sort by

153 publications mentioning hsa-mir-135a-1 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-135a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 400
Compared to NC transfected cells, p21 [Cip1] and p27 [Kip1] were downregulated and Cyclin D1 was upregulated in miR-135a -transfected cells, while p21 [Cip1] and p27 [Kip1] were upregulated and Cyclin D1 was downregulated in miR-135a -inhibitor -transfected cells (Figure  4A–C). [score:14]
Meanwhile, cells overexpressing miR-135a exhibited significantly lower expression of PHLPP2 and FOXO1, while inhibition of miR-135a led to higher PHLPP2 and FOXO1 expression (Figure  5C). [score:9]
MiR-135a decreases expression of the cell cycle inhibitors p21 [Cip1] and p27 [Kip1] and increases expression of cell cycle regulator Cyclin D1As miR-135a promoted cell proliferation, we further investigated the effect of miR-135a on the expression of the genes which regulate cell cycle and proliferation, including p21 [Cip1], p27 [Kip1] and Cyclin D1. [score:9]
The tumor suppressor genes, PHLPP2 and FOXO1, are the direct targets of miR-135a and transcriptionally downregulated by miR-135a. [score:9]
Ectopic expression of miR-135a in bladder cancer cells led to the promotion of cell proliferation, tumorigenicity and cell cycle regulation, while inhibition of miR-135a suppressed the tumor proliferation and tumorigenesis. [score:8]
Herein, in our present study, for the first time PHLPP2 was found to be downregulated in bladder cancer and miR-135a was found to target and repress the expression of PHLPP2, resulting the promotion of bladder cancer proliferation and tumorigenesis. [score:8]
Coincident with altered expression of cell cycle regulators, the expression of Ki67, a cellular marker for proliferation, was also significantly increased in miR-135a -transfected cells, and decreased in miR-135a -inhibitor -transfected cells (Figure  4A–C), which further confirmed that miR-135a promoted the proliferation and cell cycle progression of bladder cancer cells. [score:8]
These results suggested that silencing PHLPP2 and FOXO1 expression in miR-135a-repressed cells could reverse the inhibitory effect of the miR-135a inhibitor on bladder cancer cells proliferation. [score:7]
Wu et al. found miR-135a targets JAK2 and reduces p-STAT3 activation and cyclin D1 and Bcl-xL protein expression, leading to inhibition of gastric cancer cell proliferation [36]. [score:7]
It has been reported that MiR-135a promotes growth and invasion of colorectal cancer via targeting and downregulating metastasis suppressor 1, which is absent or reduced in cancer cells [35]. [score:7]
Our present study suggested that miR-135a promotes cell proliferation, tumorigenicity and cell cycle progression in bladder cells by activating Akt signaling pathway via targeting PHLPP2 and FOXO1 mRNA and suppressing their expression. [score:7]
Moreover, miR-135a has been reported as a tumor-suppressive factor that inhibits cancer cell proliferation by targeting c-MYC in renal cell carcinoma [34]. [score:7]
Furthermore, for the first time we demonstrated PHLPP2 and FOXO1 are direct targets of miR-135a and transcriptionally down-regulated by miR-135a. [score:7]
MiR-135a decreases expression of the cell cycle inhibitors p21 [Cip1] and p27 [Kip1] and increases expression of cell cycle regulator Cyclin D1. [score:7]
Moreover, our study presented data indicating that PHLPP2 and FOXO1 are direct targets of, and downregulated by, miR-135a. [score:7]
To further confirm the importance effect of PHLPP2 or FOXO1 suppression during miR-135a -induced bladder cancer proliferation, a specific siRNA of PHLPP2 or FOXO1 was used to suppress endogenous PHLPP2 or FOXO1 expression, respectively (Figure  6A). [score:7]
It is confirmed that miR-135a promotes bladder cancer cells proliferation and tumorigenicity by suppressing endogenous PHLPP2 and FOXO1 expression, and that PHLPP2 and FOXO1 suppression are essential for miR-135a -mediated cell proliferation in bladder cancer. [score:7]
The protein expression of PHLPP2 and FOXO1 were further found to be decreased in the bladder cancer tissues, compared with that of the normal bladder tissue, and miR-135a expression in these bladder cancer tissues was inversely correlated with the expression of PHLPP2 (r = −0.627, P < 0.05) and FOXO1 (r =-0.712, P < 0.05) (Figure  5B). [score:6]
Loss-of-function studies using a miR-135a inhibitor were performed to further confirm whether inhibition of miR-135a reduces bladder cancer cell proliferation. [score:5]
In the present study, miR-135a was found to be upregulated in bladder cancer cells and tissues, indicating the potential function of miR-135a in bladder cancer development. [score:5]
Figure 3 Inhibition of miR-135a suppresses the growth of bladder cancer cells. [score:5]
The miR-135a mimic (50 nM), miR-135a inhibitor (100 nM; miR -inhibitor is a commercial product from a professional bio-company “RiboBio” (RiboBio Co. [score:5]
The average miR-135a expression was normalized using U6 expression. [score:5]
To explore the molecular mechanism of miR-135a function in bladder cancer cells, the target of miR-135a was predicted using the publicly available algorithms (TargetScan). [score:5]
Moreover, miR-135a is involved in colorectal cancer pathogenesis via targeting and suppressing adenomatous polyposis coli (APC) and inducing downstream Wnt pathway activity [37]. [score:5]
Inhibition of miR-135a suppresses proliferative capacity of bladder cancer cells. [score:5]
Firefly luciferase constructs containing the 3′UTR (or 3′UTR-mutant) of the potential miR-135a target (100 ng), pRL-TK Renilla luciferase normalization control (1 ng; Promega), miRNA mimic, inhibitor or negative control were cotransfected using Lipofectamine 2000 (Invitrogen). [score:5]
Enforced expression of miR-135a promotes bladder cancer cells proliferation, whereas inhibition of miR-135a reverses the function. [score:5]
Currently, we demonstrate that PHLPP2 and FOXO1 are the direct targets of miR-135a and that silencing PHLPP2 or FOXO1 plays a crucial role in miR-135a -induced proliferation of bladder cancer cells. [score:4]
C. The expression level of PHLPP2 or FOXO1 protein in bladder cancer cells transfected with miR-135a or miR-135a inhibitor, respectively, compared with control cells (shown as NC), by Western blotting analysis. [score:4]
This study shows that miR-135a is significantly upregulated and promotes cellular proliferation in bladder cancer. [score:4]
Suppression of PHLPP2 or FOXO1, followed with dysregulation of p21, p27, CyclinD1 and Ki67, play critical roles during miR-135a -mediated bladder cancer cells proliferation. [score:4]
Collectively, these results suggested that miR-135a directly targets FOXO1 in bladder cancer cells. [score:4]
In addition, p21, p27, Cyclin D1 and Ki67 were found to be dysregulated in miR-135a- overexpressing bladder cancer cells, indicating a putative correlation between miR-135a and the PI3K/Akt signaling pathway. [score:4]
FOXO1 and PHLPP2 are direct targets of miR-135a in bladder cancer cells. [score:4]
Consist with previous studies, our results suggested that PHLPP2 and FOXO1 are both downregulated by miR-135a in bladder cancer cells, and mediated miR-135a -induced cell proliferation. [score:4]
These results suggested that downregulation of miR-135a reduces the proliferation and tumorigenicity of bladder cancer cells. [score:4]
PHLPP2 and FOXO1 are direct targets of miR-135a in bladder cancer cells. [score:4]
In the present study, we found that miR-135a is significantly upregulated in bladder cancer cells and tissue, leading to increased bladder cell proliferation and tumorigenicity. [score:4]
is used to confirm whether FOXO1 is the direct target of miR-135a. [score:4]
In order to further verify the expression pattern of miR-135a in human bladder cancer tissues, we examined and compared the expression levels of miR-135a in seven pairs of human bladder cancer tissues and adjacent non-tumor tissues. [score:4]
miR-135a is upregulated in bladder cancer cells and tissues. [score:4]
Figure 7 The mo del of miR-135a -mediated Akt signaling activation through down-regulation of PHLPP2 and FOXO1 that results in the promotion of bladder cancer cell proliferation and tumorigenesis. [score:4]
Meanwhile, colony formation assays showed that overexpression of miR-135a enhanced the proliferation of bladder cancer cells, and colonies were much larger in bladder cancer cells stably overexpressing miR-135a (Figure  2B, Additional file 1: Figure S1B and Additional file 2: Figure S2A). [score:4]
The results of cell viability MTT and the colony formation assay both indicated that suppression of PHLPP2 or FOXO1 in cells transfected with miR-135a inhibitor dramatically increased the proliferation of bladder cancer cells (Figure  6B and C). [score:4]
Suppression of PHLPP2 or FOXO1 by miR-135a, consisted with dysregulation of p21, p27, Cyclin D1 and Ki67, play important roles in bladder cancer progression. [score:4]
To explore the mechanism of miR-135a -induced cell proliferation, we investigated potential targets of miR-135a and found that PHLPP2 and FOXO1 are directly targeted by miR-135a and are essential for the bio-function of miR-135a in bladder cancer. [score:4]
All these experiments were done with T24 and 5637 cells stably overexpressing miR-135a or pMSCV-vector. [score:3]
Figure 4 MiR-135a modulates expression of cell cycle regulators, including p21 [Cip1], p27 [Kip1], Cyclin D1 and Ki67. [score:3]
D. Effects of ectopic miR-135a expression on cell cycle progression of the indicated cells, as analyzed by flow cytometry. [score:3]
MTT and colony formation assays showed that suppression of miR-135a significantly decreased the proliferative capacity of T24 and 5637 cells transfected with the miR-135a inhibitor compared with that of NC transfected cells (Figure  3A and B). [score:3]
B. The expression of miR-135a was examined in seven pairs of cancerous tissues (T) and their adjacent non-cancerous bladder tissues (ANT). [score:3]
In addition, as there are various targets that correlate with multiple biological function of miR-135a in other tumors confirmed by previous studies, the potential function of miR-135a on other bladder cancer biology might be of great interest to explore. [score:3]
D. Effects of miR-135a inhibitor or negative control on cell cycle progression of the indicated cells, as analyzed by flow cytometry. [score:3]
The miR-135a expression plasmid, pMSCV-miR-135a, was generated by cloning the genomic pre-miR-135a gene into the retroviral transfer plasmid pMSCV-puro (Clontech Laboratories Inc. [score:3]
Stable cell lines expressing miR-135a were established via retroviral infection according to a previously reported protocol [29] and stably transduced cells were selected by treatment with 1.5 μg/ml puromycin for 10 days beginning at 48 h after infection. [score:3]
It is reported this SNP decreases risk and favorable prognosis in lung cancer by miRNA-135a/b -mediated reduction of CD133 expression [33]. [score:3]
Co-transfection of miR-135a with the pGL3-PHLPP2-3′UTR or pGL3-FOXO1-3′UTR luciferase reporter plasmid caused a remarkable decrease of luciferase activity, whereas inhibition of miR-135a led to increased luciferase activity (Figure  5D). [score:3]
the expression of miR-135a was exmined by real-time RT-PCR in bladder cancer. [score:3]
C. Real-time PCR analysis of p21 [Cip1], p27 [Kip1], Cyclin D1 and Ki67 mRNA in bladder cancer cells transfected with the miR-135a inhibitor or NC. [score:3]
