Mature hsa-miR-199a-3p
| Accession | MIMAT0000232 |
| Description | hsa-miR-199a-3p mature miRNA |
| Hairpins | |
| Sequence | ACAGUAGUCUGCACAUUGGUUA |
| Evidence |
experimental
cloned [4], Illumina [5] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28358369 | results_in_movement_of CL:0002618 |
| acts_upstream_of | GO:1900747 negative regulation of vascular endothelial growth factor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28358369 | occurs_in CL:0002618 |
| acts_upstream_of_or_within | GO:1904046 negative regulation of vascular endothelial growth factor production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28358369 | has_output UniProtKB:P15692 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23142051 | has_input UniProtKB:Q8WW22 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28358369 | has_input UniProtKB:P08253 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28358369 | has_input UniProtKB:P14210 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28358369 | has_input UniProtKB:P17948 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28358369 | has_input UniProtKB:P35968 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28358369 | has_input UniProtKB:Q15389 |
| involved_in | GO:0000320 re-entry into mitotic cell cycle |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0000746 |
| involved_in | GO:0010595 positive regulation of endothelial cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23142051 | |
| involved_in | GO:0010667 negative regulation of cardiac muscle cell apoptotic process |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0002129 |
| involved_in | GO:0010667 negative regulation of cardiac muscle cell apoptotic process |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:2000046 |
| involved_in | GO:0032686 negative regulation of hepatocyte growth factor production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28358369 | occurs_in CL:0000632 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23142051 | has_input UniProtKB:Q8WW22 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28358369 | has_input UniProtKB:P08253 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28358369 | has_input UniProtKB:P14210 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28358369 | has_input UniProtKB:P17948 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28358369 | has_input UniProtKB:P35968 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28358369 | has_input UniProtKB:Q15389 |
| involved_in | GO:0045766 positive regulation of angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23142051 | |
| involved_in | GO:0051897 positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0002129 |
| involved_in | GO:0051897 positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0002129 |
| involved_in | GO:0051897 positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:2000046 |
| involved_in | GO:0051897 positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:2000046 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
