sort by

10 publications mentioning dme-mir-312

Open access articles that are associated with the species Drosophila melanogaster and mention the gene name mir-312. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 81
Moreover, the RT-qPCR-estimated quantities of 26 putatively targeted P450 transcripts showed an inverse relationship with the expression level of the corresponding miRNA(s) predicted to target them in 91-R. For example, the relative expression of three miRNAs (miR-311-3p, miR-312-3p, and miR-313-3p) were significantly down-regulated in 91-R strain (Fig 1), while the corresponding predicted targets (Cyp6a8, Cyp4s3, Cyp4ae1, Cyp6g1, Cyp6g2, Cyp6t3, Cyp6v1, Cyp18a1, Cyp49a1, Cyp303a1, Cyp309a2, Cyp313a4, and Cyp313b1) were significantly up-regulated (Fig 4). [score:17]
Findings from this study show that the down-regulation of miR-311-3p, miR-312-3p, and miR-313-3p is correlated with the up-regulation of their respective in silico predicted cytochrome P450 target transcripts, Cyp6a8, Cyp4s3, Cyp4ae1, Cyp6g1, Cyp6g2, Cyp6t3, Cyp6v1, Cyp18a1, Cyp49a1, Cyp303a1, Cyp309a2, Cyp313a4, and Cyp313b1 in 91-R. This up-regulation of Cyp6g1 target is predicted to occur via a decreased miR-310-313 expression in 91-R and also corresponds to the cytochrome P450 initially implicated in conferring DDT resistance at the DDT-R locus via integration of the Accord transposon among D. melanogaster populations [71]. [score:16]
Differentially expressed miRNAs were identified at the threshold [FDR < 0.05 and log [2](fold change) ≥|1.0|] of 91-C/ 91-R. [b] Fold change was calculated as 91-C/ 91-R. The RT-qPCR validation of the predicted significant quantitative differences in miRNA levels among eight known and four novel miRNAs were amplified showing that the expression levels of miR-986-5p were highly up-regulated in 91-R, whereas miR-286-3p, miR-4919-3p, miR-311-3p, miR-312-3p, and miR-313-3p were significantly down-regulated in 91-R (Fig 1). [score:9]
Differentially expressed miRNAs were identified at the threshold [FDR < 0.05 and log [2](fold change) ≥|1.0|] of 91-C/ 91-R. [b] Fold change was calculated as 91-C/ 91-R. The RT-qPCR validation of the predicted significant quantitative differences in miRNA levels among eight known and four novel miRNAs were amplified showing that the expression levels of miR-986-5p were highly up-regulated in 91-R, whereas miR-286-3p, miR-4919-3p, miR-311-3p, miR-312-3p, and miR-313-3p were significantly down-regulated in 91-R (Fig 1). [score:9]
Thus, our implication of down-regulated miR-311-3p, miR-312-3p, and miR-313-3p with the corresponding constitutive up-regulation of in silico predicted targets Cyp6a8, Cyp4s3, Cyp4ae1, Cyp6g2, Cyp6t3, Cyp6v1, Cyp18a1, Cyp49a1, Cyp303a1, Cyp309a2, Cyp313a4 in 91-R may provide yet another example of a miRNA -mediated posttranscriptional modification that contributes to an insecticide resistance trait. [score:9]
Furthermore, other corresponding predicted detoxification targets, Esterase8, Esterase10, GstD1, GstE10, GstS1, GABA-R, mAChR-A, nAcRalpha-A and GluR-IB were significantly up-regulated with the down-regulation of miR-286-3p, miR-2a-3p, miR-311-3p, miR-312-3p, and miR-313-3p in 91-R strain (Fig 4). [score:9]
Among these ten differentially expressed miRNAs, four members of the miR-310 family, miR-310, miR-311, miR-312 and miR-313, were significantly down-regulated in 91-R when compared with the 91-C strain. [score:5]
Interestingly, four out of these nine down-regulated miRNAs [miR-310, miR-311, miR-312 and miR-313] are clustered miRNAs and belong to the miR-310 family. [score:4]
Additionally, 4 out of 10 miRNAs predicted to be differentially expressed between 91-R and 91-C (miR-986-5p, miR-995-3p, miR-312-3p, miR-2a-3p) were also predicted to interact with and impact the transcript level of multidrug resistance -associated protein B7 (ABC-B7). [score:3]
[1 to 20 of 9 sentences]
2
[+] score: 72
Note that the regulated and unregulated mRNAs are expressed from different transgenes and that any effect of the miR-312 binding sites on mRNA levels can not be addressed in this analysis. [score:5]
Thus, the presence of the miR-312 target sites in the GFP-312 mRNA confers translational repression. [score:5]
This difference can be attributed in part, but not in whole, to unequal mRNA levels: the mRNA with miR-312 targets is present at 70% of the level of the control transgene (Fig. 1E). [score:3]
