WARNING: This summary was generated by AI. MIR199A1 is a microRNA gene located on chromosome 19, which encodes for the mature miR-199a-3p, a non-coding RNA involved in post-transcriptional gene regulation [PMC3281082][PMC9177676[PMC9177676]. This microRNA was found to be significantly upregulated in response to a 48-hour Bb infection, as demonstrated by validation using the miR-VILO kit [PMC5279786]. Additionally, MIR199A1 is among the 10 microRNAs with the highest absolute amount in a given study, indicating its potential biological significance [PMC8010072]. Functional analysis suggests that MIR199A1 has inferred functional partners such as miR21 and miR155, and shares a domain with these microRNAs, which may be relevant for precision health applications [PMC9962339]. Moreover, MIR199A1 has been identified as one of several non-coding RNAs potentially associated with hypospadias among other DMR-associated genes [PMC9834259]. Its upregulation has also been observed in differentially expressed transcripts in tumors, suggesting its role in post-transcriptional regulation that may affect tumor differentiation [PMC7433108].
aaC U C --U -g g gcc CCAGUGU CAGACUAC UGU Ca gag ||| ||||||| |||||||| ||| || ||| c cgg GGUUACA GUCUGAUG ACA gu cuc AUU C - ugu aa u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000231 |
| Description | Homo sapiens hsa-miR-199a-5p mature miRNA |
| Sequence | 6 - CCCAGUGUUCAGACUACCUGUUC - 28 |
| Evidence |
experimental
cloned [2-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000232 |
| Description | Homo sapiens hsa-miR-199a-3p mature miRNA |
| Sequence | 47 - ACAGUAGUCUGCACAUUGGUUA - 68 |
| Evidence |
experimental
cloned [4], Illumina [5] |
| Database links |
|
| Predicted targets |
|
|