sort by

103 publications mentioning mmu-mir-203 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-203. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 349
Other miRNAs from this paper: mmu-mir-133a-1, mmu-mir-133a-2
To further validate whether miR-203 plays a tumor-suppressive role by inhibiting Rap1A expression, knockdown Rap1A by shRNA -mediated Rap1A downregulation was confirmed at protein levels. [score:11]
More importantly, miR-203 expression was also observed to be downregulated in prostate cancer tissues, and the over -expression of miR-203 significantly suppresses the growth and invasion of PCa cells [28- 30]. [score:10]
Rap1A protein expression was also significantly decreased in miR-203 over -expressing cells (Figure  3C) and Rap1A protein levels in PC-3 and DU 145 cells with overexpression of miR-203 were increased after transfection with miR-203 inhibitor, compared with a control miRNA inhibitor (Figure  3D). [score:10]
All these proved that Rap1A is a functional target of miR-203 and this evidence suggested that miR-203 exerts its tumor-suppressive effects through downregulation of Rap1A in PCa cells. [score:8]
Briefly, we found that Rap1A is a novel functional target of miR-203 and both over -expression of miR-203 and knockdown of Rap1A have similar effects in PCa, which is suppressing cell proliferation, adhesion and invasion through inactivation of the Rac1/PAK1 signaling pathway. [score:8]
In addition, we identified Rap1A as a direct target suppressed by miR-203, and there was an inverse relationship between the expression of miR-203 and Rap1A in PCa. [score:8]
For over -expression studies, the lentiviruses expressing miR-203 and control viruses expressing GFP were used to infect PC-3 and DU145 cell lines in the presence of 4 g/ml of polybrene (Sigma). [score:7]
We found that expression of Rap1A partly rescue adhesion and invasiveness enhancement of PC-3 and DU 145 cells stably expressing miR-203 (Figure  5B and C), indicating that over -expression of Rap1A could reverse the effects of miR-203 in PCa cells. [score:7]
As expected, the over -expression of miR-203 induced a marked reduction in the expression of RAC1, p-PAK1 and p-MEK1 (Figure  2E, Additional file 1: Figure S1), but there is no visible change in the expression levels of total PAK1 and MEK1. [score:7]
These findings provide further evidence that a crucial role for miR-203 in inhibiting metastasis of PCa through the suppression of Rap1A expression. [score:7]
Meanwhile, the over -expression of miR-203 could lead to a decrease of endogenous Rap1A expression in PCa cells at both the transcriptional and translational levels. [score:7]
It has been reported that in breast cancer miR203 targets SOCS3 (suppressor of cytokine signaling 3), a negative regulator of fetal liver hematopoiesis and placental development, and ABL1 (Abelson murine leukemia viral oncogene homolog 1), which implicates in processes of cell differentiation, cell division, cell adhesion, and stress response [26, 27]. [score:7]
PC-3 and DU 145 cells overexpressed miR-203 were transfected with Anti-miRNA inhibitors Negative Control (anti-NC) and anti-miR-203 inhibitor (anti-miR-203) (Applied Biosystems) at a final concentration of 50 nM with the Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. [score:7]
To determine whether Rap1A was a direct target of miR-203, reporter constructs containing full-length Rap1A 3′-UTR were made, along with their corresponding mutant counterpart at the miR-203 target site. [score:6]
At first, miR-203 has been identified as a skin-specific microRNA, and altering expression of miR-203 in vivo results in promoting epidermal differentiation by restricting proliferative potential and inducing cell-cycle exit through targetting p63, an essential regulator of stem cell maintenance in epithelial stratified tissues [25]. [score:6]
Rap1A is up-regulated in PCa, and its expression is inversely correlated with miR-203. [score:6]
Data indicates that miR-203 functions as tumor suppressor in PCa and is down-regulated in advanced PCa. [score:6]
Our data proved that Rap1A is a direct target of miR-203 and over -expression of Rap1A partly rescue the effect of miR-203 on cell proliferation, adhesion and invasion. [score:6]
In this study, our data demonstrated a previously unrecognized mechanism that miR203 inhibits cell proliferation, adhesion and invasion through directly targeting Rap1A. [score:6]
Furthermore, miR-203 expression was inversely correlated with Rap1A mRNA expression in PCa tissue specimens. [score:5]
Importantly, the significant effects induced by miR-203 over -expression on cell adhesion and invasion were partially reversed by over -expression of Rap1A. [score:5]
org/) to predict the targets of miR-203 and found that Rap1A was a putative target (Figure  3A). [score:5]
Furthermore, Rap1A over -expression in PCa cells partially reversed the effects of miR-203 -expression on cell adhesion and invasion. [score:5]
Based upon bioinformatics analysis, Rap1A was predicted as a putative miR-203 target and the putative target sites for miR-203 presents within Rap1A 3′-UTR. [score:5]
To further confirm a functional connection between Rap1A and miR-203, we transfected the control vector or a Rap1A expression vector into PC-3 and DU 145 cells stably expressing miR-203. [score:5]
Over -expression of Rap1A could partly rescue the effects of ectopic miR-203 expression in PCa cells. [score:5]
To identify the potential target genes of miR-203 that might contribute to its prometastatic function, we used TargetScan (http://www. [score:5]
All data elucidate a new mechanism that miR203 suppresses tumor growth through inhibiting Rap1A. [score:5]
All these indicate that miR-203 functions as tumor suppresser through inhibiting Rap1A in PCa and miR-203 may be used in clinical applications for cancer. [score:5]
Our data demonstrated that the over -expression of miR-203 significantly inhibited relative cell growth (Figure  2B). [score:5]
Here, we confirmed that the expression of miR-203 was significantly downregulated in prostate cancer specimens compared with matched adjacent normal prostate specimens. [score:5]
As Rap1A is reported to function as an oncogene, this may indicate that miR-203 suppresses tumor metastasis through inhibiting Rap1A. [score:5]
Introducing miR-203 into PC-3 and DU 145 cells, which express relatively low levels of endogenous miR-203, led to a significant inhibition of cell proliferation, adhesion and invasion. [score:5]
In combination, these results indicated that the down-regulation of miR-203 in PCa may be involved in PCa progression. [score:4]
Nevertheless, additional direct target genes mediated by miR-203 remain to be further identified in the future. [score:4]
In this assay, each experimental mouse bearing miR-203 -overexpressing and control vector DU 145 cells, respectively, on the right or left dorsal thigh began to exhibit differences in tumor growth between the two sides within two weeks, and the difference continued to increase through the endpoint, at which tumors of the miR-203 -overexpressing group displayed a smaller tumor size and weight (Figure  6A). [score:4]
To validate whether miR-203 exerts its tumor-suppressive function through Rap1A, we knocked down Rap1A by RNA interference techniques. [score:4]
Together, these data demonstrated that that Rap1A is a direct target of miR-203. [score:4]
These results suggested that Rap1A was a direct target of miR-203. [score:4]
To demonstrate further that Rap1A was negatively regulated by miR-203, we assessed the expression of Rap1A at the mRNA level in the same panel of specimens. [score:4]
All these results proved Rap1A is a novel direct target of miR-203. [score:4]
MiR-203, a putative tumor suppressor gene, has been shown to inhibit cell proliferation and invasion and modulate the chemotherapy response in a variety of tumor cells, including lung cancer cells, glioma cells, and breast cancer cells [21- 24]. [score:4]
To further investigate the mechanisms of miR-203 downregulation in PCa, we over-expressed miR-203 in PCa cells and assessed various aspects of PCa cell biology. [score:4]
We examined the expression of miR-203 in prostate cancer tissues, adjacent normal tissues, PCa cell lines and normal prostate epithelial cells by qRT-PCR. [score:3]
The expression level of miR-203 was accessed by qRT-PCR and normalized with an endogenous control (U6). [score:3]
To investigate the biological functions of miR-203, PC-3 and DU 145 cells with ectopic expression of human miR-203 were generated and the ectopic expression of human miR-203 was verified by qRT-PCR (Figure  2A). [score:3]
HEK 293 T cells were co -transfected with 1 μg of RAP1A-3′-UTR-WT or RAP1A-3′-UTR-MUT plasmid and 50 ng of pRL-TK Renilla luciferase expression plasmid with an empty vector control or pCDH-miR-203 using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). [score:3]
In the present study, our results provided the first evidence that miR-203 supresses cell proliferation, adhesion and invasion through targeting Rap1A in PCa. [score:3]
Figure 1 Expression of miR-203 in PCa samples and cell lines. [score:3]
We then explored any change in cell adhesion and transmigration ability in PC-3 and DU 145 cells over -expressing miR-203. [score:3]
Mechanistic dissection revealed that miR-203 mediated cell proliferation, adhesion and invasion in vitro, and tumor growth in vivo, as evidenced by reduced RAC1, p-PAK1, and p-MEK1 expression. [score:3]
To further confirm the expression of miR-203, especially among Chinese patients, we extended our sample to 53 pairs of clinical specimens. [score:3]
We have shown that miR-203 over -expression reduced the activation of Rac1/PAK1 pathways. [score:3]
Lanes 2, 4, 6, 8 were samples from the miR-203 over -expression group. [score:3]
Figure 5 Rap1A partly rescues migration and invasion inhibited by miR-203. [score:3]
The efficacy of miR-203 over -expression was assessed by qRT-PCR. [score:3]
Taken together, these results supported that Rap1A was a functional target of miR-203 in PCa. [score:3]
Taken together, these findings were consistent with the in vitro results and indicated that miR-203 has the ability to suppress PCa cell growth in vivo. [score:3]
Then, we focused on the targets of miR-203 which may modulate cellular adhesion and invasion in the present study. [score:3]
An inverse correlation between the expression of miR-203 and Rap1A was observed by linear regression analysis. [score:3]
To study the molecular mechanisms of miR-203 on cell proliferation, adhesion and invasion, we examined the expression of cell adhesion molecules and downstream pathways. [score:3]
We found that miR-203 was significantly down-regulated in carcinoma tissues compared with the matched adjacent non-tumor tissues (P < 0.01; Figure  1A). [score:3]
Figure 3 Rap1A is a new target of miR-203. [score:3]
The purpose of the present study was to verify the expression of miR-203 and investigate the molecular mechanisms through which it inhibits tumor growth and metastasis. [score:3]
To determine whether miR-203 regulates the malignant behavior of PCa, we first studied the effect of miR-203 on the cell proliferation of PC-3 and DU 145 cell lines. [score:2]
First we verified that the expression of miR-203 was significantly decreased in cancerous tissues of PCa patients compared with non-cancerous prostate specimens. [score:2]
Evidence supports an important role for miR-203 in the regulation of the proliferation, migration and invasion of prostate cancer (PCa) cells. [score:2]
Figure 2 Effect of miR-203 on PCa cells and regulation of the Rac1/PAK1 pathway. [score:2]
MiR-203 suppresses tumor growth in vivo. [score:2]
Figure 6 MiR-203 inhibits tumor growth in vivo. [score:2]
The enforced expression of miR-203 attenuated cell adhesion to collagenase I and fibronectin compared with PC-3 and DU 145 cells infected with empty vector (Figure  2C). [score:2]
MiR-203 is aberrantly expressed in human prostate cancer tissues and cell lines. [score:2]
A mutant construct of Rap1A 3′-UTR, named RAP1A-3′-UTR-MUT, which carried a substitution of four nucleotides within the predicted miR-203 binding sites of Rap1A 3′-UTR, was carried out using a Phusion® site-directed mutagenesis kit (New England Biolabs). [score:2]
Knockdown of Rap1A phenocopied the effects of miR-203 on PCa cell growth and invasion. [score:2]
MiR-203 inhibits human PCa cell proliferation, adhesion and invasion. [score:2]
The final PCR product was cloned into the XbaI/EcoRI sites of the pCDH-CMV-EF1-copGFP vector (SBI) according to the manufacturer’s instructions and named pCDH-miR-203. [score:1]
Furthermore, in comparison to primary tumors tissues with lymph node and/or bone metastasis, miR-203 levels were significantly lower in PCa tissues without metastasis (P < 0.05; Figure  1B). [score:1]
For Rap1A silencing, PC-3 and DU 145 cell lines were infected as described above for miR-203. [score:1]
Small nuclear RNA U6 was used as an internal control for miR-203 and GAPDH was used to normalize Rap1A. [score:1]
Previous reports have shown that miR-203 was reduced in primary prostate cancer and even more reduced in metastatic PCa. [score:1]
miR-203 Prostate cancer Rap1A Cell proliferation Cell adhesion Cell invasion Prostate cancer is the most frequent malignancy among men in most developed countries, and it was estimated to contribute to 28% of newly diagnosed cancers and 11% of cancer-related deaths in 2011 [1]. [score:1]
Consistent with the results of miR-203, the protein levels of rac1, p-PAK1 and p-MEK1 were dramatically reduced (Figure  4A, Additional file 2: Figure S2). [score:1]
Functional analyses were performed and found Rap1A silencing could phenocopy the effects of miR-203 on phenotypes of PCa cells. [score:1]
Similar results were observed in PCa cell lines, that the miR-203 level was significantly decreased in PC-3 and DU 145 cells with high metastatic potential, in comparison to nonmalignant epithelial prostate cell lines RWPE-1 (P < 0.05; Figure  1C). [score:1]
Therefore, further exploring the function of miR-203 could broaden the strategies for prostate cancer treatment. [score:1]
DU 145 cells infected with vector or miR-203 at 5 × 10 [6] cells/150 μl were injected subcutaneously into the left flanks of anesthetized 6-week-old NOD-SCID mice. [score:1]
However, the exact mechanisms of miR-203 in PCa are not entirely clear. [score:1]
To construct the has-miR-203 expression vector, the sequence containing the miR-203 pre-miRNA was amplified by PCR from human genomic DNA using the forward primer 5′-AAATCTAGACCAGGCGAGGGCGTCTAA-3′ and the reverse primer 5′-AAAAGAATTCAGCGGTTCCCACAGCACA-3′. [score:1]
Pearson's correlation analysis was performed to examine the correlation between miR-203 and Rap1A mRNA levels of human PCa tissues. [score:1]
[1 to 20 of 89 sentences]
2
[+] score: 287
Moreover, inhibition of endogenous miR-203 by miR-203 inhibitor resulted in up-regulated expression of CASK in 7901 cells (Figure 3B). [score:10]
The data were similar to the findings in glioblastoma and prostate cancer, in which miR-203 was down-regulated, and ectopic expression of miR-203 suppressed cell proliferation and induced a G1-phase arrest by targeting PLD2 [20]. [score:10]
Figure 1 (A) miR-203 expression in 5 GC cell lines and immortalized GES-1 cells; (B) miR-203 expression in 7901 and MKN45 cells infected with different MOIs of H. pylori; (C) miR-203 expression in H. pylori positive and negative tumor tissues; (D) miR-203 expression in H. pylori positive and negative control tissues. [score:9]
Figure6 (A) expression of CASK in different MOIs of H. pylori infected 7901 cells; (B) expression of CASK in different MOIs of H. pylori infected MKN45 cells; (C) expression of CASK in H. pylori positive and negative control tissues; (D) expression of CASK in H. pylori positive and negative tumor tissues; (E) a statistically significant inverse correlation between miR-203 and CASK levels in clinical specimens (Spearman's correlation analysis, r=-0.912, p=0.000) (*p<0.05 compared with control). [score:8]
These results together showed that miR-203 was down-regulated in H. pylori infected state and its down-regulated was significantly associated with GC progression. [score:7]
In conclusion, our evidence indicated that miR-203 was down-regulated, while CASK was up-regulated in H. pylori induced GC. [score:7]
Here, we identified CASK as a new direct target of miR-203 and miR-203 exerts its tumor-suppressive function via down -regulating CASK oncogene. [score:7]
To further explore the molecular mechanisms of growth inhibition induced by miR-203, we searched the potential target of miR-203 through Targetscan and found that CASK could match the sequence of miR-203. [score:7]
Our results showed that miR-203 could inhibit cell growth, colony formation and cell invasion and suppress tumorigenesis in a murine mo del of GC xenograft, suggesting its potential tumor suppressor role in H. pylori induced GC. [score:7]
Furthermore, we identified and validated CASK gene as a novel and direct target of miR-203, as assessed by mutagenesis analysis of 3′-UTR of CASK gene and luciferase activity and showed that they play distinct roles in regulating H. pylori related GC development. [score:6]
We showed that ectopic expression of CASK significantly rescued miR-203 induced cell growth and invasion inhibition (Figure 4B). [score:5]
MiR-203 has been reported as a novel tumor and metastasis suppressor by directly targeting mRNA of PLD2 [20], Bmi-1 [21] and PKCα [22]. [score:5]
