sort by

28 publications mentioning dme-mir-184

Open access articles that are associated with the species Drosophila melanogaster and mention the gene name mir-184. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 18
We also detected a significant increase in steady-state levels of a subset of target mRNAs for several miRNAs implicated in cell proliferation and apoptosis (Reaper, E2f1 and Socs36E as targets for miR-2b, miR-184 and miR-bantam, respectively) (Fig 1H) [34, 35], consistent with the notion that miRNAs repress target gene expression by inhibiting mRNA translation and promoting target mRNA decay. [score:15]
Importantly, levels of several miRNAs, including miR-33, miR-34, miR-276a, miR-317, miR-2b, miR-184 and miR-bantam, were significantly reduced upon SmD1 knockdown (Fig 1B–1G), reminiscent of the phenotype elicited by the loss of the canonical miRNA biogenesis enzyme Drosha. [score:2]
Microprocessor activity associated with the isolated complexes was assessed using pri-miR-184 as substrate. [score:1]
[1 to 20 of 3 sentences]
2
[+] score: 16
Other miRNAs, such as miR-424, miR-184, miR-210, miR-130, miR-494, miR-21 and miR-17 regulate HIFα expression positively through indirect mechanisms [53– 60], which involve inhibition of negative regulators of this transcription factor. [score:8]
Likewise, miR-184 inhibits another cardinal regulator of HIFα: the factor inhibiting HIF-1 (FIH-1), an asparagine hydroxylase that hydroxylates HIFα, thereby inhibiting its association with the p300 transcriptional coactivator [54, 61]. [score:8]
[1 to 20 of 2 sentences]
3
[+] score: 14
It is impossible to determine from this analysis whether microRNAs have acquired more targets in one clade or lost targets in the other, but it is striking that both human homologs of the fly microRNAs miR-184 and miR-210 are expressed at low abundance across many human tissues, while the homologs of miR-10, miR-133, miR-125, let-7, and miR-285 are expressed overall at much higher levels [19]. [score:9]
However, certain microRNAs appear to have a significantly higher number of target genes in either humans (miR-10, miR-133, miR-125, let-7, and miR-285) or flies (miR-184 and miR-210). [score:3]
We singled out three microRNAs (miR-184, miR-304, and miR-210) with a drastically enhanced relative number of targets in flies compared to vertebrates. [score:2]
[1 to 20 of 3 sentences]
4
[+] score: 13
The notion that pasiflora1 and pasiflora2 expression is tightly co-regulated is also supported by the observation that both genes, together with more than half of the known SJ component-encoding mRNAs, are predicted targets of miR-184 (Hong et al., 2009; Iovino et al., 2009). [score:6]
Based on the phenotypic analysis, the expression patterns and the targeting by miR-184, we hypothesized that pasiflora proteins are either SJ components themselves or play a role in complex assembly and/or trafficking. [score:5]
miR-184 has multiple roles in Drosophila female germline development. [score:2]
[1 to 20 of 3 sentences]
5
[+] score: 10
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, dme-mir-1, dme-mir-8, dme-mir-11, hsa-mir-34a, hsa-mir-210, dme-mir-275, dme-mir-92a, dme-mir-276a, dme-mir-277, dme-mir-33, dme-mir-281-1, dme-mir-281-2, dme-mir-34, dme-mir-276b, dme-mir-210, dme-mir-92b, dme-bantam, dme-mir-309, dme-mir-317, hsa-mir-1-2, hsa-mir-184, hsa-mir-190a, hsa-mir-1-1, hsa-mir-34b, hsa-mir-34c, aga-bantam, aga-mir-1, aga-mir-184, aga-mir-210, aga-mir-275, aga-mir-276, aga-mir-277, aga-mir-281, aga-mir-317, aga-mir-8, aga-mir-92a, aga-mir-92b, hsa-mir-92b, hsa-mir-33b, hsa-mir-190