sort by

668 publications mentioning hsa-mir-145 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-145. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 339
miR-145 is significantly down-regulated in ESCC tissues and cell lines compared with normal tissues and cell lines [4, 5, 6, 7], and up-regulation of miR-145 can significantly suppress proliferation, migration, and invasion as well as epithelial–mesenchymal transition (EMT) of ESCC cells by targeting connective tissue growth factor (CTGF) [8]. [score:10]
miR-145 inhibits drug resistance to oxaliplatin in colorectal cancer cells by suppressing the expression level of target gene GPR98 [30]. [score:9]
Low expression of miR-145 is associated with poor prognosis in NSCLC, and silencing lincRNA ROR posttranscriptionally regulates the expression of p53, while silencing ROR or p53 could upregulate miR-145 levels [21]. [score:9]
In ESCC, miR-145 is commonly downregulated, and overexpression of miR-145 in esophageal ECA109 and EC9706 cells could inhibit cell proliferation and induce apoptosis [9]. [score:8]
Han et al. reported that miR-145 could bind with the 3′UTR of connective tissue growth factor (CTGF) in dual luciferase reporter gene assay, and up-regulation of miR-145 or down-regulation of CTGF could suppress the proliferation, migration, invasion and EMT process of ESCC ECA109 cells [8]. [score:8]
We further found that overexpression of miR-145-5p negatively regulated transcription factor Sp1 and inhibited the NF-κB signaling pathway via decreasing the expression of NF-κB (p65). [score:8]
Ding Y. Zhang C. Zhang J. Zhang N. Li T. Fang J. Zhang Y. Zuo F. Tao Z. Tang S. miR-145 inhibits proliferation and migration of breast cancer cells by directly or indirectly regulating TGF-β1 expressionInt. [score:8]
Our results confirmed that miR-145-5p was down-regulated in ESCC tissues, and overexpression of miR-145-5p inhibited cell proliferation, migration, invasion and EMT of ESCC cells. [score:8]
Previous studies also reported that overexpression of miR-145 could reduce target gene fascin-1 (FSCN1) expression [26, 32]. [score:7]
LincRNA CRNDE was highly expressed in gastric cancer cells, and overexpression of CRNDE increased cell viability and promoted colony formation via sponging miR-145 and activation of its target gene E2F3 [36]. [score:7]
Very importantly, we further found that overexpression of miR-145-5p inhibited the transcription of EMT associated transcription factor Slug via suppression of the Sp1/ NF-κB signaling pathway. [score:7]
Overexpression of miR-145 decreases the proliferation, migration and invasion of breast cancer cells via directly or indirectly reducing transforming growth factor-β (TGF-β) expression [28]. [score:7]
In gastric cancer cells, especially cancer stem cells (CSCs), miR-145 regulates CD44 by directly targeting the CD44 3′-untranslated region (3′-UTR) [27]. [score:7]
miR-145-5p is down-regulated in many types of cancer including cervical cancer, non-small cell lung cancer (NSCLC), colorectal cancer and ESCC, and functions as tumor suppressor in carcinogenesis [5, 8, 20, 21, 22, 23]. [score:6]
Importantly, knockdown of Sp1 or NF-κB (p65) and inhibition of the NF-κB signaling pathway using CAPE phenocopied the effects of miR-145-5p overexpression on the respective tumor cell phenotypes. [score:6]
Cui et al. found that miR-145 directly targeted the 3′UTR of phospholipase C epsilon (PLCE1) and then inhibited cell proliferation, migration and metastasis, as well as controlling the cytoskeleton dynamics of esophageal cancer [4]. [score:6]
Sp1 could transcriptionally regulate the expression of NF-κB (p65), and miR-145-5p could target Sp1 [16, 17, 18, 19]. [score:6]
Li et al. found that ginsenoside 20(S)-Rg3, a pharmacologically active component of Panax ginseng, could increase miR-145 expression by downregulating methyltransferase DNMT3A to attenuate the hypermethylation of the promoter region in the miR-145 precursor gene [33]. [score:6]
Wang et al. further found that miR-145 inhibited the proliferation and invasion of ESCC ECA109 and EC9706 cells in part by targeting c-Myc [6]. [score:5]
Very interestingly, in our study, the results showed that miR-145-5p mimics significantly inhibited the protein and mRNA expressions of Sp1 (Figure 4A–C). [score:5]
2012.12.031 23276710 8. Han Q. Zhang H. Y. Zhong B. L. Wang X. J. Zhang B. Chen H. MicroRNA-145 Inhibits Cell Migration and Invasion and Regulates Epithelial-Mesenchymal Transition (EMT) by Targeting Connective Tissue Growth Factor (CTGF) in Esophageal Squamous Cell CarcinomaMed. [score:5]
Overexpression of miR-145-5p Inhibits the Transcription of Slug via the Sp1/NF-κB Signaling Pathway. [score:5]
NF-κB is reported to regulate Slug transcription directly [15], and we evaluated whether miR-145-5p mimics inhibited the transcription of Slug via suppression of the NF-κB signaling pathway. [score:5]
In the present study, we found that overexpression of miR-145-5p using mimics inhibited the proliferation, migration, invasion and EMT of esophageal cancer cells. [score:5]
In bladder cancer cells, miR-145 is down-regulated and its mimics reduce the Warburg effect by directly silencing kruppel like factor 4 (KLF4) [29]. [score:5]
Li J. Lu J. Ye Z. Han X. Zheng X. Hou H. Chen W. Li X. Zhao L. 20(S)-Rg3 blocked epithelial-mesenchymal transition through DNMT3A/miR-145/FSCN1 in ovarian cancerOncotarget 2017 10.18632/oncotarget. [score:5]
Overexpression of miR-145-5p Inhibits Cell Proliferation, Migration, Invasion and EMT of ESCC Cells. [score:5]
We compared the miRNA expression profiles between ESCC tissues and paracancerous tissues using Agilent Human miRNA Microarray, and found that miR-145-5p was down-regulated in ESCC tissues (Figure 1A). [score:5]
In ESCC, down-regulation of miR-145 was commonly epigenetically regulated by promoter hypermethylation [10]. [score:5]
U6 was used as an internal control, and the mRNA expression of miR-145-5p was normalized to the endogenous expression of U6. [score:5]
Wang et al. reported that overexpression of miR-145 using the pLVX-IZ-miR-145 vector significantly inhibited esophageal cancer cell ECA109 proliferation, and increased the number of cells at the G2/M stage and the cell apoptotic rate [31]. [score:5]
Zhang et al. also reported that overexpression of miR-145 significantly inhibited cell proliferation and induced apoptosis [9]. [score:5]
Overexpression of miR-145-5p significantly inhibited cell proliferation of KYSE150 and KYSE510 cell lines (Figure 2B,C). [score:5]
Kano M. Seki N. Kikkawa N. Fujimura L. Hoshino I. Akutsu Y. Chiyomaru T. Enokida H. Nakagawa M. Matsubara H. miR-145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinomaInt. [score:5]
Qiu T. Zhou X. Wang J. Du Y. Xu J. Huang Z. Zhu W. Shu Y. Liu P. miR-145, miR-133a and miR-133b inhibit proliferation, migration, invasion and cell cycle progression via targeting transcription factor Sp1 in gastric cancerFEBS Lett. [score:5]
Using Transwell assay, we found that miR-145-5p overexpression significantly inhibited the migration and invasion of ESCC cells (Figure 2E–G). [score:4]
These results suggested that miR-145-5p inhibited the proliferation of ESCC cells via down -regulating CCND1, CCNA2 and CCNE1. [score:4]
Fu Q. Cheng J. Zhang J. Zhang Y. Chen X. Xie J. Luo S. miR-145 inhibits drug resistance to Oxaliplatin in colorectal cancer cells through regulating G protein coupled receptor 98Zhonghua Wei Chang. [score:4]
Therefore, we detected whether miR-145-5p inhibited cell migration and invasion of ESCC cells via regulating these genes. [score:4]
Inhibition of NF-κB signaling pathway or knockdown of NF-κB (p65) phenocopied the effects of miR-145-5p on the migration, invasion and EMT of ESCC cells. [score:4]
All of the above suggested that inhibition of the NF-κB signaling pathway or knockdown of NF-κB (p65) phenocopied the effects of miR-145-5p on the migration, invasion and EMT of ESCC cells. [score:4]
However, the tumorigenic roles and mechanisms underlying down-regulation of miR-145 in ESCC are still largely unknown. [score:4]
However, up to now, the mechanisms underlying down-regulation of miR-145 in ESCC are still largely unknown. [score:4]
CCNA2, CCND1 and CCNE1 were reported to participate in the regulation of the proliferation process in ESCC [11], and we detected whether miR-145-5p inhibited cell proliferation of ESCC cells via these genes. [score:4]
Taken together, our findings revealed that miR-145-5p functioned as a tumor suppressor gene by regulating the Sp1/ NF-κB signaling pathway in esophageal squamous cell carcinoma. [score:4]
Inhibition of NF-κB Signaling Pathway or Knockdown of NF-κB (p65) Phenocopied the Effects of miR-145-5p on the Migration, Invasion and EMT of ESCC Cells. [score:4]
The protein level of EMT -associated transcription factor Slug was also down-regulated by miR-145-5p mimics (Figure 2H). [score:4]
All these reports indicated that miR-145 regulated the proliferation and invasion of ESCC cells through several target genes and signaling pathways. [score:4]
Zeng J. F. Ma X. Q. Wang L. P. Wang W. MicroRNA-145 exerts tumor-suppressive and chemo-resistance lowering effects by targeting CD44 in gastric cancerWorld J. Gastroenterol. [score:4]
