sort by

226 publications mentioning hsa-mir-138-2 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-138-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 393
Other miRNAs from this paper: hsa-mir-31, mmu-mir-138-2, hsa-mir-138-1, mmu-mir-31, mmu-mir-138-1
The levels of BIRC5 mRNA were down-regulated upon miR-138-5p overexpression, whereas the levels of BIRC5 mRNA were up-regulated upon miR-138-5p knockdown (Fig.   2f). [score:10]
We experimentally validated the direct inhibition of Survivin translation by miR-138-5p by overexpressing and knocking down miR-138-5p in bladder cancer cells. [score:9]
miR-138-5p overexpression was achieved by transfecting bladder cancer cell lines with an miRNA mimic (a synthetic RNA oligonucleotide duplex mimicking the miRNA precursor), and knockdown was achieved by transfecting a miRNA inhibitor (a chemically modified single-stranded antisense oligonucleotide designed to specifically target the mature miRNA). [score:8]
By overexpressing or knocking down miR-138-5p in bladder cancer cells, we experimentally confirmed that miR-138-5p directly recognizes the 3′-UTR of the BIRC5 transcript and regulates Survivin expression. [score:8]
Tumors with both miR-138-5p and BIRC5 overexpression exhibited significantly higher levels of Survivin compared to tumors with miR-138-5p overexpression alone (Fig.   4, d and g), suggesting that BIRC5 overexpression could rescue the Survivin suppression caused by miR-138-5p. [score:8]
As predicted, overexpressing miR-138-5p significantly suppressed the Survivin protein levels in T24 and J82 cells, whereas miR-138-5p knockdown had the opposite effect on Survivin expression in these cells (Fig.   2d and e). [score:8]
In summary, this study revealed a critical role of miR-138-5p as a tumor suppressive miRNA in bladder carcinogenesis, explored the molecular mechanisms by which aberrant miR-138-5p expression contributes to bladder cancer progression and identified Survivin as a direct target of miR-138-5p. [score:8]
Interestingly, we further observed that the restoration of Survivin expression by an overexpressing plasmid can successfully attenuate the anti-proliferative and anti-invasive effect of miR-138-5p on bladder cancer cells, although miR-138-5p may also have many other targets. [score:7]
For example, miR-138-5p could inhibit the translation of ZEB2 mRNA and suppress the ZEB2 -mediated metastatic potential of bladder cancer [31]. [score:7]
Taken together, our findings provide the first clues regarding the role of miR-138-5p as a tumor suppressor in bladder cancer by inhibiting BIRC5 translation. [score:7]
To overexpress Survivin, an expression plasmid designed to specifically express the full-length ORF of Survivin without the miR-138-5p-responsive 3′-UTR was also constructed and transfected into T24 cells. [score:7]
In conclusion, our results demonstrated that miR-138-5p directly recognizes and binds to the 3′-UTR of the Survivin mRNA transcript to inhibit Survivin translation in bladder cancer cells. [score:6]
Xenografts with both miR-138-5p and BIRC5 overexpression exhibited increased cell mitosis compared to xenografts with only miR-138-5p overexpression (Fig.   4i), suggesting that Survivin overexpression could attenuate the anti-proliferative effect of miR-138-5p. [score:6]
T24 cells were infected with either a control lentivirus or a lentivirus containing a plasmid that overexpressed miR-138-5p and then transfected with either a control plasmid or a BIRC5 overexpression plasmid. [score:5]
In the present study, we found that elevated expression of Survivin was related to the decrease of tumor suppressor miR-138-5p. [score:5]
c Quantitative RT-PCR analysis of the expression levels of miR-138-5p in T24 and J82 cells transfected with equal doses of the miR-138-5p mimic (mim-miR-138-5p), miR-138-5p inhibitor (anti-miR-138-5p) or corresponding scrambled negative control RNA (mim-scramble and anti-scramble, respectively). [score:5]
To investigate the role of this new pathway in the network of bladder carcinogenesis signaling, we overexpressed miR-138-5p in bladder cancer cells and found that proliferation and invasion of bladder cancer cells were inhibited, which mimic the function of Survivin reduction by targeted siRNA. [score:5]
A 300-bp fragment containing the genomic miR-138-5p sequence was cloned into a lentiviral expression plasmid and produced into lentivirus-miR-138-5p, which was used to infect T24 cells and overexpress miR-138-5p. [score:5]
To determine how miR-138-5p influenced the expression of Survivin in bladder cancer, we repeated the abovementioned experiments and examined the expression of Survivin mRNA after transfection. [score:5]
These results confirmed that targeting Survivin is an important mechanism of the tumor-suppressive function of miR-138-5p. [score:5]
Immunohistochemical staining also revealed the presence of lower levels of Survivin in tumors from mice implanted with miR-138-5p -overexpressing cells, whereas the tumors from the BIRC5 -overexpressing mice showed increased Survivin protein levels. [score:5]
miR-138-5p could also suppress cell proliferation by targeting Bag-1 in gallbladder carcinoma [32]. [score:5]
However, when T24 cells were co -transfected with mim-miR-138-5p and the Survivin overexpression plasmid, Survivin dramatically attenuated the suppressive effect of miR-138-5p on cell invasion (Fig.   4d and f). [score:5]
Additionally, BIRC5 overexpression attenuated the repressive effect of miR-138-5p on tumor growth (Fig.   4, c and e), suggesting that miR-138-5p might inhibit tumor growth by silencing Survivin. [score:5]
Using three publicly available algorithms (TargetScan, miRanda and PicTar), miR-138-5p was identified as a candidate miRNA that could target BIRC5. [score:5]
In addition, we showed that in cultured bladder cancer cells, miR-138-5p inhibited Survivin expression as well as cell proliferation and invasion; furthermore, miR-138-5p also slowed tumor growth in a xenograft mouse mo del. [score:5]
The predicted interaction between miR-138-5p and its target sites in the BIRC5 3′-UTR is illustrated in Fig.   2a, which shows that miR-138-5p has 2 potential target sites in the 3′-UTR of the BIRC5 mRNA sequence. [score:5]
In the in vivo study, the Survivin overexpression plasmid significantly rescued the suppressed tumor growth induced by cells transduced with lentivirus-miR-138-5p. [score:5]
We identified 2 specific targeting sites for miR-138-5p in the 3′ untranslated region (3′-UTR) of BIRC5. [score:5]
The invasive ability of T24 cells transfected with either mimics or inhibitors (mim-miR-138-5p or anti-miR-138-5p, respectively), BIRC5 siRNA and/or the overexpression plasmid was tested in a Transwell Boyden chamber (6.5 mm; Costar). [score:5]
Zhao L, Yu H, Yi S, Peng X, Su P, Xiao Z, et al. The tumor suppressor miR-138-5p targets PD-L1 in colorectal cancer. [score:5]
Likewise, BIRC5 overexpression attenuated the pro-proliferative effect caused by miR-138-5p overexpression (Fig.   4, i and j). [score:5]
The mice were randomly divided into 4 groups and subcutaneously injected with T24 cells (2 × 10 [6] cells per mouse, 5 mice per group, Fig.   4a) that were infected with either control lentivirus or a lentivirus that overexpressed miR-138-5p followed by co-transfection with a control plasmid or a BIRC5 overexpression plasmid. [score:5]
To determine whether the negative regulatory effects of miR-138-5p on Survivin expression were mediated through the binding of miR-138-5p to the presumed sites in the 3′-UTR of the Survivin mRNA, the full-length 3′-UTR of BIRC5 containing the 2 presumed miR-138-5p binding sites was cloned downstream of the firefly luciferase gene in a reporter plasmid. [score:4]
Tumors with both miR-138-5p and BIRC5 overexpression exhibited increased Survivin protein levels compared to xenografts with only miR-138-5p overexpression (Fig.   4i and k). [score:4]
Furthermore, hematoxylin and eosin (H&E) staining of xenograft tissues showed confluent necrotic areas and reduced cell mitosis in the group implanted with the cells expressing the miR-138-5p lentiviral vector compared with the control group, whereas an increase in cell mitosis was observed in the xenografts from the BIRC5 overexpression group (Fig.   4i). [score:4]
The correlation between miR-138-5p and Survivin was further examined by evaluating Survivin expression after either overexpressing or knocking down miR-138-5p in the human bladder cancer cell lines T24 and J82. [score:4]
Validation of Survivin as a direct target of miR-138-5p. [score:4]
A significant decrease in the size and weight was observed in tumors from the miR-138-5p -overexpressing group compared to those of the control group, whereas the size and weight of the tumors in the group implanted with cells containing the BIRC5-overexpression plasmid were dramatically increased (Fig.   4, c and e). [score:4]
Fig. 2The negative regulation of Survivin expression by miR-138-5p in bladder cancer cells. [score:4]
Tumors from the miR-138-5p -overexpressing group displayed a reduction in the Survivin protein levels compared to tumors from the control group, whereas the tumors from the BIRC5 -overexpressing group showed elevated Survivin protein levels. [score:4]
Overexpression or knockdown of miR-138-5p. [score:4]
Treatment with miR-138-5p exhibited an anti-tumor effect both in vitro and in vivo by negatively regulating Survivin expression. [score:4]
After determining the levels of miR-138-5p in the same 12 pairs of bladder cancer tissues and adjacent noncancerous tissues, we found that miR-138-5p levels were notably down-regulated in bladder cancer tissues (Fig.   2b). [score:4]
Moreover, compared with cells transfected with mim-miR-138-5p alone, T24 cells transfected with both mim-miR-138-5p and the Survivin overexpression plasmid exhibited significantly higher proliferation rates (Fig.   3b), suggesting that miR-138-5p-resistant Survivin is sufficient to rescue the suppression of Survivin by miR-138-5p and to attenuate the anti-proliferative effect of miR-138-5p on bladder cancer cells. [score:4]
The efficient overexpression and knockdown of miR-138-5p in T24 and J82 cells are shown in Fig.   2c. [score:4]
These results were consistent with the findings of the in vitro assays, which firmly validated the role of miR-138-5p as a tumor suppressor by targeting BIRC5. [score:4]
Knockdown of miRNA was achieved by transfecting cells with anti-miR-138-5p, which is a chemically modified antisense oligonucleotide designed to specifically target mature miR-138-5p. [score:4]
The correlation between miR-138-5p and Survivin was further examined by evaluating Survivin expression in human bladder cancer cell lines that either overexpressed or knocked down miR-138-5p. [score:4]
Down-regulation of miR-138-5p has also been reported in other cancers [28– 30]. [score:4]
Fig. 3The role of miR-138-5p targeting Survivin in regulating the proliferative and invasive abilities of bladder cancer cells. [score:4]
After 28 days of xenograft growth in vivo, tumors from the miR-138-5p-overexpression group showed a significant increase in miR-138-5p expression compared to tumors from the control groups (Fig.   4f). [score:4]
This mutated luciferase reporter was unaffected by either overexpression or knockdown of miR-138-5p (Fig.   2g). [score:4]
A. Western blotting analysis of Survivin protein levels in T24 cells transduced with either lentivirus-miR-138-5p (MOI = 5) and/or different doses of the Survivin overexpression plasmid. [score:3]
Identification of conserved miR-138-5p target sites within the 3′-UTR of BIRC5. [score:3]
After measuring the expression levels of miR-138-5p and Survivin in human bladder cancer tissues and adjacent noncancerous tissue samples, we detected an inverse correlation between miR-138-5p expression and Survivin protein levels. [score:3]
A mammalian expression plasmid encoding the full-length human BIRC5 open reading frame (ORF) without the miR-138-5p-responsive 3′-UTR was purchased from Ribobio (Guangzhou, China). [score:3]
A lentiviral vector that overexpresses miR-138-5p was purchased from Invitrogen. [score:3]
Thus, Survivin was deduced to be a miR-138-5p target not only by computational prediction but also based on the inverse correlation between miR-138-5p and Survivin protein levels in human bladder tissues. [score:3]
Construction of the miR-138-5p overexpression lentiviral vector. [score:3]
In this study, we searched for miRNAs that can target Survivin and identified miR-138-5p as a candidate. [score:3]
The BIRC5 mRNA was significant reduced in the tumors with miR-138-5p overexpression, which was consistent with the in vitro results (Fig.   4h). [score:3]
Furthermore, we experimentally investigated the direct regulation of Survivin by miR-138-5p as well as the biological role of miR-138-5p targeting Survivin in human bladder cancer cell lines and in a mouse tumor xenograft mo del. [score:3]
These results indicate that miR-138-5p might inhibit cell proliferation and invasion by silencing Survivin. [score:3]
Overexpression of miRNA was achieved by transfecting cells with mim-miR-138-5p, which is a synthetic RNA oligonucleotide that mimics the miR-138-5p precursor. [score:3]
The next day, the T24 cells were transfected with mim-miR-138-5p, anti-miR-138-5p, BIRC5 siRNA and/or the overexpression plasmid, and the medium was replaced with RPMI 1640 medium supplemented with 2% FBS. [score:3]
T24 cells were infected with either a control lentivirus or lentivirus-miR-138-5p (MOI = 5); the resulting cells were then co -transfected with a control plasmid or a BIRC5 overexpression plasmid (6 μg/ 75 cm [2]) to produce 4 cellular phenotypes. [score:3]
In this study, we predicted that Survivin was a target of miR-138-5p. [score:3]
A luciferase reporter assay was performed to test the direct binding of miR-138-5p to the target gene BIRC5. [score:3]
All these results suggested that miR-138-5p may work as a tumor suppressor in bladder cancer. [score:3]
To test the direct binding of miR-138-5p to the target gene BIRC5, a luciferase reporter assay was performed as previously described. [score:3]
We further analyzed the biological consequences of the miR-138-5p -driven repression of Survivin expression in bladder cancer cells. [score:3]
b Quantitative RT-PCR analysis of the relative expression levels (miR-138-5p vs. [score:3]
Furthermore, the biological consequences of the targeting of BIRC5 by miR-138-5p were examined in vitro via cell proliferation and invasion assays and in vivo using a mouse xenograft tumor mo del. [score:2]
g Direct recognition of the Survivin 3’-UTR by miR-138-5p. [score:2]
For the luciferase reporter assays, HEK293 cells were cultured in 24-well plates, and each well was transfected with 0.4 μg of firefly luciferase reporter plasmid, 0.4 μg of a β-galactosidase (β-gal) expression plasmid (Ambion), and equal amounts (20 pmol) of mim-miR-138-5p, anti-miR-138-5p, or the scrambled negative control RNAs using Lipofectamine2000 (Invitrogen). [score:2]
Thus, it is hypothesized that a replacement treatment with miR-138-5p mimics could be a promising strategy for cancers characterized by down-regulation of miR-138-5p. [score:2]
a The CCK-8 viability assay was performed 12, 24, 36, and 48 hours after T24 cells were transfected with miR-138-5p mimic (mim-miR-138-5p), miR-138-5p inhibitor (anti-miR-138-5p) or corresponding scrambled negative control RNA (mim-scramble and anti-scramble, respectively). [score:2]
Bladder cancer miR-138-5p Survivin post-transcriptional regulation Bladder cancer is the most common malignancy of the urogenital system and is one of the major causes of cancer-related death among Chinese patients. [score:2]
These results demonstrated that post-transcriptional regulation of Survivin mRNA by miR-138-5p may partially contribute to the mRNA degradation of this gene. [score:2]
The role of miR-138-5p in regulating Survivin in bladder cancer cells. [score:2]
As expected, T24 cells transfected with mim-miR-138-5p showed decreased cell proliferation; in contrast, knocking down miR-138-5p had the opposite effect on cell proliferation (Fig.   3a). [score:2]
Furthermore, we introduced point mutations into the corresponding complementary sites in the 3′-UTR of Survivin to eliminate the predicted miR-138-5p binding sites (i. e., the two binding positions were mutated). [score:2]
The results demonstrated a novel regulatory network involving miR-138-5p and Survivin to fine-tune the proliferation and invasion of bladder cancer. [score:2]
We demonstrated that BIRC5 repression by miR-138-5p suppressed the proliferative and invasive characteristics of bladder cancer cells and that miR-138-5p exerted an anti-tumor effect by negatively regulating BIRC5 in a xenograft mouse mo del. [score:2]
Regulation of Survivin by miR-138-5p might explain why the decrease of miR-138-5p during bladder carcinogenesis can promote cancer progression. [score:2]
For miRNA knockdown, equal amounts of anti-miR-138-5p or anti-scramble were used. [score:2]
The MOI value of lentivirus-miR-138-5p used here was 5, and the amount of pCDNA3.1-BIRC5 transfected was 9 μg/75 cm [2]. [score:1]
[15] A sequence containing the presumed miR-138-5p binding site was designed from the human BIRC5 3′-UTR. [score:1]
Synthetic mim-miR-138-5p, anti-miR-138-5p and the corresponding negative control scrambled RNAs (mim-scramble and anti-scramble) were purchased from GenePharma (Shanghai, China). [score:1]
U6) of miR-138-5p in human bladder cancer specimens (BC) and normal adjacent tissues (NAT). [score:1]
As expected, luciferase activity was markedly reduced in the cells transfected with mim-miR-138-5p and increased in the cells transfected with anti-miR-138-5p (Fig.   2g). [score:1]
The effect of miR-138-5p and Survivin on bladder tumor growth in vivo. [score:1]
Furthermore, the miR-138-5p binding sequences in the BIRC5 3′-UTR were highly conserved across multiple species. [score:1]
The expression levels of miR-138-5p and Survivin protein were measured in 12 resected bladder cancer specimens. [score:1]
We further identified an inverse correlation between miR-138-5p and Survivin protein levels in bladder cancer tissue samples. [score:1]
d and e Western blotting analysis to detect Survivin protein levels in T24 and J82 cells transfected with equal amounts of mim-miR-138-5p, anti-miR-138-5p, mim-scramble or anti-scramble. [score:1]
a Schematic description of the hypothetical hybridizations formed by the interactions between the binding sites in the BIRC5 3′-UTR (top) and miR-138-5p (bottom). [score:1]
The resulting plasmid was transfected into HEK293 cells along with mim-miR-138-5p, anti-miR-138-5p, or corresponding scrambled negative control RNAs (mim-scramble and anti-scramble, respectively). [score:1]
The cell proliferation rate as indicated by the percentage of Ki-67 -positive tumor cells was increased in the group implanted with cells containing the BIRC5 plasmid and decreased in the group implanted with cells containing the miR-138-5p lentiviral vector. [score:1]
Detection of an inverse correlation between miR-138-5p and Survivin levels in bladder cancer tissues. [score:1]
Effects of miR-138-5p and Survivin on the growth of bladder cancer cell xenografts in mice (supplemental animal experiment). [score:1]
c and e, transwell analysis of invading T24 cells treated with equal amounts of mim-miR-138-5p, anti-miR-138-5p, mim-scramble or anti-scramble. [score:1]
f Quantitative RT-PCR analysis of Survivin mRNA levels in T24 and J82 cells transfected with equal amounts of mim-miR-138-5p, anti-miR-138-5p, mim-scramble or anti-scramble. [score:1]
Firefly luciferase reporters containing either wild-type (WT) or mutant (MUT) miR-138-5p binding sites in the Survivin 3′-UTR were co -transfected with equal doses of mim-miR-138-5p, anti-miR-138-5p or the corresponding scrambled negative control RNA (mim-scramble and anti-scramble, respectively) into HEK293 cells. [score:1]
To test the binding specificity, the sequences that interacted with the miR-138-5p seed sequence were mutated (site 1 from CACCAGC to GTGGTCG, and site 2 from ACCAGCA to TGGTCGT), and the mutant BIRC5 3′-UTR was inserted into an equivalent luciferase reporter. [score:1]
Cellular miR-138-5p levels were increased approximately 500-fold when T24 and J82 cells were transfected with mim-miR-138-5p, and these levels dropped to approximately 10% of the normal level when T24 and J82 were treated with anti-miR-138-5p. [score:1]
This finding suggested that these binding sites strongly contribute to the interaction between miR-138-5p and Survivin mRNA. [score:1]
We also investigated the biological role of miR-138-5p targeting to Survivin in bladder cancer cell lines both in vivo and in vitro. [score:1]
Equal amounts of either mim-miR-138-5p or mim-scramble were used in each well. [score:1]
The seed regions of miR-138-5p and the seed-recognition sites in the BIRC5 3′-UTR are indicated in red. [score:1]
In this study, we found that the levels of miR-138-5p in bladder cancer were much lower than those in normal adjacent bladder mucosa. [score:1]
d and (f), transwell analysis of invading T24 cells treated with equal amounts of mim-scramble plus control vector (pCDNA3.1), mim-miR-138-5p plus control vector, mim-scramble plus BIRC5 plasmid (pCDNA3.1-BIRC5), or mim-miR-138-5p plus BIRC5 plasmid. [score:1]
[1 to 20 of 113 sentences]
2
[+] score: 348
We demonstrated that TWIST2 is a direct target of miR-138, with the evidence that overexpression of miR-138 led to reduced luciferase activity with TWIST2 3′UTR and miR-138 can down-regulate TWIST2 mRNA and protein expression (Figure  3). [score:11]
By bioinformatics analysis (TargetScan and MiRanda) and experimentally validation, we found TWIST2 was a direct target of miR-138 and miR-138 can inhibit CRC metastasis by targeting TWIST2. [score:10]
To our knowledge, this is the first study showing that miR-138 is down-regulated in CRC tissues and cell lines and overexpression of miR-138 can inhibit CRC migration and invasion in vitro and in vivo. [score:8]
TWIST2 is up-regulated in primary CRC tissues and its expression correlates with miR-138 expression in CRC. [score:8]
Restoration of miR-138 resulted in a dramatic reduction of the expression of TWIST2 at both mRNA and protein levels by directly targeting its 3′-untranslated region (3′UTR). [score:8]
TWIST2 was a direct target of miR-138 which inhibited its expression via binding to its 3′UTR. [score:8]
However, the suppressive effect of miR-138 on invasion is stronger than its effect in suppressing TWIST2 expression. [score:7]
Using Kaplan–Meier method and log-rank test, the overall survival (OS, Figure  5A) and disease-free survival (DFS, Figure  5B) of CRC patients with high miR-138 expression were both significantly longer than those with low miR-138 expression. [score:7]
And we speculate that miR-138 may function as a tumor metastasis inhibitor through the inhibition of CRC EMT by targeting TWIST2. [score:7]
In agreement with these reports showing the suppressor role of miR-138, we have also observed down-regulation of miR-138 in CRC tissues and cell lines. [score:6]
As shown in Figure  3G, concomitant overexpression of miR-138 and TWIST2 nullified the inhibitory effect of miR-138 on the cell migratory ability of HCT116 cells compared with cells transfected with miR-138 and the empty expression vector groups (p < 0.01). [score:6]
We also examined miR-138 expression level in six CRC cell lines (LoVo, DLD1, HCT116, SW620, HT29, SW116) and observed that miR-138 was down-regulated in all six CRC cell lines relative to the normal primary colon cells from eight normal tissues (Figure  1B). [score:6]
Overall survival (OS) (A) and disease-free survival (DFS) (B) curves for two groups defined by low and high expression of miR-138 in patients with CRC. [score:5]
miR-138 suppressed CRC cell migration and invasion, at least in part via inhibition of oncogene TWIST2. [score:5]
Up-regulation of TWIST2 was detected in CRC tumors compared with adjacent normal tissues (P < 0.001) and is inversely correlated with miR-138 expression. [score:5]
Figure 4 Exogenetic expression of miR-138 suppresses CRC cell metastasis in vivo. [score:5]
miR-138 inhibits CRC cell motility by targeting TWIST2. [score:5]
To validate the miRNA-target interaction and determine if miR-138 affects TWIST2 expression in the intracellular environment in CRC, the expression of TWIST2 was evaluated in HCT116 and SW620 cells following transfection with either miR-138 mimics or control microRNA. [score:5]
These findings suggest that miR-138 playing the tumor suppressive role is at least partly through decreasing the TWIST2 expression. [score:5]
Furthermore, we also noticed that overexpression of TWIST2 by the pcDNA3.1-TWIST2 plasmid nullifies the effect of suppression of cell invasion by miR-138. [score:5]
Expression of TWIST2 and miR-138 exhibited a significant inverse correlation (P = 0.0039, R [2] = 0.2608; Figure  3F), further supporting the miR-138 target status of TWIST2. [score:5]
These results demonstrated that miR-138 can inhibit CRC cell migration and invasion by targeting TWIST2. [score:5]
Meanwhile, we found that exogenous miR-138 expression or ablation of TWIST2 can both abrogate the metastasis of CRC cells and inhibition of miR-138 can promote the metastatic ability of CRC cells in vitro (data not shown). [score:5]
Ectopic expression of miR-138 resulted in a dramatic inhibition of CRC migration and invasion in vitro and in vivo. [score:5]
In addition, in vivo metastatic experiments confirmed that stable over -expression of miR-138 inhibited the metastatic ability of CRC cells. [score:5]
Overexpression of miR-138 can reduce CRC cell motility through targeting TWIST2. [score:5]
Overexpression of miR-138 inhibited CRC cell colony formation, migration and invasion in vitro. [score:5]
The patients with low miR-138 expression had a significantly worse OS (P < 0.01) and DFS (P < 0.01) survival rate than those with high miR-138 expression. [score:5]
And miR-138 expression was divided into high or low expression group according to the median value. [score:5]
Figure 5 Kaplan–Meier analysis of overall survival and disease-free survival for patients with miR-138 high or low expressions. [score:5]
Low-level miR-138 expression was found to be significantly associated with a more aggressive tumor phenotype and high preoperative CEA levels and was also shown to be a strong independent predictor of a short disease-free survival period and short overall survival for patients with CRC. [score:5]
miR-138 was down-regulated in CRC cell lines and primary CRC tissues. [score:4]
Figure 1 miR-138 is commonly down-regulated in primary colorectal cancer tissues and colon cancer cell lines. [score:4]
These results inferred that down-regulation of miR-138 endows the metastatic potential to CRC cells, promotes the metastasis of CRC. [score:4]
Figure 3 TWIST2 is a direct functional target of miR-138. [score:4]
We also identified that down-regulation of miR-138 was associated with lymph node metastasis, distant metastasis, and always predicted poor prognosis. [score:4]
These data highlight a pivotal role for miR-138 in the regulation of CRC metastasis by targeting TWIST2, and suggest a potential application of miR-138 in prognosis prediction and CRC treatment. [score:4]
The expression of miR-138 was markedly increased in the lentiviral vector -mediated miR-138 -expressing stable cell line HCT116-miR138 compared with the control stable cell line HCT116-Control. [score:4]
miR-138 was found to be down-regulated in human colorectal cancer tissues and cell lines. [score:4]
In our study, we reported that TWIST2 is a direct target of miR-138. [score:4]
Knockdown of TWIST2 gene expression by siRNA had an effect on in vitro invasion capability that was similar to that of the restoration of miR-138. [score:4]
We have identified that miR-138 is down-regulated in CRC. [score:4]
Cotransfection experiments showed that miR-138 decreased the luciferase activity of wild type for 45%, but this was not observed on mutant type (Figure  3D), indicating that TWIST2 is a direct target of miR-138 through binding to its 3′UTR. [score:4]
While some studies have found miR-138 might be a potential tumor suppressor in some types of cancers, including ovarian cancer, head and neck squamous cell carcinoma, and cholangiocarcinoma [12, 21, 22]. [score:3]
And miR-138 may be a candidate tumor suppressive miRNA of CRC and might be a new prognostic biomarker for CRC patients. [score:3]
Importantly, in vivo metastatic mo dels revealed a significant decrease in tumor growth and metastatic capability treated with the stable cell lines which over-expressed miR-138. [score:3]
The cell line expressing microRNA-138 stably was named HCT116-miR138; the control vector cell line was named HCT116-control. [score:3]
These properties support the notion that TWIST2 repression contributes to the tumor metastasis suppressive effects of miR-138. [score:3]
Therefore, patients with high or low miR-138 expression were 94 and 93, respectively. [score:3]
Previous studies indicated that miR-138 may have an effect on tumor metastasis by targeting SOX4 and Hif1a in ovarian cancer, MMP2/MMP9 in cholangiocarcinoma cells and FAK in hela cells [12, 22, 23]. [score:3]
Based on Koji Okamoto et al. report, miR-138 was reduced expressed in the metastases in their experimental mo dels and others found that it may be involved in ovarian cancer and non-small cell lung cancer metastasis [11- 13], which suggested that miR-138 might play an important role in CRC progression. [score:3]
Transfection of miR-138 resulted in significant reduction of TWIST2 mRNA (Figure  3B) and protein (Figure  3C) expression by real-time RT-PCR and Western blotting analysis, respectively. [score:3]
But, miR-138 expression is significant correlated with the patient’s lymph node metastasis and distant metastasis. [score:3]
miR-138 inhibits CRC cell metastasis in vivo. [score:3]
Finally, we find reduced expression miR-138 is usually associated with poor prognosis with CRC patients by statistical analysis. [score:3]
This indicates that there might be additional miR-138 targets that act as tumor oncogenes. [score:3]
Consistent with our exception, there was a 2–3 fold decrease in the expression level of miR-138 in the 36 tumors than in their paired normal tissues (P < 0.001)(Figure  1A). [score:3]
In our study, we found that TWIST2 is a novel target of miR-138. [score:3]
Real-time PCR results showed that HCT116-miR138 cells expressed 13 fold miR-138 than control cells HCT116-control, indicating the construction was successful (Figure  4A). [score:3]
Increased expression of miR-138 in HCT116 cells following transfection was confirmed via real-time PCR (Figure  2A). [score:3]
Although the previous studies found that SOX4, Hif1a, and MMP2/MMP9 are all miR-138′s targets. [score:3]
org), we find that the 3′UTR of twist basic helix-loop-helix transcription factor 2 gene (TWIST2) contains a complementary site for the seed region of miR-138, and may be a potential target of miR-138 (Figure  3A). [score:3]
The results showed that the miR-138 -transfected cells formed considerably fewer and smaller colonies than control microRNA -transfected cells (Figure  2D), indicating a growth -inhibitory role of miR-138 in CRC cells (Figure  2D, E). [score:3]
The expression levels of miR-138 were first examined in CRC cell lines and tumor tissues by real-time PCR. [score:3]
We first examined the expression level of miR-138 in 36 human CRC tumor samples and paired normal colorectal tissues. [score:3]
And the expression of TWIST2 and miR-138 in CRC tissues is inversely correlated (Figure  3F). [score:3]
As shown in Table  1, no significant differences were observed between miR-138 expressions and age, sex, CEA level, CA199 level, tumor site, tumor Size, differentiation, and Local invasion. [score:3]
The expression of miR-138 was detected by real-time PCR in these two cell lines as described above. [score:3]
Lenti-Pac HIV Expression Packaging Kit and pLV-miR-138 (or control) were co -transfected using EndoFectin Lenti transfection reagent following the manufacturer’s instruction (GeneCopoeiaTM). [score:3]
To further evaluate the correlation between TWIST2 and miR-138 expression in primary CRCs, we compared the expression of TWIST2 and miR-138 in 36 primary CRCs. [score:2]
To explore the effect of overexpression of miR-138 on the tumorigenesis,motility and invasive capacity of CRC cells, transwell assays were performed. [score:2]
To identify the putative miR-138 target genes, we applied combined in silico seed site analysis, Western Blot, and luciferase reporter assays. [score:2]
In this study, we extended our analyses by assaying miR-138 expression in specimens from 187 human CRC patients. [score:2]
For luciferase assays, the potential miR-138 binding site in the TWIST2 3′UTR was predicted at position 375–382 from the stop codon site of TWIST2 by TargetScan (http://www. [score:2]
To determine whether TWIST2 is involved in the miR-138 -induced inhibition of migration and invasion, we performed rescue assays. [score:2]
The results showed that the migratory capacity of HCT116 cells overexpressing miR-138 was reduced by 60.7% compared with the control groups (invasive capacity was reduced by 57.5%) (Figure  2B, C). [score:2]
miR-138 was cotransfected with pGL3-Control(the empty vector) or reporters constructed containing either wild-type or mutant TWIST2 3′UTR into 293 T cells. [score:1]
Then, we implanted HCT116-miR138 and HCT116-control cells into nude mice through the lateral tail vein respectively. [score:1]
However, there was no significant difference between the group that co-transfection control microRNA with pcDNA3.1-TWIST2 and the group that co-transfection miR-138 with pcDNA3.1-TWIST2 (Figure  3G). [score:1]
The potential clinical application of miR-138 in human cancer, especially in CRC has never been reported. [score:1]
Correlations between miR-138 expressions and clinicopathological characteristics and prognosis. [score:1]
The miR-138 level is normalized to RNU6B, and the P value indicated a significant difference in miR-138 level between paired samples. [score:1]
Restoration of miR-138 can reduce CRC cell colony formation, migration and invasion in vitro. [score:1]
Cells (1 × 10 [5]/well) were plated in a 24-well plate and transfected with miR-138 or control microRNA at 20 nmol/L by using lipofectamine 2000 (Invitrogen; Life Technologies). [score:1]