Suppression of PHLPP2 or FOXO1 is essential for miR-135a -induced cell proliferation in bladder cancer. [score:3]
The results showed that the relative expression of miR-135a in bladder cancer tissues was significantly higher than that of their matched adjacent normal tissues (n = 7, r = 0.896, P = 0.006; Figure  1B). [score:3]
Lower: Real-time PCR analysis of miR-135a in bladder cancer tissues, and the correlation between miR-135a and PHLPP2 or FOXO1 expression in bladder cancer tissues. [score:3]
These data suggested that miR-135a expression was elevated in bladder cancer, indicating a putative tumor-promoter function of miR-135a in bladder cancer. [score:3]
Our study reveals for the first time that miR-135a acts as an onco-miR and promotes cell proliferation by reducing FOXO1 expression in bladder cancer. [score:3]
These results indicated that overexpression of miR-135a promoted the proliferation, tumorigenicity and cell cycle progression of bladder cancer cells in vitro. [score:3]
PHLPP2 and FOXO1 were identified among the putative targets of miR-135a and the potential binding sequence for miR-135a was identified within the 3′UTR of PHLPP2 and FOXO1 (Figure  5A). [score:3]
Figure 5 PHLPP2 and FOXO1 are potential targets of miR-135a. [score:3]
The negative regulation of PHLPP2 and FOXO1 by miR-135a leads to dysregulation of phosphorylated Akt, p21, p27, CyclinD1 and Ki67, indicating that miR-135a plays an essential role in bladder cancer progression through Akt -mediated signaling (Figure  7). [score:3]
All these experiments were done with T24 and 5637 cells stably overexpressing miR-135a, pMSCV-vector (presented as Vector) or non -transfected cell control (presented as Blk). [score:3]
Our study demonstrates that miR-135a promotes cell proliferation in bladder cancer by targeting PHLPP2 and FOXO1, and is performed as an onco-miR. [score:3]
Figure 1 Expression of miR-135a is elevated in bladder cancer cells. [score:3]
MiR-135a functions as an onco-miR in bladder cancer and interventions targeting miR-135a may provide novel insights into approaches to bladder cancer diagnosis and therapy. [score:3]
A. The expression level of PHLPP2 or FOXO1 in miR-135a -inhibitor transfected bladder cells that were transfected with PHLPP2- or FOXO1-siRNA, measured bys; α-Tubulin served as the loading control. [score:3]
In addition, miRNA-135a was also found to promote breast cancer cell migration and invasion by targeting HOXA10 [38]. [score:3]
Liu et al. demonstrated that miR-135a contributes to the development of portal vein tumor thrombus by promoting invasion and metastasis in hepatocellular carcinoma [32]. [score:2]
The level of DNA synthesis, when examined by BrdUrd incorporation assay, was significantly elevated in miR-135a overexpressing T24 and 5637 cells, whereas the control cells displayed relatively lower BrdUrd incorporation rates (Figure  2E). [score:2]
The expression of miR-135a in bladder cancer cells and tissues are performed by using Real-time PCR assay. [score:2]
As miR-135a promoted cell proliferation, we further investigated the effect of miR-135a on the expression of the genes which regulate cell cycle and proliferation, including p21 [Cip1], p27 [Kip1] and Cyclin D1. [score:2]
The biological function of miR-135a and its mechanism in bladder cancer development has not been elucidated. [score:2]
A miRNA-135a/b binding polymorphism, the SNP rs2240688A > C in the 3′-untranslated region of CD133, is considered to be a functional biomarker for the prediction of risk and prognosis in lung cancer. [score:2]
A. Effects of miR-135a inhibitor (shown as miR-135a-in) or negative control (shown as NC) on the proliferation of bladder cancer cells, as analyzed by MTT assays. [score:2]
The anchorage-independent growth assay revealed that suppression of miR-135a led to fewer and smaller colonies than the control cells (Figure  3C). [score:2]
A. Sequence of PHLPP2- or FOXO1-3′UTR miR-135a binding seed region, miR-135 and mutation of miR-135a (shown as miR-135a-mut). [score:2]
C. Effects of miR-135a inhibitor or negative control on the tumorigenicity of the indicated cells, as determined by anchorage-independent growth ability assays. [score:2]
An MTT assay showed that ectopic expression of miR-135a significantly increased the growth rate of bladder cells (Figure  2A, Additional file 1: Figure S1A). [score:2]
Figure 6 MiR-135a promotes proliferation of bladder cancer cells by inhibiting PHLPP2 and FOXO1. [score:2]
A. Real-time PCR analysis of miR-135a expression in bladder cancer cells, including primary culture cells of bladder cancer tissues (shown as T#1, T#2, T#3) and bladder cancer cell lines, EJ, T24, BIU87, SCaBER, and 5637, compared to normal bladder cells as controls. [score:2]
Thus, miR-135a plays essential role during the regulation of PHLPP2 and FOXO1, followed with activation of Akt related pathway in bladder cancer cells. [score:2]
Additionally, an anchorage-independent growth assay revealed that bladder cells stably overexpressing miR-135a showed more and larger-sized colonies than control cells (Figure  2C, Additional file 1: Figure S1C and Additional file 2: Figure S2B). [score:2]
MiR-135a expression is elevated in bladder cancer. [score:2]
However, to date, the exact functions and regulatory mechanisms of miR-135a in tumorigenesis of bladder cancer remain largely unknown. [score:2]
Flow cytometry showed a significant increase in the percentage of cells in G1/G0 phase and a decrease in the percentage of cells in S phase in cells transfected with the miR-135a inhibitor compared with NC transfected cells (Figure  3D). [score:2]
MiR-135a was found to be markedly upregulated in bladder cancer cells, including primary cultures of bladder cancer tissues and bladder cancer cell lines, EJ, T24, BIU87, SCaBER, and 5637, compared with normal bladder epithelial cells (primary cultures of normal bladder tissues) (Figure  1A). [score:2]
C. Effects of ectopic miR-135a expression on the tumorigenicity of the indicated cells, as determined by anchorage-independent growth ability assays. [score:2]
BrdUrd incorporation assays showed that the level of DNA synthesis was reduced by inhibition of miR-135a (Figure  3E). [score:2]
Further studies are required to elucidate the detailed molecular mechanism underlying the role of miR-135a in tumor progression. [score:1]
However, luciferase activity was not affected by miR-135a-mut transfection instead of miR-135a;or pGL3-PHLPP2/FOXO1-3′UTR mutant instead of pGL3-PHLPP2/FOXO1-3′UTR (Figure  5A and D; Additional file 3: Figure S3). [score:1]
B. Real-time PCR analysis of p21 [Cip1], p27 [Kip1], Cyclin D1 and Ki67 mRNA in bladder cancer cells transfected with miR-135a or NC. [score:1]
We investigated the expression of miR-135a in bladder cancer and explored its bio-function during bladder cancer progression. [score:1]
Bladder cancer miR-135a PHLPP2 FOXO1 Proliferation Bladder cancer is the most common malignancy involving the urinary system and more than 350,000 new cases of bladder cancer are diagnosed globally each year [1, 2]. [score:1]
The relative expression levels of miRNA were calculated as 2 [-[(Ct of miR-135a) – (Ct of U6)]]. [score:1]
To determine the tumor-promoter function of miR-135a in bladder cancer progression, T24, 5637 and BIU87 cells stably overexpressing miR-135a were established for further investigations. [score:1]
[1 to 20 of 103 sentences]
2
[+] score: 361
To further examine the inhibitory effect of miR-135a on cell migration and invasion is caused by targeting FAK, miRNA inhibitors and FAK inhibitor are used. [score:9]
Our data also indicates FAK can inhibit the expression of miR-135a by downregulating p53. [score:8]
Regaining the expression of miR-135a in gastric cancer cells can inhibit tumor growth, invasion and angiogenesis by targeting FAK/VEGF pathway. [score:7]
To further confirm FAK is a target of miR-135a, miRNA inhibitors are transfected into overexpressing cells to weak miR-135a effect. [score:7]
“Increased miR-135a expression” represents patients that have an elevated miR-135a in tumor tissues compared with its corresponding para-cancer (logFC > 0); “Decreased miR-135a expression” represents patients that have lower miR-135a expression (logFC < 0). [score:6]
For C& D, cells are firstly transfected with 200 nM nonsense control RNA (NC) or miRNA inhibitor (200 nM) for 24 h, then treated with FAK inhibitor for 24 h, washed with PBS and re-seeded into transwell insert (A) The effect of miR-135a and FAK inhibitor (VS6063) on HUVEC tubules formation is assessed by tubule formation assay. [score:6]
Regaining p53 in gastric cancer promotes miR-135a expression, indicating p53 mutant may be a reason for the downregulation of miR-135a in gastric cancer. [score:6]
Figure 7(A) The protein expression of FAK in 30 gastric tissues is detected by Western Blot assay, the relative expression is analyzed with Image J software and the expression of miR-135a in different FAK status is analyzed by GraphPad Prism with student t test. [score:6]
In order to identify the potential regulators of miR-135a, promoter of miR-135a is analyzed with Jaspar software (75% threshold), and the potential transcriptional factors (TFs) are listed in Supplementary Table 2. As important tumor suppressors, p53 and BRCA1 modulate the transcription of various downstream targets. [score:6]
miR-135a as a potential tumor metastasis suppressor is downregulated in gastric cancer. [score:6]
As expected, the expression of phosphorylated ERK1/2 (Figure 2B) and VEGFA (Figure 2C) are declined in miR-135a overexpressing cells. [score:5]
As shown in Figure 2D, cells treated with CM from miR-135a overexpressing cells has a lower expression of p-FAK, indicating miR-135a can also repressed VEGF -mediated FAK activation. [score:5]
Recovering the expression of miR-135a impairs the progression of breast and lung cancer by repressing EMT progress [12, 13] Recently, miRNA array analysis reveals that the expression of miR-135a is markedly decreased during lymphatic metastasis of gastric cancer. [score:5]
To further confirm the effect of miR-135a/FAK axis on cell apoptosis, miRNA inhibitors and FAK inhibitors are used. [score:5]
Our data also shows miR-135a can slightly suppress another FAK associated pathway ROCK1/LIMK1 which has been proved a target of miR-135a in prostate recently [10]. [score:5]
200 miR-135a overexpressing or control cells (2 groups) were seeded in matrigel (BD, USA) pre-coated 96-well plates and one control group added 10 μM FAK inhibitor (VS6063 also called Defactinib or PF04554878) (Sellckchem, USA). [score:5]
As shown in Figure 2B, regaining miR-135a significantly inhibits the protein expression of FAK. [score:5]
Besides, low miR-135a expression often has a higher probability of relapse and a shorter disease free survival in hodgkin lymphoma. [score:5]
Overexpression of miR-135a markedly inhibits the growth, migration and angiogenesis of gastric cancer by impairing FAK pathway. [score:5]
After blocking miR-135a with miRNA inhibitor, the migration and invasion ability of miR-135a overexpressing cells are enhanced. [score:5]
As shown in Figure 3D, when blocking miR-135a with miRNA inhibitors, apoptotic cells in miR-135a overexpressing cells are decreased. [score:5]
All these results prove miR-135a is able to inhibit the translation of FAK by binding to its 3′UTR. [score:5]
While, when miR-135a expression is blocked with its inhibitor, the tubules formation is enhanced. [score:5]
Results of immunohistochemistry show that fewer CD34 positive expression is obtained in miR-135a overexpressing group (Figure 6B). [score:5]
