Cel-mir-237, a microRNA identified in Caenorhabditis elegans, has been implicated in the modulation of radiation sensitivity [PMC4247386]. Research indicates that a deficiency in cel-mir-237 is associated with radioresistance, while its overexpression leads to increased radiosensitivity [PMC5173455]. The microRNA appears to regulate the expression of jun-1, a gene that is crucial for cellular survival following γ-irradiation [PMC5173455]. An inverse relationship between the levels of cel-mir-237 and jun-1 has been observed post γ-irradiation, with jun-1 levels rising following a decrease in cel-mir-237 [PMC5173455]. This suggests that cel-mir-237 downregulates jun-1 and that this interaction is important for the cellular response to DNA damage caused by γ-rays [PMC5173455'>PMC5173455]. The human homolog of cel-mir-237, hsa-miR-125b, has also been shown to induce radiosensitivity by targeting JUN proteins in human breast cancer cell lines [PMC5173455]. These findings underscore the potential role of cel-mir-237 and its homologs in influencing radiation response through genetic pathways involving jun family proteins [PMC5173455].
-------------- ca cg C G UU A c a uucua uug uggUCC UGA AA CUCGA CAGCUu aa g ||||| ||| |||||| ||| || ||||| |||||| || aagau aac aCCAGG ACU UU GAGCU GUCgaa uu u caaggguucacuag -- aa A G UU - c g
Accession | MIMAT0000292 |
Description | Caenorhabditis elegans cel-miR-237-5p mature miRNA |
Sequence | 16 - UCCCUGAGAAUUCUCGAACAGCU - 38 |
Evidence |
experimental
cloned [1-3], Northern [1], Illumina [4,6], CLIPseq [5] |
Database links |
![]() |
Predicted targets |
![]() |
Accession | MIMAT0020333 |
Description | Caenorhabditis elegans cel-miR-237-3p mature miRNA |
Sequence | 53 - CUGUCGAGUUUUGUCAAGGACC - 74 |
Evidence |
experimental
Illumina [6] |
Database links |
![]() |
|