In this study, we first detected the expressions of miR-138 in CRC tissues and cell lines, and a series of in vitro and in vivo studies were then conducted to investigate the mechanisms and impact of miR-138 in CRC. [score:1]
miR-138 and control microRNA precursor sequences were amplified from human genomic DNA and cloned into the BamH I and Mfe I site of the lentiviral vector pEZX-MR03 (GeneCopoeiaTM) (pLV-miR-138, pLV-miR-control). [score:1]
HCT116 cells transfected with miR-138 mimics or control microRNA were seeded into the chambers with or without matrigel, and their migratory and invasive potential were determined after 24 h, 36 h culture. [score:1]
One million HCT116-miR138 or HCT116-control stable cells were injected into the lateral tail veins of each nude mouse at a density of 1.0 × 10 [7] cells/ml. [score:1]
The in vitro and in vivo functional effects of miR-138 were examined further. [score:1]
Among these paired samples, 86.1% (31/36) of the CRC samples showed lower miR-138 levels than in the adjacent normal tissues (see Figure  1A). [score:1]
In this work, we have started to shed light on the importance of miR-138 in CRC metastasis. [score:1]
The 293 T cells (1.5 × 10 [5] cells/well) were seeded in a 24-well plate and co -transfected 18 h later with pGL3-Control (0.4 mg) or pGL3-TWIST2-WT (0.4 mg) or pGL3-TWIST2-MUT (0.4 mg), pGL4.73 vector (a control Renilla luciferase vector, 50 ng, Promega, USA), and miR-138 (20 nM) or control microRNA (20 nM) using Lipofectamine 2000 (Invitrogen, USA). [score:1]
Figure 2 Effect of miR-138 on migration, invasion and colony formation in CRC cell lines. [score:1]
Representative colony formation results for control -transfected and miR-138 -transfected HCT116 cells were shown. [score:1]
In contrast, injection of HCT116-miR138 cells generated fewer metastatic nodules than were observed in the controls (Figure  4C). [score:1]
Representative transwell results for control -transfected and miR-138 -transfected HCT116 cells were shown. [score:1]
To further investigate the role of miR-138 involved in CRC metastasis in vivo, we constructed a lentivirus vector to mediate the expression of miR-138 and established two stable cell lines, which were named HCT116-miR138 and HCT116-control (Figure  4A). [score:1]
[1 to 20 of 97 sentences]
3
[+] score: 321
Other miRNAs from this paper: hsa-mir-138-1
A study by Poos et al. reveals that miR-138 is significantly downregulated in proliferative active osteosarcoma cell lines, and downregulation of miR-138 results in the upregulation of its direct target genes which are involved in focal adhesion [20]. [score:13]
MiR-138 is also downregulated in HNSCC, and ectopically overexpressed miR-138 in HNSCC suppressed cell invasion and led to cell cycle arrest and apoptosis [17]. [score:8]
In addition, miR-138 inhibitor was transfected into the MG-63 cells, which exhibit high miR-138 expression, to knock down miR-138 expression. [score:8]
d Fold change of DEC2 mRNA expression and relative DEC2 protein expression in MG-63 cells following transfection with the miR-138 inhibitor. [score:7]
miR-138 inhibited cell proliferation and invasion, as well as promoted cell apoptosis of human osteosarcoma cells, at least partially, by inhibiting the expression of DEC2. [score:7]
MiR-138 could inhibit osteosarcoma cell proliferation and invasion, as well as promote cell apoptosis through downregulating the expression of DEC2. [score:7]
The present study revealed that miR-138 exerts its effect on osteosarcoma cells, at least partially, by downregulating the expression of DEC2. [score:6]
To identify whether DEC2 is a direct target of miR-138, wild type and mutant DEC2 3′UTR containing the putative target site of miR-138 were cloned into reporter plasmids respectively, and were transfected into the HEK293 cells along with the miR-138 mimic, or the control miRNA. [score:6]
DEC2 was verified as a direct target of miR-138, and DEC2 could reverse the inhibitory effect of miR-138 on osteosarcoma progression. [score:6]
We found miR-138 expression was downregulated in human osteosarcoma tissues and cell lines. [score:6]
a Relative DEC2 protein expression in MG-63 cells following transfection with the miR-138 inhibitor and DEC2 siRNA. [score:5]
Ectopic expression of miR-138 can inhibit colorectal cancer migration and invasion in vitro and in vivo [12]. [score:5]
In MG-63 cells, the effect of miR-138 inhibitor on cell proliferation, apoptosis and invasion was also reversed by DEC2 suppression (proliferation, P < 0.05 for 48,72 and 96 h, Fig.   6b; apoptosis, P < 0.01, Fig.   6c; invasion, P < 0.05, Fig.   6d). [score:5]
The results from real-time quantitative reverse transcription PCR analysis confirmed the ectopic overexpression of miR-138 in U2OS cells and the depletion of miR-138 expression in MG-63 cells (Figs.   2a and 3a, P < 0.01). [score:5]
In contrast, miR-138 inhibitor significantly increased the expression of DEC2 mRNA and protein (0.42 ± 0.05 vs. [score:5]
Furthermore, we demonstrated that miR-138 suppresses DEC2 expression at the mRNA and protein level. [score:5]
Mir-138 expression was downregulated in human osteosarcoma tissues and cell lines. [score:5]
a Fold change of miR-138 expression in MG-63 cells following transfection with the miR-138 inhibitor. [score:5]
miR-138 mRNA expression was normalized to U6 internal control, and DEC2 mRNA expression was normalized to GAPDH internal control. [score:5]
To further illustrate whether miR-138 affects human osteosarcoma cell proliferation, apoptosis and invasion through DEC2, DEC2 overexpression plasmid was transfected into the U2OS cells in the presence of miR-138 mimic, whereas DEC2 siRNA was transfected into the MG-63 cells in the presence of miR-138 inhibitor. [score:5]
c Fold change of DEC2 mRNA expression and relative DEC2 protein expression in U2OS cells following transfection with the miR-138 mimic. [score:5]
showed that compared with the adjacent normal tissues, the expression level of miR-138 was significantly downregulated in human osteosarcoma tissues (Fig.   1a, P < 0.01). [score:5]
Compared with the normal bone cell line hFOB, the expression levels of miR-138 were significantly downregulated in osteosarcoma cell lines, including MG-63, U2OS, SJSA-1, and Saos-2 (Fig.   1c, P < 0.01). [score:5]
In ovarian cancer, miR-138 can suppress cell invasion and metastasis by targeting SRY-box 4 (SOX4) and hypoxia inducible factor 1, alpha subunit (HIF-1α) [18]. [score:5]
To overexpress miR-138, miR-138 mimic was transfected into the U2OS cells, which have low endogenous miR-138 expression. [score:5]
Li J Wang Q Wen R Liang J Zhong X Yang W MiR-138 inhibits cell proliferation and reverses epithelial-mesenchymal transition in non-small cell lung cancer cells by targeting GIT1 and SEMA4CJ Cell Mol Med. [score:4]
[*] P < 0.05 and [#] P < 0.01 compared with the miR-CtrlCell proliferation was determined by MTT assay, and the results showed that miR-138 overexpression significantly suppressed cell viability in U2OS cells, whereas miR-138 knockdown significantly enhanced cell viability in MG-63 cells (Figs.   2b and 3b, P < 0.05 for 48,72 and 96 h). [score:4]
Among the candidate target genes of miR-138, we focused on DEC2 because of its role as a regulator of cell proliferation, apoptosis, progression to malignancy, and carcinogenesis [22– 26, 28, 29]. [score:4]
Fig 4DEC2 was a direct target of miR-138. [score:4]
In the present study, we found that miR-138 was obviously downregulated in human osteosarcoma tissues and cell lines. [score:4]
[*] P < 0.05 and [#] P < 0.01 compared with the miR-Ctrl Cell proliferation was determined by MTT assay, and the results showed that miR-138 overexpression significantly suppressed cell viability in U2OS cells, whereas miR-138 knockdown significantly enhanced cell viability in MG-63 cells (Figs.   2b and 3b, P < 0.05 for 48,72 and 96 h). [score:4]
Long et al. reported that downregulation of miR-138 in human colorectal cancer tissues was associated with lymph node metastasis, distant metastasis, and predicted poor prognosis. [score:4]
was used to identify whether DEC2 is a direct target of miR-138. [score:4]
Several studies have indicated that downregulation of miR-138 promotes the progression of tumorigenesis [12, 14, 17– 19]. [score:4]
MiR-138 is a frequently downregulated miRNA in various types of tumors, including colorectal cancer, head and neck squamous cell carcinoma (HNSCC), cholangiocarcinoma, and lung cancer [12– 16]. [score:4]
DEC2 was a direct target of miR-138. [score:4]
In the present study, we confirmed DEC2 as a novel direct target of miR-138 by luciferase reporter assay. [score:3]
b Cell viability c Cell apoptosis rate d Cell invasion of MG-63 cells following transfection with the miR-138 inhibitor. [score:3]
Our report is consistent with the previous studies showing the tumor suppressor role of miR-138 in other types of tumors [12, 14, 17– 19]. [score:3]
These findings suggested that miR-138 acts as a tumor suppressor in osteosarcoma. [score:3]
DEC2 is predicted to be a potential target of miR-138 by miRanda (http://www. [score:3]
b Cell viability c Cell apoptosis rate d Cell invasion of MG-63 cells following transfection with the miR-138 inhibitor and DEC2 siRNA. [score:3]
The expression of miR-138 in human osteosarcoma tissues and cell lines was detected by real-time PCR analysis. [score:3]
MicroRNA-138 (miR-138) has been proven to be a tumor suppressor gene in various types of tumors. [score:3]
a Fold change of miR-138 expression in U2OS cells following transfection with the miR-138 mimic. [score:3]
We found that miR-138 mimic significantly reduced DEC2 expression at the mRNA and protein level (0.60 ± 0.11 vs. [score:3]
The in vitro gain-of-function and loss-of-function experiments demonstrated that miR-138 inhibited cell proliferation and invasion, and promoted cell apoptosis of human osteosarcoma cells. [score:3]
The expression level of miR-138 was quantified by real-time quantitative reverse transcription PCR in primary osteosarcoma tissues and osteosarcoma cell lines. [score:3]
However, the expression and the role of miR-138 in human osteosarcoma are still poorly understood. [score:3]
a Relative DEC2 protein expression in U2OS cells following transfection with the miR-138 mimic and DEC2 pcDNA3.1. [score:3]
[*] P < 0.05 and [#] P < 0.01 compared with the miR-Ctrl + pcDNA3.1; & P < 0.05 and [@] P < 0.01 compared with the Mimic + pcDNA3.1 Fig 6DEC2 suppression attenuated the effects of miR-138 inhibitor on osteosarcoma cells. [score:3]
a Fold change of miR-138 expression in human osteosarcoma tissues and the adjacent normal tissues. [score:3]
b Relative expression of miR-138 in the osteosarcoma tissues from the patients with metastases and non-metastases. [score:3]
However, the expression of miR-138 and its role in human osteosarcoma are still poorly understood. [score:3]
MiR-138 was downregulated in human osteosarcoma tissues and cell lines. [score:3]
Moreover, miR-138 expression was significantly lower in metastatic osteosarcoma tissues than that in non-metastatic tissues (Fig.   1b, P < 0.01). [score:3]
The DEC2 3′-untranslated region (3′UTR) containing the wild type or mutated miR-138 binding sequences were synthesized by Genescript (Nanjing, Jiangsu, China), and were cloned into the pmirGLO luciferase reporter vector (Promega, Madison, WI, USA). [score:3]
In this study, we found DEC2 could reverse the inhibitory effect of miR-138 on osteosarcoma progression, indicating that DEC2 acts as an oncogene in osteosarcoma. [score:3]
MiR-138 mimic (40 nM), miR-138 inhibitor (40 nM), DEC2-pcDNA3.1 (100 ng), DEC2 siRNA (100 ng) and the negative controls, including miR-Control (40 nM), pcDNA3.1 vector (100 ng), siRNA-Contrl (100 ng) were all purchased from GenePharma (Shanghai, China), and were transfected using Lipofectamine 2000 (Invitrogen Life Technologies), according to the manufacturer’s instructions. [score:3]
Here, for the first time, we confirmed that miR-138 acts as a tumor suppressor in human osterosarcoma. [score:3]
We provided the in vitro evidence that miR-138 inhibits osteosarcoma cell proliferation and invasion, and promotes osteosarcoma cell apoptosis. [score:3]
Several target genes of miR-138 have been identified and verified in previous studies, such as vimentin, zinc finger e-box binding homeobox 2 (ZEB2), GRK-Interacting Protein 1 (GIT1) and semaphorin-4c (SEMA4C) [19, 31, 32]. [score:3]
Fig 5DEC2 overexpression attenuated the effects of miR-138 mimic on osteosarcoma cells. [score:3]
We found that miR-138 inhibited cell proliferation and invasion, and promoted cell apoptosis of human osteosarcoma cells. [score:3]
The increased cell proliferation and invasion, and decreased cell apoptosis in U2OS cells by miR-138 mimic transfection was attenuated by the overexpression of DEC2 (proliferation, P < 0.05 for 48,72 and 96 h, Fig.   5b; apoptosis, P < 0.01, Fig.   5c; invasion, P < 0.05, Fig.   5d). [score:3]
MiR-138 was significantly downregulated in human osteosarcoma tissues and cell lines. [score:3]
c Fold change of miR-138 expression in human osteosarcoma cell lines (MG-63, U2OS, SJSA-1, and SAOS-2) and the normal bone cell line (hFOB). [score:3]
Moreover, miR-138 expression was significantly lower in metastatic osteosarcoma tissues than that in non-metastatic tissues. [score:3]
Lane 1, miR-Ctrl; lane 2, miR-138 inhibitor. [score:3]
This study provided new insight into the mechanisms of osteosarcoma carcinogenesis, and suggested miR-138/DEC2 as a novel therapeutic target in osteosarcoma. [score:3]
On the contrary, the knockdown of miR-138 in MG-63 cells resulted in a significantly reduced cell apoptosis rate (Figs.   2c and 3c, P < 0.01). [score:2]
Mir-138 inhibited osteosarcoma cell proliferation and invasion, and promoted cell apoptosis. [score:2]
MiR-138 has been proven to be a tumor suppressor gene in various types of tumors. [score:2]
MiR-138/DEC2 may be a novel therapeutic target in osteosarcoma. [score:2]
Flow cytometry indicated that U2OS cells with ectopic overexpression of miR-138 showed a significant increase in cell apoptosis rate compared with the control. [score:2]
demonstrated that the invasive ability of U2OS cells transfected with the miR-138 mimic was much weaker compared with the cells transfected with the miR-control (miR-Ctrl); however, the invasive ability was significantly enhanced in MG-63 cells following transfection with the miR-138 inhibitor (Figs.   2d and 3d, P < 0.05). [score:2]
Subsequently, we performed the in vitro gain-of-function and loss-of-function experiments to elucidate the role of miR-138 in osteosarcoma. [score:1]
b Cell viability c Cell apoptosis rate d Cell invasion of U2OS cells following transfection with the miR-138 mimic. [score:1]
The further step of this study need to investigate the association between miR-138 expression and clinicopathological parameters of osteosarcoma patients. [score:1]
As validated by luciferase reporter assay, the luciferase activity of wild type DEC2-3′UTR was significantly suppressed in the cells transfected with the miR-138 mimic compared with the cells transfected with the miR-Ctrl (P < 0.01); however, miR-138 mimic did not affect the luciferase activity of mutant DEC2-3′UTR (Fig. 4b). [score:1]
Poos et al. suggest that miR-138 is related to osteosarcoma cell proliferation [20]. [score:1]
The predicted interaction site of 7 bp of miR-138 and DEC2 3′UTR was shown in Fig.   4a. [score:1]
Lane 1, miR-Ctrl; lane 2, miR-138 mimic. [score:1]
b The relative luciferase activity of DEC2 wild type or mutant 3'UTR in HEK293 cells following transfection with the miR-138 mimic. [score:1]
In the present study, we investigated the expression and biological function of miR-138 in osteosarcoma. [score:1]
b Cell viability c Cell apoptosis rate d Cell invasion of U2OS cells following transfection with the miR-138 mimic and DEC2 pcDNA3.1. [score:1]
DEC2 attenuated the effects of miR-138 on osteosarcoma cells. [score:1]
a The DEC2 3′UTR region containing the wild type or mutant binding site for miR-138. [score:1]
HEK293 cells were transfected with the wild type/mutant DEC2 luciferase reporter vector and miR-138 mimic/miR-Control using Lipofectamine 2000. [score:1]
These findings suggested that miR-138 may play important roles in the progression of osteosarcoma. [score:1]
[1 to 20 of 90 sentences]
4
[+] score: 307
We found that miR-138-5p markedly suppressed CRC cell growth in vitro and inhibited tumorigenesis in vivo by targeting PD-L1; miR-138-5p expression was inversely correlated with that of PD-L1 in CRC. [score:9]
miR-138-5p inhibits cell growth and blocks S-phase entry partially through PD-L1 downregulation in vitromiR-138-5p was ectopically expressed in CRC cell lines. [score:8]
miR-138-5p and PD-L1 mRNA levels were inversely correlated in CRC tissue samples (two-tailed pearson's correlation analysis, r=−0.785; P<0.01) C. Kaplan-Meier analysis indicated that PD-L1 upregulation was associated with poorer overall patient survival (P=0.0024) D. miRNAs, such as oncomiRs or anti-oncomiRs, play critical roles in the initiation and progression of human cancers through post-transcriptional regulation of gene expression [36]. [score:7]
HCT116 and SW620 cells (which have low endogenous miR-138-5p expression) transfected with miR-138-5p mimics showed decreased proliferation (P<0.05), which was rescued by overexpression of the target gene, PD-L1 (Figure 3A & 3C). [score:7]
Kaplan-Meier analysis indicated that miR-138-5p downregulation was associated with poorer overall CRC patient survival (P=0.001) E. Table 1 Feature All miR-138-5p level Low (n) High (n) P-value PD-L1 expression PD-L1 high 98 73(74.5%) 25(25.5%) PD-L1 low 90 30(33.3%) 60(66.7%)0.000 * age  <55 87 47(54.0%) 40(46.0%) 0.884  ≥55 101 56(55.4%) 45(44.6%) sex  Male 120 67(55.8%) 53(44.2%) 0.702  Female 68 36(52.9%) 32(47.1%) Differentiation  Well 61 34(55.7%) 27(44.3%) 0.855  Moderate 98 52(53.1%) 46(46.9%)  Poor 29 17(58.6%) 12(41.4%) T status  T1 9 9(8.7%) 0(0.0%)0.008 *  T2 14 11(10.7%) 3(3.5%)  T3 153 77(74.8%) 76(89.4%)  T4 12 6(5.8%) 6(7.1%) TNM stage  I 20 18(90%) 2(10%)0. 000 *  II 78 31(39.7%) 47(60.3%)  III 60 33(55%) 27(45%)  IV 30 21(70%) 9(30%) Dukes stage  A stage 30 21(70%) 9(30%)0.022 *  B stage 66 27(40.9%) 39(59.1%)  C stage 57 32(56.1%) 25(43.9%)  D stage 35 23(65.7%) 12(34.3%) Lymph node metastasis  N0 98 39(37.9%) 59(69.4%)0.000 *  N1 90 64(62.1%) 26(30.6%) M status  M0 158 82(79.6%) 76(89.4%) 0.068  M1 30 21(20.4%) 9(10.6%) * P<0.05. [score:6]
In this study, miR-138-5p was shown to be frequently downregulated in CRC tissues and might act as a tumor suppressor. [score:6]
miR-138-5p inhibits cell growth and blocks S-phase entry partially through PD-L1 downregulation in vitro. [score:6]
Kaplan-Meier analysis indicated that miR-138-5p downregulation was associated with poorer overall CRC patient survival (P=0.001) E. Table 1 Feature All miR-138-5p level Low (n) High (n) P-value PD-L1 expression PD-L1 high 98 73(74.5%) 25(25.5%) PD-L1 low 90 30(33.3%) 60(66.7%)0.000 * age  <55 87 47(54.0%) 40(46.0%) 0.884  ≥55 101 56(55.4%) 45(44.6%) sex  Male 120 67(55.8%) 53(44.2%) 0.702  Female 68 36(52.9%) 32(47.1%) Differentiation  Well 61 34(55.7%) 27(44.3%) 0.855  Moderate 98 52(53.1%) 46(46.9%)  Poor 29 17(58.6%) 12(41.4%) T status  T1 9 9(8.7%) 0(0.0%)0.008 *  T2 14 11(10.7%) 3(3.5%)  T3 153 77(74.8%) 76(89.4%)  T4 12 6(5.8%) 6(7.1%) TNM stage  I 20 18(90%) 2(10%)0. 000 *  II 78 31(39.7%) 47(60.3%)  III 60 33(55%) 27(45%)  IV 30 21(70%) 9(30%) Dukes stage  A stage 30 21(70%) 9(30%)0.022 *  B stage 66 27(40.9%) 39(59.1%)  C stage 57 32(56.1%) 25(43.9%)  D stage 35 23(65.7%) 12(34.3%) Lymph node metastasis  N0 98 39(37.9%) 59(69.4%)0.000 *  N1 90 64(62.1%) 26(30.6%) M status  M0 158 82(79.6%) 76(89.4%) 0.068  M1 30 21(20.4%) 9(10.6%) * P<0.05. [score:6]
miR-138-5p and PD-L1 mRNA levels were inversely correlated in CRC tissue samples (two-tailed pearson's correlation analysis, r=−0.785; P<0.01) C. Kaplan-Meier analysis indicated that PD-L1 upregulation was associated with poorer overall patient survival (P=0.0024) D. ISH detection of miR-138-5p and IHC detection of PD-L1 in CRCs with low A. or high B. miR-138-5p expression tissue samples which were cut into serial paraffin sections. [score:6]
These studies demonstrated that miR-138-5p downregulated PD-L1 and inhibited CRC cell tumorigenicity in nude mice. [score:6]
The tumor suppressive role of miR-138-5p in CRC is thus at least partly realized by downregulating PD-L1. [score:6]
Collectively, these results suggest that miR-138-5p expression in CRC cells is important for both proliferation and cell cycle progression, and miR-138-5p acts by downregulating PD-L1. [score:6]
Ectopic miR-138-5p expression suppresses CRC cell tumorigenicity in vivo. [score:5]
Ectopic miR-138-5p expression suppresses CRC cell tumorigenicity in vivoTwo stable cell lines derived from SW620, SW620-miR-138-5p and SW620-scramble, were established using LV-miR138-5p and LV-scramble, respectively. [score:5]
miR-138-5p expression was detected via qPCR in HCT116, SW620, NCM460 and CCD841CoN cells transfected with miR-138-5p mimics and inhibitors (* * P<0.01). [score:5]
PD-L1 was detected in NCM460 and CCD841CoN cells transfected for 48 h with miR-138-5p inhibitors or NC oligos (miR-138-5p inhibitors control) Db. [score:5]
miR-138-5p expression was also downregulated in CRC cell lines compared with normal colonic epithelium cell lines (Figure 1C). [score:5]
To examine the effect of miR-138-5p on endogenous PD-L1 expression, two cell lines with low miR-138-5p expression, HCT116 and SW620, were transfected with miR-138-5p mimics; PD-L1 protein levels were decreased (Figure 2Da). [score:5]
When two cell lines with high miR-138-5p expression, NCM460 and CCD841CoN, were transfected with miR-138-5p inhibitors, PD-L1 levels were increased (Figure 2Db). [score:5]
Relative miR-138-5p expression in CRC tissues B. miR-138-5p expression in two normal epithelial cell lines and four colon cancer cell lines as determined by qPCR (** P<0.01) C. U6 was the endogenous control. [score:5]
Low miR-138-5p expression was associated with advanced clinical stage, lymph node metastasis and poor overall patient survival, and high PD-L1 expression correlated with decreased overall patient survival. [score:5]
In addition, we demonstrated that miR-138-5p overexpression suppressed tumor growth in vivo (Figure 5). [score:5]
Alterations in miRNA expression have been observed in CRC, and several dysregulated miRNAs, including miR-625-3p [8], miR-99-5b [9], miR-361-5p [10], miR-17-5p [11], miR-137 [12], miR-95 [13], miR-23a [14, 15], miR-155 [16], miR-150 [17], miR-191[18], miR-339-5p [19], miR-429 [20], miR-345 [21], miR-22 [22], miR-638 [23] and miR-138 [24], have been shown to regulate CRC cell growth, apoptosis and metastasis. [score:5]
NCM460 and CCD841CoN cells (with high endogenous miR-138-5p expression) transfected with miR-138-5p inhibitors showed increased proliferation (P<0.05), and this was rescued by PD-L1 siRNA transfection (Figure 4B & 4D). [score:5]
We demonstrated a direct link between miR-138-5p and PD-L1 expression in CRC patients, and observed that PD-L1 and miR-138-5p levels were inversely correlated in human CRC specimens (Figure 6C). [score:4]
PD-L1 is a direct miR-138-5p target. [score:4]
In situ hybridization (ISH) analysis in 188 CRC samples showed miR-138-5p downregulation in 92/188 (48.9%) tumors (Figure 1D). [score:4]
Kaplan-Meier analysis indicated that miR-138-5p downregulation was associated with poorer overall CRC patient survival (P=0.001) E. To clarify the relationship between miR-138-5p and PD-L1, basic information about hsa-miR-138-5p was collected from miRBase. [score:4]
Whether PD-L1 is the only direct target of miR-138-5p is still unknown. [score:4]
miR-138-5p is frequently downregulated in CRC. [score:4]
PD-L1 is a direct target of miR-138-5p in CRC cells. [score:4]
miR-138-5p and PD-L1 mRNA levels were inversely correlated in CRC tissue samples (two-tailed pearson's correlation analysis, r=−0.785; P<0.01) C. Kaplan-Meier analysis indicated that PD-L1 upregulation was associated with poorer overall patient survival (P=0.0024) D. miR-138-5p expression was measured in 21 CRC samples and corresponding adjacent normal tissues by qRT-PCR. [score:4]
We determined the effects of miR-138-5p overexpression or inhibition on cell proliferation via MTT assay. [score:4]
The growth-promoting effects of miR-138-5p inhibition were attenuated by endogenous PD-L1 knockdown in colonic epithelium cells. [score:4]
miR-138-5p downregulation was detected in 19/21 (90.48%) of CRC tumors (Figure 1A). [score:4]
Previous studies indicated that miR-138 might be a tumor suppressor in some cancers, including colorectal cancer, ovarian cancer, head and neck squamous cell carcinoma, nasopharyngeal carcinoma and pancreatic cancer [8, 24, 37- 41]. [score:3]
PD-L1 overexpression reversed the effects of miR-138-5p on cell cycle distribution and proliferation in CRC cell lines. [score:3]
miR-138-5p suppressed SW620 cell tumor growth in vivo. [score:3]
In NCM460 and CCD841CoN cells transfected with miR-138-5p inhibitors, the number of cells in S phase of the cell cycle increased and the number in G1 phase decreased (P<0.05, Figure 4C & 4E); this was rescued by PD-L1 siRNA transfection (P<0.05). [score:3]
CRC cells were transfected with miR-138-5p mimics or inhibitors for 24 h, and proliferation was examined. [score:3]
miR-138-5p expression in 21 CRC tissues and corresponding adjacent normal tissues as determined by qRT-PCR analysis A. U6 was the endogenous control. [score:3]
miR-138-5p was ectopically expressed in CRC cell lines. [score:3]
PD-L1 is a putative miR-138-5p target predicted by MIRDB (Figure 2A). [score:3]
NCM460 cell proliferation B. and cell cycle progression C. after cotransfection with the miR-138-5p inhibitor and PD-L1 siRNA or scramble. [score:3]
We also showed that low miR-138-5p expression correlated with advanced clinical stage and lymph node metastasis. [score:3]
Kaplan-Meier analysis indicated that low miR-138-5p expression was associated with poorer overall survival (log-rank test, P=0.001, Figure 1E). [score:3]
Our study showed miR-138-5p was downregulated in CRC tumor samples as compared with corresponding adjacent normal tissues (Figure 1). [score:3]
Figure 6ISH detection of miR-138-5p and IHC detection of PD-L1 in CRCs with low A. or high B. miR-138-5p expression tissue samples which were cut into serial paraffin sections. [score:3]
miR-138-5p mimic and inhibitors were transfected into HCT116, SW620, NCM460 and CCD841CoN cells (Figure 2B). [score:3]
Briefly, 2000 cells from each group (untreated, miR-138-5p mimics, miR-138p inhibitors and negative control) were plated in each well of five 96-well plates in 200μL of medium. [score:3]
Figure 5miR-138-5p suppressed SW620 cell tumor growth in vivoSW620 cells were infected with LV-miR-138-5p or LV-control, and six million cells in 0.2 ml of growth medium were subcutaneously injected into BALB/c nude mice (four in each group). [score:3]
To verify PD-L1 targeting by miR-138-5p, reporter constructs in which the PD-L1 3′UTR, either wild type or mutated in the miR-138-5p binding sites, was cloned downstream of the luciferase open reading frame (Figure 2Ab). [score:3]
PD-L1 levels were decreased by ectopic miR-138-5p expression in CRC cells (Figure 2Da). [score:3]
Correlation between miR-138-5p and PD-L1 expression in human CRCs. [score:3]
Further, multivariate Cox regression analysis revealed that low miR-138-5p expression is an independent prognostic factor for poor survival of CRC patients (P<0.01, Table 2). [score:3]
The clinical association analysis found that low miR-138-5p expression was correlated with advanced clinical stage (P<0.05) and lymph node metastasis (P<0.05, Table 1). [score:3]
ISH was used to detect miR-138-5p expression in CRC tissue samples. [score:3]
CCD841CoN cell proliferation D. and cell cycle distribution E. after cotransfection with the miR-138-5p inhibitor and PD-L1 siRNA or scramble. [score:3]
Targeting PD-L1, possibly by administering miR-138-5p mimics, might be a clinically effective anti-CRC therapeutic strategy. [score:3]
In HCT116 and SW620 cells transfected with miR-138-5p mimics, the number of cells in S phase of the cell cycle decreased and the number in G1 phase increased (P<0.05, Figure 3B & 3D), and this was again rescued by PD-L1 overexpression (P<0.05). [score:3]
When the PD-L1 3′ UTR was attached to the luciferase gene, luciferase activity decreased significantly (P<0.05) in HCT116 and SW620 cells transfected with miR-138-5p mimics, demonstrating that PD-L1 was the target of miR-138-5p (Figure 2C). [score:3]
Correlations between clinicopathological features and miR-138-5p expression in CRC. [score:3]
Two single strands of the target gene 3′ UTR with 7 bases deleted in the miR-138-5p binding site were synthesized as mutant controls. [score:3]
The present study showed that PD-L1 overexpression in CRC cells can rescue them from miR-138-5p -induced cell cycle arrest and reduced proliferation (Figure 3). [score:3]
Immunohistochemical (IHC) (Figure 5C) and western blot analyses (Figure 5D) revealed that PD-L1 expression was lower in tumors derived from SW620-miR-138-5p mice as compared to controls. [score:2]
Luciferase activity assay results verified that PD-L1 was a target of miR-138-5p. [score:2]
A previous study demonstrated that PD-L1 knockdown by siRNA reduced cell proliferation in vitro similarly to miR-138 restoration [33]. [score:2]
Average miR-138-5p expression was approximately 2.3-fold lower in CRC specimens as compared with corresponding adjacent normal tissues (P<0.05, Figure 1B). [score:2]
Each of the luciferase reporter plasmids was cotransfected as indicated (untreated; NC, scramble; miR-138-5p mimic) into HCT116 Ca. [score:1]
SW620 cell proliferation C. and cell cycle distribution D. after cotransfection with miR-138-5p and PD-L1 or control plasmids. [score:1]
Base pairing between miR-138-5p and PD-L1 was predicted by MIRBASE software. [score:1]
Detection of miR-138-5p by ISH in CRC and corresponding adjacent normal tissues D. Tissue samples were cut into serial paraffin sections. [score:1]
A xenograft mo del was used to examine the effects of miR-138-5p on tumor growth in CRC cells in vivo. [score:1]
Correlations between miR-138-5p expression and clinicopathological characteristics were analyzed by Pearson's χ [2] test and Fisher's exact test. [score:1]
Cells were seeded into 24-well plates and 300ng of reporter plasmid, 30ng of renal plasmid and 20nmol of miR-138-5p mimic were cotransfected into cells using Attractene Transfection Reagent. [score:1]
miR-138-5p expression was measured in 21 CRC samples and corresponding adjacent normal tissues by qRT-PCR. [score:1]
However, the functional role and mechanistic action of miR-138-5p in CRC remained largely unclear. [score:1]
Figure 3HCT116 cell proliferation A. and cell cycle distribution B. after cotransfection with miR-138-5p and PD-L1 or control plasmids. [score:1]
PD-L1-stained SW260-LV-miR-138-5p and SW620-LV-control tumors 16 d after transplantation (magnification: ×200) C. PD-L1 detected in tumors via western blotting 16 d after transplantation D. N1–N4 were derived from SW620-LV-control mice and T1–T4 were from SW620-LV-miR-138-5p mice. [score:1]
SW-620 cells were infected with LV-miR138-5p or LV-scramble, and six million cells in 0.2 ml of growth medium were subcutaneously injected into BALB/c nude mice. [score:1]
Our results indicated that miR-138-5p reduced CRC cell proliferation and blocked the G1/S transition (Figure 3). [score:1]
Figure 2Base pairing between miR-138-5p and PD-L1 was predicted by MIRBASE software. [score:1]
“Scramble, miR-138-5p negative control sequence” was the ISH negative control and “NC” was the IHC negative control. [score:1]
We examined the effects of miR-138-5p on CRC cells in vitro and in vivo. [score:1]
HCT116 cell proliferation A. and cell cycle distribution B. after cotransfection with miR-138-5p and PD-L1 or control plasmids. [score:1]
PD-L1 was detected via western blotting in HCT116 and SW620 cells transfected for 48 h with miR-138-5p mimics or NC oligos (miR-138-5p mimics control) Da. [score:1]
We observed an inverse correlation between PD-L1 and miR-138-5p levels in tumor tissues by all methods (Figure 6A–6C). [score:1]
We assessed PD-L1 and miR-138-5p levels in CRC tissues using ISH, IHC and qRT-PCR. [score:1]
Two stable cell lines derived from SW620, SW620-miR-138-5p and SW620-scramble, were established using LV-miR138-5p and LV-scramble, respectively. [score:1]
Oligonucleotide probes complementary to hsa-miR-138-5p (where hsa indicates Homo sapiens) (product 38511-01; Exiqon) and scramble (normal control) were digoxigenin labeled at the 5′ terminal end. [score:1]
Basic information about hsa-miR-138-5p was collected from miRBase (http://microrna. [score:1]
miR-138-5p and PD-L1 levels are negatively correlated in CRC. [score:1]
SW620 cells were infected with LV-miR-138-5p or LV-control, and six million cells in 0.2 ml of growth medium were subcutaneously injected into BALB/c nude mice (four in each group). [score:1]
Importantly, low miR-138-5p (Figure 1D) and high PD-L1 levels (Figure 5D) were correlated with shorter overall CRC patient survival, indicating that miR-138-5p and PD-L1 may serve as CRC biomarkers for risk group assignment, optimal therapy selection and clinical outcome prediction. [score:1]
The predicted miR-138-5p binding site was present in PD-L1 3′ UTRs. [score:1]
SW620-miR-138-5p and SW620-scramble cells were inoculated into mice (four in each group). [score:1]
To clarify the relationship between miR-138-5p and PD-L1, basic information about hsa-miR-138-5p was collected from miRBase. [score:1]
[1 to 20 of 97 sentences]
5
[+] score: 298
Forced expression of p53 downregulated AGO2 expression at the mRNA and protein levels in p53 -deficient H1299 cells, and this downregulation was partially blocked by simultaneous inhibition of miR-138 function using a miR-138 inhibitor at the mRNA level (Fig.   1g). [score:15]
After overexpression of p53 in Hep3B cells, the q-PCR results indicated that the expression levels of miR-138 and GADD45A were upregulated, and the expression levels of AGO2 and miR-130b were downregulated (Supplementary Fig.   S4). [score:13]
While silencing the expression of p53 with siRNA in H460 cells (with p53-wild type background) upregulated AGO2 expression both at the mRNA and protein levels, the upregulation was inhibited by a miR-138 mimic (Fig.   1h). [score:13]
