sort by

16 publications mentioning dme-mir-279

Open access articles that are associated with the species Drosophila melanogaster and mention the gene name mir-279. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 279
Other miRNAs from this paper: dme-mir-286, dme-let-7, dme-mir-996
In either case, we conclude that this dramatic, fully-penetrant, neural cell specification phenotype requires the joint activity of the miR-279 and miR-996 miRNAs, and that either miRNA suffices to direct normal development of these neurons via joint repression of shared critical target genes. [score:5]
mir-279[ex117] expressed <10% the normal level of miR-996, and mir-279[ex36] did not detectably express miR-996 (Fig 2B). [score:5]
Note that the expression level for both miRNAs is copy-number dependent, since heterozygous mir-279/996[ex15C] flies expressed roughly half of both miRNAs compared to wild type animals. [score:4]
In more stringent assays, we then showed that single insertions of either "1x" transgenes, recapitulating mir-279 -knockout and mir-996 -knockout conditions, similarly provided essentially full suppression of the double deletion phenotype (Fig 4E and 4F). [score:4]
Although CO [2]-sensing neurons comprise only a small number of cells in the nervous system, we were able to detect massive derepression of nerfin-1 (Fig 4H) and substantial upregulation of escargot (Fig 4I) transcripts in whole mir-279/996[ex15C/ex15C] adult heads, relative to Canton S control heads. [score:4]
Altogether, these data indicate that intact mir-996 expression fully complements loss of mir-279 in both nervous system development and adult neurophysiology. [score:4]
Strikingly, endogenous expression of only a single copy of either 1x-mir-279 or 1x-mir-996 transgenes in the double mutant, thus recapitulating full knockout of either miRNA on top of heterozygosity for the other, was sufficient to rescue adult viability (Fig 3C). [score:4]
1005245.g002 Fig 2Severe loss of mature miR-996 expression in mir-279 deletion alleles. [score:3]
We tested 3' UTR sensors for nine genes bearing conserved miR-279 family target sites, including all of those identified in previous in vivo studies. [score:3]
Analysis of capped analysis of gene expression (CAGE) data revealed a 5' transcription start site ~1kb upstream of the mir-279 hairpin. [score:3]
Our small RNA analyses showed that miR-279 and miR-996 belong to the same expression cluster across diverse Drosophila tissue and cell line small RNA libraries [31], indicating their coordinate deployment. [score:3]
The 3' UTRs of Hairless and predicted miR-279 target genes were cloned between the XhoI and NotI sites of a modified psiCHECK-2 vector [65]. [score:3]
Surprisingly, we find that the phenotypes attributed to mir-279 deletions depend on the unanticipated loss of expression of the downstream locus mir-996, whose genomic locus is retained in extant mir-279 mutants. [score:3]
Severe loss of mature miR-996 expression in mir-279 deletion alleles. [score:3]
These defects are comparably rescued by mir-279-2x or mir-996-2x transgenes as they are by wildtype mir-279/996 genomic transgene, to target levels that are slightly higher than in Canton S heads but similar to [ex15C]/+ heads. [score:3]
While manipulation of these various targets can substantially rescue setting-specific phenotypes caused by loss of miR-279 and miR-996, none of them rescue the extremely abbreviated lifespan of the double mutant. [score:3]
In particular, mir-279[ex117] (which retains some expression of miR-996) exhibits a weaker GR21 phenotype than mir-279[ex36] or mir-279/996[ex15C] (which are nearly null or definitively null for both miRNAs, respectively) under clonal conditions (Fig 1F– 1H). [score:3]
The ectopic CO [2] neuron phenotype was shown to be driven by derepression of specific miR-279 targets, namely the transcription factors encoded by nerfin-1 and escargot [18, 23]. [score:3]
In fact, under these non-clonal conditions, this genuine double deletion mutant exhibited slightly stronger phenotypes than either of the shorter deletions that physically remove only mir-279 but compromise mir-996 expression (Fig 4G). [score:3]
mir-996-2x expressed only comparable amount of miR-996 as mir-279/996-wt and mir-996-1x transgenes. [score:3]
In the mir-279/996[ex15C] homozygous background (which is normally mostly lethal by ~4 days), expression of only a single 1x-mir-279 (I) or single 1x-mir-996 (J) transgene can restore normal rhythmic behavior in constant darkness. [score:3]
Unanticipated effects of mir-279 deletions on mir-996 expression. [score:3]
mir-279[ex36] removes sequence upstream of the promoter, presumably explaining why this allele strongly compromises expression of the downstream miRNA. [score:3]
We then deleted the rpsL-neo cassette from the targeted construct by BbvCI digestion and the remaining vector was re-ligated to generate the mir-279-1x or mir-996-1x construct. [score:3]
