miRBase entry: cel-mir-237

Stem-loop cel-mir-237


Accession
MI0000312
Description
Caenorhabditis elegans cel-mir-237 precursor miRNA mir-237
Gene
family?
RF03920; mir-237

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. Cel-mir-237, a microRNA identified in Caenorhabditis elegans, has been implicated in the modulation of radiation sensitivity [PMC4247386]. Research indicates that a deficiency in cel-mir-237 is associated with radioresistance, while its overexpression leads to increased radiosensitivity [PMC5173455]. The microRNA appears to regulate the expression of jun-1, a gene that is crucial for cellular survival following γ-irradiation [PMC5173455]. An inverse relationship between the levels of cel-mir-237 and jun-1 has been observed post γ-irradiation, with jun-1 levels rising following a decrease in cel-mir-237 [PMC5173455]. This suggests that cel-mir-237 downregulates jun-1 and that this interaction is important for the cellular response to DNA damage caused by γ-rays [PMC5173455'>PMC5173455]. The human homolog of cel-mir-237, hsa-miR-125b, has also been shown to induce radiosensitivity by targeting JUN proteins in human breast cancer cell lines [PMC5173455]. These findings underscore the potential role of cel-mir-237 and its homologs in influencing radiation response through genetic pathways involving jun family proteins [PMC5173455].

Literature search
5 open access papers mention cel-mir-237
(11 sentences)

Sequence

13091 reads, 287 reads per million, 11 experiments
uucuacauugcguggUCCCUGAGAAUUCUCGAACAGCUucaaaguguucaagCUGUCGAGUUUUGUCAAGGACCaaacaauagaagaucacuugggaac
(((((..(((..((((((.(((.((..(((((.((((((.((....)).)))))))))))..)).))).))))))..))))))))..............

Structure
--------------     ca   cg      C   G  UU     A      c  a 
              uucua  uug  uggUCC UGA AA  CUCGA CAGCUu aa g
              |||||  |||  |||||| ||| ||  ||||| |||||| ||  
              aagau  aac  aCCAGG ACU UU  GAGCU GUCgaa uu u
caaggguucacuag     --   aa      A   G  UU     -      c  g 


Annotation confidence High
Do you think this miRNA is real?
Comments
The sequence is reported to be related to lin-4 [2]. The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [3].

Genome context
chrX: 8154084-8154182 [+]

Database links

Mature cel-miR-237-5p

Accession MIMAT0000292
Description Caenorhabditis elegans cel-miR-237-5p mature miRNA
Sequence 16 - UCCCUGAGAAUUCUCGAACAGCU - 38
Evidence experimental
cloned [1-3], Northern [1], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

Mature cel-miR-237-3p

Accession MIMAT0020333
Description Caenorhabditis elegans cel-miR-237-3p mature miRNA
Sequence 53 - CUGUCGAGUUUUGUCAAGGACC - 74
Evidence experimental
Illumina [6]
Database links

References

  1. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  2. PubMed ID: 12747828
    MicroRNAs and other tiny endogenous RNAs in C. elegans
    "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
    "Curr Biol (2003) 13:807-818

  3. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  4. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  5. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179

  6. PubMed ID: 21307183
    Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer
    "Warf MB, Johnson WE, Bass BL"
    "RNA (2011) 17:563-577