Downregulation of miR-130b promotes the expression of GADD45A in human NSCLC cellsTo determine the biological functions of miR-130b regulation by the p53-miR-138-AGO2 pathway, we inhibited the expression of miR-130b using a miR-138 mimic or AGO2 siRNA in human NSCLC cells. [score:11]
Interestingly, among the top 13 significantly downregulated genes, only the 3′ UTR of HPD, SORBS2 and EIF2C2 (AGO2) were predicted to have target sites for miR-138 using bioinformatics software (miRanda 2010, TargetScan or PicTar), and AGO2 was the only target gene of miR-138 that was predicted by both miRanda and PicTar (Fig.   1b). [score:10]
When miR-138 was overexpressed in H1299 cells, the expression of AGO2 was decreased as expected, and addition of a miR-138 inhibitor (anti-miR-138) restored the AGO2 expression level (Fig.   1f). [score:9]
The main reason that results in the partial restoration at AGO2 mRNA level and undetectable restoration at protein level by the miR-138 inhibitor, as we suspect, was that miR-138 was dramatically increased by over -expression of p53 and exceeded the effective inhibition concentration of exogenous miR-138 inhibitor. [score:9]
Cell proliferation was significantly inhibited by overexpression of GADD45A, which was consistent with the results of p53 overexpression, transfection with the miR-138 mimic and AGO2 siRNA, and treatment with miR-130b inhibitors (Fig.   4i). [score:9]
While miR-138 inhibitor increased AGO2 expression by functional inhibition of endogenous base-level miR-138, the effect is undetectable in p53 over -expression cohorts at protein level (Fig.   1g). [score:9]
Here, for the first time, we demonstrated that miR-138 downregulated AGO2 expression induced by p53, resulting in decreased miR-130b abundance, which increased GADD45A expression. [score:8]
To identify the target genes of miR-138 in human NSCLC cells, two microarrays with total mRNA from H1299 cells (with a p53 -null background) with or without overexpression of miR-138 were analyzed for differential gene expression profiling (GEO: GSE69482) (Fig.   1a). [score:7]
The miRNA target prediction analysis suggested that the AGO2 3′ UTRs of humans, mice and rats have target sites for miR-138 (Supplementary Fig.   S3a) and the GADD45A 3′ UTRs of humans, mice and rats contain the target sites for miR-130b (Supplementary Fig.   S3b). [score:7]
miR-130b inhibitors significantly increased the expression levels of the GADD45A protein in H1299 cells, which was consistent with the results observed when p53 and miR-138 were overexpressed or when AGO2 was reduced (Fig.   4d). [score:7]
After inhibiting the expression of AGO2 with AGO2 siRNA or miR-138 mimic in H1299 cells, actinomycin D was used to inhibit RNA synthesis. [score:7]
The downregulated mRNA level of GADD45A was partially rescued by the miR-138 mimic, AGO2 siRNA, or miR-130b inhibitor in human H460 cells. [score:6]
Forced expression of AGO2 caused a decrease in pre-miR-130b but an increase in miR-130b, while silencing AGO2 expression either with AGO2 siRNA or a regulatory miR138 mimic demonstrated the opposite trend, i. e., an increase in pre-miR-130b but a decrease in miR-130b, with no detectable change in the pri-miR-130b levels (Fig.   2c). [score:6]
To determine the biological functions of miR-130b regulation by the p53-miR-138-AGO2 pathway, we inhibited the expression of miR-130b using a miR-138 mimic or AGO2 siRNA in human NSCLC cells. [score:6]
Li J MiR-138 downregulates miRNA processing in HeLa cells by targeting RMND5A and decreasing Exportin-5 stabilityNucleic Acids Res. [score:6]
Because miR-138 specifically targets AGO2 and we previously confirmed that p53 could activate the expression of miR-138 [23], an experiment to examine p53 regulation of AGO2 was performed. [score:6]
p53 downregulates AGO2 expression by a miR-138 -mediated pathway. [score:6]
Taking into account the results showing that AGO2 regulated miR-130b and the aforementioned p53-miR-138-AGO2 regulatory pathway, we postulated a p53-miR-138-AGO2-miR-130b pathway, which suggested downregulation of miR-130b by p53. [score:6]
We then observed that cell cycle arrest could be reversed by p53 siRNA, a miR-138 inhibitor, or overexpression of AGO2 or miR-130b. [score:5]
These observations are consistent with the results obtained by inhibiting miR-138 activity and overexpressing AGO2 (Fig.   4e). [score:5]
s were performed to test the interaction between miR-138 and the predicted wild-type AGO2 3′ UTR targeting sequence (pGL3-AGO2-Full) and the mutated targeting sequences (pGL3-AGO2-Mut1, pGL3-AGO2-Mut2, and pGL3-AGO2-Mut-all). [score:5]
We observed that miR-138 significantly reduced the luciferase activity of the reporter vectors containing either or both predicted target sites, but had little effect on the control group carrying neither target site (Fig.   1d). [score:5]
These results are consistent with the findings obtained by overexpressing AGO2 and the use of miR-138 inhibitors (anti-miR-138) (Fig.   3f). [score:5]
We also suggested the p53-miR-138-AGO2 pathway as one mechanism underlying the high expression of AGO2 in a variety of highly invasive tumour tissues with silenced or mutant p53 expression, including myeloma, colon cancer, and liver cancer 38– 41. [score:5]
Thus, the results revealed the possibility that miR-138 and miR-130b are involved in the p53 -mediated regulation of the expression levels of GADD45A in human NSCLC cells. [score:4]
To confirm the direct regulation of AGO2 by miR-138, we performed a luciferase reporter assay using a series of luciferase reporter constructs carrying the full length AGO2 mRNA 3′ UTR (879 nt, NM_012154.3) (pGL3-AGO2-Full) with two predicted miRNA-138 target sites (Fig.   1c) or mutants (pGL3-AGO2-Mut1, pGL3-AGO2-Mut2 and pGL3-AGO2-Mut all) in H1299 cells. [score:4]
We thus concluded that miR-138 mediated p53 downregulation of AGO2. [score:4]
The results indicated that miR-138 directly acted on both of the predicted target sites in the AGO2 3′ UTR. [score:4]
Among the 92 genes associated with p53, GADD45A was the differentially expressed gene, both in the miR-138 -treated group and the AGO2 siRNA -treated group (Fig.   4a,b). [score:3]
We also deduced that deviation may exist in the p53-miR-138-AGO2-miR-130b regulation pathway of GADD45A among humans, mice and rats, which may be due to differences in the regulation of miR-138 by p53. [score:3]
We found that miR-138 specifically targeted AGO2, which affected the stability and maturation of miR-130b. [score:3]
H1299 cells were transfected with AGO2 siRNA or miR-138 mimic for 24 h. Cells were co -transfected with an AGO2 expression plasmid (pCMV-AGO2) for complementation analysis. [score:3]
The results supported the notion that miR-138 specifically targeted AGO2 in the tested NSCLC cell lines. [score:3]
miR-138 has a variety of biological functions due to its ability to act on different target genes in various cells and tissues 24– 26. [score:3]
Figure 1AGO2 (EIF2C2) is a miR-138 target in human NSCLC cells. [score:3]
Jin Y Role of microRNA-138 as a potential tumor suppressor in head and neck squamous cell carcinomaInt. [score:3]
miR-138 targets identified using a microarray analysis and bioinformatics in H1299 cells (a, b). [score:3]
These results were consistent with those obtained in H460 and H1299 cells, suggesting that the p53-miR-138-AGO2-miR-130b-GADD45A pathway may be universal in its regulation of human cancer development. [score:3]
p53 signalling pathway gene expression profiles in H1299 cells treated with AGO2 siRNA, miR-138, or negative control were analyzed using a q-PCR array (a, b). [score:3]
We previously found that human miR-138 was a target gene of p53 in human NSCLC cells [23]. [score:3]
However, only the miR-130b inhibitor had such an effect in mouse NIH/3T3 and rat H9C2 cells (Supplementary Fig.   S3c), suggesting that the p53-miR-138-AGO2-miR-130b pathway was absent in mice or rats. [score:3]
Similar results were observed in H1299 cells, i. e., overexpression of p53 significantly reduced the miR-130b content, which is consistent with the effects of the miR-138 mimic and AGO2 siRNA in the cells (Fig.   3g). [score:3]
Further results showed that both the mRNA and protein expression levels of AGO2 were negatively correlated with the endogenous miR-138 level in both the p53 -null cell line H1299 and the p53 wild-type cell line H460 (Fig.   1e). [score:3]
Among the differentially expressed miRNAs (Fig.   2a,b), miR-130b decreased the most significantly both in the AGO2 siRNA group and the miR-138 mimic group. [score:3]
Li J Species-specific mutual regulation of p53 and miR-138 between human, rat and mouseSci. [score:2]
Quantitative RT-PCR assays were performed to examine the effects of AGO2 overexpression, the miR-138 mimic or AGO2 siRNA transfection on miR-130b processing. [score:2]
These results suggested a complex one-way regulatory pathway from p53 to miR-130b via miR-138 and AGO2 in human NSCLC cells. [score:2]
Figure 4p53-miR-138-AGO2-miR-130b pathway regulation of GADD45A in human NSCLC cells. [score:2]
Herein, we conducted a study of the miR-138 regulatory pathway initiated by p53 to broaden our knowledge of the p53 network. [score:2]
Our results revealed that deviation may exist in the p53-miR-138-AGO2-miR-130b regulation pathway of GADD45A among humans, mice and rats. [score:2]
The p53-miR-138-AGO2-miR-130b pathway regulation of GADD45A differs among species. [score:2]
The positions of the miR-138 binding sites correspond to the location of the GenBank accession number NM_001199742. [score:1]
Our previous study indicated that p53 activated miR-138 transcription in human NSCLC cells [23]. [score:1]
Two pairs of miRNA microarrays with total small RNA from H1299 cells treated with AGO2 siRNA or miR-138 mimic and the corresponding control cells were analyzed for miRNA profiling (GEO: GSE69562). [score:1]
A pathway enrichment analysis using miRWalk2.0 database showed that miR-138 was involved in multiple signaling pathway in NSCLC cells (Supplementary Fig.   S1a). [score:1]
The miRNA mimics and siRNA sequences were as follows: miR-138 mimic, 5′-AGCUGGUGUUGUGAAUCAGGCCG-3′ (sense); miR-130b mimic, 5′-CAGUG CAAUGAUGAAAGGGCAU-3′ (sense); p53 siRNA, 5′-UAUGAAUCGUCGUC CUAUUC-3′ (sense); AGO2 siRNA, GCCUGUAUCAAGCUAGAAA; GADD45A siRNA, ACAUCCUGCGCGUCAGCAAC. [score:1]
Decreased AGO2 induced by miR-138 affects miR-130b abundance. [score:1]
AGO2 3′ UTR-containing reporter plasmids with either or both miR-138 mutant binding sites were named pGL3-AGO2-Mut1, pGL3-AGO2-Mut2 and pGL3-AGO2-Mut-all, respectively. [score:1]
H460 cells transfected with p53 siRNA, anti-miR-138, miR-130b, pCMV-AGO2 or control plasmid were treated with or without 2 Gy IR. [score:1]
The artificial mutant 3′ UTR without the miR-138 binding sites is shown in the bottom image. [score:1]
To investigate whether AGO2 could affect the processing of miR-130b, the abundance of pri-miR-130b (primary-miR-130b), pre-miR-130b (precursor-miR-130b), and mature miR-130b were detected using q-PCR in cells with either AGO2 overexpression or AGO2 silencing using AGO2 siRNA or a miR-138 mimic. [score:1]
The wild type (WT) AGO2 3′UTRs with deletion of one or two of the predicted miR-138 binding sites were cloned into pGL3-Control vector and named pGL3-AGO2-Mut1, pGL3-AGO2-Mut2 or pGL3-AGO2-Mut-all. [score:1]
The miRNAs in H1299 cells that were significantly changed in both the miR-138 and AGO2 siRNA groups vs. [score:1]
The positions of miR-138 binding sites correspond to the locations in GenBank accession NM_001164623. [score:1]
As all the aforementioned adopted cells are human NSCLC cells, we also used the human hepatoma cell line Hep3B, with a p53 deletion, to test the existence of the p53-miR-138-AGO2-miR-130b-GADD45A pathway. [score:1]
[1 to 20 of 68 sentences]
6
[+] score: 270
Other miRNAs from this paper: hsa-mir-138-1, hsa-mir-497
To verify our speculation, miR-138 -overexpressing A549 cells were further transfected with YAP1 -overexpressing plasmid, in order to rescue the suppressive effect of miR-138 upregulation on YAP1 expression. [score:12]
Based on the findings in this study, we for the first time suggest that miR-138 inhibits the growth and metastasis of NSCLC cells partly at least via targeting YAP1, suggesting that the miR-138/YAP1 axis may serve as a potential target for the treatment of NSCLC. [score:7]
Moreover, we observed a reverse correlation between the mRNA levels of YAP1 and miR-138 in NSCLC tissues, which further suggests that upregulation of YAP1 may due to the downregulation of miR-138 in NSCLC. [score:7]
MTT assay showed that overexpression of miR-138 significantly inhibited A549 cell proliferation, while knockdown of miR-138 enhanced A549 cell proliferation (Figure 2B), suggesting that miR-138 has a suppressive effect on NSCLC cell growth. [score:7]
Moreover, the cell proliferation capacity was higher in the miR-138+YAP1 group, when compared with that in the miR-138 group, suggesting that overexpression of YAP1 rescued the suppressive effects of miR-138 upregulation on NSCLC cell proliferation. [score:7]
Next, we performed bioinformatic analysis to predicate the putative targets of miR-138, and found that YAP1 might be a target gene of miR-138 and the target site located in the 3′-UTR (Figure 3A). [score:7]
In vitro study showed that overexpression of miR-138 significantly inhibited A549 cell growth, invasion and migration, while knockdown of miR-138 enhanced the growth, invasion and migration of A549 cells. [score:6]
MTT assay showed that the cell proliferation capacity was higher in the miR-138+YAP1 group, when compared with that in the miR-138 group (Figure 4B), suggesting that overexpression of YAP1 rescued the suppressive effects of miR-138 upregulation on NSCLC cell proliferation. [score:6]
Moreover, NSCLC tissues with poor differentiation, advanced stage or lymph nodes metastasis showed significant downregulation of miR-138 expression. [score:6]
Moreover, reduced miR-138 expression was tightly associated with the advanced malignancy of NSCLC, suggesting that its downregulation is involved in the malignant progression of NSCLC. [score:6]
Besides, NSCLC with higher stage or lymph nodes metastasis also showed significant downregulation of miR-138 expression (Supplementary Figure S1B and S1C). [score:6]
Transwell assay and wound healing assay further indicated that overexpression of miR-138 significantly suppressed the invasion and migration of A549 cells, while knockdown of miR-138 enhanced A549 cell invasion and migration (Figure 2C and 2D), suggesting that miR-138 plays an inhibitory role in NSCLC cell metastasis. [score:6]
Figure 2 A. Real-time RT-PCR was conducted to examine the expression levels of miR-138 in NSCLC A549 cells transfected with miR-138 mimic or inhibitor, respectively. [score:5]
Zhang et al. demonstrated that miR-138 inhibited the tumor growth of NSCLC via targeting EZH2 [12]. [score:5]
Therefore, we suggest that miR-138 inhibits the growth of NSCLC cells partly at least via targeting YAP1. [score:5]
Based on these data, we demonstrate that miR-138 negatively regulates the protein expression of YAP1 in A549 cells via directly binding to the 3′-UTR of its mRNA. [score:5]
Moreover, overexpression of YAP1 markedly reversed the inhibitory effect of miR-138 on NSCLC cell proliferation, but had no effect on NSCLC cell migration and invasion. [score:5]
Luciferase reporter assay further confirmed their targeting relationship, and the expression of YAP1 was negatively regulated by miR-138 at the post-transcriptional level in NSCLC cells. [score:5]
As one miR have many target genes [13], whether other target genes of miR-138 exist in NSCLC still remains to be studied. [score:5]
Overexpression of miR-138 induced radiosensitization in lung cancer cells via targeting SENP1 [11]. [score:5]
YAP1 -overexpressing plasmid (Amspring, Changsha, Hunan, China), scramble miR (Amspring), miR-138 mimic (Amspring) and miR-138 inhibitor (Amspring) were diluted with serum-free DMEM, respectively. [score:5]
The diluted Lipofectamine 2000 was then added into the diluted YAP1 -overexpressing plasmid, miR-138 mimic, or miR-138 inhibitor. [score:5]
For example, Yang et al. showed that miR-138 could inhibit lung cancer cell proliferation and colony formation, and was associated with radio-sensitization by targeting Sentrin/SUMO-specific protease 1 [11]. [score:5]
These findings suggest that miR-138 acts as a tumor suppressor in inhibiting NSCLC growth and metastasis. [score:5]
Zhang et al. reported that miR-138 was downregulated in NSCLC cell lines and some clinical samples [12]. [score:4]
These data suggest that downregulation of miR-138 may contribute to the malignant progression of NSCLC. [score:4]
As demonstrated in Figure 2A, cells transfected with miR-138 mimic showed a significant increase in miR-138 level, while transfection of miR-138 inhibitor remarkably suppressed the miR-138 level, compared to the control group. [score:4]
These data indicated that miR-138 is downregulated in NSCLC. [score:4]
YAP1 is a direct target of miR-138 in NSCLC A549 cells. [score:4]
YAP1 is upregulated in NSCLC, reversely correlated with the miR-138 levels. [score:4]
A549 cells were transfected with miR-138 mimic or inhibitor, then miR-138 level was examined using real-time RT-PCR. [score:3]
The protein level of YAP1 was then examined in A549 cells transfected with miR-138 mimic or inhibitor. [score:3]
Finally, we observed a significant upregulation of YAP1 in NSCLC tissues compared to their matched normal tissues, as well as a reverse correlation between YAP1 and miR-138 levels in NSCLC tissues. [score:3]
Figure 4 A. Western blot was conducted to examine the protein levels of YAP1 in A549 cell transfected with miR-138 mimic (miR-138), or co -transfected with miR-138 mimic and YAP1 overexpression plasmid (miR-138+YAP1). [score:3]
As shown in Figure 1C, miR-138 was significantly downregulated in NSCLC cell lines compared to BEAS-2B cells. [score:3]
As shown in Figure 3C, the luciferase activity was significantly downregulated only in NSCLC A549 cells co -transfected with miR-138 mimic and wild type of YAP1 3′UTR; however, it was unchanged in other groups compared to the control group. [score:3]
MiR-138 is downregulated in NSCLC tissues and cell lines. [score:3]
Our study expands the understanding of the regulatory mechanism of miR-138 in the regulation of cancer cell proliferation. [score:3]
As indicated in Figure 1A, most NSCLC showed a decrease in miR-138 expression. [score:3]
Among these miRs, miR-138 generally acts as a tumor suppressor in different cancer types, such as ovarian cancer [7], glioblastoma [8], squamous cell carcinoma [9], head and neck squamous cell carcinoma [10], as well as NSCLC [11]. [score:3]
We observed that miR-138 could inhibit the proliferation, invasion and migration of NSCLC A549 cells. [score:3]
However, as indicated in Figure 4C and 4D, there was no significant difference in cell invasion and migration between the miR-138+YAP1 group and the miR-138 group, suggesting that the suppressive effects of miR-138 on NSCLC cell metastasis was independent with YAP1. [score:3]
These data indicate that YAP1 is a target gene of miR-138 in NSCLC cells. [score:3]
Quantitative real-time PCR was used to examine the relative miR-138 expression using mirVana™ real-time RT-PCR microRNA detection kit (Life Technologies), in accordance with the manufacturer's instruction. [score:3]
D. Western blot was conducted to examine the protein levels of YAP1 in A549 cell transfected with miR-138 mimic or inhibitor, respectively. [score:3]
Furthermore, YAP1 was identified as a target gene of miR-138. [score:3]
As shown in Figure 3D, the protein level of YAP1 was significantly reduced in miR-138 -overexpressing A549 cells, but markedly increased after knockdown of miR-138, compared to the control group. [score:3]
In the present study, we aimed to explore the expression levels of miR-138 and its clinical significance in NSCLC. [score:3]
To further confirm this result, we examined the effects of miR-138 on YAP1 expression in NSCLC A549 cells. [score:3]
Figure 1 A. and B. Real-time RT-PCR was conducted to examine the expression levels of miR-138 in 21 cases of NSCLC and their matched adjacent non-tumor tissues (Adjacent). [score:3]
In the present study, bioinformatical analysis predicated that YAP1 was a putative target of miR-138. [score:3]
Owing to its lowest expression of miR-138 among four NSCLC cell lines (Figure 1C), A549 cell line was selected in later study [14]. [score:3]
In the present study, our data showed that the expression level of miR-138 was frequently and significantly reduced in lung cancer cells and tissues. [score:3]
Figure 3 A. Bioinformatical predication showed that YAP1 was a putative target gene of miR-138. [score:3]
C. Real-time RT-PCR was conducted to examine the expression levels of miR-138 in four common human NSCLC cell lines, A549, SK-MES-1, H460, and SPC-A1, as well as in a normal human lung epithelial cell line BEAS-2B. [score:3]
MiR-138 has been reported to plays a suppressive or promoting role in different human cancers [10, 15, 16]. [score:2]
Therefore, the miR-138/YAP1 axis may play a common role in regulating the tumor growth in different types of human malignancies. [score:2]
In the present study, we found that the miR-138 expression level was significantly decreased in NSCLC tissues compared to their matched adjacent normal tissues. [score:2]
Statistical analysis showed that miR-138 expression level was significantly reduced in NSCLC tissues compared to their matched adjacent non-tumor tissues (Figure 1B). [score:2]
MiR-138 shows suppressive effects on NSCLC cell growth and metastasis. [score:2]
These findings suggest that YAP1 acts as a downstream effecter of miR-138 in the regulation of NSCLC growth, but may have no affect on NSCLC metastasis. [score:2]
Moreover, we found that the expression of miR-138 was significantly lower in poor differentiated NSCLC tissues compared to well/moderate differentiated NSCLC tissues (Supplementary Figure S1A). [score:2]
miR-138. [score:1]
In summary, we suggest that YAP1 is involved in miR-138 -mediated NSCLC cell growth but not metastasis. [score:1]
On account of the small sample size, we detected miR-138 expression in another independent population and several lung cancer cell lines, and investigated the clinical significance of miR-138. [score:1]
However, we found no difference of cell invasion and migration capacities between miR-138+YAP1 group and miR-138 group. [score:1]
A549 cells were cultured to approximately 70% confluence, and co -transfected with wildtype YAP1-3′UTR or mutant YAP1-3′UTR plasmid (100 ng), and scramble miR or miR-138 mimic (50 nM), using Lipofectamine 2000. [score:1]
To study the role of miR-138 in NSCLC, we examined the miR-138 levels in 21 cases of NSCLC tissues and their matched adjacent non-tumor tissues. [score:1]
We also studied the molecular mechanism by which miR-138 mediated the growth and metastasis of NSCLC cells involving YAP1. [score:1]
We further determined the miR-138 levels in four common human NSCLC cell lines, SK-MES-1, A549, H460, and SPC-A1, as well as in a normal human lung epithelial cell line BEAS-2B. [score:1]
Based on the above data, we speculated that YAP1 might be involved in miR-138 -mediated NSCLC cell growth and metastasis. [score:1]
Accordingly, miR-138 may become a biomarker for NSCLC. [score:1]
YAP1 is involved in miR-138 -mediated NSCLC cell growth but not in metastasis. [score:1]
C. The mRNA level of YAP1 was reversely correlated with the miR-138 levels in NSCLC tissues. [score:1]
Future studies should focus on the role of Hippo signaling pathway downstream the miR-138/YAP1 axis in NSCLC as well as in other cancer types. [score:1]
C. A549 cells were co -transfected with wildtype or mutant YAP2 3′-UTR constructs and miR-138 mimic, or scramble miR mimic. [score:1]
[1 to 20 of 76 sentences]
7
[+] score: 258
Other miRNAs from this paper: hsa-mir-138-1
Our results showed that overexpression of miR-138 significantly suppressed PDK1 expression through directly targetting 3′-UTR of PDK1 mRNA, resulting in a metabolic switch from the hypoxia -induced glycolysis to mitochondrial respiration. [score:10]
Moreover, AC16 cells with transfection of miR-138 inhibitor showed up-regulated PDK1 expression compared with control inhibitor transfection (Supplementary Figure 5 and  Figure 3C). [score:9]
In conclusion, we illustrated that overexpression of miR-138 inhibits the hypoxia -induced cardiac cells death via suppression of the dysregulated glycolysis and recovery of mitochondrial respiration. [score:8]
Figure 3 MiR-138 directly targets PDK1(A) Target prediction from TargetScan. [score:7]
Our results from showed overexpression of miR-138 suppressed PDK1 expression in AC16 cells (Figure 3B). [score:7]
Figure 6Overexpression of miR-138 protects cardiac cells against hypoxia through targetting PDK1(A) AC16 cells were transfected with control mimic, control mimic plus PDK1, miR-138 mimic alone, or cotransfection of miR-138 and PDK1 for 48 h. analysis of PDK1 protein expression. [score:7]
They reported expression of exogenous miR-138 suppressed the PASMC apoptosis and prevented caspase activation through targetting serine/threonine kinase (Mst1). [score:7]
To verify whether the miR-138 -mediated anti-apoptotic effects under hypoxia were through the modulation of glucose metabolism, we overexpressed PDK1 in miR-138 overexpressing AC16 cells by cotransfection of control vector or PDK1 overexpression vector with miR-138 (Figure 6A). [score:7]
Overexpression of miR-138 increases the cardiac cells’ viability through targetting PDK1 under hypoxiaOur results demonstrate overexpression of miR-138 contributed to the AC16 cell survival under hypoxia (Figure 1C). [score:7]
As we expected, restoration of PDK1 in miR-138 overexpressing cells resensitized cells to low oxygen (Figure 6G), indicating that the miR-138 -mediated anti-apoptotic effects under hypoxia was through directly targetting PDK1. [score:6]
PDK1 is a direct target of miR-138To elucidate the underlying molecular mechanisms for the metabolic switch driven by miR-138, we performed a bioinformatics analysis using three softwares: TargetScan, microrna. [score:6]
All these findings suggested that miR-138 inhibited PDK1 protein expression by direct binding to its 3′-UTR. [score:6]
Expression of miR-138 was found to be down-regulated in a time -dependent manner and decreased by 5.2-fold at 72-h exposure to hypoxia (Figure 1A). [score:6]
Overexpression of miR-138 increases the cardiac cells’ viability through targetting PDK1 under hypoxia. [score:5]
In addition, we observed a significant negative correlation between PDK1 mRNA expressions and endogenous miR-138 levels in ICD patient samples, indicating that miR-138 could target PDK1 in vivo (Figure 3G). [score:5]
To test whether miR-138 changes in cardiomyocytes during ischemia in vivo, we analyzed the expressions of miR-138 from 15 noncardiac ischemia patients and 15 ischemia cardiac disease (ICD) patients. [score:5]
Given that miR-138 inhibited glycolysis and promoted mitochondrial respiration (Figure 2), it was strongly supported that PDK1 may be targetted by miR-138. [score:5]
Moreover, glycolysis key enzymes, Glut1 and LDHA were found to be suppressed by miR-138 (Figure 2D), suggesting that miR-138 targets the hypoxia-modulated cellular glycolysis in AC16 cells. [score:5]
AC16 cells with miR-138 transfection significantly suppressed PDK1 expression under both normoxia and hypoxia conditions (Figure 3F). [score:5]
Moreover, miR-138 was significantly suppressed by hypoxia at 48, 72, and 96 h, suggesting that targetting miR-138 might contribute to the prevention of the myocardial infarction mediated heart failure because hypoxia may persist within the infarct for days or weeks, exacerbating the injury. [score:5]
We observed that the glucose uptake (Figure 2A), lactate product (Figure 2B), and ECAR (Figure 2C) were significantly inhibited by miR-138 overexpression. [score:5]
Overexpression of miR-138 protects cardiac cells against hypoxia through targetting PDK1. [score:5]
Figure 1 MiR-138 is down-regulated by long-time hypoxia and negatively correlated with ICD(A) Human cardiac cells AC16 were treated with normoxia or hypoxia (1% oxygen) for 8, 16, 24, 48, 72, or 96 h, followed by the measurements of miR-138 expressions by qRT-PCR. [score:4]
Interestingly, previous studies reported that miR-138 expression was induced in hypoxic cardiomyocytes and regulated the hypoxia -induced cell apoptosis [19]. [score:4]
We report that miR-138 directly targets PDK1, an enzyme which promotes glycolysis. [score:4]
Consistently, luciferase activity was significantly increased in miR-138 inhibitor and wild-type 3′-UTR cotransfection cells compared with that of the control inhibitor and wild-type 3′-UTR cotransfection (Figure 3E). [score:4]
PDK1 is a direct target of miR-138. [score:4]
To test whether PDK1 is a direct target of miR-138, we cloned the wild-type or binding site mutant 3′-UTR of PDK1 (Figure 3A) into pmiR-report vector and cotransfected miR-138 mimics or negative control with vectors in 293T and AC16 cells. [score:4]
Figure 2 MiR-138 suppresses glycolysis and promotes mitochondrial respiration of cardiac cellsAC16 cells were transfected with control mimic or miR-138 mimic at 50 nM for 48 h, then (A) glucose uptake, (B) lactate product, and (C) ECAR were analyzed. [score:3]
To investigate whether miR-138 could target PDK1 under hypoxia, we treated AC16 cells without or with miR-138 overexpression with hypoxia. [score:3]
Overexpression of miR-138 promoted glucose uptake and lactate product (Figure 6B,C), decreased oxygen consumption, mitochondrial complex activity, and intracellular ATP (Figure 6D–F). [score:3]
The above results demonstrated roles of miR-138 in regulating cellular metabolism under hypoxia, we next assessed whether the hypoxia -induced miR-138 led to decreased viability of cardiac cells through regulation of glucose metabolism. [score:3]
org, and Exiqon to predict the putative miR-138 target genes. [score:3]
Our results demonstrate overexpression of miR-138 contributed to the AC16 cell survival under hypoxia (Figure 1C). [score:3]
MiR-138 inhibits glycolysis and promotes mitochondrial respirationPrevious studies demonstrated the cellular glycolysis and mitochondrial respiration were regulated by hypoxia, contributing to cell survival with low oxygen supply [10, 11]. [score:3]
Consistently, the oxygen consumption rate (Figure 6D), mitochondrial respiration (Figure 6E), and intracellular ATP (Figure 6F) were decreased by PDK1 restoration in miR-138 overexpressing cells. [score:3]
Moreover, at 48, 72, and 96 h, we detected that miR-138 was significantly suppressed under hypoxia (Figure 1A), suggesting that miR-138 may be involved in the cellular adaptation processes in response to oxygen supply. [score:3]
To analyze the potential roles of miR-138 in cardiac cells, we overexpressed miR-138 in AC16 cells by transfection with miR-138 mimics or control miRNAs (Supplementary Figure S1). [score:3]
Previous study demonstrated that overexpression of miR-138 significantly benefited cardiomyocytes from hypoxia -induced cell apoptosis [19]. [score:3]
Taken together, these results suggest that miR-138 inhibits glycolysis but promotes mitochondrial respiration in human cardiac cells. [score:3]
MiR-138 is down-regulated by long-time hypoxia and negatively correlated with ICD. [score:3]
U6 was used as an internal control for miR-138 expression. [score:3]
To elucidate the underlying molecular mechanisms for the metabolic switch driven by miR-138, we performed a bioinformatics analysis using three softwares: TargetScan, microrna. [score:3]
results in Figure 6A demonstrated transfection of PKD1 into miR-138 overexpressing cells could efficiently restore the original protein levels of PDK1. [score:3]
Expressions of miR-138 in cardiac cells are modulated by hypoxia. [score:3]
MiR-138 has been reported as one of the miRNAs that functions in heart diseases [18]. [score:3]
First, we detected expressions of several miRNAs under hypoxia in human cardiac cell line AC16, of which miR-138 was one of the most sensitive miRNAs to hypoxia (results not shown). [score:3]
MiR-138 directly targets PDK1. [score:3]
Consistent with in vitro results, we found expressions of miR-138 were significantly decreased in cardiac tissues of ICD patients (Figure 1C), suggesting that miR-138 plays important functions in human ICD. [score:3]
The miR-138 mimics, miR-138 inhibitor, and negative control miRNAs were purchased from manufacturer GenePharma (Shanghai, China). [score:3]
Consistently, we detected the activities of complexes I, II, III, IV, and V from mitochondrial respiration chain that were significantly decreased by overexpressing miR-138 (Figure 2F). [score:3]
As we expected, overexpression of miR-138 contributed to the AC16 cell survival under hypoxic condition at 72 and 96 h (Figure 1B). [score:3]
MiR-138 inhibits glycolysis and promotes mitochondrial respiration. [score:2]
According to previous report, cells experienced metabolic switch from mitochondrial respiration to glycolysis under hypoxia, we therefore hypothesized that the mitochondrial respiration of human cardiac cells was regulated by miR-138 [10, 11]. [score:2]
In the present study, we will study the roles of miR-138 in regulating cardiac cells death during hypoxia. [score:2]
MiR-138 suppresses glycolysis and promotes mitochondrial respiration of cardiac cells. [score:2]
The 3′-UTR region of PDK1 contains binding sites for miR-138. [score:1]
Plasmid DNA and miR-138 mimics or control miRNAs were cotransfected into 293T or AC16 cells using Lipofectamine 2000 (Invitrogen Inc. [score:1]
Relative expression levels of miR-138 were calculated using the 2−ΔΔ C [t] method. [score:1]
Consistently, qRT-PCR analysis revealed that miR-138 was slightly induced under hypoxic conditions (1% oxygen concentration) at 8, 16, and 24 h (Figure 1A). [score:1]
Importantly, the luciferase activity was not reduced in miR-138 and binding site mutant 3′-UTR cotransfection cells (Figure 3D). [score:1]
qRT-PCR analysis revealed that miR-138 was slightly induced under hypoxic conditions at early time point, suggesting miR-138 may be involved in the cellular adaptation processes in response to oxygen supply. [score:1]
To confirm this prediction, we transfected miR-138 mimics or control mimics into AC16 cells, then measured the protein expression of PDK1. [score:1]