The expression of miR-203 validated after mimic or inhibitor transfection was shown in supplementary Figure 1A. [score:5]
We then overexpressed CASK in cells and found that CASK overexpression could reverse the effect of miR-203 mimics. [score:5]
Ectopic expression of miR-203 in GC cells suppressed invasion and migration in vitro. [score:5]
Ectopic miR-203 expression decreased CASK expression at the mRNA and protein levels in the GC cell line. [score:5]
Ectopic miR-203 inhibits growth and invasion of GC cells in vitroTo explore the effect of miR-203 on cell growth and invasion, MKN-45 and 7901 cells were transiently transfected with miR-203 mimic or inhibitor, respectively. [score:5]
Following observation of miR-203 -mediated growth inhibition, we transfected 7901 or MKN45 cells with miR-203 mimic or inhibitor and examined cell invasion. [score:5]
Lipofectamine 2000 (Invitrogen) was used to transfect GC cells with 30 nmol/L miR-203 mimic or inhibitor or their respective non -targeting negative control oligonucleotides (Genepharma) according to the manufacturer's instructions. [score:5]
Compared with inhibitor NC, cells transfected with miR-203 inhibitor displayed a significantly higher invasion rate, while cells transfected with miR-203 mimics inhibited the invasion compared with NC (Figure 2B and supplementary Figure 1C). [score:5]
CASK was up-regulated in H. pylori positive cells and tissues and inversely correlated with miR-203 levels. [score:4]
As shown in Figure 4A, CASK knockdown led to significant cell growth and invasion inhibition, similar to those induced by miR-203 (P<0.01). [score:4]
In addition to the oncogenic effects of CASK in GC cells, for the first time, we showed that was naturally up-regulated in H. pylori infected GC and normal specimens and inversely correlated with miR-203 levels, suggesting that CASK might play important roles in GC tumorigenesis. [score:4]
The luciferase activity was significantly lower in cells transfecting CASK wt 3′UTR, suggesting that a direct interaction between miR-203 and its targeted gene. [score:4]
CASK was a direct target of miR-203 in GC cells. [score:4]
To explore the mechanism of growth and invasion inhibition induced by miR-203, we investigated whether miR-203 could regulate CASK expression in GC cells. [score:4]
In the present study, we demonstrated that miR-203 is significantly down-regulated in H. pylori positive tissues. [score:4]
MiR-203 expression inhibited GC growth and invasion via repression of CASK. [score:4]
For luciferase assays, 7901 cells were plated in 24-well plates and, 24 hours later, co -transfected with 30 nmol/L miR-203 mimic or inhibitor or their respective negative controls, 1mg pGL3-CASK or vectors containing wild-type or mutant CASK 3′UTR, together with 0.5 mg pGL3-Renilla expressing vector (transfection control). [score:4]
As demonstrated in Figure 2A and supplementary Figure 1B, the results of MTT assay displayed that miR-203 significantly inhibited cell growth in 7901 cells and in MKN-45 cells (P<0.05), whereas miR-203 inhibitor promoted cell growth in these two cells (P<0.05). [score:4]
We further examined the expression level of miR-203 in 50 pairs of H. pylori positive and negative control specimens and in 50 pairs of H. pylori positive and negative tumor tissues. [score:3]
Moreover, co-transfection with miR-203 inhibitor and wt 3′ UTR vector in 7901 cells led to a 2-fold increase of luciferase activity. [score:3]
The growth inhibition induced by LV-miR-203 infection was similar to that induced by miR-203 mimic transfection (Figure 2D). [score:3]
We transfected 7901 and MKN45 cells with LV-miR203 at 5 different MOIs of 0, 10, 20, 50, and 100 and then examined CASK expression levels. [score:3]
Consistent with the data obtained from GC cell lines, the average expression level of miR-203 by qRT-PCR was significantly lower in H. pylori positive tumor and normal tissues (Figure 1C and 1D). [score:3]
We showed that the expression levels of miR-203 were increased in 7901 and MKN45 cells respectively in a dose -dependent manner and reached a very high level at MOI 100 (Figure 2C). [score:3]
Firstly, we silenced CASK to investigate whether the reduced expression of CASK could mimic the suppressive effect of miR-203. [score:3]
Furthermore, we silenced the CASK expression in GC cells and found that the cell functions were comparable when cells transfecting with miR-203 mimics or sh-CASK. [score:3]
We also examined the cell invasion after transfection with LV-miR-203 and consistent with the previous results which showed that LV-miR-203 transfection significantly inhibit cell invasion (Figure 2F). [score:3]
To explore the effect of miR-203 on cell growth and invasion, MKN-45 and 7901 cells were transiently transfected with miR-203 mimic or inhibitor, respectively. [score:3]
3′-UTR sequence of CASK which was predicted to interact with miR-203 or a mutant sequence with the predicted target sites were inserted into the KpnI and SacI sites of pGL3 promoter vector (Invitrogen). [score:3]
Then, we correlated CASK with miR-203 expression in the same GC specimens. [score:3]
Subsequently, we evaluated whether ectopic expression of CASK could rescue the suppressive effect of miR-203. [score:3]
The controversial results suggested that the role of miR-203 was possibly tumor specific and highly dependent on its targets in different cancer cells. [score:3]
In this study, we found that the expression of miR-203 in H. pylori positive specimens was significantly lower than that in negative tissues, regardless of normal or tumor tissues. [score:3]
A panel of human GC cell lines was first analyzed to quantitate the expression level of miR-203. [score:3]
For CASK, fragments containing the predicted binding sites for miR-203 at the 3′-untranslated regions (UTR) were amplified from 7901 genomic DNA by PCR. [score:3]
By contrast, negative control (NC) or inhibitor NC had no effect on cell growth, indicating that the effect caused by miR-203 was specific. [score:3]
These results together suggested that miR-203 could inhibit cell growth and invasion through CASK repression. [score:3]
As shown in Figure 3A, ectopic expression of miR-203 led to a dose -dependent decrease in CASK mRNA and protein levels. [score:3]
MiR-203 is aberrantly down-regulated in H. pylori positive tissues and cells. [score:3]
Previous studies have demonstrated that the expression profiling of miR-203 was tissue-specific and that it might have divergent functions depending on the tumor tissue or cell type. [score:3]
Then, we extracted RNA and protein from the tumors and found that miR-203 expression was significantly higher in LV-miR-203 treated group. [score:3]
CASK was involved in miR-203 -induced growth inhibition in 7901 cells. [score:3]
We then infected 7901 and MKN45 cells with different MOIs of H. pylori (0, 1:1, 1:50, 1:100) and we found that miR-203 expression gradually decreased with increased MOIs (Figure 1B, p<0.05). [score:3]
To elucidate whether the growth and invasion suppressive effect of miR-203 was mediated by repression of CASK in GC cells, we performed gain-of-function and loss-of-function studies. [score:3]
As shown in Figure 6E, when CASK mRNA levels were plotted against miR-203 expression, a significant inverse correlation was observed (2-tailed Spearman's correlation, r=-0.912; P=0.000). [score:3]
We next used lentiviral vectors to stably restore the expression of miR-203 in MKN-45 and 7901 cells and examined cell growth rate and invasion. [score:3]
Ectopic miR-203 inhibits growth and invasion of GC cells in vitro. [score:3]
We further performed luciferase reporter assay to determine whether miR-203 could directly target the 3′UTR of CASK in GC cells. [score:3]
MiR-203 suppressed tumor growth of GC cells in nude mice. [score:2]
The results showed that the expression level of miR-203 was decreased in all 5 GC cell lines examined, compared with the immortalized non-tumorigenic cell line GES-1 (Figure 1A, p<0.05). [score:2]
We also demonstrated that miR-203 was directly bound to the 3′-UTR of CASK. [score:2]
CASK expression was significantly higher in LV-miR-203 and pcDNA-CASK treated group and lower in LV-miR-203 treated group as compared to control group (Figure 5C). [score:2]
For invasion assays, GC cells were transfected with miR-203 mimic or inhibitor or their respective controls for 48 hours, after which 50,000 cells in serum-free medium were seeded in the top chamber of 24-well transwell units (BD Pharmingen) with RPMI-1640 containing 15% FBS added to the bottom chambers. [score:2]
Figure3 (A) mRNA (upper) and protein (lower) levels of CASK after LV-miR-203 infection at different MOIs in 7901 and MKN45 cells; (B) mRNA (left) and protein (right) levels of CASK after 7901 cells were transfected with miR-203 inhibitor after 48 hours; (C) diagram of CASK 3′UTR-containing reporter constructs; (D) luciferase reporter assays in 7901 cells, with cotransfection of wt or mt 3′UTR and miRNA as indicated. [score:2]
However, miR-203 was amplified and could promote cell growth and drug resistance in colorectal cancer [23]. [score:1]
The DNA fragments corresponding to CASK or miR-203 were amplified from human genomic DNA and were listed in supplementary table 1. Then, they were cloned into pLVTHM lentiviral vector. [score:1]
The activity of mut 3′UTR vector was unaffected by a simultaneous transfection with miR-203. [score:1]
Figure5 A, 7901 cells were infected with LV-miR-203 or LV-miR-203 and LV-CASK and injected subcutaneously into nude mice. [score:1]
Figure4 7901 cells were infected with LV-shCASK or LV-miR-203. [score:1]
We further identified the association between miR-203 and CASK through luciferase activity. [score:1]
We also infected cells with H. pylori of different MOIs and miR-203 was decreased accordingly. [score:1]
Further investigations are needed to figure out how H. pylori infection changed miR-203 expression. [score:1]
However, little is known about miRNA-203 functions in H. pylori induced GC. [score:1]
Figure2 (A) effect of miR-203 on cell proliferation was measured by MTT assay after transfecting with miR-203 mimics/inhibitor; (B) effect of miR-203 on cell invasion was measured by transwell assay after transfecting with miR-203 mimics/inhibitor; (C) expression levels of miR-203 after 7901 and MKN45 cells were infected with LV-miR-203 at 5 different MOIs. [score:1]
The relative expression ratio of miR-203 in paired tissues and cells was calculated by the 2 [−ΔΔCT] method. [score:1]
After 4 weeks, LV-miR-203-infected cells (middle) produced smallest tumors, while cells transfected with LV-miR-203 and LV-CASK produced largest tumors. [score:1]
To construct mutant vectors, putative miR-203 binding sites in CASK 3′-UTR were mutated (Genepharma, Shanghai). [score:1]
Effect of miR-203 on 7901 cell growth and invasion. [score:1]
A, 7901 cells were infected with LV-miR-203 or LV-miR-203 and LV-CASK and injected subcutaneously into nude mice. [score:1]
Furthermore, the miR-203-CASK pathway that we identified may be exploited in a therapeutic approach for the treatment of H. pylori infection induced GC. [score:1]
To further reveal the roles of miR-203 in GC cells, we tested the effect of miR-203 on cell growth and invasion. [score:1]
[1 to 20 of 83 sentences]
3
[+] score: 255
Other miRNAs from this paper: mmu-mir-212
To over-expressed and down-regulated the expression of miR-203, AML-12 were transfected with miR-203 mimics or inhibitor by using lipofectamine 2000 (Invitrogen, United States) according to the manufacturer’s instructions. [score:10]
Our data demonstrated that SREBP-1 expression was up-regulated but PPAR-α was decreased in response to alcohol exposure, and over -expression of miR-203 suppressed the ethanol -mediated induction of TG and TCH. [score:10]
Furthermore, we proved that miR-203 could regulate the biological progression of ALD via directly targeting Lipin1 expression. [score:7]
In brief, all these findings suggest that up-regulation of miR-203 inhibited the fat accumulation, suggesting that miR-203 may be involved in the development of hepatic steatosis. [score:7]
MiR-203 as a tumor suppress gene, studies have found hepatic over -expression of miR-203 could facilitate the initiation of the liver by targeting SOCS3 through IL-6/STAT3 signaling pathway (Chen et al., 2017). [score:7]
Our studies demonstrated ethanol promoted cytoplasmic localization of Lipin1, but over -expression miR-203 the LPIN1 gene expression have been inhibited. [score:7]
MiR-203 has been found be a tumor suppressor gene, which can inhibit the development of tumor by regulating cell growth, proliferation, and metastasis (Takeshita et al., 2012). [score:6]
miR-203 suppresses the proliferation and metastasis of hepatocellular carcinoma by targeting oncogene ADAM9 and oncogenic long non-coding RNA HULC. [score:5]
The subcellular localization of Lipin1 is linked with miR-203, over-expressed miR-203 can inhibited cytoplasmic localization of Lipin1 in mouse AML-12 cells. [score:5]
The cellular Oil Red staining indicated over -expression of miR-203 significantly suppressed the cellular lipids accumulation (Figures 3B,C). [score:5]
More importantly, ethanol treated dramatically decreased it in the nucleus expression, however over-expressed miR-203, the nucleus localization of Lipin1 is increased. [score:5]
miR-203 Directly Regulated the Expression of LPIN1. [score:5]
MiR-203 mimics and control mimics, miR-203 inhibitor and control inhibitor were synthesized by Biomics biotech (Jiangsu, China). [score:5]
Meanwhile, we packaged lentivirus to over-expressed miR-203 in the liver by tail vein injection with C57BL/6J mice in vivo, and transfected miR-203 mimics into AML-12 cell lines to over-expressed miR-203 in vitro. [score:5]
We then used miRBase and TargetScan to search for the target genes of miR-203. [score:5]
Further experiment showed that over -expression of miR-203 in AML-12 cells could promote the protein and mRNA level of PPAR-α and inhibit the level of SREBP-1, IL-6, or TNF-α (Figures 3D,E). [score:5]
The increase in endogenous Lipin1 protein induced by ethanol was observed strictly in the cytosolic fractions, however, the expression of Lipin1 was decreased when over -expression of miR-203 (Figure 6B). [score:5]
Lipin1 expression was negligible in liver tissue from CD-fed mice and Lenti-NC mice but highly expressed in liver tissue from EtOH-fed mice and Lenti-miR-203 mice (Figures 5A,B). [score:5]
miR-203 Inhibited Hepatocyte Lipids Accumulation in VitroTo explore the effect of miR-203 on hepatocyte lipids accumulation in vitro, AML-12 cells were transiently transfected with miR-203 mimics, miR-203 inhibitor, or miR controls. [score:5]
In our experiments, we found that the mRNA expression of Lipin1 could be decreased by miR-203 mimics (Figure 4C), and the Lipin1 mRNA level was increased in cells after transfected with miR-203 inhibitor (Figure 4D). [score:5]
Combined with the above observations, we realized that alcoholic liver injury mainly resulted from disordered lipid metabolism and that miR-203 could inhibit the inordinate metabolism and inflammation to inhibit alcoholic steatosis and injury. [score:5]
It suggests that miR-203 plays an important role in AFL partly by directly targeting Lipin1. [score:4]
MiR-203 can also suppress the hepatocellular carcinoma by targeting oncogene ADAM9 and oncogenic long non-coding RNA HULC (Wan et al., 2016). [score:4]
In addition, miR-203 can regulate liver fibrotic and TGF-β induced proliferation of hepatic stellate cells by targeting TRPV4 (Song et al., 2014). [score:4]
Microarray and qRT-PCR has been utilized to detect serum miRNAs pattern in a rat ASH mo del, they found miR-203 was down-regulated in serum and liver (Chen et al., 2013). [score:4]
Besides, our study found that protein expression of Lipin1 in AML-12 cells were negatively regulated by alteration of miR-203. [score:4]
MiR-203 can suppress the hepatocellular carcinoma cells proliferation by targeting HOXD3 and the progression is conducted through EGFR signaling pathway (Wang et al., 2016). [score:4]
The data showed that miR-203 was significantly down-regulated after stimulation. [score:4]
In summary, miR-203 is a new target in the AFL and negatively regulated Lipin1 in AML-12 cells. [score:4]
Furthermore, treatment with ethanol dramatically increased the intensity of Lipin1 staining in the cytoplasm, as compared to controls, suggesting an increase of Lipin1 protein expression, but over-expressed miR-203 the Lipin1 cytoplasmic accumulation was reduced and nuclei accumulation was increased (Figure 6A). [score:4]
miR-203 Was Down-Regulated in EtOH-Fed Mice and EtOH-Induced AML-12 Cells. [score:4]
miR-203 inhibits the migration and invasion of esophageal squamous cell carcinoma by regulating LASP1. [score:4]
miR-203 Inhibited Liver Lipids Accumulation in VivoTo explore the regulatory effect of miR-203 on Gao-binge alcoholic mice liver lipids accumulation, 8-week-old male C57BL/6J mice were tail vein injected with Lenti-miR-203 or Lenti-NC before the mo del construction. [score:4]
Furthermore, we over-expressed miR-203 by injecting lentivirus encoding miR-203 mimics through the right caudal vein in mice before ALD mo del construction. [score:3]
We examined the miR-203 expression in liver tissue from EtOH-fed mice, control diet-fed mice and AML-12 cell lines. [score:3]
Lentivirus vector have fluorescence, so the miR-203 over -expression can be analysis by microscope (Figure 2A). [score:3]
