![]() |
miRBase |
![]() |
![]() |
![]() 5 publications mentioning cel-mir-237Open access articles that are associated with the species Caenorhabditis elegans and mention the gene name mir-237. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary. |
|
1 |
![]()
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-35, cel-mir-41, cel-mir-42, cel-mir-84, cel-lsy-6
In order to examine the specificity of dextran-([as-2'OMe] lin-4) [8 ]in inhibiting lin-4, we prepared two control dextran conjugates, dextran-([as-2'OMe] miR-237) [8 ]and dextran-([s-2'OMe] lin-4) [8].
[score:3]
Sequences of 2'-O-methyl oligoribonucleotides used in this study are: [s-2'OMe] lin-4 (sense): 5' - UCCCUGAGACCUCAAGUGUGA - 3' [as-2'OMe] lin-4 (antisense): 5' - UCACACUUGAGGUCUCAGGGA - 3' [as-2'OMe] miR-237: 5' - AGCUGUUCGAGAAUUCUCAGGGA - 3' [as-2'OMe] let-7: 5' - AACUAUACAACCUACUACCUCA - 3' [as-2'OMe] lsy-6: 5' - CGAAAUGCGUCUCAUACAAAA - 3' [as-2'OMe] miR-84: 5' - UACAACAUUACAUACUACCUCA - 3' [as-2'OMe] miR-42: 5' - UCUGUAGAUGUUAACCCGGUGA - 3' For bioconjugation, an n-hexyl linker containing a disulfide bond (Thio-Modifier C6 S-S, Glen Research, Virginia, USA) was attached to the 5'-end of 2'-O-methyl oligoribonucleotides.
[score:1]
Rhodamine-dextran ([Rh]Dextran) or its conjugates of antisense 2'- O-methyl oligoribonucleotides against let-7, lin-4, lsy-6, mir-237 were injected into gonads of N2 worms at three different concentrations.
[score:1]
Dextran-([as-2'OMe] miR-237) [8 ]contains 2'-O-methyl oligoribonucleotides complementary to miR-237, a miRNA of the lin-4 family with similar, but not identical, sequence as lin-4. Dextran-([s-2'OMe] lin-4) [8 ]contains lin-4 sequence (sense).
[score:1]
Sequences of 2'-O-methyl oligoribonucleotides used in this study are: [s-2'OMe] lin-4 (sense): 5' - UCCCUGAGACCUCAAGUGUGA - 3' [as-2'OMe] lin-4 (antisense): 5' - UCACACUUGAGGUCUCAGGGA - 3' [as-2'OMe] miR-237: 5' - AGCUGUUCGAGAAUUCUCAGGGA - 3' [as-2'OMe] let-7: 5' - AACUAUACAACCUACUACCUCA - 3' [as-2'OMe] lsy-6: 5' - CGAAAUGCGUCUCAUACAAAA - 3' [as-2'OMe] miR-84: 5' - UACAACAUUACAUACUACCUCA - 3' [as-2'OMe] miR-42: 5' - UCUGUAGAUGUUAACCCGGUGA - 3'For bioconjugation, an n-hexyl linker containing a disulfide bond (Thio-Modifier C6 S-S, Glen Research, Virginia, USA) was attached to the 5'-end of 2'-O-methyl oligoribonucleotides.
[score:1]
Controls include [as-2'OMe] lin-4, a lin-4 antisense 2'- O-methyl oligoribonucleotide without dextran; D-([s-2'OMe] lin-4) [8 ]and D-([as-2'OMe] miR-237) [8], dextran conjugates containing either lin-4 sense or miR-237 antisense 2'- O-methyl oligoribonucleotide.
[score:1]
Among the reagents tested, antisense reagents (antimirs) against lin-4 and mir-237 were best tolerated, with nearly 100% of the embryos hatched normally at 100 μM.
[score:1]
[1 to 20 of 7 sentences]
|
2 |
![]()
Other miRNAs from this paper: cel-let-7, cel-mir-2, cel-mir-34, cel-mir-35, cel-mir-38, cel-mir-41, cel-mir-44, cel-mir-49, cel-mir-51, cel-mir-58a, cel-mir-60, cel-mir-63, cel-mir-67, cel-mir-79, cel-mir-86, cel-mir-246, cel-mir-359, cel-mir-1829c, cel-mir-58b, cel-mir-58c
Loss of certain miRNAs or miRNA families led to hypoxia sensitivity (mir-2, mir-35, mir-44, mir-49, mir-51, mir-60, mir-63 and mir-67) and others to hypoxia resistance (let-7, mir-58, mir-67, mir-79, mir-237, mir-246, mir-359).
[score:1]
[1 to 20 of 1 sentences]
|
3 |
![]()
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-1, cel-mir-48, cel-mir-84, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, cel-mir-241, cel-mir-265, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-1-1, cel-mir-793, cel-mir-794, cel-mir-795, cel-mir-1821
LIN-28 also did not interact with pre-lin-4, pre-miR-237 (a lin-4 relative), pre-miR-1 (an unrelated microRNA), or a control RNA, the Iron Response Element (IRE).
[score:1]
[1 to 20 of 1 sentences]
|
4 |
![]()
This indicates that STAU-1 could modulate the activity of lin-14, possibly through let-7 family miRNAs or mir-237 (the other member of lin-4 family miRNAs in C. elegans).
[score:1]
[1 to 20 of 1 sentences]
|
5 |
![]()
Other miRNAs from this paper: cel-mir-36, cel-mir-39, cel-mir-40, cel-mir-41, cel-mir-47, cel-mir-51, cel-mir-53, cel-mir-56, cel-mir-57, cel-mir-58a, cel-mir-61, cel-mir-63, cel-mir-70, cel-mir-71, cel-mir-72, cel-mir-83, cel-mir-86, cel-mir-228, cel-mir-229, cel-mir-230, cel-mir-238, cel-mir-241, cel-mir-243, cel-mir-254, cel-mir-791, cel-mir-58b, cel-mir-4813, cel-mir-58c
These included miRNAs cel-miR-237, cel-miR-238, cel-miR-229, cel-miR-791 and cel-miR-72.
[score:1]
[1 to 20 of 1 sentences]
|