2 × 10 [5] miR-135a overexpressing or control cells (2 group) were seeded into 6-well plates, and one control group was treated with 10 μM FAK inhibitor VS6063. [score:5]
Our data also demonstrate miR-135a is a novel target of p53, and can form a FAK/p53/miR-135a loop signaling, making it a potential therapeutic target for metastatic gastric cancer. [score:5]
miR-135a inhibits gastric cancer growth and tubule formation by targeting FAK. [score:5]
FAK is upregulated in gastric cancer and negatively correlated with miR-135a. [score:4]
Tumor metastasis related miR-135a is downregulated in gastric cancer cell lines and tissues. [score:4]
While, some other studies find miR-135a is downregulated in pancreatic ductal adenocarcinoma [9], prostate cancer [10] and epithelial ovarian cancer [11]. [score:4]
Taken together, this study shows that miR-135a is a key metastasis related miRNA and significantly downregulated in gastric cancer. [score:4]
Figure 3miR-135a suppress cell growth in vitro(A) assay is used to examine the effect of miR-135a and FAK inhibitor (VS6063, 10μM) on two gastric cancer cells. [score:4]
FAK is upregulated and negatively associated with miR-135a in tumor tissues. [score:4]
Consistent with these findings, we observe marked suppression of cell viability in miR-135a overexpressing and VS6063 -treated cells by performing MTT assay (Figure 3B). [score:4]
In ovarian cancer, miR-135a inhibits the growth and survival of cancer cells by repressing HOXA10 [11]. [score:3]
Besides, our data identify miR-135a as a novel target gene of p53, and can form a loop signaling with FAK (Figure 8H). [score:3]
2 × 10 [3] miR-135a overexpressing or control cells were seeded into 96-wells and allowed to attach for 24 h. Then cells were incubated with 10 μL MTT (10 mg/mL) (Beyotime Biotechnology, China) at 37°C for 4 hours. [score:3]
Para-cancer) has a lower expression of miR-135a than patients with decreased FAK (FAK down) (p = 0.0114). [score:3]
As shown in Figure 3A, clone numbers in miR-135a overexpressing groups are fewer than control groups. [score:3]
The functional cluster of miR-135a interacted target genes. [score:3]
miR-135a suppress cell growth in vitro. [score:3]
miR-135a inhibits cell migration and invasion. [score:3]
Figure 8E shows p53-lacking gastric tissues have a lower expression of miR-135a than control tissues. [score:3]
Low miR-135a expression is associated with advanced tumor TNM stage and poor patients′ survival. [score:3]
Subsequently, lower expression of miR-135a in gastric cancer tissues is confirmed by real-time PCR assay, and the tumor suppressor functions for miR-135a are validated with clone formation, flow cytometry, transwell, tubule formation and tumor bearing nude mice assays. [score:3]
Our above results show that miR-135a inhibits the production of VEGF and activation of FAK. [score:3]
To further confirm miR-135a is a downstream target of p53, miR-135a levels in primary gastric tissues from p53 wild type (p53 [+/+]) and knocking out (p53 [−/−]) mice are examined by Real-time PCR assay. [score:3]
As shown in Figure 4A, fewer migrated miR-135a overexpressing cells and VS6063 -treated cells are seen on the insert membrane than control cells. [score:3]
The association between miR-135a expression and clinical characters was analyzed with one-way ANOVA. [score:3]
FAK is a target gene of miR-135a. [score:3]
By analyzing potential target genes, we find miR-135a is involved in various signaling pathways including angiogenesis, VEGFA, EGF, oxidative stress response, p38, TGFβ and interleukin pathway. [score:3]
Further experiments in vitro reveal miR-135a can targeting FAK/ERK/VEGFA and ROCK/LIMK pathway. [score:3]
These findings are consistent with the above results in which increased miR-135a expression is only appeared in SGC-7901 cells. [score:3]
miR-135a inhibits tumor growth and angiogenesis in nude mice. [score:3]
Considering FAK is known to inhibit tumor growth by inducing apoptosis, so we wonder whether the effect of miR-135a on cell growth is caused by apoptosis. [score:3]
1 × 10 [6] miR-135a overexpression and control tumor cells (pre-mixed with 50 μL matrigel before injecting) were injected into bilateral axillary of BALB/c nude mice (n = 6 per group). [score:3]
Flow cytometry analysis shows that the proportion of apoptotic cells is increased in SGC-7901 and BGC-823 cells with forced expression of miR-135a (Figure 3C). [score:3]
Firstly, we construct miR-135a overexpressing cell lines by infecting with lentivirus, and the infection efficiency is validated by Real-time PCR (Supplementary Figure 1A). [score:3]
To better understand the function of miR-135a in cancer, we analyzes the expression of miR-135a in other cancer tissues with Starbase software. [score:3]
It is known that miR-135a can function as a selective killer of malignant glioma by targeting STAT6, SMAD5 and BMPR2 [33]. [score:3]
The expression of miR-135a in gastric cancer tissues was estimated with one-sample t test. [score:3]
Our study proposes a novel FAK/p53/miR-135a loop signaling which may be a potential therapeutic target for metastatic gastric cancer. [score:3]
Afterwards, we assess the expression of miR-135a in 176 pairs of gastric cancer tissue and its corresponding para-cancer tissues collecting from the First Affiliated Hospital of China Medical University (details are listed in Supplementary Table 1). [score:3]
Our results demonstrate that the expression of miR-135a is markedly reduced in gastric cancer cell lines and tissues. [score:3]
miR-135a is a target gene of p53 in gastric cancer. [score:3]
Subsequently, studies demonstrate miR-135a contributes to the development of portal vein tumor thrombus in hepatocellular carcinoma [7] and leads to cervical cancer cell transformation through regulating SIAH1/β-catenin signaling [8]. [score:3]
Moreover, miR-135a is markedly decreased in the metastatic MDA-MB-435 subline which is isolated from lung metastasis, indicating angiogenesis may be crucial target pathway of miR-135a. [score:3]
As shown in Figure 6A, miR-135a overexpressing SGC-7901 has a definitely smaller tumor volume than control group. [score:3]
Potential target genes that interacted with miR-135a and their functional cluster were analyzed with StarBase software. [score:3]
Similarly, regaining miR-135a is able to inhibit tumor growth and blood vessels formatting in BGC-823 cell lines (Figure 6C and 6D). [score:3]
Therefore, we assess the activated FAK in gastric cancer cells that treated with conditioned medium (CM) from control or miR-135a overexpressing cells. [score:3]
Stomach tissues in p53 knocking out mice have a lower miR-135a expression compared with p53 wild type. [score:3]
Inversely, when we elevate p53 by transfecting wild p53 plasmid, the expression of miR-135a is partly restored (Figure 8F). [score:3]
Taken together, these findings indicate that miR-135a is a tumor suppressor in gastric cancer by influencing tumor growth and angiogenesis. [score:3]
1 × 10 [5] miR-135a overexpressing or control cells were seeded into 6-well plates. [score:3]
To determine the anti-tumor function of miR-135a, we inject control and miR-135a overexpressing cells into the bilateral axillary of BALB/c nude mice respectively. [score:3]
FAK is a novel target of miR-135a in gastric cancer. [score:3]
So we wonder whether miR-135a is also a tumor suppressor in gastric cancer. [score:3]
miR-135a suppress tubules formation of HUVEC cells. [score:3]
Figure 5(A) The effect of miR-135a and FAK inhibitor (VS6063) on HUVEC tubules formation is assessed by tubule formation assay. [score:2]
All findings indicate p53 may be the major regulator of miR-135a in gastric cancer. [score:2]
In this study, we demonstrate that miR-135a is a crucial regulator of tumor metastasis. [score:2]
So the expression of miR-135a in VS6063 -treated cells are examined with Real-time PCR assay. [score:2]
Then miR-135a expression was detected with SYBR [R]premix Ex Taq™ II kit (Takara, China) using the following primers: miR-135a forward, 5′-GCGCGTATGGCTTTTTATTCCT-3′, miR-135a reverse, 5′-CAGTGCAGGGTCCGAGGTC-3; U6 forward, 5′-CTCGCTTCGGCAGCACA-3′, U6 reverse, 5′-AACGCTTCACGAATTTGCGT-3′. [score:2]
HUVEC cells that stimulated with conditioned medium (CM) from miR-135a overexpressing cells or VS6063 pre -treated cells, have a decreased tubules formatting ability compared with the control groups (Figure 5A). [score:2]
In this study, we find miR-135a is significantly decreased in metastasis cell lines compared with the parent lung metastasis cell lines, indicating miR-135a may be a key tumor metastasis suppressor. [score:2]
Surprisingly, elevated miR-135a level is observed in SGC-7901 cells, but no statistically significant changes were noted in BGC-823 cells (Figure 7B), hinting the regulation of miR-135a by FAK may be dependent on cell context. [score:2]
To generate MiR-135a overexpressing or Control BGC-823 and SGC-7901 stable cells, 1 × 10 [4]cells were seeded into 12-well plates overnight. [score:2]
However, the function and regulatory mechanism of miR-135a in gastric cancer is ill defined. [score:2]
Figure 4(A) The effect of miR-135a and FAK inhibitor (VS6063) on cell migration are examined by transwell assay (200×). [score:2]
The effect of miR-135a expression on gastric cancer prognosis is also examined by constructing Kaplan-Meier curves and difference between groups is compared by Log-rank test. [score:2]
These findings indicate distinct function of miR-135a varies among tumors depending on the landscape of tissue types. [score:1]
Results show that patients with increased miR-135a (41/176) have a better overall survival, suggesting miR-135a may be a prognosis factor of gastric cancer (Figure 1E). [score:1]
Figure 2E shows that co-transfection miR-135a mimics together with luciferase plasmids reduces the luciferase activity of WT FAK-3′UTR. [score:1]
1 × 10 [5] cells were seeded into 24-well plate, then 200 ng luciferase report vector (WT/DEL), 10 ng pMIR-Report™ control plasmid and 100 nM miR-135a mimics or control mimics were co -transfected with Higene reagent. [score:1]
As shown in Figure 1B, miR-135a level is obviously decreased in 5 gastric cancer cell lines. [score:1]
We can also find that there are two BRCA1 binding sites and one p53 binding site on the promoter of miR-135a (Figure 8A). [score:1]
Figure 8(A) of miR-135a promoter with Jaspar software. [score:1]
Previous studies have shown miR-135a also acts as an oncogene in some carcinomas. [score:1]
From the results we can find miR-135a is decreased in the metastatic subline. [score:1]
We also assess the effect of miR-135a in BGC-823 cell lines. [score:1]
Figure 2A displays miR-135a binding site on the 3′UTR of FAK. [score:1]
However, this finding does not exclude that FAK may be a potential upstream gene of miR-135a. [score:1]
Further experiments reveal that p53 can bind the promoter of miR-135a. [score:1]
miR-135a functions as an oncogenic microRNA in colorectal carcinomas by repressing adenomatous polyposis coli (APC) [6]. [score:1]
Moreover, we also find miR-135a is decreased in head & neck, lung, kidney, skin cancers, while it is increased in glioblastoma multiforme, hinting opposite function of miR-135a is determined by different genetic context. [score:1]
Our above data has proved that miR-135a is decreased in 5 gastric cancer cells. [score:1]
Figure 1C shows that the majority of tumor tissues (135/176) has a lower miR-135 level than its corresponding normal tissues. [score:1]