Harada K. Baba Y. Ishimoto T. Kosumi K. Tokunaga R. Izumi D. Ohuchi M. Nakamura K. Kiyozumi Y. Kurashige J. Suppressor microRNA-145 Is Epigenetically Regulated by Promoter Hypermethylation in Esophageal Squamous Cell CarcinomaAnticancer Res. [score:4]
2.1. miR-145-5p Is Down-Regulated in Esophageal Squamous Cell Carcinoma (ESCC) Tissues. [score:4]
Zhu X. Li Y. Xie C. Yin X. Liu Y. Cao Y. Fang Y. Lin X. Xu Y. Xu W. miR-145 sensitizes ovarian cancer cells to paclitaxel by targeting Sp1 and Cdk6Int. [score:3]
In ESCC, the expression of miR-145 was significantly associated with tumor invasion [25]. [score:3]
LincRNA ROR could also sponge miR-145 and then release the miR-145 target FSCN1, and further contribute to the acquisition of chemoresistance and EMT phenotypes of docetaxel-resistant lung adenocarcinoma cells [34]. [score:3]
miR-145 is identified as a tumor suppressor in many types of cancer. [score:3]
Our results showed that overexpression of miR-145-5p significantly reduced the levels of NF-κB (p65) and p-NF-κB (p65) (Figure 3B), and the mRNA level of NF-κB (p65) was also decreased (Figure 3C). [score:3]
Metadata showed that the expression of miR-145 was significantly lower in NSCLC than that in healthy tissues, and miR-145 tended to show better diagnostic performance in lung squamous cell carcinoma than in lung adenocarcinoma [24]. [score:3]
Our findings suggested that miR-145-5p could significantly repress the migration and invasion of ESCC cells by inhibiting EMT. [score:3]
Our study further found that overexpression of miR-145-5p significantly increased the epithelial marker of E-cadherin, and reduced the mesenchymal cell marker of N-cadherin (Figure 2H). [score:3]
Combined expression of miR-145 and miR-143 was significantly associated with the risk for ESCC [26]. [score:3]
Sheng N. Tan G. You W. Chen H. Gong J. Chen D. Zhang H. Wang Z. miR-145 inhibits human colorectal cancer cell migration and invasion via PAK4 -dependent pathwayCancer Med. [score:3]
The results showed that miR-145-5p mimics significantly decreased the expressions of MMP2, MMP7 and MMP13 using real-time PCR assay (Figure 2I). [score:2]
Transfection of miR-145-5p mimics to KYSE150 and KYSE510 cell lines significantly enhanced the expression levels with fold change above 25 compared with negative control group (Figure 2A). [score:2]
miR-145 is regulated by several mechanisms in cancer. [score:2]
The results showed that miR-145-5p decreased the mRNA levels of cell cycle regulatory genes (CCNA2, CCND1 and CCNE1) in KYSE150 and KYSE510 (Figure 2D). [score:2]
LincRNA is also a very important regulator of miR-145 in cancers. [score:2]
LincRNA MALAT1 could modulate the TGF-β1 -induced endothelial-to-mesenchymal transition through interacting and down -regulating miR-145 [35]. [score:2]
Taken together, our results revealed the new signaling pathway regulated by miR-145 in esophageal carcinogenesis. [score:2]
Therefore, we further explored the mechanism of how miR-145-5p regulates Slug transcription. [score:2]
Wang T. Y. Zhang Q. Q. Zhang X. Sun Q. L. Zhao C. P. Wang X. Y. The effect of recombinant lentiviral vector encoding miR-145 on human esophageal cancer cellsTumour Biol. [score:1]
miR-145-5p mimics, Sp1 siRNA, NF-κB (p65) siRNA and non-specific negative control were synthesized by GenePharma (GenePharma, Shanghai, China). [score:1]
Wei H. Wen-Ming C. Jun-Bo J. Plasma miR-145 as a novel biomarker for the diagnosis and radiosensitivity prediction of human cervical cancerJ. [score:1]
We also found that miR-145-5p mimics could significantly reduce the mRNA level of Slug (Figure 3A). [score:1]
Xia F. Xiong Y. Li Q. Interaction of lincRNA ROR and p53/miR-145 correlates with lung cancer stem cell signaturesJ. [score:1]
The cells were seeded in six-well plates and transfected with miR-145-5p mimics or Sp1 small interfering RNA (siRNA) or NF-κB (p65) siRNA or non-specific negative control using Lipofectamine 2000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA) following the manufacture’s protocol. [score:1]
The miR-145 promoter is significantly more hypermethylated in ESCC cancer tissues than in matched normal adjacent esophageal epithelial mucosa [10]. [score:1]
To study the tumorigenic roles of miR-145-5p in ESCC, we first evaluated the expression levels in four ESCC cell lines including KYSE30, KYSE180, KYSE150 and KYSE510 by real-time polymerase chain reaction (RT-PCR). [score:1]
Gan T. Q. Xie Z. C. Tang R. X. Zhang T. T. Li D. Y. Li Z. Y. Chen G. Clinical value of miR-145-5p in NSCLC and potential molecular mechanism exploration: A retrospective study based on GEO, qRT-PCR, and TCGA dataTumour Biol. [score:1]
Future studies should focus on the diagnostic and prognostic value of miR-145 in ESCC. [score:1]
miR-145-5p mimics sense: 5′-GUCCAGUUUUCCCAGGAAUCCCU-3′, antisense: 5′-GGAUUCCUGGGAAAACUGGACUU-3′; non-specific negative control sense: 5′-UUCUCCGAACGUGUCACGUTT-3′, antisense: 5′-ACGUGACACGUUCGGAGAATT-3′; Sp1 siRNA sense: 5′-UGAGAACAGCAACAACUCCTT-3′, antisense 5′-GGAGUUGUUGCUGUUCUCATT-3′; p65 siRNA sense: 5′-GCCUUAAUAGUAGGGUAAGTT-3′, antisense: 5′-CUUACCCUACUAUUAAGGCTT-3′. [score:1]
[1 to 20 of 80 sentences]
2
[+] score: 336
Other miRNAs from this paper: mmu-mir-132, mmu-mir-145a, hsa-mir-132, mmu-mir-145b
Our study provides compelling evidence that expression of miR-145 causes suppression of tumor growth through the inhibition of MUC13 expression. [score:9]
The overexpression of miR-145 resulted in the potent inhibition of MUC13 protein and its related targets, HER2, pAKT and PAK1 [10], whereas p53 expression was increased (Fig. 3A). [score:9]
This clearly suggests that miR-145 silences the MUC13 expression and regulates the expression of its critical tumor target genes that are involved in pancreatic pathogenesis. [score:8]
We have demonstrated that miR-145 regulates MUC13 expression in PanCa by directly targeting its 3′ UTR (Fig. 1C). [score:7]
We observed that MUC13 is markedly expressed as early as in PanIN lesions and progresses from PanIN I to PanIN III and its expression is inversely correlated to miR-145 expression (Fig. 6). [score:7]
Moreover, miR-145 overexpression directly targets AKT-3 in thyroid cancer [13]. [score:6]
These results strongly suggest that miR-145 negatively regulates MUC13 protein expression and its associated targets. [score:6]
We also observed that ectopic expression of miR-145 in MUC13 -expressing HPAF-II cell lines resulted in MUC13 down regulation at the protein level. [score:6]
The present work suggests that miR-145 is a tumor suppressor in pancreatic cancer and a novel regulator of MUC13 expression. [score:6]
These observations suggest that the consistent decrease in miR-145 expression and subsequent higher expression of MUC13 may play a role in the development and progression of PanCa. [score:6]
This data suggests that miR-145 downregulates MUC13 expression through a post-transcriptional mechanism. [score:6]
Cells transfected with MUT 3′ UTR were resistant to the suppressor activity of miR-145 (Fig. 1D), suggesting that by directly targeting 3′ UTR of the MUC13 transcript. [score:6]
Our study demonstrates no or faint expression of MUC13 in human normal pancreatic tissues while having high miR-145 expression. [score:5]
We experimentally tested this in HPAF-II and Capan-1 cells (which express high levels of MUC13) via transient transfection of miR-145 mimic or non -targeting control mimic (NC). [score:5]
We also investigated the effect of gemcitabine on protein expression of HER2, MUC13 and the gemcitabine target Mcl-1 expression after miR-145 transfection throughting. [score:5]
Additionally, decreased MUC13 expression by miR-145 and its effect on the related targets, HER2 and p53, were also confirmed by immunofluorescence using confocal microscopy. [score:5]
Thus, this suggests that miR-145 inhibits MUC13 and its related targets and leads to tumor regression in xenograft mice. [score:5]
These results indicated that miR-145 is an important tumor suppressor miRNA in PanCa and its replenishment in PanCa cells effectively inhibits their tumorigenic phenotypes (Fig. 2). [score:5]
Real-time PCR analysis showed 6-fold expression in miR-145 expression at 48 h after transfection over control (Data not shown). [score:5]
Recent studies showed that miR-145 targets ADAM17 and suppresses cell invasion in hepatocellular [11] and head and neck cancers [12]. [score:5]
Moreover, IHC analyses of tumor tissues revealed an inhibition of MUC13 expression in miR-145 treated tumors. [score:5]
Early pancreatic intraepithelial neoplasia (PanIN I) has shown moderate levels of MUC13 expression that is predominantly localized at the apical cell membrane and is lower in the cytoplasm, but shows higher miR-145 expression. [score:5]
MUC13 expression is correlated with miR-145 expression in clinical samples. [score:5]
The effect of miR-145 on cell growth and metastasis was studied in PanCa cells, HPAF-II and Capan-1 that possess high constitutive expression of MUC13 and lost expression of miR-145. [score:5]
To determine a correlation of MUC13 expression with miR-145 expression, human tumors and their adjacent normal tissues were used for MUC13 IHC and miR-145 ISH (Fig. 6). [score:5]
miR-145 expression is clinically correlated with MUC13 expression. [score:5]
