1]
Multivariate correlation analysis confirmed that the plasma miR-199a-5p levels negatively correlated with FEV [1] in patients with asthma (Adjusted R [2] = 0.164, p = 0.015). [score:1]
The plasma miR-199a-5p levels were significantly and negatively correlated with serum IgE levels (r = -0.465, p = 0.010), which indicates its relationship to non-atopic asthma. [score:1]
miR-199a-5p mimics transfection in HASMCs. [score:1]
The miR-199a-5p levels were only elevated in neutrophils from healthy controls (p < 0.01). [score:1]
Correlations between the plasma miR-199a-5p levels and clinical indexes. [score:1]
The results demonstrated increased sputum miR-199a-5p in neutrophil asthmatics. [score:1]
We detected miR-199a-5p in plasma and found that it elevated in asthma patients with neutrophil infiltration in induced sputum, which indicates its potential to identify the neutrophil phenotype of asthma. [score:1]
These results indicate that miR-199a-5p may participate in the communication between airway and systemic inflammation. [score:1]
Neutrophils from neutrophilic asthma patients secreted miR-199a-5p following LPS stimulation but not from eosinophilic asthma patients. [score:1]
In silico analysis suggested that the WNT signaling pathway participates in miR-199a-5p mediation of smooth muscle cell hypertrophy. [score:1]
However, peripheral neutrophils from eosinophilic asthma patients did not respond to LPS by secreting miR-199a-5p (n = 5, p > 0.05), which contrasts the significant response in neutrophilic patients (n = 4, p < 0.001, Fig 4B). [score:1]
We demonstrated that miR-199A-5p was only induced in neutrophils, but not macrophages, lymphocytes, or epithelial cells. [score:1]
Relative miR-199a-5p levels in sputum in different groups. [score:1]
Neutrophils secreted miR-199a-5p following LPS stimulation, but not macrophages, lymphocytes or epithelium cells. [score:1]
The WNT signaling pathway was extremely important for miR-199a-5p mediation of hypertrophy and proliferation of smooth muscle cells. [score:1]
Lipopolysaccharide (LPS) stimulation was used to detect miR-199a-5p secretion from peripheral blood-derived neutrophil, lymphocyte, macrophage and BEAS-2B cells. [score:1]
0193502.g007 Fig 7 (A) of WNT2, WNT4, and c-myc in untreated (control) and negative miRNA (Neg-miR) and miR-199a-5p mimics transfection (miR-199a-5p) for 48hours in HASMCs. [score:1]
miR-199a-5p negatively correlated with FEV [1,] FVC and PEF (r = -0.377, p = 0.026; r = -0.419, p = 0.012; and r = -0.392, p = 0.024, respectively). [score:1]
Relative miR-199a-5p levels in the plasma of different groups. [score:1]
Multivariate correlation analysis confirmed that plasma miR-199a-5p levels were negatively correlated with FEV [1] in patients with asthma (Adjusted R [2] = 0.164, p(mo del) = 0.015; β = -0.439, p = 0.015, Table 2). [score:1]
The miR-199a-5p level was only elevated with LPS stimulation in neutrophils but not macrophages, lymphocytes, or epithelial cells from healthy controls (p < 0.01). [score:1]
miR-199a-5p may mediate the neutrophil-smooth muscle cell communication and transform information from the inflammation response to a function change. [score:1]
The results of this study demonstrated that miR-199a-5p was increased following LPS stimulation in neutrophils, but not in macrophages, lymphocytes or epithelial cells, which supports that miR-199a-5p may be actively released by neutrophils and participate in the immunity disorder of the inflammation process of asthma. [score:1]
The WNT signaling pathway plays a pivotal role in the mediation of miR-199a-5p in hypertrophy and proliferation of bladder smooth muscle cells [41]. [score:1]
We examined whether the miR-199a-5p levels increased in human peripheral blood cell subsets and an epithelial cell line (BEAS-2B). [score:1]
miR-199a-5p expression was measured using quantitative real-time polymerase chain reaction (qPCR). [score:1]
The plasma miR-199a-5p level was significantly associated with impaired pulmonary function (FEV [1], FVC, and PEF). [score:1]
[1 to 20 of 83 sentences]
10
[+] score: 207
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-199a-2, hsa-mir-143, hsa-mir-150
miR-199a-5p expression was downregulated and CCR7 expression was upregulated in human bladder cancer tissue samples and cell lines. [score:11]
On the other hand, we also observed that miR-199a-5p could directly target the 3′UTR of CCR7 and regulate the expression of MMP-9 and EMT-related proteins like vimentin and E-cadherin, eventually suppress the progression of bladder cancer. [score:9]
miR-199a-5p was confirmed to be able to target the 3′ untranslated region (UTR) of CCR7 and regulate the expression of CCR7, Matrix metalloproteinases 9 (MMP-9) and Epithelial-Mesenchymal Transition (EMT)-related proteins. [score:8]
miR-199a-5p directly targeted the 3′UTR of CCR7 and inhibited the expression of MMP-9 and EMT-related proteins in T24 cells. [score:8]
Our results showed that overexpression of miR-199a-5p could significant decrease the expression of MMP-9 and vimentin, and obviously enhance the expression of E-cadherin. [score:7]
In addition, both miR-199a-5p downregulation and CCR7 upregulation were significantly involved in bladder cancer clinicopathological features. [score:7]
In addition, both CCR7 upregulation and miR-199a-5p downregulation were significantly involved in bladder cancer clinicopathological features. [score:7]
miR-199a-5p downregulation and CCR7 upregulation were firstly observed in bladder cancer samples and cell lines. [score:7]
Overexpression of miR-199a-5p significantly inhibited cell migration and invasion through decreasing the expression of CCR7. [score:7]
Taken together, our findings elucidate a novel role of miR-199a-5p in the suppression of cell metastasis through regulation MMP-9 and EMT-related genes by targeting CCR7 in bladder cancer. [score:6]
In this study, the miR-199a-5p expression was first identified to be significantly downregulated in human bladder cancer clinical samples and cell lines by qRT-PCR. [score:6]
As shown in Fig.   3d, miR-199a-5p overexpression could significant decrease MMP-9 and vimentin expression, while E-cadherin expression obviously increased in miR-199a-5p -transfected T24 cells compared with the negative control. [score:6]
For instance, miR-199a-3p modulated cell cycle, invasion capability, and doxorubicin sensitivity by targeting mammalian target of rapamycin (mTOR) and c-Met in human hepatocarcinoma cells [21]. [score:5]
Recent studies have revealed that miR-199a-5p was significantly abnormal expressed in several solid tumors and functioned as oncogene or tumor suppressor. [score:5]
Moreover, miR-199a-5p overexpression promoted cell migration and invasion by targeting klotho in gastric cancer cells [23]. [score:5]
Moreover, overexpression of miR-199a-5p could inhibit baldder cancer cell migration and invasion. [score:5]
Recent studies have established that miR-199a was significantly abnormally expressed in several solid tumors and functioned as oncogene or tumor suppressor. [score:5]
Fig. 2Overexpression of miR-199a-5p inhibited the migratory and invasive activity of bladder cancer cell. [score:5]
Overexpression of miR-199a-5p inhibited the migratory and invasive activity of bladder cancer cells. [score:5]
Consistent with miR-199a-5p, CCR7 upregulation was also correlated with TNM stage (P < 0.011), Histological grade (P = 0.001), Tumor invasion depth (T) (P < 0.001) and Lymph node metastasis (N) (P < 0.001) (Table  2). [score:4]
In summary, our present study revealed that downregulation of miR-199a-5p was positively correlated with clinicopathological factors in bladder cancer. [score:4]
After transfection with miR-199a-5p in T24 cells, the relative luciferase activity was obviously suppressed and CCR7 expression was decreased compared with the negative control. [score:4]
In present study, our results found that overexpression of miR-199a-5p could inhibit bladder cancer cell migration and invasion using wound-healing assay and. [score:4]
Our results highlighted the importance of the upregulation of the miR-199a-5p in the prevention of the metastatic ability of the bladder cancer cells. [score:4]
b Relative expression of miR-199a-5p in bladder cancer T24 cells and human normal bladder epithelial cell (SV-HUC-1). [score:3]
Fig. 1The expression of miR-199a-5p and CCR7 in human bladder cancer tissue samples and cell lines. [score:3]
Although miR-199a-5p in this study showed a good control to cell metastasis by targeting CCR7 in human bladder cancer, it should be noted that this study only revealed the effect of miR-199a-5p on cell metastasis. [score:3]
The 3′UTR encompassing the target sequence for miR-199a-5p of CCR7 was synthesized and cloned into pMiR-Report vector (Ambion) at HindIII and SpeI sites. [score:3]
In this study, we provided evidence that miR-199a-5p/CCR7 plays an essential role in both the suppression of the EMT process and the metastatic ability of bladder cancer cells. [score:3]
As for the expression of CCR7, there was an inverse relationship with that of miR-199a-5p. [score:3]
Besides, miR-199a-5p was involved in cell proliferation, migration and apoptosis by targeting of multiple myeloma-related angiogenesis [22]. [score:3]
In this study, we firstly observed that miR-199a-5p was downregulated in both human bladder cancer tissues samples and bladder cancer cells compared with that in paired adjacent normal tissues or normal epithelial cell line SV-HUC-1 by qRT-PCR, which was consistent with the previous studies [19, 20]. [score:3]
Correlation of miR-199a-5p and CCR7 expression with clinicopathological factors. [score:3]
Quantitative Real Time PCR (qRT-PCR) was firstly performed to identified the expression of miR-199a-5p and CCR7 in human bladder cancer samples and cell lines. [score:3]
However, there was no statistical difference between age, gender and tumor size and the miR-199a-5p or CCR7 expression level. [score:3]
However, after transfected with miR-199a-5p, there was no difference in mRNA level of CCR7 expression (Fig.   3c). [score:3]
a Relative expression of miR-199a-5p in bladder cancer tissues compared with corresponding normal tissues. [score:2]
As shown in Fig.   1a and b, the expression of miR-199a-5p was 3.36-fold and 5.20-fold lower in tumour tissues and bladder cancer cells compared with that in paired adjacent normal tissue or normal cell line SV-HUC-1, respectively. [score:2]
To explore whether CCR7 was a potential target of miR-199a-5p, we employed luciferase reporter assay and verified this hypothesis. [score:2]
Contrary to miR-199a-5p, the expression of CCR7 was 6.60-fold and 10.53-fold higher in tumour tissues and bladder cancer cells compared with that in paired adjacent normal tissue or normal epithelial cell line SV-HUC-1, respectively (Fig.   1c, d). [score:2]
Collectively, these results add newer insights into the multifaceted role played by miR-199a-5p/CCR7 in bladder cancer, prompting for the first time this miRNA/chemokine axis that regulates cell metastasis. [score:2]
As shown in Fig.   3b, after transfected with miR-199a-5p, the relative luciferase activity in the wild-type group was obviously suppressed compared with the mut-type group. [score:2]
Our findings added newer insights into the multifaceted role played by miR-199a-5p/CCR7 in bladder cancer, prompting for the first time this miRNA/chemokine axis that regulates cell metastasis. [score:2]
miR-199a-5p mimics and the negative control were obtained from Biomics Biotechnology Inc (Nanjing, China). [score:1]
Moreover, after transfected with miR-199a-5p, the adhesion activity was also decreased in T24 cells (Fig.   2c). [score:1]
Future studies will make great efforts to explore more functional role of miR-199a-5p in the tumorigenesis and progression of human bladder cancer. [score:1]
Magnification × 200. c Effects of miR-199a-5p mimics on adhesion to matrix gel of T24 cells. [score:1]
These data supported miR-199a-5p as a potential therapeutic agent and diagnostic marker of bladder cancer. [score:1]
Bladder cancer Metastasis CCR7 miR-199a-5p Bladder cancer, a major cause of morbidity and mortality worldwide, is the fourth most common cancer in men. [score:1]
miR-199a-5p mimics and transfection. [score:1]
Following that, the effects of miR-199a-5p on cell migratory and invasive activities were assessed by wound healing ands, respectively. [score:1]
To determine whether miR-199a-5p was involved in the tumourigenesis of human bladder cancer, we evaluated the expression levels of miR-199a-5p in human bladder cancer tissue samples and cell lines by qRT-PCR. [score:1]
a Predicted binding sequences of miR-199a-5p in the 3′UTR of CCR7. [score:1]
However, to the best of our knowledge, the relationship between miR-199a-5p and CCR7 in bladder cancer has not been reported to date. [score:1]
The results strongly supported miR-199a-5p as a potential therapeutic agent and diagnostic marker of bladder cancer. [score:1]
a for bladder cancer T24 cells transfected with miR-199a-5p mimics or the negative control. [score:1]
[1 to 20 of 56 sentences]
11
[+] score: 202
Other miRNAs from this paper: hsa-mir-199a-2
Taken together, these results suggest that miR-199a inhibits arsenic -induced angiogenesis by directly targeting COX-2 expression. [score:8]
Consistent with the report of Kang et al. (2012), our results show that miR-199a suppression by arsenic exposure releases its direct target inhibition of HIF-1α. [score:8]
To explore whether COX-2 can be directly targeted by miR-199a, we used the “target search” process to predict possible binding sites and free minimal energy of bindings and found that COX-2 is a putative target of miR-199a with two potential binding regions. [score:8]
Our previous study (He et al. 2013a) showed that miR-199a inhibits tumor angiogenesis by targeting ERBB2 and ERBB3 thus suppressing their downstream VEGF in ovarian cancer cells. [score:7]
To test whether the overexpression of COX-2 without miR-199a binding sites is able to reverse miR-199a–inhibited angiogensis in AsT cells, we established stable AsT cells overexpressing COX2 by transducing lentivirus carrying COX-2 cDNA without 3´UTR region. [score:7]
Indeed, overexpression of miR-199a in AsT suppressed HIF-1α expression (Figure 3B). [score:7]
The findings also indicate that miR-199a may have high therapeutic efficiency as a tumor suppressor by targeting both HIF-1α and COX-2. In addition, miR-199a-3p has also been reported to target COX-2 in human chondrocytes (Akhtar and Haqqi 2012). [score:7]
However, given that miR-199a expression levels were more than 100-fold lower in AsT cells, we reason that arsenic plays a major role in the suppression of miR-199a expression. [score:7]
A recent study reported that overexpression of miR-199a inhibited the hypoxia -induced cell proliferation in non-small cell lung cancer by suppressing HIF-1α (Ding et al. 2013). [score:7]
miR-199a inhibits arsenic -induced angiogenesis via COX-2 expression. [score:5]
In addition, our earlier findings indicate that miR-199a is a ROS responsive miRNA in which ROS inhibit miR-199a expression through increasing the promoter methylation of miR-199a gene by DNA methyltransferase 1 (He et al. 2012b). [score:5]
In this study, we identified that exposure to arsenic induced the suppression of miR-199a expression, which led to increased angiogenesis responses and tumor growth. [score:5]
To investigate whether ROS are upstream signals for inhibiting miR-199a expression, we treated AsT cells stably overexpressing miR-199a and AsT control cells with H [2]O [2]. [score:5]
The repression of miR-199a expression results in induction of HIF-1α and COX-2. In addition, the bidirectional regulations between HIF-1α and COX-2 forming a positive feedback further promote tumor angiogenesis and tumor growth (Figure 6C). [score:5]
Arsenic -induced ROS inhibit miR-199a expression via DNMT1 -mediated DNA methylation. [score:5]
We observed that forced expression of COX-2 completely reversed the inhibitory effect of miR-199a in angiogenesis (Figure 5C). [score:5]
Because miR-199a-3p and miR-199a-5p (miR-199a) are derived from the same precursor, the expression levels of both miRNAs may be somewhat regulated by the same mechanism(s). [score:4]
Interestingly, we noticed that miR-199a was also capable of down -regulating COX-2 expression. [score:4]
We found that miR-199a expression levels in N-Ras–transformed cells were 1.9-fold lower compared with the control cells (see, Figure S2B), indicating that transformation and/or oncogenes may decrease miR-199a expression. [score:4]
miR-199a directly targets both HIF-1α and COX-2. HIF-1 is one of the major pro-angiogenic factors through inducing transcriptional activation of vascular endothelial growth factor (VEGF) (Semenza 2000). [score:4]
Rane et al. (2009) reported that miR-199a directly targets HIF-1α in cardiac myocytes. [score:4]
We found that miR-199a (referred to miR-199a-5p) was the most down-regulated miRNA among the list of miRNAs examined (data not shown). [score:4]
These findings demonstrate that COX-2 is a novel direct target of miR-199a. [score:4]
In the context of arsenic -induced transformation, miR-199a showed strong anti-angiogenic properties not only by directly targeting HIF-1α but also another proangiogenic factor COX-2, which highlights the important role of miR-199a in angiogenesis. [score:4]
miR-199a expression levels were determined by RT-qPCR. [score:3]
The number of microvessels indicated by the endothelial marker CD31 staining in miR-199a–overexpressing tumors was significantly lower than in the control (Figure 2C). [score:3]
Oltipraz, a cancer chemopreventive agent, has anti-angiogenic property mediated by miR-199a induction and HIF-1α inhibition (Kang et al. 2012). [score:3]
miR-199a inhibits arsenic -induced angiogenesis in vitro and in vivo. [score:3]
miR-199a expression levels were significantly decreased by arsenic treatment at the dose of ≥ 1 μM (Figure 1B). [score:3]
ROS induce COX-2 pathway by suppressing miR-199a in AsT cells. [score:3]
Consistently, the expression levels of COX-2 in xenograft tumors were generally lower in AsT/miR-199a groups than those in AsT/miR-cont groups (Figure 3E). [score:3]
Arsenic-transformed BEAS-2B (AsT) cells (Carpenter et al. 2011) stably overexpressing miR-199a or miR-control were generated by infecting BEAS-2B cells with lentivirus carrying miR-199a-RFP or a negative control precursor (Applied Biosystems, Carlsbad, CA, USA), followed by selection with puromycin. [score:3]
The luciferase activity in reporters containing putative binding sites in COX-2 3´UTR from 2021 to 2029 was not affected by miR-199a, which suggests that this computation-predicted site is not functionally targeted by miR-199a (Figure 3D). [score:3]
More importantly, we also validated that COX-2 is a novel target of miR-199a and is functional in AsT cells. [score:3]
Differences were considered significant with p < 0.05. miR-199a-5p is down-regulated in AsT cells. [score:3]
A total of 2 × 10 [6] AsT/miR-cont cells or AsT/miR-199a cells (AsT cells stably overexpressing miR-control or miR-199a, respectively) in 80 μL were injected subcutaneously into the flanks of nude (nu/nu) mice (n = 10/group). [score:3]
We found that H [2]O [2]–induced COX-2 expression in AsT/miR-cont cells, but no induction was observed in AsT/miR-199a cells (Figure 6B). [score:3]
Our functional study revealed that COX-2 plays an important role in arsenic -induced angiogenesis, which can be impaired by miR-199a overexpression. [score:3]
We found similar miR-199a suppression and HIF-1α/COX-2 activation in Cr (VI)–transformed cells (see, Figure S3). [score:3]
To determine whether cell transformation affects miR-199a expression, we tested two different types of cell lines transformed by oncogenes: the AsT cells and PI3K–transformed chicken embryo fibroblast cells described above. [score:3]
First, we established AsT cells stably expressing miR-199a by transducing lentivirus-carrying miR-199a-RFP. [score:3]
Here, we provide a link in which repression of miR-199a by arsenic -induced ROS activates HIF-1α and COX-2 expression. [score:3]
COX-2 3´UTR luciferase reporters containing two putative miR-199a binding sites were constructed to validate the direct binding between COX-2 mRNA 3´UTR and miR-199a. [score:2]
Overexpression of miR-199a decreased the tumor weight by 50% as compared with negative control cells (Figure 2B). [score:2]
Interestingly, we noticed that blood vessels from AsT/miR-199a tumors had many more mural cells reflected by α-SMA immunoreactivities than AsT/miR-cont tumors, suggesting that miR-199a decreases arsenic -induced tumor angiogenesis but promotes blood vessel maturation (Figure 2E). [score:1]
As shown in Figure 1A, miR-199a was 100-fold lower in AsT cells, indicating a major change of miRNA abundance in cell malignant transformation (He et al. 2013b). [score:1]
Then we generated xenograft tumors by injecting the stable cells AsT/miR-cont and AsT/miR-199a subcutaneously in nude mice and allowed tumors to grow for 6 weeks. [score:1]
Figure 6Excessive ROS is an upstream signal of miR-199a/COX-2 pathway in AsT cells. [score:1]
To investigate the relationship between arsenic treatment and miR-199a expression, we treated BEAS-2B cells with sodium arsenic at the doses of 0.5 μM, 1 μM, and 2 μM for 24 hr. [score:1]
Co-transfection of miR-199a precursor with wild-type reporter constructs containing binding sites (COX-2 3´UTR 311/320) greatly decreased the luciferase activities in BEAS-2B cells, whereas co-transfection with the corresponding reporter containing point mutant at putative miR-199a binding sites did not affect the luciferase activities (Figure 3C). [score:1]
The 3´UTR-luciferase reporter constructs containing the 3´UTR regions of COX-2 with wild-type and mutant binding sites of miR-199a were amplified using the PCR method (GoTaq® G2 Flexi DNA Polymerase; Promega) according to the manufacturer’s instructions. [score:1]
Our earlier study (He et al. 2013a) showed that miR-199a processes an anti-angiogenic property in ovarian cancer cells. [score:1]
Transient transfection of miR-199a in AsT cells decreased tube formation by 40%. [score:1]
Interestingly, we found that miR-199a can not only reduce the total number of microvessels in tumors but also promote vascular maturation as indicated by the higher α-SMA staining. [score:1]
Cells were cultured in 6-well plates to reach a 60% confluency, and transfected using miR-199a or a negative-control precursor (both from Applied Biosystems) at 30 nM using Lipofectamine RNAiMAX reagent (Invitrogen, Grand Island, NY, USA) according to the manufacturer’s instructions. [score:1]
[1 to 20 of 55 sentences]
12
[+] score: 197
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-199b, hsa-mir-122
In conclusion, identification of the miR-199a-5p: DDR1 target pair and its crucial role in tumor cell invasion highlight the translational relevance for both prognostic prediction and targeted molecular therapy for patients with HCC. [score:7]
For instance, miR-199a-5p was also found to be down-regulated in ovarian cancer [44] and oral squamous cell carcinoma [45], but up-regulated in cervical carcinoma [46] and bronchial squamous cell carcinoma [47]. [score:7]
Transfection of miR-199a-5p did not induce a change in DDR1 mRNA expression, but significantly down-regulated DDR1 protein in SNU-182 cells. [score:6]
DDR1 is predicted to be a potential target of miR-199a-5p using publicly available PicTar (4-way), TargetScanS, and miRanda algorithms [24]. [score:5]
Expression of mature miR-199a-5p was normalized with expression of small nucleolar RNA C/D box 44 (RNU44) and hydroxymethyl-bilane synthase (HMBS). [score:5]
Although decreased expression of miR-199a-5p has been frequently demonstrated in HCC [11, 12, 15], functional analysis and translational relevance of this phenomenon has not been defined. [score:5]
Although in our study DDR1 has been validated as a target gene of miR-199a-5p, no significant correlation between miR-199a-5p and DDR1 mRNA expression was found in tumor samples from our patient cohort. [score:5]
Thus, we postulated that aberrantly expressed miR-199a-5p may contribute to invasion by modulation of DDR1 expression in HCC patients. [score:5]
Discoidin domain receptor-1 (DDR1) tyrosine kinase, involved in cell invasion-related signaling pathway, was predicted to be a potential target of miR-199a-5p by the use of miRNA target prediction algorithms. [score:5]
The pMIR- DDR1-3'-untranslated region (UTR) luciferase vector, containing the putative binding site for miR-199a-5p in the multiple cloning site within the 3' UTR of the luciferase gene in the pMIR-REPORT™ miRNA Expression Reporter Vector (Ambion) was constructed according to the manufacturer's instructions. [score:5]
These results indicate that miR-199a-5p can modulate gene expression directly via the DDR1 3'-UTR. [score:4]
Regulation of DDR1 expression by miR-199a-5p was assessed by the use and western blotting analysis. [score:4]
These results suggest that altered expression of miR-199a-5p in HepG2 cells may contribute to increased cell invasiveness by functional deregulation of the activity of DDR1. [score:4]
Considering the preexisting high expression of miR-199a-5p in SNU-182 cells, our results might hint at a certain independence of DDR1 to miR-199a-5p -mediated gene regulation and function in these cells. [score:4]
A significant down-regulation of miR-199a-5p was observed in 65.2% of HCC tissues and in four of five cell lines. [score:4]
In agreement with these data, and western blotting shows that enhanced expression of miR-199a-5p as well as knockdown of DDR1 by siRNA result in a significant decrease of endogenous DDR1 mRNA and protein levels in HepG2 cells (Figures 4B and 5A). [score:4]
Decreased expression of miR-199a-5p contributes to increased cell invasion by functional deregulation of DDR1 activity in HCC. [score:4]
A significant down-regulation of miR-199a-5p (mean 0.15, SE 0.05, 95% CI 0.04-0.25, range 0.00-0.61) was noted in 15 of 23 (65.2%) HCC tissues compared to NTs (mean 1.24, SE 0.13, 95% CI 0.96-1.53, range 0.65-2.22, p < 0.0001, Figure 1A). [score:3]
MiR-199a-5p expression has also been shown to be diversely deregulated in other cancer types. [score:3]
Figure 1Expression of miR-199a-5p and DDR1 in HCC specimens. [score:3]
Similarly to results obtained from HCC tissues, expression of miR-199a-5p was significantly (p < 0.001) decreased in four HCC cell lines (Hep3B, HepG2, HuH-7, and SK-HEP-1). [score:3]
Pre-miR™ miRNA precursors of miR-199a-5p and non -targeting control miRNA precursors (Pre-miR™ miRNA Precursor Molecules-Negative Control #1) were purchased from Ambion, Inc. [score:3]
In addition, SNU-182 hepatoma cells exhibited increased levels of expression of both miR-199a-5p and DDR1 mRNA. [score:3]
No correlation between miR-199a-5p expression and clinical parameters was encountered. [score:3]
| | | | | | | hsa-miR-199a-5p 3'    CUUGUCCAUCAGACUUGUGACCC Figure 4 DDR1 is a target gene of miR-199a-5p. [score:3]
Thus, DDR1 has been experimentally validated as a target gene of miR-199a-5p. [score:3]
DDR1 was shown to be a direct target of miR-199a-5p by luciferase reporter assay. [score:3]
For generation of a reporter vector bearing a human DDR1 fragment with putative miR-199a-5p binding sites, target sequences were cloned in the pMIR-REPORT Luciferase vector (Ambion). [score:3]
However, our study demonstrates a previously uncharacterized biological function of miR-199a-5p such as the ability to inhibit tumor invasion through targeting DDR1. [score:3]
Expression of miR-199a-5p precursors (p = 0.004) and DDR1-siRNA (p = 0.003) significantly decreased invasion of the HepG2 cell line (Figure 6A). [score:3]
The effect of aberrant miR-199a-5p expression on cell invasion was assessed in vitro using HepG2 and SNU-182 hepatoma cell lines. [score:3]
was employed to validate DDR1 as a putative miR-199a-5p target gene. [score:3]
There was no correlation between the expression of DDR1 and miR-199a-5p in tissues (r = 0.36, p = 0.09). [score:3]
Expression levels of miR-199a-5p (A) and DDR1 (B) were determined by analysis for 5 HCC cell lines (Hep3B, HepG2, HuH7, SK-Hep-1 and SNU-182) and primary human hepatocytes (HH). [score:3]
Figure 2Expression of miR-199a-5p and DDR1 in human HCC cell lines. [score:3]
Decreased miR-199a-5p expression in HCC has been repeatedly reported, but its functional relevance has not been elucidated to date [11, 12, 15]. [score:3]
In contrast, transfection of miR-199a precursor in another hepatoma cell line, namely SNU-182, was not associated with an alteration of DDR1 mRNA expression (Figure 4C). [score:3]
Transfection of miR-199a-5p inhibited invasion of HepG2 but not SNU-182 hepatoma cells. [score:3]
Figure 6 Effects of miR-199a-5p and DDR1 expression on hepatoma cell invasion and proliferation. [score:3]
Decreased miR-199a-5p expression in human HCC tissues and cell lines. [score:3]
| | | | | | | hsa-miR-199a-5p 3'    CUUGUCCAUCAGACUUGUGACCC Figure 4 DDR1 is a target gene of miR-199a-5p. [score:3]
These results demonstrated that miR-199a-5p is capable to modulate tumor cell invasion at least in part by targeting DDR1. [score:3]
To assess whether miR-199a-5p can directly alter the expression of DDR1 luciferase reporter assays were employed. [score:3]
MiR-199a-5p differentially regulates the expression of DDR1 in HepG2 and SNU-182 cells. [score:3]
Moreover, increased expression of miR-199a-5p has been considered a signature for high metastatic risk and a poor prognosis in uveal melanoma [48]. [score:2]
MiR-199a-5p expression data acquired by real time RT-PCR correlated well with microarray data (r = 0.8077, p < 0.001), indicating that the results are reliable. [score:2]
However, increased expression of miR-199a-5p was found in another hepatoma cell line, SNU-182, compared with primary human hepatocy tes (Figure 2A). [score:2]
We next compared miR-199a-5p expression between hepatoma cell lines and primary human hepatocytes. [score:2]
Our data hint at a more complex regulation network between DDR1 and miR-199a-5p in HCC. [score:2]
MiR-199a-5p does not modulate proliferation of HepG2 and SNU-182 cells in vitroTo characterize the effect of miR-199a-5p on hepatoma proliferation, we performed overexpression studies using the miR-199a-5p specific precursor. [score:1]
A fragment of the 3'-UTR of DDR1 mRNA, containing the putative miR-199a-5p -binding sequence, was cloned into a firefly luciferase reporter construct and co -transfected with a control β-gal reporter construct into HepG2 cells together with miR-199a-5p-specific precursor or control. [score:1]