By analyzing miRNA array, we find miR-135a is significantly arrested in the metastatic cell lines. [score:1]
Effects of miR-135a on tumor growth and angiogenesis in vivo. [score:1]
To evaluate whether miR-135a can inhibit cancer angiogenesis by targeting FAK/VEGF pathway, cell tubules formation of HUVEC cells are evaluated. [score:1]
Recovering miR-135a in gastric cancer cells obviously represses the cell growth, migration, invasion, HUVEC cells tubule formation in vitro, and impairs tumor growth and angiogenesis in nude mice. [score:1]
Interestingly, miR-135a is decreased in head & neck, lung, kidney, skin cancers, while increased in glioblastoma multiforme (GBM) (Figure 7C). [score:1]
[1 to 20 of 113 sentences]
3
[+] score: 96
Changes in miRNA expression at 3 h ranged from 11-fold down-regulation (miR-224) to 3.8-fold up-regulation (miR-367), and at 24 h from 7-fold down-regulation (miR-222) to 20.6-fold up-regulation (miR-135a*; Figure 2). [score:15]
Down-regulated miR-135a* target genes are listed in Table 4. Canonical pathway analysis of these genes showed that the expression of genes linked to the production of nitric oxide (NO) and reactive oxygen species (ROS; Ncf2 and Ppp2r2b), Wnt/β-catenin signaling (Wnt1), and ERK/MAP kinase signaling (Rapget3) could be down-regulated by miR-135a* in response to NP exposure Table 3 Functional classification of miR-135a* target genes Molecular and cellular functions Name P-value No. [score:13]
Down-regulated miR-135a* target genes are listed in Table 4. Canonical pathway analysis of these genes showed that the expression of genes linked to the production of nitric oxide (NO) and reactive oxygen species (ROS; Ncf2 and Ppp2r2b), Wnt/β-catenin signaling (Wnt1), and ERK/MAP kinase signaling (Rapget3) could be down-regulated by miR-135a* in response to NP exposure Table 3 Functional classification of miR-135a* target genes Molecular and cellular functions Name P-value No. [score:13]
miR-135a* was significantly up-regulated after exposure to NP for 24 h. The change in miR-135a* expression was the highest in this study (20.6-fold up-regulation). [score:9]
of genes Cell Cycle 2.48E-04 - 1.72E-02 7 Cell Death 1.02E-03 - 4.78E-02 7 Cell Morphology 1.02E-03 - 4.69E-02 3 Cell-To-Cell Signaling and Interaction 1.02E-03 - 4.78E-02 4 Cellular Assembly and Organization 1.02E-03 - 4.00E-02 2 Table 4 miR-135a* target genes the expression of which was down-regulated in NP -treated TM4 cells Gene symbol Gene title Acc. [score:8]
of genes Cell Cycle 2.48E-04 - 1.72E-02 7 Cell Death 1.02E-03 - 4.78E-02 7 Cell Morphology 1.02E-03 - 4.69E-02 3 Cell-To-Cell Signaling and Interaction 1.02E-03 - 4.78E-02 4 Cellular Assembly and Organization 1.02E-03 - 4.00E-02 2 Table 4 miR-135a* target genes the expression of which was down-regulated in NP -treated TM4 cells Gene symbol Gene title Acc. [score:8]
qRT-PCR results showed that miR-135a* was up-regulated 1.9-fold and miR-199a-5p down-regulated approximately 1.7-fold in independent experiments (Additional file 2, Figure S2). [score:7]
We chose miR-135a* and miR-199a-5p, two miRNAs that were found in microarray analyses to be highly up- and down-regulated, respectively. [score:4]
Finally, miR-135a* target gene analysis suggests that the generation of reactive oxygen species (ROS) following exposure to NP exposure may be mediated by miR-135a* through regulation of the Wnt/beta-catenin signaling pathway. [score:4]
Functional analysis of miR-135a* target genes. [score:3]
miR-135a* may target ERK/MAP kinase signaling-related genes. [score:3]
Genes implicated in the production of NO and ROS were predicted to be miR-135a* targets. [score:3]
Levels of expression of the miRNAs miR-135a* and miR-199a-5p were validated by qRT-PCR. [score:3]
Click here for file Supplemental Figure S2: Validation of miR-135* and miR-199a-5a levels by qRT-PCR. [score:1]
Supplemental Figure S2: Validation of miR-135* and miR-199a-5a levels by qRT-PCR. [score:1]
We thus suggest that miR-135a* may play important roles following NP exposure. [score:1]
[1 to 20 of 16 sentences]
4
[+] score: 41
Regarding translocation t(4;14), three miRNAs are differentially expressed, i. e. miR-135a, miR-596, and miR-432*, being significantly down-regulated when a t(4;14) is present with a maximal FC of 1.9 (Supplementary Table S6B). [score:6]
Target gene signatures for miR-135a, miR-135b, miR-200a, and miR-200b significantly predict for EFS and OS with a high “target risk-score” delineating a group with inferior survival (Figure 3B, 3C). [score:5]
Those remaining significant after correction for multiple testing, i. e. miR-135a, miR-135b, miR-200a, miR-200b, and miR-596, have recently been published to play a role in solid tumors and hematologic cancers, respectively, e. g. functioning as either oncogenes or tumor-suppressors and prognostic markers [44– 48]. [score:3]
B, C. By using miRWalk, predicted target genes for miR-135a, miR-135b, miR-200a, and miR-200b are significantly associated with (B1,C1) event-free survival (miR-135a, P <. [score:3]
ISS-stage as surrogate of tumor mass is associated with the expression miR-135a and miR-596. [score:3]
In an ANOVA-mo del including the target risk-scores of miR-135a, miR-135b, miR-200a, miR-200b and the UAMS-score, the score of miR-200a remains significant (P =. [score:3]
Indeed, a high expression of miR-135a, miR-135b, and miR-596 is significantly associated with a t(4;14), miR-596 also with del13q14. [score:3]
Regarding the IFM-score, target risk-scores of miR-135a and miR200a (P <. [score:3]
High expression of miR-135a (P =. [score:3]
Expression of three survival relevant miRNAs (miR-135a, miR-135b, and miR-596) was validated in ten cell lines and nine primary myeloma cell samples using qRT-PCR (miQPCR). [score:3]
The IFM-score is significantly associated with miR-135a (P =. [score:1]
001) and (B2,C2) overall survival (miR-135a, P <. [score:1]
Both miRNAs which were significantly associated with the ISS-stage as a surrogate of tumor mass (see above), i. e. miR-135a (P =. [score:1]
Corrected for multiple testing, five miRNAs remained significantly associated with EFS as continuous variable, i. e. miR-135a, miR-135b, miR-200a, miR-200b, and miR-596, and, but for miR-200b, also with OS (Figure 2). [score:1]
Two miRNAs, miR-135a and miR-596, show a significant association with the International Staging System (ISS) (P =. [score:1]
Besides, miR-135a (P =. [score:1]
[1 to 20 of 16 sentences]
5
[+] score: 37
For example, the targets of the mir-135 family, a family that was up-regulated in the vestibule, were enriched in a set of proteins down-regulated in this tissue; and the targets of mir-205, a miRNA that exhibited a higher expression in the cochlea, were depleted in a set of proteins also up-regulated in the cochlea. [score:16]
We noted that targets of mir-135 were marginally enriched in the set of all proteins up-regulated in the cochlea (P = 0.075), and a statistically significant enrichment was found only when considering genes up-regulated in the cochlea only on the protein level (i. e., genes without significant mRNA changes between the two tissues, P = 0.047). [score:9]
Thus, for six miRNA families – mir-135, mir-205, mir-142-3p, mir-15/16, mir-218 and mir-24 - we obtained evidence for their functional relevance in the inner ear on two levels: (a) the miRNAs were differentially expressed between the two tissues; and (b) their predicted targets were differentially expressed in a manner consistent with the currently accepted mo del of miRNA regulation. [score:8]
Due to the similarity between miR-135b and miR-135a, we predict that miR-135a also regulates PSIP1-P75 in the vestibular system. [score:2]
According to our results, miR-135a also has a higher level of expression in the vestibular as compared to the cochlear sensory epithelia. [score:2]
[1 to 20 of 5 sentences]
6
[+] score: 29
We observed a significant overexpression of miR-21, miR-96, miR-135, miR-141, miR-182, miR-205, miR-429, miR-520b (all p<0.001) in UUTUC; the microRNAs miR-10a (p = 0.012) and miR-200b (p = 0.006) showed a distinct trend towards upregulation, whereas miR-1244 (p = 0.600) was similar in normal and malignant tissue. [score:6]
The expression of eleven microRNAs (miR-10a, miR-21, miR-96, miR-135, miR-141, miR-182, miR-200b, miR-205, miR-429, miR-520b, miR-1244) formerly shown to be upregulated in urothelial bladder cancer were studied in corresponding normal and cancerous tissue samples of patients undergoing nephroureterectomy for UUTUC. [score:6]
MicroRNA expression allowed differentiation of normal and cancerous tissue: miR-21, miR-96, miR-135, miR-141, miR-182, miR-205, miR-429 and miR-520b were significantly overexpressed. [score:5]
In order to investigate the role of microRNAs as non-invasive biomarkers in patients with UUTUC, the expression of eleven microRNAs (miR-10a, miR-21, miR-96, miR-135, miR-141, miR-182, miR-200b, miR-205, miR-429, miR-520b, miR-1244) earlier shown to be upregulated in urothelial cancer of the bladder [13– 20], was analyzed [11] in corresponding normal ureter and UUTUC tissue. [score:4]
Especially miR-21, miR-96, miR-135, miR-141, miR-182, miR-205, miR-429 and miR-520b were distinctly overexpressed in UUTUC. [score:3]
Tumor grade and stage are usually correlated in urothelial cancer, and thus one would expect significant correlations with stage (miR-205) or grade (miR-10a, miR-135), respectively. [score:1]
miR-182 (p = 0.083), miR-21 (p = 0.532) and miR-135 (p = 0.261) were similar in UUTUC patients and controls. [score:1]
Furthermore, we observed lower levels of miR-10a and miR-135 in UUTUC patients. [score:1]
miR-135 also showed a trend towards lower levels in cancer patients with muscle-invasive tumors (2.18 vs. [score:1]
The miR-205 tissue levels were also correlated with undifferentiated UUTUC, and miR-10a and miR-135 were decreased in serum of patients with muscle-invasive UUTUC. [score:1]
[1 to 20 of 10 sentences]
7
[+] score: 27
Over-expressed miRs (miR-135a and miR-17-5p) and down-regulated miRNAs (miR-383 and miR-485-5p) are represented. [score:6]
We have identified miRNAs that are over-expressed in ependymomas, such as miR-135a and miR-17-5p, and down-regulated, such as miR-383 and miR-485-5p. [score:6]
Specific miRNAs were confirmed as over-expressed and down-regulated in ependymomas, such as miR-135a, miR-34a, miR-17-5p, miR-383 and miR-485-5p (Figure S1B). [score:6]
Individual assays were then performed to confirm the over -expression (e. g. miR-135a and miR-17-5p), and the down-regulation (e. g. miR-383 and miR-485-5p) of a few selected miRNAs (Figure S1B). [score:5]
Individual miRNA expression analysis for miR-135a, miR-17-5p, miR-485-5p, miR-383 and miR-34a were performed in triplicate in 96 well plates using the TaqMan® Individual miRNA assays (Applied Biosystems) according to the manufacture's instructions. [score:2]
We have verified that miR-34a and miR-135a are over-expressed in our samples when compared to normal controls. [score:2]
[1 to 20 of 6 sentences]
8
[+] score: 27
P-values for chosen candidates were as follows: miR-17(1.92E [−09]), miR-18a(2.62E [−09]), miR-29c(4.71E [−09]), miR-106a(1.84E [−08]), miR-135a(8.26E [−09]), miR-135b(1.99E [−08]), miR-221(9.19E [−05]), miR-222(2.04E [−05]) (see Supporting Table S2) Expression profiles of these candidates can be found in Figure 2. Three out of eight miRNAs exhibited decreasing expression during brain development (miR-17, miR-18a (belonging to the same cluster), miR-106a) [24]. [score:6]