Additionally, in the wild type MUC13 3′ UTR (WT-MUC13 3′ UTR), a mutant MUC13 3′ UTR (MUT-MUC13 3′ UTR) reporter construct was made by site-directed mutagenesis in the putative target site of miR-145 using Quickchange XL site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA). [score:5]
A very strong expression of miR-145 was observed in normal tissues adjacent to the cancerous tissues as well as in normal pancreatic tissues with less or no MUC13 expression (Fig. 6C). [score:5]
We have identified that miR-145 regulates MUC13 expression in PanCa. [score:4]
We employed luciferase assay to determine whether miR-145 targets the 3’ UTR of MUC13 mRNA, as indicated by the TargetScan. [score:4]
Additionally, a very recent study showed that miR-145 directly targets the insulin-like growth factor receptor I (IGFR-1) in human bladder cancer cells [19]. [score:4]
The results demonstrate that miR-145 -induced downregulation of MUC13 is associated with slower growth of PanCa cell lines, gemcitabine chemo-sensitivity and tumor growth reduction in pancreatic xenograft mice mo del. [score:4]
miR-145 negatively regulates the expression of MUC13. [score:4]
Our data revealed a significant dose dependent downregulation of MUC13 at the protein level but no apparent change at the transcript level in miR-145 mimic transfected cells (Fig. 1C). [score:4]
To assess whether miR-145 affects gemcitabine sensitivity in PDAC cells, we first determined the miRNA-145 expression in PanCa resistant cell lines. [score:3]
Additionally, we have presented evidence for an inverse correlation of miR-145 and MUC13 expression in human PanCa clinical specimens. [score:3]
This suggested that miR-145 has an ability to target MUC13. [score:3]
The cells treated with miR-145, in the presence of miR-145 inhibitor, had no effect on the basal protein levels (Fig. 3B). [score:3]
Additionally, it was intriguing that gemcitabine treatment resulted in inhibition of cell invasion in AsPC-1 cells that were transfected with miR-145. [score:3]
The use of miR-145 inhibitor confirmed that the cellular and molecular alterations observed were indeed due to miR-145 restoration. [score:3]
In conclusion, this finding suggests that miR-145 is a tumor suppressor in PanCa. [score:3]
Fig. 3 (A and B) Cells were transfected with miR-145 mimic, NC or miR-145 inhibitor in addition to miR-145 mimic for 48 h. Immunoblotting was performed for analysis of indicated proteins. [score:3]
We observed severe inhibition of MUC13 and HER2 levels in mice injected with miR-145 (Fig. 5B). [score:3]
The present study provides important insights into the tumor suppressor role of miR-145 in a well-known tumor-promoting network that includes MUC13. [score:3]
We co -transfected the HPAF-II cells with miR-145 or NC and a firefly luciferase reporter plasmid containing a region of full-length 3′ UTR of MUC13 mRNA harboring the miR-145 target site (position 597–603). [score:3]
miR-145 inhibits growth, clonogenicity and invasion of PanCa cells. [score:3]
miR-145 inhibits tumor growth in vivoThe antitumor effect of miR-145 was confirmed by in vivo experiments using PanCa xenograft mouse mo del. [score:3]
We observed a marked inhibition of cell invasion upon miR-145 transfection (48 h; HPAF-II: miR-145: 90.0±0.5, miR-145+inh: 30.1±3.4, NC: 0.0±2.4, P<0.01; and Capan-1: miR-145: 91.5±0.5, miR-145+inh: 10.3±4.0, NC: 0.0±2.7, P<0.01; Fig. 2C). [score:3]
Inorder to detect the expression of miR-145 in FFPE tissues of control and treated xenograft mice, in situ hybridization technique was used using Biochain kit (catalog number K2191050; Biochain IsHyb In Situ hybridization kit). [score:3]
miR-145 inhibits tumor growth in vivo. [score:3]
However, in adjacent normal tissues, MUC13 was localized at the apical membrane, and its expression was very low while miR-145 was found to be very high. [score:3]
miR-145 was found to be differentially expressed between normal and PanCa cells, including gemcitabine resistant cells, as detected by qRT-PCR (Fig. S2B). [score:3]
miR-145 suppresses proliferation and invasion of PanCa cells. [score:3]
Also, the xenograft tumors from miR-145 treated mice were analyzed for changes in MUC13 and HER2 expression. [score:3]
miR-145 inhibits MUC13 and its associated proteins in PanCa cells. [score:3]
To determine the effect of miR-145 on cell cycle, MUC13 expressing HPAF-II and AsPC-1 cells were transfected with miR-145. [score:3]
The tumor tissue samples were further analyzed for the expression of miR-145 levels, MUC13 and HER2 by in situ hybridization (ISH) and immunohistochemistry (IHC). [score:3]
It has also been demonstrated that miR-145 targets MUC1 in metastatic breast cancer [14], p70S6K1 in colon cancer [15], c-Myc in non-small cell lung cancer [16] and the transcription factor STAT1 in colon cancer [17]. [score:3]
This data suggests that miR-145, besides inhibiting MUC13 and pancreatic tumorigenesis, also sensitizes PanCa cells to gemcitabine treatment. [score:3]
We identified two miRNAs, miR-145 and miR-132 as MUC13 suppressing miRNAs (Fig. S2A). [score:3]
Fig. 5miR-145 inhibits tumor growth in vivoThe antitumor effect of miR-145 was confirmed by in vivo experiments using xenograft mo dels. [score:3]
The inhibitor of miR-145 abrogated the effects of miR-145 in these cells. [score:3]
Dual-luciferase 3′ UTR reporter assay was carried out to validate MUC13 as a direct target of miR-145. [score:3]
Data are presented as percent inhibition of clonogenic ability of miR-145 transfected cells as compared with their respective controls. [score:2]
These observations suggest that the consistent decrease in miR-145 levels may play a role in the development and progression of PanCa. [score:2]
miR-145 regulates MUC13 associated key oncogenes. [score:2]
miR-145 directly binds to the 3′ UTR of human MUC13. [score:2]
To test this, gemcitabine resistant AsPC-1 cells were transiently transfected with miR-145 and then treated with a gemcitabine-conditioned medium (100 nM) for 48 h. The matrigel invasion assay showed that miR-145 decreased the number of invading cells and that gemcitabine showed enhanced effects under miR-145 restoration, clearly suggesting that miR-145 increases gemcitabine sensitivity to inhibit PanCa cell invasion. [score:2]
Cells were transfected with miR-145 mimics, NC in presense or absence of miR-145 inhibitor (Assay id MH11480; Applied Biosystems). [score:2]
Cells were transfected with miR-145 mimics, NC in presence or absence of miR-145 inhibitor (Assay id MH11480; Applied Biosystems) and total protein was extracted from PanCa cells, followed byting as previously described [30, 33]. [score:2]
We studied the biological function and significance of the regulation of MUC13 protein levels by miR-145 in PanCa cells. [score:2]
Further, the miR-145 induced inhibition of cell migration was also performed through scratch assay. [score:2]
PanCa cells, HPAF-II, Capan-I and AsPC-1 cells were transiently transfected with mirVana miR-145 mimics (MC11480; Applied Biosystems), miR-132 mimics (Assay id MC10166; Applied Biosystems) or non -targeting control mimic (NC) (catalog number AM17111; Applied Biosystems). [score:2]
Another interesting observation is that miR-145 suppressed the clonogenic potential of HPAF-II and Capan-1 cells (70%), as determined by colony formation assays (Fig. 2B). [score:2]
This study elucidates the role of miR-145 as a novel regulator of MUC13, a finding that has not previously been reported. [score:2]
Immunofluorescence staining was performed to determine the effect of miR-145 transfection on the protein level of MUC13 and other related key oncogenic proteins. [score:1]
miR-145 increases gemcitabine sensitivity in PanCa cells. [score:1]
and in situ hybridization was used to detect MUC13 and miR-145, respectively, on the tissue microarray slides (procured from US Biomax, Inc. [score:1]
Additionally, the effect of miR-145 transfection on invasiveness was determined by using matrigel chambers (catalog number 734-1048, BD Biosciences), as discussed previously [10]. [score:1]
The values for mir-145 were examined for this condition alone, by comparing the time 7 value to others (‘time 7 vs miR-145). [score:1]
Our study provides important insights into the role of miR-145 in a well-known tumor-promoting network that involves MUC13, which may provide a route to therapeutic miRNA intervention in PanCa. [score:1]
Fig. 1(A) Identification of a putative miR-145 -binding site in the MUC13 3′ UTR region. [score:1]
HPAF-II cells were transiently co -transfected for 48 h with reporter plasmids (0.5 μg, WT or MUT) and 100 nM of miR-145 or NC mimic using Lipofectamine 2000. [score:1]
Additionally, the RNAi experiments using HPAF-II sh-MUC13 [−/−], reciprocated the observed effects that were seen through miR-145 transfection. [score:1]
For time points 19, 22, 26, and 29, mir-145 was significantly different than the control conditions, and was lower. [score:1]
Once palpable tumors developed (average volume 80 mm [3]), mice tumors were treated with miR-145 injections nine times. [score:1]
Thus, in the present study, we sought to delineate the association of alterations in miR-145 levels with MUC13 and its role in PanCa initiation and progression. [score:1]