In line with this clinicopathological observation, we found that DDR1 gene silencing by transfection of miR-199a-5p into HepG2 cells significantly decreased tumor cell invasion in vitro. [score:1]
| | | | | | | hsa-miR-199a-5p 3'    CUUGUCCAUCAGACUUGUGACCC Position 1199-1219 of DDR1 3' UTR 5'. [score:1]
We assessed the role of miR-199a-5p in tumor invasion by the ability of hepatoma cells to cross an extracellular matrix, a key determinant of malignant progression and metastasis formation. [score:1]
analysis was performed using 23 paired surgical specimens of HCC tissues and adjacent normal tissues for miR-199a-5p (A) and DDR1 (B). [score:1]
In mRNA stability assays we established that mir-199a-5p -mediated regulation of DDR1 in HepG2 cells is mainly achieved by degradation of DDR1 mRNA (Figure 5C). [score:1]
AJCC/UICC: American Joint Committee on Cancer and International Union Against Cancer; AUROC: area under receiver operating characteristics; β-gal: beta-galactosidase; CI: confidence interval; DDR1: discoidin domain receptor-1; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; HCC: hepatocellular carcinoma; HMBS: hydroxymethyl-bilane synthase; HPRT1: hypoxanthine phosphoribosyl-transferase 1; MGB: minor grove binder; miRNA: micro-ribonucleic acid; miR-199a-5p: microRNA excised from the 5' arm of microRNA-199a precursor; NT: non-tumor tissue;: quantitative real-time reverse transcription polymerase chain reaction; RIN: RNA integrity number; RNU44: small nucleolar RNA C/D box 44; SD: standard deviation; SDHA: succinate dehydrogenase complex, subunit A; SE: standard error; siRNA: short interfering RNA; UTR: untranslated region; WST: water soluble tetrazolium. [score:1]
To characterize the effect of miR-199a-5p on hepatoma proliferation, we performed overexpression studies using the miR-199a-5p specific precursor. [score:1]
MiR-199a-5p differentially modulates invasion of hepatoma cell lines in vitroWe assessed the role of miR-199a-5p in tumor invasion by the ability of hepatoma cells to cross an extracellular matrix, a key determinant of malignant progression and metastasis formation. [score:1]
A human DDR1 3'UTR 457-bp fragment bearing all 4 putative binding sites for miR-199a-5p, which are identical among all the DDR1 splice variants, was generated by RT-PCR from total RNA extracted from HepG2 cells. [score:1]
Mature miR-199a-5p and DDR1 expression were evaluated in tumor and adjacent non-tumor liver tissues from 23 patients with HCC undergoing liver resection and five hepatoma cell lines by the use of real-time quantitative RT-PCR (qRT-PCR) analysis. [score:1]
| | | | | | | hsa-miR-199a-5p 3'    CUUGUCCAUCAGACUUGUGACCC Position 1383-1403 of DDR1 3' UTR 5'. [score:1]
However, a notable decrease of DDR1 protein levels became evident after miR-199a-5p precursor transfection (Figure 5B). [score:1]
A significant (p < 0.001) decrease in relative luciferase activity was observed when miR-199a-5p precursor was cotransfected with the luciferase reporter construct containing the fragment of the 3'-UTR of DDR1 mRNA. [score:1]
Lane M indicates the molecular weight marker and lane numbers 1 to 4 represent control miRNA precursor, miR-199a-5p precursor, control siRNA, and DDR1-siRNA respectively. [score:1]
One reason might be that HCC is a very heterogeneous tumor entity and distinct cellular components might interfere with the effect of miR-199a-5p on DDR1 [39]. [score:1]
However, only transfection of DDR1-siRNA (p = 0.002) but not of miR-199a-5p precursors (p = 0.820) significantly decreased invasion of another hepatoma cell line, namely SNU-182 (Figure 6A). [score:1]
| | | | | | hsa-miR-199a-5p 3'  CUUGUCCAUCAGACUUGUGACCC Position 1260-1280 of DDR1 3' UTR 5'. [score:1]
HepG2 cells were transfected with 10 nM miR-199a-5p precursor or 100 nM DDR1-siRNA, and invasive potential was assessed after 48 hours. [score:1]
Proliferation of HepG2 and SNU-182 cells was neither altered by precursor miR-199a-5p (p = 0.486 and p = 0.073, respectively) nor by DDR1-siRNA (p = 0.980 and p = 0.141, respectively) (Figure 6B). [score:1]
Further investigation of therapeutic strategies targeting the miR-199a-5p- DDR1 signaling network is therefore warranted. [score:1]
However, the effect of miR-199a-5p on DDR1 varies among individuals and hepatoma cell lines. [score:1]
[1 to 20 of 72 sentences]
13
[+] score: 190
While expression of some of these miRNAs seemed to be specifically dysregulated in certain tumor stages, 12 miRNAs, including 4 up-regulated (miR-200c, miR-487a, miR-491-3p and miR-452) and 8 down-regulated miRNAs (miR-125b, miR-142-3p, miR-199a-5p, miR-22, miR-299-3p, miR-29a, miR-429, and miR-532-5p), were identified to be commonly dysregulated in all ccRCC tumors at different stages (Table 1). [score:11]
Luciferase assays were performed to assess the direct regulation of miR-199a-5p on the expression of the target genes identified using the TargetScan algorithm. [score:8]
These findings collectively demonstrate that miR-199a-5p inhibits ccRCC cell invasion by directly suppressing expression of TGFBR1 and JunB. [score:8]
To further validate the regulatory role of miR-199a-5p on the expression of TGFBR1 and JunB, we transfected hsa-mir-199a-5p mimics into the human kidney carcinoma 786-O cells, which express high levels of TGFBR1 and JunB, and low level of miR-199a-5p as shown in Fig 3. The protein expression of TGFBR1 and JunB decreased significantly in a dose -dependent manner after transfection of hsa-mir-199a-5p in 786-O cells (Fig 5C). [score:8]
Eleven commonly dysregulated miRNAs, including 3 up-regulated (miR-487a, miR-491-3p and miR-452) and 8 down-regulated (miR-125b, miR-142-3p, miR-199a-5p, miR-22, miR-299-3p, miR-29a, miR-429, and miR-532-5p), were identified in ccRCC tumor samples as compared with adjacent nontumorous samples. [score:7]
Eleven miRNAs were identified to be commonly dysregulated, including three up-regulated (miR-487a, miR-491-3p and miR-452) and eight down-regulated (miR-125b, miR-142-3p, miR-199a-5p, miR-22, miR-299-3p, miR-29a, miR-429, and miR-532-5p) in tumor tissues as compared with adjacent normal tissues. [score:7]
Transfection of miR-199a-5p successfully suppressed expression of TGFBR1 and JunB in the human embryonic kidney 293T cells, further confirming the direct regulation of miR-199a-5p on these two genes. [score:7]
Further studies suggested that miR-199a-5p plays an important role in inhibition of cell invasion of ccRCC cells by suppressing expression of TGFBR1 and JunB. [score:7]
Functional validation demonstrated that miR-199a-5p inhibited ccRCC cell invasion via suppressing the expression of TGFBR1 and JunB. [score:7]
miR-199a-5p directly suppressed expression of TGFBR1 and JunB in ccRCC. [score:6]
It has been reported that miR-199a-5p is down-regulated in prostate, colon and bladder tumors, and a variety of human cancer cell lines, and delivery of miR-199a-5p with other miRNAs can efficiently suppress GRP78 -mediated chemoresistance [34]. [score:6]
Luciferase reporter assays indicated that miR-199a-5p regulated expression of TGFBR1 and JunB by directly interacting with their 3’ untranslated regions. [score:6]
To demonstrate that the suppressive effect of miR-199a-5p was mediated through direct targeting of the recognition regions in 3’ UTR of target genes, the recognition sequences for JunB and TGFBR1 were mutated and the luciferase activities were measured. [score:6]
Using the tool TargetScan, we found that six genes involved in cancer-related pathways were predicted to be potential targets of miR-199a-5p (Table 3). [score:5]
We further confirmed that miR-199a-5p directly regulated the expression of TGFBR1 and JunB. [score:5]
As shown in Fig 5B, the hsa-mir-199a-5p mimics showed significantly inhibitory effects on 3’ UTRs of JunB and TGFBR1 containing the miR-199a-5p recognition sequences, whereas no inhibitory effects were observed on those containing the mutated recognition sequences. [score:5]
In recent years, mir-199a-5p has been found to be down-regulated in many cancers including colorectal cancer, and can regulate CAC1, a cell cycle-related protein which contributes to tumorigenesis in patients with colorectal cancer [42]. [score:5]
By over -expressing miR-199a-5p, we found that the invasive ability was significantly inhibited in 786-O cells, while cell proliferation, cell cycle distribution or apoptosis were not significantly changed by miR-199a-5p, demonstrating that miR-199a-5p functions in ccRCC cells mainly via modulating cell invasion. [score:5]
To further examine whether the predicted target genes are directly regulated by miR-199a-5p, 3’ UTR segments of the corresponding genes containing the miR-199a-5p recognition region mutated region not recognizable by miR-199a-5p were sub-cloned downstream of the luciferase reporter in psiCHECK-2 vectors (Applied Biosystems, Grand Island, NY, USA). [score:5]
Huang et al. [43] found that down-regulation of mir-199a-5p was associated with advanced stage, lymph node metastasis and reduced survival in small cell carcinoma of the cervix. [score:4]
These results confirmed that TGFBR1 and JunB are the direct targets of miR-199a-5p. [score:4]
Three key miRNAs (miR-199a-5p, miR-22 and miR-429), which regulate 53, 53, and 51 predicted target genes, respectively, were identified based on the miRNA-gene networks (Table 2). [score:4]
Shen et al. [44] found that decreased expression of miR-199a-5p contributes to increased cell invasion by functional deregulation of DDR1 activity in hepatocellular carcinoma. [score:4]
Further investigation showed that over -expression of miR-199a-5p significantly inhibited the invasion ability of 786-O cells. [score:3]
These results demonstrated that miR-199a-5p played an important role in suppressing cell invasion of ccRCC. [score:3]
Furthermore, Wang et al. found that mir-199a-5p targets clathrin heavy chain in HCC tumorigenesis [45]. [score:3]
The 11 miRNAs and their predicted target genes were analyzed by Gene Ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis, and three key miRNAs (miR-199a-5p, miR-22 and miR-429) were identified by microRNA-gene network analysis. [score:3]
In addition, no significant changes were found in either cell cycle phase distribution or apoptosis by overexpression of miR-199a-5p (P >0.05, data not shown). [score:3]
Three key miRNAs were refined according to miRNA-gene network analysis and the enrichment of predicted target genes in the “Pathway in cancers” (pathway Id, hsa05200), including miR-199a-5p, miR-22 and miR-429. [score:3]
The suppressive effects of miR-199a-5p on the 3’ UTRs of TGFBR1 and JunB were observed, as indicated by significant decrease in the luciferase activities of these genes in 293T cells transfected with miR-199a-5p. [score:3]
Candidate target genes of miR-199a-5p and the inserted sequences in psiCHECK vectors. [score:3]
0125672.g003 Fig 3Down-regulation of miR-199a-5p, miR-22 and miR-429 in ccRCC of all three stages and in 786-O cells as compared with normal kidney samples. [score:3]
These findings suggest that miR-199a-5p can function as a tumor suppressor in many cancers and contributes to anti-carcinogenesis. [score:3]
786-O cells were transfected with either miR-199a-5p or negative control (NC) mimics, and significantly higher expression of miR-199a-5p was confirmed in the miR-199a-5p mimics- transfected cells (Fig 4A). [score:3]
Down-regulation of miR-199a-5p, miR-22 and miR-429 in ccRCC of all three stages and in 786-O cells as compared with normal kidney samples. [score:3]
This study identified 11 commonly dysregulated miRNAs in ccRCC, three of which (miR-199a-5p, miR-22 and miR-429) may represent key miRNAs involved in the pathogenesis of ccRCC. [score:2]
0125672.g004 Fig 4. (A) Overexpression of miR-199a-5p in 786-O cells after miR-199a-5p mimics transfection compared with that in NC cells. [score:2]
However, 786-O cells with overexpressed miR-199a-5p showed significantly reduced invasive ability as compared with the control cells (P <0.001; Fig 4B). [score:2]
As miR-199a-5p and miR-22 were more greatly down-regulated in 786-O cells compared to miR-429, and the function of miR-22 has been wi dely studied in other cancers, we selected the less characterized miR-199a-5p for functional validation. [score:1]
293T cells that were transiently transfected with hsa-mir-199a-5p or NC mimics at 15 or 50 nM of final concentration were co -transfected with Renilla luciferase reporter vector (195 ng/well) and Firefly luciferase reporter vector (5 ng/well) using Lipofectamine 2000 (Invitrogen) in 24-well plates. [score:1]
0125672.g005 Fig 5. (A) Relative luciferase activities in 293T cells co -transfected with psiCHECK luciferase reporter containing the miR-199a-5p recognition region and hsa-mir-199a-5p mimics or NC mimics(15 nM). [score:1]
miR-199a-5p decreased invasive ability of ccRCC cells. [score:1]
No significant difference in cell viability was observed between the miR-199a-5p mimics -transfected cells and the control cells (P >0.05, data not shown). [score:1]
The hsa-mir-199a-5p mimics and negative control (NC) mimics were purchased from Genepharma (Shanghai, China). [score:1]
Three miRNAs (miR-199a-5p, miR-22 and miR-429) were further refined and may represent key miRNAs in the pathogenesis of ccRCC. [score:1]
Total proteins were extracted from 786-O cells transfected with or without hsa-mir-199a-5p mimics and NC mimics. [score:1]
[1 to 20 of 46 sentences]
14
[+] score: 189
Other miRNAs from this paper: hsa-mir-199a-2
To further study the mechanism of miR-199a-3p in suppressing expression of MDR1, we used MG132 (a drug that can inhibit the ubiquitin degradation of MDR1) and CHX (a drug that can inhibit the synthesis of MDR1). [score:9]
Interestingly, cell line GBC-SD, which had lower expression of miR-199a-3p and higher expression of mTOR and p-mTOR (sites 2481 and 2448), while RBE had higher expression of miR-199a-3p, had lower expression of mTOR and p-mTOR (Figure 3B) (** P < 0.01, *** P < 0.001). [score:9]
Previous studies indicated that miR-199a-3p is an inhibitor of mTOR, and miR-199a-3p plays a role as a tumor suppressor by targeting mTOR in several cancers [18– 20]. [score:7]
In our previous study, we demonstrated that MDR1 was regulated by the mTOR signaling pathway, and inhibition of the mTOR signaling pathway potently sensitized gallbladder cancer cells to 5-FU in vitro by suppressing the expression of 5-FU -induced MDR1 [10]; thus, we considered whether MDR1 was also involved in miR-199a-3p -mediated cisplatin -high-sensitivity in cholangiocarcinoma cells. [score:7]
To further confirm mTOR was the target gene of miR-199a-3p, we used Western blotting to detect the expression of mTOR signaling pathway proteins under the influence of miR-199a-3p mimics and inhibitor in GBC-SD and RBE cell lines. [score:7]
Overexpression of miR-199a-3p led to a lower level of protein expression of mTOR and p-mTOR by binding the mTOR gene 3′-UTR and then regulating the phosphorylation status of 4E-BP1 and p70S6K. [score:6]
CCK-8 assay showed that suppression of mTOR led to greater sensitivity to cisplatin in GBC-SD and RBE cell lines, but the sensitivity of cholangiocarcinoma cells with mTOR knockdown to cisplatin was not changed when treated with miR-199a-3p mimics or inhibitor (Figure 5A–5B) (*** P < 0.001). [score:5]
Figure 3(A) TargetScan predicted mTOR was the target gene of miR-199a-3p: miR-199a-3p could bind the 129–135 positions of the mTOR 3′-UTR. [score:5]
Several previous studies indicated that miR-199a-3p may target mTOR and affect cell proliferation, and that drug resistance is modulated through inhibition of mTOR [18– 22]. [score:5]
MiR-199a-3p has been shown to have significantly downregulated expression in several cancers [12– 17]. [score:5]
In conclusion, our study demonstrates that miR-199a-3p can increase the cisplatin sensitivity of cholangiocarcinoma cell lines by inhibiting the mTOR signaling pathway and MDR1 expression. [score:5]
MiR-199a-3p inhibited cisplatin induced MDR1 expression. [score:4]
To further study the mechanism of miR-199a-3p in regulating MDR1 expression, we used two specific drugs to treat the cholangiocarcinoma cell lines. [score:4]
The knockdown efficiency of mTOR siRNA was determined by, and the efficiency of miR-199a-3p mimics and inhibitor were confirmed by PCR analysis. [score:4]
To further investigate the mechanism of miR-199a-3p in regulating the sensitivity of cholangiocarcinoma cell lines to cisplatin, we used the target gene prediction site tool TargetScan (www. [score:4]
mir-199a-3p inhibitor (human): 5′-UAACCAAUGUGCAGACUACUGU-3′mir-199a-3p mimics (human):Sense: 5′-UUCUCCGAACGUGUC ACGUTT-3′Antisense: 5′-ACGUGACACGUUCGG AGAATT-3′ Negative control: Sense: 5′-UUCUCCGA ACGUGUCACGUTT-3′Antisense: 5′-ACGUGACACG UUCGGAGAATT-3′ was performed as described previously [8]. [score:3]
Results from our study imply that miR-199a-3p plays a critical role as an inhibitor of mTOR in cholangiocarcinoma. [score:3]
The efficiency of miR-199a-3p mimics and inhibitor was confirmed by PCR analysis (Figure 4B) (** P < 0.01, *** P < 0.001). [score:3]
To confirm our discovery, we used miR-199a-3p mimics and miR-199a-3p inhibitors. [score:3]
As expected, we found that miR-199a-3p mimics could decrease cisplatin -induced MDR1 expression in GBC-SD and RBE cell lines (Figure 6A) (*** P < 0.001). [score:3]
Recent studies have reported that miR-199a-3p plays an important role in suppressing cell proliferation and migration in various tumors, such as prostate cancer [27], colorectal cancer [28], breast cancer [29], glioma [30], osteosarcoma [31] and pancreatic ductal adenocarcinoma [32]. [score:3]
RBE or GBC-SD cells were treated with miR-199a-3p mimics, inhibitor or negative control for 48 h. Then, under treatment with 1 μg/ml cisplatin for 48 h, was performed by using the Click-iT EdU Imaging Kit (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions. [score:3]
Compared to the negative controls, miR-199a-3p mimics led to the downregulation of total mTOR and p-mTOR, which consequently reduced the phosphorylation activation of mTOR downstream proteins 4EBP1 and p70s6k. [score:3]
Cells were treated by mTOR siRNA alone, negative control in combination with miR-199a-3p mimics or inhibitor. [score:3]
Our results showed that the miR-199a-3p could reduce cisplatin -induced MDR1 expression, leading to high cisplatin sensitivity in cholangiocarcinoma cells. [score:3]
Interestingly, the RBE cell line, which had higher expression of miR-199a-3p (Figure 1B, ** P < 0.01 vs. [score:3]
Expression of miR-199a-3p was negatively correlated with cisplatin sensitivity in cholangiocarcinoma cells. [score:3]
mir-199a-3p inhibitor (human): 5′-UAACCAAUGUGCAGACUACUGU-3′mir-199a-3p mimics (human):Sense: 5′-UUCUCCGAACGUGUC ACGUTT-3′Antisense: 5′-ACGUGACACGUUCGG AGAATT-3′ Negative control: Sense: 5′-UUCUCCGA ACGUGUCACGUTT-3′Antisense: 5′-ACGUGACACG UUCGGAGAATT-3′ Western blot analysis was performed as described previously [8]. [score:3]
Cell viability under cisplatin and miR-199a-3p expression of cholangiocarcinoma cells. [score:3]
RBE and GBC-SD cells were treated with miR-199a-3p mimics, inhibitor or negative control for 48 h, following which the culture medium was replaced with complete medium containing different concentrations of cisplatin (μg/ml) for 48 h. After this, cells were trypsinized and washed three times with prechilled phosphate-buffered saline (PBS) and resuspended in 100 μL PBS. [score:3]
Thus, high expression of miR-199a-3p may lead to greater sensitivity to cisplatin treatment. [score:3]
Figure 4(A) Expression of mTOR, p-mTOR (sites 2481 and 2448), p-4EBP1, p-p70s6k, 4EBP1 and P70s6K were detected by Western blotting in GBC-SD and RBE cell lines under different treatments with miR-199a-3p. [score:3]
Further, we demonstrate that miR-199a-3p could increase the cisplatin sensitivity of cholangiocarcinoma cell lines by inhibiting the activity of the mTOR signaling pathway, decreasing the synthesis of MDR1, and increasing the degradation of MDR1. [score:3]
Meanwhile, miR-199a-3p inhibitor caused the opposite result (Figure 4A) (** P < 0.01, *** P < 0.001). [score:3]
mTOR is the target gene of miR-199a-3p. [score:3]
Above all, we demonstrated that miR-199a-3p could enhance the cisplatin sensitivity of cholangiocarcinoma by inhibiting the mTOR pathway. [score:3]
These results indicated that the role of miR-199a-3p in regulating cisplatin sensitivity was mediated by the mTOR pathway. [score:2]
MiR-199a-3p mimics, inhibitors and negative control were synthesized by GenePharma (GenePharma Co. [score:2]
We found that miR-199a-3p mimics could improve the toxicity of cisplatin in GBC-SD and RBE cell lines when compared to the negative controls, while the miR-199a-3p inhibitor led to the opposite result (Figure 2A–2B) (* P < 0.05,** P < 0.01, *** P < 0.001). [score:2]
We found that MG132 increased the protein level of MDR1 in GBC-SD and RBE cell lines, whilst using both MG132 and miR-199a-3p mimics led to lower expression of MDR1 compared to negative controls or the MG132 alone group. [score:2]
Our results, for the first time, prove that miR-199a-3p can enhance cisplatin sensitivity in cholangiocarcinoma cell lines by regulating the mTOR signal pathway and MDR1. [score:2]
To further prove that miR-199a-3p could affect the sensitivity of cholangiocarcinoma to cisplatin by regulating the activity of the mTOR signaling pathway, we performed a rescue experiment. [score:2]
We also found that CHX decreased the protein level of MDR1 in GBC-SD and RBE cell lines, and using both CHX and miR-199a-3p mimics also led to lower expression of MDR1 compared to negative controls or the CHX alone group (Figure 6B) (*** P < 0.001). [score:2]
These results demonstrated that miR-199a-3p regulated cisplatin sensitivity in cholangiocarcinoma cells by affecting the synthesis and degradation of MDR1. [score:2]
In addition, Fornari et al. reported that miR-199a-3p can regulate mTOR and c-Met to influence the doxorubicin sensitivity of human hepatocellular carcinoma cells [11]. [score:2]
Figure 2(A– B) Cell viability under different concentrations of cisplatin of GBC-SD and RBE cell lines treated with miR-199a-3p mimics, inhibitor and negative control, examined by CCK-8 assay. [score:2]
We first studied the cell viability of cholangiocarcinoma cell lines with different miR-199a-3p expression under different concentrations of cisplatin by CCK-8 assay. [score:2]
MiR-199a-3p enhances the sensitivity of cholangiocarcinoma cell lines to cisplatin via suppression of mTOR. [score:2]
MiR-199a-3p could inhibit the mTOR signaling pathway. [score:2]
Further studies have demonstrated that miR-199a-3p is a prognosis and diagnosis biomarker in hepatocellular carcinoma [33], gastric cancer [34] and colorectal cancer [35]. [score:1]
However, in cholangiocarcinoma, the role of miR-199a-3p and its relationship with mTOR are unknown. [score:1]
As expected, the results showed that miR-199a-3p increased the cisplatin sensitivity of cholangiocarcinoma cell lines both by decreasing the synthesis of MDR1 and increasing the degradation of MDR1. [score:1]
Thus, we hypothesized that MDR1 may take part in miR-199a-3p -mediated high-cisplatin-sensitivity. [score:1]
EdU assay revealed that miR-199a-3p mimics could decrease the proliferation rate of cholangiocarcinoma cell lines under treatment with cisplatin when compared to the negative controls, while the miR-199a-3p inhibitor showed the opposite effect (Figure 2C–2D). [score:1]
In this study, we found miR-199a-3p was upstream of the mTOR signaling pathway. [score:1]
Expression of miR-199a-3p was measured by qPCR with an ABI7500 Fast System (Applied Biosystems, CA) and SYBR green dye (Takara). [score:1]
MDR1 was also involved in miR-199a-3p -mediated high-cisplatin-sensitivity in cholangiocarcinoma cells. [score:1]
Figure 6(A) Protein level of MDR1 was detected in GBC-SD and RBE cell lines under treatment with miR-199a-3p mimics or cisplatin or both. [score:1]
MiR-199a-3p could regulate the cisplatin sensitivity of cholangiocarcinoma cell lines. [score:1]
However, the function of miR-199a-3p in cholangiocarcinoma was unknown. [score:1]
However, no study has reported the relationship between miR-199a-3p and mTOR in cholangiocarcinoma. [score:1]
We found that positions 129–135 of the mTOR 3′-UTR had complementary pairing with miR-199a-3p (Figure 3A). [score:1]
In this study, we focused on the role of miR-199a-3p in drug sensitivity of cholangiocarcinoma cells. [score:1]
[1 to 20 of 63 sentences]
15
[+] score: 183
As shown in Figure 5e, the miR-199a-5p expression increased steadily along with the cell number increased, whereas the expression of the miR-199a-5p target, Cav-1, declined as the cell density increased from 50% to 90% (logarithmic growth phase). [score:7]
Based on the data of the miR-199a-5p expression pattern and target gene validation, we proposed that miR-199a-5p may be a negative regulator of porcine preadipocyte differentiation. [score:6]
As shown in Figure 4b and c, PPARγ, aP2, and FAS expressions were also tested at the protein level, and Western Blotting of these proteins demonstrated a significant decrease upon miR-199a-5p overexpression. [score:5]
Using bioinformatic analyses, we profiled the anti- and pro-adipogenic factors among miR-199a-5p predicted targets, and further experimentation validated that Cav-1 is a bona fide target of miR-199a-5p in porcine adipocytes. [score:5]
Overexpression of miR-199a-5p Attenuated the Lipid Accumulation and Adipogenic Marker Genes Expression in Porcine Adipocytes. [score:5]
However, due to the fact that miRNA-mRNA targeting and the interplay relationship differs among tissue and cell types and physiological/pathological conditions [16], we proposed that in adipose tissue, miR-199a-5p may have a target gene subset different from other tissue types. [score:5]
Additionally, this expression pattern of Cav-1 is generally inverse to miR-199a-5p, the expression of which was sharply decreased at the early stage of differentiation (day 0 to day 4). [score:5]
MiR-199a-5p Is Highly Expressed in SAT and Downregulated in Early Porcine Preadipocyte Differentiation. [score:5]
We also found that overexpression of miR-199a-5p could attenuate the lipid accumulation during porcine preadipocyte differentiation, which is consistent with the anti-adipogenic effect of Cav-1 inhibition [12]. [score:5]
The expression pattern of miR-199a-5p suggests that it may play a role in adipogenesis, and in fact, studies using human bone marrow mesenchymal stem cells (hMSCs) found that miR-199a-5p overexpression can lead to a ~70% decrease in the mRNA level of FABP4 (aP2), an adipogenic marker [11]. [score:5]
In the present study, we established the precise expression pattern of miR-199a-5p during in vitro porcine adipogenesis, which is similar to the expression pattern of miR-199a-5p in the 3T3-L1 adipogenic mo del [9]. [score:5]
org/) and RNAhybrid software to predict the target genes of miR-199a-5p and its interaction schematic with target mRNAs. [score:5]
Rane S. He M. Sayed D. Vashistha H. Malhotra A. Sadoshima J. Vatner D. E. Vatner S. F. Ab dellatif M. Downregulation of miR-199a derepresses hypoxia-inducible factor-1alpha and Sirtuin 1 and recapitulates hypoxia preconditioning in cardiac myocytesCirc. [score:4]
In 2012, Zeng et al. proved that Cav-1 knockdown significantly impaired porcine adipogenesis in vitro [12], which is consistent with our data obtained by miR-199a-5p overexpression. [score:4]
Laine S. K. Alm J. J. Virtanen S. P. Aro H. T. Laitala-Leinonen T. K. MicroRNAs miR-96, miR-124 and miR-199a regulate gene expression in human bone marrow-derived mesenchymal stem cellsJ. [score:4]
MiR-199a-5p is highly expressed in 3T3-L1 preadipocytes, while its expression declines dramatically once adipogenic induction is present and only rebounds at the late stage of differentiation [9]. [score:4]
In cardiomyocytes, miR-199a-5p is confirmed to directly target hypoxia-inducible factor 1α (HIF-1α) and Sirt1 [13, 14], which play important roles upon hypoxia or hypoxia preconditioning of cardiac muscle. [score:4]
In spite of the distinctive expression pattern of miR-199a-5p during preadipocyte differentiation, the possible function of this miRNA in fat development, including porcine adipogenesis, has not been given much attention. [score:4]
Taken together, our study suggests that miR-199a-5p may be a regulator of porcine adipogenesis, functioning at least partially by targeting Cav-1. 2.1. [score:4]
We proposed that such a high expression level of miR-199a-5p in SAT may have a functional consequence. [score:3]
To elucidate the possible function of miR-199a-5p in porcine preadipocyte differentiation, we performed TargetScan 6.2 (http://www. [score:3]
Also, the binding site between miR-199a-5p and Cav-1 mRNA 3′ untranslated region (3′UTR) are conservative among pigs, human, and mice. [score:3]
Cav-1, which is preciously established to be indispensable for adipogenesis in several species, including pigs, was experimentally validated herein to be the target of miR-199a-5p in porcine adipocytes. [score:3]
However, to our understanding, there has not been any research dealing with the specific actions and possible targets of miR-199a-5p in fat cells. [score:3]
Based on an in vitro porcine adipogenesis mo del, we observed that miR-199a-5p expression declines by nearly 70% from day 0 to 4 of adipogenic differentiation (Figure 1c). [score:3]
To elucidate whether miR-199a-5p may also function in proliferating preadipocytes, we used flow cytometry to detect the alterations in the cell cycle caused by miR-199a-5p overexpression. [score:3]
In summary, our data indicated miR-199a-5p to be a facilitator of porcine preadipocyte proliferation whilst being a suppressor of adipogenic differentiation. [score:3]
The temporal expression pattern of miR-199a-5p during porcine preadipocyte differentiation is similar to the previous data obtained in the 3T3-L1 mo del. [score:3]
Apart from Cav-1, many other target genes and sophisticated functions of miR-199a-5p have been intensively studied since miR-199a-5p and-3p were first cloned [8]. [score:3]
By the overexpression of miR-199a-5p, we demonstrated for the first time that miR-199a-5p can affect both porcine preadipocyte proliferation and differentiation. [score:3]
The results showed that agomir transfection led to a ~2500-fold overexpression of miR-199a-5p at 48 h post-transfection, and the enhanced miR-199a-5p level could be maintained for at least 8 days after adipogenic induction (240 h post-transfection) (Figure 3a). [score:3]