Western blotting further revealed that the protein expression of Lipin1 was also inversely correlated with miR-203 (Figure 4). [score:3]
miR-203 Inhibited Liver Lipids Accumulation in Vivo. [score:3]
qRT-PCR showed that liver miR-203 expression was significantly increase after treated with Lenti-miR-203 (Figure 2B). [score:3]
To further test whether Lipin1 is a target of miR-203, the 3′-UTR was cloned into a luciferase expression vector to evaluate its response to miR-203. [score:3]
miR-203 Inhibited Hepatocyte Lipids Accumulation in Vitro. [score:3]
Taken together, our results suggested that Lipin1 was a target of miR-203 in AML-12 cells. [score:3]
Co -transfected the luciferase reporter with the miR-203 mimics into AML-12 cells showed the 3′-UTR conveyed decreased expression (Figure 4B). [score:3]
To explore the effect of miR-203 on hepatocyte lipids accumulation in vitro, AML-12 cells were transiently transfected with miR-203 mimics, miR-203 inhibitor, or miR controls. [score:3]
In AML-12 cells, ethanol increased total Lipin1 protein levels, however, transfected with miR-203 mimics the expression of Lipin1 was increased (Figure 5C). [score:3]
The aim of the present study was to investigate the role of miR-203 in alcoholic liver disease and to further elaborate the possible molecular mechanisms involved in miR-203 function in alcoholic liver disease. [score:3]
qRT-PCR showed that miR-203 expression was significantly increased after miR-203 mimics transfection (Figure 3A). [score:3]
Then we stimulated AML-12 cells with 100 mM EtOH for 24 h to detect the expression of miR-203, the result was the same as liver tissues. [score:3]
In order to validate the LPIN1 gene was a target of miR-203, we packaged a reporter plasmid containing luciferase with the 3′ UTR sequence of Lipin1 mRNA. [score:3]
Additionally, Western blotting further revealed that lentivirus -mediated ectopic miR-203 expression resulted in significant reduction of lipid metabolism markers including SREBP-1 and inflammation markers IL-6, TNF-α (Figures 2E,F). [score:3]
miR-203 Inhibited Cytoplasmic Localization of Lipin1 in Mouse AML-12 Cells. [score:3]
Then we verified the in vivo findings in vitro, further demonstrated that miR-203 suppressed hepatic lipid accumulation. [score:3]
However, administration of Lenti-miR-203 greatly reduced the development of AFL (Figure 2C). [score:2]
The specificity of miR-203 targeting Lipin1 mRNA was ascertained by co-transfection of pSicoR/miR-203 and pMIR-Lipin1-wild, pMIR-Lipin1-mut or the control vectors into AML-12 cells using Lip2000, and the results were determined by the relative activity of firefly luciferase unit (RLU) at 48 h post-transfection using a dual luciferase reporter assay kit (Promega, Madison, WI, United States) followed the manufacturer’s instructions. [score:2]
To assess the subcellular localization of Lipin1 in response to miR-203 regulatory in AML-12 cells. [score:2]
Importantly, miR-203 functioned as a new mediator and has therapeutic potential for AFL by regulation of lipid metabolism. [score:2]
Then we assessed the subcellular localization of Lipin1 in response to miR-203 regulatory in AML-12 cells. [score:2]
To explore the regulatory effect of miR-203 on Gao-binge alcoholic mice liver lipids accumulation, 8-week-old male C57BL/6J mice were tail vein injected with Lenti-miR-203 or Lenti-NC before the mo del construction. [score:2]
To elucidate the potential function of miR-203 in the progression of ALD pathology, we activated AML-12 cells with 100 mM EtOH in vitro. [score:1]
Interestingly, we found that the 3′-UTR of LPIN1 had putative binding sites with miR-203 (Figure 4A). [score:1]
Besides, we further evaluated the effect of ethanol on the expression of inflammation cytokines, such as TNF-α, IL-6. The results had shown alcohol feeding induces TNF-α, IL-6, but miR-203 reduce the inflammation reaction. [score:1]
In this study, we found miR-203 levels in liver tissue from EtOH-fed mice were significantly lower than those in CD-fed mice. [score:1]
These results might suggest the functions of miR-203 and its roles in ALD progression, which may provide a scientific and novel therapeutic strategy for alcoholic fatty liver (AFL). [score:1]
The packaged lentiviruses were named Lenti-miR-203. [score:1]
Then the impacts of miR-203 on lipid metabolism in liver and AML-12 cell lines are examined. [score:1]
Then Lenti-miR-203, Lenti-NC were administered at a dose of 2 × 10 [8] transducing units per animal by tail vein injection (200 μl total volume) using a 30 gauge ultra-fine insulin syringe before the ALD mo del construction. [score:1]
To the best of our knowledge, there are no data about the role of miR-203 in AFL. [score:1]
More importantly, our study indicates the cross-talk of miR-203 with Lipin1 and may provide a new insight into double functions of Lipin1 in ethanol -induced liver lipid accumulation. [score:1]
However, the functional significance of miR-203 in ethanol -induced hepatic steatosis has not been studied. [score:1]
AML-12 cells were transiently transfected with miR-203 mimics and then cultured in the presence of ethanol, and extracts of these cells were fractionated into cytosol and nuclei, followed by Western blotting analysis. [score:1]
For miR-203, the procedure was performed according to the manuscript of the one-step miRNA qRT-PCR Detection Kit (Biomics, Nantong, Jiangsu, China). [score:1]
Both H&E and Oil Red O staining pathological staining results showed that miR-203 reduced alcoholic liver steatosis. [score:1]
[1 to 20 of 72 sentences]
4
[+] score: 236
Figure 8 miR-203 expression may regulate breast cancer cells proliferation and stemness by inhibiting the expression of SOCS3 and enhancing expression of Stat3 and c-Myc. [score:10]
miR-203 expression may regulate breast cancer cells proliferation and stemness by inhibiting the expression of SOCS3 and enhancing expression of Stat3 and c-Myc. [score:10]
In this study, we observed that inhibition of miR-203 in ER -positive breast cancer cells suppresses cell proliferation by inhibiting cyclin D1 and pStat3, and inhibits tumor growth in a breast cancer preclinical mo del. [score:9]
These data suggested that miR-203 inhibits SOCS3 expression and concurrently increased the expression of pStat3 in these breast cancer cells. [score:7]
Inhibition of miR-203 increases the expression of SOCS3 and enhances phospho-STAT3 expression in breast cancer cells. [score:7]
In this study, we demonstrated that miR-203 acts like an oncomiR and its expression potently targets tumor suppressor protein, SOCS3 and concurrently activates pStat3, pERK and c-Myc which enhance the proliferation and stemness of ER -positive breast cancer cells. [score:7]
Western blot data indicated that the anti-miR-203 downregulates the expression of Nanog and Oct4 in the mammospheres of MCF-7 cells (Figure 7, panel B). [score:6]
Inhibition of miR-203 expression alters cell proliferation and key cell cycle regulatory proteins. [score:6]
Our findings are also an agreement with other study that miR-203 expression is upregulated in primary breast tumors [11]. [score:6]
Together, our results suggested that miR-203 inhibits SOCS3 expression in the ER -positive breast cancer tissues. [score:5]
Our in vitro data suggested that cyclin D1 expression was inhibited in miR-203 knockdown breast cancer cells as compared with control cells (Figure 1). [score:5]
Anti-miR-203 increases the expression of SOCS3 and decreases pStat3 expression in breast cancer cells. [score:5]
miR-203 has been proposed as a tumor suppressor in leukemia stem cells because it targets various oncogenes such as Src, survivin and Bmi-1 [31]. [score:5]
The miR-203 expression level was inversely related to the expression level of SOCS3 in ER -positive breast cancer tissues (Figure 5, panel B). [score:5]
Inhibition of miR-203 reduces mammosphere formation and the expression of Nanog and Oct4. [score:5]
Inhibition of miR-203 expression reduces breast cancer stemness. [score:5]
In this study, we observed that inhibition of miR-203 reduces mammosphere formation and cancer stem cell marker expression. [score:5]
We presented SOCS3 and miR-203 expression (dCT value) from individual patient tissue sample and mean expression. [score:5]
Inhibition of miR-203 reduces the expression of stemness makers. [score:5]
Collectively, these findings suggested that anti-miR-203 decreased the proliferation of breast cancer cells by inhibiting cyclin D1 and enhancing p21 expression. [score:5]
Our results demonstrate that the miR-203-SOCS3 axis plays an important role in breast cancer growth by inhibiting spheroid formation and CSC marker expression. [score:5]
SOCS3 was identified as a direct target of miR-203 [10]. [score:4]
However the relationship of ER positive and miR-203 upregulation remains to be elucidated. [score:4]
Our previous study have identified that SOCS3 is a direct target of miR-203 [10]. [score:4]
Inhibition of miR-203 in MCF-7 cells nude mice reduces tumor growth in nude mice. [score:3]
Anti-miR-203 decreases the expression of pERK and c-Myc in breast cancer cells. [score:3]
Our findings may offer to develop a novel miRNA based therapy (using miR-203 inhibition) for management of ER -positive breast cancer. [score:3]
Interestingly, we did not observe significant miR-203 expression in ER -negative human breast cancer cells tested. [score:3]
Inhibition of miR-203 decreases tumor growth in the nude mice. [score:3]
A strong inverse expression between miR-203 and SOCS3 levels RNA levels was noted. [score:3]
miR-203 expression was analyzed by real-time PCR, using U47 RNA as an internal control. [score:3]
Further, clinical data suggested that miR-203 is highly expressed in ER -positive breast cancer tissues [11]. [score:3]
Thus, these results indicated that miR-203 inhibition plays a role, in part, for reduction of MCF-7 tumor growth. [score:3]
miR-203 and SOCS3 are inversely expressed in ER -positive breast cancer tissues. [score:3]
We further examined the expression of miR-203 and SOCS3 in limited breast cancer tissues. [score:3]
Our results demonstrated that the expression of cyclin D1 and PCNA was significantly lower in tumors from miR-203 knockdown MCF-7 cells as compared to control cells (Figure 4, panel C). [score:3]
Anti-miR-203 suppresses cell proliferation of breast cancer cells. [score:3]
Therefore, miR-203 may exert both tumor suppressor and tumor promoting functions depending on the cellular milieu. [score:3]
Our in vitro data revealed that miR-203 expression is associated with proliferation of breast cancer cells. [score:3]
miR-203 suppresses SOCS3 in ER -positive breast cancer tissues. [score:3]
For stable cell line preparation, MCF-7 and ZR-75-1 cells were transduced with replication -deficient lentivirus expressing anti-miR-203 and control miR. [score:3]
We next investigated whether inhibition of miR-203 could also suppress tumor progression in vivo. [score:3]
ERK-c-myc signaling pathways are inhibited by anti-miR-203 in breast cancer cells. [score:3]
On the other hand, recent report showed that miR-203 expression increased the proliferation, migration and invasion of pancreatic cancer cells [32]. [score:3]
Further, our results are in agreement with the earlier miR-203 expression data in primary human breast cancer tissues [10, 11]. [score:3]
We have shown previously that miR-203 is highly expressed in breast cancer tissues and ER -positive breast cancer cell lines [10]. [score:3]
RNA from ER -positive breast cancer tissues displayed altered miR-203 expression levels compared to those of ER -negative breast cancer tissues (Figure 5, panel A). [score:2]
Based on our results, we proposed a novel molecular mechanism of miR-203 in regulation of breast cancer cell growth and stemness (Figure 8). [score:2]
We next examined the effect of miR-203 inhibition in the self-renewal capacity of breast cancer stem cells using a well-established mammosphere formation assay. [score:2]
Interestingly, mammospheres from control cells were larger in size and grew more rapidly as compared to those generated from anti-miR-203 expressing cells. [score:2]
We observed that miR-203 expression is higher in ER -positive breast cancer as compared to normal tissue, but lower in ER -negative breast cancer tissues. [score:2]
Subsequently, we studied whether knockdown of miR-203 plays a role in the stemness of breast cancer cells. [score:2]
The number of mammospheres was significantly lower in anti-miR-203 expressing cells as compared to control cells (Figure 7, panel A). [score:2]
We observed that inhibition of miR-203 caused a significant decrease in the rate of cell proliferation in MCF-7-antimiR-203 and ZR-75-1-antimiR-203 cells as compared to control cells (Figure 1, panels A & B). [score:2]
To investigate whether miR-203 mediated cell proliferation involves the expression of key cell cycle regulatory proteins, we performed Western blot analysis of cyclin D1 and p21. [score:2]
Our results showed that anti-miR-203 decreased cyclin D1 and increased p21 expression levels in MCF-7-antimiR-203 and ZR-75-1-antimiR-203 cells as compared to control cells (Figure 1, panels C & D). [score:2]
Further study needs to be focused on the miR-203-SOCS3 axis for development of additional therapeutic approaches against breast cancer. [score:2]
There is estrogen responsive element in miR-203 promoter sequences [33]. [score:1]
Therefore, it is possible that ER transcriptionally enhances miR-203 in ER -positive breast cancer cells. [score:1]
These results suggested that miR-203 plays a role in self-renewal capacity of breast cancer stem cells. [score:1]
However, the role of miR-203 in breast cancer stemness was never been studied. [score:1]
To our knowledge, this is the first study showing the role of miR-203 in ER -positive breast cancer stemness. [score:1]
We observed that anti-miR-203 in breast cancer cells alters tumor growth. [score:1]
To investigate the role of miR-203 in breast cancer stemness, we examined the expression of Nanog and Oct4 (stem cell markers) in control or MCF-7-antimiR-203 and ZR-75-1-antimiR-203 cells by Western blot analysis. [score:1]
A comparison of miR-203 levels in normal breast tissues, ER -positive and ER -negative breast cancer tissues (n = 5) are shown using scattered plot. [score:1]
[1 to 20 of 65 sentences]
5
[+] score: 227
In this study, using a well-studied murine mo del of human schistosomiasis, we show that Schistosoma infection down-regulates the miR-203-3p expression, and that IL-33, an inducer of type 2 immunity, is a direct target of miR-203-3p in hepatic stellate cells. [score:9]
Having found that IL-33 is a target of miR-203-3p and that elevation of miR-203-3p leads to a reduction of IL-13 in the liver, we hypothesized that down-regulation of miR-203-3p during the progression of hepatic schistosomiasis could lead to higher expression of IL-13 in ILC2s via increased levels of IL-33 in HSCs. [score:8]
Taken together, these data indicate that miR-203-3p regulates the expression of IL-13 in ILC2s by targeting IL-33 in HSCs, thus modulating the expression of ECM by HSCs, during the progression of hepatic schistosomiasis. [score:8]
Here, we created a schematic diagram showing the molecular mechanism underpinning the regulation of type 2 pathology after infection by miR-203-3p (Fig 6): The toxic challenge derived from parasite eggs trapped in the liver tissue induces the down-regulation of miR-203-3p in HSCs, which relieves the inhibition to IL-33. [score:7]
After 3 days in culture, cells were transfected with 40 nM miR-203-3p mimics, negative control (NC) miRNA mimics, miR-203-3p inhibitors, or negative control (NC) miRNA inhibitors for 48 h, then the expression of IL-33 was detected by qPCR (C) and western blot (D). [score:7]
To test whether IL-33 is a direct target of miR-203-3p, we first generated a reporter construct that contains the firefly luciferase gene fused to the 3’ UTR from Il33 mRNA containing a putative miR-203-3p target site (Fig 4A). [score:6]
Importantly, our data indicate that miR-203-3p targets IL-33, an inducer of type 2 immunity [16, 17], in HSCs to regulate the expression of IL-13 in hepatic group 2 innate lymphoid cells (ILC2s) during infection. [score:6]
We found that, when primary HSCs from uninfected mice were cultured on plastic plates, expression of miR-203-3p in these cells was significantly reduced, while the level of Il33 mRNA was significantly elevated, accompanied by a dramatic increase in collagen expression (S4 Fig). [score:5]
IL-33, an IL-1-related cytokine, is an inducer of type 2 immunity in several organs [18], and is a potential target of miR-203-3p, predicted by TargetScan database. [score:5]
Thus, our study highlights the crucial role of miR-203-3p in the initiation of type 2 pathology during schistosome infection, and suggests miR-203-3p as a potential target for fibrotic diseases. [score:5]
Therefore, miR-203-3p might serve as a useful target in the treatment of these fibrotic diseases. [score:5]
MiR-203-3p targets IL-33 to regulate the expression of IL-13 in hepatic ILC2 cells during infection. [score:5]
As expected, miR-203-3p expression was clearly elevated, while collagen and α-Sma expressions were distinctly reduced in HSCs after rAAV8-pri-miR-203-3p intervention (S2 Fig), suggesting that miR-203-3p could modulate the activation of HSCs in vivo. [score:5]