The luciferase-UTR reporter constructs were generated by inserting the MUC13 3′ UTR carrying a putative miR-145 binding site into pmirGLO control vector (catalog number E1330; Promega). [score:1]
The antitumor effect of miR-145 was confirmed by in vivo experiments using PanCa xenograft mouse mo del. [score:1]
Fig. 6Immunohistochemistry and in situ hybridization was used to detect MUC13 and miR-145, respectively, on the tissue microarray slides (procured from US Biomax, Inc. [score:1]
Three control, six NC and six miR-145 mice groups were used (total of 15 mice). [score:1]
, Rockville, MD) in various (A) PanIN lesions (original magnifications: MUC13 60X; miR-145 20X), (B) adenocarcinoma (original magnifications 60X) and (C) adjacent normal (Adj) (original magnifications: MUC13 40X; miR-145 20X) and normal pancreatic cancer cells (original magnifications: 20X). [score:1]
We observed a several fold increase in the miR-145 levels following transient transfection through qRT-PCR (Fig. S1A). [score:1]
This confirmed that the molecular alterations observed were due to miR-145 restoration. [score:1]
miR-145 increases gemcitabine sensitivity in PDAC cells. [score:1]
This revealed a strong correlation between MUC13 and miR-145 in both tumor and normal tissues. [score:1]
Our investigations revealed that miR-145 is inversely correlated to MUC13 expression in PanCa cell lines (Fig. S2B) and pancreatic tumor tissues (Fig. 6). [score:1]
The levels of miR-145 were observed to be very low or absent in late stage pancreatic intraepithelial neoplasia (PanIN II and III) and at later stages of PanCa. [score:1]
The values at each time point were examined by comparing the two control conditions, control and NC (Cs) vs mir-145 (these analyses are termed ‘Time xx- A vs Cs’) Table S1. [score:1]
miR-145 is a post-transcriptional repressor of MUC13. [score:1]
Tumor volumes (V) were examined as a function of time (discrete), group (control, NC, miR-145), and interaction between them. [score:1]
The antitumor effect of miR-145 was confirmed by in vivo experiments using xenograft mo dels. [score:1]
Seven bases (597 through 603) of the MUC13 3′ UTR are perfect matches (seed sequence) for miR-145 binding. [score:1]
org/), revealed a putative 7-mer-1A binding site for miR-145 in the 3′ UTR of the MUC13 transcript which is highly conserved across several mammalian species (Fig. 1 A, B). [score:1]
The study delineates the association of alterations in miR-145 levels with MUC13 and its potential role in PDAC initiation and progression. [score:1]
Primary analyses involved the comparison (for each time point separately) between control and NC vs mir-145, performed as planned comparisons. [score:1]
miR-145 promotes cell death in PanCa cells. [score:1]
The MUC13+ cells (HPAF-II and Capan-1) were transfected with miR-145 or NC. [score:1]
MiR-145 is also known to regulate OCT4, SOX2, KLF4 and repress pluripotency in human embryonic stem cells [18]. [score:1]
100 nM synthetic miR-145 complexed with 100 μl Invivofectamine 2.0 transfection reagent (catalog number 1377501; Ambion, Austin, TX) in 50 μl PBS was delivered four times intratumorally every alternate day. [score:1]
Furthermore, in vivo studies demonstrated a tremendous reduction in tumor growth in HPAF-II xenograft mice that were injected intratumorally with miR-145. [score:1]
Then, 100 nM synthetic miR-145 complexed with 2 μl siPORT Amine transfection reagent (catalog number AM4502; Ambion, Austin, TX) [34] in 50 μl PBS was delivered for next five times intratumorally every alternate day. [score:1]
These data strongly suggest a role of miR-145 in PanCa progression. [score:1]
This suggested that miR-145 might affect gemcitabine sensitivity in PanCa cells. [score:1]
[1 to 20 of 114 sentences]
3
[+] score: 296
In the present study, we transfected miR-145 mimics and MRP1 siRNA, respectively, into MCF-7 cells, MRP1 expression level decreased (Supplementary Figure S4 and Figure 4G), conversely, transfecting miR-145 inhibitor into MCF-7 cells increased MRP1 expression (Figure 4J), these data suggested MRP1 was the target of miR-145 and miR-145 negatively regulated MRP1 expression. [score:12]
Further study, we proved miR-145 sensitized breast cancer cells to doxorubicin via inducing intracellular doxorubicin accumulation by inhibiting MRP1, synthetic or stably expressed miR-145 reversed resistance to doxorubicin in vitro and in vivo by targeting MRP1, miR-145 exerts the potential to be developed for MDR inhibitors (Figure 4 and 5). [score:9]
MCF-10A and MDA-kb2 cells, which displayed high miR-145 expression level, exhibited relatively low MRP1 expression, whereas MCF-7, MDA-MB-231, MDA-MB-453 and MDA-MB-468 cells, which displayed low miR-145 level, exhibited relatively high MRP1 expression level (Figure 2B and 2C). [score:7]
We further demonstrated that miR-145 negatively regulated MRP1 expression by directly targeting MRP1 3′UTR in MCF-7 cells. [score:7]
miR-145 decreased MRP1 expression, but miR-145 M2 did not show this suppressive effect on MRP1 expression (Figure 3D). [score:7]
We found that miR-145 was significantly downregulated in breast cancer clinical samples and inversely correlated with MRP1 expression level in both breast cancer cell lines and clinical breast cancer tissues. [score:6]
And, DNA hypermethylation and p53 mutation suppressed miR-145 expression by affecting p53 binding to the p53 response element [31, 32]. [score:6]
G. and J. MRP1 expression level was detected by western blot in cells transfected with miR-145 inhibitors or ABCC1 siRNA, GAPDH was used as an internal control. [score:5]
And, we analyzed miR-145 expression level in different molecular subtypes of breast cancer, but no significant difference in miR-145 expression between different molecular subtypes was observed (Table 1). [score:5]
The qRT-PCR and western blot data showed that the protein expression level of MRP1 was decreased due to the overexpression of miR-145; this result was consistent with the in vitro findings (Figure 5E, 5F). [score:5]
Restoration of miR-145 expression sensitizes breast cancer cells to ADR by targeting MRP1 in vivoMDA-MB-231 is one of the triple negative breast cancer cell lines, and the agent doxorubicin which is classical substrate for MRP1, is used for the treatment of triple negative breast cancer patients. [score:5]
To further demonstrated that miR-145 targeted the MRP1 3′UTR, we synthesized a miR-145 mutant in which a portion of its conserved targeting region (UCC) was specifically mutated (Figure 3C, labeled as has-miR-145 M2). [score:5]
Here, we demonstrated that miR-145 sensitized breast cancer to doxorubicin both in vitro and in vivo by suppressing MRP1 expression. [score:5]
To determine whether there was an inverse correlation between MRP1 and miR-145 expression level in breast cancer, we tested the MRP1 and miR-145 expression level in two normal human mammary epithelial cell lines (MCF-10A and MDA-kb2) and four breast cancer lines (MCF-7, MDA-MB-231, MDA-MB-453 and MDA-MB-468); MCF-7 was used as a control cell line. [score:5]
In this study, firstly we predicted miRNAs potentially binding to the 3′UTR of ABCC1 using bioinformatics approach, then, screened the identified miRNAs for their ability to decrease MRP1 protein expression and found miR-145 is a strong candidate significantly reducing MPR1 expression in breast cancer. [score:5]
Restoration of miR-145 expression sensitizes breast cancer cells to ADR by targeting MRP1 in vivo. [score:5]
In conclusion, our data revealed higher MRP1 expression and lower miR-145 expression in breast cancer. [score:5]
These data proved that miR-145 overexpression partially reversed resistance to doxorubicin in MCF-7/ADR cells, and suppression of miR-145 partially got MCF-7 cells resistant to doxorubicin. [score:5]
We examined miR-145 and MRP1 expression level in the process of inducing MCF-7 doxorubicin resistance and the data showed: a) miR-145 expression level increased a little firstly and then decreased markedly; b) this decrease was followed by a time -dependent increase of MRP1 mRNA level, a strong indication of miR-145 action in MRP1 -mediated doxorubicin resistance in MCF-7 cells (Figure 1F). [score:5]
The results indicated that miR-330-5p and miR-145 markedly inhibited MRP1 expression (Figure 1E). [score:5]
DNA methylation and p53 mutation accounted at least part for the suppression of miR-145 in cancers, which may be also one of the mechanisms for the reduction of miR-145 in doxorubicin resistant MCF-7/ADR cells. [score:4]
miR-145 regulates drug sensitivity of breast cancer cell lines to ADR through targeting MRP1. [score:4]
MRP1 is a direct target of miR-145 in breast cancer. [score:4]
These results suggested that the conserved 1728-1734 nt ACUGGA region within the ABCC1 3′UTR is responsible for the binding between miR-145 and MRP1 and MRP1 is a direct target of miR-145. [score:4]
We further analyzed the data of miR-145 expression level in breast cancer from TCGA database and found miR-145 expression level in tumor samples were significantly decreased compared to that in the matched normal samples (Figure 2D). [score:4]
MPR1 is a direct target of miR-145. [score:4]