Intensities of miR-279 and miR-996 expression were quantified by normalization to homozygous wild type and marked below each lane. [score:3]
We verified comparable ectopic expression of both miR-279 and miR-996 in these transfection experiments (Fig 6B). [score:3]
On the other hand, miR-279/996 have substantial effects on different aspects of the JAK-STAT signaling pathway in circadian pacemaker cells and ovarian border cells, by targeting the ligand unpaired [24] and the transcription factor STAT [25], respectively. [score:3]
In accordance with previous studies [24], overexpression of miR-279 in circadian tissues strongly disrupted the adult behavioral rhythm. [score:3]
S2 FigSevere loss of mature miR-996 expression in mir-279 deletion alleles. [score:3]
Based on the degree of misregulation, we infer that miR-279/996 must regulate nerfin-1 outside of the CO [2]-sensing apparatus. [score:3]
In this setting, the transcription factors encoded by nerfin-1 and escargot are critical miR-279 targets [18, 23]. [score:3]
For example, the transcription factors encoded by nerfin-1 and escargot are the critical miR-279/996 targets whose de-repression induces ectopic CO [2]-sensing neurons, and whose heterozygosity confers substantial rescue of ectopic CO [2]-sensing neurons in flies that lack these miRNAs [18, 23]. [score:3]
The mir-996[ex310] homozygous mutant lacked mature miR-996, validating its nature as a null allele and demonstrating specificity of the miR-996 probe; this mutant expressed miR-279 normally (Fig 2A). [score:3]
The mir-279 or mir-996 hairpins were targeted with an rpsL-neo cassette (Gene Bridges), which was flanked by the ~50bp left and right homology arms for the miRNA and carried two BbvCI restriction sites between the rpsL-neo cassette and the homology arms. [score:3]
Both mir-279 "single" alleles and the mir-279/996 double deletion failed to express mature miR-279, as expected, but all of these mutants also proved deficient for miR-996. [score:3]
Coexpression of miR-279 and miR-996. [score:3]
However, our studies unexpectedly reveal that all mir-279 single deletion mutants affect the expression of miR-996. [score:3]
Circadian rhythm defects upon overexpression of miR-279 family miRNAs. [score:3]
On the other hand, mir-279[ex117] deletes to within 14 nt of the transcription start site (Fig 1A), which does not abolish, but apparently debilitates expression and/or processing of the intact mir-996 hairpin. [score:3]
Unanticipated effects of mir-279 deletions on mir-996 expressionWhile the initial genetic data were reasonably explained by phenotypic dominance of miR-279, certain other observations remained difficult to account for. [score:3]
These tests demonstrated specific expression of mature miR-279 and miR-996 in the designated genotypes (Fig 1A). [score:3]
S1 TablePrimer sequences used to clone mir-279/996 rescue transgenes and mir-279/996 luciferase sensor constructs, and quantify target genes. [score:2]
Circadian activities were also recovered by each member of a mutant transgene panel (as detailed in the inset box) bearing reciprocal substitutions of mir-279 or mir-996 into the other hairpin locus (mir-279-2x, D and mir-996-2x, E), as well as by knockout transgenes for either miRNA (mir-279-1x, F and mir-996-1x, G). [score:2]
Primer sequences used to clone mir-279/996 rescue transgenes and mir-279/996 luciferase sensor constructs, and quantify target genes. [score:2]
In this study, we generated single and double mutants of mir-279 and mir-996, and cursory examination suggested that miR-996 was dispensable for overt development and behavior, while miR-279 was essential. [score:2]
Altogether, these studies highlight diverse requirements for miR-279 in development and behavior. [score:2]
Our studies of miR-279 and miR-996 provide a new testbed for this, since this locus is responsible for several of the most overt developmental and behavioral phenotypes ascribed to animal miRNAs. [score:2]
1005245.g006 Fig 6(A) Luciferase sensor assays in S2 cells indicated that 3' UTRs of multiple miR-279 targets are all additionally responsive to miR-996. [score:2]
The evidence gathered indicates that miR-279 and miR-996 play surprisingly similar roles in diverse developmental and behavioral settings. [score:2]
Although the stringent evolutionary conservation of these miRNAs is de facto evidence that they are not truly "redundant", we demonstrate using precise genetic engineering that single genomic copies of either mir-279 or mir-996 can fully compensate for the deletion of all four miRNA alleles in diverse developmental and physiological settings. [score:2]
A plausible mo del was that mir-279[ex36] bears an unlinked mutation responsible for its stronger defects. [score:2]
Amongst the small number of miRNA knockouts that exhibit substantially overt phenotypes, mutants of Drosophila mir-279 are notable. [score:2]
Consideration of current modENCODE transcriptomic data at the mir-279/996 region proved informative (Fig 1). [score:1]
