Stem-loop hsa-mir-199a-2

Accession

MI0000281

Symbol

HGNC: MIR199A2

Description

Homo sapiens hsa-mir-199a-2 precursor miRNA mir-199

Gene
family

RF00144; mir-199

Literature search

379 open access papers mention hsa-mir-199a-2
(2692 sentences)

Sequence

3282236 reads, 10210 reads per million, 151 experiments

aggaagcuucuggagauccugcuccgucgcCCCAGUGUUCAGACUACCUGUUCaggacaaugccguuguACAGUAGUCUGCACAUUGGUUAgacugggcaagggagagca
.....(((.((.....((((((((.(((...(((((((.((((((((.(((.((((......))..)).))))))))))).)))))))...))).)))).))))))))).

Structure

aggaa   u  ggaga    -    c   gcC       U        C   U  --  ac 
     gcu cu     uccu gcuc guc   CCAGUGU CAGACUAC UGU Ca  gg  a
     ||| ||     |||| |||| |||   ||||||| |||||||| ||| ||  ||   
     cga ga     ggga cggg cag   GGUUACA GUCUGAUG ACA gu  cc  a
----a   -  -----    a    u   AUU       C        -   u  ug  gu 

Annotation confidence High

Comments

Lagos-Quintana et al. [1] cloned miR-199 from human osteoblast sarcoma cells. They also reported identification of a miRNA from the opposite arm in mouse cells. This sequence was named miR-199-s and the sequence from the 3' arm of the homologous mouse precursor miR-199-as. Lim et al. [2] independently predicted this miRNA computationally using conservation with mouse and Fugu rubripes sequences [2]. Expression of the miR excised from the 5' arm was validated in zebrafish, and the ends mapped by cloning. The excised miR sequences are renamed miR-199a (to avoid confusion with the subsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the 3' arm) here. The two putative hairpin precursors in human map to chromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2, MIR:MI0000281). Landgraf et al. show that both mature products are expressed, prompting the renaming to miR-199a-5p and miR-199a-3p [4].

Genome context

chr1: 172144535-172144644 [-]

Clustered miRNAs

2 other miRNAs are < 10 kb from hsa-mir-199a-2

Disease association

hsa-mir-199a-2 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-199a-5p

• Accession: MIMAT0000231
• Description: Homo sapiens hsa-miR-199a-5p mature miRNA
• Sequence: 31 - CCCAGUGUUCAGACUACCUGUUC - 53
• Evidence: experimental ; cloned [2-4]

Mature hsa-miR-199a-3p

• Accession: MIMAT0000232
• Description: Homo sapiens hsa-miR-199a-3p mature miRNA
• Sequence: 70 - ACAGUAGUCUGCACAUUGGUUA - 91
• Evidence: experimental ; cloned [4], Illumina [5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20158877
   Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
   Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
   BMC Genomics (2010) 11:S6


3. PubMed ID: 12624257
   Vertebrate microRNA genes
   "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
   "Science (2003) 299:1540


4. PubMed ID: 15978578
   Identification of human fetal liver miRNAs by a novel method
   "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
   "FEBS Lett (2005) 579:3849-3854


5. PubMed ID: 12554859
   New microRNAs from mouse and human
   "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
   "RNA (2003) 9:175-179