b, dme-mir-190, dme-mir-957, dme-mir-970, dme-mir-980, dme-mir-981, dme-mir-927, dme-mir-989, dme-mir-252, dme-mir-1000, aga-mir-1174, aga-mir-1175, aga-mir-34, aga-mir-989, aga-mir-11, aga-mir-981, aga-mir-1889, aga-mir-1890, aga-mir-1891, aga-mir-190, aga-mir-927, aga-mir-970, aga-mir-957, aga-mir-1000, aga-mir-309, cqu-mir-1174, cqu-mir-281-1, cqu-mir-1, cqu-mir-275, cqu-mir-957, cqu-mir-277, cqu-mir-252-1, cqu-mir-970, cqu-mir-317-1, cqu-mir-981, cqu-mir-989, cqu-mir-1175, cqu-mir-276-1, cqu-mir-276-2, cqu-mir-276-3, cqu-mir-210, cqu-mir-92, cqu-mir-190-2, cqu-mir-190-1, cqu-mir-1000, cqu-mir-11, cqu-mir-8, cqu-bantam, cqu-mir-1891, cqu-mir-184, cqu-mir-1890, cqu-mir-980, cqu-mir-33, cqu-mir-2951, cqu-mir-2941-1, cqu-mir-2941-2, cqu-mir-2952, cqu-mir-1889, cqu-mir-309, cqu-mir-252-2, cqu-mir-281-2, cqu-mir-317-2, aga-mir-2944a-1, aga-mir-2944a-2, aga-mir-2944b, aga-mir-2945, aga-mir-33, aga-mir-980
The most highly expressed miRNA in both mosquito species was miR-184, a miRNA conserved from insects to vertebrates. [score:3]
miR-184 was the most highly expressed miRNA in both species, represented by 1,487,481 reads in the Ae. [score:3]
albopictus C710 cells, these two species shared five out of the top ten most frequently occurring miRNAs: miR-184, miR-317, miR-277, miR-275, and miR-8 (Tables 1, 2). [score:1]
To date, miR-184 has been identified in over 39 organisms, but has no defined role in insects. [score:1]
In fact, miR-184 dominated the Ae. [score:1]
Five miRNAs, miR-184, miR-275, miR-277, miR-276, and miR-92, were sequenced >500 times and were readily detectable in total RNA isolated from C7/10 cells (Figure 3A). [score:1]
[1 to 20 of 6 sentences]
6
[+] score: 8
Co-expressed miRNAs can also act competitively, as shown for miR-184 and miR-205 regulation of ship2 [59]. [score:4]
In light of this miR-184 function, systematic assays that have found that many miRNAs when expressed individually have no effect on a 3’UTR reporter do not rule out the possibility that these miRNAs function competitively with others [60, 61]. [score:2]
MicroRNA-184 antagonizes microRNA-205 to maintain SHIP2 levels in epithelia. [score:1]
In this scenario, miR-184 does not have repressive activity itself but alleviates the repressive ability that miR-205 exerts via an overlapping binding site, as shown by comparative analysis of miR-205 alone versus in combination with miR-184 as well as analysis of mutated 3’UTR reporters containing intact miR-205 but mutant miR-184 sites. [score:1]
[1 to 20 of 4 sentences]
7
[+] score: 7
Also, the mir-184 gene has an important role during oocyte development as well as in early development (Iovino et al. 2009). [score:3]
However, for mir-184-3p and mir-995-3p, the pattern was not consistent between RNAseq and qPCR. [score:1]
Although the microRNA level varies substantially across biological replicates, the presence of seven of the maternal microRNAs here described is validated (bantam-3p, mir-311-3p, mir-92b-3p, mir-184-3p, mir-14-3p, mir-995-3p, and mir-9c-5p), although the levels of the latter two were relatively low. [score:1]
One of the most abundant maternal microRNAs, mir-184, has been already described in freshly laid Drosophila eggs (Iovino et al. 2009). [score:1]
The most abundant microRNAs in unfertilized eggs were produced by mir-92b, mir-184, the mir-310/mir-311/mir-312/mir-313 cluster, and bantam genes, which accounted for over half of the microRNA reads. [score:1]
[1 to 20 of 5 sentences]
8
[+] score: 6
Other miRNAs from this paper: dme-mir-2a-1, dme-mir-2a-2, dme-mir-14, mmu-mir-184, hsa-mir-184