The data showed that when miR-199a-5p was overexpressed, the S-phase porcine preadipocytes increased, while the G1-phase cell proportion declined; the change was significant among three independent experiments (Figure 5b). [score:3]
Therefore, Cav-1 showed an opposite expression pattern to miR-199a-5p during the cell number increased. [score:3]
Both the mRNA and protein levels of Cav-1 were significantly decreased by miR-199a-5p overexpression in porcine adipocytes (Figure 2c–e). [score:3]
Overexpression of miR-199a-5p Promoted the Proliferation of Porcine Preadipocytes. [score:3]
However, unlike its role in porcine preadipocyte differentiation, we have not determined whether Cav-1 is also the main target gene of miR-199a-5p during porcine preadipocytes proliferate, as no reports thus far have related Cav-1 to preadipocyte proliferation. [score:3]
Furthermore, we identified Cav-1 as a bona fide target gene of miR-199a-5p in porcine adipocytes. [score:3]
To test this hypothesis, we isolated porcine primary preadipocytes from Guanzhong black piglets and performed miR-199a-5p overexpression using synthetic miRNA agomir. [score:3]
We then performed the Oil Red O staining and extraction assay and observed that miR-199a-5p overexpression attenuated the lipid accumulation in porcine adipocytes (Figure 3b,c). [score:2]
Real-time qPCR measurement showed that on day 8 of differentiation, the mRNA level of adipogenic marker genes, PPARγ, aP2, Perilipin A and LPL were downregulated to different extents by the elevated miR-199a-5p level (Figure 4a). [score:2]
Based on our current observations and preliminary studies on Cav-1’s role in adipogenesis and cell proliferation, we highly proposed that miR-199a-5p may function as a potential controller of cell proliferation and differentiation during porcine adipogenesis, and such a function may at least partially depend on its regulation on Cav-1. These studies were supported by the grants from the National Natural Science Foundation of China: Study of the effects and mechanism of miRNA on commitment and adipogenesis of porcine adipose tissue derived stem cells (ADSCs) (31072014) and the Major Projects for Genetically Modified Organisms Breeding (2014ZX08009-047B). [score:2]
Song X. W. Li Q. Lin L. Wang X. C. Li D. F. Wang G. K. Ren A. J. Wang Y. R. Qin Y. W. Yuan W. J. MicroRNAs are dynamically regulated in hypertrophic hearts, and miR-199a is essential for the maintenance of cell size in cardiomyocytesJ. [score:2]
Hoechst staining of the nuclei demonstrated that miR-199a-5p overexpression led to increased cell number 24 and 48 h post-transfection compared to agomir NC treatment (Figure 5c,d). [score:2]
In human skeletal muscle, miR-199a-5p is capable of regulating the canonical Wnt pathway and affects myoblast proliferation and differentiation [15]. [score:2]
MiR-199a-5p Is Capable of Targeting Cav-1 in Porcine Fat Cells. [score:2]
However, our results showed that miR-199a-5p is even more abundant in SAT than in heart and skeletal muscle. [score:1]
These results suggested that miR-199a-5p may be a facilitator of porcine preadipocyte proliferation, and its function in proliferative porcine preadipocytes may also be mediated by Cav-1. The mature miR-199a-5p sequence possesses high evolutionary conservation among species (Figure 1a). [score:1]
The miR-199a-5p agomir sequence is listed as follows: sense: 5′-CCCAGUGUUAGACUACCUGUUC-3′; antisense: 5′-ACAGGUAGUCUGAACACUGGGUU-3′, and the agomir NC sequences are: sense: 5′-UUCUCCGAACGUGUCACGUTT-3′; antisense: 5′-ACGUGACACGUUCGGAGAATT-3′. [score:1]
The overexpression of miR-199a-5p was measured 48 h post-transfection and on day 8 of adipogenic differentiation, respectively. [score:1]
Our previous work demonstrated that the subcutaneous adipose tissue (SAT) from piglets has a higher level of miR-199-5p relative to SAT from adult pigs [10]. [score:1]
Previous studies of miR-199a-5p were focused on its function in cardiac and skeletal muscle and several types of oncocytes. [score:1]
MiR-199a-5p Agomir Transfection. [score:1]
In this study, we found that the miR-199a-5p level during porcine preadipocyte differentiation shows a similar fluctuation with that in 3T3-L1 adipogenesis. [score:1]
MiR-199a-5p agomir and negative control (NC) are double-strand, designed and synthesized by Genepharm (Shanghai, China). [score:1]
Furthermore, we used flow cytometry and Hoechst staining to show that the elevated miR-199a-5p level could also lead to accelerated proliferation of porcine preadipocytes. [score:1]
The mature miR-199a-5p sequence possesses high evolutionary conservation among species (Figure 1a). [score:1]
We also tested the miR-199a-5p level at different cell densities after the seeding of preadipocytes. [score:1]
24 h later, after seeding, miR-199a-5p agomir and agomir NC were transfected into porcine preadipocytes using Lipofectamine 2000. [score:1]
To determine the tissue distribution profile of miR-199a-5p in pigs, the total RNAs were extracted from several types of tissue and organs of adult Guanzhong black pigs. [score:1]
The luciferase vector was transfected into 293T cells with miR-199a-5p agomir and agomir NC using Lipofectamine 2000 (Invitrogen). [score:1]
These results suggested that miR-199a-5p may be a facilitator of porcine preadipocyte proliferation, and its function in proliferative porcine preadipocytes may also be mediated by Cav-1. Pig has been wi dely accepted to be an apropos research mo del for human obesity as well as the primary meat stock in many countries. [score:1]
Such research will better delineate the mechanisms by which miR-199a-5p affects adipogenesis. [score:1]
Real-time qPCR data showed that SAT has the highest expression level of miR-199a-5p among the seven tissue types or organs measured (Figure 1b). [score:1]
In addition, we observed that miR-199a-5p can promote porcine preadipocyte proliferation; this is the first time evidence about miR-199a-5p’s effect on preadipocyte proliferation. [score:1]
MiR-199a-5p agomir and agomir NC were transfected into cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). [score:1]
These results suggested that miR-199a-5p may be a facilitator of porcine preadipocyte proliferation, and its function in proliferative porcine preadipocytes may also be mediated by Cav-1. 2.2. [score:1]
[1 to 20 of 66 sentences]
16
[+] score: 161
Other miRNAs from this paper: hsa-mir-21, hsa-mir-199a-2, hsa-mir-210, hsa-mir-214, hsa-mir-143
Furthermore, inhibition of miR-199a or miR-214 using hairpin inhibitors dedifferentiated patient-derived CAFs, which was confirmed at gene expression levels. [score:7]
Inhibition of miR-199a or miR-214 using hairpin inhibitors led to the inhibition of TGFβ -induced hPSC activation, differentiation, and proliferation. [score:7]
In conclusion, this study unravels miR-199a-3p and miR-214-3p as novel therapeutic targets in pancreatic CAFs and hPSCs, as their inhibition led to dedifferentiation of pancreatic CAFs and inhibition of differentiation of hPSCs to myofibroblasts. [score:7]
We found that both miR-199a and miR-214 were highly expressed (case I) and low expressed (case II) in the stroma of the human pancreatic tumors, which can be visualized as blue stained cells (see arrow heads). [score:5]
To investigate whether inhibition of miR-199a or miR-214 dedifferentiates patient-derived CAFs and also hinders the differentiation of hPSCs into myofibroblasts, we transfected CAFs and hPSCs with their hairpin inhibitors and studied their effect at gene expression levels. [score:5]
These data indicate that inhibition of miR-199a and -214 in PSCs inhibits TGF-β-activated PSC -induced endothelial cell activation. [score:5]
These data signify that inhibition of miR-199a and miR-214 in hPSCs leads to inhibition of PSC -induced pro-tumorigenic effects in vitro, representing them interesting miRNAs to develop for potential gene therapy. [score:5]
Figure 2Transfection of anti-miR-199a or -214 hairpin inhibitors (50 nM) in CAFs, as CAFs were already activated in pancreatic tumor microenvironment (A), and TGFβ activated hPSCs (B) significantly inhibited the differentiation markers such as Acta2, Col-1a1, and PDGFβR at transcription level, as shown with qPCR. [score:5]
After 18 h, cells were transfected with anti-miR-199a and anti-miR-214 hairpin inhibitors for 24 h. Then, cells were activated with TGF-β1 (5 ng/ml) and after 48 h cells were lysed with RIPA buffer (Thermo-Scientific) containing protease inhibitor cocktail. [score:5]
Transfection of anti-miR-199a or -214 hairpin inhibitors (50 nM) in CAFs, as CAFs were already activated in pancreatic tumor microenvironment (A), and TGFβ activated hPSCs (B) significantly inhibited the differentiation markers such as Acta2, Col-1a1, and PDGFβR at transcription level, as shown with qPCR. [score:5]
Direct relationship with miR-199a and -214 target genes. [score:4]
Figure 3Transfection of anti-miR-199a or -214 hairpin inhibitors (50 nM) in hPSCs significantly inhibited the TGF-β -induced differentiation markers such as αSMA and collagen-1 at protein levels, as shown with immunocytochemical stainings (A) and Western blot and densitometry analyses of the blots (B) compared to control (without TGFβ) and negative control miR. [score:4]
Nevertheless, silencing of miR-199a or miR-214 in hPSCs/CAFs may represent a novel therapeutic option for the development of novel therapies for this devastating disease. [score:4]
The key direct targets for miR-199a are mTOR, p53, Smad1, and miR-214 are PTEN, ING4, and Bax. [score:4]
Transfection of anti-miR-199a or -214 hairpin inhibitors (50 nM) in hPSCs significantly inhibited the TGF-β -induced differentiation markers such as αSMA and collagen-1 at protein levels, as shown with immunocytochemical stainings (A) and Western blot and densitometry analyses of the blots (B) compared to control (without TGFβ) and negative control miR. [score:4]
We first examined the expression levels of miR-199a and -214 in primary CAFs isolated from resected human pancreatic tumors and TGFβ-activated human hPSCs. [score:3]
Figure 7 Ingenuity IPA pathway analysis predicted target genes for miR-199a and miR-214. [score:3]
After 18 h, cells were transfected with anti-miR-199a and anti-miR-214 hairpin inhibitors for 24 h. After that, cells were activated with TGF-β1 (5 ng/ml) for 48 h and cells were fixed and immunostained for αSMA, and Collagen1 as described elsewhere [56]. [score:3]
Identification of miR-199a/-214 candidate targets using bioinformatics tools. [score:3]
The expression levels of miR-199a and miR-214 were also confirmed in CAFs, which were isolated from three different patients (Figure 1B). [score:3]
Interestingly, network generated by IPA revealed the interactions of miR-199a with some of the potential target genes such as mTOR, TP53, and SMAD1 and for miR-214 such as PTEN, BAX and ING4 (Table 1). [score:3]
Expression of miR-199a/-214 in pancreatic stroma, CAFs, and hPSCs. [score:3]
Inhibitory effect of anti-miR-199a/-214 on hPSC differentiation at protein level. [score:3]
We found that anti-miR-199a reduced the cell growth significantly whereas anti-miR-214 showed only moderate inhibitory effects (Figure 4C). [score:3]
hPSCs were seeded in a 24-well plate (4 × 10 [4] cells/well) for 18 h and transfected with anti-miR-199a and anti-miR-214 hairpin inhibitors and allowed them to become confluent. [score:3]
Our results showed that both anti-miR-199a and -214 significantly reduced the expression of differentiation or myofibroblast markers such as Acta2, Col-1α1 and PDGFβR, at the transcriptional level in both CAFs and hPSCs (Figure 2A, 2B). [score:3]
Treatment of hPSCs with anti-miR-199a or anti-miR-214 abrogated hPSC -induced Panc-1 tumor cell growth, spheroid formation and inhibited endothelial cells activation. [score:3]
Effect of inhibition of miR-199a and -214 on hPSCs transdifferentiation. [score:3]
Both immunostaining and Western blot data clearly showed that anti-miR-199a and -214 significantly reduced TGF-β1 -induced expression of myofibroblast phenotypic markers α-SMA and Collagen1 (Figure 3A, 3B). [score:3]
Network predicted by IPA for miR-199a and -214 target genes. [score:3]
Effect of inhibition of miR-199a and -214 on CAFs and hPSCs transdifferentiation. [score:3]
Inhibitory effect of anti-miR-199a/-214 on CAFs and hPSC differentiation at gene level. [score:3]
Interestingly, TGF-β−induced activation and differentiation as well as migration and cell growth of hPSCs was inhibited by anti-miR-199a or anti-miR-214, confirming the significance of these miRs in controlling PSCs’ phenotypic behavior. [score:3]
Pretreatment of hPSCs with anti-miR-199a or -214 led to a significant inhibition of the closure of the wound (scratch gap) compared to the control cells. [score:2]
To study the effect of inhibition of miR-199a and -214 in hPSC for their effect on endothelial cells, we performed in vitro endothelial cell tube formation assay. [score:2]
To confirm that miR-199a and miR-214 are expressed in the stromal region of human pancreatic cancer, we first performed an in-situ hybridization (ISH) assay to detect the presence of miR-199a and miR-214 (Figure 1A). [score:2]
These data demonstrate that both miR-199a and miR-214 are involved in regulation of hPSC migration while miR-199a is also involved in the proliferation of hPSCs. [score:2]
We selected miR-199a-3p and miR-214-3p as main miRNAs to investigate their therapeutic potential in PSCs, as they were shown to be upregulated in activated rat PSCs, lung fibrosis and cardiac remo deling [27, 33, 41]. [score:2]
Effect of anti-miR-199a/214 on the hPSC -induced effect on endothelial cells. [score:1]
Effect of anti-miR-199a and -214 on the heterospheroid formation and hPSC -induced tumor cell proliferation. [score:1]
MicroRNA in situ hybridization (ISH) was performed using locked nucleic acid (LNA) probes for miR-199a-3p and miR-214-3p together with a MicroRNA ISH kit for FFPE tissues (Exiqon). [score:1]
Effect of anti-miR-199a and -214 on hPSC -mediated paracrine effect on endothelial cells. [score:1]
We explored the predicted genes that might be responsible for the multiple functions of miR-199a and miR-214. [score:1]
After 18 h, cells were incubated in serum-free media and transfected with anti-miR-199a and anti-miR-214 (50 nM). [score:1]
In the present study, we explored two miRNAs miR-199a-3p and miR-214-3p for their potential therapeutic role in the activation of pancreatic stellate cells (PSCs) and PSC -induced pro-tumorigenic effects in pancreatic cancer. [score:1]
Effect of anti-miR-199a and -214 on migration and proliferation of hPSCs. [score:1]
We selected miR-199a-3p and miR-214-3p as the main target for the investigation based on our miR array on stromal part isolated from colorectal tumors using laser capture dissection microscopy (Supplementary Figure 1) and the reported miRNA array in activated rat PSCs [33]. [score:1]
Although we observe a much decrease in the tube formation with conditioned medium from anti-miR-199a treated PSCs, we observed no cell death in endothelial cells microscopically after staining with calcein-red. [score:1]
After 18 h, cells were transfected with anti-miR-199a and anti-miR-214 hairpin inhibitors for 24 h. Thereafter, cells were activated with TGF-β1 (5 ng/ml) for 24 h, then total RNA was isolated using the GenElute [™] Mammalian Total RNA Miniprep Kit and the RNA amount was measured by a NanoDrop [®] ND-1000 Spectrophotometer (Wilmington, DE). [score:1]
At last we compared the miRNA expression levels in non-activated and TGF-β activated hPSCs and found that both miR-199a and miR-214 were significantly induced in the activated hPSCs compared to that of non-activated hPSCs (Figure 1F). [score:1]
Figure 6(A) Representative microscopic images (40× magnification) of human endothelial cell tube formation by HUVECs after incubation with conditioned media collected from control hPSCs or TGFβ-activated hPSCs with or without transfected with anti-miR-199a, anti-miR-214 or anti-miR negative control (NC). [score:1]
Then, we investigated the effect of inhibition of either miR-199a or miR-214 on the differentiation, cell growth and migration of hPSCs and also on the hPSC -induced paracrine effects on human pancreatic tumor cells and endothelial cells in vitro. [score:1]
Figure 1(A) ISH detection of miR-199a/-214 in pancreatic cancer tissue; blue color staining shows the miR+ positive cells while the purple color represents the counterstaining. [score:1]
Interestingly, induction of both miR-199a and miR-214 was also established in these cells, indicating a relationship of these miRNAs with PSC differentiation. [score:1]
These results indicate that both miR-199a and -214 are involved in differentiation of hPSCs into myofibroblasts. [score:1]
These results demonstrate that both miR-199a and miR-214 are involved in the differentiation of hPSCs into myofibroblasts. [score:1]
To study the effect of miR-199a and -214 on hPSC -induced paracrine effects on tumor cells, we generated heterospheroids by co-culturing hPSCs (control or transfected with anti-miRs) together with Panc-1 tumor cells in 1:1 ratio using the hanging drop method. [score:1]
Effect of anti-miR-199a/-214 on the migration and proliferation of hPSCs. [score:1]
Effect of anti-miR-199a/-214 on the paracrine activity of hPSCs. [score:1]
[1 to 20 of 59 sentences]
17
[+] score: 141
In summary, our findings revealed that ER stress suppresses the expression of the miR-199a/214 cluster by activating NFκB to upregulate pro-survival XBP-1 expression, which suggested a novel UPR/NFκB/miR-214/XBP-1 regulatory circuitry whose dysfunction may contribute to tumor survival and progression of HCC. [score:11]
We further identified that NFκB activated by unfolded protein response (UPR) suppresses miR-199a2/214 transcription, and demonstrated that activation of UPR and endoplasmic reticulum (ER) stress represents an important mechanism responsible for miR-214 and miR-199a-3p/5p down-regulation in HCC development. [score:7]
To further understand the mechanism of the miR-199a/214 cluster down -expression in HCC, we found that thapsigargin (TG) and tunicamycin (TM) or hypoxia -induced unfolded protein response (UPR) suppresses the expression of the miR-199a/214 cluster in HCC cells. [score:7]
Decreased miR-214 expression was observed in 65% of HCC (15 of 23 cases), and consistent down-regulation of both miR-199a-3p and miR-199a-5p also were detected in as much as 73% of HCC (17 of 23 cases) (Figure 1A and B). [score:6]
In our study, we showed that NFκB and XBP-1 were predominantly expressed but miR-214 was significantly reduced in human HCC tissues, miR-214 directly targets XBP-1, and UPR or hypoxia induced-NFκB activation negatively controls the miR-199a/214 cluster transcription in HCC cells. [score:6]
Result show that miR-214 and miR-199a-3p/5p was significantly down-regulated in HepG2 cells after TG and TM treatments or anoxia, further suggesting that UPR activated XBP-1 or mTOR and ERK pathway to protect tumor cell survival though suppression of the miR-199a2/214 cluster in HCC. [score:6]
Unfolded protein response downregulates miR-199a/214 expression in HCC cells. [score:6]
Thus, miR-199a and miR-214 expression levels are down-regulated by UPR under various physiological and pathological conditions. [score:6]
In the other hand, our study showed that a significant down-regulation of the miR-199a/214 cluster was observed in human HCC tissues and HCC cell lines when compared with normal liver, consistent with previous observations from profiling of miRNAs expression in HCC [9], [39], [40], [41], [42]. [score:5]
0031518.g005 Figure 5(A) HepG2 cells treated with Thapsigargin(TG, 5 µmol/L) and tunicamycin (TM, 5 µg/ml) for 24 h were analyzed by western blotting for GRP94 and XBP1 expression levels and analyzed by real-time RT-PCR for miR-199a-3p/-5p and miR-214 expression. [score:5]
0031518.g006 Figure 6(A) LPS (10 µg/ml) treatment induced NFkB p65 expression, attenuates the miR-199a/214 expression in SMMC-7721 cells. [score:5]
As the UPR transcription factor XBP-1 was identified as a target of miR-214 and recent studies have revealed the important functions of miR-199a/b-3p in HCC carcinogenesis and progression by targeting mTOR and c-Met or PAK4/Raf/MEK/ERK Pathway in HCC cells [5], [21], we decided to further investigate the correlation between UPR activation and miR-199a/214 down -expression. [score:5]
Our study suggest that modulation of miR-214 levels may provide a new therapeutic approach for cancer treatment and revealed that UPR may offer a new explanation for why the miR-199a/214 cluster were down-regulated in the progression in HCC. [score:4]
Further, we also explored whether NFκB is able to regulate miR-199a/214 expression upon anoxia. [score:4]
Therefore, a new UPR/NFκB/miR-214/XBP-1 regulatory circuitry was suggested in HCC progression, in which NFκB was activated by UPR and participated in the negative regulation of miR-199a/214 to regulate HCC progression (Figure 7). [score:4]
miR-199a/214 is downregulated in HCC cell lines and tissues. [score:4]
The regulatory role of NFκB in miR-199a/214 Expression. [score:4]
ER stress induces miR-199a/214 downregulation in HCC cells. [score:4]
showed that these miRNAs were all significantly down-regulated and miR-199a-3p>miR-199a-5p>miR-214 compared with adjacent nontumorous liver tissues. [score:3]
In the present study, we showed that miR-199a-3p, miR-199a-5p and miR-214 expression was significantly reduced in HCC tissues. [score:3]
The expression levels of miR-199a and miR-214 were also lower in HCC cells exposed to anoxia induced by CoCl [2] (100 µmol/L) (Figure 5B). [score:3]
miR-199a/214 expression in HCC samples and cell lines. [score:3]
But what is the mechanism of the miR-199a/214 cluster down -expression in HCC? [score:3]
0031518.g001 Figure 1(A) Box plot graphic displays of 23 HCC and matched adjacent benign tissues grouped according to miR-199a-3p and miR-199a-5p expression. [score:3]
Our study offer new insight into the tumor suppressor activity conferred by miR-199a/214 and the potential mechanisms of hepatocarcinogenesis. [score:3]
In addition, we further tested the effect of hypoxia -induced UPR on the level of miR-199a/214 expression. [score:3]
Some particular miRNAs were reported to be differentially expressed in different cancer, such as the miR-199a/214 cluster. [score:3]
In parallel, in HCC cell lines HepG2 and SMMC-7721, miR-199a-3p/5p and miR-214 expression was markedly decreased compared with that in human normal liver (Figure 1C). [score:2]
Summary diagram describes the ER stress/NFκB/miR-199a/214 network that regulates HCC tumorigenicity. [score:2]
Certainly, more evidences of NFκB bind site in the promoter of the miR-199a/214 cluster are needed in future to support this hypothesis and more investigations are needed to elucidate whether ER stress also activate other factors (e. g. Sp1) together involved in the downregulation of miR-199a/214 in HCC. [score:2]
Furthermore, the miPPR-199a2 region is shown here to be the authentic miR-199a2 promoter that produces the primary transcript harboring the miR-199a-3p, miR-199a-5p and miR-214 sequences as a cluster [25]. [score:1]
The miR-214, miR-199a-3p and miR-199a-5p level was quantified by real-time quantitative-PCR using TransStartTM SYBR Green qPCR Supermix (TransGen Biotech, Beijing, China), and with U6 small nuclear RNA as an internal normalized reference. [score:1]
The miR-214/XBP-1 pathway was shown in this work, while miR-199a-3p/mTOR and miR-199a-5p/DDR1 pathways were reported by other studies. [score:1]
Although miR-199a-3p and miR-199a-5p have been reported to contribute to liver carcinogenesis [5], [21], [22], the role of miR-214 in HCC tumorigenesis has not been elucidated. [score:1]
0031518.g007 Figure 7 The miR-214/XBP-1 pathway was shown in this work, while miR-199a-3p/mTOR and miR-199a-5p/DDR1 pathways were reported by other studies. [score:1]
Recently, miR-199a-3p/5p was verified to be decreased in HCC tissues, and its decrement significantly correlates with the survival of HCC patients, outlining a potential marker for predicting the prognosis of HCC patients [5], [21], [22]. [score:1]
Nevertheless, further understanding of the molecular mechanism and network by which the miR-199a/214 cluster functions may provide new avenues of research that could aid early diagnosis and treatment of this highly malignant tumor. [score:1]
It is well known that there are two genes that potentially encode pri-miR-199a, the primary precursor of hsa-mir-199a. [score:1]
To study the role of the miR-199a/214 cluster in the HCC, levels of miR-214 and miR-199a-3p/5p were determined in 23 pairs of HCC and adjacent benign tissues using real-time PCR. [score:1]
[1 to 20 of 39 sentences]
18
[+] score: 140
TGF-β1 induced expression of p53, latter increased expression of miR-199a-3p to suppress SOCS7 expression and subsequently promote activation of STAT3 and ECM accumulation. [score:9]
Furthermore, miR-199a-3p directly suppressed SOCS7 expression, which led to activation of STAT3 and upregulation of the production of probrotic proteins. [score:9]
Collectively, these data suggest a novel regulatory mechanism by which p53 upregulates STAT3 activation by direct inducing miR199a-3p to suppress SOCS7 in HK-2 cells (Fig. 11). [score:8]
In addition, we have revealed that p53 induces STAT3 activation to promote renal fibrosis via direct upregulation of miR199a-3p to suppress SOCS7 in HK-2 cells. [score:7]
To provide more direct evidence of miR-199a-3p targeting SOCS7, we co -transfected HK2 cells with a plasmid containing a luciferase report gene under the control of SOCS7 3′ untranslated region (UTR) and either a miR-199a-3p analog or a miRNA analog negative control. [score:6]
Previous results demonstrated that p53 directly induced miR-215 expression 33, which is known to be involved in increased collagen production and the progression of diabetic nephropathy by regulating the CTNNBIP1/β-catenin pathway 20. miR-199a-5p (previously called miR-199a) and miR-199a-3p (previously called miR-199a*) are two mature forms derived from the same precursor in the human genome 34 35. [score:5]
The expression of miR-215-5p, miR-199a-5p & 3p was analyzed by real-time PCR and Northern blot (Fig. 7C–F), demonstrating that the induction of miR-215, miR-199a-5p&3p after UUO was inhibited in PT-p53- KO mice. [score:5]
Pifithrin-α suppressed TGF-β1 -induced STAT3 activation and miR-199a-3p expression. [score:5]
We identified SOCS7 as the target of miR-199a-3p but not 5p predicted by the TargetScan database (http://www. [score:5]
In HK-2 cells and mouse mo dels, inhibition of p53 suppressed STAT3 activation, a key signaling of renal fibrosis, by inducing miR199a-3p that represses SOCS7. [score:5]
Furthermore, our luciferase reporter assay identified SOCS7, one member of the family of suppressors of cytokine signaling (SOCS), as a target gene of miR-199a-3p in HK-2 cells. [score:4]
The expressions of three miRNAs, miR-215-5p and miR-199a-5p&3p, were found to be consistently high in wide type mice with UUO, and they were decreased in renal cortex of global p53 knockout mice with UUO. [score:4]
However, the two down-regulated miRNAs, miR-215-5p and miR-199a-5p were correlated with the amelioration of renal fibrosis 20 21. [score:4]
A recent study reported that miR-199a-5p suppressed caveolin1 for CCl4 -induced liver fibrosis and UUO -induced renal fibrosis 21. [score:3]
We proposed that miR-199a-3p could promote STAT3 activation by inhibiting SOCS7. [score:3]
We found that the expression of fibronectin, collagen I, α-SMA, STAT3 tyrosine phosphorylation (Tyr705), and miR199a-3p during UUO injury was markedly reduced in PT-p53- KO kidney tissues than in the wild-type tissues (Fig. 10G–I). [score:3]
The induction of miR-215, miR-199a-5p, and miR-199a-3p after UUO was suppressed in PT-p53- KO mice. [score:3]
The induction of miR-215, miR-199a-5p&3p after UUO was suppressed in PT-p53- KO mice. [score:3]
The results indicated that TGF-β1 treatment markedly increased expression of vimentin and collagen I, which was significantly enhanced by transfection with miR-199a-3p analog (Fig. 8D,E). [score:3]
Furthermore, we detected that miR199a-3p expression in IgAN and DN was higher than in kidneys with MCD (Fig. 11H). [score:3]
How to cite this article: Yang, R. et al. p53 induces miR199a-3p to suppress SOCS7 for STAT3 activation and renal fibrosis in UUO. [score:3]
Data were expressed as means ± sd (n = 6); [#] p <  0.05: miR-199a-3p vs miR-ANC, or SiRNA SOCS7 vs control group. [score:3]
We found that TGF-β1 treatment markedly increased activation of STAT3 and the expression of collagen I, vimentin, and miR-199a-3p, and reduced SOCS7 protein, which was significantly reversed by pifithrin-α treatment (Fig. 8F–H). [score:3]
TGF-β1 increased miR-199a-3p expression by induction of p53. [score:3]
The results revealed that p53 induced miR-199a-3p to suppress SOCS7 for STAT3 activation. [score:3]
As shown in Fig. 9F, the antibody directed against p53 immunoprecipitated the DNA fragments from HK-2 cells containing the potential binding sites of pBS1 and pBS2, supporting the hypothesis that p53 can physically interact with the miR-199a-3p promoter region. [score:2]
MiR-199a-3p&5p were mature forms of mmu-miR-199a, hence, we further presumed that miR-199a-3p could be involved in the regulation of renal fibrosis like miR-199a-5p. [score:2]
MiR-199a-3p suppressed SOCS7 to increase STAT3 activation. [score:2]
MiR-199a-3p suppressed SOCS7 for STAT3 activation and renal fibrosis. [score:2]
However, the regulation mechanism of miR-199a-3p for fibrosis remains unclear. [score:2]
A recent study reported that miR-199a-5p was regulated by TGF-β primarily through a Smad -dependent post-transcriptional mechanism promoting miRNA maturation by Drosha 42. [score:2]
For Pifithrin-a treatment, HK-2 cells were treated with or without Pifithrin-a (10 μM) or TGF-β1 (10 ng/ml) for 24 h. For transfection experiment, after 24 h transfection of miR-199a-3p analog (100 nM) or negative control (miR-neg, Sigma) or SOCS7 siRNA (sc-41004, Santa Cruz, CA, USA). [score:1]
In current study, we found that miR-199a-3p was also a key effector of TGFβ signaling in HK-2 cells. [score:1]
How about the role of miR199a-3p in the progression of fibrosis? [score:1]
Previous studies have demonstrated that both miR-215-5p and miR-199a-5p were related to the renal fibrosis 20 21, hence, we focused on the miR-199a-3p. [score:1]
The mechanisms involved in the TGFβ -dependent modulation of miR-199a-3p are also of particular interest. [score:1]
Immunoblot (A) analysis of p-p53 Ser 15 and p53, densitometry (B) of proteins signals on immunoblots, and real time PCR analysis (C) of miR-199a-3p after indicated time point of treatment with TGF-β1. [score:1]