Expressions of miR-138 in cardiac cells are modulated by hypoxiaWe investigated the roles of miR-138 in cardiac cells under hypoxia. [score:1]
The 3′-UTR of PDK1 harboring either the wild-type miR-138 -binding site or a mutant miR-138 -binding site was cloned into the psiCHECK-2 vector (Promega, U. S. A. ) immediately downstream of the stop codon of the luciferase gene to generate the psiCHECK-PDK1-3′-UTR luciferase reporter plasmid. [score:1]
AC16 cells were transfected with control mimic or miR-138 mimic at 50 nM for 48 h, then (A) glucose uptake, (B) lactate product, and (C) ECAR were analyzed. [score:1]
Moreover, the miR-138 -binding sites on 3′-UTR of PDK1 is conserved in multiple species (Supplementary Figures S3 and S4). [score:1]
However, the mechanisms underlying that miR-138 protects cardiomyocytes from hypoxia -induced apoptosis were not completely understood. [score:1]
Recent studies demonstrated similar functions of miR-138 in pulmonary artery smooth muscle cells (PASMCs) during hypoxia as our observations [21]. [score:1]
This metabolic switch contributes to protect cardiac cells from hypoxia, presenting local delivery of miR-138 as an approach against cardiac cells dysfunction during surgery or ischemia. [score:1]
Taken together, these results demonstrated that miR-138 protects cardiac cells after long hypoxic exposure time. [score:1]
the oxygen consumption of AC16 cells was significantly decreased with the increase of miR-138 (Figure 2E). [score:1]
[1 to 20 of 72 sentences]
8
[+] score: 244
Overexpressed hsa-miR-138-2-3p played a key role in many anti-cancer biological processes in human laryngeal CSCs: (1) it decreased laryngeal CSCs proliferation and invasion in response to radiotherapy; (2) it increased the proportion of early and late apoptosis in laryngeal CSCs after radiation, raised G1 phase arrest in laryngeal CSCs after radiation, and decreased the proportion of S stage cells of cell cycle that were related to radio-resistance in laryngeal CSCs; (3) it down-regulated the expression of β-catenin in Wnt signal pathway that was related to the tolerance of laryngeal CSCs to radiotherapy; (4) it down-regulated the expression of YAP1 in Hippo signal pathway that regulated cell proliferation, invasion and apoptosis; (5) it up-regulated the expression of p38 and JNK1 in MAPK signal pathway that was concerned to radio-sensitivity. [score:19]
Over -expression of hsa-miR-138-2-3p down-regulated the expression of β-catenin and YAP1 in the laryngeal CSCs after radiation, further inhibited Wnt/ β-catenin and Hippo/YAP1 signal pathways to weaken radio-resistance in laryngeal CSCs. [score:10]
Based on the predicted genes and pathways of miRNA target, the expression profile of hsa-miR-138-2-3p that was down-regulated significantly after radiation was thought to play an important role in regulation of radio-sensitivity in laryngeal squamous CSCs. [score:9]
3233/fig-13 Figure 13Overexpressed hsa-miR-138-2-3p down-regulated expression of β-catenin. [score:8]
Overexpressed hsa-miR-138-2-3p down-regulated expression of β-catenin. [score:8]
Overexpressed hsa-miR-138-2-3p up-regulated expression of JNK1 and p38. [score:8]
According to the predicted genes and pathways of differential miRNAs target, down-regulated expression of hsa-miR-138-2-3p under radiation was thought to play a key role in enhancing the radio-sensitivity in human laryngeal squamous cancer stem cells. [score:8]
Overexpressed hsa-miR-138-2-3p down-regulated expression of YAP1. [score:8]
It suggested that overexpression of hsa-miR-138-2-3p reduced the expression of β-catenin, further inhibited the activity of Wnt/ β-catenin pathway and reduced the resistance of the laryngeal CSCs to radiation. [score:7]
The present study showed that overexpression of hsa-miR-138-2-3p reduced the expressions of β-catenin and YAP1 in the laryngeal CSCs after radiation, further inhibited Wnt/ β-catenin and Hippo/YAP1 signal pathways to weaken radio-resistance in laryngeal CSCs. [score:7]
Overexpressed hsa-miR-138-2-3p inhibited Hippo/YAP1 pathway. [score:5]
Overexpressed hsa-miR-138-2-3p inhibit cell proliferation after radiation. [score:5]
3233/fig-14 Figure 14Overexpressed hsa-miR-138-2-3p inhibited Wnt/ β-catenin pathway. [score:5]
Overexpressed hsa-miR-138-2-3p inhibited cell invasion after radiation. [score:5]
Overexpressed hsa-miR-138-2-3p inhibited laryngeal CSCs invasion. [score:5]
Overexpressed hsa-miR-138-2-3p inhibited Wnt/ β-catenin pathway. [score:5]
Overexpressed hsa-miR-138-2-3p inhibited Wnt/ β-catenin pathwayIt was known that accumulation of β-catenin leaded to abnormal activation of Wnt/ β-catenin signaling pathway and reinforce radiation resistance. [score:5]
Overexpressed hsa-miR-138-2-3p inhibited cell proliferation after radiation. [score:5]
It suggested that overexpression of hsa-miR-138-2-3p reduced the expression of YAP1, further controlling Hippo signal pathway to weaken radio-resistance in laryngeal CSCs. [score:5]
It suggested that overexpression of hsa-miR-138-2-3p promoted the expression of JNK1 and p38, further activating JNK1/p38/MAPK signal pathway to increase radio-sensitivity in laryngeal CSCs. [score:5]
The present research indicated that overexpressed hsa-miR-138-2-3p play key role in decreasing laryngeal CSCs proliferation and invasion; increasing the proportion of early and late apoptosis in laryngeal CSCs; raising G1 phase arrest; and down -regulating the proportion of S stage cells of cell cycle that were related to radio-resistance in laryngeal CSCs. [score:4]
Overexpressed hsa-miR-138-2-3p regulated signal transduction pathway of laryngeal CSCs after radiation. [score:4]
Overexpressed hsa-miR-138-2-3p inhibited cell invasion by Transwell assay. [score:4]
In our present study, overexpressed hsa-miR-138-2-3p played an key role in decreasing laryngeal CSCs proliferation and invasion; increasing the proportion of early and late apoptosis in laryngeal CSCs; raising G1 phase arrest; and down -regulating the proportion of S stage cells of cell cycle that were related to radio-resistance in laryngeal CSCs. [score:4]
Based on our previous study (Huang et al., 2013), we applied Targetscan and Miranda to investigate target genes of hsa-miR-138-2-3p, such as MAP3K11, CASP3 and HIF1AN, Which were involved in cell apoptosis, radio-sensitivity, and cell cycle arrest (Table 1). [score:3]
Furthermore, we explored the signal transduction pathways that were involved in cell initiation, development, invasion, apoptosis and cell cycle arrest, which were regulated by hsa-miR-138-2-3p. [score:3]
Overexpressed hsa-miR-138-2-3p induced cell apoptosis after radiation by flow cytometry. [score:3]
Overexpressed hsa-miR-138-2-3p reduced survival fraction after radiation. [score:3]
Overexpressed hsa-miR-138-2-3p was involved in various biological process to enhance the radiosensitivity of laryngeal CSCs. [score:3]
Overexpressed hsa-miR-138-2-3p arrested cell cycle at G1/S phase after radiation. [score:3]
These results will be useful for a better understanding of the cell biology of hsa-miR-138-2-3p in laryngeal CSCs, and for serving hsa-miR-138-2-3p as a promising biomarker and as a target for diagnosis and for novel anti-cancer therapies for laryngeal cancers. [score:3]
These results are useful for a better understanding of hsa-miR-138-2-3p in laryngeal CSCs, and prove hsa-miR-138-2-3p as a promising biomarker and as a target for diagnosis and for novel anti-cancer therapies for laryngeal cancers. [score:3]
Overexpressed hsa-miR-138-2-3p activated JNK1/p38/MAPK pathway. [score:3]
Overexpressed hsa-miR-138-2-3p activated JNK1/MAPK pathway. [score:3]
Overexpressed hsa-miR-138-2-3p activated p38/MAPK pathway. [score:3]
Furthermore, we explored the signal transduction pathways that regulated the cancer stem cell initiation, development, invasion, apoptosis and cell cycle arrest, which were controlled by hsa-miR-138-2-3p. [score:3]
These results will be useful for a better understanding of cell biology of hsa-miR-138-2-3p in laryngeal CSCs, and serve hsa-miR-138-2-3p as a promising biomarker and target for diagnosis and for novel anti-cancer therapies for laryngeal cancers. [score:3]
Overexpressed hsa-miR-138-2-3p induced cell apoptosis after radiation. [score:3]
We found that hsa-miR-138-2-3p played a key role in inhibiting laryngeal CSCs invasion. [score:3]
Target genes of hsa-miR-138-2-3p. [score:3]
Overexpressed hsa-miR-138-2-3p induced cell cycle arrest after radiation. [score:3]
Hsa-miR-138-2-3p targets prediction. [score:3]
Overexpressed hsa-miR-138-2-3p promoted DNA damage after radiation. [score:3]
Overexpressed hsa-miR-138-2-3p arrested cell cycle at G1/S phase after radiation by flow cytometry. [score:3]
Overexpressed hsa-miR-138-2-3p promoted DNA damage after radiation by Comet assay. [score:2]
In the present study, it was found that hsa-miR-138-2-3p regulated the Wnt/β-catenin pathways, the Hippo/YAP1 pathways, and the MAPK/p38/JNK1 pathways that were involved in cell proliferation, invasion, apoptosis, cell cycle arrest, radio-resistance and radio-sensitivity in laryngeal CSCs. [score:2]
Oligonucleotides Sequence hsa-miR-138-2-3p mimics 5′- GCUAUUUCACGACACCAGGGUU - 3′ nonsense oligonucleotides 5′-AAGGCAAGCUGACCCUGAAGU-3′  3′-UUCAGGGUCAGCUUGCCUUUU- 5′ Fluorescein FAM tag  oligonucleotides 5′-UUCUCCGAACGUGUCACGUTT-3′  3′- ACGUGACACGUUCGGAGAATT- 5′ The cell proliferation rates of each team at 0, 24, 48 and 72 h after radiation were shown in Fig. 2. From Fig. 2A, we can infer that at 48 h after radiation, the cell proliferation rate of 50nM-TR, 100nM-TR, and 150nM-TR were lower than 100nMN-CR and PBS-CR. [score:1]
So far, however, there is no report on the relationship between hsa-miR-138-2-3p and radiation sensitivity of laryngeal cancer. [score:1]
The percentage of M2e, and TU212 CSCs induced by transfection of 100nM hsa-miR-138-2-3p in G2 phase were more than that induced by transfection of 100nM nonsense oligonucleotides, respectively after radiation, but the percentage of Hep-2 CSCs induced by transfection of 100nM hsa-miR-138-2-3p in G2 phase was the same as that induced by transfection of 100nM nonsense oligonucleotides after radiation. [score:1]
The percentage of M2e, and TU212 CSCs induced by transfection of 100nM hsa-miR-138-2-3p in G2 phase (8%, 8%) were more than that induced by transfection of 100nM nonsense oligonucleotides (5.85%, 2.81%), respectively, after radiation, but the percentage of Hep-2 CSCs induced by transfection of 100nM hsa-miR-138-2-3p in G2 phase (8%) was the same as that induced by transfection of 100nM nonsense oligonucleotides (8%) after radiation. [score:1]
While, the percentage of Hep-2, M2e, and TU212 CSCs induced by transfection of 100nM hsa-miR-138-2-3p in S phase were less than that induced by transfection of 100nM nonsense oligonucleotides, respectively after radiation. [score:1]
The transfection efficiency of hsa-miR-138-2-3p mimics and nonsense oligonucleotides were evaluated by the positive expression of negative control FAM oligonucleotides by flow cyometry. [score:1]
As shown in Figs. 6 and 7, the percentage of Hep-2, M2e, and TU212 CSCs induced by transfection of 100nM hsa-miR-138-2-3p in G1 phase (68.68%, 65.95%, 65.24%) were more than that induced by transfection of 100nM nonsense oligonucleotides (55.44%, 56.90%, 59.23%), respectively, after radiation, while the percentage of Hep-2, M2e, and TU212 CSCs induced by transfection of 100nM hsa-miR-138-2-3p in S phase (23.32%, 26.05%, 26.76%) were less than that induced by transfection of 100nM nonsense oligonucleotides (36.56%, 37.25%, 37.96%), respectively, after radiation. [score:1]
We found that the proportion of early apoptosis and late apoptosis of Hep-2, M2e, and TU212 CSCs induced by transfection of hsa-miR-138-2-3p were larger than that induced by transfection of nonsense oligonucleotides, the differences between them were statistically significant (P < 0.001)(Figs. 3 and 4). [score:1]
Hsa-miR-138-2-3p was selected to transfected into the laryngeal CSCs. [score:1]
The percentage of Hep-2, M2e, and TU212 CSCs induced by transfection of 100nM hsa-miR-138-2-3p in G1 phase (68.68%, 65.95%, 65.24%) were more than that induced by transfection of 100nM nonsense oligonucleotides (55.44%, 56.90%, 59.23%), respectively after radiation. [score:1]
Hsa-miR-138-2-3p mimics, nonsense oligonucleotides, and negative control FAM oligonucleotides with fluorescence were synthesized in vitro (Invitrogen, Shanghai, China). [score:1]
The proportion of Hep-2, M2e, and TU212 CSCs induced by transfection of 100nM hsa-miR-138-2-3p in G1 phase were higher than that induced by transfection of 100nM nonsense oligonucleotides, respectively after radiation. [score:1]
The transfection efficiency of Hep-2, M2e, and TU212 cell lines were 82.9%, 91.5% and 90.5%, respectively, and it was indicated that hsa-miR-138-2-3p and nonsense oligonucleotides were successfully transfected into the laryngeal CSCs with high efficiency. [score:1]
While, the percentage of Hep-2, M2e, and TU212 CSCs induced by transfection of 100nM hsa-miR-138-2-3p in S phase (23.32%, 26.05%, 26.76%) were less than that induced by transfection of 100nM nonsense oligonucleotides (36.56%, 37.25%, 37.96%), respectively, after radiation. [score:1]
The percentage of M2e, and TU212 CSCs induced by transfection of 100nM hsa-miR-138-2-3p in G2 phase (8%, 8%) were higher than that induced by transfection of 100nM nonsense oligonucleotides (5.85%, 2.81%), respectively, after radiation, but the percentage of Hep-2 CSCs induced by transfection of 100nM hsa-miR-138-2-3p in G2 phase (8%) was the same as that induced by transfection of 100nM nonsense oligonucleotides (8%) after radiation. [score:1]
Oligonucleotides Sequence hsa-miR-138-2-3p mimics 5′- GCUAUUUCACGACACCAGGGUU - 3′ nonsense oligonucleotides 5′-AAGGCAAGCUGACCCUGAAGU-3′  3′-UUCAGGGUCAGCUUGCCUUUU- 5′ Fluorescein FAM tag  oligonucleotides 5′-UUCUCCGAACGUGUCACGUTT-3′  3′- ACGUGACACGUUCGGAGAATT- 5′ (A–C) show the transfection efficiency of FAM-CR teams of Hep-2, M2e, and TU212 cell line, respectively, and the percentages of FAM -positive cells (represented by “P2”) were identified by flow cytometry. [score:1]
We found that the cell numbers of early apoptosis and late apoptosis of Hep-2, M2e, and TU212 CSCs induced by transfection of 100nM hsa-miR-138-2-3p were larger than that induced by transfection of 100nM nonsense oligonucleotides, respectively, after radiation, the differences between them were statistically significant (*** P < 0.001). [score:1]
Laryngeal CSCs (2X10E5 cells/ well) were plated in 12-well culture plates, and were transfected equal volume with gradient concentrations of hsa-miR-138-2-3p mimics (conc: 50 nM, 100 nM, 150 nM). [score:1]
However, the role of hsa-miR-138-2-3p in laryngeal CSCs has not been not reported before. [score:1]
In the present study, we synthesized hsa-miR-138-2-3p in vitro and transfected it into three types of laryngeal CSCs (Hep-2, M2e, TU212) to make hsa-miR-138-2-3p overexpressed, and evaluated the tumorous specialities of CSCs, such as cell proliferation, invasion, apoptosis, cell cycle arrest, and DNA damage. [score:1]
Nonsense oligonucleotides (conc: 100 nM), negative control FAM oligonucleotides (conc: 100 nM), and PBS buffer with the same volume as hsa-miR-138-2-3p were transfected into laryngeal CSCs. [score:1]
As shown in Fig. 1, the transfection efficiency of Hep-2, M2e, and TU212 cell lines were 82.9%, 91.5% and 90.5%, respectively, and it was indicated that hsa-miR-138-2-3p and nonsense oligonucleotides were successfully transfected into the laryngeal CSCs with high efficiency. [score:1]
[1 to 20 of 68 sentences]
9
[+] score: 234
In conclusion, miR-346 -mediated upregulation and miR-138 -mediated downregulation competitively coordinate the regulation of hTERT expression by binding to a common site in the hTERT 3′UTR, which promotes the growth of human cervical cancer cells. [score:10]
Surprisingly, the miR-138/346-loop mimics upregulated hTERT expression compared to the downregulation observed in the presence of miR-138, and miR-138/miR-346-loop mut mimics abrogated the promotion of hTERT expression induced by the miR-138/346-loop mimics. [score:10]
We also demonstrated that miR-138 targets the hTERT 3′UTR, suppressing its expression and inhibiting HeLa cell growth (Fig. S1d,e and S3a–h). [score:9]
Together, these results indicate that miR-346 promotes the recruitment of hTERT mRNA to ribosomes through GRSF1 to enhanced translation, while miR-138 may facilitate targeting hTERT mRNA to RISC to suppress translation (Fig. 7e). [score:9]
To validate that miR-346 promotes and miR-138 suppresses the growth of HeLa cells by directly upregulating hTERT, the “rescue” experiments were performed using an hTERT expression vector (pcDNA3/hTERT) containing the hTERT ORF without the 3′UTR (Fig. S4a,b and Fig. S10). [score:9]
Restoration of hTERT expression abrogates the growth suppression of HeLa cells caused by miR-346 inhibition or miR-138 overexpression. [score:9]
However, Overexpression of miR-138 resulted in a left shift of hTERT mRNA distribution curve in ribosomes (Fig. 7c), indicating that miR-346 inhibition and miR-138 overexpression reduced hTERT translation. [score:9]
Here, we found that miR-138 was downregulated in cervical cancer tissues compared with adjacent normal tissues and that miR-138 functioned as a tumor suppressor through suppressing hTERT expression by binding its 3′UTR in human cervical cancer lines. [score:9]
Similarly, AGO2 knockdown attenuated miR-138 -mediated downregulation of endogenous hTERT mRNA and protein expression (Fig. 4b,c, Fig. S9), but had no effects on the ability of either pri-miR-346 or ASO-miR-346 to modulate hTERT expression (Fig. 4d,e, Fig. S8). [score:9]
These results indicate that miR-346 -mediated upregulation of hTERT does not require AGO2; in contrast, miR-138 -mediated suppression of hTERT expression is AGO2 -dependent. [score:8]
As expected, the miR-138/346-loop mimics upregulated hTERT protein expression and the miR-138/miR-346-loop mut mimics reversed the promotion of translation (Fig. 5i and Fig. S9). [score:8]
Overexpression of hTERT counteracts the cell viability (f) and growth inhibition (g) caused by ectopic miR-138 or ASO-miR-346 expression in HeLa cells. [score:7]
Together, our findings reveal a novel mo del where miR-346 enhances the expression of hTERT by binding to its 3′UTR and facilitating its recruitment to ribosomes in an AGO2-independent manner, while AGO2 -associated miR-138 concomitantly suppresses hTERT expression (Fig. 7a). [score:7]
When HeLa cells were cotransfected with ASO-miR-346 or pri-miR-138 and pcDNA3/hTERT, the inhibition of hTERT expression, cell viability and the colony formation rate were rescued by hTERT expression (Fig. 2e–g and Fig. S8). [score:7]
miR-346 and miR-138 competitively bind to a common site in the hTERT 3′UTR and facilitate the targeting of the hTERT mRNA to either the ribosome to promote translation by GRSF1 or to RISC to repress translation by AGO2, respectively. [score:7]
A previous study has shown that miR-138 downregulates the expression of hTERT in human anaplastic thyroid carcinoma cell lines 30. [score:6]
Meanwhile, a positive correlation between the hTERT and miR-346 expression (Fig. 2j), but a negative correlation between the hTERT and miR-138 (Fig. 2k) was observed, indicating that enhanced hTERT expression correlate with increased miR-346 and decreased miR-138 in human cervical cancer tissues and cell lines. [score:5]
Mutation of both binding sites (346- & 138-mut) abolished the regulation of EGFP expression by both miR-138 and miR-346 (Fig. 3c). [score:5]
Co -expression of Flag-GRSF1 and miR-138/miR-346-loop mut mimics abolished the translational enhancement induced by Flag-GRSF1 and miR-138/miR-346-loop mimics (Fig. 6j and Fig. S10). [score:5]
However, miR-138 was not obviously observed in the ribosomes, and the hTERT mRNA levels in ribosomes negatively correlated with miR-138 expression, which may shift the hTERT mRNA to RISC, indicating that miR-346 can promote the recruitment of hTERT mRNA to ribosomes for translation. [score:5]
In detail, miR-346 and miR-138 target a common target region of the hTERT 3′UTR, nucleotides 20 to 34, and that the binding sites for both miRNAs overlap by 9 bases (Fig. 3a). [score:5]
Thus, ectopic expression of miR-138 and inhibition of miR-346 using ASO were used for further studies. [score:5]
These results indicate that miR-346 and miR-138 compete for binding to a common region on the hTERT 3′UTR and competitively regulate hTERT expression and function, which depends on the ratio of miR-346 to miR-138. [score:4]
miR-346 and miR-138 competitively regulate hTERT expression and function. [score:4]
This observation prompted us to explore whether miR-346 and miR-138 competitively regulate hTERT expression. [score:4]
miR-346 and miR-138 bind a common site in the hTERT 3′UTR to coordinately regulate its expression. [score:4]
And there was a positive correlation between the EGFP expression levels and the ratio of pri-miR-346 to pri-miR-138 in the context of a fixed concentration of miR-346 or miR-138 (Fig. 3b). [score:3]
These results indicate that hTERT is a common mediator of miR-346-activated and miR-138 -suppressed cell growth in HeLa cells. [score:3]
The above results in Fig. 5 showed that miR-346 and miR-138/346-loop mimics depended on miR-346 “CCGCAU” motif to enhance the expression of ACVR2B and hTERT, respectively. [score:3]
Similarly, in co -expression group, shR-GRSF1 abrogated the enhancement of hTERT protein induced by miR-138/346-loop mimics (Fig. 6i and Fig. S10). [score:3]
hTERT is a functional target of both miR-346 and miR-138. [score:3]
miR-138 has been reported to repress hTERT expression in human anaplastic thyroid carcinoma cell lines 22. [score:3]
Bioinformatics analysis showed that miR-138 and miR-346 target common regions in the hTERT 3′UTR that overlap by 15 nucleotides (nt 21–40 and 16–35, respectively). [score:3]
Accordingly, miR-346 competes with miR-138 for binding to sites within the hTERT 3′UTR, resulting in enhanced the stability of hTERT mRNA and translation of the hTERT protein. [score:3]
Furthermore, the EGFP intensities in HeLa cells transfected with the 138-mut or 346-mut reporter vector were enhanced with increased miR-346 (Fig. 3d) or decreased miR-138 (Fig. 3e); however, mutation of both the miR-138 and miR-346 binding sites abolished regulation whatever the ratio of miR-346 to miR-138 was (Fig. 3f). [score:3]
To further investigate whether replacing the miR-138 motif with the miR-346 motif promotes hTERT expression, we detected endogenous hTERT protein expression by western blot in HeLa cells transfected with synthesized miR-138/346-loop mimics (with the wild type miR-346 “CCGCAU” sequence motif), miR-138/miR-346-loop mut mimics (with mutant sequences of the miR-346 motif) and NC. [score:3]
How to cite this article: Song, G. et al. miR-346 and miR-138 competitively regulate hTERT in GRSF1- and AGO2 -dependent manners, respectively. [score:2]
Since AGO2 is the core effector of RISC, we investigated whether AGO2 is involved in the miR-138- and miR-346 -mediated regulation of hTERT expression by RNA interference. [score:2]
Surprisingly, AGO2 depletion abolished the repression of the reporter by miR-138, but did not affect the reporter expression by the ASO-miR-346 compared with the control groups (Fig. 4a and Fig. S8). [score:2]
Furthermore, RNA immunoprecipitation (RIP) analysis showed that miR-138 and hTERT mRNA, but least miR-346 were bound to the AGO2 complex. [score:1]
Next, we synthesized miR-138 mimics with the miR-346 mutant loop sequence (miR-138/miR-346-loop mut mimics) to determine whether GRSF1 plays a promoting role in a miR-346 sequence motif -dependent manner. [score:1]
As shown in Fig. 5h, a small and different (UGAA) motif was formed by the miR-138 middle sequence. [score:1]
The correlation between the expression levels of miR-346 or miR-138 and hTERT mRNA was calculated using the Pearson correlation coefficient with the software of GraphPad Prism 6.01. [score:1]
Furthermore, RNAhybrid was also used to predict the secondary structure of the miR-138/hTERT 3′UTR duplex. [score:1]
Additionally, the endogenous hTERT protein and colony formation rate both positively correlated with the ratio of pri-miR-346 to pri-miR-138 (Fig. 3i,j and Fig. S8). [score:1]
And cold miR-16 did not decrease the binding of hot miR-346 or hot miR-138 to the hTERT 3′UTR fragment (Fig. 3h, left panel up). [score:1]
In addition, depletion of AGO2 reduced miR-138 and hTERT mRNA assembled to AGO2 complex and increased hTERT mRNA bound to miR-346 to GRSF1 complex (Fig. S6a). [score:1]
In addition, compared to the adjacent normal cervical tissues, the increased levels of hTERT mRNA as well as miR-346 and decreased levels of miR-138 were found by qRT-PCR in eighteen human cervical cancer tissues (Fig. 2h,i), and the aberrant expression of both miRNAs were futher confirmed by northern blot assays in both cervical cancer tissues and cervical cancer cell lines (Fig. 2l and S8). [score:1]
Thus, miR-346 may function as a decoy, while miR-138 may act as an inducer of decay to fine-tune hTERT levels by binding the common site in its 3′UTR. [score:1]
Furthermore, the binding to the hTERT 3′UTR with miR-138 or miR-346 mutant binding sites was weakened by increasing cold miR-346 or cold miR-138, not by itself (Fig. 3h, left panel bottom and right panel up). [score:1]
To address this question, an EGFP reporter vector containing an hTERT 3′UTR fragment with miR-346 and miR-138 binding sites was transfected along with various concentrations of pri-miR-346, pri-miR-138 or a control vector into HeLa cells (Fig. 3b, bottom panel). [score:1]
hTERT mRNA levels correlate with the ratio of miR-346 to miR-138, and this ratio correlated with the rate of colony formation in HeLa cells. [score:1]
As shown in Fig. 3g, increasing the levels of cold miR-138 decreased the binding of hot miR-346 to the hTERT 3′UTR fragment, and vice versa. [score:1]
GRSF1 also mediated the promotion of miR-346 and miR-138/346-loop mimics on ACVR2B and hTERT, respectively, in which the miR-346 “CCGCAU” motif is also essential. [score:1]
Next, we synthesized a mutant miR-138 mimics whose middle sequence was replaced with that of wild type miR-346 (miR-138/346-loop mimics) and another mutant miR-138 mimics with the mutant loop sequence of miR-346 (miR-138/miR-346-loop mut mimics). [score:1]
Whereas the hTERT 3′UTR with 346 & 138 mutant which mutated both miR-138 and miR-346 binding sites was totally abolished to bind to miR-138 and miR-346 (Fig. 3h, right panel bottom). [score:1]
In EGFP-hTERT 3′UTR reporter assays, AGO2 depletion in HeLa cells abolished miR-138 -mediated repression but did not affect the regulation by ASO-miR-346 (bottom panel). [score:1]
The miR-138 and miR-346 seed sequences are complementary to nt 34–40 and nt 29–35 of the hTERT 3′UTR, respectively; the 9 bases that mediate miR-346 binding are the same as those that mediate the miR-138 interaction (Fig. 3a-I). [score:1]
[1 to 20 of 58 sentences]
10
[+] score: 225
To address whether the TMZ resistant phenotype is reversed by downregulation of endogeneous miR-138, we transiently transfected miR-138 -expressing LN-18 and LN-229 cells with a specific miR-138 inhibitor or a non -targeting negative control molecule. [score:10]
miR-138 is upregulated in glioma cells with acquired TMZ resistance and in recurrent glioblastomas in vivoMicroarray -based miRNA expression profiling of parental and TMZ-resistant (TMZR) LN-18, LN-229 and LN-308 cells revealed several differentially expressed MiRNAs (Figure 1A), including several miRNAs previously implicated in TMZ resistance, such as mir-125b [10], miR-181 [12] or miR-221/222 [13]. [score:8]
Figure 6 Long-term TMZ treatment induces miR-138 expression, which in turn suppresses BIM translation. [score:7]
We confirmed as previously described [18] that overexpression of miR-138 promotes cell cycle progression and drives glioma cell proliferation (Figure 2B–2D), but this is at odds with the report that miR-138 overexpression in glioma reduced cell proliferation in vitro and tumorigenicity in vivo through inducing a G1/S cell cycle arrest by inhibition of a EZH2-CDK4/6-pRb-E2F1 signaling loop [19]. [score:7]
Long-term TMZ treatment induces miR-138 expression, which in turn suppresses BIM translation. [score:7]
Immunoblot analysis for expression of the miR-138 target SOX4 [17] in LN-229 cells confirmed the biological activity of miR-138 inhibition (Figure S3C). [score:7]
Next we assessed the effects of miR-138 overexpression in LN-308 and LN-319 cells selected for their low baseline expression of miR-138 (Figure 1D, Figure 2A). [score:5]
Since BIM protein levels are negatively regulated by miR-138, and miR-138 expression in turn is associated with TMZ -induced resistance, we assessed the correlation between miR-138 -dependent BIM regulation and autophagy in response to TMZ in glioma cells. [score:5]
Conversely, the overexpression of miR-138 decreased SOX4 levels by 40% in LN-308 cells selected for their low baseline miR-138 expression. [score:5]
One challenge that we faced while studying the role of miR-138 was that miR-138 depletion by an inhibitor approach did not show the opposite effect of miR-138 over -expression by adding mimic (Figure S3). [score:5]
ALCAM, an in silico predicted target of miR-138 [21], emerged as a candidate decreased in LN-18_R and LN-229_R cells from the microarray -based mRNA expression profiling (data not shown). [score:5]
For the control vectors the same fragment of BIM 3′UTR sequence was synthesized de novo, bearing mutations in the two miR-138 recognition sites: psiCheck2_mut1 (mutations in site 161-185 nt); psiCheck2_mut2 (mutations in site 1223-1249 nt); psiCheck2_mut3 (mutations in both recognition sites) (Eurofins Genomics, Ebersberg, Germany). [score:5]
In LN-308 and ZH-305 cells, chosen for their low baseline expression of miR-138, overexpression of miR-138 conferred protection from TMZ. [score:5]
mir-138 is significantly upregulated in TMZ-resistant glioma cell lines and in recurrent glioblastoma. [score:4]
To assess whether TMZ protection of glioma cells by miR-138 over -expression or by BIM silencing involves cell death regulation, we performed flow cytometry cell death analysis by Annexin V/PI staining at days 1 and 3 after TMZ treatment. [score:4]
Therefore, we postulate that the resistance phenotype mediated by miR-138 is partly dependent on BIM downregulation. [score:4]
Upregulation of miR-138 in recurrent glioblastomas of patients progressing after radiotherapy and TMZ confirmed the potential in vivo relevance of our in vitro profiling approach (Figure 1E). [score:4]
BIM is a direct target of miR-138 and modulates TMZ resistance. [score:4]
We further investigated additional predicted miR-138 targets focusing on those that were found to be downregulated at the mRNA level by Affymetrix gene chip analyses of the three parental and resistant glioma cell lines. [score:4]
Moreover, we establish a functional link between miR-138 -mediated resistance and BIM, and confirm that down-regulation of BIM by miR-138 promotes TMZ resistance. [score:4]
Moreover, miR-138 may be of particular importance in acquired rather than constitutive TMZ resistance, consistent with the observation that DNA damage induces expression of different microRNAs via transcriptional or post-transcriptional regulation [37]. [score:4]
We selected miR-138 for further investigations which showed increased expression in LN-18-resistant (LN-18_R) and LN-308-resistant (LN-308_R) cells (Figure 1B), and confirmed upregulation in these cells versus parental cells by real-time qPCR (Figure 1C). [score:4]
miR-138 is upregulated in glioma cells with acquired TMZ resistance and in recurrent glioblastomas in vivo. [score:4]
We further show that transient knockdown of BIM increased TMZ resistance of glioma cells (Figure 4E), thus mimicking the miR-138 over -expression phenotype. [score:4]
BIM downregulation via miR-138 confers TMZ resistance to glioma cells. [score:4]
Cell cycle analysis by flow cytometry showed a reduced G2/M fraction in the miR-138 overexpressing cells at day 6 post transfection (Figure 2D). [score:3]
miR-138 has been implicated in the promotion of growth and survival of glioma stem cells [18], however, it appears to have an opposite role as a tumor suppressor in other cancers [16, 35]. [score:3]
Additionally, increased autophagy was seen in TMZ-resistant cells, and upon miR-138 over -expression or BIM silencing to a lesser extent (Figure 5C). [score:3]
Next, we screened the baseline expression of miR-138 in a panel of 9 LTC and 5 GIC (glioma-initiating cells) lines (Figure 1D). [score:3]
This finding may partially be due to the overwhelming role of MGMT promoter methylation and expression in TMZ sensitivity [36], whose strong impact on alkylator resistance might override the effects of miR-138 -mediated TMZ resistance in these cell lines. [score:3]
We confirmed that the expression of miR-138 was increased in 9 of 10 paired tissues from primary and recurrent glioblastomas following TMZ/RT→TMZ, corroborating the potential significance of this miRNA in human glioblastoma in vivo (Figure 1E). [score:3]
When miR-138 -overexpressing LN-308 and ZH-305 cells were exposed to increasing concentrations of another alkylating agent, CCNU, a gain of resistance was also achieved (Figure 3B). [score:3]
Consistent with our observation in primary tumors in vivo (Figure 1E), transfection of glioma cell lines or glioma stem-like cells with miR-138 mimics increased TMZ resistance (Figure 3A); yet, this effect was only seen in mo dels with low baseline miR-138 expression. [score:3]
miR-138 overexpression increases glioma cell proliferation. [score:3]
We succeeded to confirm the in silico predictions that BIM is a direct target of miR-138 by luciferase reporter assays (Figure 4C). [score:3]
BIM levels were reduced or increased, respectively, in glioma cells transfected with miR-138 mimic or miR-138 inhibitor (Figure 4B). [score:3]
Luciferase reporter assays assessing miR-138 binding to the BIM-3′UTR region confirmed BIM as a direct target of miR-138. [score:3]
In contrast, no such effect was seen in LN-18 or LN-428 cells (Figure S2A), which have higher baseline expression of miR-138 (Figure 1D). [score:3]
It is tempting to speculate that TMZ treatment, leading to increased miR-138 expression, which in turn reduces BIM levels, leads to autophagy that results in cell survival, thus TMZ resistance. [score:3]