Further, MRP1 was negatively regulated at the posttranscriptional level by miR-145 through a specific target motif at nt 1728-1734 of the MRP1 3′UTR. [score:4]
Besides, miR-145 was downregulated in MCF-7/ADR cells (Figure 1G). [score:4]
C. Detection of the miR-145 expression level in different breast cancer cell lines. [score:3]
G. Comparison of the miR-145 expression level in MCF-7 and MCF-7/ADR by real-time PCR, U6 snRNA was used as an internal control. [score:3]
Figure 5The restoration of miR-145 sensitized MDA-MB-231 cells to doxorubicin in vivo A. The expression level of miR-145 in MDA-MB-231 cells stably transfected with leti-miR-145 was tested by qRT-PCR, U6 snRNA was used as an internal control. [score:3]
Stable transfectants overexpressing miR-145 were generated via lentiviral transduction using a GV369-GFP vector (GeneChem Co. [score:3]
miR-145 sensitizes breast cancer cells to doxorubicin through inhibiting MRP1. [score:3]
Figure 4 A. and D. The expression of miR-145 was examined by qRT-PCR in cells transfected with the mimics. [score:3]
Moreover, miR-145 sensitized breast cancer to ADR chemotherapy in vitro and in vivo by reducing the MRP1 expression level and increasing the intracellular concentration of ADR. [score:3]
miR-145 mimics, miR-145 M2 oligonucleotide or negative control oligonucleotide was transfected into MCF-7, or co -transfected with wild-type luciferase reporter plasmid into MCF-7, MRP1 mRNA expression level and luciferase was examined. [score:3]
The markedly differences in the tumor volume between the NC + ADR chemotherapy group and the miR-145 + ADR chemotherapy group (Figure 5D) suggested that ectopic miR-145 expression can sensitize breast cancer to ADR chemotherapy. [score:3]
However, miR-145 overexpression decreased the IC [50] of doxorubicin in MCF-7ADR cells from 74 to 20uM, which was still higher than the IC [50] of MCF-7 (2uM) in MCF-7 cells. [score:3]
In our collection (55 breast cancer tissues and 21 breast non-tumor tissues), the miR-145 expression level was also significantly lower in the breast cancer tissues than in the non-tumor breast tissues (Figure 2E). [score:3]
As suggested by a decline in the IC [50] values (Figure 4B and 4E), miR-145 overexpression markedly sensitized cells to ADR. [score:3]
Inverse correlation between the miR-145 and MRP1 expression level in breast cancer. [score:3]
We found that the breast cancer cell lines displayed lower endogenous miR-145 expression level than the normal human mammary epithelial cell lines (Figure 2C). [score:3]
F. and G. Spearman's correlation analysis of the correlation between the miR-145 and MRP1 mRNA expression level in breast cancer. [score:3]
In vivo, forced expression of miR-145 increased sensitivity to doxorubicin in MDA-MB-231 cell -based xenograft of nude mice. [score:3]
This observation showed that miR-145 suppressed breast cancer growth in vivo (Figure 5D), consistent with previous report [21]. [score:3]
E. and F. The expression level of miR-145 and MRP1 in group nc and group miR-145 were analyzed. [score:3]
In addition, our data showed that miR-145 expression level was reduced in doxorubicin resistant MCF-7/ADR versus MCF-7 cells (Figure 1G). [score:3]
B. Luciferase assay for the direct targeting of 3′UTR of ABCC1 by miR-145. [score:3]
This result further indicated that miR-145 sensitized breast cancer to ADR chemotherapy via increasing intracellular ADR accumulation by reducing the MRP1 expression level. [score:3]
Moreover, suppression of miR-145 increased the IC [50] of doxorubicin in MCF-7 cells from 0.9 to 3uM, which was still lower than the IC [50] of doxorubicin in MCF-7/ADR cells. [score:3]
Thus, miR-145 suppresses MRP1 via binding to MRP1 3′UTR. [score:3]
Then, the cells were transfected with 50 nM miR-145 mimic/inhibitor, or ABCC1 siRNA (GenePharma) or 50 nM negative control (NC) siRNA using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. [score:3]
In a parallel experiment, the predicted targeting region for miR-145 binding (nt 1728-1734, ACUGGA), was mutated (Figure 3A, labeled as mt ABCC1 3′-UTR). [score:3]
The underling mechanisms of the alterations of miR-145 expression level are still unclear. [score:3]
and qRT-PCR were performed to determine the MRP1 and miR-145 expression levels and the concentration of ADR. [score:3]
A. and D. The expression of miR-145 was examined by qRT-PCR in cells transfected with the mimics. [score:3]
A. The expression level of miR-145 in MDA-MB-231 cells stably transfected with leti-miR-145 was tested by qRT-PCR, U6 snRNA was used as an internal control. [score:3]
F. Determination of MRP1 and miR-145 expression level in the process of inducing doxorubicin resistance in MCF-7 cells by real time PCR. [score:3]
These data suggest miR-145 sensitizeed MCF-7 cells to ADR via inducing intracellular ADR accumulation by inhibiting MRP1. [score:3]
According to the previous study, doxorubicin was p53 inducer and p53 transcriptionally induced miR-145 expression by binding to the p53 response element in the upstream of miR-145 promoter region. [score:3]
miR-145 overexpression increased intracellular doxorubicin accumulation in MCF-7 cells (Figure 2C), accompanied by increased sensitivity to doxorubicin (Figure 2B). [score:3]
And miR-145 expression level increased at the beginning then decreased markedly and maintained in low level in the process of inducing doxorubicin resistance in MCF-7 cells (Figure 1F). [score:3]
As a consequence, MRP1 expression level was increased (Figure 4G), conversely, the miR-145 level was reduced; leading to an increase in the IC [50] value of ADR (Figure 4H) and a decrease in the intracellular concentration of ADR (Figure 4I). [score:3]
In our study, lentivirus -mediated transfection was used to obtain a cell line stably overexpressing miR-145 (Figure 5A). [score:3]
Our results revealed that miR-145 expression level decreased significantly both in breast cancer tissues and breast cancer cell lines compared the control. [score:2]
Then, we examined the sensitivity of this stable miR-145 -overexpressing cell line to ADR chemotherapy using the MTT assay. [score:2]
In luciferase assay, we constructed a series plasmids which contained human MRP1 3′UTR region fragment, co-transfecting miR-145 and wild type plasmid decreased luciferase activity, and then we mutated the binding site, co-transfecting miR-145 and mutant plasmid reversed luciferase activity compared with co-transfecting miR-145 and wild type plasmid (Figure 3B), these results suggested MRP1 was the direct target of miR-145. [score:2]
Our results proved that miR-145 sensitized breast cancer to doxorubicin chemotherapy and provide a new strategy for the development of MRP1 modulators. [score:2]
The miR-145 expression level was compared between tumor samples and matched normal samples (n = 102). [score:2]
To examine the effect of endogenous miR-145, antisense oligonucleotide against miR-145 (50 nM) was transfected into MCF-7 cells. [score:1]
These results provide evidence that miR-145 sensitizes breast cancer cells to ADR via MRP1. [score:1]
A mutant miR-145 binding site was generated in the complementary site for the seed region of miR-145 (wt, wild type; mt, mutant). [score:1]
miR-145 mimics (50 nM) were transfected into MCF-7 or MCF-7/ADR cells to increasemiR-145 level (Figure 4A and 4D). [score:1]
The wild-type or miR-145 binding sequence mutated luciferase reporter plasmids were co -transfected with miR-145 mimics or negative control oligonucleotide and then luciferase activity was analyzed. [score:1]
The restoration of miR-145 sensitized MDA-MB-231 cells to doxorubicin in vivo. [score:1]
Significant difference in the tumor volume was observed between the NC group and the NC + ADR chemotherapy group (Figure 5D), and between the miR-145 group and the miR-145 + ADR chemotherapy group (Figure 5D). [score:1]
To investigate whether miR-145 increases breast cancer drug sensitivity in vivo, MDA-MB-231 cells stably expressing a control vector or miR-145 were subcutaneously injected into the right fat pad of nude mice. [score:1]
To determine whether miR-145 sensitized cells to ADR via MRP1, we detected the intracellular ADR concentration in MCF-7 or MCF-7/ADR cells transfected with miR-145 mimics. [score:1]
Figure 3 A. miR-145 and its putative binding sequence in the 3′UTR of ABCC1. [score:1]
C. Synthesis of the mutant of miR-145 in which a sequence of the conserved MRP1 -binding base was specifically mutated; this sequence was labeled as miR-145 M2. [score:1]
D. and E. Identify the effect of miR-145 M2 on MRP1. [score:1]
A. miR-145 and its putative binding sequence in the 3′UTR of ABCC1. [score:1]
The results showed that miR-145 increased the intracellular ADR concentration (Figure 4C and 4F). [score:1]
E. Quantification of the miR-145 levels via real-time PCR in clinical breast cancer tissues (n=55) and normal breast tissues (n=21). [score:1]
In this study, the tumor volume of miR-145 group was smaller than that of NC group. [score:1]
And, this observation could also be seen in doxorubicin resistant MCF-7/ADR cells (Figure 2E and 2F), suggesting that miR-145 sensitized both MCF-7 and MCF-7/ADR to doxorubicin. [score:1]
And luciferase activity was restored when mt ABCC1 3′UTR plasmid and miR-145 mimics were co -transfected into MCF-7 cells (Figure 3B, P<0.0001). [score:1]