Total RNA (10 μg per lane) was analyzed by Northern blotting as described in the concise Methods section using a [32]p-labeled probe of miR-215, miR-199a-5p, and miR-199a-3p. [score:1]
Relative protein levels (D) of vimentin, COL1, and β-actin 24 h after transfection of miR-199a-3p analog (100 nM) or miR analog negative control (miR-ANC) with or without TGF-β1 treatment, densitometry (E) of proteins signals on immunoblots. [score:1]
First, the real time PCR results demonstrated that miR-199a-3p was significantly induced by TGF-β1 at 2 h and 24 h (Fig. 8C). [score:1]
The lysate of the kidney cortex was collected for immunoblot analysis of p53, p-STAT3 (Tyr705), fibronectin, collagen I, α-SMA, and β-actin by using specific antibodies (E, G), densitometry (F, H) of proteins signals on immunoblots, and real time PCR analysis of miR-199a-3p (I). [score:1]
Immunoblot analysis (F) of vimentin, COL1, SOCS7, p-STAT3, STAT3 and β-actin, densitometry (G) of proteins signals on immunoblots, and real time PCR analysis (H) of miR-199a-3p 24 h after TGF-β1 alone or TGF-β1 plus pifithrin-a treatment. [score:1]
In the pathogenesis of tissue fibrosis, both miR-199a-5p and miR-199a-3p were associated with the progression of liver fibrosis in humans and mice 39 40. [score:1]
Real time PCR analysis of miR-199a-3p (H). [score:1]
Cultured HK-2 cells were treated with transfection of miR-199a-3p or negative control analog or SOCS7 siRNA, followed by immunoblot for p-STAT3, STAT3, and ECM genes, and immunoprecipitation with antibodies to p53. [score:1]
Cultured HK-2 cells were treated with 10 ng/ml TGF-β1 or 10 μM pifithrin-a for 0 to 24 h or transfection of miR-199a-3p or negative control analog or SOCS7 siRNA, followed by immunoblot for p-STAT3, STAT3, and ECM genes, and real time PCR for miR-199a-3p. [score:1]
As shown in Fig. 9A,B, transfection of HK2 cells with miR-199a-3p also led to significant decrease in SOCS7 protein. [score:1]
[1 to 20 of 47 sentences]
19
[+] score: 137
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-193a
We thus predicted the targets of miR-199a-3p using the following websites: TargetScan (http://www. [score:5]
To decipher the mechanistic insights that regulate the multi-drug resistance of OS, we selected miR-199a-3p as our target, which was previously identified to regulate OS drug resistance [24]. [score:5]
Down-regulation of miR-199a-3p in cisplatin-resistant breast cancer is able to attenuate cisplatin resistance via regulating the mitochondrial transcription factor A [32]. [score:5]
In this work, we identified that miR-199a-3p could regulate OS multi-drug resistance, probably via controlling its target gene AK4. [score:4]
Qu F, Zheng J, Gan W, Lian H, He H, Li W, Yuan T, Yang Y, Li X, Ji C, et al. MiR-199a-3p suppresses proliferation and invasion of prostate cancer cells by targeting Smad1. [score:4]
As a result, the NF-кB pathway was up-regulated, which is in agreement with the negative effect of miR-199a-3p. [score:4]
In agreement with the previous findings, here we demonstrated that the expression level of AK4 is associated with the multi-drug resistance of OS cell lines, which might be regulated by miR-199a-3p. [score:4]
For instance, miR-199a-3p is downregulated in hepatocellular carcinoma, resulting in an increased sensitivity to doxorubicin -induced apoptosis [31]. [score:4]
Notably, the previous report suggested that miR-199a-3p is down-regulated in OS [11]. [score:4]
Transfection of the miR-199a-3p mimic increased the miR-199a-3p level to approximately 70.55- and 104.27-fold, respectively, whereas the transfection of the miR-199a-3p antagomiR significantly down-regulated the miR-199a-3p level to 15% (Fig.   2a and b). [score:4]
Our data revealed that both miR-199a-3p and its target gene AK4 are reversely correlated with the OS drug resistance. [score:3]
The construct was transfected into G-292, U2OS, and MNNG/HOS cells to determine whether AK4 is a target of miR-199a-3p. [score:3]
In this study, using a systematic analysis in the multi-drug sensitive (G-292 and U2OS) and resistant (MNNG/HOS) OS cell lines, we found that miR-199a-3p inhibits multi-drug resistance of OS. [score:3]
The sequences used in this study are as follows:si-AK4: GCCTAATGATGTCCGAGTT 5’-GCCUAAUGAUGUCCGAGUU dTdT-3′ 3′-dTdT CGGAUUACUACAGGCUCAA-5’ Portion 5572–5579 of the AK4 3’-UTR combined with the target sequence for miR-199a-3p was cloned into the 3′ end of the luciferase-coding sequence of pEZX-MT01 to construct pEZX-MT01-luc-AK4 WT. [score:3]
The AK4 mRNA (c and d) and protein (e) in the miR-199a-3p mimic (3 PM) transfected G-292 and U2OS cells and the miR-199a-3p antagomiR (3PA) transfected MNNG/HOS cells versus the negative control (NC), determined by qRT-PCR or Western analysesNext, we constructed a reporter vector pGL3-AK4 UTR WT by the fusion of the 3′-untranslated region (UTR) of the AK4 gene harboring the putative binding site of miR-199a-3p with the Renilla luciferase gene (Fig.   3a). [score:3]
Consistent with the changes of the miR-199a-3p level, transfection of the miR-199a-3p mimic down-regulated AK4 at both mRNA and protein levels compared to those with the NC-transfection (Fig. 2c, d and e). [score:3]
As expected, the miR-199a-3p antagomiR transfection increased the expression of AK4 in MNNG/HOS cells (Fig. 2c, d and e). [score:3]
We further revealed that miR-199a-3p targets the AK4 gene, which was reported to be involved in stress, drug resistance, malignant transformation in cancer [20– 22]. [score:3]
We also found that the AK4 gene is a target of miR-199a-3p that positively correlates with the OS drug resistance (Additional file 2). [score:3]
Taken together, these results suggested that AK4 is indeed a target of miR-199a-3p. [score:3]
The AK4 gene is one of the targets of miR-199a-3p and negatively correlates with the effect of miR-199a-3p on OS drug-resistance. [score:3]
Up- or down-regulation of miR-199a-3p and/or the AK4 gene was done to detect their roles in OS multi-drug resistance using drug resistance profiling assays. [score:3]
AK4 is a target of miR-199a-3p in OS cells. [score:3]
The AK4 mRNA (c and d) and protein (e) in the miR-199a-3p mimic (3 PM) transfected G-292 and U2OS cells and the miR-199a-3p antagomiR (3PA) transfected MNNG/HOS cells versus the negative control (NC), determined by qRT-PCR or Western analyses Next, we constructed a reporter vector pGL3-AK4 UTR WT by the fusion of the 3′-untranslated region (UTR) of the AK4 gene harboring the putative binding site of miR-199a-3p with the Renilla luciferase gene (Fig.   3a). [score:3]
Fig. 3 a. The sequences in UTR region of AK4 gene targeted by miR-199a-3p. [score:3]
We then tested the expression level of these two pathways by forced changes in the miR-199a-3p level in both G-292 and MNNG/HOS cells. [score:3]
The results showed that an intratumoral injection of the miR-199a-3p agomiR decreased the tumor mass to about 49% (Fig.   6a, b and c), which suggests that miR-199a-3p is capable of inhibiting in vivo tumor growth. [score:3]
The sequences used in this study are as follows: si-AK4: GCCTAATGATGTCCGAGTT 5’-GCCUAAUGAUGUCCGAGUU dTdT-3′ 3′-dTdT CGGAUUACUACAGGCUCAA-5’ Portion 5572–5579 of the AK4 3’-UTR combined with the target sequence for miR-199a-3p was cloned into the 3′ end of the luciferase-coding sequence of pEZX-MT01 to construct pEZX-MT01-luc-AK4 WT. [score:3]
Consistently, as revealed by the qPCR assays, the expression of miR-199a-3p was relatively higher in MNNG/HOS cells than that in G-292 and U2OS cells, with the relative ratio of 12.36:1:0.56 for MNNG/HOS:G-292:U2OS (Fig.   1a and b). [score:2]
MiR-199a-3p inhibits both the growth and CDDP drug resistance of G-292-derived tumor xenografts in nude mice. [score:2]
We performed the qRT-PCR, western blot and the luciferase reporter assays to test whether Adenylate Kinase 4 (AK4) is the target of miR-199a-3p. [score:2]
Fig. 5 a The signaling pathways regulated by miR-199a-3p and their downstream genes. [score:2]
MiR-199a showed distinct expression profiles in several types of cancer [29, 30]. [score:2]
Osteosarcoma Multi-chemoresistance miR-199a-3p AK4 MiRNAs (miRNAs) are small non-coding RNAs which are recognized as vital and evolutionarily ancient components of gene regulation [1]. [score:2]
For instance, the accumulating studies showed that the dysregulation of miR-199a is found in various cancers, including hepatocellular carcinoma [8], ovarian cancer [9], renal cell carcinoma [10], osteosarcoma [11] and etc. [score:2]
The transfection of either miR-199a-3p mimic or si-AK4 into G-292 or U2OS cells significantly decreased the AK4 level in both mRNA and protein levels (Fig.   4a and b). [score:1]
We further predicted the putative signal pathway involved in the miR-199a-3p -mediated OS drug-resistance. [score:1]
Fig. 6The miR-199a-3p’s effect on both the in vivo growth and CDDP chemoresistance of G-292 derived xenografts in nude mice. [score:1]
However, whether miR-199a-3p is involved in the OS drug resistance is still unknown. [score:1]
Our findings suggest that miR-199a-3p functions as a potential biomarker for treating OS chemoresistance. [score:1]
Accumulating evidences have suggested that miR-199a-3p is involved in cancer biology [27, 28]. [score:1]
b. The relative activities of the pathways in the miR-199a-3p mimic (3 PM) -transfected versus NC -transfected G-292 cells as well as miR-199a-3p antagomiR (3PA) -transfected versus NC -transfected MNNG/HOS cells The in vivo experiment was performed to test the role of miR-199a-3p in OS drug resistance. [score:1]
In accordance with previous findings, here we showed that miR-199a-3p involves in OS multi-drug resistance. [score:1]
Upon the transfection of the miR-199a-3p mimic into G-292 cells, the activity of Cell cycle/pRb-E2F was increased accompanied by the elevation of the miR-199a-3p level. [score:1]
Overall, only the NF-кB pathway correlates well in the two cell lines, which indicates the involvement of the NF-кB pathway in the miR-199a-3p -mediated OS drug resistance. [score:1]
By contrast, the transfection of the miR-199a-3p antagomiR into MNNG/HOS cells increased the drug-resistance capability to all tested drugs, except MNNG/HOS to DOX (Fig. 4e). [score:1]
MiR-199a-3p regulates the activities of the NF-кB signaling pathway in the context of OS multi-drug resistance. [score:1]
Furthermore, we performed in vitro and in vivo experiments in cultured cells and tumor xenografts to address the roles of miR-199a-3p and AK4 in OS drug resistance. [score:1]
In addition, the fine mechanism for the miR-199a-3p/AK4 -mediated OS drug-resistance remains to be elucidated. [score:1]
A mo del of G-292-derived tumor xenografts was subject to an intratumoral injection of miR-199a-3p agomiR, the scramble sequence control (Mock) or phosphate-buffered saline (PBS). [score:1]
The results suggested that miR-199a-3p is involved in the multi-drug resistance of OS cells. [score:1]
In addition, the activity of the NF-кB signaling pathway was drastically altered by the forced changes of the miR-199a-3p level in OS cells. [score:1]
Fig. 1The relative miR-199a-3p level (fold) in G-292, U2OS and MNNG/HOS cell lines by qRT-PCR analyses is shown in table (a) and plot (b). [score:1]
By contrast, the activity of NF-кB was repressed, which correlates well with the forced changes of the miR-199a-3p level in G-292 cells (Fig. 5b). [score:1]
Fig. 2The level of miR-199a-3p (a and b). [score:1]
The intratumoral injection of an miR-199a-3p agomiR into G-292 indeed led to a decrease of the AK4 level in the tumor sections (Fig. 6d and e), which further confirmed that miR-199a-3p has a negative effect on both the growth and drug resistance of OS cell-derived tumor xenografts in nude mice. [score:1]
Moreover, the tumor weight of the miR-199a-3p agomiR transfected mice was much smaller than the control in the context of CDDP -treated group of G-292 cells (Fig. 6a, b and c). [score:1]
We then determined the AK4 level in miR-199a-3p mimic -transfected G-292 and U2OS cells and antagomiR -transfected MNNG/HOS cells. [score:1]
All these studies indicated that miR-199a-3p may be involved in cancer chemotherapy resistance. [score:1]
We then transfected the miR-199a-3p antagomiR into MNNG/HOS cells to decrease of the miR-199a-3p level. [score:1]
b-e. The relative luciferase activity (fold) of the reporter with wild-type (WT) AK4-UTR or with no UTR (Vec) were determined in the miR-199a-3p mimic (in G-292 and U2OS) or antagomiR (in MNNG/HOS) or Mock transfected osteosarcoma cells. [score:1]
[1 to 20 of 61 sentences]
20
[+] score: 122
Other miRNAs from this paper: hsa-mir-199a-2
The 3′-untranslated region (UTR) fragments of the mTOR gene were predicted to be complementary to the sequence of miR-199a according to an analysis of the miRNA target gene prediction database, TargetScan. [score:7]
The purpose of the present study was to define the role of this miRNA during the development of cisplatin drug resistance in the human OV2008 and C13* ovarian cancer cell lines by analyzing the expression levels of miR-199a and mTOR, a possible target of miR-199a. [score:6]
To investigate whether miR-199a is involved in the regulation of the expression of mTOR, the mimics or inhibitors of miR-199a were transfected into the C13* and OV2008 cells, respectively, and the mRNA and protein expression levels of mTOR were detected by qPCR and western blotting. [score:6]
As shown in Fig. 2B, the OV2008 cells were transfected with miR-199a inhibitor or inhibitor NC, followed by treatment with 40 μM cisplatin for 24 h. s using annexin-V staining showed that significantly lower apoptosis ratios were detected in the OV2008 cells transfected with miR-199a inhibitor compared with the NC group (Fig. 2B). [score:6]
Based on previous research, miR-199a may be a potential cancer suppresser and could act as a new therapeutic target for ovarian cancer patients with a risk for cisplatin resistance. [score:5]
As shown in Fig. 3A, the expression of mTOR mRNA was increased following miR-199a inhibitor transfection in the OV2008 cells. [score:5]
Subsequently, inhibitors of miR-199a were transfected into the OV2008 cells and it was observed that the miR-199a reduction increased the mTOR expression level, decreasing the sensitivity of the OV2008 cells to cisplatin. [score:5]
Subsequent to analyzing miRNA target prediction public databases (TargetScan, Pictar), it was observed that the 3′-UTR mRNA of mTOR included a highly-conserved binding site for miR-199a (Fig. 4A). [score:5]
To further demonstrate whether miR-199a was able to regulate the sensitivity of OV2008 and C13* cells to cisplatin, the OV2008 and C13* cells were transfected with inhibitors of miR-199a or mimics of miR-199a, respectively. [score:4]
Regulation of mTOR expression by miR-199a. [score:4]
Future studies are required to further demonstrate whether mTOR is a direct target of miR-199a and whether additional molecular mechanisms exist (19). [score:4]
During this process, mTOR is at least an indirect target gene of miR-199a. [score:4]
These results show that miR-199a is able to reverse cisplatin chemoresistance by the negative regulation of mTOR expression. [score:4]
The miR-199a mimics and inhibitors were purchased from Ambion (Life Technologies Inc. [score:3]
In the present study, the expression levels of miR-199a were analyzed in OV2008 and C13* cells and attempts were made to identify the molecular mechanism between cisplatin resistance and miR-199a. [score:3]
Based on the present data, we attempted to identify whether mTOR is the target gene of miR-199a, which may explain miR-199a-related cisplatin resistance in ovarian cancer cells. [score:3]
Transfecting mimics of miR-199a into the C13* cells caused the expression level of mTOR to be reduced, while the sensitivity to cisplatin was increased. [score:3]
OV2008 and C13* cells in the exponential phase of growth were plated in six-well plates at 3.5×10 [5] cells/well and cultured for 16 h. The cells were then transfected with the mimics or inhibitors of miR-199a or the negative control (NC) RNA, at a final concentration of 100 nM using Lipofectamine 2000 (Invitrogen) and OPTI-MEM reduced serum medium (Life Technologies Inc. [score:3]
In summary, the present study indicates that miR-199a contributes to the reversal of cisplatin resistance by blocking the expression of mTOR in cisplatin-resistant ovarian cancer cells. [score:3]
These results indicated that mTOR expression was significantly blocked by miR-199a. [score:3]
According to the present study results, we predict that miR-199a may be a potential therapeutic target for cisplatin-resistant ovarian cancer. [score:3]
mTOR may be a target gene of miR-199a. [score:3]
Consequently, mTOR may be the target gene of miR-199a. [score:3]
The low expression of miR-199a has been previously detected in ovarian carcinoma and is significantly correlated with a poor prognosis (3). [score:3]
Expression levels of miR-199a in OV2008 and C13* ovarian cancer cells. [score:3]
The intersection of algorithms indicated that mTOR was a potential target gene of the mature miR-199a. [score:3]
The expression levels of miR-199a were, on average, 83.4-fold higher in the OV2008 cells compared with the C13* cells (P<0.05, Fig. 1A). [score:2]
The mTOR protein expression level was also increased (Fig. 3C), while the mRNA and protein levels of mTOR were decreased in the C13* cells transfected with miR-199a mimics compared with the NC groups (Fig. 3D). [score:2]
First, it was demonstrated that the miR-199a level was lower in the C13* cells compared with the parental OV2008 cells, while the expression of mTOR was noticeably higher. [score:2]
As shown in Fig. 2C, transfection with inhibitors of miR-199a markedly decreased the sensitivity of the OV2008 cells to cisplatin compared with the cells treated with NC. [score:2]
miR-199a is located on human chromosome 19q13.2 (3) and has been detected in human ovarian carcinoma. [score:1]
Quantitative (q)PCR for miR-199a and mTOR mRNA detection. [score:1]
Effect of miR-199a on sensitivity to cisplatin treatment in C13* and OV2008 cells. [score:1]
The cDNA was used for the amplification of mature miR-199a, mTOR, GAPDH and U6 snRNA through qPCR. [score:1]
These results indicated that miR-199a is able to reverse cisplatin-resistance in ovarian cancer cells by promoting cisplatin -induced apoptosis in vitro. [score:1]
Luciferase 3′-UTR-reporter vectors (100 ng) and 100 nmol miR-199a mimics were co -transfected into C13* cells using Lipofectamine 2000 reagent according to the manufacturer’s instructions (Invitrogen). [score:1]
Subsequent to 24 h, the OV2008 and C13* cells were transfected with the inhibitors or mimics of miR-199a for 24 h. Following 12 h of incubation, the cells were then treated with various concentrations of cisplatin for 48 h. The absorbance at 450 nm was measured using a multilabel plate reader (Perkin-Elmer, Waltham, MA, USA). [score:1]
These results clearly indicate that miR-199a is significant in the cisplatin resistance mechanism of ovarian cancer cells. [score:1]
Restoring attenuated levels of miR-199a in human hepatocarcinoma cells results in G [1]-phase cell cycle arrest, leading to reduced invasive ability, increased susceptibility to hypoxia and enhanced sensitivity to doxorubicin -induced apoptosis (7). [score:1]
The levels of miR-199a and mTOR were detected by qPCR and western blotting in the OV2008 and C13* cells. [score:1]
[1 to 20 of 40 sentences]
21
[+] score: 121
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-199a-2, hsa-mir-34b, hsa-mir-34c
Significant difference (P<0.01) We then analysed the human miR-199a-3p and miR-34a sequence and its target gene sequence, confirmed that mTOR (mammalian target of rapamycin), MET and MDM4 were target genes for that miRNA s. Figure 3 showed that miR-199a-3p and miR-34a targeted mTOR, MET and MDM4 at the 3′-UTR (untranslated region) in human osteosarcoma cells to regulate translation. [score:14]
It was found to down-regulate the oncogenes after the target gene analysis of miR-199a-3p and miR-34a using TargetScan tools, such as Met, mTOR and MDM4. [score:8]
Our research demonstrated that miR-199a-3p and miR-34a could down-regulate its target genes, mTOR, MET and MDM4 in human osteosarcoma cells. [score:6]
Transfection with miR-199a-3p and miR-34a mimics oligonucleotides as a result down-regulated mTOR (regulon of cell proliferation), MET (regulon of cell proliferation) and MDM4 (repressor of p53) expression to activate the p53-apoptosis pathway. [score:6]
In the other report, overexpression of miR-199a-3p leads to inhibition of cell migration and cell growth, increase of G1-phase cell population [21]. [score:5]
Protein expression of mTOR, MET and MDM4, putative target genes was performed on miR-199a-3p and miR-34a transfected cells according to Gel-Pro Analyzer 4 comparative method. [score:5]
miR-199a-3p and miR-34a mimics down-regulated MDM4, MET and mTOR expression compared with the blank control, scrambled, liposome control and oligonucleotides. [score:5]
The growth inhibitory effect of the miR-199a-3p and miR-34a mimics was time -dependent, with the maximum inhibition detected 7 days after transfection. [score:5]
MiR-199a-3p and miR-34a target genes expression in human osteosarcoma cells. [score:5]
As shown in Figure 2, the growth inhibitory effect of the miR-199a-3p and miR-34a mimics was time -dependent, with the maximum inhibition detected 7 days after transfection. [score:5]
MiR-199a-3p and miR-34a mRNA up-regulation in miR-199a-3p and miR-34a mimics transfected human osteosarcoma cells. [score:4]
Thirdly, miR-199a-3p down-regulates both Met proto-oncogenes [21, 30]. [score:4]
These results suggested that the osteosarcoma suppressor activity of miR-199a-3p and miR-34a in human osteosarcoma cells may be associated with p53 pathway. [score:3]
MiR-199a-3p and miR-34a inhibited the proliferation of human osteosarcoma cells in vitro. [score:3]
MiR-199a-3p and miR-34a expression after transfection in human osteosarcoma cells. [score:3]
Effect of miR-199a-3p and miR-34a mimics on MDM4, MET and mTOR expression. [score:3]
Bar=50 μm The expressions of members of apoptosis pathway were analysed in human osteosarcoma cells treated with miR-199a-3p and miR-34a mimics or scrambled oligonucleotides using real-time PCR. [score:3]
First, the expression of miR-199a-3p is decreased in all proliferating cell lines tested except for fibroblasts. [score:3]
The expression of miR-199a-3p and miR-34a was quantified by qRT-PCR 72 h after transfection. [score:3]
The miR-199a-3p decreases the expression of several oncogenes and anti-apoptotic genes, including Met and mTOR. [score:3]
These results suggest that miR-199a-3p and miR-34a might function as a novel tumour suppressor in human osteosarcoma. [score:3]
Bar=50 μmThe expressions of members of apoptosis pathway were analysed in human osteosarcoma cells treated with miR-199a-3p and miR-34a mimics or scrambled oligonucleotides using real-time PCR. [score:3]
Transfection of miR-199a-3p and miR-34a mimics oligonucleotides into human osteosarcoma cells significantly decreased cell growth and increased cell apoptosis, thus indicating that the inhibition effect is associated with an activation of p53-apoptosis pathway (Figure 5). [score:3]
These results are consistent with several studies that have suggested that miR-199a-3p is a potential tumour suppressor [27– 29]. [score:3]
In conclusion, in this study, we provide direct evidence that miR-199a-3p and miR-34a influences cell apoptosis. [score:2]
Future studies are needed to further define the additional molecular pathways mediated by miR-199a-3p and miR-34a. [score:1]
Figure 1Cells were incubated with synthetic oligonucleotides as described in the Materials and Methods section and miR-199a-3p and miR-34a mRNA was quantified by real-time PCR. [score:1]
This symbolic apoptotic event was greatly reduced with miR-199a-3p and miR-34a. [score:1]
The function of miR-199a-3p and miR-34a in cell proliferation and apoptosis, it was clearly dependent on the presence of mTOR, MET and MDM4 gene in human osteosarcoma cells. [score:1]
So, our studies suggest that miR-199a-3p and miR-34a may play an important role in the pathogenesis of cancers, especially osteosarcoma. [score:1]
MiR-199a and miR-34a has showed it could repress the cancer cell growth and migration respectively in previous study [19– 21]. [score:1]
To determine the functional role of miR-199a-3p and miR-34 in human osteosarcoma cells, we stably transfected miR-199a-3p and miR-34a mimics into human osteosarcoma cells. [score:1]
The oligonucleotide sequence of the hsa-miR-199a-3p mimics (MIMAT0000232) and has-miR-34a (MIMAT0000255) were: 5′-ACAGUAGUCUGCACAUUGGUUA-3′ and 5′-UGGCAGUGUCUUAGCUGGUUGU-3′. [score:1]
Secondly, introduction of the miR-199a-3p precursor induced apoptosis in cancer cells. [score:1]
As shown in Figure 1, miR-199a-3p and miR-34a levels were significantly elevated by the miRNA mimics. [score:1]
Here, the miR-199a and miR-34a were transfected together to human osteosarcoma cells to investigate the mechanisms of suppress proliferation and apoptosis. [score:1]
[1 to 20 of 36 sentences]
22
[+] score: 119
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-199b, hsa-mir-214
Overall, these findings indicated that genes that are suppressed by miR-199a and simultaneously require the Brm-type SWI/SNF complex for efficient expression show distinct expression patterns: expression in type 1 cells but no expression in type 2 cells. [score:11]
Whereas we know that suppression of the expression of a target protein by a certain miRNA is usually moderate and is not unconditionally retained in steady states, we selected the candidates of type 1-specific genes from various targets of miR-199a-5p (10 genes tested), miR-199a-3p (11 genes tested), and miR-214 (6 genes tested). [score:9]
Interestingly, two other epithelial-type keratin genes 29 30, KRT7 31 (an miR-199a-3p target) and KRT19 (an miR-199a-5p target), were not expressed in any of the type 2 cells but were expressed in some of the type 1 cells (Supplementary Fig. 2 and 3). [score:9]
On the other hands, the expression levels of GSK3β and Sirt1 (miR-199a-5p targets), and PTEN (a miR-214 target), which did not show type 1-specific expression patterns, were not affected by high levels of either Brm or NFκB in SW13 cells (Fig. 4a). [score:9]
Given that miRNA usually suppresses its target protein in a modest manner, it might be somewhat unexpected that some miR-199a targets were regulated in an all-or-none manner between type 1 and type 2 cells (Fig. 2a,b). [score:8]
However, in the other areas expressing these 4 proteins, we detected also miR-199a expression, indicating expression heterogeneity in cancer legions. [score:7]
These results suggest that CAV1/2 and possibly MET are specifically expressed in type 1 cells by evading transcriptional suppression by EGR1 proteins and also post-transcriptional suppression by miR-199a-5p/3p. [score:7]
The results of a series of quantitative reverse transcription-polymerase chain reaction (RT-PCR) experiments (Fig. 1a) confirmed our previous observations that epithelial tumor cell lines can be classified into two types according to the expression levels of Brm, EGR1, and miR-199a; type 1 cells specifically express Brm mRNA, whereas expressions of EGR1 mRNA and miR-199a-5p and-3p, as well as miR-214, which is also generated from the miR-199a (2) gene locus, are restricted to type 2 cells. [score:7]
Of 32 candidate genes tested by quantitative RT-PCR (Fig. 2a and Supplementary Figs. 2 and 3), CAV1 25 and KRT80 (both miR-199a-5p target genes) and CD44 26, MET 27, and CAV2 28 (all miR-199a-3p targets) were expressed in most of the type 1 cells but in none of the type 2 cells (Fig. 2a). [score:7]
Mann-Whitney test further confirmed that these miR-199a target gene products (CD44, MET, CAV1 and CAV2) are specifically expressed in type 1 cells (Supplementary Fig. 4). [score:5]
In some of these areas, expression of miR-199a was undetectable as shown in Fig. 8 (surrounded by solid line), which recapitulates the expression patterns of type 1 cells. [score:5]
The full-length blots were presented in the supplementary Figure 7. (a) Relative expression levels of miR-199a-3p and type 1-specific mRNAs were determined by quantitative RT-PCR in A549 and HeLaS3 cells which were transduced with retroviral vectors expressing EGR1. [score:5]
We speculated that this all-or-none phenomenon could be reflecting regulation by the molecular switch through miR-199a/Brm/EGR1 axis, where Brm and miR-199a expressions manifest a mutually exclusive pattern. [score:4]
When HeLaS3 and A549 cells were stably transduced with EGR1 -expressing retrovirus, endogenous miR-199a-3p levels were elevated as expected from the axis (Fig. 5a). [score:3]
In the area between solid line and the cancer pearl in Fig. 8, where tumor cells assumed intermediate differentiation status, these 4 proteins and miR-199a were weakly expressed with various extents. [score:3]
In our current study, we were able to efficiently identify the type 1-specific genes by setting the reported miR-199a and miR-214 target genes as the candidates. [score:3]
After preparing sequential thin sections of total 21 SCC cases, they were immunohistochemically stained with antibodies against Brm, CD44, MET, and CAV1 and also probed for miR-199a-5p by in situ hybridization and interrelationships among their expression patterns in the coincident area of the each section were analyzed by comparing lower and higher differentiation status. [score:3]
Type 1-specific genes would be regulated in an all-or-none manner by either of these two feedforward loops that associate with the robust miR-199a/Brm/EGR1 axis that dictates cancer cell lines to either of the steady states, [miR-199(−)/Brm(+)/EGR1(−)] and [miR-199a(+)/Brm(−)/EGR(+)] (Fig. 6b). [score:2]
This might indicate EGR2, EGR3, and EGR4 are involved in the miR-199a/Brm axis in a similar manner to EGR1. [score:1]
One is composed of miR-199a-5p/3p, Brm and CD44, MET and KRT80 (Fig. 6a left) and another is composed of EGR1, miR-199a-5p/-3p and CAV1, and CAV2 (and possibly MET) (Fig. 6a right). [score:1]
Therefore, in normal epithelial cells, we expect miR-199a-5p and-3p would fine-tune caveolin function such as homeostasis for plasma membrane integrity, signaling platforms, cytoskeleton remo deling and cell migration. [score:1]
In situ hybridization analysis to detect miR-199a-5p in formalin-fixed, paraffin-embedded sections was performed using LNA -modified oligonucleotide probes as described previously 17 60. [score:1]