Zoom-in of the 5' breakpoint of the mir-279[ex117] deletion shows it removes sequence just downstream of the CR31044 TSS, leaving the putative TATA box intact. [score:1]
Altogether, these findings were consistent with an interpretation that miR-279 is primarily responsible for essential genetic requirements of this two-miRNA locus. [score:1]
The mir-996 hairpin is located ~1.5 kb downstream of the mir-279 hairpin (Fig 1A). [score:1]
Nevertheless, each of the four transgenes fully rescued adult viability of mir-279/996 double deletion backgrounds. [score:1]
Generation of mir-279/996 genomic rescue transgenesThe 3.0kb genomic sequence containing only mir-279 was cloned from the genome and inserted into the pBDP vector [59]. [score:1]
2) and mir-279[ex36] (also known as Δ1. [score:1]
Both miR-279 and miR-996 mediate specification of CO [2]-sensing neurons. [score:1]
Late stage pupae of mir-279[ex117], mir-279[ex36] and mir-279/996[ex15C] mutants were transferred from culture bottles to clean petri dishes humidified with wet Kimwipe papers. [score:1]
The mir-279 hairpin was PCR cloned and inserted to the 5' end of the mir-996 downstream fragment, then the resultant 3.1kb piece was digested out and ligated with the 13.5kb mir-996 upstream sequence to generate the mir-279-2x construct. [score:1]
At the time, we hypothesized that CG31044 might represent the primary transcript for mir-996, distinct from mir-279 [26]. [score:1]
Quantitative data for these genotypes is shown in Table 2. This was not due to inability to produce miR-996, since the degree of accumulation of ectopic miR-996 induced by tim-Gal4 was greater than for miR-279 (Fig 6F). [score:1]
Generation of new mir-279/996 deletion alleles. [score:1]
9% (31/32) 23.55±0.04 68.7±5.7 mir-996-2x/+; mir-279/996[ex36/ex15C] 100% (32/32) 23.44±0.04 96.0±4.8 mir-996-1x/+; mir-279/996[ex36/ex15C] 100% (32/32) 23.58±0.05 104.5±6.2 mir-279-1x/+; mir-279/996[ex36/ex15C] 100% (32/32) 23.41±0.04 78.4±6.7 mir-279/996-wt/+; mir-279/996[ex15C/ex15C] 100% (32/32) 23.36±0.04 80.1±6.3 mir-279-2x/+; mir-279/996[ex15C/ex15C] 93.8% (30/32) 23.55±0.04 66.8±4.9 mir-996-2x/+; mir-279/996[ex15C/ex15C] 100% (32/32) 23.44±0.04 78.6±5.1 mir-996-1x/+; mir-279/996[ex15C/ex15C] 93.8% (30/32) 23.60±0. [score:1]
Nevertheless, mature miR-279 is more similar to miR-286 than it is to miR-996 (Fig 1A). [score:1]
In contrast, mir-279 single hairpin deletions, which we now recognize as deficient for mature miR-996, exhibit ectopic CO [2]-sensing neurons in the palp, and these project to medial glomeruli. [score:1]
Normalized activity profiles of mir-279/996 transgene rescues of mir-279[ex117] mutants. [score:1]
The 3.0kb genomic sequence containing only mir-279 was cloned from the genome and inserted into the pBDP vector [59]. [score:1]
S3 FigNormalized activity profiles of mir-279/996 transgene rescues of mir-279[ex117] mutants. [score:1]
Generation of mir-279/996 genomic rescue transgenes. [score:1]
While the initial genetic data were reasonably explained by phenotypic dominance of miR-279, certain other observations remained difficult to account for. [score:1]
Subsequent studies defined additional functions of miR-279, including to mediate normal circadian activity [24] and for specification and migration of border cells [25]. [score:1]
The mir-279/996[ex15C/ex15C] phenotype was fully rescued by a single insertion of the wildtype 16.6kb mir-279/996 transgene, validating its status as a fully functional genomic fragment (Fig 4B). [score:1]
Finally, we could rescue the viability and locomotor behavior of this mutant using the 3kb mir-279-only genomic transgene. [score:1]
In mutant heads bearing either wildtype mir-279/996 genomic transgene, or mir-279-only or mir-996-only transgenes, we observed comparable restoration of nerfin-1 and escargot transcript levels by the various miRNAs (Fig 4H and 4I). [score:1]
Generation of single and double deletion alleles of the mir-279 and mir-996 loci. [score:1]
Following the segregation of TMS, Δ2–3, we screened ~500 candidate excision chromosomes for deletions in the mir-279/ mir-996 region using the the following PCR amplicons: mir279F excision CAAGAAACCACCCCGAGAAGAAGAAG mir279R excision AGCAGGTGTTACAGTTACACTCAAACG. [score:1]
This suggests that miR-279 and miR-996 are selected for distinct sequences, presumably related to some separable functions. [score:1]
On the basis of such transcriptome data, the provenance of CR31044 was expanded in the most recent FlyBase release (5.47), such that it now includes both mir-279 and mir-996 (Fig 1A). [score:1]
We use precise genetic engineering to show that a single endogenous copy of either mir-279 or mir-996 can fully rescue viability, olfactory neuron, and circadian rhythm defects of double deletion animals. [score:1]
A third seed member, mir-286, is genomically unlinked from the mir-279/996 cluster and moreover deployed in a spatially and temporally distinct manner, being essentially restricted to early embryogenesis [26, 29, 30] (S1 Fig). [score:1]