Further, our results showed that miR-145 level inversely correlated with the MRP1 mRNA level in the breast cancer and normal human mammary epithelial cell lines examined (correlation coefficient R= -0.9771; P=0.0042) (Supplementary Figure S2). [score:1]
So, miR-145 level may be induced via p53 by doxorubicin at the beginning. [score:1]
Approximately 5×10 [6] MDA-MB-231 cells stably transfected with lenti-miR-145 or the control vector were subcutaneously injected into the right fat pad of nude mice. [score:1]
miR-145 level inversely correlates with MRP1 mRNA level in breast cancer. [score:1]
Additionally, MCF-7 cell lines in our laboratory did not show any ability of forming tumor in nude mice, so MDA-MB-231 cell line was chose to validate the action of miR-145 in-vivo. [score:1]
miR-145 level in different molecular subtypes of breast cancer. [score:1]
MCF-7 cells were transfected with miR-145 or miR-145 M2, respectively. [score:1]
correlation between the miR-145 and MRP1 level in different molecular subtypes of breast cancer. [score:1]
Similarly, co-transfecting miR-145 M2 and wild type ABCC1 plasmid eliminated the function of co-transfecting miR-145 and wild type ABCC1 plasmid on luciferase activity (Figure 3E). [score:1]
[1 to 20 of 96 sentences]
4
[+] score: 296
Although downregulated miR-145-5p was supposed to increase ADD3 expression level, its original level of miR-145-5p in LX-2 cells may by low and thus unable to upregulate ADD3 expression. [score:11]
LX-2 cells were transfected with 3x10 [6] ifu of above lentiviruses together with polybrene (10ug/ml, Santa Cruz Biotechnology) in five groups, miR-145, miR-145 plus miR-145-3p inhibitor, miR-145 plus miR-145-5p inhibitor, miR-145-3p inhibitor plus miR-145-5p inhibitor, empty vectors, to generate high expression level of miR-145-5p and miR-145-3p, only high level of miR-145-5p, only high level of miR-145-3p, low level of miR-145-5p and miR-145-3p, no miR-145 but empty vector, respectively. [score:11]
Similarly, if it was miR-145-3p that had an functional role in regulating ADD3 expression, ADD3 would not be repressed in group 2 but rather similar results would be shown in group 1 and group 3. qPCR was performed in 5 groups with lentiviral transfection plus 1 group without transfection to identify ADD3 mRNA expression level 72 hours after lentiviral transfection, which showed that miR-145-5p could suppress the expression of ADD3 mRNA as well as protein level. [score:10]
In the intervention group 2 and group 3, i. e. overregulated miR-145-5p and overregulated miR-145-3p, we found that ADD3 mRNA were suppressed more in the former group although both were suppressed, suggesting that miR-145-5p may play an important role in regulating ADD3 mRNA expression. [score:10]
Group 1: Increase both miR-145-5p and miR-145-3p by transfection with miR-145; Group 2: Only increase miR-145-5p by transfection with both miR-145 and miR-145-3p inhibitor; Group 3: Only increase miR-145-3p by transfection with both miR-145 and miR-145-5p inhibitor; Group 4: Decrease both miR-145-3p and miR-145-5p by transfection with both miR-145-3p inhibitor and miR-145-5p inhibitor; Group 5: Transfection with empty vector without miR-145 to control variables. [score:9]
In order to identify whether miR-145-5p indeed has a direct interaction with ADD3 and regulates its expression and thus, contributes to liver fibrosis in biliary atresia, we synthesize 4 different lentiviruses, miR-145, miR-145-3p inhibitor, miR-145-5p inhibitor and empty vector without miR-145, respectively. [score:9]
The downregulation of miR-145 may contribute to liver fibrosis in BA by upregulating the expression of ADD3. [score:9]
The Lentiviral vectors containing miR-145, miR-145-3p inhibitor, miR-145-5p inhibitor, empty vector were transfected into human hepatic stellate cell line (LX-2) to determine the functional effect of miR-145 on ADD3 expression at both mRNA and protein level. [score:7]
Our findings revealed that ADD3 was upregulated in liver tissues of BA while miR-145-5p was downregulated. [score:7]
Downregulated miR-145-5p may contribute to liver fibrosis in BA by up -regulating the endogenous expression of ADD3. [score:7]
Transfection of lentiviruses containing miR-145 into LX-2 cells decreased the expression of ADD3 at both mRNA and protein level compared to negative control group, and suppressed the expression of p-Akt at protein level. [score:6]
Recently microRNA-145 (MiR-145) has been implicated in liver fibrosis by regulating matrix gene expression in smooth muscle cells, suppressing transforming growth factor-β (TGF-β) dependent extracellular matrix (ECM) accumulation and fibrosis[10]. [score:6]
Our study has shown that overexpressed ADD3 and downregulated miR-145 were detected in BA liver tissues. [score:6]
Compared with CC groups, the expression of miR-145 was significant in BA group (p = 0.0267) To identify the potential targets of miR-145 in biliary atresia, MiRanda and TargetScan 7.1 were used. [score:6]
The lower expression of miR-145-5p in BA liver tissues could facilitate the activation and proliferation of HSCs and the corresponding higher expression of ADD3 could facilitate the adhesion of epithelial cells, dysregulate spectrin-actin interaction and thus aggregate the normal bile flow causing cholestasis and accelerating the progression of liver fibrosis. [score:6]
It revealed that over-expressed miR-145 repressed the activity of luciferase with ADD3 3’UTR, which conformed to the predicted results of TargetScan. [score:5]
Zhou et al. [10] found that miR-145 inhibited the activation and proliferation of hepatic stellate cells (HSCs) by binding to ZEB2, and thus suppress the progression of liver fibrosis. [score:5]
ADD3, verified as a target of miR-145-5p, was shown to be overexpressed in infants with BA at the mRNA level (p = 0.0118). [score:5]
Taken together, we indicated that miR-145-5p, but not miR-145-3p, directly regulated the endogenous expression of ADD3 in LX-2 cells. [score:5]
TargetScan was used to predict the possible target site for ADD3, and it showed that miR-145-5p, but not miR-145-3p, may bind to ADD3 through its 3’UTR. [score:5]
Lentiviral vectors containing miR-145, miR -145-3p inhibitor, miR -145-5p inhibitor, empty vectors without microRNAs, with a sequence of the following, GAAAGGACGAGGATCCCACCTTGTCCTCACGGTCCAGTTTTCCCAGGAATCCCTTAGATGCTAAGATGGGGATTCCTGGAAATACTGTTCTTGAGGTCATGGTTGAATTCTAGTTATTAA, GAAAGGACGAGGATCCACCGAGCGAGAGCGCTCGGTATAAGAACAGTATTTCCAGGAATCCATACGCTCGGTAGAGACCGAGCGTTTTTTGAATTCTAGTTATTAA, GAAAGGACGAGGATCCACCGAGCGAGAGCGCTCGGTATAAGGGATTCCTGGGAAAACTGGACATACGCTCGGTAGAGACCGAGCGTTTTTTGAATTCTAGTTATTAA, respectively, were all synthesized by Takara (Dalian, China). [score:5]
To identify the potential targets of miR-145 in biliary atresia, MiRanda and TargetScan 7.1 were used. [score:5]
However, both group 3 and group 4, i. e. downregulated miR-145-5p didn’t significantly increase ADD3 expression at both mRNA and protein level compared to the NC group (Fig 3). [score:5]
MiR-145 inhibits ADD3 expression in LX-2 cells. [score:4]
In order to further assess whether miR-145-5p but not miR-145-3p has a functional role in regulating endogenous ADD3 expression, 5 groups of lentiviral transfection intervention were built. [score:4]
Because miR-145-5p were both increased in LX-2 cells after transfection in group 1 and group 2, if it was miR-145-5p that had a more important role in regulating the expression of ADD3, then both groups would have a similar results. [score:4]
0180896.g003 Fig 3 (A) ADD3 mRNA was repressed byupregulated miR-145 transfection. [score:4]
MiR-145-5p was predicted to be broadly conserved while MiR-145-3p was very poorly conserved for binding to ADD3 3’UTR by TargetScan, taken together with the previous luciferase reporter assays, miR-145-5p was confirmed to target on ADD3 3’UTR. [score:4]
was performed to verify the direct interaction between miR-145-5p and ADD3 3’ Untranslated Regions (3’UTR). [score:4]
Therefore, fibrosis process may be inhibited via regulation of miR-145 on p-Akt. [score:4]
Compared with CC groups, the expression of miR-145 was significant in BA group (p = 0.0267) MiR-145 was shown to be differentially expressed in liver tissues of BA. [score:4]
Consistent with the results of luciferase reporter gene assay, both ADD3 mRNA and protein expression level were significantly suppressed by miR-145. [score:4]
ADD3 and microRNA-145 (miR-145) expression profiles in liver tissues of BA and CC were determined using qPCR. [score:3]
However, when transfected with anti-miR-145, there was no significant increased expression of ADD3 neither at the mRNA nor protein level. [score:3]
Expression level of miR-145-5p in BA liver tissues. [score:3]
0180896.g005 Fig 5 The expression level of ADD3 was shown to be negatively reated to miR-145-5p in LX-2 cell. [score:3]
In order to roll out the possibilities that miR-145 could regulate the luciferase activities other than binding to ADD3 3’UTR, a plasmid containedmutations in thepredicted sites was constructed by using the StarMut Site-directed Mutagenesis Kit (GenStar), with a primer sequence: 5’-ctgaaagtttttcttttgtaaaacctctttcagggtcttcaagtgcacattgctacatcccccaatctgatctaccattg-3’ (forward) and 5’-caatggtagatcagattgggggatgtagcaatgtgcacttgaagaccctgaaagaggttttacaaaagaaaaactttcag-3’ (reverse) (S1 Table). [score:3]
