miRBase entry: hsa-mir-199a-1

Stem-loop hsa-mir-199a-1


Accession
MI0000242
Symbol
HGNC: MIR199A1
Description
Homo sapiens hsa-mir-199a-1 precursor miRNA mir-199
Gene
family?
RF00144; mir-199

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR199A1 is a microRNA gene located on chromosome 19, which encodes for the mature miR-199a-3p, a non-coding RNA involved in post-transcriptional gene regulation [PMC3281082][PMC9177676[PMC9177676]. This microRNA was found to be significantly upregulated in response to a 48-hour Bb infection, as demonstrated by validation using the miR-VILO kit [PMC5279786]. Additionally, MIR199A1 is among the 10 microRNAs with the highest absolute amount in a given study, indicating its potential biological significance [PMC8010072]. Functional analysis suggests that MIR199A1 has inferred functional partners such as miR21 and miR155, and shares a domain with these microRNAs, which may be relevant for precision health applications [PMC9962339]. Moreover, MIR199A1 has been identified as one of several non-coding RNAs potentially associated with hypospadias among other DMR-associated genes [PMC9834259]. Its upregulation has also been observed in differentially expressed transcripts in tumors, suggesting its role in post-transcriptional regulation that may affect tumor differentiation [PMC7433108].

Literature search
381 open access papers mention hsa-mir-199a-1
(2613 sentences)

Sequence

4289936 reads, 7153.0 reads per million, 194 experiments
gccaaCCCAGUGUUCAGACUACCUGUUCaggaggcucucaauguguACAGUAGUCUGCACAUUGGUUAggc
(((...(((((((.((((((((.(((.((.(((...)))..))...))))))))))).)))))))...)))

Structure
   aaC       U        C   --U  -g   g 
gcc   CCAGUGU CAGACUAC UGU   Ca  gag  
|||   ||||||| |||||||| |||   ||  ||| c
cgg   GGUUACA GUCUGAUG ACA   gu  cuc  
   AUU       C        -   ugu  aa   u 


Annotation confidence High
Do you think this miRNA is real?
Comments
Lagos-Quintana et al. [1] cloned miR-199 from human osteoblast sarcoma cells. They also reported identification of a miRNA from the opposite arm in mouse cells. This sequence was named miR-199-s and the sequence from the 3' arm of the homologous mouse precursor miR-199-as. Lim et al. [2] independently predicted this miRNA computationally using conservation with mouse and Fugu rubripes sequences [2]. Expression of the miR excised from the 5' arm was validated in zebrafish, and the ends mapped by cloning. The excised miR sequences are renamed miR-199a (to avoid confusion with the subsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the 3' arm) here. The two putative hairpin precursors in human map to chromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2, MIR:MI0000281). Landgraf et al. show that both mature products are expressed, prompting the renaming to miR-199a-5p and miR-199a-3p [4].

Genome context
chr19: 10817426-10817496 [-]

Disease association
hsa-mir-199a-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-199a-5p

Accession MIMAT0000231
Description Homo sapiens hsa-miR-199a-5p mature miRNA
Sequence 6 - CCCAGUGUUCAGACUACCUGUUC - 28
Evidence experimental
cloned [2-4]
Database links
Predicted targets

Mature hsa-miR-199a-3p

Accession MIMAT0000232
Description Homo sapiens hsa-miR-199a-3p mature miRNA
Sequence 47 - ACAGUAGUCUGCACAUUGGUUA - 68
Evidence experimental
cloned [4], Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  4. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  5. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179