Therefore, miRNAs up-regulated in F50 cerebellum (e. g. miR-135a, miR-135b and miR-7, see Figure 2) and F100 cerebellum (e. g. miR-216a and miR-216) make promising candidates for developmental switches in the cerebellum. [score:5]
Interestingly miR-135a and miR-135b have previously been described in prostate cancer [33], breast cancer [34], as well as involved in osteoblastic differentiation (by regulating expression of bone-related genes) [35]. [score:4]
The miR-135a/135b cluster was chosen because of its very interesting expression pattern in the brain and because it has not been previously described in the brain. [score:3]
Moreover, we have revealed an interesting and novel expression pattern of the miR-135a and miR-135b cluster in the brain. [score:3]
Numerous developmental stage or tissue-specific microRNAs including, miR-17, miR-18a, miR-29c, miR-106a, miR-135a and b, miR-221 and miR-222 were found by microarray analysis. [score:2]
The correlation coefficient values (R [2]) for particular miRNAs include: miR-17 (R [2] = 0.84), miR-18a (R [2] = 0.94), miR-29c (R [2] = 0.92), miR-106a (R [2] = 0.81) and miR-135a (R [2] = 0.89) miR-135b (R [2] = 0.95), miR-221 (R [2] = 0.91) and miR-222 (R [2] = 0.88). [score:1]
Additionally, we have identified the miR-135a -135b cluster in brain, which has not been previously described. [score:1]
A third group is represented by two miRNAs belonging to the same cluster, namely, miR-135a and miR-135b. [score:1]
Eight different candidate miRNAs: hsa-miR-17, hsa-miR-18a, hsa-miR-29c, hsa-miR-106a, hsa-miR-135a hsa-miR-135b, hsa-miR-221 hsa-miR-222 and two reference miRNAs: hsa-miR-103 and hsa-miR-191 were profiled by. [score:1]
[1 to 20 of 10 sentences]
9
[+] score: 23
Consistent with these studies, the overexpression of the other AR-responsive miRNAs, miR-135a and miR-9 increased the phosphorylation of AKT (Zheng et al., 2016) and suppressed PTEN expression in carcinoma cells (Lu et al., 2016). [score:7]
Further studies are required in order to identify the miRNAs, including miR-9, miR-17-5p, miR-135a, and miR-449a, that contribute to K [Ca]1.1 translational repression via mRNA degradation in AR -overexpressing breast cancer tissues. [score:5]
Androgen-regulated microRNA-135a decreases prostate cancer cell migration and invasion through downregulating ROCK1 and ROCK2. [score:5]
miRNA-135a promotes hepetocellular carcinoma cell migration and invasion by targeting forkhead box O1. [score:3]
We identified miR-9, miR-17-5p, miR-135a, and miR-449a as androgen-regulated, K [Ca]1.1-down -regulating miRNAs in prostate cancer. [score:3]
[1 to 20 of 5 sentences]
10
[+] score: 19
We found that the three ethanol-sensitive miRNAs with the highest average expression fold changes in the hippocampus, including the well-conserved miR-135a and miR-135b, were also significantly up-regulated in serum. [score:6]
Of the remaining validated ethanol-sensitive miRNAs, miR-135a and miR-135b are well-conserved and predicted to target Complexin 1 and Complexin 2 (TargetScan, Release 6.2), which are involved in modulating neurotransmitter release [40]. [score:5]
Four out of seven miRNAs, miR-135a, miR-135b, miR-467b-5p and miR-487b, were confirmed to be significantly up-regulated in ethanol-exposed mice (Fig.   4c). [score:4]
Three miRNAs, miR-135a, miR-135b and miR-467b-5p, were significantly up-regulated (≥twofold) in the ethanol-exposed group compared to controls (Fig.   5). [score:3]
Linear regression analysis showed significant linear relationships between the hippocampus and serum for miR-135a (R [2] = 0.84, P < 0.01), miR-135b (R [2] = 0.91, P < 0.001) and miR-467b-5p (R [2] = 0.60, P < 0.05) in ethanol-exposed mice only. [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 19
Finally, the differential expression of mir-373 was reported in several neoplastic diseases except in lymphomas [32]; on the contrary, both the mir-135a downregulation (able to target JAK2) and miR-135a overexpression were associated to relapse of Hodgkin's [33] and follicular and diffuse large B cell lymphomas [29, 31]. [score:12]
Conversely, 15 miRNAs resulted downregulated in activated B cells: mir-483, mir-95, mir-326, mir-135a, mir-184, mir-185, mir-516-3p, mir-30b, mir-203, mir-216, mir-150, mir-182*, mir-141 and mir-211 (Table 3). [score:4]
Our study identified 8 new differentially expressed miRNAs: mir-323, mir-138, mir-9*, mir-211, mir-149, mir-373, mir-135a and mir-184; that have not been reported in literature so far. [score:3]
[1 to 20 of 3 sentences]
12
[+] score: 18
For example, miR-135a/b miRNAs, which are overexpressed in CRC, are able to directly target APC, leading to the upregulation of Wnt signaling (Nagel et al., 2008). [score:9]
MiR-135a/b is also predicted to target and inhibit secreted frizzled-related protein 4 (SFRP4), which binds and represses extracellular Wnt proteins (Kawano and Kypta, 2003). [score:4]
SFRP4 and miR-135 expression is inversely correlated in multiple types of cancer (Jacobsen et al., 2013). [score:3]
Regulation of the adenomatous polyposis coli gene by the miR-135 family in colorectal cancer. [score:2]
[1 to 20 of 4 sentences]
13
[+] score: 14
As indicated, lncRNA linc- MD1 “sponges” miR-133 and miR-135, antagonizing the miRNA -mediated translation suppression Another example of involvement of lncRNA in AS is sno- lncRNA, a class of nuclear-enriched intron-derived lncRNAs transcribed from a critical region of chromosome 15 (15q11-q13). [score:5]
As indicated, lncRNA linc- MD1 “sponges” miR-133 and miR-135, antagonizing the miRNA -mediated translation suppression Another example of involvement of lncRNA in AS is sno- lncRNA, a class of nuclear-enriched intron-derived lncRNAs transcribed from a critical region of chromosome 15 (15q11-q13). [score:5]
Linc- MD1 “sponges” miR-133 and miR-135 to regulate the mRNA translation of mastermind-like-1 (MAML1) and myocyte-specific enhancer factor 2C (MEF2C), respectively (Fig.   2f). [score:4]
[1 to 20 of 3 sentences]
14
[+] score: 14
MiR-29 and miR-30e have been shown to influence Wnt signaling; miR-23b has been shown to inhibit FZD7 translation; miR93 has been shown to down-regulate expression of genes encoding β-catenin, Axin, Myc and Cyclin D; and miR-135a/5 have been shown to suppress APC expression [4]. [score:14]
[1 to 20 of 1 sentences]
15
[+] score: 14
Microarray data revealed that after TSA treatment, 19 miRNAs, including miR-4323 and miR-135a-3p, were upregulated 2-fold relative to the control group; 30 miRNAs, including miR-4261, miR374b-5p and miR-4306, were downregulated 2-fold (Figure 1B). [score:7]
Functional screening by in vitro transfection of miRNA mimics and inhibitorsMiRNA mimics for miR-1237, miR-365b-5p, miR-550a-5p and miR-135a-3p and miRNA inhibitors for miR-301b, miR-503, miR-542-5p and miR-210 were chosen for further functional investigation. [score:3]
We performed GO analysis and KEGG pathway analysis on the differentially expressed miRNAs, and the results are shown in Supplementary Figure 1. Ultimately, fifteen potential miRNAs associated with the proliferation of osteosarcoma were selected for microarray validation by quantitative real-time RT-PCR analysis, including miR-1237, miR-550a-5p, miR-365b-5p, miR-135a-3p, miR-933, miR-762, miR-629-3p, miR-542-5p, miR-503, miR-301b, miR-210, miR-374a-5p, miR-199a-5p, miR-199a-3p and miR-195-5p. [score:3]
MiRNA mimics for miR-1237, miR-365b-5p, miR-550a-5p and miR-135a-3p and miRNA inhibitors for miR-301b, miR-503, miR-542-5p and miR-210 were chosen for further functional investigation. [score:1]
[1 to 20 of 4 sentences]
16
[+] score: 13
The miR-135a targets HOXA10, which has been shown to induce p53 expression in breast cancer cells, and it is a metastasis suppressor in breast cancer [122]. [score:7]
The miR-135a suppresses the expression of HOXA10, which results in increased migration and invasion. [score:5]
Another potential oncogenic miRNA molecule is miR-135a, which has been implicated in several cancers, including breast cancer. [score:1]
[1 to 20 of 3 sentences]
17
[+] score: 12
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCC miRNAs regulate gene expression at the post-transcriptional level. [score:6]
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCCmiRNAs regulate gene expression at the post-transcriptional level. [score:6]
[1 to 20 of 2 sentences]
18
[+] score: 12
Taipaleenmäki H Browne G Akech J Zustin J van Wijnen AJ Stein JL Hesse E Stein GS Lian JB Targeting of Runx2 by miRNA-135 and miRNA-203 impairs progression of breast cancer and metastatic bone diseaseCancer Res. [score:5]
Recently, Taipaleenmäki et al. showed that malignant phenotypes of breast cancer cells are significantly suppressed by miR-135/miR-203-caused direct reduction of RUNX2. [score:4]
It has been shown that the additional miRNAs (miR-23a, miR-34c, miR-133a, miR-135a, miR-205 and miR-217) also attenuate osteogenesis by targeting RUNX2 [162, 163]. [score:3]
[1 to 20 of 3 sentences]
19
[+] score: 12
Yao et al. reported that KLF4 has an effect as a target of miR-135a-5p on the modulation of TGF-β1 to hepatocellular carcinoma metastasis by regulating the expression of KLF4 [10]. [score:6]
Differential expression of microRNAs in patients with hepatocellular carcinoma was reported in numerous studies, such as miR-135a, miR-33a, miR-320a, miR-122, and miR-31 [10– 14]. [score:3]
Various studies also reported the differential expression of miRNAs in patients with hepatocellular carcinoma, including miR-135a, miR-33a, miR-320a, miR-122, and miR-31 [10– 14]. [score:3]
[1 to 20 of 3 sentences]
20
[+] score: 12
This work is important to our study because miR-135a downregulates APC gene expression [43, 44] and thus may be responsible affecting chemotherapeutic resistance in our mo del systems. [score:6]
Another important factor is miR-135a, which binds to the APC gene [43, 44], and inhibits STAT3 -induced pro survival gene expression and induces apoptosis in gastric cancer and lymphoma [45]. [score:5]
Recently work has also shown that miR-135a contributes to paclitaxel resistance in vitro in cell culture mo dels for non-small cell lung cancer, breast cancer and ovarian cancer while in vivo work with a non-small cell lung cancer mo del demonstrated a similar response [44]. [score:1]
[1 to 20 of 3 sentences]
21
[+] score: 11
Five miRNAs predicted to target Smad3 (miR-135a, miR-140-5p, miR-582-3p, miR-582-5p, and miR-938) were overexpressed, of which miR-140-5p has already been validated to target Smad3 directly [58]. [score:8]
Thereby, the miRNAs targeting TGF- β signaling (miR-135a, miR-140-5p, miR-582-3p, miR-582-5p, and miR-938) may have effects in apoptosis [22]. [score:3]
[1 to 20 of 2 sentences]
22
[+] score: 11
MiR-135 has shown high P [CT] value against GATA3 gene and has the potential to inhibit the expression of this gene and Th2 immune cell conversion. [score:4]
We also identified that miR-135 have the great potential to down regulate the expression of the STAT6 transcription factor at the post-transcriptional level in CD4 [+] T cells. [score:4]
GATA3 protein has multiple transcripts but for NM_001002295 transcript, by using all three web servers we found that miR-135 has the binding site at the 3′-UTR of GATA3 gene (position 207–213). [score:1]
MiR-135 has a putative binding site to regulate GATA3 transcription factor which control the Th2 immune cell differentiation from CD4 [+] T cells. [score:1]
STAT6 gene with 3′-UTR length of 1168 nucleotides were found to show miR-135 binding at position 1100–1107. [score:1]
[1 to 20 of 5 sentences]
23
[+] score: 11