First, the overall GFP level was typically lower from the mRNA with the miR-312 targets, consistent with the quantitative western blot analysis. [score:3]
However, when reporter transcripts with MCP binding sites (with or without miR-312 target sites) are also present, the MCP::GFP adopts a new distribution: it is now predominantly cytoplasmic (Fig. 4B,C). [score:3]
0004669.g001 Figure 1Expression and activity of miR-312 in the ovary. [score:3]
If the presence of the miR-312 binding sites reduces mRNA levels, as is common in cases of miRNA regulation, then the effective degree of negative regulation would be even greater. [score:3]
Northern blot analysis of miRNAs during embryogenesis has revealed that miR-312 is present at the highest levels in 0–1 hour embryos, suggesting that it is expressed during oogenesis [17]. [score:3]
Translational repression of the reporter mRNAs could be due to the action of miRNAs, or could arise in some other manner because of the addition to the reporter mRNA of the sequences that make up the miR-312 binding sites. [score:3]
We confirmed the ovarian expression of miR-312 by in situ hybridization. [score:3]
Although no confirmed targets of miR-312 action have been identified, the ovarian kelch mRNA is a candidate with 4 predicted miR-312 binding sites [48]. [score:3]
The miRNA miR-312 is expressed during oogenesis, and addition of synthetic miR-312 binding sites to either of two different reporter mRNAs reduces their activities. [score:3]
Here, quantitative analyses of transcript and protein levels of transgenes with or without synthetic miR-312 binding sites show that the binding sites do confer translational repression. [score:3]
Expression and activity of miR-312 in the ovary. [score:3]
In contrast, expression of the UAS-osk-312 transgene with the miR-312 binding sites has no significant effect on embryonic patterning: the vast majority of embryos (94%; n = 373) appear wild type (Fig. 1G). [score:3]
Thus, in each of two assays the addition of miR-312 binding sites to an mRNA leads to its translational repression. [score:2]
Indeed, miR-312 expression in the ovary has been detected by a PCR assay [44]. [score:2]
A Locked Nucleic Acid probe for miR-312 reveals the miRNA to be present throughout the ovary, in both germ line cells (nurse cells and the oocyte) and somatic follicle cells (Fig. 1A). [score:1]
The miR-312 hybridization signal appears throughout these stages of oogenesis (levels are very low at the earliest stages of oogenesis, at the extreme left. [score:1]
A–C differ with respect to which reporter mRNAs with MS2 binding sites are present: A, no reporter mRNAs; B, reporter mRNAs lacking miR-312 binding sites; and C, reporter mRNAs with miR-312 binding sites. [score:1]
Our evidence shows that the miRNA machinery is competent for function during oogenesis, and it would be very unlikely that only miR-312 can make use of that machinery. [score:1]
UAS-osk-312 differs from UAS-osk by the addition of four tandem copies of the synthetic miR-312 binding site. [score:1]
The probe in A is complementary to miR-312, while the probe in B has a scrambled sequence. [score:1]
A 4× version of the miR-312 binding sites was introduced into the XbaI site between the osk coding region and UASp vector 3′ UTR of UAS-osk [62] to make UAS-osk-312 (p8619). [score:1]
The insets in A'–C' are a higher resolution image of the regions in A'–C' indicated by arrows, with Union Jack LUTs as described in the legend to Fig. 3. MS2::GFP in the presence of the osk reporter mRNAs, with or without miR-312 binding sites, is cosncentrated in puncta (appearing white and red in the insets in B',C') that are not observed with MS2::GFP alone (inset in A'). [score:1]
To detect miR-312, a digoxigenin labeled Locked Nucleic Acid probe (TATTGCACTTGAGACGGCCTGA)(Exiqon) was used according to the manufacturers instructions with annealing temperature of 55°C. [score:1]
The binding sites were designed to allow incomplete base pairing with miR-312, such that the 5′ ‘seed’ and 3′ regions of the miRNA would be fully base paired, with a central unpaired bulge (Fig. 1D). [score:1]
To test for miRNA activity in the Drosophila ovary we focused on miR-312. [score:1]