Our data revealed that, at both the mRNA and protein levels, elevation of miR-203-3p distinctly reduced the expression of IL-33, while depletion of miR-203-3p significantly increased the expression of IL-33 (Fig 4C and 4D). [score:5]
Our data showed that, similar to the expression pattern in whole liver, the expression of miR-203-3p in hepatocytes and HSCs began to decrease at day 42 post-infection, while the level of Il33 mRNA was elevated at the same time (Fig 3C and 3D). [score:5]
Infection induces the down-regulation of miR-203-3p in HSCs, resulting in the elevation of IL-33. [score:4]
1006957.g006 Fig 6 Infection induces the down-regulation of miR-203-3p in HSCs, resulting in the elevation of IL-33. [score:4]
In this study, our data also indicated that IL-33 is crucial for inducing the progression of type 2 pathology after infection, as significant reductions in hepatic fibrosis and IL-13-producing ILC2s were observed upon down-regulation of IL-33 in the liver, which resulted from rAAV8 -mediated elevation of miR-203-3p. [score:4]
, and downregulation of miR-203-3p leads to elevated levels of IL-33 in HSCs, initiating type 2 pathology after infection. [score:4]
However, we provided evidence that human IL-33 is also a direct target of miR-203-3p in the HSCs (S5 Fig). [score:4]
In contrast, mutation of 5 nt in the miR-203-3p seed sequence led to a complete abrogation of reporter inhibition (Fig 4B). [score:4]
Our data showed that significantly decreased miR-203-3p expression and increased collagen and α-Sma expression were observed in the infected mice without rAAV8-pri-miR-203-3p treatment compared with uninfected mice (S2 Fig). [score:4]
Importantly, we show that miR-203-3p targets IL-33, an inducer of type 2 immunity, in HSCs to regulate the expansion and IL-13 production of hepatic ILC2s during infection. [score:4]
This includes miR-203-3p as the most down-regulated [15]. [score:4]
IL-33 is a direct target of miR-203-3p in HSCs. [score:4]
To examine the role of miR-203-3p in schistosomiasis in vivo, mice were first challenged with a lethal dose of S. japonicum cercaria and then intravenously injected with either rAAV8-pri-miR-203-3p vector sustainedly expressing the miRNA, control vector, or PBS at day 10 post-infection. [score:3]
Finally, we analyzed IL-33 levels in primary HSCs from infected livers treated with rAAV8-pri-miR-203-3p, and found that IL-33 expression was markedly reduced (Fig 4E and 4F). [score:3]
1006957.g003 Fig 3(A, B) The expression of miR-203-3p (A) and Il-33 mRNA (B) in the livers during infection was detected by qPCR. [score:3]
Analysis of miR-203-3p and IL-33 expression in the liver during infection. [score:3]
Cells were collected at various time points to detect the expression of Il33 mRNA, Col1α1 mRNA, and miR-203-3p using qPCR. [score:3]
However, the expression of both miR-203-3p and Il33 mRNA in KCs was unchanged during the observed time (Fig 3C and 3D). [score:3]
We found that expression of miR-203-3p began to decrease in the liver at day 32 post-infection, reaching its lowest levels at day 42 and 52 (Fig 3A); in contrast, the level of Il33 mRNA was maintained during the early stage of infection, then significantly elevated by day 42 post-infection (Fig 3B). [score:3]
We also characterized the relative abundance of miR-203-3p and Il33 mRNA in different hepatic cell compartments, and found that, in both the uninfected and infected livers, miR-203-3p was selectively expressed in hepatocytes and HSCs (Fig 3E), whereas Il33 was primarily expressed in HSCs (Fig 3F and 3G). [score:3]
Thus, our study highlights the crucial role of miR-203-3p and its target IL-33 in the initiation of type 2 pathology during schistosome infection. [score:3]
S5 Fig(A) Sequence alignment of miR-203-3p and its target sites in 3’ UTRs of human Il33. [score:3]
We transfected miR-203-3p mimics or inhibitors into primary HSCs from uninfected mice, and quantified the level of IL-33 by qPCR or western blot. [score:3]
Again, the expression of miR-203-3p was significantly increased in the rAAV8-pri-miR-203-3p treated mice (Fig 2B). [score:3]
1006957.g004 Fig 4(A) Sequence alignment of miR-203-3p and its target sites in 3’ UTRs of Il33. [score:3]
Taken together, these results suggest that the activated HSCs in infected livers are a source of IL-33, and that IL-33 is a potential target of miR-203-3p in HSCs. [score:3]
In addition, we detected the expression of miR-203-3p and Il33 during the progression of HSC activation in vitro. [score:3]
For transfection, HSCs were transfected with 40 nM miR-203-3p mimics (Qiagen), miR-203-3p inhibitors (Qiagen), or negative controls at day 3 after seeding using Lipofectamine 3000 (Invitrogen). [score:3]
In addition, we noticed that the target site of miR-203-3p in the 3’UTR of Il33 gene is not conserved from mouse to human. [score:3]
To express miR-203-3p, pri-miR-203-3p fragment was amplified by PCR from C57/B6 mouse genomic DNA using primer pri-miR-203-3pF (5´AACAGGTCCTCGCACAGAGTGCAGCCCGGC 3´) and pri-miR-203-3pR (5´AACAGGTCCTCCACCCCCGCGCCCCTCTCA3´), then cloned into the PpuMI restriction site in the intron of pscAAVCBPI GLuc plasmid [36]. [score:2]
Considering that elevation of miR-203-3p attenuates type 2 pathology, we speculated that miR-203-3p could regulate the initiation of type 2 immunity after infection. [score:2]
In this study, we used a murine mo del of Schistosoma japonicum (S. japonicum) to investigate the role of miR-203-3p, a miRNA down-regulated following infection in the progression of hepatic schistosomiasis [15]. [score:2]
Schematic diagram of the role of miR-203-3p in the initiation of type 2 pathology after infection. [score:1]
The human or mouse wild-type or mutant 3’ UTRs of IL-33 containing the predicted miR-203-3p binding sites were synthesized (South Gene Technology, China) and cloned into the pGL3.0-control vectors according to the manufacturer’s instructions (Promega). [score:1]
Amounts of Col1α1, Col3α1, and α-Sma mRNA were dramatically reduced in livers of mice treated with rAAV8-pri-miR-203-3p (Fig 1G, 1H and 1I). [score:1]
1006957.g001 Fig 1(A) Mice were infected percutaneously with 30 S. japonicum cercariae at day 0 and treated with rAAV8-PI (n = 10) or rAAV8-pri-miR-203-3p vectors (n = 10) at a dose of 1×10 [11] virus genomes, or PBS (n = 10) by tail vein injection at day 10 post-infection. [score:1]
Consistent with the antenuated fibrotic phenotype, a strong reduction in mRNA levels of Il13 and Tgf-β1 was detected in livers of mice treated with rAAV8-pri-miR-203-3p (Fig 1J and 1K). [score:1]
qPCR analysis of levels of miR-203-3p in the liver samples (B). [score:1]
Elevation of miR-203-3p partially reverses schistosome -induced hepatic fibrosis. [score:1]
Moreover, we observed that, following elevation of miR-203-3p in HSCs using rAAV8-pri-miR-203-3p vectors, the number of ILC2s and production of IL-13 in these cells were markedly reduced (Fig 5A and 5B). [score:1]
In addition, we detected the alteration of the cytokines that are associated with type 2 immune response in liver tissues after elevation of miR-203-3p. [score:1]
S4 FigLevels of miR-203-3p, IL-33, and collagen in HSCs during in vitro activation were detected by qPCR. [score:1]
Relationship between miR-203-3p and IL-33 in human system. [score:1]
Validation of the relationship between miR-203-3p and IL-33. [score:1]
This construct was transiently transfected into 293T cells together with miR-203-3p mimics or a negative control miRNA. [score:1]
To analyze the relationship between miR-203-3p and IL-33, we evaluated their expression during the progression of hepatic schistosomiasis. [score:1]
We found that recombinant adeno -associated virus 8 (rAAV8) mediated elevation of miR-203-3p in the liver protected mice from lethal infection through alleviating type 2 pathology. [score:1]
rAAV8 -mediated elevation of miR-203-3p protects mice against lethal schistosome infection by attenuation of type 2 pathology. [score:1]
In this study, we demonstrate that efficient and sustained elevation of miR-203-3p in liver tissues, using the highly hepatotropic rAAV8, protects mice against lethal schistosome infection by alleviating hepatic fibrosis. [score:1]
Production of IL-13 in hepatic ILC2s and STAT6 activation in HSCs after elevation of miR-203-3p in the infected livers. [score:1]
To this end, we isolated primary HSCs from infected mice after administration with vectors to quantify mRNA levels of miR-203-3p, Col1α1, Col3α1, and α-Sma. [score:1]
MiR-203-3p regulates the activation of HSCs. [score:1]
Infected mice received rAAV8-PI or rAAV8-pri-miR-203-3p vectors at a dose of 1×10 [11] virus genomes or PBS by tail vein injection at day 10 post-infection. [score:1]
We observed a marked reduction in luciferase activity in cells transfected with miR-203-3p mimics together with Il33-UTR (Fig 4B). [score:1]
The reduced miR-203-3p leads to elevated levels of IL-33, promoting the expansion and IL-13 production of hepatic group 2 innate lymphoid cells and thus initiating type 2 pathology. [score:1]
293T cells were seeded in 24-well plates, then transfected with 40 nM miR-203-3p or a negative control (Qiagen) and co -transfected with 0.8 μg per well wild-type IL-33 3’ UTR-luc or mutant IL-33 3’UTR-luc, using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. [score:1]
By 6 weeks post-infection, mice receiving rAAV8-pri-miR-203-3p displayed a significant reduction in ECM deposition as shown by hydroxyproline quantification (Fig 1C) and Masson’s trichrome staining (Fig 1D and 1F), whereas the size of hepatic granulomas in all groups was similar as shown by H&E staining (Fig 1E and 1F). [score:1]
Striped bars, uninfected mice (n = 4); white bars, mice receiving PBS (n = 4); grey bars, mice receiving rAAV8-PI (n = 4); black bars, mice receiving rAAV8-pri-miR-203-3p (n = 4). [score:1]
In addition, we investigated the expression of miR-203-3p and Il33 mRNA in different hepatic cell compartments, including hepatocytes, HSCs, and Kupffer cells (KCs). [score:1]
Six of ten mice receiving rAAV8-pri-miR-203-3p survived to the end of the study (i. e. 80 days; Fig 1A). [score:1]
Importantly, rAAV8 -mediated elevation of miR-203-3p in liver tissues protects mice against lethal schistosome infection by alleviating hepatic fibrosis. [score:1]
The infected mice were treated with praziquantel to kill the parasites, then received rAAV8-PI or rAAV8-pri-miR-203-3p vectors at a dose of 1×10 [11] virus genomes or PBS by tail vein infection at day 42 post-infection. [score:1]
Levels of miR-203-3p, IL-33, and collagen in HSCs during in vitro activation were detected by qPCR. [score:1]
We found that a single dose of rAAV8-pri-miR-203-3p protected infected mice from the lethal effect of schistosomiasis. [score:1]
Our data revealed that the level of miR-203-3p in the rAAV8-pri-miR-203-3p treated group was significantly higher than in the control groups (Fig 1B). [score:1]
rAAV8 -mediated elevation of miR-203-3p has therapeutic potential for hepatic fibrosis induced by schistosome infection. [score:1]
Striped bars, uninfected mice (n = 3); white bars, mice receiving PBS (n = 3); grey bars, mice receiving rAAV8-PI (n = 3); black bars, mice receiving rAAV8-pri-miR-203-3p (n = 3). [score:1]
The identity of pri-miR-203-3p was verified by sequencing. [score:1]
Striped bars, uninfected mice (n = 3); white bars, mice receiving PBS (n = 6); grey bars, mice receiving rAAV8-PI (n = 6); black bars, mice receiving rAAV8-pri-miR-203-3p (n = 6). [score:1]
The levels of miR-203-3p, Col1α1, Col3α1, α-Sma, Ifn-γ, Tnf-α, Tgf-β1, Il4, Il5, Il10, Il13, and Il33 were detected using the SYBR Green Master Mix kit (Roche). [score:1]
Elevation of miR-203-3p protects hosts from lethal schistosome infection by relieving type 2 pathology. [score:1]
[1 to 20 of 84 sentences]
6
[+] score: 153
Other miRNAs from this paper: mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-148a, mmu-mir-29c, mmu-mir-34a
However, we found that the inhibition of these two signaling pathways does not affect the miR-203 expression level, indicating that the expression of miR-203 is not regulated by these two signaling pathways in osteoblast differentiation. [score:8]
Using Targetscan and miRBase searches, we identified four miRNA regulatory elements (MREs) (positions 1–4; P1–P4) for miR-203 in the 3'-untranslated region (UTR) of Runx2 mRNA (Figure 3a). [score:6]
Furthermore, our findings suggest that miR-203 functions by inhibiting its direct target Runx2 at the post-transcriptional level. [score:6]
The overexpression of miR-203 suppressed the luciferase activity of the Runx2 3'-UTR reporter genes, whereas mutation within the sequences abolished this repression (Figure 3f). [score:6]
Alizarin red staining revealed that the overexpression of miR-203 inhibited the osteogenic differentiation of the osteoblast cells, whereas the silencing of miR-203 promoted the osteogenic differentiation process (Figures 4a and b). [score:5]
Previously, it has been reported that miR-203 expression is highly inhibited in many tumor cells, 19, 20, 21 indicating that miR-203 has an important role in the initiation, progression and metastasis of tumors. [score:5]
Among the miRNAs, miR-203 exhibited a substantial difference in expression between the two groups, with expression levels approximately 10 times higher in HO specimens than in normal bones. [score:5]
Furthermore, our experimental evidence from in vitro and in vivo studies strongly suggests that Runx2 could be a functional target of miR-203 and may mediate its regulatory role in the development of HO. [score:5]
We observed that the miR-203 expression level was lower and the Runx2 expression level was higher in the recurrent samples (Figure 5d). [score:5]
miR-203 inhibits osteoblastic differentiation by targeting Runx2. [score:5]
Therefore, we posit that the dysregulation of miR-203 leads to the overexpression of Runx2, which activates β-catenin and ERK signaling and promotes the development of HO. [score:5]
However, only expression of miR-203, not the other miRNAs, was negatively correlated with the expression of Runx2 in the HO samples (Supplementary Figure 1B). [score:5]
[39] Our data suggest that downregulated miR-203 may also have an important role in the recurrence of HO. [score:4]
In our study, we found a mechanism by which miR-203 is involved in the regulation of the expression of the Runx2 protein in HO tissues. [score:4]
miR-203 inhibits the development of HO in vivo. [score:4]
miR-203 inhibits the development of HO in vivoWe further verified whether miR-203 had an essential role in vivo. [score:4]
Runx2 is a direct target of miR-203. [score:4]
The increased expression of miR-203 upon transfection was confirmed with a real-time PCR assay (Figure 2b), and the ectopic expression of miR-203 significantly reduced the levels of Runx2, β-catenin and p-ERK 48 h after transfection as shown by densitometric analysis (Figures 2a and c, left panels). [score:4]
However, few reports have focused on the role of miR-203 in the regulation of osteoblast function and the development of HO. [score:3]
miR-203 and Runx2 expression are inversely correlated in HO patients. [score:3]
However, miR-203 did not affect β-catenin (CTNNB1 gene) and ERK (MAPK1 gene) mRNA expression (Figure 2d). [score:3]
These data together suggested that miR-203 inhibited the ERK and β-catenin signaling in a Runx2 -dependent manner. [score:3]
showed that the expression of several miRNAs including miR-203, miR-29c, miR-30c, miR-34a and miR-148a was substantially reduced in the HO samples (Supplementary Figure 1A). [score:3]
To clarify the expression profile of miR-203 during osteoblast differentiation, hFOB1.19 cells were cultured in OM for 21 days. [score:3]
In our study, we found that decreased miR-203 levels accompanied the increased expression of osteoblast differentiation marker genes in patients with elbow HO. [score:3]
To examine the specificity of miR-203, we showed that the miRNA inhibitor antagomiR-203 specifically abolished the luciferase activity (Figure 3d). [score:3]
In our work, we demonstrated that miR-203 is involved in these processes by repressing Runx2 expression at the post-transcriptional level. [score:3]
[28] Our data demonstrate that a change in the miR-203 level results in an altered expression of Runx2. [score:3]
Using non-parametric tests, we found a significant inverse correlation between Runx2 mRNA and miR-203 expression in the HO samples (R [2]=0.6809; Figure 1e). [score:3]
We found that the expression of miR-203 decreased gradually during osteogenesis (Figure 4c). [score:3]
We found that HO specimens from the recurrent patients exhibited a decreased expression of miR-203. [score:3]
Luo et al. [22] has demonstrated that miR-203 represses primary myoblast proliferation and differentiation by targeting c-JUN and MEF2C. [score:3]
Furthermore, the expression of miR-203 after the different in vivo treatments was determined by real-time PCR analysis. [score:3]
Furthermore, our results suggest that the therapeutic overexpression of miR-203 in osteoblasts may reduce HO and even prevent this disorder. [score:3]
Our results provide a new paradigm for the role of miR-203 during the development of traumatic HO. [score:2]
To determine whether miR-203-regulated osteoblast differentiation is Runx2 dependent, we used a Runx2 siRNA to verify the effect of Runx2 on osteoblast differentiation (Figure 4f). [score:2]
We found that cells transfected with the P1 luciferase reporter plus miR-203 exhibited significantly less luciferase activity (Figure 3b). [score:1]