Another research showed that miR-135a, transcribed by FOXM1, contributes to the development of portal vein tumor thrombus by promoting metastasis in HCC by targeting metastasis suppressor 1 [63]. [score:6]
For example, miR-135a is a FOXM1 -induced miRNA which acts as an oncogenic miRNA in portal vein tumor thrombosis by repressing the expression of metastasis suppressor 1 [63, 64]. [score:5]
[1 to 20 of 2 sentences]
24
[+] score: 11
Next, we examined the effect of individual ovarian steroids on the regulation of miR-95, this being the most up-regulated miRNA in our in vitro decidualization assay, as well as miR-135 b and miR-96. [score:4]
miRNA Mimic Transfection and in vitro Decidualization To overexpress miR-96 and miR-135 b we used the corresponding miRNA mimics and control sequences from SABiosciences. [score:3]
To overexpress miR-96 and miR-135 b we used the corresponding miRNA mimics and control sequences from SABiosciences. [score:3]
The efficiency of miRNA overexpression (more than 100 fold change compared to control, data not shown) was confirmed by RT-qPCR using specific miR-96 and miR-135 b primers from SABiosciences. [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 10
Other miRNAs from this paper: hsa-mir-135a-2, hsa-mir-372, hsa-mir-216b
Zhou H. Guo W. Zhao Y. Wang Y. Zha R. Ding J. Liang L. Yang G. Chen Z. Ma B. Yin B. MicroRNA-135a acts as a putative tumor suppressor by directly targeting very low density lipoprotein receptor in human gallbladder cancer Cancer Sci. [score:5]
Three biological mechanisms may be involved in its deregulation: as a direct target of miR-135a-5p [42]; hypermethylation of the gene (9p24.2) promoter [43] and homozygous loss of the gene observed in genome-wide screening for copy-number alterations in cancer cell lines, albeit infrequently [43]. [score:5]
[1 to 20 of 2 sentences]
26
[+] score: 10
Evidence of the concerted interplay of miRNAs regulated by CpG-ODN and their potential target mRNAs was observed (Fig. 4) for 2 miRNAs upregulated (hsa-miR-302b and hsa-miR-374b) and for 13 miRNAs downregulated in CpG-ODN -treated mice (hsa-miR-135a, hsa-miR-136, hsa-miR-340, hsa-miR-445-5p, hsa-miR-424, hsa-miR-96, hsa-miR-142-3p, hsa-miR-140-5p, hsa-miR-542-3p, hsa-miR-18a, hsa-miR-18b, hsa-miR-101, and hsa-miR-99a). [score:10]
[1 to 20 of 1 sentences]
27
[+] score: 10
Other miRNAs from this paper: hsa-mir-21, hsa-mir-135a-2, hsa-mir-155
While no polymorphisms have been identified yet, miRNA have been associated with the IL-12 signaling network including miR-21 that regulates mIL-12p35 expression [80], miR-135a that regulates JAK2 expression [81], and miR-155 that regulates SOCS1 expression [82]. [score:10]
[1 to 20 of 1 sentences]
28
[+] score: 10
The target genes of miRNA-32, miRNA-34c, miRNA-135a, miRNA-18b, and miRNA-9, which were up-regulated in the follicular fluid of women with PCOS, were involved in insulin regulation and inflammation [28]. [score:7]
The expression of miRNA-32, miRNA-34c, miRNA-135a, miRNA-18b, and miRNA-9 was significantly increased in the follicular fluid of women with PCOS [28]. [score:3]
[1 to 20 of 2 sentences]
29
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Analyses of 238 intermediate-risk cytogenetic AML patients showed that reduced expression of miR-135a and miR-409-3p is associated with a higher risk of relapse [106], while higher miR-142 expression was associated with a better overall survival in these same patients [111]. [score:5]
High miR-3151 expression was associated with high miR-501-5p and low miR-590, miR-135a, miR-100*, miR-186* and let-7a* expression, however the significance of this association is unknown [129]. [score:5]
[1 to 20 of 2 sentences]
30
[+] score: 10
BMP2 treatment downregulated the expression of miR-133 and miR-135 that inhibit osteogenic differentiation by targeting Runx2 and Smad5 [18]. [score:10]
[1 to 20 of 1 sentences]
31
[+] score: 10
Based on the collected miRNA-circRNA interactions and the deregulated RNA molecules, we collected several abnormally expressed miRNAs, including 11 downregulated miRNAs (miR-124-3p, miR-129-5p, miR-135a-5p, miR-153-3p, miR-204-5p, miR-208a-3p, miR-211-5p, miR-218-5p, miR-488-3p, miR-490-3p, and miR-504-5p) and 1 upregulated miRNA (miR-373-3p). [score:10]
[1 to 20 of 1 sentences]
32
[+] score: 9
miR-135 has recently been shown to inhibit expression of the tumor suppressor gene Adenomatous Polyposis Coli (APC) in colorectal cancer [60]. [score:7]
We also observed a significant increase in miR-135 expression in SCLC cells compared to NSCLC cells. [score:2]
[1 to 20 of 2 sentences]
33
[+] score: 9
With the exception of miR-135a, which increased throughout the RA time-course, these miRNAs showed a similar pattern of expression, i. e., in addition to being clearly up-regulated during early stages of neural differentiation, their expression peaked between day 6 and day 14 of RA (Fig. 5 and Fig. S1B). [score:8]
We identified MREs for two miRNAs conserved in human and dog (miR-135a and miR-371-5p), one conserved in human and mouse (miR-494) and four conserved in human, mouse and dog (miR-92a, miR-219-5p, pred-MIR145 and pred-MIR207; Fig. 5). [score:1]
[1 to 20 of 2 sentences]
34
[+] score: 9
Both oncogenic miRNAs and tumor suppressive miRNAs have been demonstrated and described in colon carcinogenesis and progression, such as upregulated miR-135, miR-21, miR-17-92, and miR-196a, and downregulated miR-34, miR-195, and miR-365 [9]– [13]. [score:9]
[1 to 20 of 1 sentences]
35
[+] score: 9
REST directly down-regulates a large number of genes at the transcriptional level, but also probably indirectly activates the expression of other genes at the post-transcriptional level via the repression of many noncoding targets (Conaco et al., 2006; Mortazavi et al., 2006; Wu and Xie, 2006; Visvanathan et al., 2007; Singh et al., 2008; Johnson et al., 2009), including several micro RNAs (miRNAs) considered to be brain-specific (such as miR9, miR124, miR132, miR135, miR139, and miR153; Figure 1). [score:9]
[1 to 20 of 1 sentences]
36
[+] score: 9
Interestingly, Chinese mistletoe lectin-I (CMI) has been firstly reported to induce apoptotic cell death in colorectal cancer cells, by down -regulating miR-135a and miR-135b expression and up -regulating expression of their target gene adenomatous polyposis coli (APC), thereby, reducing activity of its downstream Wnt signaling [10]. [score:9]
[1 to 20 of 1 sentences]
37
[+] score: 9
LncRNAs functioning as ceRNAs can be also observed in: mouse and human myoblasts, where the large intergenic non-coding RNA (lincRNA) called linc-MD1 controls muscle differentiation by targeting miR-133 and miR-135 to regulate the expression of MAML1 and MEF2C [74]; human embryonic stem cells, where linc-RoR competes with the transcription factors NANOG, OCT4, SOX2 for binding to miR-145 regulating cell pluripotency and self-renewing [75]; human thyroid cancer, where the thyroid-specific lncRNA PTCSC3 targets miR-574-5p [76]; human embryonic kidney 293 (HEK293) cells, where the lncRNA H19 modulates the let-7 miRNAs family availability causing precocious muscle differentiation [77]. [score:9]
[1 to 20 of 1 sentences]
38
[+] score: 8
Of note, miR-135a and miR-135b were also found to be upregulated in vivo in colorectal adenomas and carcinomas and correlated with low APC levels [13]. [score:4]
miR-135a and miR-135b decrease translation of the APC transcript in vitro. [score:3]
These observations suggest that alteration in the mir-135 family can be one of the early events in CRC's molecular pathogenesis. [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 8
Of note, miR-135a and miR-135b were also found to be upregulated in vivo in colorectal adenomas and carcinomas and correlated with low APC levels [22]. [score:4]
miR-135a and miR-135b decrease translation of the APC transcript in vitro. [score:3]
These observations indicate that alteration in the mir-135 family can be one of the early events in CRC’s molecular pathogenesis. [score:1]
[1 to 20 of 3 sentences]
40
[+] score: 8
Furthermore, miR-135a-5p is a negative regulator of STAT3 phosphatase PTPRD and is up-regulated in HCV-infected hepatocytes, leading to an enhanced STAT3 transcriptional activity [27]. [score:5]
Similarly, miR-135a-5p and miR-19a enhance pY705 phosphorylation by respectively targeting the mRNA of PTPRD and SOCS3 [27, 28]. [score:3]
[1 to 20 of 2 sentences]
41
[+] score: 8
[14, 15] MiR-135a*, miR-188-5p, miR-663 and miR-483-5p were downregulated in plasma cell leukemia. [score:4]
Moreover, we report tumor suppressor functions of miR-198, miR-135a*, miR-200c, miR-663 and miR-483-5p in myeloma, that they reduced cell viability, migration and colony formation. [score:3]
At the same time, many other miRNAs were unmasked, including miR-125a-3p, miR-155, miR-135a*, miR-198, miR-200c, miR-188-5p, miR-630, miR-663 and miR-483-5p. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 8
PSD95 is a high-ranking target of miR-125, miR-135, miR-320, and miR-327, all of which are either exclusively expressed in brain or enriched in brain tissue (Lagos-Quintana et al. 2002; Krichevsky et al. 2003; Sempere et al. 2004). [score:5]
” Neuronal differentiation of embryonic carcinoma cells by retinoic acid in both mice and humans is coupled to induction of let-7b, miR-30, miR-98, miR-103, and miR-135 (Sempere et al. 2004), and their targets are enriched in “neurogenesis” (3.5-fold). [score:3]
[1 to 20 of 2 sentences]
43
[+] score: 8
For instance, miR-135a/b are downregulated in cisplatin resistance (A549/DDP) cells, and the overexpression of miR-135a/b sensitizes A549/DDP cells to cisplatin by targeting MCL1 (myeloid cell leukemia 1) [15]. [score:8]
[1 to 20 of 1 sentences]
44
[+] score: 8
Recently, miR-135a is shown to inhibit specifically cancer stem cell driven MB by targeting Arhgef6 (rho guanine nucleotide exchange factor 6), a gene frequently upregulated in MB [121]. [score:8]
[1 to 20 of 1 sentences]
45
[+] score: 8
Several miRNAs modulate osteogenic differentiation: miR-125b negatively regulates osteoblastic differentiation through targeting VDR, ErbB2, and Osterix [28, 29]; miR-133 (targeting RUNX2) and miR-135 (recognizing SMAD5) inhibit differentiation of mouse osteoprogenitors [30]; miR-26a and miR-29b facilitate osteogenic differentiation of human adipose tissue-derived stem cells (hADSCs), and positively modulate mouse osteoblast differentiation [31, 32]. [score:8]
[1 to 20 of 1 sentences]
46
[+] score: 8
MiR-135-5p, one of the miRNAs found to be upregulated in cells treated with serum from HNSCC patients, targets the tumor suppressor APC and promotes cell growth in colorectal cancer (59). [score:8]
[1 to 20 of 1 sentences]
47
[+] score: 7
miR-135a could not be amplified from most monocyte and neutrophil samples; the results have therefore been shown here as expression relative to RNU24 only. [score:3]
miR-223, miR-125b, miR-10a, miR-196b and miR-135a showed similar patterns of expression to that observed in the TLDA data. [score:3]
miR-135a could be detected in all the progenitor samples, though the levels of miRNA were quite low. [score:1]
[1 to 20 of 3 sentences]
48
[+] score: 7
MiR-143 and miR-135 inhibitors treatment induces skeletal myogenic differentiation of human adult dental pulp stem cells. [score:3]