Predicted miR-138 targets in mediating TMZ sensitivity – no role for activated leukocyte cell adhesion molecule (ALCAM). [score:3]
We found no clear-cut association between baseline miR-138 expression levels and TMZ sensitivity of various glioma cell lines (Figure S1). [score:3]
Overexpression of miR-138 confers TMZ and CCNU resistance in glioma cells. [score:3]
Overexpression of miR-138 induces resistance to TMZ and CCNU in glioma cells. [score:3]
Here, we demonstrate that miR-138 may mediate TMZ resistance by targeting Bcl-2-like protein 11 (BCL2L11), also known as BIM, a BH3-only apoptosis initiator from the Bcl-2 protein family [20]. [score:3]
We identified a set of differentially expressed miRNA candidates and selected miR-138 for further analysis. [score:3]
We assume that upon miR-138 inhibitor application, residual endogenous levels of miR-138 are still high enough to preserve the primary resistant phenotype. [score:3]
For this purpose, we studied two predicted miR-138 targets for their involvement in TMZ resistance of glioma cells, namely CD166/ALCAM and BCL2L11/BIM. [score:3]
The miRIDIAN miR-138 mimics and miR-138 miRIDIAN hairpin inhibitors and respective control molecules were purchased from Dharmacon (Dharmacon GE Healthcare, Lafayette, CO). [score:3]
Figure 4(A) Immunoblot for BIM detection in LN-18, LN-229 and LN-308 parental versus resistant (R) cells (B) and in LN-308 or LN-229 cells transfected with miR-138 mimic, inhibitor or the respective control (100 nM); lysates were collected 72 h post-transfection. [score:3]
Left panel: schematic of the two miR-138 binding sites in the 3′UTR region of the BIM mRNA, and the content of each vector construct (red cross represents mutation in the recognition site). [score:2]
More importantly, knockdown of BIM or transfection of miR-138 mimic led to enhanced autophagy as assessed by increased LC3-II production (Figure 5C). [score:2]
There was no significant correlation of baseline miR-138 expression with sensitivity to TMZ in clonogenic survival assays either for all cell lines pooled (r = 0.25, p = 0.39) (Figure S1A), LTC alone (r = 0.03, p = 0.95) (Figure S1B), or GIC alone (r = 0.3. p = 0.68) (Figure S1C). [score:2]
Additionally, control vectors carrying either each at a time or both mutated miR-138 -binding sites in the BIM-3′UTR region revealed that the binding site 1223-1249 nt is more potently regulated by miR-138 (Figure 4C; Figure S6A). [score:2]
We provide evidence that miR-138 mediates acquired TMZ resistance in glioblastoma by regulating the apoptosis inducer BIM and autophagy. [score:2]
Still, miR-138 mimic or siBim -transfected cells showed reduced cell death upon TMZ stimulation at day 3 (Figure 5A), suggesting that regulation of apoptosis via miR-138 and BIM is only partially involved in acquired TMZ resistance. [score:2]
Significance was assessed using two-sided unpaired Student's t-test, paired Student's t-test for comparison of miR-138 expression in primary and recurrent glioblastomas, one-sample Student's t-test for analysis of luciferase reporter results or two-way ANOVA with post hoc Bonferroni test, and correlation was calculated by assessing the Spearman's coefficient (r) (GraphPad Prism 5, La Jolla, CA) (* p < 0.05, ** p < 0.01, *** p < 0.001). [score:1]
In conclusion, we demonstrate a role for miR-138 in acquired TMZ resistance in glioma cells. [score:1]
Band intensity quantification confirmed a reduction of BIM protein levels in the miR-138 mimic -transfected cells. [score:1]
TMZ and miR-138 induce little apoptosis but cytoprotective autophagy. [score:1]
miR-138 has been implicated in the pathogenesis of several cancers [15– 17], including gliomas [18, 19], however, it has not been related to therapy resistance. [score:1]
Following attachment overnight, cells were co -transfected with 100 ng of the respective reporter construct and 50 nM of miR-138 mimic or control molecules. [score:1]
A 1281-bp fragment of the BIM 3′UTR sequence containing two predicted binding sites for miR-138 was subcloned into the psiCHECK™-2 dual luciferase vector (Promega, Madison, WI). [score:1]
However, if the number of antisense oligonucleotides is not in several-fold excess of the miRNA copies per cell, the miRNA saturation is not complete, hence the residual levels that we observe upon miR-138 silencing (Figure S3A) might be sufficient to maintain the original phenotype [38, 39]. [score:1]
miR-138 induces proliferation of glioma cells in vitro. [score:1]
Autophagy is induced by TMZ and miR-138, negatively correlates with BIM protein levels, and acts as a pro-survival pathway. [score:1]
Autophagy mediates TMZ resistance via the miR-138/BIM axis. [score:1]
Additionally, we propose that the miR-138/BIM axis mediates resistance to TMZ by autophagy. [score:1]
[1 to 20 of 67 sentences]
11
[+] score: 202
Other miRNAs from this paper: mmu-mir-138-2, hsa-mir-138-1, mmu-mir-138-1, hsa-mir-630
As shown in Additional file 5: Figure S3B, overexpression of ANGPTL1 significantly enhanced miR-138 expression by 1.51-fold (P < 0.0001), whereas miR-138 level was markedly (86%) inhibited by knockdown of ANGPTL1 (P < 0.0001), indicating that ANGPTL1 may regulate the expression of miR-138. [score:11]
These findings suggest that ANGPTL1 directly or indirectly up-regulates the expression of miR-138, and miR-138 is involved in ANGPTL1 -mediated inhibition of migration of CRC cells. [score:10]
For example, miR-138 expression can be decreased by methylation of its DNA [27] and up-regulated by a histone deacetylase inhibitor [28] and overexpression of P 19 H-Ras [29]. [score:10]
Among these candidates, miR-138 was reported to be down-regulated in CRC tissues, and its down-regulation was associated with more severe metastasis in vitro and in vivo by targeting TWIST2 [17]. [score:9]
In addition, miR-138 was down-regulated in CRC tissues, and this down-regulation was associated with more severe metastasis in vitro and in vivo by targeting TWIST2 [17]. [score:9]
In SW620-ANGPTL1 cells, the expression of miR-138 was significantly enhanced compared to control cells (P < 0.0001), while it was markedly inhibited in SW480-shANGPTL1 cells (P < 0.0001) The level of miR-138 was further determined in cells with ANGPTL1 overexpression and knockdown. [score:7]
a SW620-Ctrl cells treated with miR-138 inhibitor showed enhanced migratory capacity (P = 0.01), and miR-138 inhibitor reversed the inhibition of migration in SW620-ANGPTL1 cells (P = 0.001). [score:7]
As shown in Fig.   5a-b, SW620-Ctrl cells treated with miR-138 inhibitor showed enhanced migratory capacity (P = 0.01), and miR-138 inhibitor reversed the inhibition of migration in SW620-ANGPTL1 cells (P = 0.001). [score:7]
In SW620-ANGPTL1 cells, the expression of miR-138 was significantly enhanced compared to control cells (P < 0.0001), while it was markedly inhibited in SW480-shANGPTL1 cells (P < 0.0001) The level of miR-138 was further determined in cells with ANGPTL1 overexpression and knockdown. [score:7]
Specifically, miR-138 overexpression inhibits EMT process by targeting Vimentin and EZH2, thus reducing breast cancer invasion [30]. [score:7]
B. miR-138 inhibitor or mimics decreased or enhanced the expression of miR-138, respectively, whereas the negative controls had no significant effects on its expression. [score:7]
In vitro and in vivo experiments showed that ANGPTL1 suppressed migration and invasion of CRC cells and prolonged overall survival (OS) in mouse mo dels, which may be mediated by the up-regulation of microRNA-138 (miR-138). [score:6]
miR-138 was up-regulated by ANGPTL1 and involved in ANGPTL1 -mediated inhibition of migration of CRC cells. [score:6]
ANGPTL1 might directly or indirectly regulate miR-138 expression via the above mechanisms. [score:6]
MicroRNA-138 expression was positively correlated with ANGPTL1 mRNA level in CRC tissues and up-regulated by ANGPTL1 in CRC cells. [score:5]
In addition, the microRNA-138 inhibitor or mimics could reverse or promote the ANGPTL1 -mediated inhibition of the migratory capacity of CRC cells, respectively. [score:5]
In CRC patients, miR-138 targets TWIST2, a crucial regulator of EMT, to attenuate metastasis [17]. [score:4]
In this study, we found that miR-138 was up-regulated by ANGPTL1, but the mechanism of its biogenesis remains unexplored. [score:4]
b Level of miR-138 in cells with overexpression and knockdown of ANGPTL1. [score:4]
d Representative images of transwell migration assay in cells treated with/without miR-138 mimics In this study, we compared the gene expression profiles of paired cancerous and normal tissues from TCGA datasets, and identified ANGPTL1 as a down-regulated gene in CRC. [score:4]
Because ANGPTL1 has also been reported to regulate EMT to attenuate metastasis [7], it is likely that EMT might be a potential mechanism in the ANGPTL1-miR-138 -induced inhibition of metastasis in CRC, which requires further exploration. [score:4]
Future studies are warranted to investigate the underlying mechanisms by which ANGPTL1 regulates the transcription of miR-138, and the target genes that are involved in the ANGPTL1-miR-138 -induced inhibition of metastasis in CRC. [score:4]
As reported by Jiang et al. [25], ectopic transfection of miR-138 contributed to the reduced migration and invasion in oral tongue squamous cell carcinoma by targeting RhoC and ROCK2, which are involved in the remo deling of cellular cytoskeleton. [score:3]
With respect to the potential targets of miR-138, EMT, the TGF-β pathway, the RhoC-Erk-MMP-2/9 pathway, and the cofilin pathway have been identified to participate in the reduced migratory and invasive activity induced by miR-138 [24]. [score:3]
The specific data for expression levels of ANGPTL1 and miR-138 in tumor tissues are plotted in Additional file 5: Figure S3A. [score:3]
miR-138 inhibitor, mimics and negative controls were synthesized by GenePharma (Shanghai, China) and were dissolved in DEPC -treated H [2]O. The lentiviral vectors for ANGPTL1 were purchased from Cyagen Biosciences (Guangzhou, China), including pLV (Exp)-Puro-CMV > hANGPTL1/HA-IRES-eGFP and its control vector, pLV (Exp)-Puro-CMV > IRES-eGFP. [score:3]
As reported, epigenetic and transcription factors, as well as many other molecules, are correlated with miR-138 expression [24]. [score:3]
The final concentration of the miR-138 inhibitor or mimics and their corresponding negative controls was 50 nmol/l. [score:3]
A. Expression data of ANGPTL1 and miR-138 in 8 CRC tumor tissues from patients extracted from the GSE35982 dataset. [score:3]
A number of studies have demonstrated that miR-138 regulates various molecular pathways and is associated with initiation and progression of cancer, and thus is considered as a potential tumor suppressor [24]. [score:3]
For miR-138 inhibitor, the single-stranded RNA sequence was 5′-CGGCCUGAUUCACAACACCAGCU-3′. [score:3]
In clear cell renal cell carcinoma cells, miR-138 reduced the expression of hypoxia-inducible factor-1 alpha, which in turn enhanced apoptosis and decreased cell migration [26]. [score:3]
Our results also confirmed that miR-138 expression is positively correlated with ANGPTL1 mRNA level in CRC tissues and is involved in ANGPTL1 -induced attenuated migration of CRC cells, which was consistent with the reports of Long et al. [17]. [score:3]
Cells were transiently transfected with a miR-138 inhibitor, mimics or negative controls at 50 nmol/l using Lipofectamine 2000. [score:3]
Finally, we found that ANGPTL1 exerts its effect by up -regulating miR-138. [score:2]
We demonstrate that ANGPTL1 represses migration and invasion of CRC cells by up -regulating miR-138. [score:2]
d Representative images of transwell migration assay in cells treated with/without miR-138 mimics To identify genes of tumorigenic potential, we analyzed gene expression profiles of paired cancerous and normal tissues from TCGA datasets. [score:2]
b Representative images of transwell migration assay in cells treated with/without miR-138 inhibitor. [score:2]
Then, we conducted transwell migration assay to determine whether miR-138 is involved in ANGPTL1 -mediated inhibition of migration of CRC cells. [score:2]
miR-138 was suggested to be of great priority of being involved in ANGPTL1-regulated metastasis. [score:2]
For quantifying mature miR-138, reverse transcription was performed using a miRNA 1st Strand cDNA Synthesis kit (Sangon Biotech, Shanghai, China) according to the manufacturer’s protocol. [score:1]
ANGPTL1 repressed migration and invasion of CRC cells, and that miR-138 was involved in this process. [score:1]
ANGPTL1 repressed migration and invasion of CRC cells, and microRNA-138 was involved in this process. [score:1]
For miR-138 mimics, the sequences of oligonucleotides were 5′-AGCUGGUGUUGUGAAUCAGGCCG-3′ (sense), and 5′-GCCUGAUUCACAACACCAGCUUU-3′(antisense). [score:1]
To validate this finding, we explored the association between transcript levels of ANGPTL1 and miR-138 in another GSE dataset (GSE35982). [score:1]
In addition, in SW480-shANGPTL1 cells transfected with miR-138 mimics, the shANGPTL1 -induced increase in migratory capacity was significantly attenuated (P = 0.006, Fig.   5c-d). [score:1]
Among the miRNAs, the level of miR-138 was significantly higher in the samples with high levels of ANGPTL1 (P = 0.01). [score:1]
c SW480-Ctrl cells treated with miR-138 mimics showed decreased migratory capacity (P = 0.006), and miR-138 mimics reversed the promotion of migration in SW480-shANGPTL1 cells (P = 0.006). [score:1]
The mature miR-138 level was normalized with U6 determined by, as described previously. [score:1]
Pearson correlation analysis suggested that ANGPTL1 mRNA level was positively correlated with miR-138 level in CRC tumor samples (Pearson correlation value = 0.94, P = 0.001). [score:1]
The levels of ANGPTL1 and miR-138 were positively correlated (Pearson correlation value = 0.94, P = 0.001). [score:1]
[1 to 20 of 51 sentences]
12
[+] score: 177
Our data demonstrated that restoration of miR-138 significantly inhibited both mRNA and protein expression levels of VIM in RCC cells, suggesting VIM was regulated by tumor suppressive miR-138. [score:8]
This miRNA was downregulated in our previous signature, and downregulation of miR-138 has been observed in several malignancies, including anaplastic thyroid carcinoma (19) and lung cancer (20). [score:7]
First, downregulation of VIM was recognized in the expression signature of miR-138 transfectants. [score:6]
The mRNA and protein expression levels of VIM were markedly downregulated in miR-138 transfectants (A498 and 768-O) in comparison with the mock and miRNA-control transfectants (Fig. 2B and C). [score:6]
We selected 99 genes that were downregulated in miR-138 transfectants and demonstrated their expression levels in a heatmap diagram (Fig. 2A). [score:6]
miR-138 regulation of molecular targets assessed by genome-wide gene expression analysis. [score:6]
Our previous study showed that miR-138 was reduced in RCC miRNA expression signature (12), we validated the down-regulation of miR-138 in RCC clinical specimens in this study. [score:6]
Third, VIM has a putative miR-138 target site in its 3′ untranslated region. [score:5]
The two expression signatures in this study (miR-138 transfectants and RCC clinical specimens) revealed that VIM was a promising putative target gene in miR-138 in RCC. [score:5]
Based on this view, we performed molecular target searches for miR-138 in cancer cells by combining two genome-wide gene expression studies (miR-138 transfectants and RCC mRNA clinical signature) and in silico analysis. [score:5]
The results of this study and previous data indicate that VIM is a functional target of tumor suppressive miR-138, and this pathway contributes to cancer cell migration, invasion, and metastasis. [score:5]
These data suggested that miR-138 functions as a tumor suppressor that inhibits RCC invasion and metastasis. [score:5]
The report also showed that protein expression of CCND3 was negatively correlated with miR-138 expression in HCC tissues. [score:5]
Furthermore, overexpression of miR-138 reduced cell viability and colony formation in HCC cell lines targeting CCND3(35). [score:5]
To confirm that miR-138 regulated molecular targets in RCC cells, we performed genome-wide gene expression analysis using miR-138 transfectants compared with miRNA-control transfectants in A498 cells. [score:5]
To identify miR-138-regulated cancer pathways, we undertook both a genome-wide gene expression analysis (miR-138 transfectants and RCC clinical specimens) and an in silico study. [score:4]
VIM as a direct target of repression by miR-138 in RCC cells. [score:4]
A total of 99 genes were downregulated in miR-138 transfectants. [score:4]
Interestingly, it has been shown that miR-138 regulated cell migration and invasion by targeting RhoC, ROCK, ZEB2, EZH2 and VIM in HNSCC cells (33, 34). [score:4]
The elucidation of new molecular pathways regulated by tumor suppressive miR-138 is important for our understanding of human RCC invasion and metastasis. [score:4]
Morphological changes of RCC cells and accelerated cell migration and invasion is caused by the reduction of miR-138 and the upregulation of VIM pathways. [score:4]
Our data of miR-138 transfectants in RCC cell lines demonstrated that CCND3 is a putative target of miR-138 in RCC, suggesting that miR-138 regulation of the CCND3 pathway is important for RCC oncogenesis. [score:4]
A morphological change of cancer cells by miRNA transfection is an important discovery and it suggested that miR-138 functions as a tumor suppressor in RCC cells. [score:3]
Entries from the microarray data were approved by the Gene Expression Omnibus (GEO), and were assigned GEO accession numbers GSE 36951 (RCC clinical specimens) and GSE 37119 (miR-138 transfectants). [score:3]
The existence of a tumor suppressive miR-138 -mediated cancer pathway provides new insights into the potential mechanisms of RCC oncogenesis and metastasis. [score:3]
The tumor suppressive miR-138 -mediated cancer pathway provides new insights into the potential mechanisms of RCC oncogenesis and metastasis. [score:3]
Furthermore, restoration of miR-138 significantly inhibited cancer cell migration and invasion in RCC cells. [score:3]
The results showed that vimentin (VIM) was a promising candidate target gene of miR-138. [score:3]
Restoration of miR-138 in RCC cells changed the EMT-like morphology and suppressed cell migration and invasion. [score:3]
Studies of a large number of samples with balanced pathological backgrounds are needed to elucidate the precise correlation between VIM and/or miR-138 expression and clinicopathological parameters. [score:3]
Importantly, restoration of miR-138 in an HNSCC cell line changed the EMT-like cell morphology and suppressed cell migration and invasion (34). [score:3]
Quantitative stem-loop RT-PCR demonstrated that the expression levels of miR-138 were significantly reduced in 33 RCC samples (Table I) in comparison with adjacent non-cancerous specimens (clinical RCC specimens, 0.346±0.201 versus adjacent normal tissues, 2.983±0.715, P<0.0001) (Fig. 5A). [score:3]
Aberrant expression of miR-138 has been observed in several types of cancer such as head and neck squamous cell carcinoma (HNSCC) (30), anaplastic thyroid carcinoma (19) and lung cancer (20). [score:3]
In summary, the reduction of miR-138 and the increased expression of VIM are frequent events in RCC clinical specimens. [score:3]
Expression levels of miR-138 and VIM mRNA in RCC clinical specimens. [score:3]
We evaluated the expression levels of miR-138 in two RCC cell lines, A498 and 786-O. RNA was extracted and miRNA expression levels of miR-138 were determined by real-time RT-PCR. [score:3]
Oligomicroarray Human 60K (Agilent) was used for expression signature in miR-138 -transfected A498 cells in comparison with the miR -negative control transfectant, as previously described (23). [score:3]
The predicted target site of miR-138 in VIM in the 3′UTR is shown in Fig. 2D. [score:3]
The XTT assay revealed that cell proliferation was significantly inhibited in miR-138 transfectants in comparison with the transfectant reagent only (mock) and the miR-control transfectants. [score:2]
The wound healing assay demonstrated that significant inhibition of cell migration occurred in the miR-138 transfectants in comparison with mock and the miR-control transfectants. [score:2]
Screening of miR-138-regulated genes by microarray. [score:2]
The expression levels of miR-138 were significantly lower in both RCC cell lines compared with normal kidney RNA (relative to normal kidney RNA, 0.090±0.008 and 0.102±0.009, respectively) (Fig. 1B). [score:2]
The aim of the study was to investigate the functional significance of miR-138 and identify its target genes in RCC cells. [score:1]
Effect of miR-138 transfection on cell proliferation, migration, and invasion activity of RCC cell lines. [score:1]
Two miR-138 precursor genes, miR-138-1 and miR-138-2, have identical sequences in the mature miRNA and map to human chromosomes 3p21.33 and 16q13, respectively. [score:1]
Transfection of si- VIM-1 and si- VIM-2 in the RCC cell lines (A498 and 768-O) caused EMT-like changes in cell morphology, as that observed when cells were transfected with miR-138 (Fig. 4A). [score:1]
Importantly, we found significant morphologic change in RCC cell lines (A498 and 786-O) by miR-138 transfection. [score:1]
Cells were transfected with miR-138 and si- VIM for 72 h and were then examined by an inverted microscope (CK2-BIP2, Olympus). [score:1]
In this study, we focused on miR-138. [score:1]
In this study, we focused on VIM as a putative candidate of miR-138 in RCC cells. [score:1]
[1 to 20 of 50 sentences]
13
[+] score: 156
Other miRNAs from this paper: mmu-mir-138-2, hsa-mir-138-1, mmu-mir-138-1
In support of a crucial role of MiR-138 in the regulation of endothelial S100A1 expression, we found that levels of MiR-138 were significantly increased in samples taken from both human patients with CLI (Figure 6A) and ischemic mouse gastrocnemius muscles (Figure 6B), while expression of housekeeping small nucleolar RNAs RD44 and RD47 did not change, demonstrating that tissue ischemia leads to an increase in MiR-138 that could potentially be responsible for the observed downregulation of S100A1. [score:8]
It is tempting to speculate that one or both of the MiR-138 genes may be direct targets of Hif1-α, since we have shown here that this transcription factor is indispensable for the hypoxia -induced expression of MiR-138 and the subsequent repression of S100A1. [score:5]
Expression of U6 RNA was used to normalize the expression of miR-138. [score:5]
In this light it is interesting to note that MiR-138 has been reported to directly target Hif1-α in cultured cells [17], [18], potentially allowing for feed-back control of MiR-138 expression during hypoxia. [score:5]
Here we report that MiR-138 targets the 3′UTR of S100A1 and regulates its expression in a hypoxia -dependent manner specifically in ECs. [score:5]
Specific inhibition of the prolyl-hydroxylase 2 enzyme by IOX2 leads to the stabilization of Hif1-α in endothelial cells [5] (Figure 7A), and greatly increased MiR-138 levels (Figure 7B), concomitant with reduced S100A1–3′UTR reporter gene expression. [score:4]
0078684.g003 Figure 3 Murine C2C12 skeletal myoblasts (left panels) or differentiated myotubes (right panels) were subjected to hypoxia for 24 h. Protein extracts were immunoblotted for S100A1 protein expression (upper panels) and expression of MiR-138 by qPCR (lower panels). [score:4]
Since NO production contributes to the pro-angiogenic actions of VEGF [13], these experiments provide conclusive evidence for the pathophysiological relevancy of increased MiR-138 expression and subsequent suppression of S100A1 in ECs. [score:4]
Neither skeletal muscle myoblasts, differentiated myotubes (Figure 3), nor primary human vascular smooth muscle cells (HVSMCs, Figure 4) display much of a change of S100A1 or MiR-138 expression when subjected to hypoxia, even though all of these cell types express both S100A1 and MiR-138. [score:4]
Murine C2C12 skeletal myoblasts (left panels) or differentiated myotubes (right panels) were subjected to hypoxia for 24 h. Protein extracts were immunoblotted for S100A1 protein expression (upper panels) and expression of MiR-138 by qPCR (lower panels). [score:4]
While MiR-138, like all other microRNAs, has a large number of potential targets, its suppression of S100A1 in ECs may be especially important for vascular physiology since we have shown here that restoration of S100A1 levels in ECs with increased MiR-138 is sufficient to reverse EC dysfunction, as manifest by restored stimulus -dependent NO generation and Matrigel tube formation capability. [score:4]
Pathophysiologic relevance may be derived from the observation that S100A1 levels are severely downregulated [3], while MiR-138 levels are increased, in both human muscle biopsies procured from patients with CLI, as well as mice with induced limb ischemia (Figure 6). [score:3]
The hypoxia -induced increase in MiR-138 led us to examine the contribution of the transcription factor hypoxia -induced factor 1-α (Hif1-α) to the regulation of MiR-138 expression. [score:3]
The critical role of Hif1-α in the induction of MiR-138 in ECs was proven by siRNA -induced silencing of Hif1-α, which completely prevented the hypoxia -induced downregulation of reporter gene activity (Figure 7D). [score:3]
Overall homology of the 3′UTR is 72%, homology of the miR-138 target is 95% (21/22). [score:3]
Alternatively, in some experiments we used a cholesterol-conjugated antagomir-138 (1 µmol/L) to inhibit MiR-138 [6]. [score:3]
Confirmation of the role of MiR-138 in the regulation of S100A1 was obtained by deleting the putative 22 nucleotide MiR-138 target site within the S100A1–3′UTR of the luciferase reporter. [score:3]
This indicates that hypoxia regulates S100A1 expression in ECs predominantly via MiR-138 (Figure 5A). [score:3]
The predicted miR-138 target region (deleted in the DMiR138 construct) is outlined in red. [score:3]
Endothelial dysfunction develops when these carefully balanced multiple feedback loops become dysregulated allowing for prolonged MiR-138 expression with consequent loss of S100A1 and reduced eNOS activity. [score:3]
To inhibit activity of microRNA-138, 40 nmoles of a hairpin antimir (Dharmacon ThermoFisher cat # IH-300605-0005) to MiR-138 was transfected into EA. [score:3]
However, we can not rule out other ways by which MiR-138 expression is controlled since processing of the mature MiR-138 from the pre-MiR-138 also appears to be a regulated step in some tissues [19]. [score:3]
Here we show for the first time that S100A1, a central co-activator of eNOS activity, is drastically downregulated by hypoxia -induced MiR-138 in endothelial cells. [score:3]
This was specifically due to the induction of MiR-138 since co-transfection with the antimir-138 completely reversed the decrease in reporter gene expression (Figure 7C). [score:3]
In order to assess the physiological relevance of endogenously produced MiR-138, we inhibited the function of endogenously generated MiR-138 by incubating primary HMVECs with a specific antagomir to MiR-138 [6]. [score:3]
Infection with recombinant adenovirus expressing S100A1 [11] re-established S100A1 levels to near normal in MiR-138 mimic transfected cells (Figure 8B), and re-established tube formation capability (Figure 8A). [score:2]
0078684.g006 Figure 6A) Gastrocnemius muscle biopsy specimens from patients with CLI and non-ischemic control [3] were analyzed for expression levels of MiR-138 and the housekeeping small nucleolar RNAs snoRD44 and snoRD47 by qPCR. [score:2]
Real Time PCR for MiR-138 Expression in Mice. [score:2]
This change in eNOS phosphorylation also was normalized upon re -expression of physiologic levels of S100A1, even in the continued presence of the MiR-138 mimic. [score:2]
Re -expression of S100A1 reverses the MiR-138 induced EC dysfunction. [score:2]
In order to examine the physiological relevance of increased EC MiR-138 expression we transfected primary HMVEC with the MiR-138 mimic and tested the ability of these cells to form capillary-like tube networks on Matrigel matrix. [score:2]
MiR-138 Targets the S100A1-3′UTR in ECs. [score:2]
Furthermore it is clear that hypoxia, per se, does not increase MiR-138 levels in all cells, as we have shown that C2C12 skeletal muscle cells, while expressing both MiR-138 and S100A1, do neither increase MiR-138, nor decrease S100A1 when subjected to hypoxia. [score:2]
A) Gastrocnemius muscle biopsy specimens from patients with CLI and non-ischemic control [3] were analyzed for expression levels of MiR-138 and the housekeeping small nucleolar RNAs snoRD44 and snoRD47 by qPCR. [score:2]
In order to verify the potential targeting of S100A1 by MiR-138, we co -transfected a MiR-138 mimic (Dharmacon) together with the S100A1–3′UTR reporter into EA. [score:2]
MiR-138 decreases S100A1 gene expression in Endothelial Cells. [score:2]
MiR-138 compromises VEGF-stimulated NO production by inhibiting S100A1. [score:2]
Real Time PCR for MiR-138 Expression inRNA was isolated from mice as well as cell samples using RNAzol RT according to manufacturer’s instruction (MRC, Inc cat# RN190). [score:2]
While total eNOS levels remained unchanged in MiR-138 mimic transfected ECs, the reduction of S100A1 greatly increased eNOS phosphorylation on Thr-495, a demonstrated eNOS inhibitory site [12] (Figure 8B). [score:2]
While a recent report by Li et al. demonstrated a hypoxia -induced increase of MiR-138 in airway smooth muscle cells [20], we did not observe a significant hypoxia -induced change in either MiR-138 or S100A1 expression in primary human vascular smooth muscle cells, however it is likely that the significant differences in smooth muscle cell type (airway vs. [score:2]
B) Expression levels of MiR-138 were assessed by qPCR in extracts prepared from EA. [score:2]
Specific inhibition of MiR-138 prevents the hypoxia -induced loss of S100A1 in ECs. [score:2]
MiR-138 compromises EC Matrigel -induced capillary formation by inhibiting S100A1. [score:2]
B) Expression of MiR-138 was by qPCR. [score:2]
B) Gastrocnemius muscle biopsy specimens from mice post femoral artery resection (FAR) and non-ischemic contralateral control were analyzed for expression levels of MiR-138 and the U6 small nuclear housekeeping RNA by qPCR at times indicated. [score:2]
A gene block (IDT) comprising the entire S100A1 3′UTR, but lacking specifically the 22 nucleotide putative MiR-138 target site, was subcloned NheI to XhoI into the luciferase reporter vector to generate the ΔMiR-138 construct. [score:2]
MiR-138 Induces EC Dysfunction Specifically via Inhibition of S100A1. [score:2]
hy926 ECs were transfected with either the wild-type (WT) S100A1–3′UTR luciferase reporter gene or a S100A1–3′UTR with deletion of the 22 nucleotide putative MiR-138 target site (ΔMiR138). [score:2]
The most important finding of our work is the identification of MiR-138 as a crucial determinant of S100A1 expression in ECs subjected to hypoxia. [score:2]
Indeed hypoxia (induced by either low oxygen or chemical reagents) drastically increased expression of MiR-138 in both EA. [score:2]
As strategies to manipulate microRNA levels in vivo become more mature [6], [28], MiR-138 might represent an attractive target for the treatment of pathologies that have underlying EC dysfunction. [score:2]
Together, these findings strongly suggest that hypoxia induces cell-type selective expression of MiR-138 and that this induction can drastically reduce S100A1 protein levels in ECs. [score:2]
The MiR-138 mimic reduced reporter gene expression by over 95% after 24 h (Figure 2A). [score:2]
Hif1-α Activation is Required for the Hypoxia -induced Expression of MiR-138. [score:2]
Figure S2 A) Alignment of miR-138 with the human S100A1-3′UTR as predicted by miRANDA. [score:1]
It is clear that MiR-138 itself is dynamically regulated in response to low oxygen levels in a cell-type specific manner. [score:1]
Proposed Scheme of S100A1 regulation by MiR-138. [score:1]
Confirmation of this was also obtained by co-transfecting a hairpin anti-MiR-138 (antimir-138, Dharmacon) into EA. [score:1]
[1 to 20 of 58 sentences]
14
[+] score: 149
GWAS SNP miRNA target site SNP CHR BP Distance to GWAS SNP miRNA target site SNP alleles LD R2 microRNA Target gene Target transcript rs113948889 rs112215626 12 2,059,337 44,833 G/A 1 hsa-miR-4775 DCP1B ENST00000540622 rs113948889 rs1044950 12 2,061,982 42,188 T/C 1 hsa-miR-138-5p DCP1B ENST00000541700 rs113948889 rs34730825 12 2,064,602 39,568 C/T 1 hsa-miR-3147 DCP1B ENST00000543381 rs113948889 rs111963484 12 2,102,086 2,084 C/A 1 hsa-miR-4270 DCP1B ENST00000535873 rs113948889 rs111963484 12 2,102,086 2,084 C/A 1 hsa-miR-4441 DCP1B ENST00000535873 rs113948889 rs111963484 12 2,102,086 2,084 C/A 1 hsa-miR-505-5p DCP1B ENST00000535873 rs113948889 rs112637373 12 2,102,271 99 G/T 1 hsa-miR-2909 DCP1B ENST00000535873 rs113948889 rs34730825 12 2,064,602 39,568 C/T 1 hsa-miR-92a-1-5p DCP1B ENST00000543381 Legend: Predicted miRNA target site SNPs in linkage disequilibrium with GWAS SNP rs113948889 listed in descending order of predicted effect on miRNA-to-mRNA binding. [score:11]
In addition to generating independent genetic association data, future work will need to extend our eQTL findings to the CNS, confirm the regulatory role of hsa-mir-138-5p on endogenous expression of DCP1B and other target genes and their corresponding proteins (in particular those potentially involved in human memory function, such as WWC1 [KIBRA]), and assess the role of this miRNA on their putative targets in vivo. [score:8]
In the GWAS results generated here, genes containing hsa-mir-138-5p targets identified by three or more of the prediction algorithms show a significant (P < 0.05 based on 100,000 permutations) enrichment for memory -associated SNPs as compared to genes not targeted by this miRNA (Supplementary Table 4), further supporting the notion that hsa-mir-138-5p represents a potential molecular regulator of human memory function. [score:6]
Hsa-mir-138-5p expression levels were comparable to those observed for hsa-miR-let-7b, a miRNA ubiquitously expressed in many human tissues including brain (and used here as positive control miRNA), in the same specimen (data not shown). [score:5]
Finally, expression profiling of both hsa-mir-138-5p and DCP1B mRNA in post-mortem brain tissue revealed that both putative interactants are co-expressed in brain. [score:5]