The results in our present study reveal that in normal cells, the interplay between chromatin remo deling factors and miRNAs would fine-tune plasma membrane sensors by several motifs including the miR-199a/Brm/EGR1 axis and two feedforward motifs detected here. [score:1]
Using 12 cell lines that were strictly derived from human epithelial tumors, we can confirm the findings of our previous report that these cells can be classified into type 1 [mir-199a(−)/Brm(+)/EGR1(−)] (8 lines) or type 2 [miR-199a(+)/Brm(−)/EGR1(+)] (4 lines) cells. [score:1]
In situ hybridization In situ hybridization analysis to detect miR-199a-5p in formalin-fixed, paraffin-embedded sections was performed using LNA -modified oligonucleotide probes as described previously 17 60. [score:1]
These results indicate that the miR-199a/Brm/EGR1 axis is largely retained in variety of epithelial tumor cell lines. [score:1]
We detected a Brm [−], CD44 [−], MET [−], and CAV1 [−], and miR-199a [+] phenotype in all of the cancer pearls where the cell retained nuclei, which recapitulated that of type 2 cells (Fig. 8 within the broken line). [score:1]
SCC categorized as NSCLC analyzed by in situ hybridization for miR-199a-5p or immunohistochemistry for Brm, CD44, MET, CAV1. [score:1]
The miR-199a/Brm/EGR1 axis persists in an extended panel of cell lines originating from epithelial tumors. [score:1]
Because our panel of cancer cell lines used for the development of the cell line typing was limited to 14 cell lines, we intended to increase the number of cell lines by directly performing quantitative RT-PCR of Brm mRNA (using totally 4 PCR primer pairs), EGR1 mRNA (using totally 4 PCR primer pairs) and miR-199a-3p by adding 12 new cell lines using the same experimental protocol as used for Fig. 1a (Fig. 7). [score:1]
[1 to 20 of 30 sentences]
23
[+] score: 109
Upregulation of miR-199a-3p in osteosarcoma reduces the expression of CD44 mRNA and leads to decreased translation of the functional CD44 protein. [score:8]
CD44 is a direct target of miR-199a-3p, and the miR-199a-3p expression profile in osteoblast and osteosarcoma cell lines. [score:6]
Aberrantly expressed miR-199a-3p in osteosarcoma leads to the degradation of CD44 mRNA and further generates decreased translation of CD44 protein. [score:5]
Considering the clinical data we obtained that osteosarcoma patients who responded poorly to chemotherapy presented stronger CD44 levels, it is hypothesized that miR-199a-3p may attenuate drug resistance through inhibition of CD44 expression. [score:5]
Moreover, miR-199a-3p inhibits the expression of CD44 in osteosarcoma both in a time and dose -dependent manner. [score:5]
Therefore, miR-199a-3p could be a potential regulator of CD44 expression. [score:4]
CD44 is a direct target of miR-199a-3p in osteosarcoma. [score:4]
In accordance with a former study, down-regulation of CD44 by miR-199a-3p remarkably increased the chemosensitivity to cisplatin, paclitaxel, and adriamycin in ovarian cancer cells 39. [score:4]
In order to evaluate whether CD44 is a direct target of miR-199a-3p, osteosarcoma cell lines U-2OS and KHOS were transfected with miR-199a-3p mimic, and the effects on CD44 expression were determined. [score:4]
Here, we found that CD44 is also a direct target of miR-199a-3p in osteosarcoma. [score:4]
How to cite this article: Gao, Y. et al. CD44 is a direct target of miR-199a-3p and contributes to aggressive progression in osteosarcoma. [score:4]
Importantly, our previous study has demonstrated that the expression of miR-199a-3p was dramatically decreased in osteosarcoma cell lines (U-2OS and KHOS) in comparison with normal osteoblast (HOB-c and NHOst) cells (Fig. 2B) 15. [score:3]
miR-199a-3p may mediate the expression level of CD44 and thus impact the drug sensitivity of osteosarcoma cells. [score:3]
Specifically, when normalized to control cells, the expression levels of CD44 in cells transfected with 10 nM, 20 nM, and 40 nM miR-199a-3p mimic were decreased to 80.4%, 53.3%, 29.2%, and 18.3% for U-2OS, and 75.5%, 68.7%, 39.2%, and 43.1% for KHOS. [score:3]
Our findings are consistent with recent reports showing that miR-199a-3p can mediate CD44 expression in hepatocelluar carcinoma and ovarian cancer 38 39. [score:3]
A Alignment of the predicted miR-199a-3p 3′-UTR target sequences of CD44 mRNA. [score:3]
These results suggested that miR-199a-3p repressed CD44 expression in both a dose -dependent and time -dependent manner. [score:3]
As revealed by analysis, levels of CD44 were significantly suppressed in the cells treated with miR-199a-3p in a dose -dependent manner (Fig. 3A,B). [score:3]
Transfection of expression vector -based miR-199a-3p precursor and miRNASelect™ pEP-miR-Null (Cell Biolab, Inc, San Diego, CA) into U-2OS, and selection of stable clones was performed as previously described 15. [score:3]
B comparison of miR-199a-3p expression levels between in comparison with osteoblasts (HOB-c and NHOst) and osteosarcoma cells (U-2OS and KHOS) based on the miR microarray platform and unsupervised hierarchical clustering analysis. [score:3]
Further analysis showed that the alignment of predicted miR-199a-3p target sequences in CD44 mRNA reside at nucleotide 74 to 91 from the start of the CD44 3′-UTR (Fig. 2A). [score:3]
miR-199a-3p transfection increased drug sensitivity by knocking down CD44 in osteosarcoma. [score:2]
A and B miR-199a-3p knocked down CD44 in osteosarcoma cells as a dose dependent manner. [score:2]
C and D miR-199a-3p knocked down CD44 in osteosarcoma cells as a time dependent manner. [score:2]
In addition, protein from U-2OS dosed with 60 nM miR-199a-3p was collected at different time points to determine the time -dependent knockdown effect of CD44. [score:2]
These data suggest that the CD44-miR-199a-3p axis may be involved in the development of osteosarcoma. [score:2]
Taking the aforementioned functions of CD44 and miR-199a-3p contributed by our and others’ endeavors into account, we hypothesized that the CD44-miR-199a-3p axis plays an important role in the development of metastasis, recurrence, and drug resistance of osteosarcoma (Fig. 4). [score:2]
The dose and time dependent effect of miR-199a-3p on knocking down CD44 and increasing the doxorubicin sensitivity of osteosarcoma. [score:2]
miR-199a-3p mimic/precursor transfection. [score:1]
One of the top ranked and highest scoring miRs was miR-199a-3p. [score:1]
Moreover, transfection of miR-199a-3p was reported to reduce the cellular proliferation rate and influence doxorubicin sensitivity in liver cancer cells, and decrease osteosarcoma cell growth and migration 15 36. [score:1]
It is worth mentioning here that significantly decreased osteosarcoma cell proliferation and migration has been found by restoration of miR-199a-3p 15. [score:1]
Transfection of synthetic miR-199a-3p mimic (Ambion® mirVanaTM miR-199a-3p mimics, TX) into KHOS and U-2OS cells was performed with Lipofectamine [®] RNAiMAX Reagent (Invitrogen) according to the manufacturer’s instructions. [score:1]
The miR-199a-3p can bind the site within the 3′-UTR of CD44 mRNA, which leads to degradation of the bound RNA. [score:1]
U-2OS, U-2OS/miR -null, and U-2OS/miR-199a-3p cells were seeded into 96-well microplates at a density of 1 × 10 [3] cells per well and incubated with a series of concentrations of doxorubicin, which were supplied by the pharmacy at the Massachusetts General Hospital. [score:1]
The seed match sequences for miR-199a-3p are indicated by lines. [score:1]
Transfection of miR-199a-3p significantly restored the sensitivity to chemotherapeutic drug doxorubicin in U-2OS. [score:1]
Our results also underscore the pivotal role of the CD44/miR-199a-3p interaction in determining malignancy in osteosarcoma. [score:1]
Schematic representation showing CD44-miR-199a-3p axis mediated aggressive behaviors in osteosarcoma. [score:1]
It is assumed that the enhancement of doxorubicin sensitivity in our study may be induced by loss of function of CD44 when miR-199a-3p concentration is enriched inside osteosarcoma cells. [score:1]
[1 to 20 of 40 sentences]
24
[+] score: 102
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-214
The results showed that, under normoxic condition, these target genes were upregulated 1.8–2.2-fold after inhibition of the miR-199a/214 cluster in hiPS-NSCs. [score:8]
Therefore, our CRISPRi system targeting the E-box element in the promoter of the miR-199a/214 cluster successfully inhibited miR-199a-5p, miR-199a-3p, and miR-214 expression in hiPS-NSCs under hypoxic condition. [score:7]
In the view that miR-199a-5p, miR-199a-3p, and miR-214 of the miR-199a/214 cluster are targeting the HIF-1 α and c-Met signaling pathways that play an essential role in hypoxia -induced cell migration (Figure 2(a)) [12– 15], we attempted to develop a CRISPRi system to inhibit the expression of this microRNA gene cluster. [score:7]
It has been described that miR-199a-5p, miR-199a-3p, and miR-214, which are coexpressed from the miR-199a/214 cluster on Chromosome 1, negatively regulate hypoxia -induced cell migration via downregulation of the HIF-1 α and c-Met signaling [12– 15]. [score:7]
Consistent with our previous studies [5, 8], the expression levels of miR-199a-5p, miR-199a-3p, and miR-214 in hiPS-NSCs were very high under normoxic condition but downregulated by 30%–50% under hypoxic condition. [score:6]
Under hypoxic condition, the expression levels of these genes were elevated merely 1.2–2.7-fold but 3.3–4.5-fold after inhibition of the miR-199a/214 cluster. [score:5]
Our data showed that the CRISPRi system successfully suppressed the expression of miR-199a-5p, miR-199a-3p, and miR-214 in hiPS-NSCs and significantly enhanced their tumor tropism in vitro and in vivo. [score:5]
More importantly, the animal experiment using a breast cancer lung metastasis mouse mo del has demonstrated that targeted inhibition of the miR-199a/214 cluster by CRISPRi significantly augmented the tumor tropism of hiPS-NSCs in vivo. [score:5]
Targeted inhibition of the miR-199a/214 cluster in NSCs significantly improved their tumor tropism in vitro and in vivo. [score:5]
Targeted Inhibition of the MiR-199a/214 Cluster by a CRISPRi System in NSCs. [score:4]
MicroRNA qPCR was performed to access the absolute expression levels of miR-199a-5p, miR-199a-3p, and miR-214 in hiPS-NSCs transduced with the CRISPRi system and under hypoxic condition (Figure 2(c)). [score:3]
We have developed a baculovirus- delivered CRISPRi system that specifically inhibits the miR-199a/214 cluster on Chromosome 1 by blocking the E-box in the promoter region. [score:3]
In our animal experiment, we demonstrated that, by inhibition of the miR-199a/214 cluster, a significantly higher ratio of NSC vectors migrated into the tumor tissues. [score:3]
Here we have attempted to inhibit the miR-199a/214 cluster using a CRISPRi system to promote hiPS-NSC migration towards tumors under hypoxic condition. [score:3]
The results showed that, under normoxic condition, the inhibition of miR-199a/214 cluster did not increase the migration ratio of hiPS-NSCs towards 4T1 cells. [score:3]
Taken together, our results demonstrated that the inhibition of miR-199a/214 cluster by CRISPRi could significantly improve the tumor tropism of hiPS-NSCs in vitro under hypoxic condition. [score:3]
To search an optimal sgRNA target site for CRISPRi, the sequence of the promoter region (−357 bp to −1 bp) containing an E-box element of the miR-199a/214 cluster was retrieved from the UCSC Genome Browser (http://genome. [score:3]
In summary, the inhibition of the miR-199a/214 by CRISPRi significantly augments the tumor tropism of hiPS-NSCs in vivo. [score:3]
According to literature, the region between −357 bp and −1 bp of the promoter, containing an E-box element (CATCTG), is necessary to drive the transcription of the miR-199a/214 cluster [30]; hence, the sequence of this region was retrieved and screened for candidate sgRNA target sites overlaid with the E-box element. [score:3]
Under hypoxic condition, the inhibition of miR-199a/214 cluster promoted the migration ratio of hiPS-NSCs towards 4T1 cells from 40% to 60%. [score:3]
To further examine whether inhibition of the miR-199a/214 cluster could improve the hiPS-NSC tumor tropism in vivo, an animal study was performed using a mouse mo del of breast cancer lung metastasis. [score:3]
Hence, we hypothesized that inhibition of the miR-199a/214 cluster may enhance the hiPS-NSCs migration towards tumors under hypoxic condition. [score:3]
However, the SDF-1/CXCR4 and HGF/c-Met signaling pathways are negatively regulated by the miR-199a/214 cluster in NSCs. [score:2]
Inhibition of the MiR-199a/214 Cluster Promotes NSC Tumor Tropism In Vitro. [score:2]
Inhibition of the MiR-199a/214 Cluster Enhances NSC Tumor Tropism In Vivo. [score:2]
We then further investigated whether the inhibition of miR-199a/214 cluster could derepress the hypoxia-related signaling pathways and promote hiPS-NSC migration under hypoxic condition. [score:1]
[1 to 20 of 26 sentences]
25
[+] score: 95
Other miRNAs from this paper: hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-199a-2
Taken together, our data suggest that the inhibitory effect of miR-199a-5p on ADSC proliferation is very likely to due to down-regulation of the VEGF gene. [score:6]
0073673.g006 Figure 6(A) ZsGreen intensity indicated that most ADSCs were effectively infected by lentiruses that contained miR-199a-1, miR-199a-2 or scrambled miRNA; (B) Trypan blue assay indicated that miR-199a-5p overexpression inhibited ADSC proliferation; (C) Trypan blue assay indicated that miR-199a-5p inhibitor promoted ADSC proliferation; (D) ELISA assay revealed that miR-19-5p inhibitor increased VEGF levels in ADSCs. [score:6]
We have further demonstrated that VEGF positively regulates ADSC proliferation in vitro and identified miR-199a-5p as a potent negative regulator for VEGF expression. [score:5]
Cell number counting by trypan blue staining revealed that ADSC proliferation in the miR-199a-1 group or the miR-199a-2 group was inhibited by 24 to 27% whereas the miR-199a-5p inhibitor increased its proliferation rate by 49% (Fig. 6B, C). [score:5]
To investigate the effects of miR-199a-5p inhibition, ADSCs were seeded at 5×10 [4] cells/well in 6 well plates and transfected with commercial synthetic miR-199a-5p inhibitor or inhibitor negative control (RIBOBIO co. [score:5]
To investigate the regulatory mechanisms underlying miR-199a-5p effects on VEGF expression in ADSCs, we examined the expression status of two human microRNA coding sequences, miR-199a-1 (on chromosome 19) and miR-199a-2 (on chromosome 1) that potentially contribute to miR-199a-5p transcription in ADSCs. [score:4]
Comparative analysis supported the view that VEGF might be one of the abundant genes and its expression may be regulated by miR-199a-5p. [score:4]
Taken together, VEGF could promote ADSC proliferation and miR-199a-5p regulates ADSC proliferation by fine-tuning VEGF expression level. [score:4]
In this study, we have also demonstrated that down-regulation of VEGF by either VEGF shRNA or miR-199a-5p decreases ADSC proliferation, indicating that VEGF plays a role in ADSC proliferation. [score:4]
Our gain- or loss-of-function experiments have demonstrated that miR-199a-5p acts as an endogenous regulator for VEGF expression through binding to the VEGF 3′-UTR. [score:4]
ADSCs were infected with lentiviral expressing miR-199a-5p and then seeded in 48-well plates with 2×10 [4] cells per well. [score:3]
The inhibitory effect of miR-199a-5p on ADSC proliferation. [score:3]
Furthermore, up-regulation of miR-199a-5p in ADSCs was also found to attenuate VEGF mRNA level by qRT-PCR and ELISA assays (Fig. 5E, F). [score:3]
Importantly, miR-199a-5p overexpression restrains ADSC proliferation. [score:3]
To determine the role of miR-199a-5p in ADSC proliferation, we overexpressed miR-199a-5p in ADSCs infected with the miR-199a-5p lentivirus. [score:3]
MiR-199a-5p differentially regulates the expression of VEGF in ADSCs. [score:3]
A summary of miR-199a-5p target sites in the 3′UTRs of VEGF is presented in Fig. 5A. [score:3]
MiR-199a-5p -mediated VEGF down-regulation in ADSCs. [score:3]
The infection efficiency of these two lentivirus overexpression miR-199a-5p was more than 90% (Fig. 5B). [score:3]
Thus, targeting VEGF/miR-199a-5p signaling may serve as a strategy for tissue engineering or clinical use of ADSCs during in vitro expansion. [score:3]
Cells were divided into 3 groups as follows: scrambled miRNA (control), miR-199a-1 and miR-199a-2. Lentiviral infection efficiency was determined by detecting the expression of ZsGreen by fluorescence microscopy. [score:3]
Our findings suggest that miR-199a-5p may act as a VEGF regulator to antagonize ADSC proliferation. [score:2]
The pLuci-3′UTR mut vector for the miR-199a-5p binding site of VEGF 3′UTR was constructed by using GeneTailor site-directed mutagenesis system (Invitrogen). [score:2]
We studied the role of endogenous miR-199a-5p in repressing VEGF expression by the dual-luciferase reporter assay. [score:2]
ELISA assay indicated that miR-199a-5p inhibitor increased VEGF levels by 38% (Fig. 6D). [score:2]
Figure S2 The inhibitory effect of miR-199a-5p on hADSCs proliferation by MTT assay. [score:2]
0073673.g005 Figure 5(A) Targetscan indicates that miR-199a-5p binds the 3′UTR of VEGF mRNA; (B) Lentiviral infection efficiency was evaluated by ZsGreen intensity; (C) Dual-luciferase reporter assay indicated that miR-199a-5p interacted with the 3′UTR of VEGF mRNA by using lentiviral infection (n = 3); (D) qRT-PCR assay indicated that the lentiviruses overexpressed miR-199a-5p (n = 3); (E) qRT-PCR assay indicated that miR-199a-5p overexpression in ADSCs reduced VEGF mRNA levels by approximately 42% (n = 3). [score:2]
QRT-PCR analysis confirmed that ADSCs infected with the miR-199a-5p lentivirus exhibited higher miR-199a-5p levels (Fig. 5D). [score:1]
We constructed miR-199a-1 and miR-199a-2 lentiviral vectors by inserting sequences complementary to the miR-199a-5p strand. [score:1]
Luciferase activities were measured 24 hours after reporter vectors were transfected into ADSCs infected with lentivirus overexpression miR-199a-5p. [score:1]
[1 to 20 of 30 sentences]
26
[+] score: 79
Recently, Hou, et al. observed that miR-199a is frequently downregulated in hepatocellular carcinoma, and that the degree of downregulation significantly correlated with survival, indicating that miR-199a has potential as marker of prognosis in hepatocellular carcinoma [43]. [score:7]
0033762.g004 Figure 4 Has-miR-100 and has-miR-125b down-regulation were significantly associated with poorer survival, and has-let-7c, has-miR-143, has-miR-145 and has-miR-199a-5p down-regulation tended to predict poorer survival, although these results were not statistically significant. [score:7]
Has-miR-100 and has-miR-125b down-regulation were significantly associated with poorer survival, and has-let-7c, has-miR-143, has-miR-145 and has-miR-199a-5p down-regulation tended to predict poorer survival, although these results were not statistically significant. [score:7]
Kaplan–Meier survival analyses revealed that the SCCC patients with low expression of has-miR-100 (P = 0.019) and has-miR-125b (P = 0.020) had a poorer prognosis compared to patients with high expression of these miRNAs, while has-let-7c (P = 0.071), has-miR-143 (P = 0.064), has-miR-145 (P = 0.072) and has-miR-199a-5p (P = 0.056) down-regulation tended to adversely affect survival. [score:7]
In this study, we observed that downregulation of six miRNAs (has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p) is associated with advanced tumor stage, lymph node metastasis and poorer survival in SCCC patients (Table 1 ), suggesting that clustering analysis based on miRNA expression may facilitate a detailed individual diagnosis of SCCC patients. [score:6]
MiR-199a is downregulated in lung cancer and is suggested to be candidate tumor suppressor [41]. [score:5]
Alternatively, cancer cells may produce miR-199a to promote cell migration and invasion, and miR-199a could be downregulated after metastasis. [score:4]
Interestingly, of the nine miRNAs associated with metastasis, downregulation of has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were also significantly correlated with advanced tumor stage as described above. [score:4]
Among, downregulation of six miRNAs, has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were significantly associated with lymph node metastasis and reduced survival in SCCC. [score:4]
Shen et al. reported that decreased expression of miR-199a-5p contributes to increased cell invasion by functional deregulation of DDR1 activity in hepatocellular carcinoma [42]. [score:4]
In conclusion, this study has revealed that downregulation of has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p are significantly correlated with advanced tumor stage, lymph node metastasis and poorer survival in SCCC. [score:4]
Seven miRNAs, has-let-7c, has-miR-10b, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were significantly down-regulated in advanced stage SCCCpatients (FIGO IB2-IV) compared to early stage SCCC patients (FIGOIB1). [score:3]
Conversely, increased expression of miR-199a has been associated with poorer survival in several other tumor types, including acute myeloid leukemia and lung cancer [41], [44], suggesting that the role of miR-199a is dependent on the cell type. [score:3]
Kaplan-Meier estimates of overall survival in 44 patients with stage small cell carcinoma of the cervix according to has-let-7c (A), has-miR-100 (B), has-miR-125b (C), has-miR-143 (D), has-miR-145 (E) andas-miR-199a-5p expression (F). [score:3]
In our study, MiR-199a was downregulated in the SCCC patients with lymph node metastasis compared to patients without metastasis (fold change: 4.774, P = 0.004). [score:2]
We also identified nine miRNAs (has-let-7c, has-miR-31, has-miR-100, has-miR-125b, has-miR-143, has-miR-145, has-miR-199a-5p, has-miR-203 and has-miR-218) which could significantly discriminate between tumor tissues from patients with metastasis (M, n = 13) and without metastasis (NM, n = 31, P<0.05). [score:1]
The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.030); (B) has-miR-100 (P = 0.025); (C) has-miR-125b (P = 0.007); (D) has-miR-143 (P = 0.016); (E) has-miR-145 (P = 0.009); (F) has-miR-199a-5p (P = 0.008). [score:1]
0033762.g006 Figure 6The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.030); (B) has-miR-100 (P = 0.025); (C) has-miR-125b (P = 0.007); (D) has-miR-143 (P = 0.016); (E) has-miR-145 (P = 0.009); (F) has-miR-199a-5p (P = 0.008). [score:1]
0033762.g005 Figure 5The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.009); (B) has-miR-100 (P = 0.002); (C) has-miR-125b (P = 0.003); (D) has-miR-143 (P = 0.006); (E) has-miR-145 (P = 0.004); (F) has-miR-199a-5p (P = 0.015). [score:1]
Has-let-7c, has-miR-10b, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were significantly down- regulated in advanced stage SCCC, compared to early stage SCCC. [score:1]
The sensitivity and specificity of discriminate early from advanced tumour stages for each miRNA were plotted: has-let-7c (P = 0.009), has-miR-100 (P = 0.002), has-miR-125b (P = 0.003), has-miR-143 (P = 0.006), has-miR-145 (P = 0.004), has-miR-199a-5p (P = 0.015). [score:1]
Further study is required to clarify the role of miR-199a in SCCC. [score:1]
Similarly, the sensitivity and specificity of discriminate presence or absence of lymph node metastasis for each miRNA were: has-let-7c (P = 0.030, has-miR-100 (P = 0.025), has-miR-125b (P = 0.007), has-miR-143 (P = 0.016), has-miR-145 (P = 0.009), has-miR-199a-5p (P = 0.008). [score:1]
The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.009); (B) has-miR-100 (P = 0.002); (C) has-miR-125b (P = 0.003); (D) has-miR-143 (P = 0.006); (E) has-miR-145 (P = 0.004); (F) has-miR-199a-5p (P = 0.015). [score:1]
[1 to 20 of 24 sentences]
27
[+] score: 70
When coculturing irradiated or Snail -overexpressed HUVECs with fibroblasts, it was found that in addition to increased expression of miR-199a-5p in endothelial cells, miR-199a-5p expression in fibroblasts was also unexpectedly increased, suggesting that miR-199a-5p is located downstream of Snail -induced EndMT and that it could be transferred from endothelial cells to fibroblasts. [score:7]
After radiation, the expression of miR-145-5p and miR-199a-5p was upregulated in HUVECs (Figure 3(a)). [score:6]
We subsequently tested the fibrotic markers of cocultured MRC-5 cells and found that both α-SMA and collagen type I expression were upregulated after transfecting HUVECs with miR-199a-5p mimic. [score:6]
Furthermore, both Snail -overexpressed and irradiated HUVECs showed increased miR-199a-5p expression in cocultured MRC-5 cells (Figure 3(c)). [score:5]
Then, we transfected MRC-5 with miR-199a-5p mimic or inhibitor, and the expression of the fibrotic marker in fibroblasts was altered accordingly. [score:5]
Only miR-199a-5p expression was increased by Snail overexpression (Figure 3(b)). [score:5]
Therefore, miR-199a-5p may promote the activation of fibroblasts by downregulating caveolin-1 in fibroblasts in radiation induced microenvironment cross-talk. [score:4]
To verify the direct effect of miR-199a-5p on fibroblasts, we transfected MRC-5 cells with miR-199a-5p mimic or inhibitor. [score:4]
Both HUVECs and MRC-5 cells expressed high levels of miR-199a-5p when transfected with miR-199a-5p mimic. [score:3]
Inhibition of Snail or miR-199a-5p in endothelial cells could be a promising strategy for the prevention or treatment of RIPF. [score:3]
Furthermore, reduced levels of miR-199a-5p were detected when HUVECs were transfected with miR-199a-5p inhibitor (Figure 4(a)). [score:3]
Snail Increased miR-199a-5p Expression in HUVECs. [score:3]
Mimics and inhibitors of miRNA and negative control oligonucleotides for hsa-miR-199a-5p were obtained from RiboBio. [score:3]
The present study is the first to propose that irradiated endothelial cells undergoing EndMT promoted myofibroblast activation via the Snail/miR-199a-5p axis, providing new targets for the prevention and treatment of RIPF, consequently enhancing the effect of radiotherapy for non-small-cell lung cancer. [score:3]
It has been reported that miR-199a-5p promotes the differentiation of fibroblasts into myofibroblasts by regulating caveolin-1, a key mediator of pulmonary fibrosis, to induce pulmonary fibrosis [18]. [score:2]
In conclusion, our experiments showed that irradiated endothelial cells undergoing EndMT promoted myofibroblast activation via the Snail/miR-199a-5p axis. [score:1]
We found that miR-199a-5p was profibrotic mediator downstream of Snail. [score:1]
Then, we cultured the cells with GFP-labeled MRC-5. After 48 h of coculture, the cell types were sorted by flow cytometry and the miR-199-5p level was determined in each population. [score:1]
Snail-Induced miR-199a-5p Elevation Promoted Myofibroblast Differentiation. [score:1]
miR-199a-5p has been shown to play an important role in a variety of organ fibrosis [18, 33, 34], and we have demonstrated, for the first time, its status in Snail -induced EndMT in RIPF. [score:1]
To investigate whether elevated miR-199a-5p in HUVECs affected the differentiation of fibroblasts into myofibroblasts, we transfected HUVECs with miR-199a-5p mimic or inhibitor. [score:1]
To investigate whether miR-199a-5p had an impact on fibroblasts, we transfected HUVECs with miR-199a-5p mimic or inhibitor and examined the effects in both HUVECs and MRC-5 cells. [score:1]
To our knowledge, the present study is the first to report that irradiated endothelial cells undergo EndMT via the Snail/miR-199a-5p axis to promote the differentiation of fibroblasts into myofibroblasts. [score:1]
[1 to 20 of 23 sentences]
28
[+] score: 67
In LX-2 cells treated with TGFβ, the expression levels of miR-199a and miR-199a* were significantly higher than in untreated cells; the expression levels of miR-200a and miR-200b were significantly lower than in untreated cells. [score:5]
In this report and prior mouse studies and the expression pattern of 3 miRNAs (miR-199a-5p, 199b*, 125-5p) was found to be similar while the expression pattern of 11 miRNAs (miR-223, 221, 24, 877, 29b, 29a, 29c, 30c, 365, 148a, and 193) was partially consistent with fibrosis grade [16]. [score:5]
B. The expression levels of 3 fibrosis related genes in LX2 cells with overexpressing miR-199a, 199a*, 200a, or 200b, respectively were significantly higher than that in cells transfected with control miRNA (p<0.05; two-tailed Student t-test). [score:5]
The expression level of these 4 miRNAs was significantly different between F0 and F3 and spearman correlation analysis also showed that the expressions of these miRNAs were strongly and positively correlated with fibrosis grade (n = 105, r = 0.498(miR-199a), 0.607(miR-199a*), 0.639(miR-200a), 0.618(miR-200b), p-values<0.0001) (Figure 3). [score:5]
TGFβ -induced factor (TGIF) and SMAD specific E3 ubiquitin protein ligase 2 (SMURF2), both of which play roles in the TGFβ signaling pathway, are candidate targets of miR-199a* and miR-200b, respectively, as determined by the Targetscan algorithm. [score:5]
The relationship between expression level of miR-199 and 200 families and expression level of three fibrosis related genes. [score:5]
The expression of miR-199a* was silenced in several proliferating cell lines excluding fibroblasts [21]. [score:3]
Figure S2Comparison of the expression level of miR-199 and 200 familes in several cell lines and human liver tissue. [score:3]
Endogenous expression level of miR-199a, 199a*, 200a, and 200b in normal liver and LX2 cell as determined by microarray analysis (Agilent Technologies). [score:3]
In both the mouse and human studies, the expression levels of miR-199a, 199a*, 200a, and 200b were positively and significantly correlated to the progressed liver fibrosis. [score:3]
Lab Invest 21 Kim S Lee UJ Kim MN Lee EJ Kim JY 2008 MicroRNA miR-199a* regulates the MET proto-oncogene and the downstream extracellular signal-regulated kinase 2 (ERK2). [score:3]
Over expression of miR-199a, 199a*, 200a, and 200b was associated with the progression of liver fibrosis. [score:3]
We identified that 4 highly expressed miRNAs (miR-199a, miR-199a*, miR-200a, and miR-200b) that were significantly associated with the progression of liver fibrosis both human and mouse. [score:3]
The expression level of miR-199 and 200 families in human liver biopsy specimen by real-time qPCR. [score:3]
Furthermore, overexpression of miR-199a, miR-199a*, miR-200a and miR-200b in LX-2 cells resulted significant induction of above fibrosis-related genes compared with control miRNA (Figure 4B). [score:2]