Indeed, the deep conservation of divergent non-seed regions of miR-279 and miR-996, and the observation that mir-279 is ancestral and that mir-996 emerged more recently during arthropod evolution [28], suggest that miR-996 may have neofunctionalized from miR-279 to acquire some distinct activity. [score:1]
Such mir-279-2x and mir-996-2x constructs carried a NotI site at the 5' side and an AscI site at the 3' side of the ectopic hairpin. [score:1]
The mature sequences of three members of the miR-279 seed family are shown; note that miR-286 is encoded elsewhere in the genome but is more related to miR-279 than is miR-996. [score:1]
Both miR-279 and miR-996 mediate normal adult rhythmic behavior. [score:1]
These experiments utilized male body and male head RNA samples, and show similar results as to female samples shown in main Fig 2. Levels of mature miR-996 are strongly diminished in the mir-279 alleles [ex117] and [ex36] that retain the mir-996 genomic DNA. [score:1]
RNA samples were separated on 12% polyacrylamide denaturing gels (National Diagnostics), transferred to the GeneScreen Plus (Perkin Elmer) membrane, crosslinked with UV light and hybridized with γ- [32]P-labeled LNA (Exiqon) antisense probes for miR-279 and miR-996 at 45°C overnight. [score:1]
Our previous efforts yielded two alleles in this region, [ex117] and [ex36], that delete mir-279 but spare the mir-996 locus (Fig 1A). [score:1]
Since the available allelic series did not permit assessment of phenotypes caused by specific loss of miR-279, we sought an alternative strategy to analyze "clean" mir-279 and mir-996 mutant backgrounds. [score:1]
It is commonly observed in Drosophila that 3' fragments of Drosha-cleaved primary transcripts are less stable than 5' Drosha fragments [33, 34], and evidently at the mir-279/ 996 locus, the 3'-most fragment of its primary transcript is least stable of them all (Fig 1A). [score:1]
Note that all mir-279[ex117/ex117] animals exhibited generally less activity than heterozygotes. [score:1]
Both miR-279 and miR-996 contribute to circadian rhythm. [score:1]
In contrast to the unactivated transgene background, tim>mir-279 animals quickly became arrhythmic following their transfer to constant darkness (Fig 6C). [score:1]
The mir-996 locus was later identified in the vicinity of mir-279 and shown to encode a similar seed, but they otherwise have distinct mature sequences and were originally suggested to derive from separate genes [26, 27]. [score:1]
Their analyses utilized a stock of mir-279[ex117] that had been outcrossed to remove potential second-site aberrations. [score:1]
The activity and circadian defects in mir-279[ex117/ex117] animals were rescued by single copies of the wild-type 16.6kb mir-279/996 transgene (D) or the 2x-mir-279-only (E) or 2x-mir-996-only (F) transgenes. [score:1]
The [ex117] allele, which is null for miR-279 and strongly hypomorphic of miR-996, exhibits normal circadian behavior as a heterozygote (A) but not as a homozygote (B). [score:1]
Generation of new mir-279/996 deletion allelesThe mir-996 single deletion and mir-279/996 double deletion alleles were generated by imprecise excision of P{EPgy2}CR31044[EY03350], which is inserted 370bp downstream of the mir-996 hairpin. [score:1]
Similar and distinct capacities of miR-279/996 in gain-of-function analyses. [score:1]
Such phenotypic differences suggested that miR-279 has stronger capacity to influence circadian cell activity, even though endogenous mir-996 is completely able to compensate for the absence of mir-279. [score:1]
The wildtype genomic fragment was modified to replace the mir-279 and mir-996 hairpins with either a deletion or the non-cognate miRNA. [score:1]
For example, there might theoretically be another non-coding function of the primary mir-279 transcript, or even perhaps a peptide encoded by this region. [score:1]
1005245.g003 Fig 3(A) In the 16.6kb mir-279/ 996 rescue transgene, the 5' end extends to cover a portion of the upstream CG14508 gene and 3' end extends into the downstream Ef1gamma gene. [score:1]
As a negative control, the Hairless 3' UTR does not contain any miR-279/996 binding site and the sensor was not repressed upon miRNA transfection (Fig 6A). [score:1]
In essence, then, all studies of mir-279 mutants to date [18, 23– 25] have effectively been of double mutants. [score:1]
Inspection of companion transcriptome data [32] revealed relatively continuous, although graded, levels of RNA-seq reads across the entire locus, consistent with the notion of a single primary mir-279/ 996 transcript. [score:1]
Our current studies affirm and extend the broad impact of the mir-279/ mir-996 locus, which generates phenotypically critical miRNAs of profound impact. [score:1]
The mir-996 single deletion and mir-279/996 double deletion alleles were generated by imprecise excision of P{EPgy2}CR31044[EY03350], which is inserted 370bp downstream of the mir-996 hairpin. [score:1]
1005245.g005 Fig 5(A-F) Typical activity profiles of individual flies of various mir-279/996 genotypes. [score:1]
