sort by

5 publications mentioning cel-mir-237

Open access articles that are associated with the species Caenorhabditis elegans and mention the gene name mir-237. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 9
In order to examine the specificity of dextran-([as-2'OMe] lin-4) [8 ]in inhibiting lin-4, we prepared two control dextran conjugates, dextran-([as-2'OMe] miR-237) [8 ]and dextran-([s-2'OMe] lin-4) [8]. [score:3]
Sequences of 2'-O-methyl oligoribonucleotides used in this study are: [s-2'OMe] lin-4 (sense): 5' - UCCCUGAGACCUCAAGUGUGA - 3' [as-2'OMe] lin-4 (antisense): 5' - UCACACUUGAGGUCUCAGGGA - 3' [as-2'OMe] miR-237: 5' - AGCUGUUCGAGAAUUCUCAGGGA - 3' [as-2'OMe] let-7: 5' - AACUAUACAACCUACUACCUCA - 3' [as-2'OMe] lsy-6: 5' - CGAAAUGCGUCUCAUACAAAA - 3' [as-2'OMe] miR-84: 5' - UACAACAUUACAUACUACCUCA - 3' [as-2'OMe] miR-42: 5' - UCUGUAGAUGUUAACCCGGUGA - 3' For bioconjugation, an n-hexyl linker containing a disulfide bond (Thio-Modifier C6 S-S, Glen Research, Virginia, USA) was attached to the 5'-end of 2'-O-methyl oligoribonucleotides. [score:1]
Rhodamine-dextran ([Rh]Dextran) or its conjugates of antisense 2'- O-methyl oligoribonucleotides against let-7, lin-4, lsy-6, mir-237 were injected into gonads of N2 worms at three different concentrations. [score:1]
Dextran-([as-2'OMe] miR-237) [8 ]contains 2'-O-methyl oligoribonucleotides complementary to miR-237, a miRNA of the lin-4 family with similar, but not identical, sequence as lin-4. Dextran-([s-2'OMe] lin-4) [8 ]contains lin-4 sequence (sense). [score:1]
Sequences of 2'-O-methyl oligoribonucleotides used in this study are: [s-2'OMe] lin-4 (sense): 5' - UCCCUGAGACCUCAAGUGUGA - 3' [as-2'OMe] lin-4 (antisense): 5' - UCACACUUGAGGUCUCAGGGA - 3' [as-2'OMe] miR-237: 5' - AGCUGUUCGAGAAUUCUCAGGGA - 3' [as-2'OMe] let-7: 5' - AACUAUACAACCUACUACCUCA - 3' [as-2'OMe] lsy-6: 5' - CGAAAUGCGUCUCAUACAAAA - 3' [as-2'OMe] miR-84: 5' - UACAACAUUACAUACUACCUCA - 3' [as-2'OMe] miR-42: 5' - UCUGUAGAUGUUAACCCGGUGA - 3'For bioconjugation, an n-hexyl linker containing a disulfide bond (Thio-Modifier C6 S-S, Glen Research, Virginia, USA) was attached to the 5'-end of 2'-O-methyl oligoribonucleotides. [score:1]
Controls include [as-2'OMe] lin-4, a lin-4 antisense 2'- O-methyl oligoribonucleotide without dextran; D-([s-2'OMe] lin-4) [8 ]and D-([as-2'OMe] miR-237) [8], dextran conjugates containing either lin-4 sense or miR-237 antisense 2'- O-methyl oligoribonucleotide. [score:1]
Among the reagents tested, antisense reagents (antimirs) against lin-4 and mir-237 were best tolerated, with nearly 100% of the embryos hatched normally at 100 μM. [score:1]
[1 to 20 of 7 sentences]
2
[+] score: 1
Loss of certain miRNAs or miRNA families led to hypoxia sensitivity (mir-2, mir-35, mir-44, mir-49, mir-51, mir-60, mir-63 and mir-67) and others to hypoxia resistance (let-7, mir-58, mir-67, mir-79, mir-237, mir-246, mir-359). [score:1]
[1 to 20 of 1 sentences]
3
[+] score: 1
LIN-28 also did not interact with pre-lin-4, pre-miR-237 (a lin-4 relative), pre-miR-1 (an unrelated microRNA), or a control RNA, the Iron Response Element (IRE). [score:1]
[1 to 20 of 1 sentences]
4
[+] score: 1
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-48, cel-mir-84, cel-mir-241, cel-lsy-6
This indicates that STAU-1 could modulate the activity of lin-14, possibly through let-7 family miRNAs or mir-237 (the other member of lin-4 family miRNAs in C. elegans). [score:1]
[1 to 20 of 1 sentences]
5
[+] score: 1
These included miRNAs cel-miR-237, cel-miR-238, cel-miR-229, cel-miR-791 and cel-miR-72. [score:1]
[1 to 20 of 1 sentences]