miR-199a* is also one of the negative regulators of the HCV replication [22]. [score:2]
Down regulation of miR-199a, miR-199a* and 200a in chronic liver injury tissue was associated with the hepatocarcinogenesis [9]. [score:2]
0016081.g003 Figure 3 validation of the 4 miRNAs (miR-199a, miR-199a*, miR-200a, and miR-200b). [score:1]
validation of the 4 miRNAs (miR-199a, miR-199a*, miR-200a, and miR-200b). [score:1]
The sequences of mmu-miR-199a-5p, mmu-miR-199b, mmu-miR-199b, mmu-miR-200a, and mmu-miR-200b in mouse miRNA corresponded to the sequences of hsa-miR-199a, hsa-miR-199a*, hsa-miR-199a, hsa-miR-200a, and hsa-miR-200b in human miRNA, respectively (Table S3). [score:1]
Thus, our in vitro analysis suggested a possible involvement of miR-199a, 199a*, 200a, and 200b in the progression of liver fibrosis. [score:1]
For detection of the miRNA level by real-time qPCR, TaqMan® microRNA assay (Applied Biosystems) was used to quantify the relative expression level of miR-199a (assay ID. [score:1]
The miR-199 and miR-200 families have are circumstantially related to liver fibrosis. [score:1]
The 4 human miRNAs (miR-199a, miR-199a*, miR-200a, and miR-200b) with the largest difference in fold change between the F1 and F3 groups were chosen to validate the microarray results using stem-loop based real-time qPCR. [score:1]
[1 to 20 of 24 sentences]
29
[+] score: 64
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
Seven miRNAs including six up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-148b and miR-21-5p) and one down-regulated (bta-miR-200a) were found to be regulated (P < 0.05) by both treatments, and thus considered core differentially expressed (DE) miRNAs. [score:9]
The expression of seven miRNAs including six up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-148b and miR-21-5p) and one down-regulated (bta-miR-200a) were significantly affected by both treatments. [score:9]
Seven of the DE miRNAs by safflower oil treatment (6 up-regulated: bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-148b, miR-21-5p; one down-regulated: bta-miR-200a) were also significantly affected by linseed oil supplementation. [score:7]
Out of this number, 11 were up-regulated (bta-miR-4286, miR-885, miR-199c, miR-199a-3p, miR-3431, miR-98, miR-196a, miR-378, miR-23b-3p, miR-148b and miR-21-5p) while only 3 were down-regulated (miR-200a, miR-335 and miR-2299-5p) (Table  2). [score:7]
SCD1 gene, presumably targeted by bta-miR-199a-3p is a key gene with role in the synthesis of USFAs, was reported to be down-regulated in response to linseed oil supplementation [18]. [score:6]
When compared with the control period (day-14), we identified a total of 22 DE miRNAs at day+28 including 10 up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-34a, miR-152, miR-16a, and miR-28) and 12 down-regulated (bta-miR-200a, miR-145, miR-99a-5p, miR-125b, miR-99b, miR-125a, miR-96, miR-484, miR-1388-5p, miR-342, miR-486 and miR-1271) (Table  2). [score:6]
Quantitative RT-PCR was used to validate the expression of select differentially expressed miRNAs (bta-miR-199a-3p, miR-378, miR-34a and miR-98). [score:5]
Target analysis showed that stearoyl-CoA desaturases, SCD1 and SCD5, which are involved in FA biosynthesis, are targeted by bta-miR-200a and miR-199a-3p respectively. [score:5]
The highest number of gene targets (1180) was recorded for bta-miR-98 while miR-199a-3p only targeted 81 genes (with high confidence). [score:5]
Real-time quantitative PCR (qPCR) was used to validate the expression levels of selected DE miRNAs (bta-miR-199a-3p, miR-34a, miR-378 and miR-98) identified in this study (Fig.   5). [score:3]
For example, bta-miR-199a and bta-miR-378 were differentially expressed at day+28 compared with day-14 in both treatments (P < 0.05) after RNA-sequencing and confirmed by qPCR. [score:2]
[1 to 20 of 11 sentences]
30
[+] score: 62
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-149, hsa-mir-518a-1, hsa-mir-518a-2
Strikingly, we found that miR-199a-5p directly inhibited IL-6 and TNF-α protein expression through binding to the 3′-UTRs of the human IL-6 and TNF-α genes, thereby negatively regulating visfatin -mediated IL-6 and TNF-α expression. [score:9]
We found that visfatin markedly inhibits miR-199a-5p expression in OASFs. [score:5]
Visfatin Increases IL-6 and TNF-α Production in OASFs by Inhibiting miR-199a-5p Expression. [score:5]
In addition, treatment with ERK, p38 and JNK inhibitors reversed visfatin -mediated miR-199a-5p expression (Figure 5H). [score:5]
Our data suggest that visfatin increases IL-6 and TNF-α production by inhibiting miR-199a-5p expression. [score:5]
In conclusion, our investigations into the signaling pathway involved in visfatin -induced increases in IL-6 and TNF-α expression in human synovial fibroblasts reveal that visfatin inhibits miR-199a-5p expression through the ERK, p38 and JNK signaling pathways (Figure 6). [score:5]
Collectively, these data suggest that miR-199a-5p directly represses IL-6 and TNF-α expression via binding to the 3′-UTR region of the human IL-6 and TNF-α genes through the ERK, p38 and JNK pathways. [score:4]
Our findings show that visfatin promotes IL-6 and TNF-α production by repressing miR-199a-5p expression via the extracellular-signal-regulated kinase (ERK), p38 and c-Jun N-terminal kinase (JNK) signaling pathways. [score:4]
Furthermore, we found that visfatin enhances IL-6 and TNF-α production by inhibiting miR-199a-5p via the ERK, p38 and JNK signaling pathways in OASFs. [score:3]
The three prime untranslated region (3′-UTR) of human IL-6 and TNF-α contains a miR-199a-5p binding site. [score:3]
Stimulation of OASFs with visfatin lowered miR-199a-5p expression in a concentration -dependent manner (Figure 5B). [score:3]
Using miRNA target prediction software, we found that the 3′-UTRs of IL-6 and TNF-α mRNAs harbor potential binding sites for miR-199a-5p (Figure 5A). [score:3]
Co-transfection of cells with miR-199a-5p mimic abolished visfatin -induced increases in IL-6 and TNF-α expression. [score:3]
To learn whether miR-199a-5p regulates the 3′-UTRs of IL-6 and TNF-α, we constructed luciferase reporter vectors harboring the wild-type 3′-UTRs of IL-6 and TNF-α mRNAs (IL-6-3′-UTR-wt and TNF-α-3′-UTR-wt) and a vector containing mismatches in the predicted miR-199a-5p binding sites (IL-6-3′-UTR-mut and TNF-α-3′-UTR-mut) (Figure 5F). [score:2]
We obtained control miRNA, miR-199a-5p mimic and Lipofectamine 2000 from Life Technologies (Carlsbad, CA, USA), rabbit polyclonal antibodies for P-ERK, ERK, P-p38, p38, P-JNK, JNK, TNF-α, IL-6 and β-actin; ERK, p38, JNK and control siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA), recombinant human visfatin was purchased from PeproTech (Rocky Hill, NJ, USA). [score:1]
Further investigations confirmed the involvement of miR-199a-5p in visfatin -induced increases in IL-6 and TNF-α mRNA and protein expression; miR-199a-5p mimic reversed these increases (Figure 5C–E). [score:1]
We found that transfection with the miR-199a-5p mimic antagonized visfatin -induced increases in luciferase activity in the IL-6-3′-UTR-wt and TNF-α-3′-UTR-wt but not in the IL-6-3′-UTR-mut and TNF-α-3′-UTR-mut plasmids (Figure 5G). [score:1]
[1 to 20 of 17 sentences]
31
[+] score: 54
Among D3 UM with liver metastasis (n = 6), higher expressions of miR-149* (83.3%), miR-1238 (83.3%), miR-199a (100%); moderate expressions in miR-134 (50%), miR-214 (50.0%), while lower expressions of miR-146b (33.33%) and let-7b (25%) and negative expression in miR-143 (100%) were observed. [score:9]
Among M3 UM with liver metastasis (n = 11), higher expressions of miR-149* (72.72%), miR-1238 (100%), miR-134 (100%), miR-214 (54.54%), miR-146b (54.54%), miR-199a (100%) while moderate expression of miR-143 (45.45%) and negative expression of let-7b (100%) was observed. [score:7]
Further, gene targets prediction of the differentially expressed miRNAs revealed the negative regulation of gene lists namely (i) SMAD4, WISP1, HDAC8 and C-KIT by miR-146b, (ii) WISP1 by miR-1238, miR-134 and (iii) SMAD4 by miR-199a (Fig 4). [score:6]
Interestingly, miR-199a, another regulator of SMAD4 was also up-regulated in the present study (S6 Table). [score:5]
Among D3 UM with no liver metastasis (n = 29), higher expressions of miR-149* (72.41%), miR-1238 (86.2%), miR-199a (82.75%), miR-134 (41.37%), miR-214 (41.37%) and miR-146b (58.62%), while lower expression of miR-143 (37.93%), let-7b (13.79%) were observed (S6 Table and Fig 3). [score:5]
Among M3 UM with no history of liver metastasis (n = 40), higher expressions of miR-149* (90.0%), miR-1238 (97.5%) and miR-134 (57.5%), miR-214 (62.5%), miR-146b (67.5%), miR-143 (65.0%), miR-199a (90.0%) and lower expression of let-7b (30.0%) were observed. [score:5]
Gene target prediction revealed SMAD4, WISP1, HIPK1, HDAC8 and C-KIT as the post-transcriptional regulators of miR-146b, miR-199a, miR-1238 and miR-134. [score:4]
Among the five miRNAs previously shown as class 2 tumor discriminators [13], four up-regulated miRNAs (miR-214, miR-143, miR-146b and miR-199a) showed a significant association with M3 tumors while the other miRNA, let-7b did not show any significant association with M3 UM (Fig 3). [score:4]
Five miRNAs (miR-214, miR146b, miR-143, miR-199a and miR-134) were found to be differentially expressed in M3/ D3 UM tumors. [score:3]
Differential expression of 8 miRNAs: miR-214, miR-149*, miR-143, miR-146b, miR-199a, let7b, miR-1238 and miR-134 were studied. [score:3]
The data derived from metastasis-free survival analysis is presented in S6 Table and Fig 5. These results indicate that the expression of miR-214, miR-149*, miR-146b, miR-199a, miR-1238 and miR-134 can be used to evaluate the metastasis-free survival in UM patients. [score:1]
In the second study, 6 miRNAs (let-7b, miR-199a, miR-199a*, miR-143, miR-193b, and miR-652) were identified to differentiate class 1 and class 2 UM tumors [13]. [score:1]
Three miRNAs: miR-149*, miR-1238 and miR-134 (which were in common with supervised and unsupervised data analysis; Fig 1C) and 5 miRNAs: miR-214, miR-143, miR146b, miR-199a and let7b (earlier shown as class 1/ class 2 discriminators) [13] were selected for validation. [score:1]
[1 to 20 of 13 sentences]
32
[+] score: 53
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
This miRNA expression pattern is in accordance with published MRF expression results, potentially suggesting that changes in miR-199a-5p expression may be concomitant with the initiation of MBP expression. [score:9]
Besides having a strong target bias for C11Orf9, miR-199a-5p also has a significant bias for targetting DDR1, a tyrosine kinase receptor found to be upregulated during in vivo remyelination and in vitro oligodendrocyte differentiation [34]. [score:8]
The highly differential expression of miR-199a-5p, along with its high number of stringent evolutionarily conserved target sites to DDR1 mRNA, suggests a likely regulatory interaction involved in oligodendrocyte differentiation. [score:6]
From our top ten differentially expressed miRNAs at the early OP to mid OP stage transition, two miRNAs (miR-199a-5p and miR-145) show strong target bias towards C11Orf9. [score:5]
Interestingly, miR-199a-5p demonstrated a large decrease in expression beginning at the early OP stage and an increase at the final stage. [score:3]
However, while the increase of miR-199a-5p at the final stage corresponds with the decreased MRF expression at this transition, additional validation is necessary. [score:3]
Target predictions for miR-199a-5p showed high likelihood for C11Orf9 repressive interactions. [score:3]
Similarly, the expression pattern of miR-145 at these stages conformed to the same trend as miR-199a-5p. [score:3]
For instance, miR-145 and miR-199a-5p within our data showed similar expression patterns throughout differentiation and both contain conserved 8mer predicted seed pairings to multiple sites within the 3′-UTR of C11orf9. [score:3]
Importantly, miR-199a-5p showed a sharp ∼8.6-fold decrease in expression from the early OP to mid OP stage, followed by minimal ∼1.1-fold change during the mid OP to late OP stage transition. [score:3]
MiR-199a-5p, with a ∼8.6-fold decrease from OP1 to OP2 stage, contains four total evolutionarily conserved target sites (three 8mer, one 7mer-1A) within the 3′ UTR of DDR1 mRNA. [score:2]
Therefore, these data suggest that miR-199a-5p and miR-145 may be simultaneously regulating the human homolog of MRF. [score:2]
MiR-199a-5p has three sites with evolutionarily conserved 8mer seed matches to the 3′ UTR of C11Orf9, suggesting a high probability for miRNA-mRNA interactions. [score:1]
Then, miR-199a-5p levels rose (∼1.7 fold) at the final stage of differentiation. [score:1]
The key miRNAs discussed in this manuscript were validated by conducting real-time qRT-PCR for samples from the appropriate stages, including the following: miR-199a and miR-145 at the OP1, OP2, OP3, and OL stages; miR-214 at the OP1 and OP2 stages; miR-184 and miR-1183 at the GP and OP1 stages (Table 1 ). [score:1]
[1 to 20 of 15 sentences]
33
[+] score: 52
We initially expected to observe complementary expression patterns of miRNAs and their predicted target genes among the tissues, but in the case of miR-199a/199b/214 that had low expression in brain and PBMC compared to the rest of tissues, most predicted targets that showed brain/PBMC-specific expression only appeared in either brain or PBMC but hardly both. [score:10]
The opposite expression pattern between miR-199a/199b/214 and their 168 refined predicted targets in fetal/adult brain and non-brain tissues strongly suggested that repressed expression of these three miRNAs is important in brain development. [score:8]
For example, many predicted target genes of miR-199a/199b/214 (low expression in brain and PBMC) are required by the developing nervous and hematopoietic systems. [score:5]
We were also able to identify miRNAs with moderate to high expression in all tissues examined except for certain organs that had much lower or no expression at all, such as miR-199a/199b/214 in brain and PBMC and miR-10a/10b in brain. [score:5]
Figure 7 The list of predicted target genes for miR-199a/199b/214 was refined by their expression in 19 normal tissue types extracted fromthe GNF database. [score:5]
Complete phenotypic data extracted from IGTC for the refined list of predicted target genes of miR-199a/199b/214. [score:3]
Lower expression of miR-199a/214 was previously reported in brain than in liver, thymus, testes, and placenta by 16 to 180 folds in a study using microarrays [16]. [score:3]
Interestingly, expression of miR-199a/214 in brain compared to other major tissues was also reduced during zebrafish embryonic development [26]. [score:3]
Phenotypic data for the refined list of predicted target genes of miR-199a/199b/214. [score:3]
Click here for file Phenotypic data for the refined list of predicted target genes of miR-199a/199b/214. [score:3]
To validate the low abundance of miR-199a/199b/214 in brain, their expression was examined in 6 additional adult brain specimens (including four derived from different regions of the brain and one fetal brain specimens) and all were reproducibly lower than the other tissue types (Table 3). [score:3]
One member of the miR-199a (miR-199a-2) is located at only 5.6 kb away from miR-214, while miR-199a-1 and miR-199b are located at two separate regions with no other miRNAs nearby; miR-10a and miR-143 do not have relationship with miR-199a/199b/214 in genomic structure and were excluded from the analysis. [score:1]
[1 to 20 of 12 sentences]
34
[+] score: 47
Downregulation of these miRNAs would in turn effect the translation of mRNAs for genes such as IKK-β and BRM (possibly regulated by miR-199a-3p) and other proteins important for HTLV-1 gene expression. [score:9]
AntagomiRs used include anti-hsa-Let-7i to target p50 and p65 miRNA, anti-hsa-miR-132 to target GSK-3β miRNA, and anti-hsa-miR199a-3p to target IKK-β and BRM miRNA. [score:7]
Of particular interest are a set of cellular miRNAs, such as Let-7i, miR-199a-3p, and miR-132 that are downregulated after infection, resulting in an upregulation of cellular proteins that are known to be recruited and utilized by the HTLV-1 promoter. [score:7]
Based on three recent studies which examined expression changes of cellular miRNAs in HTLV-1 infected cell lines, we selected the downregulated miRNAs, miR-199a, miR-132, and miR-Let7i for further analysis [67], [89]– [90], [92]. [score:6]
Here the rationale was that Tax would decrease Drosha levels, resulting in downregulation of miRNA, such as Let7i, miR-199a-3p and miR-132. [score:4]
In ovarian cancer cells, miR-199a-3p has been shown to regulate IKK-β to affect NF-κB activity as well as targeting the SWI/SNF subunit BRM in a variety of human cancers [93]– [94]. [score:4]
HTLV-1 infection results in a dramatic up (i. e. miR-130b, miR-18a, miR-20b) and downregulation (i. e. Let-7i, miR-132, miR-199a) of many host cellular miRNAs [67]. [score:4]
AntagomiRs were obtained from Qiagen as follows: miScript miRNA inhibitor Anti-hsa-let-7i (Catalog # MIN0000415), Anti-hsa-miR-199a-3p (Catalog # MIN0000232), and Anti-hsa-miR-132 (Catalog #MIN0000426). [score:3]
B) 293T cells were transfected with Tax (5 µg) or antagomiRs (100 nM) targeting miR-199a-3p, miR-132, or Let7i. [score:3]
[1 to 20 of 9 sentences]
35
[+] score: 46
d Main pathway influenced by genes targeted by miR-199a-5p, and miR-22 KEGG pathway analysis showed that the predicted target genes related to miR-98, miR-375, and miR-335 were involved in cytokine-cytokine receptor interaction, calcium signaling pathway, glycan structures - biosynthesis 1, melanoma, and Wnt signaling pathway (Fig.   3c), whereas the predicted target genes of miR-199a-5p and miR-22 were related to MAPK signaling pathway, chronic myeloid leukemia, melanogenesis, insulin signaling pathway, and prostate cancer (Fig.   3d). [score:7]
d Main pathway influenced by genes targeted by miR-199a-5p, and miR-22 KEGG pathway analysis showed that the predicted target genes related to miR-98, miR-375, and miR-335 were involved in cytokine-cytokine receptor interaction, calcium signaling pathway, glycan structures - biosynthesis 1, melanoma, and Wnt signaling pathway (Fig.   3c), whereas the predicted target genes of miR-199a-5p and miR-22 were related to MAPK signaling pathway, chronic myeloid leukemia, melanogenesis, insulin signaling pathway, and prostate cancer (Fig.   3d). [score:7]
b Relationships among target genes predicted by miR-199a-5p and miR-22 Fig. 3GO and pathway analysis results of the target genes predicted by differentially expressed miRNAs in HBV infection. [score:7]
d Main pathways influenced by genes targeted by two or more miRNAs from miR-19b, miR-101, and miR-199a-5p Pathway analysis showed that the predicted target genes related to miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p were involved in regulation of actin cytoskeleton, focal adhesion, MAPK signaling pathway, calcium signaling pathway, and axon guidance (Fig.   5c). [score:6]
d Main pathways influenced by genes targeted by two or more miRNAs from miR-19b, miR-101, and miR-199a-5p Pathway analysis showed that the predicted target genes related to miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p were involved in regulation of actin cytoskeleton, focal adhesion, MAPK signaling pathway, calcium signaling pathway, and axon guidance (Fig.   5c). [score:6]
MiR-199 targets hepatocyte growth factor receptor, mammalian target of rapamycin (mTOR), and hypoxia-inducible factor (HIF1α), thereby regulating receptor tyrosine kinase and mTOR activation [15]. [score:5]
In the same way, the processes targeted by miR-199a-5p and miR-22 were cellular response to starvation, fructose 2, 6-bisphosphate metabolism, central nervous system projection neuron axon genesis, neuron migration, and dendrite morphogenesis (Fig.   3b). [score:3]
b Main biological processes influenced by genes targeted by miR-199a-5p, and miR-22. [score:3]
Five miRNAs (miR-98, miR-375, miR-335, miR-199a-5p, and miR-22) matched the criterion. [score:1]
Eight miRNAs (miR-223, miR-98, miR-15b, miR-199a-5p, miR-19b, miR-22, miR-451, and miR-101) were involved in HBV-unrelated HCC, 5 miRNAs (miR-98, miR-375, miR-335, miR-199a-5p, and miR-22) were involved in HBV infection, and 7 miRNAs (miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p and miR-92b) were specifically altered in HBV-related HCC. [score:1]
[1 to 20 of 10 sentences]
36
[+] score: 42
miR-199a can downregulate mTOR (mechanistic Target of Rapamycin), c-MET (protein encoded by the MET gene), and its downstream effector ERK2, thus inhibiting cell proliferation, motility, and the invasive capabilities of tumor cells [22, 23]. [score:8]
The target sequence for miR-199a-3p also targets miR-199a1, miR199-a2, and miR-199b, whereas the target sequence against miR-199a-5p only binds to miR-199a1 and miR-199a2. [score:7]
In the lung metastases, miR-199-3p showed a 14-fold and miR-199-5p showed a 25-fold upregulation in the stroma compartment compared to the tumor compartment (p < 0.0001) and a 5-fold (miR199-3p; p = 0.03) and 9-fold (miR-199-5p; p = 0.0004) upregulation compared to the normal lung tissue. [score:5]
miR-199-3p and miR-199-5p were 500-fold upregulated in the stroma compartment of the liver metastases compared to the tumor compartment (p < 0.0001), respectively, but did not show a significant upregulation compared to the normal liver tissue. [score:5]
Both miR-125 and miR-199a were shown to inhibit angiogenesis through decreased expression of HIF‑1a (Hypoxia-inducible factor 1-alpha) and VEGF (Vascular Endothelial Growth Factor) in ovarian cancer [24]. [score:5]
It remains speculative but those data might explain why an increased expression of miR-199-3p in the stromal compartment is associated with a better clinical outcome. [score:3]
Intriguingly, we found that the expression of miR-199-3p in the stromal compartment of liver metastases was significantly associated with an improved survival (p = 0.05; Table 4). [score:3]
Kim S. Lee U. J. Kim M. N. Lee E. -J. Kim J. Y. Lee M. Y. Choung S. Kim Y. J. Choi Y. -C. MicroRNA miR-199a* Regulates the MET Proto-oncogene and the Downstream Extracellular Signal-regulated Kinase 2 (ERK2) J. Biol. [score:3]
Fornari F. Milazzo M. Chieco P. Negrini M. Calin G. A. Grazi G. L. Pollutri D. Croce C. M. Bolondi L. Gramantieri L. miR-199a-3p Regulates mTOR and c-Met to Influence the Doxorubicin Sensitivity of Human Hepatocarcinoma Cells Cancer Res. [score:2]
The final selection of miRNAs for further analysis consisted of 11 miRNAs: miR-19b, miR-21, miR-125b, miR-127-3p, miR-145, miR-192, miR-194, miR-199a-3p, miR-199a-5p, miR-215, and miR-429. [score:1]
[1 to 20 of 10 sentences]
37
[+] score: 36
In conclusion, a more sensible and specific quantification of miRNAs by absolute Q-PCR analysis highlighted common up-regulation of miR-206, miR-223, miR-199a-5p, miR-199b*, miR-27a, miR-128a, miR-31 and miR-142-5p, and down-regulation of miR-17 in dystrophic fibres isolated from TA, DIA and VA of the adult mdx mouse (Figure S1). [score:7]
Absolute quantification confirmed common up-regulation of miR-206, miR-199a-5p, miR-223 and miR-199b* in all mdx single fibres tested (Figure S1). [score:4]
In the case of the FRG1 over -expressing mice, only 4 of the tested miRNAs were found over-expressed in all muscle analyzed (miR-206, miR-223, miR-199a-5p and miR-199b), while the remaining 10 miRNAs showed a heterogeneous behaviour depending on the muscle considered. [score:4]
Data obtained evidenced a group of miRNAs whose expression does not change during muscle repair afterwards acute damage (miR-15b, miR-17, miR-128a, miR-221, miR-199a-5p miR-199b and miR-199b*) (Table 1), and a group of miRNAs that are triggered afterwards CTX delivery (miR-206, miR-31, miR-21, miR-335-5p, miR-27a, miR-142-5p and miR-223) (Table 1), suggesting major involvement of the latter in muscle regeneration. [score:3]
Dystrophic muscle fibres isolated from different animal mo del of MDs were commonly characterized by the over -expression of several miRNAs (miR-15b, miR-21, miR-27a, miR-31, miR-128a, miR-142-5p, miR-199a-5p, miR-199b, miR199b*, miR-206, miR-221, miR-223 and miR-335-5p) with an expression profile strictly dependent on muscle impairment and damage accumulation (Figure 7). [score:3]
We identify fourteen miRNAs associated to dystrophic fibres (miR-15b, miR-17, miR-21, miR-27a, miR-31, miR-128a, miR-142-5p, miR-199a-5p, miR-199b, miR199b*, miR-206, miR-221, miR-223 and miR-335-5p) that may mediate muscle regeneration and remo delling in animal mo dels of MDs and acute muscle damage, and confirm over -expression of the previously identified regeneration -associated myomiR-206. [score:3]
The expression levels of miR-21, miR-142-5p, miR-199a-5p, miR-199b*, miR-206, miR-223 and miR-335-5p were instead strictly related to the type of muscle considered, underling a relationship with muscle-type dependent impairment (Figure 2B). [score:2]
Fourteen miRNAs were found dysregulated in dystrophic muscle fibres of the mdx mouse with differences linked to the originating muscle (miR-206, miR-199a-5p, miR-223, miR-199b, miR-199b*, miR-21, miR-221, miR-17, miR-15b, miR-31, miR-128a, miR-142-5p, miR-335-5p and miR-27a). [score:2]
Otherwise the expression profile of miR-15b, miR-221, miR-21, miR-199a and miR-335-5p was strictly related to the muscle-type considered (Figure S1). [score:2]
Otherwise, single muscle fibres isolated from lower affected TA and VA of the mdx mouse were respectively associated to 7 (miR-206, miR-199a-5p, mir-223, mir-199b, miR-199b*, miR-21 and miR-221) and 5 (miR-206, miR-199a-5p, mir-223, mir-199b and miR-199b*) dysregulated miRNAs (Figure 1). [score:2]
The only exceptions are represented by miR-206, miR-199a-5p and miR-17 whose dysregulation depended on the muscle considered (Figure 3A). [score:1]
In agreement with data already published characterizing the miRNome of mdx and DMD muscle [15], [16], [17], the over -expression of several miRNAs (miR-21, miR-31, miR-199a-5p, miR-199b, miR-142-5p, miR-221, miR-223 and miR-335-5p) was confirmed in murine dystrophic single muscle fibres. [score:1]
In support to this: miR-335 and miR-21 were found in human mesenchymal stromal cells [50] and in mesenchymal stem cells (MSCs) together with miR-21, miR-27a, miR-128a, miR-199b [51] miR-15b, miR-17, miR-21, miR-27a, miR-31, miR-199a, miR-199b, miR-221 and miR-335-5p were found in MSCs and in MSC secreted microparticles [49], [52], [53]. [score:1]
The array analysis evidenced a dystrophic miRNA-signature not dependent to the muscle type of origin which include the regeneration -associated miR-206; miR-199a-5p, miR-199b, miR-199b* and miR-223. [score:1]
[1 to 20 of 14 sentences]
38
[+] score: 36
Of 29 miRs, they showed that only 4 (miR-141, miR-200a, miR-200b, and miR-200c) were upregulated and 25 were downregulated, including miR-199a, miR-140, miR-145, and miR-125b-1 in the cancer samples [21]. [score:7]
In ovarian cancer, 11 miRs were upregulated (miR-16, miR-20a, miR-21, miR-23a, miR-23b, miR-27a, miR-93, miR-141, miR-200a, miR-200b, and miR-200c) and 12 were downregulated (miR-10b, miR-26a, miR-29a, miR-99a, miR-100, miR-125a, miR-125b, miR-143, miR-145, miR-199a, miR-214, and let-7b). [score:7]
Joshi et al. found that the expression of miR-199a is reduced in cancer cells by hypoxic stimuli, and exogenous expression of miR-199a decreased cell migration and metastasis of ovarian cancer cells by targeting the 3′-UTRs of HIF-1 α and HIF-2 α [67]. [score:7]
miR-199a also targets CD44 to suppress the tumorigenicity and multidrug resistance of ovarian cancer-initiating cells [64]. [score:5]
Similarly, miR-125b and miR-199a were also shown to act as tumor suppressors by targeting HIF-1 α and VEGF in ovarian cancer cells, consequently reducing angiogenesis [82]. [score:5]
Chen et al. discovered that miR-199a regulates IKK expression, which modulates the inflammatory microenvironment in ovarian cancer [62]. [score:4]
6.2. miR-199/214 Cluster. [score:1]
[1 to 20 of 7 sentences]
39
[+] score: 34
Table 1 MicroRNAs involved in regulating HIFs and HIF regulatory gene levels in ECs miRNA Cell type Impact of hypoxia on miRNA expression miRNA target (s) (direct or indirect*) Investigated processes miR-18a Choroidal endothelial cells Upregulated HIF1A Proliferation migration[116] miR-107 Endothelial progenitor cells—EPCs Upregulated ARNT Differentiation[121] miR-135b HUVECs Upregulated HIF1AN Angiogenesis[124] HIF1A* miR-155 Mouse skin endothelial SENDs cells and HUVECs Upregulated HIF1A Angiogenesis hypoxia[108] miR-199a Endometrial stromal cells; endothelial EA. [score:19]
The polymorphism in the miR-199a target site in HIF1A sequence is associated with pancreatic ductal adenocarcinoma risk [122], whereas forced overexpression of miR-199a in endometrial stromal cells (ESCs) attenuated HIF1A’s angiogenic potential during hypoxia via targeting both VEGFA and HIF1-α in these cells [123]. [score:7]
Finally, if a mutation creates a new miRNA binding site that results in lower expression of an important gene, as in the case of the HIF-1α/miR-199a [122] polymorphism, treatment could occur by protecting this new mutant target site [164]. [score:6]
Unfortunately, however, the changes in physiological levels of miR-199a under normoxia and hypoxia in these cells were not determined [123]. [score:1]
Therefore, the possible physiological effects of miR-199a on HIF-1α in ECs will require further studies. [score:1]
[1 to 20 of 5 sentences]
40
[+] score: 33
The miRNAs with the most significant differences in expression levels mirrored those observed in the primary group: miR-24, miR-223, miR-27b and miR-199a (Fig.   2). [score:3]
Five of them differed between HNF1A-MODY and HNF1B-MODY, and, amongst those, four (miR-24, miR-27b, miR-223 and miR-199a) showed HNF1B-MODY-specific expression levels in the replication group. [score:3]
Expression levels of: (c) miR-24 ΔC [t]; (d) miR-223 ΔC [t]; (e) miR-27b ΔC [t]; (f) miR-199a ΔC [t]; (g) miR-32 ΔC [t]; (h) miR-23a ΔC [t]; (i) miR-423 ΔC [t]; (j) miR-145 ΔC [t]. [score:3]
Among the 11 differentially expressed miRNAs (significant in ANOVA), eight differed significantly between HNF1B-MODY and at least one of the other groups (miR-32, miR-223, miR-23a, miR-199a, miR-27b, miR-24, miR-145 and miR-423; ESM Table 3). [score:3]