In summary, these gain-of-function experiments reveal intrinsic differences between miR-279 and miR-996, which otherwise exhibit surprising genetic redundancy under carefully controlled endogenous conditions. [score:1]
Strikingly, all transgene isoforms, including single mir-279 and mir-996 versions, fully restored the normal circadian clock in the mutant flies (Fig 5I and 5J and Table 1). [score:1]
The control Hairless 3' UTR has no miR-279/996 seed match and was not repressed by these miRNAs. [score:1]
miR-279 restricts the JAK-STAT ligand unpaired in circadian pacemaker cells [24], whereas in ovarian border cells it represses the transcription factor STAT [25]. [score:1]
miR-279 and miR-996 co-accumulate at various embryonic and post-embryonic settings. [score:1]
Using this genomic fragment, we then generated a series of mutant transgenes in which we specifically deleted 100bp covering either the mir-279 or mir-996 hairpins (1x-mir-279 and 1x-mir-996, which essentially serve as mir-996- KO and mir-279- KO transgenes, respectively) or replaced either miRNA with the non-cognate hairpin (2x-mir-279 and 2x-mir-996) (Fig 3A). [score:1]
6 mir-279[ex117/ex117] 30.2% (16/53) 23.59±0.07 8.5±2.0 mir-279/996-wt/+; mir-279/996[ex117/ex117] 100% (32/32) 23.64±0.05 115.7±6.4 mir-279-2x/+; mir-279/996[ex117/ex117] 100% (32/32) 23.63±0.05 75.5±5.9 mir-996-2x/+; mir-279/996[ex117/ex117] 100% (32/32) 23.55±0.04 71.8±5.0 mir-996-1x/+; mir-279/996[ex117/ex117] 96.8% (30/31) 23.80±0.07 75.3±5.3 mir-279-1x; mir-279/996[ex117/ex117] 100% (32/32) 23.52±0.05 96.6±5.2 mir-279/996-wt/+; mir-279/996[ex36/ex15C] 96.9% (31/32) 23.39±0.05 89.0±6.8 mir-279-2x/+; mir-279/996[ex36/ex15C] 96. [score:1]
n = ~32 for each genotype; the number of flies assayed for each genotype are indicated in Table 1. The evidence gathered indicates that miR-279 and miR-996 play surprisingly similar roles in diverse developmental and behavioral settings. [score:1]
Northern analysis of small RNAs in different mir-279 and mir-996 alleles confirmed this hypothesis. [score:1]
For the large rescue transgenes, we retrieved 16.6kb extending into both upstream and downstream protein-coding genes of the mir-279/996 locus from the BAC CH322-35G11 (BACPAC Resources) and cloned it into the attB-P[acman]-AmpR vector by recombineering as described [60]. [score:1]
Other previously-described stocks utilized in this study include UAS-luc-mir-279 and UAS-DsRed-mir-996 [61], tim-Gal4 and tim-UAS-Gal4 [62], and the MARCM tester stock eyflp; Gr21-Gal4, UAS-sytGFP; FRT82, tubGal80 [18, 63]. [score:1]
The mir-279[ex117] (also known as Δ1. [score:1]
Genotype for the mutant is: Gr21-Gal4, UAS-syt-GFP/+; mir-279/996[ex15C], and rescued genotypes are: Gr21-Gal4, UAS-syt-GFP/mir[rescue]; mir-279/996[ex15C]. [score:1]
However, we were unable to recover homozygous mir-279[ex36] stocks that survived longer, even after extensive outcrossing of this mutant chromosome. [score:1]
While mir-279[ex36] is lethal within a few days of eclosion, mir-279[ex117] adults can eclose and survive for weeks with optimal care, despite their locomotor difficulties (Fig 1C). [score:1]
Comparison of gain-of-function activities of miR-279 and miR-996. [score:1]
miR-996 restores proper CO [2]-sensing neurons to mir-279/996 double mutants. [score:1]
Perhaps most germane was the fact that the mir-279[ex117] and mir-279[ex36] single deletions, both null for mir-279, exhibited distinct viability. [score:1]
Nevertheless, we were interested to assess whether miR-996 contributes to any biological settings known to depend on miR-279. [score:1]
This lies <30nt downstream of a typical TATA box sequence (GTATATAAA), suggesting that as the promoter for the mir-279/996 transcription unit. [score:1]
To generate the mir-279-2x construct, genomic fragments 13.5kb upstream and 3.0kb downstream of the mir-996 hairpin were retrieved from the CH322-35G11 BAC and cloned between the AscI and NotI sites of the attB-P[acman]-AmpR vector. [score:1]
mir-996[ex310] is a deletion of the mir-996 region that does not affect mir-279 and mir-279/996[ex15C] deletes both miRNAs. [score:1]
Our newly generated mir-279/ 996 double deletion mutant [ex15C] exhibited similar gross phenotypes as mir-279[ex36], with respect to lifespan (Fig 1C) and ectopic GR21+ projections (Fig 1H). [score:1]
In mir-279 alleles [ex117] and [ex36] that retain the mir-996 genomic DNA, the levels of mature miR-996 are strongly diminished ([ex117]) or nearly undetectable ([ex36]). [score:1]
CAGE data (in black) reveals a single peak in the mir-279/996 region located downstream of a TATA box, likely representing the start of a shared primary mir-279/996 transcript (i. e., CR31044). [score:1]
Signal quantifications were performed in the Image Gauge software and levels of miR-279 and miR-996 in different genotypes were normalized to 2S rRNA. [score:1]
Green and blue triangles represent mir-279 and mir-996 hairpins, respectively. [score:1]