eQTL analyses on the potential role of rs9882688 in expression of hsa-miR-138-5p were performed using next-generation small RNA sequencing data of peripheral lymphoblastoid cell line (LCL) samples generated by the Genetic European Variation in Health and Disease (GEUVADIS) consortium (for a description of sequencing methods and data preparation, see Lappalainen et al., 2013). [score:5]
Regardless of the observed interindividual and regional expression differences, these experiments clearly demonstrate that both hsa-mir-138-5p and DCP1B mRNA are co-expressed simultaneously in both the hippocampi and frontal cortices in human brain, setting the temporal and spatial stage for an interaction of these two RNA molecules in vivo. [score:5]
Second, another conclusion of this study is that SNP rs9882688 is involved in the regulation of hsa-mir-138-5p expression. [score:4]
Although the lead GWAS signal (elicited by rs9882688) identified in this study was not predicted to interfere with miRNA-to-mRNA binding in silico, this SNP maps into a potential regulatory site 20 kb upstream of miRNA hsa-mir-138-1. The primary transcript of this miRNA is processed into two different mature products hsa-mir-138-5p and hsa-mir-138-1-3p, which are both expressed in humans (Landgraf et al., 2007). [score:4]
Among these were SNPs predicted to be involved in the expression and function of hsa-mir-138-5p, a miRNA known to be important in brain development and function. [score:4]
While co-transfection of the same reporter constructs with hsa-mir-138-5p to SH-SY5Y cells generally showed similar effects pointing in the same direction, the difference in luciferase expression between constructs containing the G- vs. [score:4]
qPCR of hsa-mir-138-5p revealed high expression of this miRNA in both hippocampal and frontal brain slices for all three individuals (Figure 3A). [score:3]
Landgraf (Landgraf et al., 2007) later showed that mir-138 was also highly expressed in adult human brain samples, including frontal cortex and hippocampus. [score:3]
Depicted are the mean Renilla luciferase intensities and the standard errors relative to the control luciferase intensities of the construct co -transfected with the non -targeting miRNA control (corresponding to the horizontal line): (A) for transcript ENST00000541700 containing the reference (G) or alternative (A) allele of rs1044950 and co -transfected with has-miR-138-5p into HEK293 and SH-SY5Y cells. [score:3]
Analysis of expression levels of hsa-miR-138-5p and DCP1B mRNA in human post-mortem brain tissueWhile both hsa-mir-138-1 (Landgraf et al., 2007) and transcripts of DCP1B (URL: http://human. [score:3]
Analysis of expression levels of hsa-miR-138-5p and DCP1B mRNA in human post-mortem brain tissue. [score:3]
Specifically, the presence of the minor G-allele of rs9882688 was associated with increased hsa-miR-138-5p expression levels (n = 309, beta = 80.87, standard error [SE] = 23.00, P-value = 0.000504, Figure 4). [score:3]
Figure 3Expression profile of hsa-miR-138-5p and DCP1B in autopsy brain tissues of three deceased human probands. [score:3]
These data suggest that the same SNP showing association with episodic memory performance in humans, also significantly correlates with changes in hsa-mir-138-5p expression in human peripheral cell lines. [score:3]
Expression levels of hsa-miR-138-5p showed a symmetrical, approximately normal distribution in the effective sample size of 309 individuals [as determined by the Shapiro–Wilk test implemented in R (P = 0.548) and quantile–quantile plotting, Supplementary Figure 1]. [score:3]
For instance, Miska (Miska et al., 2004) showed that mir-138 expression levels increase with age in the developing rat brain reaching their peak in juvenile and adult rats. [score:3]
In addition, we found that SNP rs1044950 (as proxy of another top GWAS signal) leads to allele-specific changes in the expression of reporter constructs containing the 3′UTR sequence of DCP1B transcripts predicted to contain binding sites for hsa-mir-138-5p in peripheral (HEK293, P = 0.047) and neuronal (SH-SY5Y, P = 0.0866) human cell lines. [score:3]
In addition to DCP1B, hsa-mir-138-5p is predicted to target a large number of different human transcripts in silico (ranging between a few hundreds to a few thousands depending on the prediction algorithm used). [score:3]
Third, linking the GWAS results for rs9882688 to this SNP's eQTL effects on hsa-mir-138-5p suggests that the same (i. e., G) allele increasing miRNA expression is associated with worse episodic memory performance (indicated by the negative beta-coefficient in Supplementary Table 1). [score:3]
Expression quantitative trait locus (eQTL) analyses of hsa-miR-138-5p using next-generation sequencing data. [score:3]
Thus, a potential effect of rs9882688 on the expression of hsa-mir-138-5p could be indicative of a more systematic involvement of this miRNA in human memory performance. [score:3]
Specifically, genotypes at SNP rs9882688 (which represented the lead memory GWAS signal in this study) were shown to correlate significantly with the expression of this hsa-mir-138-5p in human LCLs using next-generation small -RNA sequencing data. [score:3]
The resulting data set included 333 individuals of European descent with both hsa-miR-138-5p expression data and rs9882688 genotypes. [score:3]
In summary, by combining unbiased genome-wide screening with extensive in silico mo deling, in vitro functional assays, and gene expression profiling, our study identified hsa-mir-138-5p as a potential molecular regulator of human memory function. [score:3]
Thus, DCP1B and mir-138 function within the same general pathway, i. e., the degradation of mRNAs bound by miRNAs, likely including those targeted by hsa-mir-138 itself. [score:3]
Hsa-miR-138-5p was expressed in both frontal cortex (FC) and hippocampus (HC; C [T] ~ 19). [score:3]
For the eQTL analyses here, we downloaded normalized expression data of hsa-miR-138-5p for four populations of European descent [i. e., Utah Residents with Northern and Western European Ancestry (CEU), Finns (FIN), British (GBR), Toscani (TSI)] as released by the GEUVADIS project database (URL: http://www. [score:3]
In summary, the results of the luciferase reporter experiments suggest that SNP rs1044950 elicits allele-specific effects on the expression of constructs containing the corresponding DCP1B 3′UTR in the presence of hsa-mir-138-5p in vitro. [score:3]
In that study, mir-138 was found to act as a negative regulator of dendritic spine size possibly by tuning the activity of antagonistic signaling that regulate the actin cytoskeleton in spines. [score:3]
The results of these analyses revealed a significant dose -dependent effect of this SNP on hsa-mir-138-5p expression in these peripheral cell lines. [score:3]
More recently, mir-138 was identified as part of a functional screen for dendritic miRNAs that regulate spine morphogenesis in rats (Siegel et al., 2009). [score:2]
A functional screen implicates microRNA-138 -dependent regulation of the depalmitoylation enzyme APT1 in dendritic spine morphogenesis. [score:2]
In summary, in this study various lines of independent evidence converge on the notion that hsa-mir-138-5p may play a significant role in processes related to human episodic memory performance. [score:1]
The alternative T allele of the rs1044950 (highlighted in red) may alter binding affinity of hsa-miR-138-5p to the DCP1B 3′UTR and subsequently alter protein levels. [score:1]
While the novel experimental data generated here support the hypothesis that hsa-mir-138-5p plays an important role in physiological mechanisms involved in human memory performance, we note the following potential limitations of our findings. [score:1]
Our data, in which we observed multiple converging lines of genetic evidence suggesting a potential role of hsa-mir-138-5p in episodic memory performance, provide some first independent support of this hypothesis and extend it to humans. [score:1]
In HEK293 cells, co-transfections of the resulting 3′UTR Renilla vectors and hsa-mir-138-5p showed significant reductions of luciferase luminescence in comparison to co-transfections with the non -binding miRNA control (P [one−tailed] ≤ 0.000191), confirming our predictions that this miRNA binds to the corresponding 3′UTR in vitro (Figure 2A). [score:1]
Here they could lead to increased levels of hsa-mir-138-5p in A-allele carriers of rs1044950, i. e., similar to what is observed for rs9882688-G. Finally, it needs to be emphasized that the GWAS results reported here represent preliminary findings that need to be replicated in independent data sets. [score:1]
Notably, hsa-mir-138-5p is the same miRNA whose binding to DCP1B is also potentially affected by the presence of SNP rs1044950, as suggested by the in silico and in vitro experiments outlined above. [score:1]
In a review on the same topic Schratt hypothesized that miR-138-related pathways might also contribute to long-lasting forms of synaptic plasticity […]” (Schratt, 2009). [score:1]
This suggests that this miRNA, as opposed to hsa-mir-138-5p, does not bind to the corresponding DCP1B transcript, at least under these experimental conditions. [score:1]
Our RNA-profiling experiments using human frontal cortex and hippocampus samples clearly demonstrate that this is the case for hsa-mir-138-5p and DCP1B. [score:1]
The data from our study are in line with previous research on the potential role of mir-138 in mammalian brain function. [score:1]
The second strongest effect was estimated for rs1044950, which was predicted to interfere with the binding of hsa-miR-138-5p to the 3′ UTR of another DCP1B transcript (Figure 1B). [score:1]
[1 to 20 of 49 sentences]
15
[+] score: 140
To elucidate the effect of miR-138 on p53 in humans, we overexpressed miR-138 in p53 wild-type human H460 cells found no downregulation of the p53 mRNA expression levels (Fig. 5B). [score:8]
To explore the relation of p53 to miR-138, we firstly silenced p53 expression in human lung cancer H460 cells (p53 wild-type cells) using a p53 siRNA, and observed that the expression levels of miR-138 and its precursors were significantly downregulated in H460 cells (Fig. 1A). [score:8]
Overexpression of miR-138 in human H460 cells could not knock down p53 mRNA expression, while the p53 mRNA level decreased significantly in NIH/3T3 and H9C2 cells (Fig. 5B). [score:6]
org) in combination revealed that the 3′ UTRs of mouse and rat p53 mRNA have miR-138 target sites, but the 3′ UTR of human p53 mRNA has lost the miR-138 target sites because of mutations (Fig. 5E,F). [score:6]
In this study, we found that p53 could regulate miR-138 and was regulated by miR-138, and the mutual regulation between p53 and miR-138 was confirmed as species-specific; i. e., the regulatory effects between p53 and miR-138 are unidirectional in mouse and human cells, which would lead to different biological effects on the molecules downstream of p53 and miR-138. [score:6]
To further determine the regulations of miR-138 by p53 in human lung cancer cells, we compared the expressions of p53 and miR-138 in H460 and H1299 cells, which lack p53 expression. [score:5]
Correspondingly, the expression levels of mature miR-138 and its precursors increased significantly after overexpression of wild-type p53 in H1299 cells (Fig. 1D). [score:5]
Further analysis of the possible target sites of miR-138 in the 3′ UTRs of mouse, rat and human p53 mRNA using TargetScan (http://www. [score:5]
We found that miR-138 decreased significantly after p53 “knock down” and restored when p53 overexpression in human normal breast cell HBL-100 and normal liver cell L02 (Fig. 7A,B). [score:4]
To test the regulation of p53 on miR-138 in other species, we silenced the p53 expression in mouse NIH/3T3 cells and rat H9C2 cells (both p53 wild-type cells) using p53 siRNA. [score:4]
To further elucidate the differences in p53 regulation by miR-138 among mouse, rat and human, we performed further bioinformatic analysis of the target sites for miR-138 in p53. [score:4]
We further compared the relation between p53 and miR-138 in a series of human and rat tissues, and found a nearly positive expression correlation between miR-138 and p53 in human tissues (placenta, lung, breast, gallbladder and thyroid) while a negative expression correlation in rat tissues (placenta, heart, lung, kidney and liver) (Fig. 7D,E). [score:4]
Considering that miR-138 regulates p53 only in mouse and rat cells and that miR-138 could be regulated by p53 only in human cells, suggested that it is difficult to form the “ transcription factor – miRNA feedback loop” with same miRNA in the same cells, which may be important in stable gene regulation. [score:4]
Under these conditions, the mature level and the primary level of miR-138 were significantly upregulated (Fig. 1B). [score:4]
Surprisingly, the expression levels of miR-138 and its precursors showed no significant changes in these cells, which suggested that p53 regulation of miR-138 is species specific (Fig. 4A,B and Supplementary Fig. S3). [score:4]
Conversely, p53 was not downregulated by miR-138 (Fig. 7C). [score:4]
miR-138 is a transcriptional target of p53. [score:3]
However, unlike miR-138, miR-125b specifically target human p53 instead of mouse and rat (Fig. 6A,B). [score:3]
To elucidate whether p53 directly regulates the transcription of human miR-138 as a transcription factor, we searched for the potential binding sites of p53 in the 5 kb upstream and downstream genomic regions of the miR-138 transcript using p53MH algorithm 32 and BioSun software 33. [score:3]
To test whether p63 and p73 have transcriptional activation functions for these two binding sites in human miR-138 genes, we overexpressed the wild-type p63 and p73 in H1299 cells and co -transfected them with the reporter vector containing p53 binding sites. [score:3]
The expression level of miR-138 was significantly higher in H460 cells than in H1299 cells under both the natural state and under stimulation by ionizing radiation (Fig. 1C). [score:3]
Surprisingly, when we reviewed previous report concerning the regulation of p53 by miR-138 30, we found that the experiments were done only in mouse embryonic fibroblast cells and the majority of reports on the regulation of p53 by miRNAs were done in human cells (Fig. 5A). [score:3]
To rule out tissue and cell type-specific regulation differences, we further chosed human normal cell lines instead of other cancerous cell lines to test the regulation between p53 and miR-138. [score:3]
Mutual regulation differences of p53 - miR-138 in human, mouse and rat. [score:2]
How to cite this article: Li, J. et al. Species-specific mutual regulation of p53 and miR-138 between human, rat and mouse. [score:2]
MiR-138 targeting p53 shows divergence between species. [score:2]
P53 regulation of miR-138 shows divergence between species. [score:2]
The p53 -binding sites oligonucleotides (bold) contains XhoI at the 5′-end and HindIII sequence (italic) at the 3′-end (miR-138-1: 5′- CTCGAG ATCCTTGTCTGAAAGACATGGCC AAGCTT-3′; miR-138-2: 5′- CTCGAG TGTCTTGTTCCCTGTGGTGCCTCCCTTGCCT AAGCTT-3′) were separately inserted upstream of a minimal promoter of the luc2 gene and named pGL4-138-1 and pGL4-138-2. Reporter plasmids for the miRNA target assay: The almost full length human P53 3′ UTR (1496 nt, GenBank accession NM_001126114) was PCR amplified using genomic DNA from H460 cells. [score:2]
These results could confirm the existence of species-specific differences of the regulations between miR-138 and p53. [score:2]
Similarly, the transcriptional regulation of p53 on miR-138 was significantly stronger than that of p63 and p73 in H1299 cells (Fig. 3D). [score:2]
The p53 -binding sites oligonucleotides (bold) contains XhoI at the 5′-end and HindIII sequence (italic) at the 3′-end (miR-138-1: 5′- CTCGAG ATCCTTGTCTGAAAGACATGGCC AAGCTT-3′; miR-138-2: 5′- CTCGAG TGTCTTGTTCCCTGTGGTGCCTCCCTTGCCT AAGCTT-3′) were separately inserted upstream of a minimal promoter of the luc2 gene and named pGL4-138-1 and pGL4-138-2. Reporter plasmids for the miRNA target assay: The almost full length human P53 3′ UTR (1496 nt, GenBank accession NM_001126114) was PCR amplified using genomic DNA from H460 cells. [score:2]
P53 regulates miR-138 in human non-small cell lung cancer cells. [score:2]
Taken together, these results indicated that p53 acts as a transcriptional activator after interaction with the binding sites in the miR-138 gene. [score:1]
P53 -mediated activation of miR-138 in human NSCLC cells. [score:1]
The predicted p53 binding region of miR-138 was amplified from immunoprecipitates of anti-p53, anti-Histone H3 or normal rabbit IgG control. [score:1]
Nevertheless, when we mutated the miR-138 binding site in the 3′ UTR of human p53 mRNA, we found that miR-138 could obviously interact with the mutated binding and reduce the activity of the luciferase reporter (Fig. 5G). [score:1]
The human miR-138 family comprises hsa-miR-138-1 and hsa-miR-138-2, located on chromosomes 3p21.32 and 16q13, respectively. [score:1]
The mutated human P53 3′ UTR containing a predicted miR-138 binding site was cloned into pGL3-Control Vector and named H p53 mut-3′UTR. [score:1]
In fact, not only miR-138, miR-125b regulation of p53 also has species specificity, compared with miR-485 without this feature. [score:1]
ChIP analysis failed to identify p53 binding sites in the mouse and rat miR-138 gene region, which explains the lack of response of miR-138 transcription to p53 in mouse and rat cells (Fig. 4C,D). [score:1]
p53 binds to the predicted p53 binding site of hsa-miR-138. [score:1]
Although two miR-138 precursor molecules (pre-miR-138-1 and pre-miR-138-2) exist in human, mouse and rat, distributed on different chromosomes, the sequences of mature miR-138 were completely consistent in human, mouse and rat (Fig. 5C). [score:1]
shtml) of the 5 kb upstream and downstream genomic regions of the miR-138 gene in human, mouse and rat showed little homology between humans and mice or rats (Supplementary Fig. S1). [score:1]
The double-stranded oligonucleotides harbouring the p53 binding sequence (miR-138-1 sense: 5′-ATCCTTGTCTGAAAGACATGGCC-3′; miR-138-1 antisense: 5′-GGCCATGTCTTTCAGACAAGGAT-3′; miR-138-2 sense: 5′-TGTCTTGTTCCCTGTGGTGCCTCCCTTGCCT-3′, miR-138-2 antisense: 5′-AGGCAAGGGAGGCACCACAGGGAACAAGACA-3′) were end labelled by biotin (Invitrogen, Carlsbad, CA, USA). [score:1]
To amplify the potential p53 -binding sites from the upstream or downstream genomic regions of miR-138, real-time PCR was performed. [score:1]
These results further confirmed the existence of p53 REs in the upstream and downstream of the has-miR-138 gene and that p53 transcriptionally activates miR-138 by binding to these sites. [score:1]
That is, similar relation between p53 and miR-138 was found both in non-cancerous human cell lines and in NSCLC cell lines. [score:1]
A putative p53 binding site (BS) located −4285 to −4263 bp upstream of miR-138-1; a predicted p53 binding site located downstream (1569 to 1599 bp) of miR-138-2. (B) ChIP-qPCR analyses were preformed using digested chromatin from H460 cells. [score:1]
The relation between p53 and miR-138 in non-cancerous human cell lines and tissues. [score:1]
First, we analysed the conservation of miR-138, which showed that miR-138 is highly conserved in many vertebrates. [score:1]
After 48 h, quantitative RT-PCR was performed to examine miR-138 and pri-miR-138 levels. [score:1]
The miRNA mimic and siRNA sequences were as follows: miR-138 mimic, 5′-AGCUGGUGUUGUGAAUCAGGCCG-3′ (sense); p53 siRNA, 5′-UAUGAAUCGUCGUCCUAUUC-3′ (sense). [score:1]
[1 to 20 of 52 sentences]
16
[+] score: 112
Correlation analysis between miRNA and the predicted target mRNA expression levels showed that hsa-miR-138 were involved most frequently in significantly inversely correlated miRNA-target mRNA pairs. [score:7]
The proportion of significantly altered miRNAs that involved in predicted miRNA-target mRNAs pairs was shown in Fig.   4. The top 10 miRNA - target mRNA pairs that have the largest number of predicted results in prediction tools were listed in Table  4. Among them, seven of the top 10 miRNA-target mRNA pairs are related to hsa-miR-138. [score:7]
We identified a number of differentially expressed miRNA and its predicted mRNA, including hsa-miR-138 and its target EZH2. [score:5]
Secondly, correlation analysis suggested a highly significant negative correlation between expression levels of hsa-miR-138 and its potential target mRNAs of interest. [score:5]
Furthermore, the expression level of predicted target genes of hsa-miR-138-5p in trisomy 21 fetus, including zeste homolog 2 (EZH2) were further confirmed. [score:5]
These results indicated that EZH2 was a direct target of hsa-miR-138 in HEK293T cells. [score:4]
To test whether EZH2 was a direct target of hsa-miR-138, a construct of 3′UTR of EZH2 fused downstream of the firefly luciferase gene was generated. [score:4]
EZH2, has highly conserved putative hsa-miR-138 binding site within its 3′UTR, has been proved as one of directly targets of hsa-miR-138 [21]. [score:4]
Fig. 8Hsa-miR-138 downregulated EZH2 by interacting with its 3′UTR. [score:4]
In this research, we found that hsa-miR-138 is up-regulated in hippocampus from DS fetal. [score:4]
EZH2 is a direct target of hsa-miR-138. [score:4]
The results showed that hsa-miR-138 overexpression reduced the EZH2 3′UTR luciferase reporter activity compared to none-target control transfected group (Fig.   8a). [score:4]
Hsa-miR-138 mimics and none-target control were purchased from GenePharma. [score:3]
And the sequence are as follows: hsa-miR-138 mimics, Forward: 5′AGCUGGUGUUGUGAAUCAGGCCG 3′and Reverse: 5′GCCUGAUUCACAACACCAGCUUU 3′; none-target control, Forward: 5′ UUCUCCGAACGUGUCACGUTT 3′and Reverse: 5′ ACGUGACACGUUCGGAGAATT 3′. [score:3]
The expression of hsa-miR-138, hsa-miR-409 and hsa-miR-19 showed significant difference between two groups. [score:3]
While the mechanisms as to how hsa-miR-138 targets EZH to play roles in DS needs to be further studied. [score:3]
The function of hsa-miR-138-5p and its target EZH2 was involved in hippocampus in DS patients. [score:3]
Regulation of zeste homolog 2 (EZH2) expression by hsa-miR-138 was determined by luciferase reporter assay. [score:3]
The asterisks indicate the statistically significant difference Fig. 6The predicted targets of hsa-miR-138 and hsa-miR-409 were reduced examined by real-time PCR. [score:3]
a The pMIR-REPORT-EZH2 3′ UTR was cotransfected into HEK293T cells with hsa-miR-138 mimics or none-target control. [score:3]
The results implicated that hsa-miR-138 and its targets enhancer of zeste homolog 2 (EZH2) were involved in DS patients and potentially contributed in neurological deficiency in DS patients. [score:3]
Nevertheless, our data provide a clue regarding hsa-miR-138 and its targets EZH2 are associated with neurological deficiency in DS. [score:3]
In addition, luciferase assay indicated that EZH2 was a direct target of hsa-miR-138 in HEK293T cells. [score:3]
Hsa-miR-138 mimics or none-target control was transfected into HEK293T cells as well as 200 ng of pMIR-REPORT-EZH2 and 20 ng of pRL-renilla by lipofectmine 2000 (Invitrogen). [score:3]
The expression of hsa-miR-138 (a), hsa-miR-409 (b), hsa-miR-19 (c) and hsa-miR-204 (d) were tested in fetal hippocampus tissues of DS and control group. [score:3]
pMIR-REPORT-EZH2 3′ UTR was transfected with hsa-miR-138 mimics or none-target control together into HEK293T cells. [score:3]
The hsa-miR-138 has been previously demonstrated to have essential roles in tumor suppression. [score:3]
In addition, real-time PCR analysis showed that hsa-miR-138 overexpression significantly decreased EZH2 mRNA level in HEK293T cells (Fig.   8b). [score:3]
The function of hsa-miR-138 in cell proliferation and cell apoptosis may affect the normal development of hippocampus. [score:2]
The expression of hsa-miR-138 and hsa-miR-409 were obviously increased in DS group compared to control group. [score:2]
Cytoscape software suggested that hsa-miR-138 has the largest number of mRNA neighbors. [score:1]
The asterisks indicate the statistically significant difference EZH2 had a pupative hsa-miR-138 binding site with its 3′UTR. [score:1]
It is presumed that hsa-miR-138 and EZH2 could be involved in neurological deficiency of DS patients. [score:1]
[1 to 20 of 33 sentences]
17
[+] score: 95
Therefore, the downregulated expression of miR-138-5p and miR-422a potentially inhibited hTERT expression. [score:10]
Downregulation of miR-138 promotes metastasis by directly targeting TWIST2 and is associated with lymph-node metastasis, distant metastasis, and predicted poor prognosis in CRC (25). [score:7]
These mechanisms described above offered possible interpretations of the observed negative statistical association between the downregulated miR-138-5p and miR-422 and the overexpression of hTERT protein. [score:6]
In conclusion, our results confirm that miR-124-3p, miR-133a-3p, miR-133b, miR-138-5p, miR-150-5p, miR-378a-3p and miR-422a expression levels were downregulated in CRC and that miR-138-5p and miR-422a were found to potentially interact with hTERT. [score:6]
The results revealed that the expression level in CRC tissues of miR-124-3p, miR-133a-3p, miR-133b, miR-138-5p, miR-150-5p, miR-378a-3p and miR-422a (P<0.0001 for all) were statistically significantly downregulated when compared with the corresponding normal tissues. [score:5]
Mitomo et al (13) have shown that the overexpression of miR-138 induced a reduction in hTERT protein expression in human anaplastic thyroid carcinoma. [score:5]
A statistically significant difference in miR-138-5p expression was observed with regard to distant metastasis (P<0.000) while a significant difference in miR-422a expression was also noted between subgroups according to lymph-node metastasis (P=0.023). [score:5]
It has been shown that miR-138 may have an effect on tumor metastasis by targeting SOX4 and HIF1a in ovarian cancer and targeting MMP2/MMP9 in cholangiocarcinoma (23, 24). [score:5]
of the Kaplan-Meier method and log-rank test showed that the OS of CRC patients with a high -expression miR-138-5p was longer than that of patients with low -expression miR-138-5p (the estimated median OS time was 59 and 50 months, respectively), albeit the difference was not statistically significant (P=0.432, Fig. 4A). [score:5]
Thus, combined with the results of our study, the probability of miR-138-5p and miR-422a potentially inhibiting hTERT expression in CRC is valuable. [score:5]
Additionally, using luciferase reporter assay those authors confirmed target specificity between miR-138 and the hTERT 3′-untranslated region. [score:4]
Thus, miR-138-5p and miR-422a may be more likely to inhibit hTERT expression potentially compared to the remaining 5 miRNAs. [score:4]
Relationship between miR-138-5p and miR-422a expression and clinicopathological factors in CRC patients. [score:3]
However, a statistically significant difference in miR-138-5p expression was observed with regard to distant metastasis (P<0.000). [score:3]
In contrast to hTERT promoting tumor metastasis, miR-138 and miR-422a have been found to be potential tumor suppressors in certain types of cancer. [score:3]
Our results suggested that hTERT protein showed a significant negative correlation with the expression levels of miR-138-5p (r=−0.362, P=0.001) and miR422a (−0.306, P=0.005), while the correlation between hTERT and other miRNAs (miR-124-3p, miR-133a-3p, miR-133b, miR-150-5p and miR-378a-3p) revealed no significant negative correlation (Table IV). [score:3]
miR-138 was the first demonstrated hTERT -targeting miRNA. [score:3]
Three different miRNAs (miR138 in human anaplastic thyroid carcinoma cell lines, miR-1207 and miR1266 in gastric cancer) have been identified that may influence hTERT expression (12, 13). [score:3]
Our results suggest that hTERT protein showed a significant negative correlation with the expression levels of miR-138-5p (r=−0.362, P=0.001) and miR422a (−0.306, P=0.005). [score:3]
However, this results remains to be confirmed in future studies Similar to previous studies showing the downregulation of miR-138-5p and miR422a in cancer tissues, in our study, we investigated whether or not the decreased levels of miR-138-5p and miR-422a in CRC were associated with the clinicopathology and survival of patients. [score:2]
The expression levels of the 7 miRNAs (miR-124-3p, miR-133a-3p, miR-133b, miR-138-5p, miR-150-5p and miR-378a-3p, miR-422a) were found to be significantly decreased in 84 pairs of the CRC tissues when compared with their matched corresponding normal tissues using RT-qPCR. [score:2]
There were no significant variations in miR-138-5p between the subgroups regarding age, gender, tumor size, tumor site, differentiation, the depth of invasion, lymph-node metastasis and TNM stage. [score:1]
Notably, miR-138-5p or miR-422a may have a negative connection with hTERT in tumor cell proliferation and metastasis. [score:1]
Eight miRNAs with the potential to interact with hTERT were predicted: miR-29c-3p, miR-124-3p, miR-133a-3p, miR-133b, miR-138-5p, miR-150-5p, miR-378a-3p and miR-422a, respectively. [score:1]
[1 to 20 of 24 sentences]
18
[+] score: 94
The 6 upregulated miRNAs (mmu-miR-5132-5p, mmu-miR-3104-5p, mmu-miR-669c-5p, mmu-miR-705, mmu-miR-760-3p, mmu-miR-1962) and the 9 downregulated miRNAs (mmu-miR-146a, mmu-miR-138, mmu-miR-5123, mmu-miR-196b, mmu-miR-5099, mmu-miR-150, mmu-miR-145, mmu-miR-27a, mmu-miR-23a) chosen for validation were also based on their target genes predicted, whose functions are well relevant to inflammation and cancer. [score:9]
Clin Respir J. 39 Long L, Huang G, Zhu H, Guo Y, Liu Y, et al (2013) Down-regulation of miR-138 promotes colorectal cancer metastasis via directly targeting TWIST2. [score:7]
Among them, all the 16 colorectal cancers showed downregulated miR-138 and miR-150 levels (Figures 3A and 3D), and 15 out of the 16 colorectal cancers showed lower miR-145 and miR-146a expression levels than normal control (Figures 3B and 3C). [score:6]
As shown in Figure 3, in overall, the expression level of miR-138, miR-145, miR-146a and miR-150 were downregulated by approximately 3.37, 3.39, 2.56 and 4.99 fold in colorectal cancers than those in the matched adjacent normal mucosa (p<0.0001). [score:6]
Among the markedly changed miRNAs, the downregulated miRNAs, miR-138, 145, 146a and 150, were validated in both mouse and human tissues, particularly, in human colitis and colorectal cancer tissues, suggesting suppressing roles of miR-138, 145, 146a and 150 in colitis malignant transition via interacting with cytokines and inflammatory factors. [score:6]
miR-138 inhibited cancer cell growth and tumorigenesis in non-small cell lung cancer and nasopharyngeal cancer by targeting 3-phosphoinositide -dependent protein kinase-1 (PDK1) and CCND1 [38]– [40]. [score:5]
Unfortunately, no common inflammation- and cancer -associated targets for all of the 4 miRNAs (miR-138, 145, 146a and miR-150) were identified using miRNA target prediction tools. [score:5]
Please be noted that CCT3 and PAPPA were the common targets for miR-138, miR-146a and miR-150, and ZHX2 was the common target for miR-138, miR-145 and miR-150. [score:5]
As shown in Figure 5 and Table 2, there were 21, 13 and 25 common targets between miR-138 and miR-145, miR-146a and miR-150, respectively; there were 16 and 15 common between miR-145 and miR-146a and miR-150, respectively; and there were 7 common targets between miR-146a and miR-150. [score:5]
Although the observations were obtained from small sized samples, the trends of significant downregulation of miRNAs (miR-138, 145, 146a and miR-150) strongly suggested their clinical importance of linkage to chronic colitis and colitis -associated colorectal cancer, indirectly indicating their potential biological functions of involving in colitis malignant transformation. [score:5]
Our study further identified some common targets of the miR-138, 145, 146a and miR-150 (Table 2 and Figure 5), such as PAPPA (pregnancy -associated plasma protein A), CCT3 (chaperonin containing TCP1, subunit 3) and ZHX2 (zinc fingers and homeoboxes 2), which were the common targets of three miRNAs. [score:5]
Most recent studies reported that downregulated miR-138 sustained inflammatory factor NF-kB activation and promoted esophageal cancer progression [42], and that miR-138 response to pro-inflammatory cytokines depends on the stabilization of HIF1-α in primary human microvascular endothelial cells [43]. [score:4]
A, miR-138 was significantly downregulated in colitis. [score:4]
A, miR-138 was significantly downregulated in colorectal cancers. [score:4]
0099132.g003 Figure 3A, miR-138 was significantly downregulated in colorectal cancers. [score:4]
0099132.g004 Figure 4A, miR-138 was significantly downregulated in colitis. [score:4]
Previous studies have demonstrated tumor suppressor roles of miR-138 in cancer biology. [score:3]
Numbers of the common targets of the miRNAs (miR-138, 145, 146a and miR-150), and their network. [score:3]
In colorectal and ovarian cancers, miR-138 suppressed cancer cell migration and metastasis through interfered with TWIST2, SOX4 and HIF1-a [39], [41]. [score:3]
Back to our findings, that were, cytokines were significantly increased (Figure 6) and miR-138, 145, 146a and miR-150 were significantly decreased in Muc2 [−/−] mouse colon and human colitis and colorectal cancer, incorporating with the published observations, strongly support our hypothesis that the cytokine -associated miRNAs, miR-138, 145, 146a and miR-150, play important roles in chronic colitis malignant transformation through interfering with cytokines and inflammatory factors. [score:1]
[1 to 20 of 20 sentences]
19
[+] score: 64
Accordingly, the overexpression of MSI1, which is also a target of miR-138, abrogated the inhibitory effect of miR-138 on cell proliferation [55]. [score:7]
To address the significance of regulation of telomerase activity by endogenous miRNAs we electroporated inhibitors of miR-138, miR-342, miR-491, and miR-541 into Jurkat cells in which these miRNAs are expressed [42]. [score:6]
miR-138 was demonstrated to directly bind its target site in the hTERT 3′UTR and repress hTERT protein expression [31]. [score:6]
miRNAs miR-133a, miR-138, and miR-491, which specifically inhibited reporter activity, also directly inhibit telomerase activity in cells a few hours after treatment. [score:6]