Linking miRNA and effector pathways in our study was based on bioinformatic predictions; however, a recent study on chromatin immunoprecipitation (ChIP) of HNF1β published by Hajarnis et al (deposited as GSE71250 in the Gene Expression Omnibus database) showed that miR-223 indeed has a strong HNF1β -binding site in its promoter region, while the intragenic miR-199a has an HNF1β -binding site in the promoter of the dmm-2 gene [33]. [score:3]
Significant differences in covariate-adjusted expression levels were noted for miR-24 (p = 0.0072), miR-223 (p = 0.0184), miR-27b (p = 0.0107) and miR-199a (p = 0.0435; ESM Fig.   1). [score:3]
The most striking differences were found between the HNF1B-MODY and HNF1A-MODY groups, evidenced by lower expression levels of miR-223, miR-24, miR-27b and miR-199a in the former. [score:3]
In conclusion, we have shown that expression of the circulating miRNAs miR-24, miR-223, miR-27b and miR-199a depends on HNF1β function, making them potentially applicable in the diagnosis of HNF1B-MODY. [score:3]
Brackets are used to connect the groups with significant (p < 0.05) pairwise differences; [†] p = 0.07; exact p values are shown in ESM Table  4 Afterwards, we measured the impact of siRNA -induced knockdowns of HNF1α and HNF1β on the expression levels of miR-24, miR-223, miR-27b and miR-199a in human hepatocytes (HepG2). [score:2]
Significance criterion was met by 11 distinct miRNAs: miR-223, miR-24, miR-99b, miR-423, miR-92a, miR-27b, miR-23a, miR-199a, miR-101, miR-145 and miR-32; these are presented on a hierarchical cluster heatmap in Fig.   1b. [score:1]
Fig. 2Comparisons of serum miRNA levels in the UK group: (a) miR-24; (b) miR-223; (c) miR-27b; (d) miR-199a. [score:1]
The silencing of HNF1A significantly decreased levels of miR-24, miR-27b and miR-199a, and had no effect on the miR-223 content in HepG2 cells (Fig.   3d). [score:1]
AU, arbitrary units These data suggest that serum levels of miR-24, miR-223, miR-27b and miR-199a associated with HNF1B dysfunction might reflect changes in intracellular miRNA profile in the liver. [score:1]
miR-24, miR-223, miR-23 and miR-199a show 100% conservation of seed region sequences between humans and mice [23]. [score:1]
Interestingly, another study also showed that miR-223 and miR-199a are dependent on liver function [32], supporting our assumption that the most significant impact of an HNF1A or HNF1B defect would be manifested predominantly via hepatic function disruption rather than by beta cell -associated effects. [score:1]
Silencing of HNF1B in human hepatocytes significantly decreased intracellular levels of miR-24, miR-27b, miR-199a and miR-223. [score:1]
[1 to 20 of 16 sentences]
41
[+] score: 33
Particularly, they demonstrated that miR-199a-3p inhibits not only proliferation, but also motility and invasive capabilities of tumor cells by downregulating both c-Met and its downstream effector ERK2 [31]. [score:6]
Minna and colleagues reported downregulation of miR-199a-3p in papillary thyroid cancer (PTC) specimens and cell lines, and demonstrated that its restoration in PTC cells reduces c-Met and mTOR protein levels, impairing migration and proliferation and, more interestingly, inducing lethality through an unusual form of cell death similar to methuosis, caused by macropinocytosis dysregulation, unveiling interesting networks including HGF and macropinocytosis pathways [32]. [score:5]
Duan Z. Choy E. Harmon D. Liu X. Susa M. Mankin H. Hornicek F. MicroRNA-199a-3p is downregulated in human osteosarcoma and regulates cell proliferation and migration Mol. [score:4]
The miR-199–miR-214 cluster is of particular interest because it is downregulated in the majority of hepatocellular carcinomas (HCCs) [25, 26], bladder [27], ovarian [28], and renal carcinomas [29] and in cancer-derived cell lines in experimental neoplastic and preneoplastic conditions [30]. [score:4]
Kim S. Lee U. J. Kim M. N. Lee E. J. Kim J. Y. Lee M. Y. Choung S. Kim Y. J. Choi Y. C. MicroRNA miR-199a* regulates the MET proto-oncogene and the downstream extracellular signal-regulated kinase 2 (ERK2) J. Biol. [score:3]
Both Kim and Migliore identified the c-Met proto-oncogene as a target of the miR-199a-3p [18, 31]. [score:3]
Huang J. Dong B. Zhang J. Kong W. Chen Y. Xue W. Liu D. Huang Y. miR-199a-3p inhibits hepatocyte growth factor/c-Met signaling in renal cancer carcinoma Tumour Biol. [score:3]
It was recently reported that serum concentration of HGF, the c-Met receptor ligand, was significantly elevated in renal cell carcinoma (RCC) patients compared to healthy individuals, thereby suggesting that miR-199a-3p impairs HGF/c-Met signaling pathway, including STAT3, mTOR and ERK1/2, which is crucial for RCC development, thus also suggesting that this miR may serve as a potential target for RCC therapy [29]. [score:3]
2.2. miR-199a-3p. [score:1]
Fornari F. Milazzo M. Chieco P. Negrini M. Calin G. A. Grazi G. L. Pollutri D. Croce C. M. Bolondi L. Gramantieri L. MiR-199a-3p regulates mTOR and c-Met to influence the doxorubicin sensitivity of human hepatocarcinoma cells Cancer Res. [score:1]
[1 to 20 of 10 sentences]
42
[+] score: 31
miRNA target has-miR302a MECP2 hsa-miR29a TET1, TET2, TET3 has-miR29a/c DNMT3A, DNMT3B has-miR29b-1/2 DNMT1 (Indirect via SP1) hsa-miR148a DNMT3B hsa-miR148a DNMT1 hsa-miR152 DNMT1 has-miR302a DNMT1 (Indirect via AOF2) hsa-miR342 DNMT1 hsa-miR17-92 DNMT1 hsa-miR26a-1/2 EZH2 hsa-miR101-1/2 EZH2/EED hsa-miR214 EZH2 hsa-miR128-1/2 BMI-1 hsa-miR199a-1/2 BRM hsa-miR433 HDAC6 hsa-miR449a HDAC1 hsa-miR138 SIRT1In the first column we report a list of miRNAs which are known to target epigenetic regulators and in the second column the corresponding targets. [score:10]
This toggle switch is known to play an important role in several types of cancer leading to different cell populations during oncogenesis, thus explaining why mir-199 had been reported as an ambiguous marker in several types of cancer, being either upregulated or downregulated in different samples of the same tumor. [score:7]
One of them is the Brm gene (also known as Smarca2) whose translation is controlled by mir-199 (Sakurai et al., 2011). [score:3]
MicroRNAs miR-199a-5p and-3p target the Brm Subunit of SWI/SNF to generate a double -negative feedback loop in a variety of human cancers. [score:3]
Interestingly, the 3′UTR region of Brm is targeted by both the mature versions of mir-199, i. e., mir-199-3p and mir-199-5p (Sakurai et al., 2011). [score:3]
In turn Brm is able to silence the mir-199, mir-214 cluster by silencing Egr1 which is known to be a strong activator of the cluster (Sakurai et al., 2011), thus closing in an indirect way a double negative feedback loop between Brm and mir-199. [score:2]
It is located at less than 5kb of distance from another important miRNA: mir199a which, remarkably enough, is involved in another epigenetic feedback loop (Section 4.2.3). [score:1]
However, it is deeply linked with the previous ones, since mir-199 is located in the same cluster of mir214 and is known to form a common precursor with mir-214 (Loebel et al., 2005), and is thus controlled by the same PRC2 complex discussed in the previous examples. [score:1]
The BRM - mir199 loop. [score:1]
[1 to 20 of 9 sentences]
43
[+] score: 31
This study identified 68 up-regulated and 2 down-regulated miRNAs between the ISCCs and normal epithelial tissues, with miR-199s, miR-9, miR-199a*, miR-199a, miR-199b, miR-145, miR-133a, miR-133b, miR-214 and miR-127 being among the miRNAs most overexpressed. [score:9]
Among the down-regulated miRNAs was miR-199a, which is also down-regulated in hepatocellular carcinoma [27] and ovarian cancer [28]. [score:7]
At least eight miRNAs showed significant down-regulation between normal cervical samples and the pre-neoplasic and neoplasic samples, namely miR-143, miR-145, miR-99a, miR-26a, miR-203, miR-513, miR-29a and miR-199a. [score:4]
This contradicts data from a recent cervical cancer study, which showed that miR-199a was up-regulated in early stage invasive squamous cell carcinomas [18]. [score:4]
Eight miRNAs exhibited relative decreased expression with transition from normal cervix to atypical dysplasia to cancer (miR-26a, miR-143, miR-145, miR-99a, miR-203, miR-513, miR-29a, miR-199a) (Figure 4A). [score:3]
The same study showed that an anti-miR-199a inhibits cell growth, suggesting that miR-199a can promote cell proliferation. [score:3]
Regarding the canonical pathways, there was less consistency, with Wnt/β-catenin signaling found three times (miR-145, miR-199a and miR-132). [score:1]
[1 to 20 of 7 sentences]
44
[+] score: 30
Shi Y. Song Q. Yu S. Hu D. Zhuang X. Microvascular invasion in hepatocellular carcinoma overexpression promotes cell proliferation and inhibits cell apoptosis of hepatocellular carcinoma via inhibiting miR-199a expression Onco Targets Ther. [score:11]
Furthermore, they found that lnc-MC was able to downregulate miR-199a-5p, which resulted in increased activin A receptor type IB (ACVR1B) expression. [score:6]
Shi et al. looked at microvascular invasion in hepatocellular carcinoma (MVIH), a lncRNA aberrantly expressed in HCC, and found that it was capable of inhibiting miR-199a (Figure 1). [score:5]
Specifically, DANCR was found to block the repressing effect of miR-214, miR-320a, and miR-199a on CTNNB1, which resulted in the upregulation of this gene (Figure 1). [score:4]
In fact, both the luciferase reporter and RNA immunoprecipitation experiments showed that miR-199a was able to directly bind with MVIH RNA [43]. [score:2]
1/lnc-MC and miR-199a-5p. [score:1]
Lnc-MC was shown to facilitate the process of monocyte/macrophage differentiation, while miR-199a-5p was shown to impair differentiation. [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 27
Other miRNAs from this paper: hsa-mir-21, hsa-mir-199a-2, hsa-mir-1-2, hsa-mir-1-1
The major finding was that CC2238/αANP induced Apolipoprotein E (ApoE) downregulation through NPR-C -dependent mechanisms involving the upregulation of miR199a-3p and miR199a-5p and the downregulation of DnaJ (Hsp40) homolog (DNAJA4). [score:10]
This set of in vitro data provided the first original demonstration that CC2238/αANP, through NPR-C -dependent activation of Egr-1 and the consequent upregulation of miR199a, downregulates ApoE in vascular smooth muscle cells. [score:7]
Of note, the upregulation of miR199a by NPR-C was mediated by a ROS -dependent increase of early growth response protein-1 (Egr-1) transcription factor. [score:4]
In fact, Egr-1 knockdown abolished the impact of CC2238/αANP on ApoE and miR199a. [score:2]
The relevance of an epigenetic regulation underlying some of the vascular effects of CC2238/αANP was later on reinforced by additional findings on the role of microRNA-199a (miR199a) in the same cell line [45]. [score:2]
Interestingly, the findings describe for the first time the cAMP-PKA axis as the one driving all other signaling events stemming from CC2238/αANP, such as the CREB-miR21and the Egr-1-miR199a-ApoE pathways in smooth muscle cells, NADPH increase, and particularly Nox2 increase in platelets (Figure 1). [score:1]
Stanzione R. Sciarretta S. Marchitti S. Bianchi F. Di Castro S. Scarpino S. Cotugno M. Frati G. Volpe M. Rubattu S. C2238/αANP modulates Apolipoprotein E through Egr-1/miR199a in vascular smooth muscle cells in vitroCell Death Dis. [score:1]
[1 to 20 of 7 sentences]
46
[+] score: 26
Interestingly, several potential interactions between 8 up-regulated miRNAs and 6 down-regulated aquaporins (AQPs) genes were observed for examples: miR-199a-5p, -214 and -503 can anneal to Aqp1 and Aqp12a with octamer seeds; and Aqp4 has multiple 9nt long binding sites for miR-132. [score:7]
Moreover, three miRNAs (miR-199a-5p, -214 and -132) were predicted to anneal within 3′-UTR of Rb1 (down-regulated) which is also a cell cycle inhibitor. [score:6]
For example, the putative seeds of miR-199a-5p (9nt long seed) and miR-34a (7nt long seed) within 3′-UTR region of p27 (Cdkn1b) suggest the possibility that this gene may be down-regulated by these 2 miRNAs in PKD. [score:4]
Taqman assays showed increased expression of rno-miR-199a-5p, -214, -146b and -31 in diseased kidneys (Figure 4 ). [score:4]
Of note, Ift88 and Ift122 were determined as the possible targets of rno-miR-199a-5p and -214. [score:3]
The rno-miR-199a-5p/214 transcript was previously reported during development [46] and epithelial ovarian cancer cells [47]. [score:2]
[1 to 20 of 6 sentences]
47
[+] score: 26
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
The oncomiR miR-199a was shown to significantly inhibit SMAD4, thereby inhibiting TGF-β1 signaling control over cell proliferation and apoptosis, and promoting anchorage-independent growth in soft agar [39, 58, 62, 63, 64, 65]. [score:5]
In GC, high expression of miR-195 [58], miR-199a [39, 58, 62, 63, 64, 65], miR-1952 [58], miR-335 [82, 83], miR-375 [39, 74, 86, 87, 88], miR-451 [58, 94, 95, 96] and miR-4512 [39], and low expression of miR-142-5p [39] are more likely to indicate relapse or recurrence of GC patients. [score:5]
Zhang Y. Fan K. J. Sun Q. Chen A. Z. Shen W. L. Zhao Z. H. Zheng X. F. Yang X. Functional screening for miRNAs targeting Smad4 identified miR-199a as a negative regulator of TGF-beta signalling pathway Nucleic Acids Res. [score:4]
Zhao X. He L. Li T. Lu Y. Miao Y. Liang S. Guo H. Bai M. Xie H. Luo G. SRF expedites metastasis and modulates the epithelial to mesenchymal transition by regulating miR-199a-5p expression in human gastric cancer Cell Death Differ. [score:4]
Song G. Zeng H. Li J. Xiao L. He Y. Tang Y. Li Y. miR-199a regulates the tumor suppressor mitogen-activated protein kinase kinase kinase 11 in gastric cancer Biol. [score:4]
Sakurai K. Furukawa C. Haraguchi T. Inada K. Shiogama K. Tagawa T. Fujita S. Ueno Y. Ogata A. Ito M. MicroRNAs miR-199a-5p and-3p target the Brm subunit of SWI/SNF to generate a double -negative feedback loop in a variety of human cancers Cancer Res. [score:3]
Li C. Li J. F. Cai Q. Qiu Q. Q. Yan M. Liu B. Y. Zhu Z. G. miRNA-199a-3p in plasma as a potential diagnostic biomarker for gastric cancer Ann. [score:1]
[1 to 20 of 7 sentences]
48
[+] score: 25
Among the remaining seven predictions, six were validated by more recent studies: miR-92a was determined to directly target the anti-apoptosis molecule BCL-2-interacting mediator of cell death (BIM) in CN tissues and an anti-miR-92a antagomir led to the apoptosis of CN cell lines [67]; overexpressed miR-199a-3p (the 3p arm of the pre-miRNA for miR-199a) contributed to the late TNM stage in CN and transfecting miR-199a-3p inhibitor into CN SW480 cells could significantly limit the cell proliferation [68]; miR-142-3p (the 3p arm of the pre-miRNA for miR-142) functioned as a CN suppressor through targeting CD133, leucine-rich-repeat-containing G-protein-coupled receptor 5 (Lgr5) and ATP binding cassette (ABCG2) [69]; miR-146b enhanced the proliferation of CN by targeting the calcium-sensing receptor (CaSR) and impairing the anti-proliferative and pro-differentiating actions of calcium [70]; miR-150 was found to be a tumor suppressor in CN by targeting c-Myb [71]; overexpressed miR-122 and its concomitantly suppressed target gene, cationic amino acid transporter 1 (CAT1), would contribute to the development of CN liver metastasis [72]. [score:25]
[1 to 20 of 1 sentences]
49
[+] score: 24
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-203b
Moreover, HERV-K mRNA expression was significantly inversely associated with BCL2 mRNA expression (r [S] = -0.408; p = 0.0002) and miR-199a (r [S] = 0.361; p = 0.0004) expression, while solely HERV-F expression was significantly associated with miR-203 expression (r [S] = 0.333; p = 0.005). [score:11]
Furthermore, as a secondary end point we analyzed the correlation of the mRNA expression of HERV-K and HERV-F with the RNA expression of known apoptosis-related [B-cell cll/lymphoma 2 (BCL2)] or hypoxia-related (miR-210, miR-199a, Hypoxia inducible factor 1a) genes as well as known epigenetically regulated genes (miR-203, H2A. [score:6]
miR-199a-5p regulates HIF-1α and OSGIN2 and its expression is correlated to soft-tissue sarcoma patients’ outcome. [score:4]
Expression analyses for BCL2 mRNA, miR-203 and miR-210 (Greither et al., 2012), HIF-1α mRNA (Kessler et al., 2010) and miR-199a (Keßler et al., 2016) were carried out as previously described. [score:3]
[1 to 20 of 4 sentences]
50
[+] score: 24
Ectopic up-regulation of miR-199a-5p/E2F3 contributed to the inhibition of invasion and migration in HCC, accounting for the anti-tumor effect of PPIX [53]. [score:6]
In HCC, miR-199a-5p levels were down-regulated accompanied by E2F3 overexpression. [score:6]
After PPIX treatment, miR-199a-5p was modulated to increase and led to the inhibition of E2F3 expression [53]. [score:5]
In HCC, PPIX was testified to inhibit mesenchymal tumor angiogenesis, depending on the increase of miR-199a-5p by targeting E2F3 [53]. [score:5]
PPIX, regulating miR-199a-5p/E2F3, prevented tumor cell growth and migration of tumor cells and sensitized mesenchymal hepatoma cells to chemotherapeutic agents [53]. [score:2]
[1 to 20 of 5 sentences]
51
[+] score: 24
Thus, downregulation of miR-199a-3p and miR-199b-3p might be a part of the regulatory changes leading to increased proliferation of HCC cells. [score:5]
When performing standard pathway analysis for miR-199a-3p and miR-199b-3p, no cancer -associated pathways were enriched (human, TargetScan). [score:3]
0151771.g002 Fig 2 (A) Targets of miR-199a/b-3p in the human KEGG Actin Cytoskeleton pathway (red). [score:3]
While the function of miR-199a-3p and miR-199b-3p is not fully defined, they target members of Raf/MEK/ERK signaling [23]. [score:3]
Our novel methodology with tissue filter suggested a role of miR-199a/b-3p in cell migration, EMT and ultimately metastasis through regulation of cytoskeleton. [score:2]
The liver filter thus identified the known association of miR-199a-3p and miR-199b-3p with Raf/MEK/ERK signaling through associated regulatory pathways. [score:2]
Interestingly, the involvement of miR-199a/b-3p in cell migration and EMT has been described in other tissues [25, 26]. [score:1]
2011.01.001 24 Callegari E, Elamin BK, D’Abundo L, Falzoni S, Donvito G, Moshiri F, et al Anti-tumor activity of a miR-199 -dependent oncolytic adenovirus. [score:1]
First, we analyzed miR-199a-3p and miR-199b-3p. [score:1]
We used our new methodology to first analyze the role of miRNAs in hepatocellular carcinoma and identified the liver-specific effect of miR-199a/b-3p on pathways associated with proliferation and cell migration, a novel function that a recent study proposed. [score:1]
Indeed, a recent study indicates a role for miR-199a/b-3p in HCC proliferation [27]. [score:1]
The decrease of miR-199a/b-3p in HCC might increase metastatic potential in HCC. [score:1]
[1 to 20 of 12 sentences]
52
[+] score: 24
The third category had a high expression level on day 1 and down-regulated expression on day 7, and included miR-132, miR-186, miR-199, miR-338, and miR-219. [score:8]
Expression levels of the other miRNAs were calculated as fold changes based on the miR-214 expression level of 1. miR-148, miR-494, miR-124, miR-193, and miR-300 showed increased expression levels from day 1 to 7. miR-148 showed very high expression levels (2272 to 6517 fold changes compared with that of miR-214) (Figure 3B), while miR-132, miR-186, miR-199, miR-338, and miR-219 showed decreased expression from day 1 to 7 (Figure 3C). [score:8]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG We have previously shown that miR-124 is expressed in human core blood hematopoietic progenitor cells (HPCs) and it specifically binds to the Tip110 3′UTR and has a regulatory effect on core blood HPCs [7]. [score:4]
Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
Figure 3Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
| | | | | | |3′ UCGGGUUUUCCUCUUAAGAAACPosition 931–951 of Tip110 3′UTRHsa-miR-199a-5p5′. [score:1]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG (A) Schematic of the Tip110 3′UTR region with predicted miRNA binding sites (Tip110 miRNA). [score:1]
[1 to 20 of 7 sentences]
53
[+] score: 24
We found that miR-199a, a miRNA upregulated in human breast CSCs, targets Snail and suppresses its expression [164]. [score:10]
Because miR-199a is highly upregulated and miR-182 is downregulated in human breast CSCs and mammary stem/progenitor cells, it is possible that miRNAs function as epigenetic regulators of the EMT transcription factors Snail and Slug to regulate the stem cell abilities of breast CSCs and normal mammary stem/progenitor cells. [score:9]
miR-199a suppresses the expression of FOXP2 and promotes breast cancer CSC propagation, tumor initiation, and metastasis [183]. [score:5]
[1 to 20 of 3 sentences]
54
[+] score: 23
Of the other six differentially expressed miRNAs in the sequencing experiment, mir-199a-5p, which was significantly down regulated in obese subjects in the sequencing data, was also down regulated when assessed by qPCR, but did not reach significance. [score:5]
MicroRNAs miR-96, miR-124, and miR-199a regulate gene expression in human bone marrow-derived mesenchymal stem cells. [score:4]
An exception from this general trend was mir-199-5p which was not significantly differentially expressed in the qPCR study. [score:3]
For the males we found 7 differentially expressed miRNAs, two of which (mir-9-1-3p and mir-199a-5p) overlap with the analysis of the combined dataset. [score:3]
Differential expression in the sequencing data from the lean and obese pigs was calculated using the DESeq2 package in R and revealed six significantly differentially expressed miRNAs between the two groups: mir-9-5p, mir-124a-3p, mir-9-3p, mir-199a-5p, mir-489-3p and mir-34c-3p. [score:3]
Mir-199a-5p has been identified as differentially expressed in subcutaneous adipose tissue from humans, where it was up regulated in obesity [64]. [score:3]
The other mature arm of mir-199a, mir-199a-3p, has been identified as down regulated upon weight loss in morbidly obese human patients [65]. [score:2]
[1 to 20 of 7 sentences]
55
[+] score: 22
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Out of the 114 differentially expressed miRNAs, the only 10 upregulated miRNAs in SzS samples were miR-145, miR-574-5p, miR-200c, miR-199a*, miR-143, miR-214, miR-98, miR-518a- 3p, and miR-7. The aberrant expression of MYC in SzS was found to correlate with the set of miRNAs including miR-30, miR-22, miR-26a, miR-29c, miR-30, miR-146a, and miR-150 which were downregulated. [score:11]
Ballabio et al. [59] also showed that direct targeting of EVL which is the host gene of miR-342, by the upregulated miRNA, miR-199a* was responsible for its downregulation. [score:10]
Distinctive miRNA signatures obtained using unsupervised hierarchical clustering could distinguish these three groups based on just 16 miRNAs with miR-17~92 cluster members (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-20b, and miR-92) and its paralog miR-106a, being the predominant one in addition to miR-29a/c,miR-100, miR-199a*, miR-140, miR-630, and miR-16 [49]. [score:1]
[1 to 20 of 3 sentences]
56
[+] score: 22
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-199b
In conclusion, our results show that miR-199 downregulation is a frequent alteration in metastatic CRC that emerges as a novel therapeutic target and a contributing mechanism to SET overexpression in this disease. [score:10]
Association between miR-199b downregulation and molecular and clinical parameters are included in Table 1. Interestingly, we observed miR-199b dowregulated in 17 out of 32 cases with SET overexpression, suggesting that low miR-199 is a relevant contributing alteration to deregulate SET in a subgroup of CRC patients. [score:8]
Interestingly, our findings indicate that miR-199 downregulation is a common event that plays an oncogenic role in CRC cells. [score:4]
[1 to 20 of 3 sentences]
57
[+] score: 21
Using microarray analysis, miRNA expression pattern in hearts revealed that miR-1, miR-29, miR-30, miR-133, and miR-150 have often been found to be down-regulated while miR-21, miR-125, miR-195, miR-199, and miR-214 are up-regulated with hypertrophy. [score:9]
It was concluded that in the cancerous tissues, i. e., miR-141, miR-200a, miR-200b, and miR-200c, had the highest level of up-regulation while miR-125b, miR-140, miR-145, and miR-199a were the most down-regulated. [score:7]
It was established that increased expression of miR-23a, miR-27a, miR-30c, let-7g, and miR-199a-3p corresponds to resistance to platinum -based chemotherapy while reduced expression of miR-378 and miR-625 relates to resistance. [score:5]
[1 to 20 of 3 sentences]
58
[+] score: 21
MiR-150 was reported to function as a key regulator in the tumorigenesis and progression of CN by targeting c-Myb [39]; miR-92a played a critical role in the CN development and an anti-miR-92a antagomir could lead to the apoptosis of CN cells [40]; miR-199a-3p, the 3p arm of the pre-miRNA for miR-199a, exhibited a higher expression in CN tissues, resulting a significantly lower survival rate for the patients [41]; miR-142-3p, the 3p arm of the pre-miRNA for miR-142, could suppress the CN cell growth via downregulating three CN -associated proteins CD133, Lgr5, and ABCG2 [42]; an inverse correlation observed between the levels of miR-101 and the EP4 receptor protein in CN suggested that miR-101 might serve as a therapeutic target for the cancer [43]; miR-146b, with its expression inhibited, would lead to a high CsSR protein receptor level and reduce CN proliferation [44]. [score:18]
Wan D Aberrant expression of miR-199a-3p and its clinical significance in colorectal cancersMed. [score:3]
[1 to 20 of 2 sentences]
59
[+] score: 20
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-199b, hsa-mir-214
To determine whether the inhibition of proliferation induced by PPAR α overexpression was related to miR-199a and miR-214 transcription, we examined the activity of DNMO3os in control and PPAR α -overexpressing cells. [score:7]
Indeed, basal transcription level was induced in U87 and U251 cells after overexpression of PPAR α (Figure 3(a)), and consistent with this, miR-214, miR-199a-3p, and miR-199a-5p levels were higher in PPAR α -expressing cells than in the control cells (Figure 3(b)). [score:5]
PPAR α is known to regulate transcription of the DNMO3os, which encodes miR-199a and miR-214 [8, 16]. [score:2]
PPAR α Promotes Transcription of DNMO3osPPAR α is known to regulate transcription of the DNMO3os, which encodes miR-199a and miR-214 [8, 16]. [score:2]
However PPAR α do not have correlation with miR-199a-3p and negative correlation with miR-199a-5p. [score:1]
The mechanism that the correlation between PPAR α and miR-199a was not clear, which need the future study. [score:1]
The DNMO3os transcription unit includes miR-199a and miR-214 [23]. [score:1]
PPAR α promotes transcription of the dynamin-3 gene opposite strand (DNMO3os), which encodes a miR-214 and miR-199 cluster [8– 10]. [score:1]
[1 to 20 of 8 sentences]
60
[+] score: 20
Ten miRNAs were used for further in silico validation: one predicted by using above programs with elevated expression in microarray analysis (hsa-miR-574-3p; miRBase accession number: MIMAT0003239) and nine up-regulated in microarray analysis but not predicted by the algorithms used (hsa-miR-122, hsa-miR-199a-3p, hsa-miR-140-3p, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-483-5p, hsa-miR-574-5p; miRBase accession numbers: MIMAT0000421, MIMAT0000232, MIMAT0004597, MIMAT0000510, MIMAT0005792, MIMAT0005793, MIMAT0006764, MIMAT0004761, MIMAT0004795, respectively). [score:6]
Although is hard to predict, which miRNA is involved in SERCA2 regulation, since the differentially expressed miRNA can be also from non-cardiomyocytes, we identified some good candidate miRNAs, which could be involved in the SERCA2 regulation (miR-199a for SERCA2b, miR-140 for both isoforms, and miR-574 for SERCA2a). [score:5]
Other up-regulated and in silico validated miRNAs were miR-199a, four members of miR-320 family and miR-483. [score:4]
Free-energy of binding and flanking regions (RNA22, RNAfold) was calculated for 10 up-regulated miRNAs from microarray analysis (miR-122, miR-320a/b/c/d, miR-574-3p/-5p, miR-199a, miR-140, and miR-483), and nine miRNAs deregulated from microarray analysis were used for validation with qPCR (miR -21, miR-122, miR-126, miR-1, miR-133, miR-125a/b, and miR-98). [score:3]
miR-199a was described as involved in the maintenance of cell size in cardiomyocytes [28], and as a master regulator of a hypoxia-triggered pathway [29]. [score:2]
[1 to 20 of 5 sentences]
61
[+] score: 20
Fig. 3Expression of pro-proliferative miR, mir-199a and miR-590, and their target mRNA during heart development. [score:6]
miR-199a was identified in Cluster 2 and the expression pattern of miR-590 did not allow its inclusion in any cluster. [score:3]
In sheep, miRNA that have been previously identified as key promoters of proliferation in rodents are predicted to have decreased expression with age and therefore reside in Clusters 2, 5 or 6. miR-199a, which has been shown to stimulate proliferation in cultured rat cardiomyocytes [13] was identified in Cluster 2, however, further analysis using qRT-PCR demonstrated that miR-199a peaked around birth, then decreased into postnatal life to the level of that seen at 91 days gestation. [score:3]
P <0.05 was considered significant The expression of miR-199a peaked around birth, but then decreased by 21 days of age to the level seen at 91 days gestation (P < 0.05; Fig.   3a). [score:2]
P <0.05 was considered significantThe expression of miR-199a peaked around birth, but then decreased by 21 days of age to the level seen at 91 days gestation (P < 0.05; Fig.   3a). [score:2]
The relative expression of (MS00031423, QIAGEN Pty Ltd, Doncaster, Australia), the (miR-15a, MS00008785; miR-15b, MS00008799; miR-16, MS00031493; miR-195, MS00008953; miR-497, MS00031906; QIAGEN Pty Ltd, Doncaster, Australia), miR-199a (MS00007602; QIAGEN Pty Ltd, Doncaster, Australia) and miR-590 (MS00010269; QIAGEN Pty Ltd, Doncaster, Australia) were measured using quantitative real-time reverse transcription PCR (qRT-PCR) on an ABI ViiA7 (PE Applied Biosystems, Foster City, CA). [score:1]
miR-199a and miR-590. [score:1]
Microarray miR-133 miR-590 miR-199a Cardiomyocyte Proliferation From late gestation, the majority of human cardiomyocytes cease proliferating due to either an absence of karyokinesis and/or cytokinesis [1– 3]. [score:1]
miR-199a increases with age, but is then reduced to the level seen at 91 days gestation by 21 days of age (a). [score:1]
[1 to 20 of 9 sentences]
62
[+] score: 20
