miRBase entry: hsa-mir-138-2

Stem-loop hsa-mir-138-2


Accession
MI0000455
Symbol
HGNC: MIR138-2
Description
Homo sapiens hsa-mir-138-2 precursor miRNA mir-138
Gene
family?
RF00671; mir-138

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR138-2 is a microRNA encoded by a specific genomic locus in mice, with its expression being post-transcriptionally regulated and detectable in tissues where a certain Dicer inhibitor is absent [PMC2647296]. Unlike other microRNAs with proximal NKX2-5 binding sites, MIR138-2 is not dysregulated, suggesting a unique regulatory mechanism [PMC6828809]. It has been identified as one of the microRNAs significantly associated with CAG length in the brain and has been implicated in various biological processes, including cancer [PMC5764268]. MIR138-2 has also been linked to tumor suppression and other cancer-related processes [PMC9763387]'>PMC9763387], as well as to type 2 diabetes through differentially methylated regions associated with the gene [PMC9763387]. This locus has undergone duplication events, indicating its potential importance in genomic variation and disease association [PMC8005705].

Literature search
226 open access papers mention hsa-mir-138-2
(1607 sentences)

Sequence

73255 reads, 512 reads per million, 82 experiments
cguugcugcAGCUGGUGUUGUGAAUCAGGCCGacgagcagcgcauccucuuacccgGCUAUUUCACGACACCAGGGUUgcauca
.(.(((.((..(((((((((((((...(((((..(((.((......)))))...)))))..))))))))))))).)).))).).

Structure
c u   u  AG             UCA     -ac   c  cg 
 g ugc gc  CUGGUGUUGUGAA   GGCCG   gag ag  c
 | ||| ||  |||||||||||||   |||||   ||| ||   
 c acg UG  GACCACAGCACUU   UCGgc   uuc uc  a
a u   U  -G             -UA     cca   -  cu 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr16: 56858518-56858601 [+]

Disease association
hsa-mir-138-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-138-5p

Accession MIMAT0000430
Description Homo sapiens hsa-miR-138-5p mature miRNA
Sequence 10 - AGCUGGUGUUGUGAAUCAGGCCG - 32
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-138-2-3p

Accession MIMAT0004596
Description Homo sapiens hsa-miR-138-2-3p mature miRNA
Sequence 57 - GCUAUUUCACGACACCAGGGUU - 78
Evidence experimental
cloned [2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739