These results suggest that endogenous miR-138, miR-342, miR-491, and miR-541 inhibit telomerase activity and their downregulation during tumorigenesis can results in activation of telomerase. [score:6]
All miRNAs inhibited reporter activity in assays with the PAX5 3′UTR reporter including miR-138 (site not predicted by TargetScanHuman but several binding sites were identified by PITA and RNAhybrid programs) [43], [44]. [score:4]
miR-138 was found to be downregulated in anaplastic T cell (ATC) leukemia and in aggressive variants of papillary thyroid carcinomas (PTC), in oral and head and neck squamous cell carcinomas (OSCC and HNSCC) as well as in lung, hepatic and gastric tumors [15], [31], [61]– [65]. [score:4]
miR-138-5p was shown to regulate hTERT in thyroid carcinoma cells by directly interacting with hTERT mRNA [31]. [score:3]
miR-133a, miR-138, miR-188, miR-342, miR-491, and miR-541 were co -transfected into HeLa cells with a reporter plasmid containing the appropriate 3′UTR and their ability to inhibit reporter activity was analyzed as described for the hTERT 3′UTR. [score:3]
The inhibitory effects of miR-138 and let-7g* were greatly reduced for mutated reporters. [score:3]
The experiments above demonstrated that the transfection of the miRNAs (miR-138, miR-188, miR-342, miR-491, miR-541) inhibit TCF7 and MSI1 3′UTR reporters, therefore, we analyzed their ability to alter the endogenous protein levels of these genes in DLD-1 cells (Figure 5). [score:3]
The luciferase activity of the WT reporter construct was significantly inhibited in cells transfected with precursors of let-7g*, miR-133a, miR-138, miR-342, miR-491, and miR-541 relative to cells transfected with the negative control. [score:3]
This gene was shown previously to be regulated by miR-138 [55] and our results demonstrated that it is also under regulation of miR-188, miR-342, miR-491, and miR-541. [score:3]
Further, the transfection of four of these six miRNAs (let-7g*, miR-133a, miR-138, miR-491) also decreased telomerase activity. [score:1]
The second group contained three miRNAs that are conserved among Bilateria or vertebrates (let-7g*, miR-133a and miR-138) (MIX2). [score:1]
The miR-138-5p was previously shown to bind a site in the hTERT 3′UTR [31]. [score:1]
Preliminary immunoprecipitation of Argonaute complexes with miR-138 supported the luciferase results suggesting that miRNAs effect is due to binding predicted miRNA sites (data not shown). [score:1]
Additional miRNAs for further analysis were selected based on their broad conservation across most bilaterian metazoans (miR-9-5p, miR-133a) or because they have previously been shown to interact with the hTERT 3′UTR (miR-138-5p, let-7g*) [31], [32]. [score:1]
The mixtures of miRNAs as well as scrambled control (SC) were always at a concentration of 60 nM; MIX1 (miR-491, miR-541, and miR-342), MIX2 (let-7g*, miR-133a, and, miR-138), MIX3 (MIX1+MIX2). [score:1]
miR-138-5p and -133a also have potential binding sites in two out of the three selected genes, while a miR-9 is predicted to have two sites in TCF7 (Figure 1b). [score:1]
[1 to 20 of 20 sentences]
20
[+] score: 56
miR-138 has been shown to inhibit osteogenic differentiation in telomerase immortalized bone marrow derived hMSC through down-regulation of FAK and subsequently down regulation of the FAK downstream targets RUNX2 and Osterix [21]. [score:9]
More recently, miR-138 was reported by Eskilden and coworkers to be a negative regulator of osteogenic differentiation through inhibition of the expression of Osterix (OSX) via targeting focal adhesion kinase (FAK) [21]. [score:8]
An unpaired t-test revealed 7 miRs with significant differences in expression: miR-146a-5p, miR-301b and miR-138 displayed higher expression in epiphyseal cells while miR-143, miR-146a, miR-34a and miR-145 displayed higher expression levels in diaphyseal cells (A). [score:7]
Only 7 miRs were identified with a statistically significant difference in expression between epiphyseal and diaphyseal cells (Figure 4A), namely: miR-146b-5p, miR-301b and miR-138 (higher expression in epiphyseal cells) and miR-143, miR-145, miR-146a and miR-34a (increased expression in diaphyseal cells). [score:7]
Relative expression (RT-qPCR) of miR-140, miR-138 and miR-146a in epiphyseal and diaphyseal cell populations (A–C) and the effect of differentiation media on expression in diaphyseal cells (D–F). [score:5]
Foetal epiphyseal cells expressed higher levels of miRs including miR-140 and miR-138 reported to promote chondrogenesis [20]– [22] while diaphyseal cells expressed miRs including miR-210 and miR-93 previously reported to promote osteogenesis [3], [23], [39]. [score:5]
Culture in osteogenic media failed to modulate the expression of miR-138, miR-140 and miR-146a (Figure 5D and E). [score:3]
miR-138, known to have anti-osteogenic effects was found to have a lower level of expression in diaphyseal cells (B). [score:3]
In addition, the effects of osteogenic and chondrogenic media on the expression of miR-140, miR-138 and miR-146a were examined. [score:3]
The use of osteogenic media did not affect the expression levels of miR-140, miR-138 and miR-146a compared to culture in basal conditions (D–F). [score:2]
Individual TaqMan assays confirmed the expression of the cartilage specific miR-140 and the anti-osteogenic miR-138 was higher in the epiphyseal cell populations (Figure 5A and B). [score:2]
A number of the miRs identified by the microarray analysis have already been described to be involved in the differentiation of SSC, namely; miR-146b-5p [25], [26], miR-138 [7], [21], miR-143 [8], [9], [27] and miR-145 [10], [28], [29]. [score:1]
miR-138 and miR-140, have previously been reported to have anti-osteogenic and pro-chondrogenic properties respectively [21], [24] and were found to display a higher expression in epiphyseal cell populations and thus selected for revalidation using individual TaqMan RT-qPCR assay to assess the consistency of data of the current study compared to current literature. [score:1]
[1 to 20 of 13 sentences]
21
[+] score: 53
Other miRNAs from this paper: hsa-mir-138-1
Of note, FAK siRNA pre-treatment did not affect the miR-138 expression (P > 0.05, Fig. 3a), indicating that FAK is likely the downstream target, rather than the upstream element of miR-138. [score:5]
In fact, our finding is consistent with that from another study, in which FAK is identified as the direct target for miR-138 during osteogenic differentiation of hBMSCs 29. [score:4]
Especially, miR-138 is also suggested to be a negative regulator of the BMSCs osteogenic differentiation 29 42, and antimiR-138 that acts to inhibit the endogenous miR-138 level is demonstrated to enhance the in vivo bone formation 29. [score:4]
Overexpression of miR-138 abrogates the ESW -induced osteogenesis. [score:3]
Therefore, for the first time, we find an alternative physical intervention, i. e. ESW, can interrupt the expression level of miR-138. [score:3]
Before, the stem cells (normal, siRNA pre -treated, miR-138 overexpressed, U0126 pre -treated) were washed and re-suspended with complete medium. [score:3]
In the present report, for the first time, we reveal a common underlying mechanism that inhibition of miR-138 by ESW (0.16 mJ/mm [2]) leads to significantly activate the FAK signaling with increased phosphorylation of FAK at tyr397 site (Fig. 4g). [score:3]
In addition, quantitative data from western blotting showed that the activation of FAK, ERK1/2 and RUNX2 were significantly inhibited by transfection of miR-138 mimics (Fig. 3c). [score:3]
These results, at least, indicate that miR-138 expression is inversely correlated with FAK during the ESW induced osteogenesis of MSCs (BMSCs, TDSCs, and ADSCs). [score:3]
The expression of miR-138 was detected by qRT-PCR using miScript SYBR Green PCR Kit according to the manufacturer’s protocol from Qiagen. [score:3]
The miR-138 expression was not affected by the pre-treatment of FAK siRNA. [score:3]
More importantly, the indispensable mechanism initiated by ESW, which goes from the inhibition of miR-138 to the elevation of RUNX2, is revealed step by step. [score:3]
As FAK gene was previously identified as a direct target for miR-138 during the osteogenic differentiation of hBMSCs 29, we next evaluated whether miR-138 is also involved in the promotion of osteogenesis induced by ESW. [score:2]
miR-138 is the upstream regulator of FAK signaling in the promotion of osteogenic differentiation induced by ESW. [score:2]
miR-138 mimics were successfully transfected into the cells (Fig. 3a). [score:1]
Regarding the downstream effectors of FAK in our study, ERK1/2 is proven as the main signaling activated by FAK, followed by RUNX2, as the osteogenic stimulation and elevation of RUNX2 induced by ESW was markedly abrogated in U0126 pretreated MSCs, without miR-138 and FAK activation affected. [score:1]
However, U0126 did not affect the alternation of miR-138 and p-FAK initiated by ESW (Fig. 4c–e). [score:1]
from Alizarin red staining show that transfection of miR-138 mimics significantly decreased the capability of osteogenic differentiation induced by ESW (P < 0.01, Fig. 3b). [score:1]
Here, our data on miR-138-FAK interaction is supported by gain of function of miR-138 would actually abolish the benefit effect induced by ESW via inactivating the FAK signaling, ERK1/2 and RUNX2. [score:1]
It has been reported previously that the ectopic expression of miR-138 significantly improved the efficiency of iPS cell generation via Oct4, Sox2, and Klf4, with or without c-Myc, without sacrificing the pluripotent characteristics of the generated iPS cells 41. [score:1]
In this study, we optimized the experimental conditions for transfection as following: the same initial cell seeding density (at passage 3), 4 × 10 [3] cell/cm [2]; cultured in medium without antibiotics and serum; concentration, 50 nM for both; required reaction time, miR-138 mimics (24 hours)/ FAK siRNA (48 hours). [score:1]
The FAK small interfering RNA (siRNA), siRNA control, miR-138 mimics and mimics control were synthesized according to designed sequences by GenePharma (Shanghai, China). [score:1]
miR-138 is significantly decreased post-ESW treatment. [score:1]
[1 to 20 of 23 sentences]
22
[+] score: 52
The cell type specific upregulated miRs (miR-520a-5p, -4271 and -4306 for hESCs and miR-140-3p, -210, -485 and -1271 for hMSCs) were predicted, or previously experimentally validated, to target HIF pathways inhibitors-HIF1AN and HIF3A while downregulated miRNAs (miR-138-5p, -92a-1-5p and miR-92a-2-5p in hESCs) were predicted to target HIF1A [56, 58]. [score:13]
The hESC (miR-520a-5p, -4271, and miR-4306) and hMSC (miR-138-5p, -140-3p, -210 and miR-1271) upregulated HRMs were predicted to target HIF pathway inhibitors; HIF1A inhibitor (HIF1AN) and HIF3A, respectively, creating a prospective HIF pathway positive feedback loop. [score:10]
Up-regulated (miR-138-5p, -195-5p, -379-5p, -181a-2-3p, and miR-629-5p) and down-regulated (miR-1246, -4485, -3175, and miR-663a) miRNA expression was confirmed with quantitative stem loop RT-PCR in hMSC derived RNA from two independent donor bone marrow samples (Fig 2c and 2d, S2a and S2b Fig). [score:9]
Further evidence of distinct behaviour was noted in relation to miR-138-5p which was downregulated and upregulated by hypoxia in hESC and hMSC, respectively. [score:7]
Conversely a number of previously described upregulated HRMs including miR-138, -195, -181a-2-3p, -485-3p, -210, 17-5p, -27a/b were also upregulated in hypoxic hMSC [56, 57, 58]. [score:7]
This includes miR-138-5p, miR-140, miR-17-5p and members of miR-143/145 cluster as upregulated HRMs which have been described elsewhere as having a role in suppression of hMSCs differentiation [48– 51]. [score:6]
[1 to 20 of 6 sentences]
23
[+] score: 48
This study describes how p19 affects the RNA world and shows that: i) miR-342, miR-206, miR-330, miR-138 and miR-99b are upregulated by p19 but not by p19W164A mutant; ii) anti-miR-206 can restore the G2 phase in the presence of p19; iii) p19 and p21Q61L regulate their own alternative splicing; iv) miR-206 and miR-138 are differentially regulated by p19 and p21 H-Ras and v) P19G12S Costello mutants show a clear upregulation of miR-374, miR-126, miR-342, miR-330, miR-335 and let-7. These results allow us to conclude that the H-Ras G12S mutation plays an important role in miRNA expression and open up a new line of study to understand the consequences of this mutation on Costello syndrome. [score:13]
Figure  3b, c show that miR-138 is clearly upregulated in KO H-Ras [(−/−)] mice that stably express pEGPP-19, whereas it is unaffected in KO H-Ras [(−/−)] mice that stably express pEGPP-21 (Fig.   3b). [score:8]
Hela cells line were used in all the experiments stated above P19 alters miRNAs expression but not the cell growth in H-Ras [(−/−)] KO cell linesIn order to further understand how the alternative splicing of H-Ras alters miRNAs, we differentially expressed pEGFP-p19 or pEGFP-p21 in H-Ras [(−/−)] KO MEFs and analyzed their effect on miR-206 and miR-138. [score:5]
miRNA upregulation by p19 H-Ras was re-validated by RT-PCR with a specific Taqman assay for mature miR-206, miR-342, miR-138 and miR-330 and was found to increase 2-, 1.6-, 16- and 2.5-fold, respectively, upon overexpression of p19 in three independent experiments and quadruplicate analysis. [score:5]
miR-138, a miRNA that suppresses invasion and promotes apoptosis in some carcinoma cells [36], was also studied. [score:3]
pEGFP-p19 also has a large effect on miR-138 in both KO MEFs and HeLa cells (Fig.   3b, c, respectively), thus indicating that the alternative splicing of H-Ras towards p19 or p21 affects the expression of several miRNAs. [score:3]
Candidate miRNAs were found to be miR-342, miR-206, miR-330, miR-138, and mirR-99b (Fig.   1a and 1), which vary with p19 but not with the specific p19mut overexpression. [score:3]
Hela cells line were used in all the experiments stated above In order to further understand how the alternative splicing of H-Ras alters miRNAs, we differentially expressed pEGFP-p19 or pEGFP-p21 in H-Ras [(−/−)] KO MEFs and analyzed their effect on miR-206 and miR-138. [score:3]
c Regulation of miR-138 in transient transfections in HeLa cells Fig. 4P19 H-Ras does not activate cell growth. [score:2]
Fig. 3P19 and p21 H-Ras differentially regulate miR-206 and miR-138. [score:2]
The regulation of miR-206 (a) and miR-138 (b) was analyzed in these cells with specific miRNA Taqman assays. [score:1]
[1 to 20 of 11 sentences]
24
[+] score: 39
On the other hand, expression of miR-138 was significantly higher in tumor tissues than in matched normal tissues (Figure 2D) and the expression levels of miR-26a and miR-124 were not significantly different between tumor and matched normal tissues (Figure 2E and F). [score:5]
On the other hand, it was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR-214 could inhibit the expression of EZH2 in some tumors. [score:5]
It was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR214 inhibit the expression of EZH2 in nasopharyngeal carcinoma, nasopharyngeal carcinoma, glioblastoma, hepatocellular carcinoma, head and neck squamous cell carcinoma, and neuroblastoma, respectively [21- 26]. [score:5]
On the other hand, miR-138 expression was significantly higher in tumor than in normal tissues and miR-26a and miR-124 expression was comparable between the two types of tissues. [score:5]
It was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR-214 were involved in the regulation of EZH2 expression in some human tumors such as nasopharyngeal carcinoma, nasopharyngeal carcinoma, glioblastoma, hepatocellular carcinoma, head and neck squamous cell carcinoma, and neuroblastoma [21- 26]. [score:4]
Considering that the expression and function of miRNAs may vary in different types of tumors, here we set out to investigate whether these miRNAs (miR-26a, miR-98, miR-101, miR-124, miR-138 and miR214) regulate tumor metastasis via altering EZH2 expression in human ESCC. [score:4]
MiR-26a, miR-98, miR-101, miR-124,miR-138 and miR-214 were reported to be decreased in some human tumors and posttranscriptionally regulate the expression of EZH2 [21- 26]. [score:4]
showed that the expression of miR-98 (A), miR-101 (B) and miR-214 (C) were significantly decreased in tumor tissue compared with the matched normal tissue; while that of miR-138 (D) was significantly increased in tumors tissue, and there was no significantly difference in the expression of miR-26a (E) and miR-124 (F) between the two groups. [score:4]
In the present study, we first examined the expression levels of MiR-26a, miR-98, miR-101, miR-124, miR-138 and miR214 in clinical samples of ESCC and matched normal tissues using qPCR. [score:3]
[1 to 20 of 9 sentences]
25
[+] score: 28
Of note, down-regulated miR-22 and up-regulated miR-138 were found to have significant association of simultaneous inverse expression in their target genes, DDIT4 (DNA-damage-inducible transcript 4) and ROCK2 (Rho -associated, coiled-coil containing protein kinase 2), respectively (p-value < 0.05). [score:11]
Although further studies for functional validation of target genes of DEMs are necessary, the present study indicates that altered expression of miR-138 and miR-22 may be associated with the maintenance of tumor heterogeneity HMM by regulating their target gene expression. [score:10]
One of the upregulated DEMs in our study, miR-138, has been reported to enhance cell survival, in vitro tumor sphere formation and in vivo tumorigenicity glioma [26]. [score:4]
Among them, ROCK2 and DDIT4 were found to be statistically significant targets of miR-138 and miR-22, respectively. [score:3]
[1 to 20 of 4 sentences]
26
[+] score: 28
miRNA Tissue type Mode of action Reference miR-491-5p Cervical cancerUnknown, inhibits hTERT Zhao et al., 2015 miR-1182 Gastric cancerBinds the ORF of hTERT mRNA, preventing translation Zhang et al., 2015 miR-1207-5p Gastric cancerRepresses hTERT in normal tissues Chen et al., 2014 miR-1266 Gastric cancerRepresses hTERT in normal tissues Chen et al., 2014 miR-138 Anaplastic thyroid carcinoma (ATC)Interaction with 3′UTR of hTERT to reduce protein expression Mitomo et al., 2008 let-7g Pulmonary fibrosisInteraction with 3′UTR of hTERT to reduce expression Singh et al., 2010 miR-133a Jurkat cellsInteraction with 3′UTR of hTERT to reduce expression Hrdličková et al., 2014 miR-342 Jurkat cellsInteraction with the 3′UTR of hTERT to reduce expression Hrdličková et al., 2014 miR-541 Jurkat cellsInteraction with the 3′UTR of hTERT to reduce expression Hrdličková et al., 2014 Non-coding RNAs can also target transcription factors involved in the control of hTERT. [score:17]
Downregulation of miR-138 is associated with overexpression of human telomerase reverse transcriptase protein in human anaplastic thyroid carcinoma cell lines. [score:6]
Overexpression of miR-138 induced a reduction in hTERT protein expression by interation with the 3′UTR in anaplastic thyroid carcinoma (ATC) (Mitomo et al., 2008). [score:5]
[1 to 20 of 3 sentences]
27
[+] score: 26
miR-138 expression is increased in both CNS white matter and oligodendrocytes, and has low expression in neurons and astrocytes. [score:5]
MiRNA-138 suppresses ovarian cancer cell invasion and metastasis by targeting SOX4 and HIF-1alpha. [score:4]
Demyelinated hippocampal sections of MS patients display reductions miR-138 expression (Dutta et al., 2013). [score:3]
Additionally, miR-138 targets the Sox4 transcription factor, a repressor of OL maturation (Potzner et al., 2007; Yeh et al., 2013). [score:3]
In vitro, miR-138 induced oligodendrocyte differentiation and expression of CNP and MBP. [score:3]
In contrast, sustained expression of miR-138 eventually leads to reductions in MOG protein, suggesting miR-138 may have a transient role in OPC differentiation and a Janus role in the transition to a mature OL. [score:3]
miR-138 is an additional miRNA with higher expression in mature oligodendrocytes compared with OPCs (Dugas et al., 2010). [score:2]
Furthermore, miRNA profiling in this murine mo del at multiple time points demonstrated increases in miR-138, -338, and -21 following HI (Birch et al., 2014). [score:1]
Notably, miR-138 is not as potent as other OL-promoting miRNAs such as miR-219 and miR-338 (Dugas et al., 2010). [score:1]
These results are unexpected due to impaired remyelination seen in KO mice, along with the increases of miR-138 and -338 in OPC differentiation, an impaired process in HI. [score:1]
[1 to 20 of 10 sentences]
28
[+] score: 24
We suggest that some miRNAs targeting this machinery (e. g., let-7, miR-27, miR-29, and miR-103) are expressed fairly wi dely, while others (e. g., miR-138 and miR-25) have lower and more restricted expression. [score:7]
In contrast, the only miRNA that targets Ago-2 is miR-138, which has so far been cloned only once in the cerebellum (Lagos-Quintana et al. 2002). [score:3]
What do our results imply regarding the mechanism of action?In analogy to plant miRNAs that have near perfect sequence complementarity and facilitate mRNA degradation, our predicted targets with near perfect complementarity between miRNA and mRNA plausibly are involved in mRNA cleavage (e. g., miR-196 and miR-138; see ). [score:3]
Ago-3 is also a top target for miR-138, with only two mismatches in its site. [score:3]
The target site for miR-138 has only one mismatch at position 8; this may induce a siRNA-like cleavage of the message (Hutvágner and Zamore 2002a; Doench et al. 2003). [score:3]
In analogy to plant miRNAs that have near perfect sequence complementarity and facilitate mRNA degradation, our predicted targets with near perfect complementarity between miRNA and mRNA plausibly are involved in mRNA cleavage (e. g., miR-196 and miR-138; see ). [score:3]
Our data suggest that the RNAi–miRNA machinery itself is under miRNA regulation; for example Dicer appears to be controlled by let-7 and miR-15b; Ago-1 by let-7 and miR-29b/c; Ago-2 by miR-138; Ago-3 by miR-138, miR-25, and miR-103; and Ago-4 by miR-27a/b. [score:2]
[1 to 20 of 7 sentences]
29
[+] score: 21
In addition, miR-138 was recently reported to directly target EZH2 [33] and miR-214 has been shown to directly target EZH2 during myogenesis [34]. [score:7]
The other candidate EZH2 binding miRNAs displayed a very similar pattern of expression: for example, the expression kinetics of miR-139 was similar to that of miR-101, and the expression pattern of miR-31 and miR-200b was comparable to that of miR-138 throughout differentiation (S4 Fig). [score:7]
Expression of EZH2 can be modulated by direct binding of miRNAs, including miR-101, miR-138 and miR-214, to EZH2 [33, 34, 52]. [score:4]
B. Relative expression of miR-101, miR-138, miR-214 and miR-124 during hepatocytes differentiation from hPSC- iEZH2 cell line doxy induced the first 8 days of differentiation. [score:3]
[1 to 20 of 4 sentences]
30
[+] score: 21
miR-138 is known to target SIRT1 and HIF-1α, which are two genes that have previously been associated with impaired monocyte responses [27, 28] and could plausibly contribute to the pathogenesis of this form of immunosuppression [29]. [score:5]
Our results are consistent with previous reports demonstrating an upregulation of miR-155 and miR-138 in response to stimuli such as LPS [24– 26]. [score:4]
Other miRNAs approaching significance with log2 fold changes up- or downregulation by greater than 1 included miR-10a, miR-133b, miR-138, miR-150, miR-155, miR-212, miR-362-3p, miR-518e, and miR-885-5p. [score:4]
miR-138 and miR-155 remained significantly upregulated when comparing impaired against naïve conditions at 17 h (Fig 5). [score:4]
In summary, we have shown that impaired monocytes express elevated levels of miR-155 and miR-138 and are associated with decreased p65 and TNF-α production. [score:3]
miRNA confirmation demonstrated that miR-155 and miR-138 were significantly elevated in the impaired monocyte. [score:1]
[1 to 20 of 6 sentences]
31
[+] score: 20
Finally, miR-375, miR-138 and miR-9 were selected for further analysis due to their down-regulation in clinical samples and their ability to induced phenotypic changes in vitro. [score:4]
To validate the identified phenotypes, the miRNAs that were down-regulated in clinical samples and Top-40 ranked in the phenotype screen (miR-150, miR-375, miR23b, miR-138, miR-139-5p and miR-9) were subjected to detailed functional analysis using HCT116, HT29, LS174T TR4, DLD1 TR7 and SW480 colon cancer cell lines. [score:4]
Figure S4 The expression of miR-9 and miR-138 in laser capture microdissected colorectal cancer tissue. [score:3]
miR-9 and miR-138 were expressed primarily by stromal cells from both normal colon mucosa and adenocarcinomas (Figure S4). [score:3]
The ectopic expression of miR-375, miR-9 and miR-138 significantly reduced the viability of more than one cell line (MTT reduction >20% and p≤0.05) (Figure 2A (HCT116) and Figure S2), possible due to a general anti-proliferative or pro-apoptotic role of these miRNAs. [score:3]
Detection of miR-375, miR-138 and miR-9 in laser microdissected colorectal tissue. [score:1]
To elucidate the cellular origin of miR-375, miR-138 and miR-9, we measured their expression in laser captured microdissected colorectal adenocarcinomas and adjacent normal colon mucosa (Figure 2E and Figure S4). [score:1]
In conclusion, the validation analysis confirmed the anti-proliferative role of miR-9 and miR-138, and the apoptosis inducing capacity of miR-375 as identified in the high-throughput analysis. [score:1]
[1 to 20 of 8 sentences]
32
[+] score: 19
In our analysis, three differentially regulated miRNAs categories were found: i) miRNAs upregulated in VP and CABG veins (miR-21/146a/221; Fig. 6A); ii) miRNAs upregulated in CABG but not in VP treatment (miR-138/200b/200c; Fig. 6B) and iii) one miRNA (miR-133a), that was more pronouncedly downregulated by VP than by CABG pressure (Fig. 6C). [score:11]
In keeping with this hypothesis, the search for putative targets of the miR-138/200b/200c signature in CABG-stimulated samples revealed, among others, a high probability of genes modulation functionally annotated in Notch, p53, HIF-1α, TGF-β and mTOR related pathways (S1 Table). [score:3]
Prediction of miR-138/200b/200c signature putative targets by functional annotation tools. [score:3]
In particular, the finding of micro -RNAs (miR138/200b/200c/133a) specifically up or down modulated by arterial-like pressure indicates the existence of biomechanically-regulated transcriptional circuitries governed by mechanical strain possibly related to epithelium(endothelium)-mesenchymal transition [51], vascular stress [52] or inflammatory [53] responses. [score:2]
[1 to 20 of 4 sentences]
33
[+] score: 19
Up-regulated miRNAs in NSCLC included miR-142-5p, miR-148b, miR-148a, miR-369-3p, miR-215, miR-152 and miR-155, whereas down-regulated miRNAs were miR-373 and miR-138-I. Some of these miRNAs have a well-characterized association with cancer progression, e. g., miR-10b, miR-21, miR-30a, miR-30e, miR-125b, miR-141, miR-200b, miR-200c, and miR-205 [90]. [score:5]
Down-regulation of miR-138 has been previously observed in tongue squamous cell carcinoma (TSCC) [118] and thyroid carcinoma [119]. [score:4]
In contrast, knockdown of miR-138 enhanced cell invasion and suppressed apoptosis. [score:4]
Ectopic transfection of miR-138 mimic suppressed cell invasion and led to cell cycle arrest and apoptosis. [score:3]
Two putative genes for miR-138 precursors have been located on chromosome 3p21.33 and 16q13, respectively, in human genome. [score:1]
Notably, loss of heterozygosity at both chromosome loci is a frequent event that has been associated to HNSCC progression and metastasis [120– 122], which could be due to reduced levels of miR-138. [score:1]
Particularly, lower miR-138 levels were consistently observed in all highly invasive cell lines. [score:1]
[1 to 20 of 7 sentences]
34
[+] score: 19
Li J. Chen Y. Qin X. Wen J. Ding H. Xia W. Li S. Su X. Wang W. Li H. Mir-138 downregulates miRNA processing in hela cells by targeting rmnd5a and decreasing exportin-5 stability Nucleic Acids Res. [score:6]
Interestingly, Li et al. showed that miR-138 regulates XPO5 stability by regulating required for meiotic nuclear division the expression of 5 homolog A (RMND5A). [score:5]
Additionally, in neck squamous cell carcinoma, miR-138 decreases the downstream E-cadherin gene (CDH1) and influences EMT by altering expression of EZH2, VIM and ZEB2 [60]. [score:3]
Liu X. Wang C. Chen Z. Jin Y. Wang Y. Kolokythas A. Dai Y. Zhou X. Microrna-138 suppresses epithelial-mesenchymal transition in squamous cell carcinoma cell lines Biochem. [score:2]
[58, 59] RMND5A RMNDA5A regulates XP05 stability together with miR-138. [score:2]
As expected, miR-138 is also processed by XPO5, but miR-138 represses the stability of XPO5 and decreases miRNA processing, indicating the existence of a feedback loop in the miR-138/RMND5A/XPO5 pathway [61]. [score:1]
[1 to 20 of 6 sentences]
35
[+] score: 18
Nevertheless 5 of our 19 downregulated miRNA in the cancer cell lines and ATC were reported as downregulated in at least one of these studies: let-7f, miR-26a, miR-138 and miR-141. [score:7]
Considering a fold-change of 1.5, only three miRNA were downregulated following TSH addition (hsa-miR-492 and hsa-miR-584 at 48 h and has-miR-138 at 72 h) and no miRNA was upregulated. [score:7]
Another miRNA (hsa-miR-138) was also downregulated after 72 hours of TSH treatment (Table1). [score:4]
[1 to 20 of 3 sentences]
36
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
In the further analysis, the authors showed that miR-138 had a restricted expression in atrioventricular canal, and it targeted atrioventricular canal domain genes by regulating retinoic acid synthesis and direct repression of chondroitin sulfate proteoglycan 2 (cspg2). [score:7]
Xia et al. (2011) Heart miR-218a-1/2 Zebrafish Knockdown, overexpression, ISH, luciferase reporter assay, qRT-PCR Heart field migration Fish et al. (2011) miR-138 Zebrafish Knockdown, antagomiR, ISH, luciferase reporter assay, qRT-PCR Cardiac patterning Morton et al. (2008) miR-21, miR-218a Zebrafish Knockdown, overexpression, ISH, qRT-PCR, luciferase reporter assay Heart valve formation Chiavacci et al. (2012) and Banjo et al. (2013) let-7e,f,g,h,i,j,k,l,m,n,o, miR-1a, miR-20, miR-21a,b,c, miR-29a,b, miR-103, miR-125, miR-126a,b, miR-128c, miR-145, and miR-199b Asian seabass qRT–PCR ? [score:5]
miR-138 knockdown during zebrafish cardiac development resulted in defects in elongation of ventricular cardiomyocytes and in early cardiac looping (Morton et al. 2008). [score:3]
In chicken, hypothalamic neuronal cell migration is mediated through miR-138 repression of RELN (Kisliouk and Meiri 2013). [score:1]
Soares et al. (2009) let-7a,b,c,f,i, miR-7b, miR-9-5p, miR-9-3p, miR-34b, miR-103, miR-107, miR-124a, miR-125a,b, miR-128, miR-129-3p, miR-132, miR-138, miR-181a,b, miR-216, miR-217, miR-219, and miR-375 Zebrafish Microarray, ISH ? [score:1]
Wienholds et al. (2005) let-7a,b,c, miR-9, miR-34, miR-92b, miR-124, miR-128, miR-135c, miR-137,miR-138, miR-153a, miR-219, miR-222 Zebrafish ISH ? [score:1]
[1 to 20 of 6 sentences]
37
[+] score: 18
Other miRNAs from this paper: hsa-mir-138-1
In vivo, miR-138 treatment potently suppresses glioma growth, decreasing the ratio of intratumoral Treg, reducing the expression of CTLA-4 and PD-1, and leading to a 43% increase in the median survival time [153]. [score:5]
Upon transfection into CD4+T cells, miR-138 could inhibit the expressions of CTLA-4, PD-1, and FoxP3 in T cells. [score:5]
MiR-138, a miRNA abundant in the brain, is a tumor suppressor, with its inhibition detected in multiple cancers. [score:5]
Both PD-1 and CTLA-4 are downstream targets for miR-138. [score:3]
[1 to 20 of 4 sentences]
38
[+] score: 17
The observation of downregulation of miR-138 in HNOC is consistent with a similar observation in thyroid cancer, in which the downregulation of miR-138 has also been associated with enhanced telomerase reverse transcriptase (TERT) expression [71]. [score:9]
Also, downregulation of several microRNAs has been consistently observed in HNOC, including miR-26b, miR-138, miR-107, miR-139. [score:4]
In addition, miR-138 appears to play an important role in embryonic development, as it is required for cardiac morphogenesis during embryonic development in a temporal knockdown zebrafish mo del [95]. [score:4]
[1 to 20 of 3 sentences]
39
[+] score: 17
miRNA target has-miR302a MECP2 hsa-miR29a TET1, TET2, TET3 has-miR29a/c DNMT3A, DNMT3B has-miR29b-1/2 DNMT1 (Indirect via SP1) hsa-miR148a DNMT3B hsa-miR148a DNMT1 hsa-miR152 DNMT1 has-miR302a DNMT1 (Indirect via AOF2) hsa-miR342 DNMT1 hsa-miR17-92 DNMT1 hsa-miR26a-1/2 EZH2 hsa-miR101-1/2 EZH2/EED hsa-miR214 EZH2 hsa-miR128-1/2 BMI-1 hsa-miR199a-1/2 BRM hsa-miR433 HDAC6 hsa-miR449a HDAC1 hsa-miR138 SIRT1In the first column we report a list of miRNAs which are known to target epigenetic regulators and in the second column the corresponding targets. [score:10]
In particular it was shown in Liu et al. (2013) that mir-138 is a suppressor of axon regeneration and that the switch between mir138 and Sirt1 is able to regulate mammalian axon regeneration in vivo. [score:4]
MicroRNA-138 and SIRT1 form a mutual negative feedback loop to regulate mammalian axon regeneration. [score:1]
The Sirt1 - mir138 loop. [score:1]
It has been recently shown in Liu et al. (2013) that Sirt1 is controlled by mir-138 which in turn is repressed by Sirt1. [score:1]
[1 to 20 of 5 sentences]
40
[+] score: 17
As determined, hsa_circ_0020397 acted as a miR-138 sponge and promoted the expression of miR-138 targets TERT and PD-L1, which promoted viability and invasion of colorectal cancer cells and inhibited their apoptosis [117]. [score:7]
A negative correlation between expression profiles of miR-138 and hsa_circ_0020397 was determined in colorectal cancer cells, where hsa_circ_0020397 was significantly upregulated [117]. [score:6]
Foxo3P and circ-Foxo3 were highly expressed in noncancerous cells and could function as miRNA sponges for several cancer -associated miRNAs, including miR-22, miR-136, miR-138, miR-149, miR-433, miR-762, miR-3614-5p, and miR-3622b-5p. [score:3]
Sry circRNA serves as the miR-138 sponge and contains 16 miR-138 binding sites [34]. [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 17
According to the initial microarray data analysis, the “Top 5” predicted miRNA targets of hsa_circRNA_101238 were hsa-miR-320b, hsa-miR-320a, hsa-miR-138-5p, hsa-miR-593-5p, and hsa-miR-320c (Figure 4A) out of which, three were downregulated in the TAD aortic specimen [4]. [score:6]