The conservation analyses and sequence complementarity predicted by TargetScan showed that ADD3 3’UTR was broadly conserved sites for miR-145-5p. [score:3]
Akt phosphorylation was significantly inhibited in both miR-145 and miR-145-5p -transfected groups by (Fig 6). [score:3]
We then performed luciferase reporter assay and lentiviral transfection, showing that the expression of ADD3 was regulated by miR-145-5p. [score:3]
qPCR was used to quantify the miR-145-5p expression in 14 infants with BA and 14 infants with CC. [score:3]
14 infants with BA and 14 infants with CC were enrolled in the analysis, showing that expression of miR-145 was significant lower in BA group than that in CC group (0.1706 ± 0.03245 vs. [score:3]
Furthermore, correlation between miR-145-5p and ADD3 was analyzed by Pearson correlation analysis, showing that reduction of ADD3 expression was negatively related to the increase of miR-145-5p in vitro, with a 95% confidence interval of [-0.9901, -0.3693] and Pearson r of -0.9086 (Fig 5). [score:3]
MiR-145 was downregulated in BA liver tissues. [score:3]
Moreover, in our microRNA gene microarrays, we figured out that miR-145 was differentially expressed in BA liver tissues. [score:3]
Luciferase reporter gene assay showed that ADD3 is a direct target of miR-145-5p. [score:3]
The expression of ADD3 was affected by miR-145 or anti-miR-145 in LX-2 cells. [score:3]
0180896.g010 Fig 10qPCR was used to quantify the miR-145-5p expression in 14 infants with BA and 14 infants with CC. [score:3]
31 differentially expressed of microRNAs were identified, including miR-145 (Fig 9). [score:3]
We supposed that it was because LX-2 cells were related to fibrosis, and according to the findings from Zhou et al. [10]], miR-145 could suppress the proliferation of HSC and thus limit fibrosis progression. [score:3]
2mg of cDNA was used for real-time PCR (qPCR) by using SYBR-Green Master Mix (TaKaRa) and Mir-X [™] miRNA qRT-PCR SYBR [®] Kit (Clontech) on an ABI 7500 thermocycler (Applied Biosystems) to quantify relative expression of ADD3 and miR-145, respectively. [score:3]
The expression level of ADD3 was shown to be negatively reated to miR-145-5p in LX-2 cell. [score:3]
ADD3 was predicted to be a potential target of miR-145-5p in the base sequence of 111–117, 125–132 and 1575–1581, by binding to 3’UTR of ADD3 (Fig 1). [score:3]
The protein levels of phosphorylated Akt (pAkt) was inhibited in both miR-145-5p and miR-145 -transfected cells compared to NC groups. [score:2]
To investigate whether miR-145 could regulate endogenous ADD3 expression in vitro, LX-2 cells, which belong to HSC cell line, were used in our study. [score:2]
Compared with CC groups, the expression of miR-145 was significant in BA group (p = 0.0267) Biliary atresia is a devastating neonatal cholangiopathy that destroys extrahepatic bile ducts and obstruct bile flow with an incidence rate of about 1/5300 in Taiwanese population[1]. [score:2]
MiR-145 was predicted to target to ADD3 through 3’UTR interaction. [score:2]
Therefore, we selected miR-145 as our study direction that miR-145-ADD3 may contribute to liver fibrosis in biliary atresia. [score:2]
This further confirmed a direct interaction between miR-145-5p and ADD3. [score:2]
MiR-145 is predicted to target 3’UTR of ADD3. [score:2]
MiR-145 was shown to be down-regulated in liver tissues of infants with BA compared to CC (p = 0.0267). [score:2]
As both ADD3 and p-Akt were regulated by miR-145-5p in LX-2 cells, we suppose that ADD3 may play a role in Akt signaling pathway, and facilitate the activation and proliferation of LX-2 cells, and thus contributes to advanced liver fibrosis. [score:2]
We as well generated a plasmid containing mutations in predicted miR-145-ADD3 sites. [score:2]
MiR-145-5p inhibited Akt phosphorylation in LX-2 cells. [score:2]
0180896.g009 Fig 9 MiR-145 was shown to be differentially expressed in liver tissues of BA. [score:2]
MiR-145-5p was used as a primer for qPCR reaction to verify the expression of MiR-145 in BA liver tissues. [score:1]
A combined plasmid with mutations in the predicted binding site was generated and underwent co-transfection with different groups of miR-145 by luciferase assays, showing that there was NO significant difference among different groups for luciferase activities (Fig 2B). [score:1]
And this was confirmed in the qPCR for miR-145-5p after transfection. [score:1]
Pearson correlation analysis between miR-145-5p and ADD3. [score:1]
cDNA of ADD3 was synthesized from each sample using PrimeScript RT reagent Kit (TaKaRa, Dalian, China) while that of miR-145 was synthesized from each sample using MiR-X miRNA First-Strand Synthesis (Clontech, Japan). [score:1]
Therefore they suggest that miR-145 could be one of the treatments for liver fibrosis in BA infants. [score:1]
0180896.g001 Fig 1 (A) and (B) ADD3 was predicted to have a putative miR-145 binding site within its 3’UTR. [score:1]
MiR-145-5p was confirmed to target ADD3 by luciferase reporter assay. [score:1]
So the original level of miR-145 may be low in LX-2 cells, even though anti-miR-145 was transfected into LX-2 cells, there would be no further influence on ADD3. [score:1]
Furthermore, qPCR for miR-145 was performed. [score:1]
0180896.g002 Fig 2s for miR-145 and ADD3 3’UTR co-transfection. [score:1]
In order to verify a successful lentiviral transfection, fluorescence was detected and qPCR for miR-145-5p was performed after transfection (Fig 4). [score:1]
It was as well confirmed by luciferase assays that miR-145 decrease the relative activity of luciferase by directly binding to 3’UTR of ADD3 in LX-2 cells (Fig 2A). [score:1]
[1 to 20 of 78 sentences]
5
[+] score: 293
Other miRNAs from this paper: hsa-mir-17, hsa-mir-34a, hsa-mir-143, hsa-mir-34b, hsa-mir-34c
SOD1, although not predicted as a direct target of miR-143 or miR-145 in bioinformatics analysis (miRanda MiRBase, Target Scan and MiRDB), was reduced after miR-143 and miR-145 overexpression in human colon cancer cells, thus suggesting indirect targeting. [score:11]
A gross analysis of protein expression variation between samples showed that approximately 30% of proteins displayed altered abundance both in miR-143 and miR-145 overexpressing cells, from a total of 83 differentially expressed proteins in miR-143 overexpressing versus Empty cells and 112 in miR-145 overexpressing versus Empty cells. [score:11]
Proteomic analysis revealed a total of 83 differentially expressed proteins in miR-143 overexpressing cells and 112 in miR-145 overexpressing cells. [score:7]
Red arrows represent proteins that were down-regulated in miR-143 or miR-145 2-DE patterns, while green arrows represent proteins that were up-regulated in miR-143 or miR-145 2-DE patterns. [score:7]
From the total altered proteins, showing a differential fold expression < 0.7 or > 2 between each test sample and the control, we identified 45 proteins in miR-143 overexpressing cells, and 48 proteins in miR-145 overexpressing cells (S2 Table). [score:7]
However, oxidative stress inhibition in miR-145 overexpressing cells following oxaliplatin treatment significantly reduced caspase-3/7 activity, while NAC exposure partially blocked apoptosis, suggesting that oxidative stress -induced apoptosis may be induced by oxaliplatin treatment, but may not be the major cell death mechanism at play in miR-145 overexpressing cells. [score:7]
SOD1, GRP94 and ANXA2 proteins are among those whose steady state levels were downregulated by miR-143 or miR-145 overexpression. [score:6]
In this study, comparative proteomic analysis of HCT116 colon cancer cells with stable miR-143 or miR-145 overexpression identified several differentially expressed proteins associated with the regulation of protein folding, cell death and response to oxidative stress. [score:6]
Similarly, miR-145 overexpression has been shown to regulate apoptosis [21] and to inhibit colon cancer cell proliferation [21, 22]. [score:6]
In miR-145 overexpressing HCT116 cells, 35% of the identified interacting proteins are involved in the regulation of cell death (q-value < 0.001) (GO Pathway number 0010941), including proliferation -associated protein 2G4 (PA2G4), pyrroline-5-carboxylate reductase 1, mitochondrial (P5CR1), T-complex protein 1 subunit alpha (TCPA), heat shock proteins HSPD1, HSP90B1, HSP90AB1, HSPA9 and HSPB1, protein disulphide isomerase (PDIA1), Rho GDP-dissociation inhibitor 1 (GDIR1), glutathione S-transferase (GSTP1), peroxideroxin-2 (PRDX2), calreticulin (CALR), and the proteasome activator complex subunit 1 (PSME1) (S3B Fig). [score:6]
Therefore, SOD1 reduction in miR-145 overexpressing cells may not be enough to increase oxidative stress, as other important targets regulating ROS production in these cells may also play a role. [score:6]
This study identified differentially expressed proteins in miR-143 and miR-145 overexpressing cells using proteomic analysis, further validated for three candidate proteins related to carcinogenesis. [score:5]
Particularly, expression of the antioxidant enzyme superoxide dismutase 1 (SOD1) was reduced in cells overexpressing miR-143 or miR-145. [score:5]