Future studies are required to better define the precise mechanism by which miR-203 and these transcription factors contribute to HO following trauma. [score:1]
[38] Our data demonstrated that HO was significantly reduced when miR-203 levels were enhanced in vivo. [score:1]
HO tissues from the mice treated with agomiR-203 had increased miR-203 levels, whereas treatment with antagomiR-203 resulted in decreased miR-203 levels (Figure 6c). [score:1]
We then determined the intracellular miR-203 levels by real-time PCR analysis after treatment with agomir-203 or antagomir-203 (Supplementary Figure 4E). [score:1]
Furthermore, the effects of miR-203 were completely blocked by Runx2 siRNA transfection, suggesting that the function of miR-203 in osteoblast differentiation is Runx2 dependent (Figure 4g). [score:1]
To obtain the luciferase constructs, Runx2 mRNA 3'-UTRs containing the four miR-203 -binding sequences were amplified by PCR. [score:1]
We further verified whether miR-203 had an essential role in vivo. [score:1]
To investigate the role of miR-203 during osteoblastic differentiation, hFOB1.19 cells were transfected with agomiR-203 or antagomiR-203 to overexpress or silence the miRNA, respectively, and then the cells were cultured in osteogenesis induction medium (OM). [score:1]
A Runx2 3'-UTR luciferase reporter that contains mutated sequences of the miR-203 -binding sites (MUT-Runx2-3'-UTR) was constructed, and hFOB1.19 cells were transfected with agomiR-203 or agomiR-NC (Figure 3e). [score:1]
14, 15 The effects of miR-203 transfection on Runx2, β-catenin and p-ERK levels were analyzed by western blotting (Figure 2a). [score:1]
[1 to 20 of 47 sentences]
7
[+] score: 107
As presented in Table 2, MAPKAPK3 and IL25, the targets of up-regulated miRNA miR-691; SOCS4, the target of up-regulated miRNAs miR-377; CCR10 and NFAT5, the targets of up-regulated miRNA miR-1935; VEGFA, the target of up-regulated miRNA miR-203; and CD40, the target of up-regulated miRNA miR-290-5p, were found to be down-regulated. [score:29]
In this study, the target genes of modulated miRNAs were found to be involved in Jak-STAT signaling, including JAK2 SOCS4, which are targets of miR-377; TYK2 and IL12A, targets of miR-691; IL6, a target of miR-190; IFNAR2, a target of miR-135a*; IFNGR2 and AKT1, targets of miR-290-5p; and SOCS3 and AKT2, targets of miR-203. [score:15]
These included FASL IL18RAP, and KITL, which are targets of miR-377; IL25 IL12A TNFSF14, and CLCF1, which are targets of miR-691; CCR10, a target of miR-1935; CXCL16, a target of miR-190; IL24 IFNG CXCL16, and CD40LG, targets of miR-135a*; IL18R1 CD40 CXCL12, and CSF, targets of miR-290-5p; and IL24 XCL1, and IL12B, targets of miR-203 (Table 1). [score:15]
cDNA samples were diluted 1:80 in nuclease-free water and then PCR was amplified using SYBR Green Master Mix and specific LNA [TM] miRNA primers (Exiqon, Denmark) for mmu-miR-691 (target sequence AUUCCUGAAGAGAGGCAGAAAA), mmu-miR-377 (target sequence AUCACACAAAGGCAACUUUUGU), mmu-miR-1935 (target sequence AGGCAGAGGCUGGCGGAUCUCU), mmu-miR-190 (target sequence UGAUAUGUUUGAUAUAUUAGGU), mmu-miR-203 (target sequence GUGAAAUGUUUAGGACCACUAG), and mmu-miR-145 (target sequence GUCCAGUUUUCCCAGGAAUCCCU). [score:12]
The predicted target genes of five up-regulated miRNAs, miR-691, miR-377, miR-190, miR-203, and miR-1290-5p, and one down-regulated miRNA, miR-145, were found to be involved in other pathways, such as the Adherens junction, Wnt signaling pathway, Axon guidance, cell cycle, TGF-beta signaling pathway, and Focal adhesion. [score:9]
As shown in Table 1, the predicted target genes of six up-regulated miRNAs, miR-691, miR-377, miR-1935, miR-190, miR-203, and miR-135a*, and one down-regulated miRNA, miR-145, were found to be involved in immune-related pathways, such as the Jak-STAT signaling pathway, MAPK signaling pathway, Fc gamma R -mediated phagocytosis and cytokine-cytokine receptor interactions. [score:9]
These included SPRED2, a target of miR-691, MAP3K12, a target of miR-1935, MAPKAPK3 and MAP3K1, targets of miR-290-5p, and MAP3K13 MAP4K3, and MAP3K1, targets of miR-203 (Table 1). [score:9]
To validate the differential expression profiles of miRNAs obtained by microarray analysis, quantitative RT-PCR was performed on six selected differentially expressed miRNAs including miR-691, miR-377, miR-1935, miR-190, miR-203, and miR-145. [score:5]
As shown in Figure 2B, nine miRNAs, miR-691, miR-377, miR-1935, miR-190, miR-1902, miR-135a*, miR-203, miR-2138, and miR-290-5p, were found to be significantly up-regulated. [score:4]
[1 to 20 of 9 sentences]
8
[+] score: 76
This result is in agreement with the predicted target of miR-203 and with the findings of Coleman group that have reported that breast cancer cells with hypermethylated DNA phenotype have DNMT3b overexpression and a downregulation of miR-203 [32, 33]. [score:8]
In order to validate Dnmt3b as miR-203 target, we have transfected cell with miR-203 expressing vector, which promotes Dnmt3b downregulation. [score:8]
The analysis of the expression of other miRNA that potentially targets Mecp2 and Dnmt3b, miR-203, revealed that it was significantly upregulated in 4C3− cells compared with the melan-a and 4C3+ cell lines (Figure 5(a)). [score:7]
This finding supports the hypothesis that miR-203 regulates both genes and might be involved in the induction of the transformed state as only the nonmetastatic cell line showed an upregulation of miR-203 expression. [score:7]
In conclusion, this study demonstrated that miR-203 overexpression promotes Dnmt3b downregulation. [score:6]
A significant downregulation of Dnmt3b at RNA and protein levels was observed (Figure 6), being the first evidence of miR-203 regulating Dnmt3b. [score:5]
To test the hypothesis that miR-203 targets Dnmt3b, we overexpress the miR-203 in melan-a cells. [score:5]
Additionally, miR-203 is also predicted to target Mecp2, showing an inverse correlation of expression between normal melanocytes and nonmetastatic melanoma. [score:5]
Given that miR-26 and miR-29 exhibit expression patterns similar to that of miR-203 in 4C3− cells treated with 5-aza-CdR, it is conceivable that these miRNAs are also epigenetically regulated in these cells. [score:4]
Alternatively, miR-203 could be overexpressed in 4C3− cells as a feedback mechanism to avoid transformation, as miR-203 has been previously described as an antimetastatic agent in human prostate cancer [52]. [score:3]
Additionally, the expression of miR-203 has been inversed correlated to DNMT3B in breast cancer cells [32, 33]. [score:3]
After treatment, increased miR-203 expression was observed in melan-a and 4C3− cells (Figure 5(b)). [score:3]
Additionally, it highlights the importance of miR-26, miR-29, and miR-203 in promoting the imbalanced expression of genes involved in the epigenetic machinery during the malignant transformation of melanocytes. [score:3]
Furthermore, to determine whether miR-26, miR-29 family members and miR-203 could be epigenetically regulated, cells were treated with the hypomethylating agent 5-aza-deoxycytidine (5-aza-CdR). [score:2]
Moreover, miR-203 has been validated as a regulator of Bmi-1, which is a member of the Polycomb repressive complex 1 (PRC1) family of proteins and is also involved in epigenetic modifications [47]. [score:2]
An aliquot of 3,5  μg of PSilencer 4.1-CMV-Puro plasmid containing the sequence of mmu-miR-203 or scrambled was kindly provided by Dr. [score:1]
These results are consistent with the literature reporting that miR-203 is epigenetically silenced in human tumor cells [53, 54]. [score:1]
Taken together, these data suggest that epigenetic alterations that occur early during malignant transformation might be a result from the modulation of miR-26, miR-29, miR-203, and the consequent effects on key genes involved in the epigenetic machinery. [score:1]
Cell Culture, Treatment with 5-aza-CdR, and Transfection with miR-203. [score:1]
miR-203, by its turn, is intergenic and seems to be embedded in a CpG island of 804 bp. [score:1]
[1 to 20 of 20 sentences]
9
[+] score: 57
In conclusion, we present evidence that three miRNAs, miR-203-3p, miR-664-3p and miR-708-5p are robustly associated with median strain lifespan in 6 well-characterized inbred strains of mice, and that both early life (miR-203-3p) and later life (miR-664-3p and miR-708-5p) changes in their expression may modulate the expression of target genes in several very well-known aging and longevity pathways. [score:5]
The p63 and caveolin genes are known to be targets of miR-203-3p 27. p63 is a member of the p53 family of transcription factors and the absence of expression of one of its isoforms, TAp63, has been shown to lead to senescence and premature aging of epidermal and dermal precursors 28. [score:5]
279 miRNAs were found to be expressed above the limit of detection and of these, 5 (miR-297b-5p, miR-708-5p, miR-224-5p, miR-203-3p and miR-327) were shown to be differentially expressed between average-lived and long-lived strains after correction for multiple testing (significance cutoff: p < 0.0002). [score:5]
The lifespan effects of miR-203-3p, miR-664-3p and miR-708-5p are probably mediated by altered regulation of their target genes. [score:4]
Also predicted to be enriched for miR-203-3p, miR-664-3p and miR-708-5p binding sites are the ‘Pathways in cancer (mmu05200)’ pathway, the ‘MAPK signalling pathway (mmu04010), the ‘signalling pathways regulating pluripotency of stem cells (mmu04550)’ pathway and the ‘TGF-beta signalling pathway (mmu04350)’, with 33, 26, 14 and 10 genes targeted respectively (FDR-adjusted p-values = 0.03, 0.005, 0.05 and 0.0001 respectively). [score:4]
The expression of miR-203-3p was negatively correlated with longer lifespan. [score:3]
Analysis of expression in relation to age of the animals revealed that miR-203-3p was not significantly associated with age whereas both miR664-3p and miR-708-5p were positively associated (see Supplementary Table S4). [score:3]
In contrast to miR-203-3p, the changes we noted were most evident in the old animals of the long-lived strains, suggesting that increased expression of miR-664-3p may be a later life effect on longevity. [score:3]
We identified 15 pathways that were predicted to be enriched in miR-203-3p, miR-664-3p or miR-708-5p target genes, many of which are known to be associated with aging or longevity (see Table 2). [score:3]
Our finding of reduced miR-203-3p expression in long-lived mouse strains may be indicative of a phenotype in which cells have greater proliferative and adaptive capacity alongside a reduced propensity to become senescent, all of which could create favorable conditions for increased longevity. [score:3]
Gene set enrichment analysis using the DIANA miRPath webtool 21 reveals 15 pathways that are enriched for miR-203-3p, miR-664-3p and miR-708-5p target genes. [score:3]
Prominent pathways targeted by all 3 miRNAs include the ‘FoxO signalling pathway (mmu04068)’ and ‘mTOR signalling pathway (mmu04150)’, which contain 16 and 11 genes with predicted miR-203-3p, miR-664-3p and miR-708-5p binding sites (FDR-adjusted p-values = 0.02 and 0.01 respectively). [score:3]
For example, Zfhx3, in the ‘pluripotency of stem cells’ pathway is targeted by both mmu-miR-203-3p and mmu-664-3p, one of which is negatively associated with lifespan and the other positively. [score:3]
The observation that many of the pathways implicated contain genes that are known to control shared outcomes such as apoptosis, cell cycle regulation, differentiation, proliferation, cell survival, autophagy and DNA repair adds strength to the hypothesis that miR-203-3p, miR-664-3p and miR-708-5p may have functionality in terms of longevity. [score:2]
MicroRNA miR-203-3p showed significantly reduced expression in both young and old animals of strains of longer lifespan when considered separately, as well as in the analysis of old and young animals of different median strain lifespans combined, after correction for multiple testing (β-coefficients = −0.64, −0.67 and −0.67; p = 4.78 × 10 [−11], 3.60 × 10 [−6] and 4.74 × 10 [−7] for all, young and old analyses respectively, see Supplementary Table S2 and Fig. 1a–c). [score:2]
In comparison with miR-203-3p, miR-664-3p has not been extensively studied, with conflicting conclusions having been drawn by different research groups. [score:1]
miR-203 was also one of the miRNAs demonstrated to be inversely associated with lifespan in a longitudinal study of human serum samples from the Baltimore Longitudinal Study of Aging (BLSA) 32. [score:1]
How to cite this article: Lee, B. P. et al. MicroRNAs miR-203-3p, miR-664-3p and miR-708-5p are associated with median strain lifespan in mice. [score:1]
We found that 3 miRNAs; miR-203-3p, miR-664-3p and miR-708-5p were associated with median strain lifespan (Supplementary Table S2). [score:1]
However, evidence suggests that there are links between both miR-664-3p and miR-203-3p and lifespan in human studies 32 35, suggesting that unrelated strain differences alone probably do not account for our observations, at least for these microRNAs. [score:1]
Here we show that three miRNAs; miR-203-3p, miR-664-3p and miR-708-5p, are significantly associated with strain lifespan in mouse spleen. [score:1]
[1 to 20 of 21 sentences]
10
[+] score: 50
Other miRNAs from this paper: rno-mir-203a, rno-mir-203b
It has been reported that p63 expression is strongly inhibited during low-calcium culture of primary mouse keratinocytes transfected with wild-type miR-203, which indicates that miR-203 regulates p63 by translational suppression [46]. [score:10]
MiR-203 regulates p63 by suppressing translation, and strongly inhibits p63 expression. [score:9]
With regard to early-stage protein expression, we found increased m -RNA transcription in CD29, p63, VEGF-A, sustained expression of high levels of CK15 and low levels of the regulatory factor miR-203, suggesting that the chitin membrane promotes early-stage protein synthesis at the wound surface and enhances the healing speed together with ESCs which is play an important role in this process, perhaps because the signaling molecules secreted by these cells may induce ESCs differentiation, resulting in self-repair and regeneration of tissues after activation. [score:6]
Quantitative RT-PCR was used to analyze the mRNA expression levels of CD29, CK15, p63 and VEGF-A throughout the ESCs -modified chitin membrane skin repair process and to track changes in the regulatory factor microRNA-203 (miR-203). [score:4]
Regulatory factor miR-203 did not show a significant difference between the two groups before day 7, but its expression increased in the group C-CBM at day 28 and the two groups significant difference (P<0.01) (Figure 5B, f). [score:4]
MiR-203 expression is obvious during epidermis differentiation and development. [score:3]
Over-expressed miR-203 reduces Np63 mRNA [45]. [score:3]
After the defects of miR-203, p63 translation in the basal epidermis will increase. [score:3]
If expressed too early in epidermal cells in the basal layer, miR-203 may result in premature differentiation and defects of proliferative potential. [score:3]
MiR-203 targets Np63 mRNA, and acts as a switch in the proliferation and differentiation of keratinocytes in the adult epidermis. [score:2]
MiR-203 is a regulation gene of ESCs differentiation. [score:1]
Therefore, miR-203 is a key molecule controlling the differentiation of keratinocytes from the basal state to the basal layer. [score:1]
Quantitative RT-PCR Analysis and miR-203. [score:1]
[1 to 20 of 13 sentences]
11
[+] score: 50
miR-203 was expressed in all cell types with weak expression in the marginal cells, while miR-145 was expressed in all cell types in the SV with strongest expression in the marginal cells. [score:9]
As shown, the expression levels of miR-342 and miR-455 in SV were significantly downregulated, while miR-29a and miR-203 were upregulated when compared to those of the P21 mice. [score:8]
Among the list, members of the miR-29 family, miR-203, miR-762, and miR-1224, showed upregulation, whereas members of the miR-107 family, miR-127 and miR-130a/b, miR-342-3p, miR-351, miR-379, miR-455, and miR-467a, were downregulated in both strains. [score:7]
Two upregulated (miR-29a and miR-203) and two downregulated (miR-342 and miR-455) miRNAs shown in the microarray analyses were selected for q-PCR analysis. [score:7]
miR-203 exhibited significant upregulation in the LW of both strains, and its expression was confirmed by both q-PCR and in situ hybridization (Figs. 6A, B). [score:6]
In melanocytes, miR-203 acts as a tumor suppressor by inducing senescence, and ABL1 is the target of miR-203, suggesting an anti-proliferative function of this miRNA [41]. [score:5]
Since miR-203 is an anti-proliferative/pro-apoptotic miRNA and was upregulated, it is likely this miRNA is involved in degeneration of the SV. [score:4]
miR-203, a transcriptional target of p53/TA-p73/p63 [37], is an anti-proliferative/pro-apoptotic miRNA involved in regulation of proliferation, differentiation, and apoptosis in several cell types (including epithelia and melanocyte) through p16/Rb and p53 pathways [38], [39]. [score:4]
[1 to 20 of 8 sentences]
12
[+] score: 41
