Cel-mir-237 is a microRNA (miRNA) that has been identified as a potential predictor of radioresistance [PMC4247386]. It has been found that loss of cel-mir-237 is associated with radioresistance [PMC5173455]. Additionally, there is a temporal correlation between cel-mir-237 and jun-1 expression post-γ-irradiation [PMC5173455]. Experimental studies have shown that cel-mir-237 can alter radiation sensitivity and downregulate jun-1 levels, which is important for cellular survival post-γ-irradiation [PMC5173455]. The expression profile of cel-mir-237 is inversely correlated with jun-1 expression [PMC5173455'>PMC5173455'>PMC5173455'>PMC5173455]. Both cel-mir-237 and hsa-miR125b have been found to induce radiation sensitivity by targeting and downregulating JUN [PMC5173455]. It has been predicted that jun1 is a target of cel-mir-237 based on sequence and conservation analysis [PMC5173455]. The loss of cel-mir-237 protects cells from γ-radiation, while overexpression of cel-miR 237 promotes radiosensitivity in C. elegans nematodes [PMC5173455]. The levels of cel-miR 237 significantly decrease in wild-type N2 animals after γ-radiation treatment, suggesting an active downregulation mechanism to promote survival during and after γ-radiation exposure [PMC5173455].
-------------- ca cg C G UU A c a uucua uug uggUCC UGA AA CUCGA CAGCUu aa g ||||| ||| |||||| ||| || ||||| |||||| || aagau aac aCCAGG ACU UU GAGCU GUCgaa uu u caaggguucacuag -- aa A G UU - c g
Accession | MIMAT0000292 |
Description | Caenorhabditis elegans cel-miR-237-5p mature miRNA |
Sequence | 16 - UCCCUGAGAAUUCUCGAACAGCU - 38 |
Evidence |
experimental
cloned [1-3], Northern [1], Illumina [4,6], CLIPseq [5] |
Database links | |
Predicted targets |
Accession | MIMAT0020333 |
Description | Caenorhabditis elegans cel-miR-237-3p mature miRNA |
Sequence | 53 - CUGUCGAGUUUUGUCAAGGACC - 74 |
Evidence |
experimental
Illumina [6] |
Database links |
|