Experiments using miR-14 and miR-184 gave similar results (Additional file 5, Figure S5). [score:1]
Mutating miRNA nt 2 in miR-2a and miR-184 influenced the order of preference for nt 1 in flies (Figures 4B and 4C). [score:1]
Hence additional features in the miRNA/miRNA* duplex must influence the order of preference for miRNA nt 1. Mutating the overhanging nucleotide in miR-184* did not alter the efficiency of loading miR-184 (Additional file 7, Figure S7), excluding a role for base pairing between nt 1 and the 3′ overhang of the miRNA*. [score:1]
Strikingly, the order of preference for nt 1 was not the same across the three tested miRNA: miR-2a preferred U > A > C (Figure 3), miR-14 preferred U ~ C > A and miR-184 preferred U ~ A > C (Additional file 6, Figure S6). [score:1]
Changing the 5′-nt of miR-2a (C) or miR-184 (D) into 5′-guanidine (5′-G) decreases miRNA loading (relatively to a 5′-A). [score:1]
The Ago2 loading machinery has a moderate effect on miR-184 loading preferences, while it strongly affects miR-184* loading preferences. [score:1]
[1 to 20 of 6 sentences]
9
[+] score: 5
Phylogenetic analysis, target gene prediction and pathway analysis showed that, among the 13 conserved miRNAs (miR-1, miR-100, miR-10a, miR-124, miR-125, miR-184, miR-33, miR-34, miR-7, miR-9, miR-92a, miR-92b and miR-let7), several highly conserved miRNAs (miR-1, miR-7 and miR-34) targeted the same or similar genes leading to the same pathways in shrimp, fruit fly and human (Figure 3b). [score:5]
[1 to 20 of 1 sentences]
10
[+] score: 5
Other miRNAs from this paper: ame-mir-184
We utilized the processing machinery of pri-dme-mir-184 to express miR162 in Drosophila S2 cells. [score:3]
The 300-bp pri-dme-mir-184 was GTTTTCTATTCACGCTTTAGTGCACTTATTTACTCGATTGTATGATCCAAAGCTCCTCTTTGACTCGCCGAATTCCTGTCGATTCAATGGGTATTGGTTTGGTTGGCCGGTGCATTCGTAC CCTTATCATTCTCTCGCCCCGTGTGCACTTAAAGACA ACTGGACGGAGAACTGATAAGGGCTCGTATCACCAATTCATCCTCGGGTCAGCCCAGTTAATCCACTGATTTGCACACTTTTCTTTATACATACGAGGATACTTACCCCACGTTTCGATTACGCGCATCAATCAATCAATCA, and the underlined parts were replaced with TCGATAAACCTCTGCATCCAG and AATGAATGAGAGGCTTTATCGA, respectively. [score:1]
The miR162a sequence was substituted into a 300-bp pri-dme-mir-184 backbone with structurally conserved nucleotide changes to maintain pairing. [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 5
For example, the target site of C. elegans miR-248 matches the E-box, a site known to be bound by several transcription factors of the basic helix-loop-helix family; similarly, the target site of D. melanogaster miR-184* matches the binding site for GATA factors. [score:5]
[1 to 20 of 1 sentences]
12
[+] score: 5
We also observe that the most abundant microRNAs (bantam-3p, bantam-5p, miR-184-3p, miR-33-5p, miR-8-3p) repress their targets by similar amounts, despite representing a more than 30-fold difference in expression. [score:5]
[1 to 20 of 1 sentences]
13
[+] score: 4
Among the highly expressed; bantam, miR-184, miR-81, miR-100, miR-92, miR-2766, miR-279 are listed in the top (S1 Table) and these findings are in concurrence with recent reports [19]. [score:3]
The miRs (sfr-mir-305-5p, sfr-mir-307-3p, sfr-mir-71-3p, sfr-mir-281, sfr-mir-317, sfr-mir-2756, sfr-mir-932, sfr-mir-184-3p, sfr-mir-2766, Novel_miR15, Novel_miR16, and Novel_miR17) were easily detectable in total RNA isolated from Sf21 cells (Fig. 4). [score:1]
[1 to 20 of 2 sentences]
14
[+] score: 4
Other miRNAs from this paper: dme-bantam, dme-mir-972, dme-mir-975, dme-mir-977
Furthermore, mir-977 has higher expression variance in the testes of multiple D. melanogaster lines than the conserved miRNAs that have important developmental functions (miR-184, bantam etc. [score:4]