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-101-1, dme-mir-1, dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-101a, mmu-mir-124-3, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-137, mmu-mir-140, mmu-mir-142a, mmu-mir-155, mmu-mir-10b, mmu-mir-183, mmu-mir-193a, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-183, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-222, hsa-mir-223, dme-mir-133, dme-mir-34, dme-mir-124, dme-mir-79, dme-mir-210, dme-mir-87, mmu-mir-295, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, dme-let-7, dme-mir-307a, dme-mir-2c, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-193a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-27a, mmu-mir-34a, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-210, mmu-mir-223, mmu-mir-222, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-411, hsa-mir-193b, hsa-mir-411, mmu-mir-193b, hsa-mir-944, dme-mir-193, dme-mir-137, dme-mir-994, mmu-mir-1b, mmu-mir-101c, hsa-mir-203b, mmu-mir-133c, mmu-let-7j, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, mmu-mir-124b
iso1 had a more pronounced differential expression (i. e. 2-fold upregulation) than hsa-miR-203 (i. e. 1.6-fold change (35)) in PP versus NN. [score:6]
Taken together, the high abundance and upregulation of 5′-isomiRs of hsa-miR-203 and hsa-miR-142 may indicate their functional roles in inflammatory and hyperproliferative phenotype of psoriatic lesions. [score:4]
hsa-miR-203-3p has been found to target, among many other mRNAs, Δp63 that has multiple functions during skin development (53, 54). [score:4]
One prominent example is hsa-miR-203 in which 5′-isomiRs accumulated to more than 40% reads and were more than 2-fold upregulated in psoriasis. [score:4]
Figure 1. (A) miR-203 hairpin with 5′-isomiRs and the major miRNA expressed in human skin. [score:3]
Remarkably, the 3p arm of miR-203 hairpin carried the most abundant 5′-isomiRs, which ranked the 8th of all major miRNAs and miRNA isoforms expressed in human skin (Table 2). [score:3]
Because miR-203 in mammals has been characterized in skin morphogenesis as a repressor in the suprabasal layers of the epidermis (53, 54), the upregulation of hsa-miR-203. [score:2]
One illustrating example is the hsa-miR-203 hairpin (Figure 1), where the arm abundance of 5′-isomiRs on the 3p arm was more than 40% versus 1.3% on the 5p arm. [score:1]
iso1) versus ∼200 reads from the 5p arm (hsa-miR-203. [score:1]
Interestingly, hsa-miR-203. [score:1]
For example, the abundance of the 5′-isomiRs from miR-203-3p accounted for 45.5% of the total miR-203-3p abundance whereas the abundance of the 5′-isomiRs from let-7a-5p was only 0.61% of the total let-7a-5p abundance. [score:1]
The 3p arm of murine mmu-miR-203 hairpin also had a higher 5′-isomiR arm abundance (34.9%) than the 5p arm (2%) (Supplementary Table S3), suggesting that the mechanism of yielding 5′-isomiRs of miR-203 is conserved in mammals. [score:1]
Given that hsa-miR-203-3p. [score:1]
hsa-miR-203, found in suprabasal layers of the epidermis, limits the proliferative potential of keratinocytes and establishes a well-defined boundary between proliferating and terminally differentiating keratinocytes (53, 54). [score:1]
of 5′-isomiR reads Arm abundance hsa-miR-203 GAAAUGU 3p 8 8,774,451 45.5 hsa-miR-140 CCACAGG 3p 37 1,072,944 39.5 hsa-miR-126 GUACCGU 3p 54 776,502 13.8 hsa-miR-199b ACAGUAG 3p 55 724,009 27.0 hsa-miR-101 UACAGUA 3p 57 662,855 27.3 hsa-miR-10a CCCUGUA 5p 59 661,921 22.7 hsa-miR-143 UGAGAUG 3p 69 619,911 1.8 hsa-miR-378a UGGACUU 3p 71 402,197 6.0 hsa-miR-29a UAGCACC 3p 77 334,605 18.1 hsa-let-7a AGGUAGU 5p 89 269,329 0.6 The arm abundance of a 5′-isomiR is the percentage of all reads mapped to one arm that represents the 5′-isomiR. [score:1]
In light of the function of many miRNAs (e. g. miR-203 and miR-142) in skin and psoriasis, DE 5′-isomiRs (such as miR-203-3p. [score:1]
hsa-miR-203-3p and the most abundant 5′-isomiR, hsa-miR-203-3p. [score:1]
The most prominent example was miR-203-3p. [score:1]
The horizontal color lines indicate the annotated major miR-203 (red), and its less abundant 5′-isomiR, miR-203. [score:1]
Indeed, 39 miRNA hairpins, e. g. the hairpin of miR-203, had high 5′-heterogeneities on the 3p arms but low 5′-heterogeneities on the 5p arms, supporting the previous observation of a higher fi delity of Drosha than Dicer (34). [score:1]
Dominance of a 5′-isomiR on one arm over the other of a miRNA hairpin was prominent, exemplified by the 5′-isomiR of hsa-miR-203 (Figure 1B), where more than 8 million reads were from the 3p arm (hsa-miR-203. [score:1]
This is further illustrated by the two sharp boundaries separating major miR-203 and the flanking reads, indicated by the arrows in Figure 1A and the two vertical lines in Figure 1B. [score:1]
[1 to 20 of 22 sentences]
13
[+] score: 39
Specifically, in miR-153 transfected ALCs, the expression of miR-3085 and miR-346 was upregulated compared with negative control siRNA, while the expression of miR-298, miR-135a, miR-376b and miR-203 was downregulated (P < 0.05) (Fig. 3b and). [score:10]
In miR-153 transfected ALCs compared with negative control siRNA transfected ALCs, the expression of miR-3085 and miR-346 was upregulated, while the expression of miR-298, miR-135a, miR-376b and miR-203 was downregulated. [score:10]
The expression of miR-203 did not show any statistically significant changes in response to EMD uptake in either cell mo dels (a, b), and decreased expression of miR-346 was only significant in ALCs (a). [score:5]
The expression of miR-203 did not show any statistically significant changes in response to EMD uptake in either cell mo del; and, decreased expression of miR-346 was only significant in ALCs (Fig. 6a,b and). [score:5]
Additionally, miR-31, miR-21, miR-135a, miR-138, miR-203 and miR-346 showed significantly differential expression patterns between ALCs and LS8 cells (P < 0.05) (Fig. 3a and). [score:3]
MiR-31, miR-21, miR-135a, miR-138, miR-203 and miR-346 showed statistically significant differential expression between the two ameloblast-like cell mo dels. [score:3]
In the significantly enriched functional categories, such as those labeled with ‘endosome membrane’ or ‘lysosomal lumen’, miR-153 together with miR-3085, miR-298, miR-138, miR-135a, miR376b, miR-203 and miR-346 were predicted to be epigenetic regulators involved in endocytosis and endosomal/lysosomal pathways 11. [score:2]
In order to identify that ALCs and LS8 cells are suitable mo dels for investigating the functional role of miR-153, the baseline expression of miR-153 (along with miR-31, miR-21, miR-223, miR-410, miR-3085, miR-298, miR-135a, miR-138, miR376b, miR-203 and miR-346) was quantified by real-time PCR. [score:1]
[1 to 20 of 8 sentences]
14
[+] score: 34
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-132, mmu-mir-133a-1, mmu-mir-136, mmu-mir-144, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-10b, mmu-mir-185, mmu-mir-190a, mmu-mir-193a, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-215, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-144, hsa-mir-152, hsa-mir-127, hsa-mir-136, hsa-mir-146a, hsa-mir-185, hsa-mir-190a, hsa-mir-193a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-337, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-29b-2, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, hsa-mir-337, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-434, hsa-mir-486-1, hsa-mir-146b, hsa-mir-193b, mmu-mir-486a, mmu-mir-540, hsa-mir-92b, hsa-mir-411, hsa-mir-378d-2, mmu-mir-146b, mmu-mir-193b, mmu-mir-92b, mmu-mir-872, mmu-mir-1b, mmu-mir-3071, mmu-mir-486b, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, hsa-mir-203b, mmu-mir-3544, hsa-mir-378j, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-let-7k, hsa-mir-486-2
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
[1 to 20 of 2 sentences]
15
[+] score: 33
It is likely that the downregulation of multiple stemness -inhibitory miRNA including miR-96, miR-183, and miR-203 targets various pluripotent stem cell transcription factors in NPC CSCs. [score:8]
BMI1 is a downstream target of miR-203 [35], which was also significantly downregulated in NPC CSCs (Additional file 1: Figure S1B). [score:6]
Significant downregulation of miR-200a and miR-203 expression was also detected in NPC CSCs (Additional file 1: Figure S1B). [score:6]
Significant downregulation of miR-200a, miR-96, miR-183, and miR-203 expression was found in the nasopharyngeal carcinoma cancer stem-like cells. [score:6]
Several downregulated miRNAs including miR-200a and miR-203 were previously reported to modulate CSC properties in NPC cells [19, 20]. [score:4]
Wellner et al. showed that overexpression of miR-183, miR-203, and miR-200c decreases the sphere-forming capacity of pancreatic cancer cells [12]. [score:3]
[1 to 20 of 6 sentences]
16
[+] score: 31
In this study, we found that the mature form of miR-203, miR-203a-3p, was downregulated in NPC tissues and could suppress cell proliferation and metastasis both in vitro and in vivo. [score:6]
A recent study screened for differentially expressed miRNAs in NPC tissues through high-throughput microarray assays and found that miR-203 may down-regulated in NPC tissues [19]. [score:5]
In the present study, we confirmed that the mature form of miR-203, miR-203a-3p, was down-regulated in both NPC cell lines and tissue samples. [score:4]
MiR-203 has been reported down-regulated in NPC tissues through microarray analysis [19]. [score:3]
Each experiment was independently repeated at least three times MiR-203, which is now named as miR-203a, have been demonstrated to be an important tumor suppressor participating in the pathogenesis of esophageal [24, 33], prostate [23, 34], lung cancers [27, 35] including nasopharyngeal carcinoma [19– 21]. [score:3]
A recent study found that miR-203 reduced radioresistance of NPC cells through inhibiting IL-8/AKT pathway [21]. [score:3]
Recent studies found that miR-203 participated in NPC radioresistance and chemoresistance through negatively-regulate IL8/AKT pathway and ZEB2 [20, 21], respectively. [score:2]
MiR-203 was reported to be down-regulated in NPC tissues through high-throughput microarray assay [19]. [score:2]
Each experiment was independently repeated at least three times MiR-203 was reported to be down-regulated in NPC tissues through high-throughput microarray assay [19]. [score:2]
However, miR-203 expression in nasopharyngeal carcinoma and its biological function on proliferation and metastasis have barely been investigated in NPC. [score:1]
[1 to 20 of 10 sentences]
17
[+] score: 30
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-205, mmu-mir-200a, mmu-mir-200c
It has been reported that the EMT-inducing transcription factors, which suppress the CDH1 expression, are negatively regulated by the miRNAs (miR-200 family, miR-203, and miR-205, etc. ) [score:6]
In our study, elevated expression of miR-203 and miR-205 was detected in the two lines of RICs, suggesting that they might act as tumor suppressors in addition to MET inducers by repressing EMT -associated genes. [score:5]
In accordance with this observation, significant up-regulation of miR-200 family, (miR-200a, -200b, -200c, -141, and -429), miR-203, and miR205 was detected in the RICs from HOC313 cells. [score:4]
The HOC313 RICs showed increased levels of miR-200 family members (miR-200a, -200b, -200c, -141, and -429), miR-203, and miR-205 (Fig 3G), which could down-regulate the SNAI and ZEB families [15– 17]. [score:4]
It has been reported that the down-regulation of miR-203 was observed in some malignant tumor including SCC in head and neck [37– 39]. [score:4]
Rewiring of an epithelial differentiation factor, miR-203, to inhibit human squamous cell carcinoma metastasis. [score:3]
Benaich et al. reported that the incidence of lung metastasis was low when SCC cells over-expressed miR-203 [40]. [score:3]
The OSC-19 RICs showed increased levels of miR-203 and miR-205, although the miR-200 family members were not altered (Fig 4I). [score:1]
[1 to 20 of 8 sentences]
18
[+] score: 28
Evidently, TA-p73/p63 appears to increase E-cadherin expression (a negative regulator of EMT), by suppressing ZEB1/2 through its target miRs, such as miR-192, miR-215, miR-145, miR-203, miR-200b, miR-200c, miR-183, miR-92a/b, miR-132, and miR-30a-e [45]. [score:8]
MiRNAs have been shown to inhibit the expression of the tumor suppressor p53 (miR-125a/b) and p63 (miR-92, miR-21, 302 and miR-203) [Table 3], indicating that Dicer function may be required to generate mature miRNAs. [score:7]
Interestingly, ΔN-p63 expression has shown to be suppressed by miR-203, a transcriptional target of p53/TA-p73/p63 [76] [Figure 3]. [score:7]
In connection with these findings, it has recently been shown that in the absence of Dicer or miR-203, ΔNp63 expression is not switched off in the suprabasal cells of the epidermis [8], indicating that Dicer -mediated miRNA processing is required for the down regulation of ΔNp63. [score:4]
MiRNAs, such as miR-34[a, b, c], miR-203, miR-29, let 7, miR-15, and miR-16, and their processing components have shown to be down regulated in multiple cancers. [score:2]
[1 to 20 of 5 sentences]
19
[+] score: 26
Two independent studies found miR-203 to be significantly upregulated in both ALK(+) ALCL cell lines and primary tumors but not expressed in normal T-cells, the ALK(−) ALCL cell line Mac-1 and ALK(−) primary cases [27, 35]. [score:6]
Compared to ALK(−) ALCLs, miR-203, miR-135b, miR-886-5p/3p, miR-20b, miR-106a and miR-183 were significantly upregulated in ALK(+) ALCLs while others (miR-155, miR-181a, miR-210, miR-29a/b, miR-342-5p/3p, miR-369-3p miR-374a/b, miR-423-5p, miR-625, miR-205, miR-146a and miR-26a) were down-regulated (Table 1). [score:6]
Thus, the decreased expression of miR-181a and the increased expression of miR-203 in ALK(+) ALCL might provide a mechanism by which these tumors escape immune surveillance. [score:5]
Furthermore, miR-203 was identified by Steinhilber and colleagues as part of a signature of three miRNA (miR-181a, miR-146b-5p and miR-203) significantly regulated by the C/EBPβ transcription factor, which is specifically overexpressed in ALK(+) ALCL cell lines and shown to promote tumoral cell proliferation and survival (Table 2 and Table 3). [score:4]
In addition, this miRNA is one of the three miRNA (miR-181a, miR-146b-5p and miR-203) regulated by the C/EBPβ transcription factor. [score:2]
Although its function remains elusive, miR-203 seems to play a role in the immune response through the regulation of SOCS-3 [35]. [score:2]
2.2.4. miR-203. [score:1]
[1 to 20 of 7 sentences]
20
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The top negatively correlated (conserved) mouse miRNAs include miR-30a/d (targets Runx2) [57], miR-148a (targets Met/Snail) [58], miR-503 (targets Bcl-2 and Igf1r, implicated in involution) [59], miR-203 (targets the transcription factor p63) [60] and miR-34a (targets Dll1 and CD44, important for stem cell activity) [61, 62]. [score:11]
Many of these are likely to be relevant to lineage restriction in the mammary gland such as miR-203, which is expressed in luminal cells and targets the basal-restricted genes Snai2 and Trp63 [46– 48]. [score:5]
Zhang Z Zhang B Li W Fu L Fu L Zhu Z Epigenetic silencing of miR-203 upregulates SNAI2 and contributes to the invasiveness of malignant breast cancer cellsGenes Cancer. [score:4]
Ding X Park SI McCauley LK Wang CY Signaling between transforming growth factor beta (TGF-beta) and transcription factor SNAI2 represses expression of microRNA miR-203 to promote epithelial-mesenchymal transition and tumor metastasisJ Biol Chem. [score:3]
In the context of miRNAs that potentially control these pathways, we identified several luminal-restricted miRNAs, including miR-10a, miR-200a/b, miR-203, miR-148a. [score:1]
[1 to 20 of 5 sentences]
21
[+] score: 22
Inhibition of FGF signaling through SU5402 -treated primitive streak regions of chick embryos identified up-regulation of let-7b, miR-9, miR-19b, miR-107, miR-130b, miR-148a, miR-203, and miR-218 and down-regulation of miR-29a and miR-489 (Bobbs et al. 2012). [score:9]
Down-regulation of Dicer1, predicted by miR-152, miR-203 and miR-222, could be a part of a complex regulation related to the global abundance of miRNAs and their requirements for processes such as cell-cycle exit control and onset of cell differentiation. [score:5]
In contrast, expression of miR-9 and miR-203 was induced by FGF2 in lens, although they were induced via inhibition of FGF receptors in the embryonic chick mo del (Bobbs et al. 2012). [score:5]
Ten miRNAs, miR-20b, miR-145, miR-152, miR-155, miR-181a, miR-203, miR-222, miR-301a, miR-324-5p, and miR-351. [score:1]
Similarly, the highest ranking “late” -induced miRNAs, including miR-203, miR-182, miR-181a, miR-369-3p, and miR-29c (Figure 6B), also make the greatest number of connections with the 12 genes analyzed in Figure 6B. [score:1]
Similar analysis of “late” group, including c-Maf, Ets1, N-Myc, Nfat5, and Nfib, yielded 10 miRNAs: miR-20b, miR-145, miR-152, miR-155, miR-181a, miR-203, miR-222, miR-301a, miR-324-5p, and miR-351, with multiple connections. [score:1]
[1 to 20 of 6 sentences]
22
[+] score: 22
Moreover, miR-203 was downregulated in the LSCC tissues, and restored miR-203 expression suppressed cellular proliferation, invasion and induced apoptosis, G1 phase cell cycle arrest of Hep-2 cells through targeting ASAP1 [9]. [score:10]
In addition, low-expressed miR-203 was found in LSCC tissues, and functioned as a tumor suppressor through inhibiting proliferation, invasion and inducing apoptosis of Hep-2 cells, which was mediated by ASAP1 [9]. [score:7]
