MIR138-2 is a mouse microRNA that is post-transcriptionally regulated and its expression is dependent on the presence or absence of a certain inhibitor of Dicer in tissues like kidney and liver [PMC2647296]. H19, another microRNA, can sequester hsa-miR-107, leading to the release of NF1 expression in NSCLC tumor tissues [PMC7279016]. Despite having proximal NKX2-5 binding sites, MIR138-2 was not dysregulated [PMC6828809]. In a meta-analysis study, MIR138-2 was found to be significantly associated with CAG length in the meta-analysis of Series 1 6 and 10-month data [PMC5764268]. MIR138-1 and MIR138-2 are two distinct genes that encode miR-138 [PMC7376782]. The duplication of the MIR138-2 locus has been identified as one of the copy number variations (CNVs) associated with miR-138 expression [PMC8005705]. miR-137 is expressed from a single locus on Chromosome 3, while miR-138 has two distinct genomic loci (Mir138-1 and MIR138-2) on Chromosomes 8 and 9 in mice [PMC6836737]. In addition to its role in gene regulation during early embryonic development, miR290 has also been associated with maintaining pluripotent cell state [PMC4430308]. Furthermore, MIR138-2 has been implicated in cancer processes such as tumor suppression [PMC9763387].
c u u AG UCA -ac c cg g ugc gc CUGGUGUUGUGAA GGCCG gag ag c | ||| || ||||||||||||| ||||| ||| || c acg UG GACCACAGCACUU UCGgc uuc uc a a u U -G -UA cca - cu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000430 |
Description | Homo sapiens hsa-miR-138-5p mature miRNA |
Sequence | 10 - AGCUGGUGUUGUGAAUCAGGCCG - 32 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004596 |
Description | Homo sapiens hsa-miR-138-2-3p mature miRNA |
Sequence | 57 - GCUAUUUCACGACACCAGGGUU - 78 |
Evidence |
experimental
cloned [2] |
|