The rhythmic behavior of [ex117] homozygotes was fully rescued by a single insertion of the wildtype 16.6 kb genomic transgene covering the mir-279/996 locus (C). [score:1]
A mutant of mir-279 initially emerged from a genetic screen for altered patterning of olfactory neurons, yielding a line with ectopic CO [2]-sensing neurons in the maxillary palp [18]. [score:1]
In addition, flies carrying mir-279[ex36] in trans to a deficiency of the region showed the same gross phenotypes. [score:1]
Taken together, these findings suggested that phenotypic differences between mir-279[ex117] and mir-279[ex36] must reside extremely close to the mir-279 hairpin. [score:1]
1005245.g004 Fig 4miR-996 restores proper CO [2]-sensing neurons to mir-279/996 double mutants. [score:1]
We initially studied the hypomorphic mir-279[ex117] homozygous condition, and confirmed previous observations [24] that a majority of mir-279[ex117] mutant flies displayed arrhythmic locomotor activity in constant darkness (Fig 5A and 5B). [score:1]
The mir-279/996[ex15C] data shown here are the same as plotted in Fig 1C. [score:1]
Therefore, the capacities of miR-279 and miR-996 in S2 cells are similar. [score:1]
Both miR-279 and miR-996 contribute to maintenance of circadian rhythm. [score:1]
Phylogenomic tracing indicates that mir-279 is ancestral and that mir-996 has adopted a derived sequence [28]. [score:1]
As well, the pharate lethality of homozygous [ex15C] mutants was well-rescued by the mir-279-only genomic transgene. [score:1]
The mir-279/996[ex15C] allele bears a 2825bp deletion that removes both miRNA hairpins and retains 84bp of P-element sequence. [score:1]
A particularly compelling example is miR-279 [17, 18]. [score:1]
We also recovered a longer deletion ([ex15C]) that removes both mir-279 and mir-996 loci, thus establishing an apparent allelic series of single and double mutants of these miRNAs (Fig 1A). [score:1]
Shown are Northern blots of miR-279 and miR-996 in various mir-279 and mir-996 homozygous or trans-heterozygous allele combinations. [score:1]
We placed one copy of each transgene into mir-279/996[ex15C] homozygotes, and performed Northern blotting for the two miRNAs from adult females. [score:1]
The wildtype 16.6 kb transgene restored accumulation of mature miR-279 and miR-996 (Fig 3B) and fully rescued viability of mir-279/996[ex15C] double deletion homozygotes (Fig 3C). [score:1]
As we showed in the head, endogenous miR-279 and miR-996 exhibit comparable activity to restrict the accumulation of nerfin-1 and escargot transcripts (Fig 4H). [score:1]
Moreover, single insertions of either "2x" transgene, in which mir-279 was substituted for mir-996, and vice versa, also provided complete rescue of the ectopic CO [2]-sensing neurons (Fig 4C and 4D). [score:1]
This confirmed their status as a bona fide panel of single mutants of the mir-279/996 locus, an allelic series that was not functionally fulfilled by corresponding single genomic deletions. [score:1]
In contrast, mir-279 deletions induced ectopic medial projections (Fig 1F and 1G), as described [18], and reflected the generation of ectopic CO [2]-sensing neurons in the maxillary palp. [score:1]
Generation of single and double deletion alleles of the mir-279 and mir-996 lociThe mir-996 hairpin is located ~1.5 kb downstream of the mir-279 hairpin (Fig 1A). [score:1]
mir-996[ex310] is a deletion of the mir-996 region that does not affect mir-279, and mir-279/996[ex15C] is a deletion of both miRNAs. [score:1]
This was associated with a transposon insertion near mir-279, which was phenocopied by multiple mir-279 deletion alleles. [score:1]
1005245.g001 Fig 1The mir-279/996 locus and phenotypes of single and double deletion alleles. [score:1]
As the phenotypes of these mutants were rescued by a ~3kb genomic transgene bearing only mir-279, and lacked mir-996 sequence [18], mir-279 appeared to be causal. [score:1]
Generation of genetically defined miR-279 and miR-996 single and double mutants. [score:1]
Both miR-279 and miR-996 mediate specification of CO [2]-sensing neuronsUnder MARCM clonal conditions, mir-996 single hairpin deletions exhibit normal specification of CO [2]-sensing neurons within the antenna, and these project to ventral glomeruli in the central brain (Fig 1D and 1E). [score:1]
Other Drosophila mutants and transgenesThe mir-279[ex117] (also known as Δ1. [score:1]
Therefore, we conclude that the available mir-279 "single" mutants are unexpectedly also strong or nearly null alleles of mir-996. [score:1]
This indicates that there is no essential requirement for the unique miR-279 sequence, and that one allele of either mir-279 or mir-996 supports normal viability of Drosophila. [score:1]
Notably, miR-996 has not been implicated in any biological processes, since available mir-279 deletion alleles do not affect the mir-996 locus, and mir-279 mutant phenotypes can be rescued by a genomic transgene that contains only mir-279 and lacks mir-996 sequence [18]. [score:1]