2011.1571 22139384 9. Tian L Li M Ge J Guo Y Sun Y Liu M MiR-203 is downregulated in laryngeal squamous cell carcinoma and can suppress proliferation and induce apoptosis of tumoursTumor Biol. [score:5]
[1 to 20 of 3 sentences]
23
[+] score: 22
These include on the one hand the up-regulated miRNAs: mmu-miR-342-3p, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-21, mmu-miR-335-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-674 and mmu-miR-379; and on the other hand the down-regulated ones after HFD -induced obesity: mmu-miR-122, mmu-miR-133p, mmu-miR-1, mmu-miR-30a, mmu-miR-192 and mmu-miR-203. [score:7]
Mmu-miR-200b and mmu-miR-200c(members of the mmu-miR-200 family), mmu-miR-203 and mmu-miR-192 target Zeb1 and Zeb2 that regulate epithelial to mesenchymal transition [41] and have recently been implicated in adipogenesis and obesity [42]. [score:4]
The down-regulation of mmu-miR-203 and mmu-miR-192 is described for the first time and warrants further elucidation. [score:4]
On the contrary, the following miRNAs were down-regulated in WAT after HFD feeding: mmu-miR-141, mmu-miR-200a, mmu-miR-200b, mmu-miR-200c, mmu-miR-122, mmu-miR-204, mmu-miR-133b, mmu-miR-1, mmu-miR-30a*, mmu-miR-130a, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-203, mmu-miR-378 and mmu-miR-30e*. [score:4]
The following 22 murine microRNAs were selected for qPCR validation of their expression: mmu-miR-1, mmu-miR-21, mmu-miR-30a*, mmu-miR-30e*, mmu-miR-122, mmu-miR-130a, mmu-miR-133b, mmu-miR-141, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-200b, mmu-miR-200c, mmu-miR-203, mmu-miR-204, mmu-miR-222, mmu-miR-342-3p, mmu-miR-378 and mmu-miR-379. [score:3]
[1 to 20 of 5 sentences]
24
[+] score: 19
One of these pathways involves down-regulation of microRNA-203 (miR-203) by HPV8 E6 by inhibiting EP300 which in turn affects CCAAT/enhancer -binding protein a (CEBPA) transcription factor activity that controls miR-203 expression. [score:8]
Significantly, up-regulation of miR-203 during calcium -induced differentiation is abrogated in HPV8 E6 expressing keratinocytes (Marthaler et al., 2017). [score:6]
Identification of C/EBPalpha as a novel target of the HPV8 E6 protein regulating miR-203 in human keratinocytes. [score:4]
High-level TP63 and low levels of miR-203 were also detected throughout the lesional tissue of an HPV8 positive EV patient (Marthaler et al., 2017). [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 19
We observed a significant reduction in the expression of miR21, miR34a, miR200c, miR203 and miR19a, whereas miR200a, miR200b and miR205 displayed increased expression in HuΔNp63α -expressing 940 cells (Fig. 2I). [score:7]
Importantly, the reduction of miR21, miR19a and miR203, and the increased expression of miR200a, miR200b and miR205 are compatible with a possible reduction in the metastatic potential of 940 cells upon ectopic expression of huΔNp63α, and may explain the indirect regulation of EMT-mediating transcription factors described above. [score:7]
In the present study we show that the experimental deregulation of p63 levels promoted altered expression of various miRNA previously involved in EMT and tumor metastasis, including miR-21, miR-34a, miR-200a, miR-200b, miR-203, miR19a and miR205. [score:4]
These include miR21, miR200 family, miR34 family, miR130a, miR203, miR19a and miR205. [score:1]
[1 to 20 of 4 sentences]
26
[+] score: 19
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
Network analysis of deregulated miRNAs suggested that Ppara may regulate the expression of certain miRNAs, including miR-378, miR-125a-3p miR-20a, miR-203, and miR-101a, after exposure to NP. [score:5]
[1 to 20 of 3 sentences]
27
[+] score: 18
miR-34-5p (B), miR-410-3p (C), miR-449-5p (D) and miR-203 (E) expression, determined by Real-time PCR, was down-regulated in HPCx tumor tissues from gemcitabine -treated mice (p < 0.05). [score:6]
Thus, we identified potential miRNAs related to gemcitabine resistance in a human pancreatic cancer xenograft (HPCx) with miRNA microarray analysis and showed that miR-34-5p, miR-410-3p, miR-449-5p and miR-203 were significantly down-regulated in HPCx tumor tissues from gemcitabine -treated mice. [score:4]
Real-time PCR confirmed that miR-34-5p (Figure 1B), miR-410-3p (Figure 1C), miR-449-5p (Figure 1D) and miR-203 (Figure 1E) were down-regulated in HPCx tumor tissues from gemcitabine -treated mice (P < 0.05). [score:4]
Real-time PCR was used to detect the expression levels of miR-34-5p, miR-410-3p, miR-449-5p, miR-203, HMGB1, ARFIP1, GRIA2, CPEB4, NDFIP2, KLF6, PARG, OTX2, TMEFF2, TRPC1 and KLHL5. [score:3]
In contrast, the chemoresistance to gemcitabine was merely slightly repressed in human PDAC cells treated with miR-34-5p or miR-203 mimics (Supplementary Figure 2). [score:1]
[1 to 20 of 5 sentences]
28
[+] score: 17
The de-regulated miRNAs exhibit a full range of expression levels in normal CNS tissue from miRNAs found at very low abundance in the brain, such as miR-203 which is preferentially expressed in endothelial cells, to highly expressed miRNAs such as let-7b and let-7d. [score:8]
EGR1 is itself a putative target of two miRNAs identified in this study, miR-203 and miR-191. [score:3]
B, Dose dependent reduction in the expression of luciferase activity when HeLa cells are co -transfected with miR-203 and C, co-transfection with miR-191. [score:3]
We used a luciferase reporter assay to determine that miR-191, but not miR-203, is a potential regulator of EGR1, Figure 4. 10.1371/journal. [score:1]
We used a luciferase reporter assay to determine that miR-191, but not miR-203, is a potential regulator of EGR1, Figure 4. 10.1371/journal. [score:1]
The siPORT™ NeoFX™ Transfection Agent kit (Ambion) was used to co-transfect HeLa cells with both the reporter vector and mmu-miR-203 or mmu-miR-191 (Ambion). [score:1]
[1 to 20 of 6 sentences]
29
[+] score: 16
It was proved consistent by both the microarray assay and the real-time PCR that the expression of miR-146a-5p and miR-203-3p were significantly down-regulated and miR-15b-5p expression was significantly up-regulated in the fibrotic liver in mice. [score:10]
In accordance with the microarray assay results, qRT-PCR confirmed that miR-15b-5p was significantly up-regulated, whereas miR-146a-5p and miR-203-3p were down-regulated in fibrosing steatohepatitis. [score:6]
[1 to 20 of 2 sentences]
30
[+] score: 16
For example, miR200 targets snai2, zeb1 and zeb2 mRNA [57– 59] whereas miR203 targets snai1 and zeb2 mRNA [59], and miR34 targets snai1 mRNA [60]. [score:7]
To make our mo delling more insightful, we reduced the complexity by lumping variables into modules corresponding to signalling pathways: the TGF-β pathway (TGFb_pthw consisting of TGFbeta, SMAD), Notch pathway (Notch_pthw, includes activated Notch intracellular domain (NICD), the WNT pathway (WNT_pthw consisting of DKK1, CTNNB1), the p53 pathway (p53, consisting of p53), the p63-p73 proteins (p63_73 consisting of p63 and p73), the miRNA (miR34, miR200, miR203), the EMT regulators (EMT_reg including Twist1, Zeb1, Zeb2, Snai1, Snai2, Cdh2, Vim), E-cadherin (Ecadh with Cdh1), growth factors (GF), the ERK pathway (ERK_pthw: ERK), p21 is included in the CellCycleArrest phenotype, AKT1 module and AKT2 module. [score:2]
2012.58 59 Moes M, Le Béchec A, Crespo I, Laurini C, Halavatyi A, et al (2012) A Novel Network Integrating a miRNA-203/SNAI1 Feedback Loop which Regulates Epithelial to Mesenchymal Transition. [score:2]
miR203 & ! [score:1]
miR203 CellCycleArrest (miR203 | miR200 | miR34 | ZEB2 | p21) & ! [score:1]
miR203 p73 DNAdamage & ! [score:1]
miR203 TGFbeta (ECM | NICD) & ! [score:1]
miR203 SNAI1 (NICD | TWIST1) & ! [score:1]
[1 to 20 of 8 sentences]
31
[+] score: 16
During the whole time course of the mo del, PXN is a potential target of several downregulated (mmu-miR-203, -218, -30b, -30c, -27a and -21) and upregulated (mmu-miR-20b, -466g, -30d and -145) miRNAs. [score:9]
At ST, a decrease in mmu-miR-203 and -1 expression is expected to induce the upregulation of MMP-24 and TIMP-3 (Figure 9). [score:6]
It is of interest that a large number of modulated miRNAs were pointed out to interact with SRC (mmu-miR-197 and -230), CRK and CRKL (mmu-miR-203, -497, -218, -320, -214, -328), and various MAPKs (4 miRNAs for MAPK1, 3, 8 and 14; 7 miRNAs for MAPK9; 13 miRNAs for MAPK7; see Tables S5- S10 for details). [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 15
Other miRNAs from this paper: mmu-mir-204, hsa-mir-203a, hsa-mir-204, hsa-mir-203b
In further support of its pro-tumorigenic properties, Sam68 overexpression may drive tumor progression by downregulating tumor suppressive miRNAs, including miR-203 and miR-204 [13, 16]. [score:8]
In some cancers, high expression of Sam68 correlates with low expression of certain miRNAs shown to target Sam68, such as in the case of miR-203 and miR-204 observed in neuroblastoma and breast cancer, respectively [13, 16]. [score:7]
[1 to 20 of 2 sentences]
33
[+] score: 15
In the context of a putative role of miRNA in pGE, it is noteworthy that several mRNAs, upregulated upon mTEC maturation, showed tissue-specific expression patterns, i. e. being restricted to brain (miR-124 and miR-129), heart (miR-499), testis (miR-202), skin (miR-203) or embryo (miR-467 and miR-302). [score:6]
Moreover, miR-124 and miR-203 have been shown to be upregulated upon terminal differentiation in neurons and keratinocytes, respectively [33, 34]. [score:4]
miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were stably expressed at two- to tenfold higher level in the mTEC [high] subset independent of the maturation marker used for sorting the cells (Fig. 1C). [score:3]
Interestingly, miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were differentially regulated in immature and mature Aire [neg] versus mature Aire [pos] mTEC subsets. [score:2]
[1 to 20 of 4 sentences]
34
[+] score: 14
[24] MiR-146 is upregulated in monocytes in response to LPS and downregulates genes involved in the signal transduction pathway of TLR4 signaling,[15] and miR-203 is enhanced in skin of patients with psoriasis. [score:7]
Based on these results, antagomirs were created against the top-4 upregulated miRNAs in this colitis-transfer mo del (miR-142-5p, miR-146b, miR-203, and miR-223; experiment #2). [score:4]
Several miRNAs were induced in the colon during colitis development, most significantly miR-223, miR-142-5p, miR-146B and miR-203. [score:2]
no cell transfer vehicle/PBS scrambled anti-miR-203 anti-miR-142-5p anti-miR-146banti-miR-223 X X XTo assess clinical impact of blocking selected miRNAs in transfer-colitic mice. [score:1]
[1 to 20 of 4 sentences]
35
[+] score: 14
Overexpression of miR-124 and miR-203 suppressed HCC cell growth in vitro. [score:5]
It has been reported recently that miR-124, and miR-203 may regulate iqgap1 expression in HCC [56]. [score:4]
This study characterized miR-124 and miR-203 as novel tumor-suppressive miRNAs in HCC and may provide an explanation for the observed upregulation of IQGAP1 in human HCC tumors [43]. [score:4]
MiR-124 and miR-203 were identified as epigenetically silenced in HCC as a result of assessment of the methylation status of 43 loci containing CpG islands around 39 mature miRNA genes in a panel of HCC cell lines and noncancerous liver tissues as controls. [score:1]
[1 to 20 of 4 sentences]
36
[+] score: 14
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
A one-base-shift form of miR-203 showed some increased expression in the metastatic line relative to reference miR-203, whereas in the non-metastatic line it showed a lower expression. [score:5]
[1 to 20 of 2 sentences]
37
[+] score: 13
Next, we performed Assay 2 using 54 miRNAs that were predicted to target MYC and found that miR-33b and miR-203 down-regulated the reporter with the MYC 3′UTR downstream (Fig 1C; Supporting Information Fig S1B). [score:5]
Immunoblotting analyses show that down-regulation of c-Myc by miR-33b is dose dependent and miR-203 does not reduce c-Myc protein levels. [score:4]
We performed Assay 1 in 293T cells using hundreds of miRNA minigenes in our genetic library (Lu et al, 2011) and found that 4 miRNAs (miR-33a, miR-33b, miR-212 and miR-203) significantly down-regulated the c-Myc -dependent reporter (Fig 1B; Supporting Information Fig S1A). [score:3]
We did not pursue miR-203, as it did not reduce c-Myc protein levels. [score:1]
[1 to 20 of 4 sentences]
38
[+] score: 12
Small RNA sequencing revealed several transcripts to be slightly regulated: miR-15 (log2 fold change 1.5), miR-383–5p (log2 fold change of 1.3) and miR-146b-5p (log2 fold change of 1.1) were top upregulated candidates, while Gm24706 (log2 fold change of 1.4), miR-7046–3p (log2 fold change of 1.1) and miR-203–5p (log2 fold change of 0.9) were top downregulated transcripts. [score:8]
Top downregulated small RNA candidates in our sequencing analysis were Gm24706, miR-7046-3p and miR-203-5p. [score:4]
[1 to 20 of 2 sentences]
39
[+] score: 12
Blocking iASPP expression allows for differentiation via upregulation of miRs 754-3p and 720, which downregulate ΔNp63 α. Other examples include miR203, which directly targets p63 through its 3′UTR for degradation and promotes differentiation by restricting proliferative potential and promoting cell cycle exit [70]. [score:12]
[1 to 20 of 1 sentences]
40
[+] score: 11
The upregulation of miR-142a and miR-155 in parallel with the down-regulation of miR-203, was confirmed recently by Fernandez et al., in a set of 16 GML cases compared to gastritis cases, (Fernandez et al., 2017). [score:6]
Epigenetic silencing of microRNA-203 dysregulates ABL1 expression and drives Helicobacter -associated gastric lymphomagenesis. [score:4]
MicroRNAs 142-3p, miR-155 and miR-203 are deregulated in gastric MALT lymphomas compared to chronic gastritis. [score:1]
[1 to 20 of 3 sentences]
41
[+] score: 11
The expression of a miR-let-7k, b miR-129-1-3p, c miR-378d, d miR-21a-5p, e miR-29c-3p, f miR-203-3p, g miR-7a-5p in DB/DB groups (white column), db-/db-H [2]O (gray column) and db-/db-AOE (black column) detected by QRT-PCR consist with sequencing. [score:3]
Interestingly, 7 miRNAs (let-7k, miR-378d, miR-129-1-3p, miR-21a-5p, miR-29c-3p, miR-203-3p, and miR-7a-5p) expression was significantly restored after AOE treatment. [score:3]
In them, 9 miRNAs (miR-21a, miR-29c, miR-30a, miR-30b, miR-34a, miR-106b, miR-203, miR-378 and miR-802) had been shown to be related with diabetes or glucose metabolism. [score:1]
miR-203 is modified in diabetic mice, and might responds to hepatic insulin resistance [33, 34]. [score:1]
7 miRNAs (mmu-let-7k, mmu-miR-378d, mmu-miR-129-1-3p, mmu-miR-21a-5p, mmu-miR-29c-3p, mmu-miR-203-3p, and mmu-miR-7a-5p) were selected as candidate and quantified by qRT-PCR. [score:1]
In them, 7 miRNAs (mmu-let-7k, mmu-miR-378d, mmu-miR-129-1-3p, mmu-miR-21a-5p, mmu-miR-29c-3p, mmu-miR-203-3p, and mmu-miR-7a-5p) were identified in both comparison groups (Fig.   2). [score:1]
In them, 4 miRNAs (miR-378d, miR-21a-5p, miR-29c-3p and miR-203-3p) had been shown to be related with renal interstitial fibrosis or glucose metabolism. [score:1]
[1 to 20 of 7 sentences]
42
[+] score: 11
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-126b
In prostate cancer, the upregulation of EZH2 in high grade and metastatic disease represses miR-203, which targets MMSET, explaining, at least in part, MMSET upregulation [59]. [score:11]
[1 to 20 of 1 sentences]
43
[+] score: 11
Silencing PRDM14 reduced the expression of miRNAs upregulated in breast cancer tissues (e. g. miR-106a, miR-149, miR-18a, miR-221, miR-222, miR-224, miR-23a, miR-24, miR-27a/b, and miR-493) and increased expression of those that were downregulated (e. g. miR-15a, miR-150, miR-183, and miR-203). [score:11]
[1 to 20 of 1 sentences]
44
[+] score: 11
While for miR-200b, miR-203 and miR-340 expression was low also in microenvironmental cells, for miR-223 a high expression (10 to 5000 fold increase) was observed in stroma cells compared to breast tumor cells. [score:4]
This approach unravelled a group of six microRNAs, miR-19ab, miR-200bc, miR-203, miR-21, miR-223 and miR-340, predicted to be deregulated during breast cancer progression. [score:2]
In this way, a group of six microRNAs, miR-19ab, miR-200bc, miR-203, miR-223, miR-21 and miR-340 (as from miRBase v13) or miR-19ab-3p, miR-200bc-3p, miR-203a, miR-223-3p, miR-21-5p and miR-340-5p (as from miRBase v20) was revealed. [score:1]
All tumor cells resulted almost empty for miR-223 and miR-340, while showed variable levels for miR-200b and miR-203 and higher levels of miR-19 and miR-21. [score:1]
In this way we identified miR-19ab, miR-200bc, miR-203, miR-21, miR-223 and miR-340 as putative players of breast cancer progression. [score:1]
microRNA precursors: Pre-miR™ microRNA Precursor Molecules for Negative Control#1, Hsa-miR-223 (PM12301) or Hsa-miR-203 (PM10152) and Hsa-miR-196 (PM10068) used as unrelated microRNAs (controls for some experiments). [score:1]
In this way, we used three datasets [37], [38], [39] for microRNA predictions and, once more, miR-19ab, miR-200bc, miR-203, miR-223, miR-21and miR-340 were predicted (Table 1). [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 11
One potential target of miR-203, SOCS-3, is upregulated in psoriatic lesions. [score:6]
As STAT3 is the key transcription factor for FLT3 induced DC production, the increased miR-203 expression may lead to activation of STAT3, and then facilitate pDC and cDC differentiation. [score:3]
MiR-203 is expressed at the highest level in skin keratinocytes. [score:2]