Cell type microRNA mRNA target Differentiation DPSCs miR-135 Nd MyogenicLi et al., 2015 miR-143 DPSCs miR-720 DNMT3a, NANOG OsteogenicHara et al., 2013 PDLSCs miR-21 PLAP-1 OsteogenicLi et al., 2012 miR-101 DPCs miR-424 VEGF, KDR Angiogenic (endothelial cells)Liu et al., 2014 DPSCs miR-196 HOX C8 OsteogenicGardin et al., 2016 DPSCs miR-218 RUNX2 OsteogenicGay et al., 2014 GMSCs PDLSCs DPSCs miR-816-3a WNT5A, EGRF Control of cell fateVasanthan et al., 2015 miR-7-5p DPSCs miR-32 DSPP OdontoblasticWang et al., 2011 miR-586 miR-885-5 WNT5A, WNT FAMILY MEMBER 5A; EGRF, EPIDERMAL GROWTH FACTOR RECEPTOR; DSPP, DENTIN-SIALOPHOSPHOPROTEIN; DNMT3A, DNA METHYLTRANSFERASE 3A; NANOG, NANOG HOMEOBOX; PLAP-1, PERIODONTAL LIGAMENT-ASSOCIATED PROTEIN 1; VEGF, VASCULAR ENDOTHELIAL GROWTH FACTOR; KDR, VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR-2/KINASE INSERT DOMAIN RECEPTOR; and RUNX2, RUNT-RELATED TRANSCRIPTION FACTOR2. [score:3]
It was found that the application of 5-aza-dC impaired the function of both miR-135 and miR-143 and arrested cell proliferation to sustain myogenic differentiation, indicating that miRNAs could perform a decisive function in DPSC fate. [score:1]
[1 to 20 of 3 sentences]
49
[+] score: 7
Moreover, some differentially up-regulated microRNAs (such as miR-466h-5p, miR-135a-1*, miR-2137, miR-223, miR-139-5p, miR-29b-1*, and miR-7a) displayed earlier in PR8 infected lungs than in BJ501 infected lungs. [score:4]
There was no target for mmu-miR-1, mmu-miR-135a-1, mmu-miR-2145, mmu-miR-24-2 or mmu-miR-29b-1 in the database. [score:3]
[1 to 20 of 2 sentences]
50
[+] score: 7
This may be due to a reduction in miR-135a, which binds to ROCK-1 and inhibits entry into senescence in young tendon. [score:3]
A recent study in rat tendon-derived stem cells from older donors demonstrated earlier entry into senescence which was postulated to be due to a reduction in the levels of miRNA-135a, a ROCK-1 targeting microRNA (miR) that blocks entry into senescence pathways. [score:3]
Thus a decrease in miR-135a in older tendon may be the cause of reduced stem cell proliferation, self-renewal and tenogenic differentiation [18]. [score:1]
[1 to 20 of 3 sentences]
51
[+] score: 7
Deletion of the miR-221/222 binding site in the Angptl2-3′UTR reporter (Fluc-Angptl2-3'UTR-Δ 221/222) was performed using a PrimeSTAR mutagenesis basal kit (Takara Bio) according to the manufacturer's instructions miR-221, miR-222, miR-211, miR-204 or miR-135a overexpression vectors were constructed by inserting sequences including the full-length mature microRNA sequences into pBApo-CMV (Takara Bio). [score:3]
Relative luciferase activity in NRCMs harbouring the reporter and transfected with control pcDNA3.1 vector or miR-221, miR-222, miR-211, miR-204 or miR-135a expression vectors. [score:3]
org database identified five candidates, including miR-135a, miR-204, miR-211, miR-221 and miR-222, predicted to bind to the Angptl2 mRNA 3′UTR. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 7
There have been no indications so far for involvement in neurodegenerative processes of miR-135a, known to target genes involved in blood pressure regulation [94]. [score:4]
The next top five microRNAs found in the regulatory network were miR-124, miR-135a, miR-141, miR-182 and miR-19a. [score:2]
We suggest that the following nine microRNAs namely, miR-135 A1, miR-141, miR-153-1, miR-15 A, miR-16-1, miR-182, miR-19 A, miR-27 A and miR-96 could be of potential interest in HD. [score:1]
[1 to 20 of 3 sentences]
53
[+] score: 7
[82] Intriguingly, miR-135a levels are upregulated after the administration of antidepressants. [score:4]
[81] A strong miRNA-target interaction between miR-135 and the sodium -dependent serotonin (5-hydroxytryptamine; 5-HT) transporter and 5-HT receptor-1A transcripts has also been reported. [score:3]
[1 to 20 of 2 sentences]
54
[+] score: 7
Previous studies have identified Wnt/β-catenin signaling as a direct and functional target of several miRNAs, such as miR-200a, miR-135a, miR-30–5p and miR-612 [16, 17, 20, 21]. [score:4]
As a result, transfection of miR-200a and miR-135a mimics could inhibit the reporter activity (Data not shown), which is consistent with previous reports [16, 17]. [score:3]
[1 to 20 of 2 sentences]
55
[+] score: 7
It has recently been shown that increased levels of miR-135a/b lead directly to decreased protein expression of the CC tumor suppressor APC via a direct binding interaction between miR-135b and APC mRNA 3' UTR [40]. [score:7]
[1 to 20 of 1 sentences]
56
[+] score: 7
Other miRNAs from this paper: hsa-mir-135a-2, hsa-mir-135b
It has been shown experimentally that in in vitro miRNA system – miR135a and miR135b interact with 3’UTR transcript of the APC gene and affect the level of mRNA and, in this way, regulate APC expression and consequently the Wnt proliferation control pathway. [score:4]
Furthermore, it was observed that increased quantities of miR-135a and miR-135b lead to the reduction in the amount of mRNA of the APC gene in neoplastic tumours of the intestine [63]. [score:1]
The gene coding miR-135a-1 is located in the first intron of the stabilin 1 gene STAB1 (3q21), whereas the gene coding miR-135a-2 is found in intron 5 of the RMST gene coding the transcript associated with rabdomyosarcoma (12q23) [62]. [score:1]
miRNA precursors are made up of 93, 102 and 99 nucleotide sequences and can be found on chromosome 3 - miR135a-1, on chromosome 12 miR-135a-2 and chromosome 1 miR-135b, respectively. [score:1]
[1 to 20 of 4 sentences]
57
[+] score: 7
Tumor-suppressive microRNA-135a inhibits cancer cell proliferation by targeting the c-MYC oncogene in renal cell carcinoma. [score:7]
[1 to 20 of 1 sentences]
58
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-18a, hsa-mir-21, hsa-mir-27a, hsa-mir-96, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30b, mmu-mir-99a, mmu-mir-124-3, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-21a, mmu-mir-27a, mmu-mir-96, mmu-mir-135b, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-200a, hsa-mir-135b, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-15a-1, dre-mir-15a-2, dre-mir-18a, dre-mir-21-1, dre-mir-21-2, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30b, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-135c-1, dre-mir-135c-2, dre-mir-200a, dre-mir-200b, dre-let-7j, dre-mir-135b, dre-mir-181a-2, dre-mir-135a, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
An example of such a miR-target pair is miR-135 and Psip, PC4- and SF-2 interacting protein/Ledgf (Elkan-Miller et al, 2011), which has been implicated in transcriptional regulation of stress-related genes, having an anti-apoptotic effect, involved in mRNA splicing, cell survival and is part of a fusion gene in leukaemia. [score:4]
miR-135 is reduced in the cochlear hair cells, while its expression is high in vestibular hair cells. [score:3]
[1 to 20 of 2 sentences]
59
[+] score: 7
In skeletal muscle C2C12 cells, miR-135a targets Irs-2 by binding to its 3′-UTR, and this interaction negatively regulates insulin signaling [46]. [score:4]
Agarwal P. Srivastava R. Srivastava A. K. Ali S. Datta M. MiR-135a targets IRS2 and regulates insulin signaling and glucose uptake in the diabetic gastrocnemius skeletal muscle Biochim. [score:3]
[1 to 20 of 2 sentences]
60
[+] score: 7
miR-135a targets IRS2 and regulates insulin signaling and glucose uptake in the diabetic gastrocnemius skeletal muscle. [score:4]
For example, miRNA-135a was elevated in skeletal muscle tissue of hyperglycemic db/db mice whereas in vivo silencing of miRNA-135a reduced hyperglycemia and improved glucose tolerance in db/db mice, probably via inhibitory effects on IRS2 (Agarwal et al., 2013). [score:3]
[1 to 20 of 2 sentences]
61
[+] score: 7
In this sense, for example, it has been shown that hsa-miR-135a promotes metastasis in breast cancer cell lines by direct interaction with HOXA10 gene, which acts as a metastasis suppressor in this cancer mo del (Chu et al., 2004; Chen et al., 2012). [score:4]
miRNA-135a promotes breast cancer cell migration and invasion by targeting HOXA10. [score:3]
[1 to 20 of 2 sentences]
62
[+] score: 7
In addition, ectopic expressions of miR-138 and miR-135 targeting the FAK 3′UTR reportedly suppress FAK -mediated tumor growth and invasion as well as drug sensitivity [150]. [score:7]
[1 to 20 of 1 sentences]
63
[+] score: 7
They found that miR-199b-5p and miR-100-3p were downregulated and miR-155-5p, miR-135-5p, and miR-146-5p upregulated in more aggressive osteosarcoma cell lines. [score:7]
[1 to 20 of 1 sentences]
64
[+] score: 7
Regeneration-miRNAs were up-regulated (miR-31, miR-34c, miR-206, miR-335, miR-449, and miR-494), while degenerative-miRNAs (miR-1, miR-29c, and miR-135a) were down-regulated in mdx mice and in DMD patients’ muscles. [score:7]
[1 to 20 of 1 sentences]
65
[+] score: 6
These results strongly demonstrated the specificity of miR-135 targeting GSK3β. [score:3]
Figure S1 qRT-PCR measured the miR-135 expression levels in U87 cells transfected with miR-135b mimics as well as U87R cells transfected with miR-26a inhibitors. [score:3]
[1 to 20 of 2 sentences]
66
[+] score: 6
The most up-regulated miRNAs are: miR-21, miR 17-92 cluster, miR-135a/b, miR-471 and miR-675, whereas miR-143, miR-14, let-7 and miR-101 showed a decreased expression in CRC. [score:6]
[1 to 20 of 1 sentences]
67
[+] score: 6
Notably, linc-MD1 detaches miR-135 away from MEF2C mRNA, and thus, depresses the expression of MEF2C in skeletal muscle development and disease [86]. [score:6]
[1 to 20 of 1 sentences]
68
[+] score: 6
MicroRNA-135a and -200b, potential Biomarkers for Alzheimers disease, regulate β secretase and amyloid precursor protein. [score:3]
Beta-secretase 1 (BACE-1) and APP, which play important roles in AD, were identified as the targets of miR-135a and miR-200b, respectively (Liu et al., 2014). [score:3]
[1 to 20 of 2 sentences]
69
[+] score: 6
Expression of mastermind-like-1 (MAML1) is controlled by miR-133, and myocyte-specific enhancer factor 2C (MEF2C) is the target of miR-135 [64]. [score:5]
linc-MD1 acts as a natural decoy for two muscle-specific miRNAs, miR-133 and miR-135 (Figure1 C) [64]. [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 6
For example, miRNA-135a has been reported to suppress cell proliferation, apoptosis, and adhesion by targeting HOXA10 in ovarian cancer [31]. [score:5]
The cells were transfected with 50 nM miR-135-5p mimics by using Lipofectamine [®] 2000 reagent (Thermo Fisher Scientific), following the manufacturer’s protocol. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
In a review, Gramantieri et al. (2008) show miRNAs aberrantly expressed in HCC compared to non-tumorous liver tissue (up -expression of miR-33, miR-130, miR-135a, miR-210, miR-213, miR-222, miR-331, miR-373, miR-376a, and down -expression of miR-130a, miR-132, miR-136, miR-139, miR-143, miR-145, miR-150, miR-200a, miR-200b, miR-214). [score:6]
[1 to 20 of 1 sentences]
72
[+] score: 6
The dysregulation of miRNAs in CRC has been reported using miRNA expression profiling studies with different miRNAs identified either as enhancers (miR-21, miR-31, miR-103, miR-107) or suppressors (miR-135, miR-145, miR-200c) in the initiation and evolution of tumor metastasis [8- 13]. [score:6]
[1 to 20 of 1 sentences]
73
[+] score: 5
Several genes including oncogene MYC, tumor suppressor gene APC and negative regulator of WNT pathway AXIN2 were regulated by miR-34a, miR-135a and miR-135b. [score:5]
[1 to 20 of 1 sentences]
74
[+] score: 5
MiR-133 and miR-135 also negatively regulate the osteogenic differentiation of hBMSCs induced by BMP2 by directly targeting RUNX2 and Smad5, respectively 24. [score:5]
[1 to 20 of 1 sentences]
75
[+] score: 5