The low expression of hsa-miR-320a, hsa-miR-138-5p and hsa-miR-593-5p was validated in the TAD tissues using qRT-PCR (Figure 4C), whereas the high expression of MMP9 in the TAD tissues was detected byting (Figure 4D). [score:5]
Furthermore, we examined the expression levels of hsa-miR-320a, hsa-miR-138-5p, hsa-miR-593-5p and MMP9 in the TAD tissues as compared to the NA. [score:2]
C. qRT-PCR analysis shows the expression of hsa-miR-320a, hsa-miR-138-5p and hsa-miR-593-5p in the TAD tissues as compared to the normal controls. [score:2]
In this figure, hsa-miR-320a exhibited the highest degree, followed by hsa-miR-138-5p, hsa-miR-593-5p, hsa-miR-320b, and hsa-miR-320c. [score:1]
Similarly, SRY was another miRNA sponge that harbored 16 binding sites for miR-138 [13]. [score:1]
[1 to 20 of 6 sentences]
42
[+] score: 16
Therefore miR-138 appears to indirectly regulate PPARγ, an established transcription factor driving adipogenic gene expression in human MSCs [11]. [score:5]
For example, miR-138 is reported to be downregulated during adipogenic differentiation [77]. [score:4]
MiR-138 has been demonstrated to target the 3’UTR of EID-1, an interacting inhibitor of differentiation that can interact with SHP, an endogenous enhancer of adipogenic PPARγ2 [77]. [score:4]
In addition, overexpression of miR-138 in human multi-potent MSCs during adipogenesis could effectively reduce lipid droplet accumulation [77]. [score:3]
[1 to 20 of 4 sentences]
43
[+] score: 16
Overexpressed miRNA-138 was also shown to regulate the DDR by inhibiting expression of its target, H2AX, and reducing formation of foci of phosphorylated H2AX [19, 20]. [score:10]
Yang H. Luo J. Liu Z. Zhou R. Luo H. MicroRNA-138 regulates DNA damage response in small cell lung cancer cells by directly targeting H2AX Cancer Investig. [score:4]
Wang Y. Huang J. W. Li M. Cavenee W. K. Mitchell P. S. Zhou X. Tewari M. Furnari F. B. Taniguchi T. MicroRNA-138 modulates DNA damage response by repressing histone H2AX expression Mol. [score:2]
[1 to 20 of 3 sentences]
44
[+] score: 16
Two of the upregulated miRNAs (miR-222-3p, miR-138-5p) and two of the downregulated miRNAs (miR-125b-5p, miR-99a-5p) were confirmed to be significantly differentially expressed between iDCs and 27DCs (Figure 3). [score:9]
Among them, four miRNAs (miR-125b-5p, miR-138-5p, miR-222-3p, and miR-99a-5p), which potentially target genes involved in ErbB, Wnt, TGF-β, MAPK, and PI3K signaling pathways, were validated by RT-qPCR. [score:3]
From these results, miR-21-5p and miR-138-5p potentially target hepatitis C and influenza A virus, respectively. [score:3]
Four of these were confirmed by RT-qPCR (miR-99a-5p, miR-222-3p, miR-138-5p, and miR-125b-5p). [score:1]
[1 to 20 of 4 sentences]
45
[+] score: 16
Mir-138 was found upregulated in follicular lymphoma but downregulated in the GC subtype of diffuse large B cell lymphoma [28] [29]. [score:6]
Recently, mir-138 was shown to target acyl protein thioesterases (LYPLA1 and LYPLA2) able to regulate the palmitoylation of CD95 and apoptosis in chronic lymphoblastic leukemia [27]. [score:4]
Moreover, miR-323, mir-138 and miR-204 were more highly expressed in naïve and SE B cells. [score:3]
Our study identified 8 new differentially expressed miRNAs: mir-323, mir-138, mir-9*, mir-211, mir-149, mir-373, mir-135a and mir-184; that have not been reported in literature so far. [score:3]
[1 to 20 of 4 sentences]
46
[+] score: 16
Other miRNAs from this paper: hsa-mir-138-1
Up-regulation of miR-138 inhibits hypoxia -induced cardiomyocyte apoptosis via down -regulating lipocalin-2 expression. [score:9]
On the other side, the up-regulation of the miR-138 gene inhibits the hypoxia -induced cardiomyocyte apoptosis via down -regulating of LCN2 acting pro-apoptotic (Xiong et al., 2016). [score:7]
[1 to 20 of 2 sentences]
47
[+] score: 16
Other miRNAs from this paper: hsa-mir-21, hsa-mir-125b-1, hsa-mir-125b-2, hsa-mir-138-1
Again, miRNA-21, described to be upregulated [64], targets E2F (involved in cell cycle and apoptosis) and inhibits PTEN; miRNA-138, found to be downregulated [63, 64], targets the human telomerase reverse transcriptase (hTERT) gene which is also found to be totally downregulated in both ATC and PTC cell lines in comparison with normal thyroid tissues [64]. [score:16]
[1 to 20 of 1 sentences]
48
[+] score: 15
RT-PCR validation of mostly dysregulated miRs confirmed that miR-138, miR-147b, miR-148a, miR-99a, miR-455-3p and miR-125b were significantly upregulated and miR-31-star, miR-422a, miR-330-3p, mir-330-5p and miR-378d were downregulated in PANC-1-GR cell clones vs. [score:8]
MiR-screening revealed significantly upregulated (miR-21, miR-99a, miR-100, miR-125b, miR-138, miR-210) and downregulated miRs (miR-31*, miR-330, miR-378) in chemoresistant PDAC (p<0.05). [score:7]
[1 to 20 of 2 sentences]
49
[+] score: 15
The aforementioned hsa_circ_0020397 binds to miR-138 to inhibit the activity of miR-138 and promotes the expression of miR-134, which in turn regulates molecules such as telomerase reverse transcriptase and PD-L1 in colorectal cancer cells [66]. [score:6]
Whether circular SRY can be used as a ceRNA to inhibit miR-138 and regulate RhoC needs further discussion. [score:4]
Circular SRY binds to miR-138 and inhibits its activity [2]. [score:3]
Granados-Riveron JT Aquino-Jarquin G Does the linear Sry transcript function as a ceRNA for miR-138? [score:1]
MiR-138 SRY regulates the Ras homolog gene family member C (RhoC) mRNA. [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 15
Moreover, miR-138 reportedly induced cell cycle arrest by targeting CCND3 in hepatocellular carcinoma cells [37] and miR-592 inhibited cell proliferation by suppressing CCND3 expression in CRC [38] Similarly, miR-4779 efficiently induced cell cycle arrest and apoptosis by targeting CCND3, and further contributed to cell cycle arrest by suppressing PAK2 expression. [score:15]
[1 to 20 of 1 sentences]
51
[+] score: 14
Other studies have shown that over -expression of miR-138 inhibits osteogenic and adipogenic differentiation [92], [93]. [score:5]
In addition to miR-335 and miR-138, there are a number of other differentially-expressed miRNAs identified in the present study that will be worth pursuing in the context of cartilage biology; some of these are generally not well-reported in the literature and their functional roles in normal tissue development and homeostasis are unknown so far (e. g. miRs- 301, 502, 532, 660, 1244, 1247, 1290, 1291). [score:4]
Interestingly, it has also been demonstrated that miR-138 can promote induced pluripotent stem cell (iPS) generation via regulation of p53 [94]. [score:2]
This study is the first to report miR-138 in cartilage and that higher expression is associated with differentiated and hypertrophic chondrocytes when compared to precursor cells (∼12 fold and 17 fold difference, respectively; Tables 2 and 3 ). [score:2]
This clearly indicates that miR-138 can control cellular differentiation and may function through different mechanisms depending on the tissue microenvironment. [score:1]
[1 to 20 of 5 sentences]
52
[+] score: 14
To better understand the biological processes linked to differentially expressed miRNAs and their predicted target genes, we constructed an interaction network where rno-miR-674-5p, rno-miR-672-5p, rno-miR-138-5p and rno-miR-21-3p were found to be highly connected, which means that they may play crucial roles in the regulatory network. [score:6]
Interestingly, Wang et al. (2011) reported that miR-674-5p was able to stimulate the expression of osteogenic marker genes; miR-138-5p is a risk factor for pancreatic cancer (Yu et al., 2015) and Alzheimer’s disease (Lugli et al., 2015); and miR-21-3p increases resistance to cisplatin in a range of ovarian cell lines (Pink et al., 2015). [score:5]
Rno-miR-674-5p, rno-miR-672-5p, rno-miR-138-5p, and rno-miR-21-3p had high degrees of connectivity and may play crucial roles in this regulatory network. [score:2]
Rno-miR-674-5p, rno-miR-672-5p, rno-miR-138-5p, and rno-miR-21-3p were found to have the highest degrees of connectivity. [score:1]
[1 to 20 of 4 sentences]
53
[+] score: 14
Five miRNAs, miR-138, miR-30c, miR-125a, miR-125b and miR-31, were selected for their capacity to inhibit osteoblast gene expression [25- 28]. [score:5]
These were found to be targeted by miR-125b and miR-138 [23, 40], two miRNAs that we have shown to be increased in hOst incubated with hAdi-CM, suggesting that the transferred miRNAs are functional. [score:3]
We observed in hMSC-Ost incubated in hAdi-CM an increase in the adipogenic PPARγ, leptin, CEBPα and CEBPδ transcripts as well as the anti-osteoblastic miR-138, miR30c, miR125a, miR-125b, miR-31 miRNAs, probably implicated in the observed osteocalcin (OC) and osteopontin (OP) expression decrease. [score:3]
We observed in the osteoblastic population an increase in the adipogenic PPARγ, leptin, CEBPα and CEBPδ transcripts, dependent on mRNA amount as shown by conditioned media obtained from adipocytes at several differentiation stages and PPARγ silencing experiments, as well as the anti-osteoblastic miR-138, miR30c, miR125a, miR-125b, miR-31 miRNAs [23- 26], probably implicated in osteocalcin (OC) and osteopontin (OP) expression decrease. [score:3]
[1 to 20 of 4 sentences]
54
[+] score: 13
Morton et al. reported that miR-138 is expressed in specific domains of the zebrafish heart and is required to establish appropriate chamber-specific gene expression patterns. [score:5]
Furthermore, the authors demonstrated that miR-138 helps in establishing discrete domains of gene expression during cardiac morphogenesis by targeting multiple members of the retinoic acid signaling pathway [69]. [score:5]
Disruption of miR-138 function led to expansion in the expression of ventricular-specific genes, normally restricted to the atrio-ventricular valve region, and, ultimately, to disrupted ventricular cardiomyocyte morphology and cardiac function. [score:3]
[1 to 20 of 3 sentences]
55
[+] score: 13
, High Wycombe, UK) analysis of 1733 human microRNAs and validation by qRT-PCR showed microRNA-21, microRNA-99a, microRNA-100, microRNA-125b, microRNA-138, microRNA-147b, microRNA-148a, microRNA-210, microRNA-376a, and microRNA-455-3p to be significantly upregulated, whereas microRNA-31-star, microRNA-330-3p, microRNA-330-5p, microRNA-378d, microRNA-422a, and microRNA-486-5p were significantly downregulated. [score:7]
MicroRNA-21 (p = 4.3817E-07), microRNA-31 (p = 0.0003), microRNA-99a (p = 0.0406), microRNA-100 (p = 4.0492E-08), microRNA-125b (p = 0.0001), microRNA-138 (p = 0.0301), microRNA-147b (p = 0.0028), and microRNA-210 expression (p = 0.0044) were significantly upregulated in PDAC stage II vs. [score:6]
[1 to 20 of 2 sentences]
56
[+] score: 13
Other miRNAs from this paper: hsa-mir-20a, hsa-mir-204, hsa-mir-138-1, hsa-mir-346
For instance, miR-138, which is down-regulated during osteoblast differentiation of hBMSCs, functions as a negative regulator of osteogenic differentiation by targeting FAK and suppressing the FAK-ERK1/2 signaling pathway [13]. [score:9]
For example, miR-138, miR-204, and miR-20a have been reported to regulate osteoblast differentiation by targeting various osteoblast genes [13]– [15]. [score:4]
[1 to 20 of 2 sentences]
57
[+] score: 13
miR-138 (Table 6) from the second group (predicted for targeting the CD3EAP gene responsible for the CD3-epsilon subunit) was down-regulated, and miR-214 from the third group (predicted for targeting the CD247 gene responsible for the CD3-zeta subunit), was down-regulated in cancer tissues investigated in most of the studies. [score:9]
Since miR-378, miR-422a, miR-593, miR-494, miR-138 and miR-214 could target the CD3 subunits, some of which have been studied in different cancers and have been considered as biomarkers to detect cancer at the early stages, it is then highly likely that miRNAs damage the immune system so that it cannot distinguish cancer cells. [score:2]
From the first group only 6 miRNAs (miR-378, miR-422a, miR-593 and miR-494, miR-515 and miR-136), from the second group one miRNA (miR-138) and from the third group only one miRNA (miR-214) were identified and studied, based on their levels in tissues or blood sera of different cancer patients. [score:1]
One miRNA (miR-138) was found to be conserved and similar to the CD3EAP gene and three conserved miRNAs (miR-761, miR-214 and miR-3619-5p) were shown to be similar to the CD247 gene. [score:1]
[1 to 20 of 4 sentences]
58
[+] score: 13
mRNAs encoding SMAD4, NF-kappaB p65 and Cyclin D3 are targets of miR-138 and they were suppressed by miR-138 after CUR treatment. [score:5]
In contrast, inhibition of miR-138 was shown to increase the expression of SMAD4, NF-kappaB p65 and Cyclin D3. [score:5]
This was shown to occur by CUR inducing miR-138 expression. [score:3]
[1 to 20 of 3 sentences]
59
[+] score: 12
Furthermore, miR-138 was suggested to suppress the expression of prometastatic RhoC and other downstream signaling molecules FAK, Src, and Erk1/2 in HNSCC-derived cells [55]. [score:5]
At the molecular level, miR-138 regulated the expression of key EMT-related molecules like Fos-like antigen 1 (FOSL1), vimentin (VIM), zinc finger E-box -binding homeobox 2 (ZEB2), enhancer of zeste homologue 2 (EZH2), RhoC, and ROCK2 [52– 54]. [score:4]
Different studies have shown a role for miR-138 in the suppression of EMT, cell proliferation, migration, and invasion in HNSCC-derived cells. [score:3]
[1 to 20 of 3 sentences]
60
[+] score: 12
Other miRNAs from this paper: cel-let-7, cel-lin-4, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-101a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-132, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-132, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-138-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, rno-let-7d, rno-mir-7a-1, rno-mir-101b, mmu-mir-101b, hsa-mir-181b-2, mmu-mir-17, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-101-2, cel-lsy-6, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7a-2, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-92a-1, rno-mir-92a-2, rno-mir-101a, rno-mir-128-1, rno-mir-128-2, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-199a, rno-mir-181a-1, rno-mir-421, hsa-mir-181d, hsa-mir-92b, hsa-mir-421, mmu-mir-181d, mmu-mir-421, mmu-mir-92b, rno-mir-17-2, rno-mir-181d, rno-mir-92b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, mmu-mir-101c, mmu-let-7j, mmu-let-7k, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
A northern blot shows that rno-miR-138 expression was restricted to brain. [score:3]
We found that rat miR-138 also was expressed only in brain (Additional data file 4). [score:3]
A file (Additional data file 4) showing rno-miR-138 brain specific expression. [score:3]
In only a few cases did there seem to be discrepancies; for example, relative levels of expression of miR-138 at P4 compared to adult differed between the northern blots and the microarrays. [score:2]
The probes used were: EAM119 (miR-29b), EAM125 (miR-138), EAM224 (miR-17-5p), EAM234 (miR-199a), EAM131 (miR-92), EAM109 (miR-7), EAM150 (miR-9) and EAM103 (miR-124a). [score:1]
[1 to 20 of 5 sentences]
61
[+] score: 12
Other miRNAs from this paper: hsa-mir-182, hsa-mir-145, hsa-mir-138-1, hsa-mir-150
Especially in EOC, Yeh et al. [7] indicated the downregulation of miRNA-138 in the highly invasive cells, and its functioning as an inhibitor of cell migration and invasion; Wang et al. [8] found that miR-182 may act as an oncogenic miRNA and promote cancer cell growth, invasion, and chemoresistance by targeting PDCD4 in EOC cells; Wu et al. [9] suggested that miR-145 may modulate EOC growth and invasion by suppressing p70S6K1 and MUC1, functioning as a tumor suppressor. [score:12]
[1 to 20 of 1 sentences]
62
[+] score: 12
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Finally, other subsets of miRNAs were either up-regulated (miR-23a-3p, miR132-3p, miR-146a-5p, miR-154-3p, miR-181d-5p, miR-212-3p, miR-212-5p, miR-344b-5p, miR-380-3p, miR-410-3p, miR-433-3p and miR-3584; Fig. 2, Supplementary Fig. S4), or down-regulated (miR-29c-5p, miR-30a-5p, miR-30c-2-3p, miR-30e-3p, miR-138-5p, miR-140-3p, miR-551b-3p and miR-652-3p; Fig. 2, Supplementary Fig. S5) during all phases of the disease. [score:9]
Another subgroup of miRNAs displayed an opposite pattern, i. e. decreased expression during latency: miR-7a-1-3p, miR-107-3p, miR-138-5p, miR-139-3p, miR-186-5p, miR-204-5p, miR-222-3p, miR-324-3p and miR-505-3p were significantly decreased during latency (peak at 4 days after SE), then gradually returned to control levels (Fig. 2, Supplementary Fig. S2). [score:3]
[1 to 20 of 2 sentences]
63
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-210, hsa-mir-215, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-369, hsa-mir-371a, hsa-mir-340, hsa-mir-335, hsa-mir-133b, hsa-mir-146b, hsa-mir-519e, hsa-mir-519c, hsa-mir-519b, hsa-mir-519d, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-499a, hsa-mir-504, hsa-mir-421, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-190b, hsa-mir-301b, hsa-mir-302e, hsa-mir-302f, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-371b, hsa-mir-499b
Mitomo S. Maesawa C. Ogasawara S. Iwaya T. Shibazaki M. Yashima-Abo A. Kotani K. Oikawa H. Sakurai E. Izutsu N. Downregulation of miR-138 is associated with overexpression of human telomerase reverse transcriptase protein in human anaplastic thyroid carcinoma cell lines Cancer Sci. [score:6]
Several miRNAs have been linked with telomere maintenance; The TRF1 gene is known to be a target of miR-155 [32] and TERT transcripts themselves are targeted by miR-138 in human anaplastic thyroid carcinoma cell lines [33]. [score:5]
[1 to 20 of 2 sentences]
64
[+] score: 11
Other miRNAs from this paper: hsa-mir-134, hsa-mir-138-1
Other mechanisms for translation repression are, for example, Pumilio family binding to 3′-UTRs and promoting deadenylation, FMR1 protein binding to G-quartet of mRNAs and inhibiting translation, microRNA such as miR-134 and miR-138 blocking translation of LIMK and APT1F at synapse (Darnell et al., 2004; Schratt et al., 2006; Goldstrohm et al., 2008; Siegel et al., 2009; Maurin et al., 2014). [score:9]
A functional screen implicates microRNA-138 -dependent regulation of the depalmitoylation enzyme APT1 in dendritic spine morphogenesis. [score:2]
[1 to 20 of 2 sentences]
65
[+] score: 11
For example, miR-138 modulates metastasis and EMT in breast cancer cells by targeting vimentin [7], miR-122 regulates hypoxia-inducible factor-1 and vimentin in hepatocytes [47], miR-141 downregulates the expression of vimentin in renal tubular epithelial cells [48], and miR-200c suppresses vimentin [49, 50]. [score:11]
[1 to 20 of 1 sentences]
66
[+] score: 11
In parallel, several miRNAs, including miR-200, miR-34a, and miR-138, have been found to be down-regulated in cancer cells to allow PD-L1 expression (19 – 21). [score:6]
Zhao L., Yu H., Yi S., Peng X., Su P., Xiao Z., Liu R., Tang A., Li X., Liu F., and Shen S. (2016) The tumor suppressor miR-138–5p targets PD-L1 in colorectal cancer. [score:5]
[1 to 20 of 2 sentences]
67
[+] score: 11
Statistical analysis of other miRNAs relative to recurrence and other clinico-pathological variables (listed in Additional file 1) revealed only miR-138 as having a significantly higher expression in lower Stage I tumours (All GCTs p = 0.012; Adult-GCTs only p = 0.009; >stage I mean 0.29, [score:3]
Normalised expression values of a. hsa-miR-138-5p, b. hsa-miR-184, c. hsa-miR-204-5p, d. hsa-miR-29c-3p, e. hsa-miR-328-3p, and f. hsa-miR-501-3p in healthy normal granulosa cells (circle), juvenile-GCT (square) and adult-GCT (triangle) assessed using RT-qPCR. [score:3]
BCL2, involved in apoptosis (hsa04210) and PI3K-Akt signalling (hsa04151), was a common TarBase target for four of the six miRNAs (miR-138-5p, -204-5p, -29c-5p and -501-3p). [score:3]
We have validated six miRNAs as novel markers for subtype classification in GCTs with low levels of miR-138-5p correlating with early tumour stage. [score:1]
The six miRNAs did not correlate with these features although a trend towards significance (p < 0.09) was seen for miR-138 and miR-204 in the <10-cm tumours. [score:1]
[1 to 20 of 5 sentences]
68
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-370, hsa-mir-371a, hsa-mir-375, hsa-mir-378a, hsa-mir-133b, hsa-mir-423, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-520c, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-33b, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-509-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
[192] miR-33b Decrease lipogenesis via early B cell factor 1 (EBF1) targeting C/EBPα and PPARγ signaling[193] miR-93 Sirt7 and Tbx3[194] miR-125a ERRα[195] miR-130 Inhibition of adipogenesis by inhibiting PPARγ[66] miR-138 Inhibition of adipocyte differentiation via EID-1. Lipid droplet reduction[196] miR-145 Preadipocyte differentiation by targeting IRS1[197] miR-155 C/EBPβ pathway[198] mirR-193a/b Adiponectin production in the adipose tissue. [score:11]
[1 to 20 of 1 sentences]
69
[+] score: 11
For instance, the up-expressed miR-143 and miR-138 can, respectively, target the genes, HK2 and HK1, which are the crucial enzymes in glycolysis and so that lead to potential glycemia [28, 29]; miR-9 and miR-204 were reported that they can regulate the insulin secretion by targeting the gene, SIRT1 [30– 32], while miR-96 can decrease the expression of NOC2 which is involved in the insulin secretion [33]. [score:10]
The microRNAs filtered in intact comparison but not filtered in HFD comparison and no-T2D comparison, including miR-143-3p, miR-99a-5p, miR-138-5p, miR-1304-3p, and miR-33b-5p, might involve the progress of T2D fed with normal diets only. [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 10
Mitomo S. Maesawa C. Ogasawara S. Iwaya T. Shibazaki M. Yashima-Abo A. Kotani K. Oikawa H. Sakurai E. Izutsu N. Downregulation of miR-138 is associated with overexpression of human telomerase reverse transcriptase protein in human anaplastic thyroid carcinoma cell linesCancer Sci. [score:6]
Chakrabarti M. Banik N. L. Ray S. K. miR-138 overexpression is more powerful than hTERT knockdown to potentiate apigenin for apoptosis in neuroblastoma in vitro and in vivoExp. [score:4]
[1 to 20 of 2 sentences]
71
[+] score: 10
For example, downregulation of mir-138 was shown to be associated with h TERT overexpression in anaplastic thyroid carcinoma cells, and the enforced overexpression of mir-138 induced a significant reduction in h TERT expression through interaction with h TERT 3’UTR [173]. [score:10]
[1 to 20 of 1 sentences]
72
[+] score: 10
Although miR-138, which regulates osteogenesis in hMSCs has been shown to target FAK [21] and differential expression of miRNAs was reported as part of a study using rat MSC cultures on micro-grooved surfaces [26], we believe this is the first study to systematically identify changes to hMSC miRNA expression in response to substrate mechanical properties. [score:8]
Eskildsen T MicroRNA-138 regulates osteogenic differentiation of human stromal (mesenchymal) stem cells in vivoProc. [score:1]
Interestingly, the pro-osteogenic effect of miR-138 was mediated by its effects upon focal adhesion kinase (FAK), suggestive of a link between miRNA signalling, MSC mechanotransduction and MSC fate [21]. [score:1]
[1 to 20 of 3 sentences]
73
[+] score: 10
In hippocampal neurons, miR-138 inhibits the expression of acyl protein thioesterase 1, an enzyme that mediates depalmitylating α13 subunits of G proteins, which is required for enlargement of dendritic spines (Siegel et al., 2009). [score:5]
microRNA-138 modulates cardiac patterning during embryonic development. [score:2]
A functional screen implicates microRNA-138 -dependent regulation of the depalmitoylation enzyme APT1 in dendritic spine morphogenesis. [score:2]
MicroRNA-138 regulates osteogenic differentiation of human stromal (mesenchymal) stem cells in vivo. [score:1]
[1 to 20 of 4 sentences]
74
[+] score: 10
Downregulation of miR-138 is associated with overexpression of telomerase and the acquisition of malignant behavior in human anaplastic thyroid carcinoma cell lines [47]. [score:6]
Thereby, it is expected that targeting miR-138 would be useful as a diagnostic tool or might contribute to the development of new strategic treatments for specific kinds of carcinomas as already suggested for miR-378 [48]. [score:4]
[1 to 20 of 2 sentences]
75
[+] score: 10
Other miRNAs from this paper: mmu-mir-138-2, hsa-mir-138-1, mmu-mir-138-1
To that extent, the presence in the vDCP-NBs of SUMO proteins, which were shown in cultured cells to participate in intrinsic antiviral resistance to HSV-1 infection [23], strengthens the idea that PML-NBs in general and vDCP-NBs in particular are nuclear relays of the cellular intrinsic antiviral response to HSV-1. Studies performed in vivo and in vitro showed that VP16 expression likely plays a major role in the onset of the lytic program in neurons [60], and a neuron-specific microRNA, miR-138, targets ICP0 mRNA to prevent its synthesis [53]. [score:5]
Finally, a recent study demonstrated that a neuron-specific microRNA, miR-138, targets ICP0 mRNA, preventing ICP0 synthesis at least in cultured cells [53]. [score:3]
The absence of VP16 axonal transport, the stochastic regulation of its promoter, and the absence of ICP0 synthesis due to miR-138 activity are likely to lead to a nuclear environment that would favor the establishment of latency through the formation of vDCP-NBs and/or ML patterns, depending on the type I IFN signaling context of the infected neuron. [score:2]
[1 to 20 of 3 sentences]
76
[+] score: 9
For the latent stage, 18 consistently differentially expressed mature miRNA sequences were identified: 8 were up-regulated (miR-212-3p, miR-21-5p, miR-132-3p, miR-20a-5p, miR-17-5p, miR-27a-3p, miR-23a-3p, miR-146a-5p) and 10 were down-regulated (miR-139-5p, miR-551b-3p, miR-33-5p, miR-708-5p, miR-7a-5p, miR-935, miR-138-5p, miR-187-3p, miR-30e-3p, miR-222-3p) (Table  2). [score:9]
[1 to 20 of 1 sentences]
77
[+] score: 9
Of the 137 studied miRNAs with more than 50 targets found in the mRNA expression profiles, 67% (92) showed negative mean Pearson correlation coefficients with their targets, 18% (24, including miR-125b, miR-29a, and miR-194) and 7% (9, including let-7i, and miR-138) showed significantly stronger negative and positive, respectively, mean correlations with their targets than with all mRNAs (P < 0.05) [see Additional file 3]. [score:9]
[1 to 20 of 1 sentences]
78
[+] score: 9
In addition, miR-451, miR-27a, miR-21, miR-130a, miR-let-7, miR-137, miR-200c, miR-122, miR-138 and miR-10a/b were suggested to regulate ABCB1 gene expression indirectly by targeting other mRNAs that code the proteins associated with the activation of ABCB1 gene expression [72, 73, 74, 75, 76, 77, 78, 79]. [score:9]
[1 to 20 of 1 sentences]
79
[+] score: 9
Yang H. Luo J. Liu Z. Zhou R. Luo H. MicroRNA-138 regulates DNA damage response in small cell lung cancer cells by directly targeting H2AX Cancer Investig. [score:4]
For instance, a recent study reported that miR-138 could reduce the DNA damage repair capacity of small cell lung cancer (SCLC) cells by targeting H2AX which plays an important role in DNA repair by increasing the local concentration of repair factors near the lesion [78]. [score:3]
In addition, miR-138 plays a role in causing resistance to cisplatin in NSCLC by negatively regulating the ERCC1 gene which is involved in the NER pathway [82]. [score:2]
[1 to 20 of 3 sentences]
80
[+] score: 8
miR-138 suppresses cell proliferation and invasion by inhibiting SOX9 in hepatocellular carcinoma. [score:5]
has been shown to act as a miR-138 sponge by Hansen et al. and has demonstrated in vitro to have 16 putative target sites for miRNAs (Capel et al., 1993; Hansen et al., 2013a). [score:3]
[1 to 20 of 2 sentences]
81
[+] score: 8
Other miRNAs from this paper: hsa-mir-138-1
Interestingly, a recent paper [43] reported that the presence of downregulation of microRNA miR-138 expression may partially contribute to the gain of hTERT protein expression in ATC. [score:8]
[1 to 20 of 1 sentences]
82
[+] score: 8
Recent experimental studies showed that the down-regulation of mir-16, mir-101 and mir-138 in the t (14;18) -negative FL (follicular lymphoma) subset was connected to profound mRNA expression changes of potential target genes involving cell cycle control and apoptosis 64. [score:8]
[1 to 20 of 1 sentences]
83
[+] score: 8
Modulation of pulmonary miRNAs targeting p53 (miR-138 and miR-376c) and apoptosis (miR-98 and miR-350) is consistent with the notion that AMPK is involved in the p53 -mediated cell cycle arrest and apoptosis 2. Several miRNAs upregulated in the lung of metformin -treated mice, including miR-30b, miR-138, miR-239a, miR-342, and miR-574, are involved in stress response and inflammation and target NF κB or Tlr9 (Toll-like receptor). [score:8]
[1 to 20 of 1 sentences]
84
[+] score: 7
In the R5-supernatant treated LX2 cells, miR-3687 and miR-138-2* were the most upregulated (fold change, >2; p-value, <0.01) of all miRNAs while miR-4286 and miR-1260 were the most downregulated (fold change, >−2; p-value, <0.05). [score:7]
[1 to 20 of 1 sentences]
85
[+] score: 7
However, previous studies on hMSCs-Ad undergoing adipogenesis reported that miR-21 13, miR-22 14, miR-196 15, miR-27b 20, and miR-138 31 were either upregulated or downregulated, and miR-148a was not reported in hMSCs-Ad. [score:7]
[1 to 20 of 1 sentences]
86
[+] score: 7
Tanaka K, Kawano M, Itonaga I, Iwasaki T, Miyazaki M, S Ikeda S, et al. Tumor suppressive microRNA-138 inhibits metastatic potential via the targeting of focal adhesion kinase in Ewing's sarcoma cells. [score:7]
[1 to 20 of 1 sentences]
87
[+] score: 7
miR-124-3p is reported to radiosensitize human glioma cells by downregulating CDK4 [71], while CDK6 is a direct target of miR-138-5p and miR-491-3p/5p [35, 72]. [score:7]
[1 to 20 of 1 sentences]
88
[+] score: 7
Zhu et al recently found that miR-138, which is down-regulated in osteosarcoma, directly targets EZH2 transcript and can increase the sensitivity of osteosarcoma cells to cisplatin [59]. [score:7]
[1 to 20 of 1 sentences]
89
[+] score: 7
Other miRNAs from this paper: hsa-mir-138-1
In fact, it was reported that overexpression of miR-138 (mapped to 3p21) downregulated hTERT protein level but not hTERT mRNA in human thyroid carcinoma cell lines. [score:6]
It is thus unlikely that the miR-138 functions as a transcriptional repressor of hTERT [31]. [score:1]
[1 to 20 of 2 sentences]
90
[+] score: 7
In addition, treatment of inflammatory cytokines to periodontal ligament cells results in expressional changes of various miRNAs, such as miR-138, miR182 18, 19, suggesting that miRNAs which regulate periodontal tissue development and repair may be affected by inflammatory environmental cytokines and could result in impaired periodontal tissue regeneration. [score:5]
Zhou X MicroRNA-138 inhibits periodontal progenitor differentiation under inflammatory conditionsJ. [score:2]
[1 to 20 of 2 sentences]
91
[+] score: 7
In addition, ectopic expressions of miR-138 and miR-135 targeting the FAK 3′UTR reportedly suppress FAK -mediated tumor growth and invasion as well as drug sensitivity [150]. [score:7]
[1 to 20 of 1 sentences]
92
[+] score: 7
Yeh Y. M. Chuang C. M. Chao K. C. Wang L. H. MicroRNA-138 suppresses ovarian cancer cell invasion and metastasis by targeting SOX4 and HIF-1alpha Int. [score:4]
miR-138 also has a role in the inhibition of EMT and invasion in S KOV-3 ovarian cancer cells [74]. [score:3]
[1 to 20 of 2 sentences]
93
[+] score: 7
In this respect, the miRNAs targeting telomerase directly or indirectly, might serve as tumor suppressive genes in cellular processes, such as let-7g, miR-138, miR-1207 and miR-1266, which induced tumor senescence and death eventually [15– 17]. [score:7]
[1 to 20 of 1 sentences]
94
[+] score: 6
Other miRNAs from this paper: hsa-mir-145, hsa-mir-138-1, hsa-mir-494
CFTR may also be indirectly regulated by miR-138, which inhibits SIN3A [93], a transcriptional repressor that regulates the gene and alters its chromatin dynamics [56]. [score:6]
[1 to 20 of 1 sentences]
95
[+] score: 6
In contrast, miR-138 acts as negative regulator ofthe osteogenic differentiation of hBMSCs by targeting FAK and suppressing theFAK-ERK1/2 signaling pathway 7 23. [score:6]
[1 to 20 of 1 sentences]
96
[+] score: 6
Another 11 miRNAs (miR-206, miR-34a, miR-374, miR-424, miR-100, miR-101, miR-323, miR-368, miR-137, miR-138 and miR-377) were abundantly expressed in transdifferentiated neuronal progenitors. [score:3]
In contrast, 11 miRNAs (hsa-miR-206, hsa-miR-34a, hsa-miR-374, hsa-miR-424, hsa-miR-100, hsa-miR-101, hsa-miR-323, hsa-miR-368, hsa-miR-137, hsa-miR-138 and hsa-miR-377) were abundantly expressed in day 9 neuronal progenitors (Figures 1B and 2A). [score:3]
[1 to 20 of 2 sentences]
97
[+] score: 6
Five miRNAs were upregulated (miR-140, miR-099a, miR-099b, miR-030b, and miR-030c) and only one (miR-138-2) was downregulated in macroadenomas compared to microadenomas. [score:6]
[1 to 20 of 1 sentences]
98
[+] score: 6
Xu J Li L Yun HF Han YS MiR-138 promotes smooth muscle cells proliferation and migration in db/db mice through down-regulation of SIRT1Biochem. [score:3]
Of these, rs1052299 was predicted to create novel -binding sites for two highly conserved miRNAs affecting bone and muscle 36– 38 -miR-133a-5p and miR-138-5p—and is more likely to affect miRNA -mediated regulation of TOM1L2. [score:2]
Eskildsen T MicroRNA-138 regulates osteogenic differentiation of human stromal (mesenchymal) stem cells in vivoProc. [score:1]
[1 to 20 of 3 sentences]
99
[+] score: 6
In addition, miR-138 suppresses expression of p53 and its downstream genes, and significantly enhances iPSC generation [41]. [score:5]
Ye D Wang G Liu Y Huang W Wu M MiR-138 promotes induced pluripotent stem cell generation through the regulation of the p53 signalingStem Cells. [score:1]
[1 to 20 of 2 sentences]
100
[+] score: 6
The analysis for the KC animals compared to controls revealed that miR-150, miR-494, miR-138, miR-148a*, miR-216a, and miR-217 (p-value = 0.01) were significantly downregulated (Table 1), whereas, miR-146b, miR-205, miR-31, miR-192, and miR-21 (p-value = 0.01) were significantly upregulated (Table 2). [score:6]
[1 to 20 of 1 sentences]