[1 to 20 of 1 sentences]
15
[+] score: 4
Moreover, miR-184 down-regulates the BMP receptor Saxophone in posterior cyst cells [41]. [score:4]
[1 to 20 of 1 sentences]
16
[+] score: 3
This is complemented by dSmurf -mediated degradation of Mad (Casanueva and Ferguson, 2004; Chen and McKearin, 2005), and the control of expression and localization of the Dpp receptor Saxophone by miR-184 in differentiating cells (Iovino et al., 2009). [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
We also performed analogous experiments in Drosophila S2R+ cells with two predicted targets of miR-184 (PCK and CG13088), and revealed that both of these MREs are functional in this cell type (Supplementary Fig. 1). [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
However, for simplicity in this network, Ago represents the overall function of Argonaute-1 and miR-184 and is regulated by Mei-P26. [score:2]
In the Argonaute mediated network Ago, feedback is hypothetically mediated by the observed Mei-P26 repression of miRNA levels (interacting with Argonaute-1) [14], taking effect through miR-184, which represses a Dpp receptor as well as pMad signaling [34]. [score:1]
[1 to 20 of 2 sentences]
19
[+] score: 2
In both strains, miR-184-3p miRNA was the most abundant among the means of non-normalized reads across triplicate libraries, with miR-8-3p, miR-276a-3p, bantam-3p, and miR-33-5p as the next most abundant miRNAs in both strains (Table 2). [score:1]
MicroRNAs mir-184 and let-7 alter Drosophila metabolism and longevity. [score:1]
[1 to 20 of 2 sentences]
20
[+] score: 2
The phylogenetic tree for the mir-1 and mir-184 miRNA family is shown in Figure 6; other detailed results are listed in Additional file 4. Figure 6Phylogenetic tree of the mir-1 family and the mir-184 family. [score:1]
The phylogenetic tree for the mir-1 and mir-184 miRNA family is shown in Figure 6; other detailed results are listed in Additional file 4. Figure 6Phylogenetic tree of the mir-1 family and the mir-184 family. [score:1]
[1 to 20 of 2 sentences]
21
[+] score: 2
Proc Natl Acad Sci U S A 44 Iovino N Pane A Gaul U 2009 miR-184 has multiple roles in Drosophila female germline development. [score:2]
[1 to 20 of 1 sentences]
22
[+] score: 2
miR-184 has multiple roles in Drosophila female germline development. [score:2]
[1 to 20 of 1 sentences]
23
[+] score: 1
Among the old microRNAs, we have the mir-92, mir-184 and mir-9 families, which are conserved even in chordates. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
Practically all canonical miRNAs reported by Cristino et al. [14] are present (except miR-1-5p and miR-184-5p), and are the most abundant in the present libraries. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
For instance, dme-miR-263-5p, 5-5p and 9c-5p are primarily found in the mRNP fraction whereas dme-miR-184-3p is mainly part of polysomal fractions. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
Other miRNAs from this paper: hsa-mir-92a-1, hsa-mir-92a-2, dme-mir-92a, dme-mir-310, hsa-mir-184
included Ub-GAL4, UAS-mir-92a, UAS-dsRed, UAS-mir-184 and psiCHECK2. [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
Other miRNAs from this paper: dme-mir-7, dme-mir-275, dme-bantam, dme-mir-310
For example, miR-184 (Iovino et al. 2009) and bantam (Yang et al. 2009) are both required to balance GSC maintenance vs. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
Ame-mir-184 had the highest read count of any miRNA in our small RNA library (Table 1). [score:1]
[1 to 20 of 1 sentences]