The quantification of percentage of rhythmic animals, their circadian period, and their power of rhythmicity are shown in Table 1. Restoration of either miR-279 or miR-996 on the [ex117] background, in either two doses or in a single dose, fully recovered behavioral rhythmicity (Fig 5D– 5F and Table 1). [score:1]
The rescued levels were consistently slightly greater than Canton S but were actually similar to mir-279/996[ex15C/+] heterozygotes in all cases. [score:1]
We proceeded to subject these engineered miRNA backgrounds to detailed phenotypic study, to ascertain the extent to which defects previously attributed to miR-279 might actually depend on the joint function of miR-279 and miR-996. [score:1]
The deletion extents of the " mir-279" alleles, relative to the transcription start, were notable. [score:1]
The genomic regions deleted in five mir-279/996 alleles are shown in red. [score:1]
The mir-279/996 locus and phenotypes of single and double deletion alleles. [score:1]
Modified genomic transgenes to assess individual miR-279/996 functions. [score:1]
[1 to 20 of 177 sentences]
2
[+] score: 68
We, and others, have determined that Apt functions as a feedback inhibitor of STAT activity by regulating the expression of two direct STAT pathway inhibitors: Suppressor of Cytokine Signaling at 36E (Socs36E) and the STAT -targeting microRNA miR-279 [47, 48]. [score:13]
The following fly stocks were utilized: Canton S and w [1118] (for wild type), tubP-Gal80 [ts] [49], upd-Gal4 (expressed in hub [22]), c587-Gal4 (expressed in CySCs and early cyst cells [50]), Tj-Gal4 (expressed in hub, CySCs, and early cyst cells [51, 52]), UAS-tdf/MKRS (for over -expression of apt; tdf is an alternative name for apt [53]), protein trap line PTT-GC apt [CC01186] [54, 55], Stat92E [397] /TM3 (a null allele of Stat92E) [46], two independent null miR-279 alleles (miR-279Δ 1.2 and miR-279Δ 1.9 [56]), miR-279sponge [48], UAS-Hop [TUM-L] /CyO [57], and UAS-mCD8-GFP [58]. [score:9]
Apt’s genetic interactions with the STAT -targeting miR-279 and the conserved inhibitor of STAT, Socs36E, suggest it may mediate expression of these targets, as in ovaries. [score:9]
As in ovaries, Apt expression in CySCs partially depends on STAT activity, and its feedback inhibition of STAT signaling functions through a regulatory network including Socs36E and miR-279. [score:6]
“n” indicates number of testes scored Apt promotes expression of the STAT -targeting microRNA miR-279 in ovaries [48]. [score:5]
“n” indicates number of testes scoredApt promotes expression of the STAT -targeting microRNA miR-279 in ovaries [48]. [score:5]
Simultaneous loss of the STAT regulators apt and Socs36E, or the Stat92E -targeting microRNA miR-279, expanded the somatic stem cell-like population. [score:4]
In summary, we postulate that Apt functions as a feedback inhibitor of JAK/STAT activation in the CySCs via its regulation of Socs36E and miR-279 (Fig.   7). [score:4]
A genetic interaction between apt and the Stat92E targeting miR-279 [48] supports this idea. [score:3]
Expressing the miR-279 sponge in CySCs and early cyst cells via c587-Gal4 led to a significant increase in the total number of Zfh-1+ cells (Fig.   6d-f). [score:3]
To test if this regulator also acts in CySCs, we utilized a miR-279 sponge, which binds and decreases the endogenous microRNA [48, 84]. [score:2]
Then, Apt functions through Socs36E and miR-279 to attenuate pathway activation, which is required for timely CySC differentiation. [score:1]
g Quantification of Zfh-1+ cells in the specified genotypes reveals a genetic interaction between  apt and  miR-279. [score:1]
Testes from these flies had significantly more Zfh-1+ cells relative to a single copy reduction of miR-279 or apt alone (Fig.   6g). [score:1]
Unlike loss of Socs36E, reduction of miR-279 in the CySC and early cyst cell populations significantly expanded the Zfh-1+ population. [score:1]
To determine if miR-279 function depends on or overlaps with Apt in testes, we generated apt-/+; miR-279-/+ double heterozygous flies [56]. [score:1]
[1 to 20 of 16 sentences]
3
[+] score: 18
Our analyses in the very early stages of embryo development (NFE and ED0) of B. germanica, T. castaneum, D. melanogaster and D. virilis indicated that miRNAs from MIR-276 and MIR-279 families are differentially expressed in short germ-band species, whereas those of MIR-92 family are differentially expressed in long germ-band species. [score:6]
The first two waves of miRNA expression, represented by CoMod-A1 and CoMod-A2, involve Mir-279, which is associated with multiple biological processes [24], and let-7 and Mir-9, which are related with neural differentiation and function [25– 27]. [score:3]
In D. melanogaster, maternal mRNA clearing has been associated with the Mir-309 cluster, which includes Mir-9/4/79, Mir-5/6/2944, Mir-3/309 and Mir-279/286, which are mainly expressed between 9 and 12% of embryo development [21]. [score:3]
Finally, Mir-9 and Mir-279, which are associated with maternal mRNA clearance in D. melanogaster [21], belong to CoMod-A2 and show high levels of expression in ED2. [score:2]