[1 to 20 of 3 sentences]
46
[+] score: 10
On the contrary, miR-203-3p is progressively downregulated in primary prostate tumors, is absent or lowly expressed in bone metastatic PCa cells and metastases, and suppresses Runx2 and other genes that promote PCa metastasis to bone [33]. [score:8]
Of note, several miRNAs reported to regulate Runx1 and/or Runx2, such as miR-135a [50] and miR-203 [33], and are associated with invasive and metastatic PCa trend downwards but do not achieve significant differences between transgenic and non-transgenic animals. [score:2]
[1 to 20 of 2 sentences]
47
[+] score: 10
For example, miR-23 and miR-203 have been shown to enhance radiosensitivity by targeting IL8/Stat3 and IL8/AKT signalling pathway, respectively in nasopharyngeal carcinoma [24, 25]; miR-205 has been reported to function as a tumour radiosensitizer by inhibiting DNA repair pathway via down-regulation of ZEB1 and Ubc13 in breast cancer cells [26]; miR-15a/16 can enhance radiation sensitivity of NSCLC cells by targeting the TLR1/NF-κB signalling pathway [27]. [score:10]
[1 to 20 of 1 sentences]
48
[+] score: 10
We found correlations indicating putative intrathymic functions for some miRNAs, such as miR-183 that direct regulates integrin β1 expression (56), miR-143, suppressing fibronectin directly (57), miR-218 controlling focal adhesion kinase (58), and miR-203 increasing metalloproteinase-1 expression (59). [score:10]
[1 to 20 of 1 sentences]
49
[+] score: 9
Both genes of IL-6 and its downstream target, Akt, were inhibited by miR-203. [score:5]
Since miR-203 was down-regulated at 4-week after fracture in aged female mice, IL-6 signaling was activated in aged female mice at 4-week after fracture (Figure 5). [score:4]
[1 to 20 of 2 sentences]
50
[+] score: 9
In MDA-MB-231 cells expressing the OVOLs, we used to assess expression of miR-200 family members (miR-200a, miR-200b, miR-200c, miR-141, miR-429, miR205, miR-203), relative to controls miR-U6 and miR16. [score:5]
We observed significant upregulation of miR-203 and miR-205 in epithelial cells (Figure 6F). [score:4]
[1 to 20 of 2 sentences]
51
[+] score: 8
Noguchi S. Kumazaki M. Yasui Y. Mori T. Yamada N. Akao Y. MicroRNA-203 regulates melanosome transport and tyrosinase expression in melanoma cells by targeting kinesin superfamily protein 5b J. Investig. [score:5]
MiR-203 reduces melanosome transport and promotes melanogenesis by targeting Kif5b and negative regulation of the CREB1/MITF/Rab27a pathway in melanoma [23]. [score:3]
[1 to 20 of 2 sentences]
52
[+] score: 8
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
[1 to 20 of 1 sentences]
53
[+] score: 8
For example, microRNA-375, miR-29c, miR-195, miR-625, miR-203, miR-302b, miR-133a, miR-101, miR-27a, miR-655 and miR-200b can suppress the growth of ESCC cells by regulating the expression of a variety of molecules, including IGF1R (insulin-like growth factor 1 receptor), cyclin E, Cdc42, Sox2, Ran, ErbB4, FSCN1 and MMP14, enhancer of zeste homolog 2 (EZH2), KRAS, ZEB1, TGFBR2 and Kindlin-2. In this study, we revealed the inhibitory effects of both miR-26a and miR-144 on proliferation and metastasis of ESCC. [score:8]
[1 to 20 of 1 sentences]
54
[+] score: 8
In contrast, expression of miR-203 did not display a statistically significant association with patient prognosis in this cohort (Figure 1D), so we focused our study on the role of miR-148a in metastasis of breast cancer, in particular the triple -negative subtype. [score:3]
Four of these miRNAs, miR-148a, miR-203, miR-200b, and miR-200c, also displayed significantly reduced expression in the MDA-MB-231 cells compared to MCF7-Ras cells, suggesting that they may play roles in modulating metastasis (Figure 1B). [score:2]
Out of these 29 miRNAs detected at comparable levels, six miRNAs (miR-205, miR-200c, miR-200b, miR-148a, miR-203, miR-24) were found to be expressed at markedly lower levels in MDA-MB-231 cells compared to HMEC cells (top 6 miRNAs in Figure 1A). [score:2]
Since two of these miRNAs (miR-148a and miR-203) have not been previously reported to affect metastasis, we determined their clinical relevance by analyzing the survival time of patients with low or high levels of these miRNAs in the TCGA breast cancer patient database (Figure 1C, 1D, and Supplementary Figure 1). [score:1]
[1 to 20 of 4 sentences]
55
[+] score: 7
Anti-miR-203 upregulates SOCS3 expression in breast cancer cells and enhances cisplatin chemosensitivity. [score:6]
Several miRNAs, mir-19b (177), mir-203 (178), and let-7 (179), are predicted to bind SOCS3 transcripts. [score:1]
[1 to 20 of 2 sentences]
56
[+] score: 7
No expression differences were observed in the expression of miR-148a, miR-145 or miR-203 when compared to control vector grafts (Fig. S9). [score:4]
In HPV-infected CC or HNSCC, miR-145, miR-146a, miR-148a, miR-200a, miR-203 and miR-21 (among others) are deregulated, some of them in association with clinical variables [10], [68]– [71]. [score:2]
Figure S9 qRT-PCR for miR-148a, miR-145 and miR-203 miRNAs in E7-transplants. [score:1]
[1 to 20 of 3 sentences]
57
[+] score: 7
Other miRNAs from this paper: mmu-mir-139
miR-203 and miR-139-5p were the most significantly upregulated or downregulated. [score:7]
[1 to 20 of 1 sentences]
58
[+] score: 7
Examples include: inhibition of miR-21 enables to increase gemcitabine sensitivity in cholangiocarcinoma [13] and to suppress the growth of topotecan-recalcitrant MCF-7 cells [14]; miR-203 targets the 3′-UTR of ABL and leads to sensitization of BaF3-BCR/ABL cells to imatinib in chronic myeloid leukemia (CML) [15]; miR-125b attenuated epithelial-mesenchymal transition (EMT), including chemoresistance, migration and stemness in hepatocellular carcinoma (HCC) [16], etc. [score:7]
[1 to 20 of 1 sentences]
59
[+] score: 7
Other miRNAs from this paper: hsa-mir-203a, hsa-mir-203b
Here, the E6 protein has been shown to down-regulate the microRNA-203 that both interferes with cell differentiation and up-regulates ΔNp63, another member of the p53 family. [score:7]
[1 to 20 of 1 sentences]
60
[+] score: 6
The profile of cluster 7, including miR-196a/b and miR-203, showed an inverse pattern to cluster 4, with high expression in early development and gestation followed by low expression in lactation and involution stages. [score:6]
[1 to 20 of 1 sentences]
61
[+] score: 6
In this study, increased expression of miR-203 observed in thyroid cancer cell lines excludes the existence of terminal deletion of chromosome 14. [score:3]
Increased expression of miR-203, which is located downstream of DLK1-DIO3, shows absence of terminal deletion of chromosome 14. [score:3]
[1 to 20 of 2 sentences]
62
[+] score: 6
miR-93, miR-106b, and miR-203 directly bind IL8 mRNA to suppress translation [29, 30]. [score:6]
[1 to 20 of 1 sentences]
63
[+] score: 6
Previous studies have demonstrated that HDAC inhibitors can suppress survivin [38, 39], which has been mechanistically linked to regulation of miR-203 in NSCLC tumor mo dels [40], as well as to activation of AMP-activated protein kinase (AMPK) or the MAPK pathway (P38) in colon cancer mo dels [41]. [score:6]
[1 to 20 of 1 sentences]
64
[+] score: 5
Luo W. Wu H. Ye Y. Li Z. Hao S. Kong L. Zheng X. Lin S. Nie Q. Zhang X. The transient expression of miR-203 and its inhibiting effects on skeletal muscle cell proliferation and differentiation Cell Death Dis. [score:5]
[1 to 20 of 1 sentences]
65
[+] score: 5
MicroRNAs can individually regulate large networks of genes, so the finding that mir-203-3p correlates with the down-regulation of Ppargc1a and Ppargc1b could in theory be due to a secondary effect of mir-202-3p on a different gene. [score:5]
[1 to 20 of 1 sentences]
66
[+] score: 5
Other miRNAs from this paper: hsa-mir-203a, hsa-mir-203b
Recently, Tao et al. (2014) confirmed that RECQL1 silencing by overproduction of miR-203, an miRNA that suppresses the expression of RECQL1, also leads to a strong anticancer effect on squamous carcinoma cells both in vitro and in vivo. [score:5]
[1 to 20 of 1 sentences]
67
[+] score: 5
For example, miR-125a and miR-26a suppress tumor metastasis in hepatocellular carcinoma (HCC) 8, 9, while miR-203 suppresses cell proliferation, migration and invasion in colorectal cancer [10]. [score:5]
[1 to 20 of 1 sentences]
68
[+] score: 5
Targets for two conserved DE miRs are currently not in the TargetScanMouse 7.1 database: mmu-miR-126a-3p and mmu-miR-203-3p. [score:5]
[1 to 20 of 1 sentences]
69
[+] score: 5
By contrast, some miRNAs that are significantly up-regulated were also observed, including miR-290 cluster members, miR-291a and miR-291b, miR-129-1-3p, miR-129-2-3p, miR-23a-3p, miR-434-3p, miR-145-5p, and miR-203-3p. [score:4]
Unfortunately, miR-203 and miR-145, which repress pluripotency -associated genes (i. e., Sox2 and Klf4), were also increased for unknown reasons [28]. [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 5
miR-203 and miR-205 expression in esophageal squamous cell carcinoma is significantly lower than in normal epithelial tissues, while the expression of miR-21 is significantly higher than in the normal epithelial tissues [1]. [score:5]
[1 to 20 of 1 sentences]
71
[+] score: 5
miR-203 regulates the epidermal keratinocyte differentiation and directed repression of p63 expression [12, 13]. [score:5]
[1 to 20 of 1 sentences]
72
[+] score: 5
MiRNAs have been found to regulate cell proliferation, differentiation, and apoptosis [15- 17] and they have also been implicated in the regulation of senescence (miR-29, miR-30, miR-34a, miR-34b, miR-34c, miR122 miR-203, miR-205 and miR-217) [18- 23] mostly by interfering with either the p53 pathway or the retinoblastoma RB1/E2F function. [score:3]
MiR -dependent induction of cellular senescence in MM has recently and independently been demonstrated by other researchers for miR-203 and miR-205 in cutaneous MM and for miR-34a in uveal MM [23, 25, 50]. [score:1]
Two independent research groups have reported a miRNA -dependent induction of senescence in MM cell lines with a focus on miR-205/miR-203-E2F axis [23, 25]. [score:1]
[1 to 20 of 3 sentences]
73
[+] score: 5
In addition, interference with the ZEB1 function by the class I HDAC inhibitor mocetinostat led to the restoration of miR-203 expression, repressing stemness properties, and inducing sensitivity to chemotherapy [14]. [score:5]
[1 to 20 of 1 sentences]
74
[+] score: 5
The miRNAs (miR-203, miR-194, miR-98, let-7 g, and miR-155) predicted to have seed sites in the 3’UTR of Rictor were stably over expressed in the ERα [+] MCF-7 cell line and screened by qPCR for Rictor expression levels. [score:5]
[1 to 20 of 1 sentences]
75
[+] score: 4
Moreover, miR-203 is a tumour suppressor identified in LSCC, and it is hypothesized to regulate ASAP1 in relation to epithelial–mesenchymal transition (EMT) and cancer stem cells [46]. [score:4]
[1 to 20 of 1 sentences]
76
[+] score: 4
Identification of C/EBPα as a novel target of the HPV8 E6 protein regulating miR-203 in human keratinocytes. [score:4]
[1 to 20 of 1 sentences]
77
[+] score: 4
In addition, miR-106a, miR-146, miR-155, miR-150, miR-17-3p, miR-191, miR-197, miR-192, miR-21, miR-203, miR-205, miR-210, miR-212, and miR-214 have been reported to be up-regulated in lung cancer [12]. [score:4]
[1 to 20 of 1 sentences]
78
[+] score: 4
Other miRNAs from this paper: mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
Moreover, E. papillata induces an upregulation of the four miRNA species: miR-1959, MCMV-miR-M23-1-5P, miR-203, and miR-21 [25]. [score:4]
[1 to 20 of 1 sentences]
79
[+] score: 4
Other miRNAs from this paper: mmu-mir-143, mmu-mir-23a
Bu P. Yang P. MicroRNA-203 inhibits malignant melanoma cell migration by targeting versicanExp. [score:4]
[1 to 20 of 1 sentences]
80
[+] score: 4
Recently, deregulations of many miRs have been implicated in the growth and metastasis of HCC, such as miR-21 [11], miR-101 [12], miR-124 [13], miR-203 [13], and miR-148 [14], which may be used as potential therapeutic targets or candidates for HCC treatment. [score:4]
[1 to 20 of 1 sentences]
81
[+] score: 4
Another TGFβ pathway miRNA, miR-203-3p, was not upregulated until the Thy1- to SSEA1+ transition, along with the miR-200 family [35]. [score:4]
[1 to 20 of 1 sentences]
82
[+] score: 3
miR-203 can repress p63 expression in supra-basal epithelial cells, contributing to definition of the border between progenitors and differentiated epithelial cells [47]. [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
Although our results confirmed a lower expression of miR-203 and miR-205 in DU145 and PC3 cells, only miR-205 was significantly decreased in LNCaP cells and human PCa samples, in agreement with previous observations [22, 47, 48]. [score:3]
[1 to 20 of 1 sentences]
84
[+] score: 3
In the developing lip, for instance, both miR-203 and members of the miR-302/367 cluster target different isoforms of p63, of which a deletion leads to cleft lip and palate (Warner et al., 2014). [score:3]
[1 to 20 of 1 sentences]
85
[+] score: 3
Altered expression of miR-21, miR-125b, and miR-203 indicates a role for these microRNAs in oral lichen planus. [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 3
Third, Zfp281 has been identified and validated as a top candidate target of the skin microRNA-203, which promotes differentiation and represses stemness in epidermis [21]. [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
Other miRNAs from this paper: mmu-mir-221
Li J. Shan F. Xiong G. Chen X. Guan X. Wang J. -M. Wang W. -L. Xu X. Bai Y. EGF -induced C/EBPβ participates in EMT by decreasing the expression of miR-203 in esophageal squamous cell carcinoma cellsJ. [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
Identification of a common consensus sequence between the regulatory miR-515 and miR-203 family members (below). [score:2]
In addition to the known Wnt-modulatory miRNAs, such as miR-200a [29], [32], Drosophila miR-315 [28], miR-8 [30], miR-27 [31], zebrafish miR-203 [33], and miR-34 [34], we identified 37 additional miRs that modulate the activity of the Wnt-pathway reporter in cultured human cells. [score:1]
[1 to 20 of 2 sentences]
89
[+] score: 3
Furthermore, miR-135 and miR-203 reduce tumor growth and metastasis of MD-MB-231 cells to the bones by targeting the runt-related transcription factor 2 (Runx2) [8]. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 2
The predicted structure of pre-miR-342 with the addition of the in del (rs261236356) is shown at rightSeven other miRNAs had local eQTL: miR-146b, miR-181d, miR-187, miR-203, miR-221, miR-322, and miR-503. [score:1]
The predicted structure of pre-miR-342 with the addition of the in del (rs261236356) is shown at right Seven other miRNAs had local eQTL: miR-146b, miR-181d, miR-187, miR-203, miR-221, miR-322, and miR-503. [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 2
Galectin-7 regulates keratinocyte proliferation and differentiation through JNK-miR-203-p63 signaling. [score:2]
[1 to 20 of 1 sentences]
92
[+] score: 2
MiR-182 and miR-203 are BAT-specific miRNAs, essential for the maintenance and differentiation of brown adipocytes in vivo [21]. [score:1]
However, only miR-203 was conserved in human BAT. [score:1]
[1 to 20 of 2 sentences]
93
[+] score: 2
Other miRNAs from this paper: hsa-mir-203a, hsa-mir-203b
Zhou et al. reported that H. pylori infection caused hepatic insulin resistance by mediating the c-Jun/miR-203/SOCS3 signaling pathway [42]. [score:1]
Zhou X. Liu W. Gu M. Zhou H. Zhang G. Helicobacter pylori infection causes hepatic insulin resistance by the c-Jun/miR-203/SOCS3 signaling pathway J. Gastroenterol. [score:1]
[1 to 20 of 2 sentences]
94
[+] score: 2
Their assignment to specific families is shown in Additional files 2 and 3. After treatment with cytokines for 48 h, 3 miRNAs (miR-146a, miR-203, miR-298-5p) were significantly differentially expressed in αTC1-6 as compared to matched untreated controls (Limma test, Benjamini-Hochberg adjusted p-values < 0.05) (see Additional file 4). [score:2]
[1 to 20 of 1 sentences]
95
[+] score: 2
[40] It was revealed that miR-146, [41] miR-155, [42] and miR-203 [43] regulate arthritic inflammatory response. [score:2]
[1 to 20 of 1 sentences]
96
[+] score: 1
It has been shown that acute stressor exposure modified plasma exosome -associated Hsp72 and microRNA (miR-142-5p and miR-203) [36]. [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
Among these, there were miRNAs with a reported role in smooth muscle (e. g. miR-143 and miR-145) [46] and stem cell differentiation (e. g. miR-106a and miR-203) [47, 48] (Figure 7A, B). [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
Madhavan et al. demonstrated that breast cancer patients that are positive for circulating tumor cells (CTCs) versus patients negative for CTCs had significantly higher levels of miR-141, miR-200a, miR-200b, miR-200c, miR-203, miR-210, miR-375, and miR-801 in their plasma [13]. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
Accumulating evidence has shown a strong connection between miRNA (e. g., miRNA-103 [38], let-7b [39], miRNA-7a [40], miRNA-203 [41], miRNA-219 [24], miRNA-365-3p [27], and miRNA-183 cluster [42]) modulation and pain pathways from primary afferent nociceptors, the DRG, the spinal cord, and brain areas in different pain mo dels. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
At 2 ppm, three miRNAs (miR-142-3p, miR-145 and miR-203) were significantly decreased. [score:1]
[1 to 20 of 1 sentences]