The miRNAs expressed at the highest levels coincided with those reported by previous studies, and were similar to those expressed by NBC in our study, though several divergences emerged between CLL and NBC, such as the previously reported overexpression of miR-150-5p, miR-29a-3p, miR-155-5p, or miR-101-3p, underexpression of miR-181a-5p, or miR-181b-5p [14– 19], and others not firmly established yet, including the highly divergent miR-451a, miR-28-5p, miR-144-5p, miR-486-5p, or miR-486-3p, within the overexpressed, and miR-126-3p, miR-365a-3p, miR-199a-3p, or miR-582-5p, within the underexpressed. [score:13]
However, 41 miRNAs were differentially expressed between CLL and NBC according to the Student t test (cut-off 2-fold, p<0.05), being 29 overexpressed in CLL, including miR-150-5p, miR-29a-3p, miR-29b-3p, let-7a-5p, miR-26a-5p, miR-451a, miR-155-5p, miR-101-3p, miR-28-5p, miR-144-5p, miR-486-5p, or miR-486-3p, and 12 underexpressed, including miR-181a-5p, miR-222-3p, miR-126-3p, miR-365a-3p, miR-181b-5p, miR-199a-3p, or miR-582-5p (Table 1). [score:7]
[1 to 20 of 2 sentences]
63
[+] score: 20
Recently, He et al. found that klotho was a target gene of miR-199a-5p in cancer 18, suggesting that the miR-199 family may be involved in the regulation of klotho in DN. [score:4]
A previous study reported that serum miR-199a was up-regulated in diabetic mice and that this resulted in an increase in beta cell apoptosis 38. [score:4]
Combined with the decreased antioxidant abilities levels in the cells exposed to 20 mmol/L glucose, we hypothesized that high glucose leads to excessive production of reactive oxygen species and depletion of antioxidant enzymes, resulting in oxidative stress, up-regulation of histone acetylation, and activation of miR-199a-5p. [score:4]
Real-time PCR was used to detect serum and renal tubular epithelial cell miR-199-5p expression (D). [score:3]
Another study of T2DM patients found that plasma miR-199a was overexpressed and that it played a role in repressing glucose uptake 39. [score:3]
To investigate the effects of miR-199b-5p and klotho on renal function in vivo, the STZ -induced diabetic mice were injected with AAV-miR-199b-5p to overexpress miR-199-5b. [score:1]
The effects of miR-199b-5p and klotho on renal function in vivoTo investigate the effects of miR-199b-5p and klotho on renal function in vivo, the STZ -induced diabetic mice were injected with AAV-miR-199b-5p to overexpress miR-199-5b. [score:1]
[1 to 20 of 7 sentences]
64
[+] score: 19
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-214
Notably, higher miR-214 expression, as well as the other members of the cluster miR-199a/199a*, is significantly associated with improved survival in patients with HCC, further suggesting a tumor-suppressive function of the molecule. [score:5]
miR-214 was also found significantly reduced in HCC tissues consistent down-regulation of both miR-199a and miR-199a*. [score:4]
But not as in HCC tissue, miR-199a was up-regulated in HCC serum. [score:4]
Kaplan–Meier correlation analysis between miR-214 (D) miR-199a* (E) and miR-199a (F) levels and overall survival of patients with HCC with high and low miR-214 expression. [score:3]
Decreased expression of miR-199a/199a* has been frequently demonstrated in HCC [13– 15], and its decrement significantly correlates with the survival of HCC patients, outlining a potential marker for predicting the prognosis of HCC patients [16– 18]. [score:3]
[1 to 20 of 5 sentences]
65
[+] score: 19
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
In contrast, the miRNAs up-regulated in the liver (miR-199-3p, miR-199-5p, miR-21, miR-214 and miR-210) showed significantly higher levels in mouse serum at 12 weeks post infection (Fig. 2), however these failed to differentiate S. mansoni infected from uninfected humans (Fig. S4). [score:4]
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infectionBetween weeks 6 and 12, female parasites continue to produce ∼300 eggs per day [51], resulting in an increase in the number of granulomas in the liver and the development of fibrosis [45]. [score:4]
The miRNAs that displayed the largest differential expression included miR-199a and miR-214, which are known to be altered in liver fibrosis caused by hepatitis C infection or induced by carbon tetrachloride [47], [48]. [score:3]
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infection. [score:3]
Thirty-three mouse miRNAs were differentially expressed in infected compared to naïve mice (>2 fold change, p<0.05) including miR-199a-3p, miR-199a-5p, miR-214 and miR-21, which have previously been associated with liver fibrosis in other settings. [score:2]
Consistent with the array results, there was an increase in miR-199-5p, miR-199-3p, miR-214, miR-21, miR-210, and a reduction of miR-192, miR-194, miR-365, miR-122 and miR-151 in the liver tissue of S. mansoni infected mice as compared to naïve mice; miR-9 and miR-744 did not display differential expression and were not analysed further (Table 1). [score:2]
The 5 host miRNAs were detectable in serum (miR-21, miR-199-3p, miR-199-5p, miR-210, miR-214) but showed variable abundance and failed to differentiate ‘egg -positive’ and ‘egg -negative’ participants (Fig. S4). [score:1]
[1 to 20 of 7 sentences]
66
[+] score: 19
Shatseva and colleagues proposed that miR-199a-3p mediates increased proliferation of virus-immortalised rat endothelial cells as well as breast cancer cells by down-regulation of CAV2, while its overexpression leads to decreased proliferation. [score:6]
Although CDC42 was predicted to be a miR-199a-3p target, CAV2 and CDC42 possessed negatively correlated expression in the studied tumour cell line MT1. [score:5]
Interestingly, they observed concomitant overexpression of CDC42 and hypothesised a possible link between miR-199a-3p, CAV2 and CDC42 potentially regulating cell proliferation [16]. [score:4]
In a recent study, Shatseva and colleagues have shown that miR-199a-3p modulates tumour cell proliferation as well as survival by regulating CAV2 [16]. [score:2]
Several recently published studies have shown that microRNAs (miRNAs) such as miR-203 or miR-199a-3p regulate both CAV1 and CAV2, respectively [15], [16]. [score:2]
[1 to 20 of 5 sentences]
67
[+] score: 19
Based on the fold changes, qRT-PCR was performed to validate microarray results on 12 miRNAs, specifically miRNAs up-regulated in both heart and plasma (miR-660-3p, miR-665, miR-1285-3p and miR-4491), down-regulated in heart but up-regulated in plasma (miR-206 and miR-1268b), up-regulated in heart but down-regulated in plasma (miR-130-3p, miR-199a and miR-330-3p), down-regulated in both heart and plasma (miR-221-30, miR-487b-3p and miR-4288), were chosen for validation test in the plasma of 45 control and 45 CHF patients. [score:19]
[1 to 20 of 1 sentences]
68
[+] score: 18
Our previous study showed that miR-199a is downregulated in arsenic-transformed (As-T) cells, and arsenic inhibited miR-199a expression for decreasing angiogenesis [17]. [score:8]
It was reported that several miRNAs were upregulated; while miR-199a, miR-200b, miR-164, and miR-171 were downregulated in response to arsenic treatment [13, 14]. [score:7]
MiR-199a and miR-145 are commonly regarded as tumor suppressor genes in many cancers [7, 8]. [score:3]
[1 to 20 of 3 sentences]
69
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Targets of miR-199 were endothelin-1 and HIF1α, loss of miR-199 expression increased endothelial HIF1α levels [63]. [score:5]
Chronic ethanol feeding to mice induces an increase in the expression of miR-21, miR-199a-3p and miR-211 and down regulated miR-148a and miR-802 in the pancreas [18]. [score:4]
In addition, alcohol decreased the expression of miR-199 in human and rat liver sinusoidal endothelial cells [63]. [score:3]
Yeligar S. Tsukamoto H. Kalra V. K. Ethanol -induced expression of ET-1 and ET-BR in liver sinusoidal endothelial cells and human endothelial cells involves hypoxia-inducible factor-1alpha and microRNA-199 J. Immunol. [score:3]
Among these only four of them (miR-185, miR199a-3p, miR-214 and miR-490) were shown to be similarly altered in liver tissue and circulation [29]. [score:1]
Decreased microRNAs were miR-27b, miR-182, miR-183, miR-199a-3p, miR-200a, miR-214, and miR-322 [61]. [score:1]
[1 to 20 of 6 sentences]
70
[+] score: 17
In mice with AFL, miR-199-3p, miR-214, miR-93, miR-146a, miR-191, and let-7b are downregulated and miR-129, miR-490, miR-21, miR-503, miR-183, and miR-185 are upregulated compared with healthy mice [103]. [score:6]
Chatila W. M. Criner G. J. Hancock W. W. Akimova T. Moldover B. Chang J. K. Cornwell W. Santerre M. Rogers T. J. Blunted expression of miR-199a-5p in regulatory T cells of patients with chronic obstructive pulmonary disease compared to unaffected smokers Clin. [score:5]
In addition, miR-199a-5p is downregulated in regulatory T cells (Tregs) in patients with COPD versus healthy smokers. [score:5]
Also, miR-199a-5p modulates the response of Tregs through the TGF-β pathway [78]. [score:1]
[1 to 20 of 4 sentences]
71
[+] score: 17
By the end of the year 2010, miR-199a-3p and miR-210 were found to suppress HBsAg expression by directly targeting the HBV S protein coding region and pre-S1 region, respectively [37]; miR125a-5p was then shown to interfere with the viral translation, down -regulating the expression of the surface antigen [38], while miR-1 increases HBV transcription by upregulating farnesoid X receptor α (FXRA), a nuclear receptors binding to the HBV core promoter and regulating HBV transcription and replication. [score:17]
[1 to 20 of 1 sentences]
72
[+] score: 17
miR-199a, a bone morphogenic protein 2-responsive MicroRNA, regulates chondrogenesis via direct targeting to Smad1. [score:5]
MicroRNA-199a-3p is downregulated in human osteosarcoma and regulates cell proliferation and migration. [score:4]
For instance Duan et al. found that miR-199a-3p restoration decreased mTOR and Signal Transducer and Activator of Transcription (STAT) expression and proliferation and migration in osteosarcoma cells making it a strong therapeutic candidate in osteosarcoma (Duan et al., 2011). [score:3]
Twist-1 regulates the miR-199a/214 cluster during development. [score:3]
In addition to this study, Guled et al. demonstrated miRNAs including miR-199b-5p, miR-320a, miR-199a-3p, miR-126, and miR-22 were differentially expressed in LMS and undifferentiated pleomorphic sarcoma (UPS) as compared to mesenchymal stem cells (control) (Guled et al., 2014). [score:2]
[1 to 20 of 5 sentences]
73
[+] score: 17
For example, miR-146b and miR-34a were up-regulated in the liver tissues of patients with non-alcoholic steatohepatitis [11], while in the CCl [4] induced liver fibrosis, miR-199a-5p and miR-199a-3p were positively and significantly correlated to the progression of liver fibrosis [12]. [score:4]
To identify miRNAs that reflected the schistosome infections and PZQ chemotherapy, six miRNA candidates (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) were selected for analysis in serum that were commonly deregulated in human liver diseases. [score:4]
Expression levels of serum miR-223 (B), miR-122 (C), miR-34a (D), miR-199a-5p (E) miR-199a-3p (F), and miR-146b (G) were detected in the three groups of mice. [score:3]
The expression levels of miR-34a, miR-223, miR-122, miR-146b, miR-199a-5p, miR-199a-3p were determined using the SYBR Green Master Mix kit (TaKaRa, Dalian, China). [score:3]
Conversely, levels of serum miR-199a-3p, miR-199a-5p, and miR-146b in mice decreased after infection (Figure  1E-G). [score:1]
To test this hypothesis, we selected six candidate serum miRNAs for analysis (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) in the murine mo del of human schistosomiasis and then performed validation in other host species including rabbits, buffalos and human patients infected with S. japonicum. [score:1]
We analyzed the serum levels of six selected candidate miRNA molecules (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) from mice, rabbits, buffalos and humans infected with Schistosoma japonicum using qPCR. [score:1]
[1 to 20 of 7 sentences]
74
[+] score: 16
In obese subjects with DM-2, the expression of miR-K12-7, miR-484 and miR-130b, was down-regulated, while miR-1229, miR-199a-5p, miR-221 and miR-125b, were up-regulated compared with non-obese subjects [Figure 4B and Table S2]. [score:8]
Of note, miR-185, miR-139-5p, miR-484, and miR-130b were down-regulated in obese without DM-2 when compared to non-obese subjects while the expression of miR-99a, miR-1229, miR-125b, miR-221 and miR-199a-5p was up-regulated [Figure 4A and Table S2]. [score:8]
[1 to 20 of 2 sentences]
75
[+] score: 16
Our NGS data have revealed that miR-23b-3p was downregulated and miR-199a-5p was upregulated in penile cancer tissues, indicating their tumor-suppressive and oncogenic effect, respectively. [score:9]
Correspondingly, the highly expressed miRNAs in cancerous penile tissues were let-7f-5p, let-7a-5p, let-7b-5p, let-7c-5p, miR-140-3p, miR-199b-3p, let-7g-5p, miR-199a-3p, let-7e-5p and miR-143-3p possessed the top abundant expression levels. [score:5]
Similarly, recent studies have shown that miR-199a-5p played opposite roles in cancer initiation and development of various cancer types [73]. [score:2]
[1 to 20 of 3 sentences]
76
[+] score: 16
They found that upregulation of miR-499a-5p is a common feature of all placental insufficiencies such as preeclampsia (n = 80), gestational hypertension (n = 35), and FGR (n = 35); in addition, they demonstrated an upregulation of miR-1-3p in FGR pregnancies with abnormal umbilical fetal flows (n = 19); finally, they found downregulation of a series of miRNAs (miR-16-5p, miR-26a-5p, miR-100-5p, miR-103a-3p, miR-122-5p, miR-125b-5p, miR-126-3p, miR-143-3p, miR-145-5p, miR-195-5p, miR-199a-5p, miR-221-3p, miR-342-3p, and miR-574-3p) in FGR requiring the delivery before 34 weeks of gestation. [score:10]
Last year, Hromadnikova's group investigated maternal blood levels of specific miRNAs involved in cardiovascular and cerebrovascular diseases, finding a downregulation of miR-100-5p, miR-125b-5p, and miR-199a-5p in 39 patients with gestational hypertension, in 68 with preeclampsia, and in 33 with fetal growth restriction compared with 55 healthy controls; in addition, they showed downregulation of miR-17-5p, miR-146a-5p, miR-221-3p, and miR-574-3p only in FGR pregnancies [46]. [score:6]
[1 to 20 of 2 sentences]
77
[+] score: 16
qRT-PCR results showed that miR-135a* was up-regulated 1.9-fold and miR-199a-5p down-regulated approximately 1.7-fold in independent experiments (Additional file 2, Figure S2). [score:7]
We chose miR-135a* and miR-199a-5p, two miRNAs that were found in microarray analyses to be highly up- and down-regulated, respectively. [score:4]
Levels of expression of the miRNAs miR-135a* and miR-199a-5p were validated by qRT-PCR. [score:3]
Click here for file Supplemental Figure S2: Validation of miR-135* and miR-199a-5a levels by qRT-PCR. [score:1]
Supplemental Figure S2: Validation of miR-135* and miR-199a-5a levels by qRT-PCR. [score:1]
[1 to 20 of 5 sentences]
78
[+] score: 15
Rasheed Z. Rasheed N. Al-Shobaili H. A. Epigallocatechin-3- O-gallate up-regulates microRNA-199a-3p expression by down -regulating the expression of cyclooxygenase-2 in stimulated human osteoarthritis chondrocytes J. Cell. [score:9]
Consistent with the anti-arthritic and chondroprotective properties of the bioactive compounds of green tea, exemplified by epigallocatechin-3- O-gallate (EGCG) [99, 100], this green tea polyphenol engages a miR-199a-3p -dependent pathway to repress the expression of cyclooxygenase-2 (COX-2) and the synthesis of prostaglandin E [2] (PGE [2]) in chondrocytes treated with IL-1β [101]. [score:3]
On the other hand, OA SBOs display a mineralization defect and altered profile of gene expression, which can be restored through miRNA mimics (i. e., synthetic miRNA-590-5p, miRNA-211-5p, miRNA-199a-5p, and miRNA-199a-3p), as evidenced in a rat mo del for OA. [score:3]
[1 to 20 of 3 sentences]
79
[+] score: 15
Second, it represses the expression of two COX-2 inhibiting microRNAs miR101 and miR199a and indirectly promote COX-2 expression [11]. [score:8]
We have previously demonstrated that the epithelial sodium channel (ENaC) in the endometrial epithelial cells can be activated by embryo-derived protease, which subsequently triggers a sequence of events in endometrial epithelial cells, including Ca [2+] increase, phosphorylation of CREB (Ca [2+]/cAMP responsive element binding protein), downregulation of miR101 and miR199a, upregulation of COX-2 and eventually PGE [2] production and release to the stroma, leading to decidualization and embryo implantation [10, 11]. [score:7]
[1 to 20 of 2 sentences]
80
[+] score: 15
To validate the microarray data, we selected 3 miRNAs (miR-10b-5p, miR-1471 and miR-199a-5p) that were downregulated in pNK cells and 3 miRNAs (miR-181a-2-3p, miR-26b-3p and miR-362-5p) that were upregulated in human pNK cells for RT-PCR confirmation. [score:7]
Red and green pseudocolors indicate transcripts levels below or above the mean, respectively, on a log 2 scale representing gene expression ratios from 0 to 6. (c) Real-time PCR analysis of the expression of miR-10b-5p, miR-1471, miR-199a-5p, miR-181a-2-3p, miR-26b-3p, and miR-362-5p. [score:5]
These stringent criteria were met by 7 miRNAs that were specifically up-regulated in NK cells compared to NKT and T cells (miR-340-3p, miR-210, miR-199a-3p, miR-483-3p, miR-130a-3p, miR-199b-5p, and miR-362-5p) (Fig. 1e). [score:3]
[1 to 20 of 3 sentences]
81
[+] score: 15
It can be observed for the whole analysed group of 12 miRNAs that their overexpression is associated with increased expression of mRNA transcripts, regulated by the miRNA (except for identified decrease in the transcriptional activity of DIAPH1 with the increased expression of regulating miRNAs: hsa-miR-1275, hsa-miR-143, hsa-miR-1909, and hsa-miR-199a-5p). [score:9]
The incubation of NHDF cell cultures for 2 hours with a biological drug leads to changes in the expression of 12 miRNAs (hsa-miR-1231, hsa-miR-1275, hsa-miR-143, hsa-miR-16, hsa-miR-1909, hsa-miR-196a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-3162, hsa-miR-34a, hsa-miR-382, and hsa-miR-939), regulating the expression of the analysed transcripts. [score:6]
[1 to 20 of 2 sentences]
82
[+] score: 15
For the first set of MSCs only 3 miRNAs (miR-324-3p, miR-494-3p, and miR-1260a) were observed to be statistically significant (p < 0.05) between passages 3 and 7. For the second set of MSCs, 7 miRNAs (let-7i, miR-25-3p, miR-106b-5p, miR-130b-3p, miR-199a-5p, miR-365a-5p, and miR-1260a) were statistically significant between passages 4 and 8. MiR-1260a was found to be significantly different between early and late passages for both MSC sets; however, it was upregulated at passage 7 for the first MSC set and downregulated at passage 8 for the second MSC set. [score:7]
Based on the results of the microarray study, 16 miRNAs had detectable expression with 3 miRNAs being consensus miRNAs expressed in MSCs from the Clark et al., (let-7f, let-7i and miR-199a-5p) [49]. [score:5]
In our studies, 2 of the known miRNAs, let-7f and let-7i, were observed to be expressed in all samples of both MSC sets, while miR-199a-5p was not (Additional file 8: Table S5). [score:3]
[1 to 20 of 3 sentences]
83
[+] score: 15
In contrast, 9 miRs were downregulated with the lowest expression level observed for miR-199a (Table 1(b)). [score:6]
In this line, profiling studies identified chondrocytes miRNAs that were expressed differentially in human OA cartilage [14– 16], some of which being shown to regulate matrix degradation such as miR-27b, miR-140, and miR-199a [17– 20]. [score:4]
The pcDNA3.1-pre-miR-29b and pcDNA3.1-pre-miR-199a (chosen as a IL-1 responsive control) plasmids were used to express miR-29b and miR-199a from their human precursors, hsa-pre-miR-29B1 (81 bp sequence, referred to as MI0000105 in miRbase v17) and hsa-pre-miR-199a-1 (71 pb sequence, referred to as MI0000242 in miRbase v17), respectively. [score:3]
HeLa cells were transfected with 500 ng of pGL3-Luc::hCOL2A1, pGL3-Luc::hCOL1A2, or pGL3-Luc::hCOL10A1 plasmid and 500 ng of pcDNA3.1-pre-miR-29b or pcDNA3.1-pre-miR199a or empty pcDNA3.1 and 5 ng of the pRL plasmid encoding Renilla luciferase (Promega) using EXGEN500™ (Euromedex) in 12-well plates. [score:1]
Using this approach, we report here a strong increase of miR-146a and a significant decrease of miR-140, miR-199a, and miR-455 which are in good agreement with previous studies in OA chondrocytes [17– 20, 51, 52]. [score:1]
[1 to 20 of 5 sentences]
84
[+] score: 14
Several other studies, however, show that a loss in expression of miR-199a, enhanced tumor progression by an enhancement of IKKβ expression and its induced inflammatory and tumorigenic signals in ovarian cancer [47]. [score:5]
One study suggests that leukemias with higher expression of miR-199a exhibit a worse prognosis [46]. [score:3]
Expression of miR-199a has also been associated with cancers. [score:3]
Furthermore, RNA co-immunoprecipitation confirmed the specific regulation of SMADs on the microprocessors of miR-21 and miR-199a, but not miR-214, in response to BMP4 or TGF-β (Fig. 2). [score:2]
Through studying which miRNAs might play a role in the phenotypic changes of the vascular smooth muscle cells in response to TGF-β signaling, they found that miR-21 and miR-199a were induced by BMP4 and TGF-β stimulation. [score:1]
[1 to 20 of 5 sentences]
85
[+] score: 14
The overexpression of miR-199a in LX-2 cells triggers the upregulation of tissue inhibitor of metalloproteinase (TIMP)-1, Col1a1, and MMP-13 mRNA [34]. [score:8]
A transcription factor, Twist-1, binds to the E-box region, regulating miR-214 and miR-199a expression [22]. [score:4]
We previously reported an increase in miR-199a in the fibrotic livers of patients with chronic HCV infection [25], and similar findings have been reported by others [31- 33]. [score:1]
miR-214 and miR-199a are encoded in a region that contains an E-box DNA promoter sequence [22]. [score:1]
[1 to 20 of 4 sentences]
86
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-28, hsa-mir-29a, hsa-mir-93, hsa-mir-100, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-34a, hsa-mir-181c, hsa-mir-182, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-217, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-134, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-106b, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-372, hsa-mir-382, hsa-mir-148b, hsa-mir-196b, hsa-mir-424, hsa-mir-448, hsa-mir-449a, hsa-mir-483, hsa-mir-491, hsa-mir-501, hsa-mir-503, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320c-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320c-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Among them, miR-199a-3p targets HBsAg coding region and the pre-S region of the HBV genome, whereas miR-125a-5p binds to HBsAg mRNA leading to inhibition of its translation [46, 68]. [score:7]
Conversely, miR-199a, Let-7b, miR-448 and miR-196 are all implicated in suppressing HCV RNA replication [58– 60]. [score:3]
The miRNAs shown to reduce HBV replication and the expression of HBV surface antigen (HBsAg) are miR-199a-3p, miR-210 and miR-125a-5p. [score:3]
miR-199a counteracts the action of miR-122 and represses HCV replication by binding to the seed map site within the 5′ UTR of the HCV genome just downstream of the second miR-122 binding site [58]. [score:1]
[1 to 20 of 4 sentences]
87
[+] score: 14
While most miRNAs (e. g. miR-18b up-regulation and miR-145 down-regulation) showed an ER status independent differential expression, miR-199 and miR-214 were down-regulated in proliferating samples only in the 38 ER -negative samples (both with TNoM p<0.01, see Table S6). [score:12]
In addition, we find miR-199a and miR-214 to be significantly down regulated in HP samples, specifically in ER -negative samples. [score:2]
[1 to 20 of 2 sentences]
88
[+] score: 14
In an in-vitro study using H-69 lung cancer cell line, Pak et al. (2014) reported upregulation of miR-16-2, miR-93, miR-95, mir-153, mir-195, miR-199a-3p, and down-regulation of miR let7a, let7i, miR-124a in the presence of excretory secretory protein of C. sinensis. [score:7]
The miR-214 and miR-199 showed maximum differential expression. [score:3]
In a mice mo del study of infected liver cells, highly elevated expression of miR-34c, miR-199, miR-134, miR-223, and miR-214 at 45dpi had been noticed (Cai et al., 2013b). [score:3]
Among the miRNAs, seven of them (miR-16-2, miR-93, miR-95, miR-136, miR-153, miR-195, and miR-199a-3p) were mainly associated with esophageal adenocarcinoma, breast cancer and colorectal carcinoma, suggesting the role of these miRs in cell-proliferation and cell-signaling. [score:1]
[1 to 20 of 4 sentences]
89
[+] score: 14
The 4 miRNAs, including miR-195–5p, miR-199a-3p, miR-320a, and miR-374a-5p, were shown to be upregulated by a factor greater than two-fold. [score:4]
miR-199a-3p could inhibit osteosarcoma cell growth, migration, and induce the apoptosis via p53 signaling pathway [21– 22]. [score:3]
In addition, circulating miR-195-5p and miR-199a-3p were correlated with metastasis status, while miR-199a-3p and miR-320a were correlated with histological subtype. [score:1]
miR-320a showed significantly higher levels in the osteoblastic patients than the chondroblastic ones (Fig. 5C), while circulating levels of miR-199a-3p was significantly decreased in patients with osteoblastic subtype (Fig. 5D). [score:1]
Furthermore, the plasma levels of miR-195–5p and miR-199a-3p were analyzed in the 50 patients without or with metastasis who underwent surgical removal of the tumors. [score:1]
Four plasma miRNAs including miR-195-5p, miR-199a-3p, miR-320a, and miR-374a-5p were significantly increased in the osteosarcoma patients. [score:1]
As shown in S1 Fig., both miR-195–5p and miR-199a-3p were significantly decreased in the patients without and with metastasis after tumor removal. [score:1]
In this study, miR-195–5p and miR-199a-3p were correlated with metastatic status, and miR-320a and miR-199a-3p were correlated with osteoblastic subtype. [score:1]
The AUC was 0.9029 for miR-195–5p (95% confidence interval [CI], 0.8602–0.9456) (Fig. 3A), 0.9025 for miR-199a-3p (95% confidence interval [CI], 0.8658–0.9392) (Fig. 3B), 0.9188 for miR-320a (95% confidence interval [CI], 0.8857–0.9519) (Fig. 3C), and 0.9173 for miR-374a-5p (95% confidence interval [CI], 0.8855–0.9492) (Fig. 3D). [score:1]
[1 to 20 of 9 sentences]
90
[+] score: 14
C-C motif chemokine ligand (CCL5), also known as regulated upon activation, normally T-expressed, and presumably secreted (RANTES) has been implicated in downregulation of miR-199a in human chondrosarcoma cells, which promotes VEGF upregulation and angiogenesis [81]. [score:10]
Liu G. T. Huang Y. L. Tzeng H. E. Tsai C. H. Wang S. W. Tang C. H. Ccl5 promotes vascular endothelial growth factor expression and induces angiogenesis by down -regulating mir-199a in human chondrosarcoma cellsCancer Lett. [score:4]
[1 to 20 of 2 sentences]
91
[+] score: 13
Twist1 has been reported to regulate the expression of the miR-199a/214 cluster during development [24]. [score:5]
All results of relative expression values are shown as mean ± s. e. m. obtained from triplicate experiments (unpaired two-sample Student’s t test, * P < 0.05 and ** P < 0.01) The miR-199a/214 gene cluster is located in the Dynamin-3 (DNM3) gene as two clustered miRNAs approximately 6 kb apart. [score:3]
Lee YB Twist-1 regulates the miR-199a/214 cluster during developmentNucleic Acids Res. [score:3]
The miR-199a/214 gene cluster is located in the Dynamin-3 (DNM3) gene as two clustered miRNAs approximately 6 kb apart. [score:1]
The miR-199a/214 gene cluster is located in the 7.9-kb noncoding intron of the DNM3 gene. [score:1]
[1 to 20 of 5 sentences]
92
[+] score: 13
miR-200a and miR-141 were identified as highly upregulated in cancer, whereas miR-199a, miR-140, miR-145, and miR-125b1 were most significantly downregulated. [score:7]
Yang et al. (2008a) identified 36 miRNAs differentially expressed between normal ovarian cells and tumors, including miR-199a*, miR-214, miR-200a which were found upregulated in 53, 56, and 43% tumor tissues respectively, and associated with high-grade and late-stage tumors. [score:6]
[1 to 20 of 2 sentences]
93
[+] score: 13
Other miRNAs from this paper: hsa-mir-199a-2, hsa-mir-340
Moreover, we confirmed the expression of miR-199a-5p and miR-340 in two cell lines, examined with a relatively higher expression level of miR-199a-5p (Fig. 2B). [score:5]
Human HCC cell lines SMMC-7721 and human embryonic kidney cell line HEK-293T (American Type Culture Collection), in which two microRNAs (miR-199a–5p and miR-340) were identified to be positively expressed by using TaqMan miRNA expression assay (Applied Biosystems, USA) as previously described 24, were cotransfected with either pMIR-rs2057482-C or pMIR-rs2057482-T (200 ng/well) with or without anti-miR-199a-5p (Applied Biosystems, USA) and the internal control plasmid pRLTK (Promega) (20 ng/well) in a 24-well plate with 2 × 10 [5] cells per well. [score:4]
Our functional assay indicated the potential impact of rs2057482 on the post-transcriptional regulation of HIF1A gene by miR-199a-5p. [score:1]
Our results indicated that anti-miR-199a-5p significantly increased the luciferase activity of two UTR constructs (p-MIR-C and p-MIR-T) in both cell lines and obliterated the differences of luciferase activity between two reporter plasmids. [score:1]
do) showed that rs2057482 is close to two predicted microRNA binding sites (hsa-miR-199a/b-5p and hsa-miR-340) 32. [score:1]
do) showed that rs2057482 is close to two predicted microRNA binding sites (hsa-miR-199a/b-5p and hsa-miR-340) (Fig. 2A). [score:1]
[1 to 20 of 6 sentences]
94
[+] score: 13
Other miRNAs from this paper: hsa-mir-31, hsa-mir-199a-2, hsa-mir-525, hsa-mir-940
Of note, Wang et al., demonstrate that miRNA, miR-199a-3p, targets ZHX1 for RNA degradation to promote cell proliferation and suppresses apoptosis in gastric cancer. [score:5]
Differential expression of ZNF proteins in different cancer types can be regulated by 1) cancer-related miRNAs, including miR-199a-3p, miR-525-3p, miR-940 and miR-31, or 2) different environmental stimuli, which activate signaling cascades and therefore fine-tune ZNF protein functions through various of PTMs, including phosphorylation (P) and acetylation (Ac). [score:4]
First, differential expression levels of ZNF proteins in different cancer types are regulated by cancer-related miRNA, including miR-199a-3p, miR-525-3p, miR-940 and miR-31. [score:4]
[1 to 20 of 3 sentences]
95
[+] score: 13