In D. melanogaster, MIR-279 has been related to maternal mRNA clearance in the MZT transition (see above), restricting the emergence of CO [2]-sensing neurons, the maintenance of circadian rhythm, and the regulation of ovarian border cells [24]. [score:2]
PCA showed the main drivers of this grouping to again be MIR-279 (for B. germanica and T. castaneum) and MIR-92 (for D. virilis) (Fig. 6b). [score:1]
PCA (Fig. 5b) showed this grouping to be mostly driven by the MIR-276, MIR-279 and MIR-92 families. [score:1]
[1 to 20 of 7 sentences]
4
[+] score: 10
bmo-miR-1, bmo-let-7a, bmo-miR-8, bmo-miR-14, bmo-miR-276a, bmo-miR-279 were strongly expressed in all developmental stages (larva, pupa and moth). [score:4]
Of the 46 identified miRNAs, bmo-miR-279 was the only one for which we failed to find target sites. [score:3]
bmo-miR-279 and other mir-279 precursor sequences have sequence similarities of >55%; bmo-miR-277 precursors share >56% sequence similarity; bmo-miR-27 precursors share >57% sequence similarity; bmo-miR-71 precursors share >59% sequence similarity; and bmo-bantam precursors share >60% sequence similarity. [score:1]
Members of the bantam, mir-71, mir-275, mir-277, mir-279 miRNA families have a high degree of similarity in their precursor sequences. [score:1]
These newly identified miRNAs are bmo-miR-2a*, bmo-miR-8*, bmo-miR-13a*, bmo-miR-46*, bmo-miR-263*, bmo-miR-279*, and bmo-miR-305*. [score:1]
[1 to 20 of 5 sentences]
5
[+] score: 6
We recovered four targets from this list (miR-7/HLHm5, miR-279/SP555, miR-124/Gli, and miR-310/imd) but failed to locate conserved nuclei for the other six targets (see comments in Table 3). [score:5]
The only gene with a higher score (40.5) is nerfin-1, which contains two anchor sites for miR-286 (or equivalently miR-279) conserved in all flies, and many additional sites for the same microRNA (see ). [score:1]
[1 to 20 of 2 sentences]
6
[+] score: 4
Six miRNAs (miR-279, miR-33, miR-79, miR-9, miR-S5 and miR-S12) were significantly down-regulated by more than twofold. [score:4]
[1 to 20 of 1 sentences]
7
[+] score: 4
Some other maternal microRNAs have roles unrelated with embryonic development, such as mir-14, which regulates insulin production (Xu et al. 2003); mir-279, involved in the circadian clock (Luo and Sehgal 2012); or mir-8, associated to abdominal pigmentation (Kennell et al. 2012), to name but a few cases. [score:3]
The microRNA genes studied in that paper were mir-9b, mir-279, and bantam, all of which were detected in this study as maternal. [score:1]
[1 to 20 of 2 sentences]
8
[+] score: 3
Among the highly expressed; bantam, miR-184, miR-81, miR-100, miR-92, miR-2766, miR-279 are listed in the top (S1 Table) and these findings are in concurrence with recent reports [19]. [score:3]
[1 to 20 of 1 sentences]
9
[+] score: 3
Primers for mature miRNAs also tended to show the strongest effects of transcript direction (for example, ame-mir-279; Table 1), and retained strand-specific expression levels when the 18-30 nt RNA pool was assayed. [score:2]
Similarly, ame-mir-279 is embedded within intron 3 of GB12486, the honey bee DNA polymerase-α primase. [score:1]
[1 to 20 of 2 sentences]
10
[+] score: 2
Mimics of miR-279-3p, miR-8-3-p, miR-275-3p, miR-34-3p and miR-304-5p (sequences of these miRNAs are listed in Table S1) as well as a negative control (NC) were synthesized by GenePharma (Shanghai, China). [score:1]
To characterize the interaction between the five miRNAs (miR-279-3p, miR-8-3-p, miR-275-3p, miR-34- 3p and miR-304-5p) and the 3′-UTR of bmfrn mRNA, the full length sequence of the 3′-UTR of bmfrn and the sequences of all miRNA candidates were submitted online to RNAhybrid, an algorithm taking into account the free energy level of RNA -RNA duplexes and degree of miRNA target sequence complementarity 21. [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 1
Limulus polyphemus has also lost mir-981 and mir-279, but has retained the other 31 conserved P. tepidariorum microRNA families (fig. 2). [score:1]
[1 to 20 of 1 sentences]
12
[+] score: 1
A new Prospero and microRNA-279 pathway restricts CO2 receptor neuron formation. [score:1]
[1 to 20 of 1 sentences]
13
[+] score: 1
elegans, Drosophila,Mouse, Humans miR-279 upd Rhythmicity N Insects miR-276a timeless Rhythmicity Peak at ZT10 Trough at ZT18 Insects miR-124 – Phase Peak at ZT19 Trough at ZT7C. [score:1]
[1 to 20 of 1 sentences]
14
[+] score: 1
Similarly, “seed paralogs” were found for Drosophila mir-279, mir-285 and mir-286. [score:1]
[1 to 20 of 1 sentences]
15
[+] score: 1
A new prospero and microRNA-279 pathway restricts CO2 receptor neuron formation. [score:1]
[1 to 20 of 1 sentences]
16
[+] score: 1
We also observed that mir-9 and mir-279 microRNAs appear clustered in some insects (Apis mellifera and Tribolium castaneum according to miRBase), suggesting that an original cluster may have split in Drosophila. [score:1]
[1 to 20 of 1 sentences]