Six tandem copies of a synthetic miR-312 binding site were added to the 3′ UTR of a UAS-GFP transgene (Fig. 1C). [score:1]
C. GFP reporter transgenes to detect miR-312 activity. [score:1]
Multiple copies of the miR-312 binding sites were used to increase the probability of efficient miR-312 binding. [score:1]
A synthetic single miR-312 binding site cassette was constructed by PCR and had the sequence 5′TCTAGATCAGGCCGTAGAAGTGCAATACTAGT 3′. [score:1]
The levels of miR-312 RNA appear to increase during this period (Fig. 1A), but attempts to use fluorescent -based in situ hybridization to obtain more quantitative data that would address this possibility have not been successful. [score:1]
The transgene with miR-312 sites produces significantly less GFP than the control transgene (Fig. 1E). [score:1]
Transgenes with the osk coding region as the reporter are essentially the same, with replacement of the coding regions, except that the GFP reporter has 6 copies of the miR-312 binding site while the osk reporter has 4 copies. [score:1]
D. Sequence of a single copy of the miR-312 synthetic binding site, shown as it would base pair to miR-312. [score:1]
[1 to 20 of 36 sentences]
3
[+] score: 14
Other miRNAs from this paper: dme-mir-92a, dme-mir-34, dme-mir-92b, dme-mir-9c, dme-let-7
However, by relaxing these constraints to require a maximum free energy of miRNA/target hybridization of -12 kcal/mole at room temperature and a minimum of 6 out of 8 consecutive base pairs in the miRNA 5' end, MovingTargets predicts that mir-9c, mir-92a, mir-92b, and mir-312 (the latter three are closely related miRNAs) target ttk. [score:7]
The CrebA mRNA is predicted to have three target sites for miR-92b and mir-312 (Table 1); these miRNAs are closely related, sharing the same nts in positions 2–9 and 15–21. [score:3]
We tested mir-92b and mir-312 in the S2 cell assay, and both miRNAs repress expression of the luc/ttk reporter (Figure 2C). [score:2]
Each primary transcript was amplified by PCR from genomic DNA to generate fragments with the following sequence coordinates: let-7: 2L:18450072-18450291; mir-92b: 3R:21466427-21466673; mir-312: 2R:15647675-15647897; mir-34: 3R:5926642-5926792. [score:1]
For panels A and C, the vertical bars above the line indicate sites for miR-92b, while vertical bars below the line indicate sites for miR-312. [score:1]
[1 to 20 of 5 sentences]
4
[+] score: 7
The red rectangle represents the target sequences in esg’s ORF of miR-310, miR-311, miR-312 and miR-313. [score:3]
There is practically no adult expression of the miR-310, miR-311 and miR-312 transcripts from wt, Δ40 and F1. [score:3]
The miR-310 [c] codes for four microRNAs: miR-310, miR-311, miR-312 and miR-313 that share an identical seed sequence. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 3
Other miRNAs from this paper: dme-mir-275, dme-mir-34, dme-mir-9b
Interestingly, the E74 transcription unit displays features common to other potential LARK targets: it contains an A-rich element in the 3′UTR, the transcription unit contains a large ∼37-kb intron, and the 3′UTR contains binding sites for several miRNAs including miR-34, miR-9b, miR312, miR275, and miR-iab-4-5p. [score:3]
[1 to 20 of 1 sentences]
6
[+] score: 2
We found that potential Dg-regulated miRNAs are miR-956, miR-962, miR-980, miR-274, miR-312, miR-975, and miR-1003. [score:2]
[1 to 20 of 1 sentences]
7
[+] score: 1
Comparable results were obtained with a known miRNA cluster (mir-310, mir-311, mir-312 and mir-313, Figure 6A), suggesting that the novel clusters may also encode polycistronic transcripts. [score:1]
[1 to 20 of 1 sentences]
8
[+] score: 1
As a matter of fact, ongoing work in the laboratory has shown that the microRNAs mir-92a and mir-92b, and the mir-310/mir-311/mir-312/mir-313 cluster are abundant in Drosophila unfertilized eggs [33]. [score:1]
[1 to 20 of 1 sentences]
9
[+] score: 1
Adenylation by Wispy has been clearly shown to result in decreased stability of miR-312 in Drosophila cells, [38] however, the exoribonuclease responsible for the degradation has not been determined. [score:1]
[1 to 20 of 1 sentences]
10
[+] score: 1
The most abundant microRNAs in unfertilized eggs were produced by mir-92b, mir-184, the mir-310/mir-311/mir-312/mir-313 cluster, and bantam genes, which accounted for over half of the microRNA reads. [score:1]
[1 to 20 of 1 sentences]