Interestingly, 14 of these miRNAs (miR-596, miR-630, miR-422a, miR-490-5p, miR-375, miR-708, miR-345, miR-125b-2, miR-516a-3p, miR-135a, miR-1228, miR-1915, miR-134, and miR-663) have established roles in tumor suppression and drug resistance, while 5 miRNAs (miR-630, miR-375, miR-345, miR-1228, and miR-134) are known to inhibit epithelial–mesenchymal transition and invasion in cancer cells. [score:5]
[1 to 20 of 1 sentences]
76
[+] score: 5
Targeting of Runx2 by miR-135 and miR-203 impairs progression of breast cancer and metastatic bone disease. [score:5]
[1 to 20 of 1 sentences]
77
[+] score: 5
HCV infection regulates expression of several miRs, including miR-146a-5p [119], miR-196a [120] and miR-135a-5p [27], that regulate metabolic pathways and hepatocarcinogenesis. [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-98, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-141, mmu-mir-194-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-203a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-200b, mmu-mir-300, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-2, hsa-mir-141, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-343, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-135a-2, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-326, hsa-mir-135b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-21, rno-mir-26b, rno-mir-27b, rno-mir-27a, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-33, rno-mir-98, rno-mir-126a, rno-mir-133a, rno-mir-135a, rno-mir-141, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-203a, rno-mir-211, rno-mir-218a-2, rno-mir-218a-1, rno-mir-300, hsa-mir-429, mmu-mir-429, rno-mir-429, hsa-mir-485, hsa-mir-511, hsa-mir-532, mmu-mir-532, rno-mir-133b, mmu-mir-485, rno-mir-485, hsa-mir-33b, mmu-mir-702, mmu-mir-343, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, hsa-mir-300, mmu-mir-511, rno-mir-466b-1, rno-mir-466b-2, rno-mir-532, rno-mir-511, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466b-8, hsa-mir-3120, rno-mir-203b, rno-mir-3557, rno-mir-218b, rno-mir-3569, rno-mir-133c, rno-mir-702, rno-mir-3120, hsa-mir-203b, mmu-mir-344i, rno-mir-344i, rno-mir-6316, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-3569, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, rno-mir-466b-3, rno-mir-466b-4, mmu-mir-203b
Cesana et al. showed that a long-intergenic ncRNA (lincRNA), linc-MD1, regulates muscle differentiation by interacting with two miRNAs, miR-135 and miR-133, which can bind to MAML1 and MEF2C to regulate their expression levels. [score:5]
[1 to 20 of 1 sentences]
79
[+] score: 5
Moreover, osteogenic differentiation of MSC can be inhibited by miR-125b, miR-133, miR-135 and miR-206 which attenuate the expression of ERBB2 as one of the epidermal growth factor receptors, RUNX2 (Runt-related transcription factor 2) essential for osteoblast differentiation and skeletal morphogenesis, Smad5 as a signaling modulator of bone morphogenic proteins, and connexin-43 as a transmembrane protein and part of gap junctions, respectively. [score:5]
[1 to 20 of 1 sentences]
80
[+] score: 5
Its lower expression is instead significantly correlated with larger tumor size and poor prognosis in colorectal cancer patients (74) Linc-MD1 MusclesGoverns the timing of muscle differentiation by acting as a competing endogenous RNA (ceRNA) with respect to miR-133 and miR-135 in mouse and human myoblasts (75) Xist Somatic cellsExpressed by the future inactive X chromosome, triggers gene silencing in cis by coating the chromosome. [score:5]
[1 to 20 of 1 sentences]
81
[+] score: 5
For instance, linc-MD1 is a muscle-specific intergenic lncRNA that acts as a sponge for miR-133 and miR-135, preventing their suppression of MAML1 and MEF2C and activating muscle-specific gene expression [6]. [score:5]
[1 to 20 of 1 sentences]
82
[+] score: 5
For example, miRNAs, such as miR-135, miR-27, mir-155, miR-129, miR-106b, let-7, miR-125, miR-663, and miR-142, target APC and activate canonical Wnt signaling [100, 138, 139, 140, 141, 142, 143, 144, 145, 146]. [score:3]
Nagel R. le Sage C. Diosdado B. van der Waal M. Oude Vrielink J. A. Bolijn A. Meijer G. A. Agami R. Regulation of the adenomatous polyposis coli gene by the miR-135 family in colorectal cancer Cancer Res. [score:2]
[1 to 20 of 2 sentences]
83
[+] score: 5
Similar to linc-RoR, but with a pro-differentiation role, linc-MD1 functions as a ceRNA by binding miR-133 and miR-135, which target and inhibit the factors involved in myoblast differentiation [25]. [score:5]
[1 to 20 of 1 sentences]
84
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-100, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-139, hsa-mir-10b, hsa-mir-34a, hsa-mir-182, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-221, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-135a-2, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-134, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-154, hsa-mir-320a, hsa-mir-155, hsa-mir-128-2, hsa-mir-200a, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-302c, hsa-mir-367, hsa-mir-370, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-379, hsa-mir-328, hsa-mir-151a, hsa-mir-135b, hsa-mir-335, hsa-mir-133b, hsa-mir-449a, hsa-mir-451a, hsa-mir-410, hsa-mir-486-1, hsa-mir-146b, hsa-mir-520f, hsa-mir-518d, hsa-mir-517c, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-584, hsa-mir-602, hsa-mir-629, hsa-mir-638, hsa-mir-449b, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-298, hsa-mir-1246, hsa-mir-1908, hsa-mir-718, hsa-mir-2861, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-4728, hsa-mir-4734, hsa-mir-378j, hsa-mir-6165, hsa-mir-486-2
Qu et al. (2016a) MiR-34a, MiR-141, MiR-134, MiR-135a, MiR-135b, and MiR-370The adenocarcinomic human alveolar basal epithelial cell line A549 cells The collection of non-small cell lung cancer (NSCLC) patient tissue samples qRT-PCR analysis, Electron microscopy assay, and Western blotting YKT6 downregulation is associated with a remarkable reduction in exosome release in an NSCLC cell line and that low YKT6 expression is associated with better clinical outcome in NSCLC patients. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 4
Our results reported 42 differentially expressed miRNAs in PBLs cultured for 24 h in MMG with respect to 1 g, of which 14 (miR-34a-5p, miR-34b-5p, miR-663a, miR-135a-3p, miR-1225-5p, miR-940, miR-221-5p, miR-29b-1-5p, miR-10a-5p, let-7i-3p, miR-200a-3p, miR-7-5p, miR-7-1-3p, and miR-505-5p) were found altered also by γ-irradiation, as assessed in our previous study [47]. [score:3]
As shown in Figure 4, most transcripts are associated with more than one miRNA, as in the case of TLR4 transcript, correlated with eight different miRNAs (miR-10a-5p, miR-7-5p, miR-135a-3p, miR-103a-3p, miR-7-1-3p, miR-107, miR-629-5p, and miR-362-5p). [score:1]
[1 to 20 of 2 sentences]
86
[+] score: 4
Other miRNAs from this paper: hsa-mir-135a-2
Tanshinone I enhanced tumor necrosis factor- (TNF-) related apoptosis inducing ligand (TRAIL) via increasing cleaved poly-ADP ribose polymerase (PARP), arresting cells in the subG1 phase, activating caspase-8 and caspase-9, and upregulating miR-135a -mediated death receptor 5 [17]. [score:4]
[1 to 20 of 1 sentences]
87
[+] score: 4
JAK2 30, target of hsa-miR-135a, is a key player in JAK-STAT signaling pathway 21. [score:3]
Hsa-miR-135a and hsa-miR-135b play crucial roles in distinguishing breast tumors by ER status, which has been extensively discussed in ref. [score:1]
[1 to 20 of 2 sentences]
88
[+] score: 4
A muscle-specific lncRNA, linc-MD1, displays decoy activity for two specific miRNAs (miR-133 and miR-135) and regulates the expression of MAML1 and MEF2C in a molecular circuitry affecting the differentiation program [28]. [score:4]
[1 to 20 of 1 sentences]
89
[+] score: 4
However, this validation was performed using PCR, and like miR-9 in the present study, the expression of miR-135 and miR-200 may be undetectable by hybridization. [score:3]
MiR-135 and miR-200, although validated, were not found in any of the hybridization data sets. [score:1]
[1 to 20 of 2 sentences]
90
[+] score: 4
Other studies show that hsa-miR-135a* is expressed in peripheral blood lymphocytes and seems to be involved in immune/inflammatory response [23]. [score:3]
An additional miRNA that seems to be affected by anticoagulant EDTA was hsa-miR-135a*. [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 4
Mmu-miR-135a ectopically overexpressed with a lentivirus in tooth germ during the cap stage, revealed that Bmp signaling, specifically Bmpr-Ia and Bmpr-Ib, regulates tooth formation in conjunction with this miRNA [25]. [score:4]
[1 to 20 of 1 sentences]
92
[+] score: 4
For example, in C2C12 cells under osteogenic differentiation, multiple miRNAs such as miR-133 and miR-135 that attenuate Runx2 or Smad signalling are downregulated by BMP2 [18]. [score:4]
[1 to 20 of 1 sentences]
93
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The prospect that a similar function may extend to other miRNAs is suggested by the conservation of several miRNAs (e. g. miR-25, miR-34a/b/c, miR-135a/b, miR-194, and miR-200a) that are capable of directly targeting the Wnt/β-catenin, a signaling pathway that has been wi dely implicated in the control of oncogenic hallmarks such as cell proliferation, metastasis, angiogenesis, telomerase activity, and apoptosis (reviewed by [49]). [score:4]
[1 to 20 of 1 sentences]
94
[+] score: 4
We also identified EB upregulated miRNAs that have not been previously reported such as miR-130a, miR-301a, and miR-135, miR-190, miR-30c, and miR-30e. [score:4]
[1 to 20 of 1 sentences]
95
[+] score: 4
The following factors were confirmed to modulate vimentin expression: (1) non-coding RNA in the regulation of transcription, such as miR-135a, miR-137, miR-200c, miR-141, miR-122 and long non-coding RNA [5– 11]; (2) protein modification, such as phosphorylation and acetylation [12– 15]. [score:4]
[1 to 20 of 1 sentences]
96
[+] score: 4
Van Renne N, Roca Suarez AA, Duong FH, Gondeau C, Calabrese D, Fontaine N, Ababsa A, Bandiera S, Croonenborghs T, Pochet N, De Blasi V, Pessaux P, Piardi T, Sommacale D, Ono A, Chayama K, Fujita M, Nakagawa H, Hoshida Y, Zeisel MB, Heim MH, Baumert TF, Lupberger J 2017 miR-135a-5p -mediated downregulation of protein tyrosine phosphatase receptor delta is a candidate driver of HCV -associated hepatocarcinogenesis. [score:4]
[1 to 20 of 1 sentences]
97
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-197, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-328, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-486-1, hsa-mir-146b, hsa-mir-494, hsa-mir-503, hsa-mir-574, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
MiR-135a/b overexpression was found to reduce MCL1 protein levels and sensitize A549 cells to cispatin -induced apoptosis, suggesting a potential role of miR-135a/b loss of function in the development of cisplatin resistance in lung cancer [215]. [score:4]
[1 to 20 of 1 sentences]
98
[+] score: 3
Also, miR-135a reduces proliferation and clonogenicity possibly by targeting BMI1 in Pancreatic ductal adenocarcinoma[23]. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
Furthermore, overly-expressed miR-135a and miR-335 were shown to contribute to the progression of colorectal cancer [24]. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The miRNA families that change expression in both mouse and human were: let-7, miR-7, miR-15, miR-101, miR-140, miR-152 (all validated by qPCR, P < 0.05), as well as miR-17, miR-34, miR-135, miR-144, miR-146, miR-301, miR-339, miR-368 (qPCR not performed). [score:3]
[1 to 20 of 1 sentences]