In addition, combination of miR-143 and miR-145 overexpression inhibited colon cancer cell line proliferation and migration in vitro, decreasing in vivo tumour growth [24]. [score:5]
miR-143 and miR-145 overexpression reduce SOD1, GRP94 and ANXA2 protein expression in human colon cancer cells. [score:5]
Protein-protein interaction network analysis revealed a significant interaction between 35 proteins in miR-143 overexpressing HCT116 cells (S3A Fig), and 40 proteins in miR-145 overexpressing HCT116 cells (S3B Fig and Table 1) (p < 0.001). [score:5]
Importantly, our results showed that ROS levels in miR-143 overexpressing cells, but not in miR-145 overexpressing cells, were greater than in control cells, and re-introducing SOD1 abrogated miR-143 -induced ROS production. [score:5]
In colon cancer mouse xenografts, forced expression of miR-145 suppresses tumour growth [23] and angiogenesis [22]. [score:5]
In this study, using two-dimension gel electrophoresis and mass spectrometry we analysed protein expression patterns of HCT116 colon cancer cells overexpressing either miR-143 or miR-145. [score:5]
Moreover, 50 protein spots were present only in the 2-DE protein patterns of cells overexpressing miR-143, and 142 spots were identified only in cells overexpressing miR-145. [score:5]
Validation of differentially expressed proteins in miR-143 or miR-145 overexpressing cells. [score:5]
Forced expression of miR-145 resulted in inhibition of ROS production and oxidative stress -induced apoptosis [48]. [score:5]
Consistent with the proteomic data, SOD1 was downregulated in HCT116 cells with stable miR-143 or miR-145 overexpression compared to control cells, as confirmed by Western blotting (p < 0.05) (Fig 3A, top). [score:5]
Identification of differentially expressed proteins in miR-143 or miR-145 overexpressing cells. [score:5]
One-way ANOVA test with Turkey’s post-test analysis for comparison between the 3 conditions (HCT116 Empty cells, HCT116 overexpressing miR-143 cells, and HCT116 overexpressing miR-145 cells) retrieved a p-value < 0.0001. [score:5]
MicroRNA-145 suppresses cell invasion and metastasis by directly targeting mucin 1. Cancer research. [score:5]
Both miR-143 and miR-145 are broadly described as downregulated in numerous solid tumours, including colon cancer [14]. [score:4]
In turn, KRAS and RREB1 are miR-143 and miR-145 direct targets, respectively, potentiating KRAS -mediated tumourigenesis [42]. [score:4]
We found that miR-145 overexpression in HCT116 cells is not associated with an increase in ROS generation. [score:3]
Finally, a principal component analysis (PCA) showed that each protein 2-DE pattern obtained for each condition has distinct variances, and revealed that the variation between protein patterns was more pronounced in cells overexpressing miR-145 (Fig 1B). [score:3]
Fold variance of common proteins between HCT116 human colon cancer cells overexpressing miR-143, miR-145 or Empty vector. [score:3]
and protein extraction for two-dimensional electrophoresis HCT116 cells overexpressing miR-143 and miR-145, and Empty control cells, were seeded, allowed to grow for 72 h and processed for total protein extraction. [score:3]
In this regard, we show here that miR-145 overexpression also induces apoptosis in HCT116 cells treated with oxaliplatin, suggesting that miR-145 enhances chemosensitivity of cancer cells to oxaliplatin treatment. [score:3]
Our results showed that proteins found to be significantly modulated in miR-143 or miR-145 overexpressing cells are involved in cell death pathways, response to oxidative stress and protein processing in endoplasmic reticulum. [score:3]
Only pathways common to miR-143 or miR-145 overexpressing HCT116 cells are indicated. [score:3]
Briefly, HCT116 cells were transduced with retroviral particles carrying MSCV-Neo constructs overexpressing miR-143, miR-145 or Empty vector, followed by selection with 1 mg/ml neomycin. [score:3]
Functional proteomic analysis also indicated that regulation of apoptosis might be a biological process regulated by both miR-143 and miR-145. [score:3]
HCT116 cells overexpressing miR-143 and miR-145, and Empty control cells, were seeded, allowed to grow for 72 h and processed for total protein extraction. [score:3]
Likewise, miR-145 has been shown to induce caspase -dependent apoptosis in colon cancer by targeting DNA fragmentation factor (DFF45) [21], and to sensitize cells to tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) -induced apoptosis [52, 53]. [score:3]
Average and standard deviation of the % volume of proteins in at least three independent 2-DE maps of HCT116 human colon cancer cells stably overexpressing miR-143, miR-145 or Empty vector. [score:3]
While 211 protein spots were identified in the control, 244 and 349 proteins were identified in HCT116 cells overexpressing miR-143 and miR-145, respectively (Fig 1A). [score:3]
HCT116 cells stably expressing miR-143 or miR-145, and empty control cells, were seeded for 48 h. Then, attached cells were washed with PBS to remove detached cells, fixed with 4% paraformaldehyde in PBS for 20 min, washed with PBS, and stained with 5 μg/ml Hoechst 33258 (Sigma-Aldrich) in PBS for 15 min at room temperature, protected from light. [score:3]
Although miR-143 and miR-145 have targets in common, they play distinct roles in cellular function. [score:3]
Caspase-3/7 activity and annexin V/7-AAD assays also showed that combined overexpression of miR-143 and miR-145 did not induce further changes after oxaliplatin treatment as compared with overexpression of individual miRNAs (S4 Fig). [score:3]
Protein extracts from HCT116 human colon cancer cells stably overexpressing miR-143 or miR-145, and from HCT116 Empty control cells (S1 Fig) were subjected to proteomic analysis to hint at molecular players involved in colon cancer control by miR-143 and miR-145. [score:3]
Protein expression was also evaluated in HCT116, HT29 and SW620 cells with transient miR-143 or miR-145 overexpression (Fig 3C). [score:3]
After oxaliplatin treatment, miR-143 and miR-145 overexpression increased caspase-3/7 activity as well as apoptotic cells (Fig 5C and 5D). [score:3]
No significant effect was observed in miR-145 overexpressing cells. [score:3]
S1 Fig miR-143 and miR-145 expression in HCT116 (a, b), HT29 (c), and SW620 (b) human colon cancer cells. [score:3]
For SOD1, GRP94 and ANXA2 expression protein analysis, at the time of platting, cells were transfected with 40 nM of specific miR-143 or miR-145 precursors (premiR-143, AM17100; premiR-145, AM11480) alone or in combination, or with a pre-miR negative control (premiR-C, AM17110), using Lipofectamine 3000 (Thermo Fisher Scientific), according to the manufacturer’s protocol, and collected 72 h later. [score:3]
Forced expression of miR-143 or miR-145 in HCT116 cells resulted in increased proteins in the 2-DE patterns. [score:3]
miR-143 or miR-145 overexpression increases cetuximab -mediated antibody -dependent cellular cytotoxicity in human colon cancer cells. [score:3]
In turn, GRP94 and ANXA2 steady-state levels were reduced in HCT116 cells with stable miR-143 or miR-145 overexpression (p < 0.05) (Fig 3B). [score:3]
HCT116 cells with stable overexpression of miR-143 and miR-145 and empty control cells, were seeded and allowed to grow to confluence. [score:3]
Two-dimensional gel electrophoresis analysis of HCT116 human colon cancer cells overexpressing miR-143, miR-145, or Empty vector. [score:3]
NAC exposure, in turn, decreased apoptosis induced by miR-143 or miR-145 overexpression and oxaliplatin treatment, as shown by a significant reduction in caspase activity (p < 0.05) (Fig 5D, top) and in apoptotic cells (p < 0.01) (Fig 5D, bottom). [score:3]
miR-143 and miR-145 overexpression increases sensitivity to oxaliplatin -mediated apoptosis in human colon cancer cells. [score:3]
We generated miR-143 and miR-145 stably overexpressing HCT116 cells as previously described [25]. [score:3]
Protein-protein network in HCT116 human colon cancer cells overexpressing miR-143 or miR-145, relative to Empty vector. [score:3]
We selected SOD1, GRP94 and ANXA2 to validate differential protein expression and evaluated steady state levels by immunoblotting in cells with stable or transient miR-143 or miR-145 overexpression (S1 Fig). [score:3]
GO biological processes altered in miR-143 or miR-145 overexpressing HCT116 human colon cancer cells compared to Empty control cells with False Discovery Rate < 0.05.. [score:2]
Cell growth profiles showed that miR-143 and miR-145 overexpression reduced HCT116 cell proliferation by up to 20 and 40% (p < 0.01) at 96 h, respectively, compared to empty vector control cells (Fig 5A). [score:2]
0191607.g005 Fig 5(a) The growth profiles of HCT116 cells transiently expressing miR-143 (premiR-143), miR-145 (premiR-145), or control (premiR-C) precursors were monitored by MTS metabolism assay at 4, 24, 48, 72 and 96 h after plating. [score:2]
In addition, overexpression of miR-143 or miR-145 enhanced nuclear fragmentation (Fig 5B, top), and decreased cell migration (Fig 5B, bottom), as compared to empty control cells. [score:2]
The expression of miR-143 and miR-145 was analysed by quantitative reverse transcription PCR (qRT-PCR) by TaqMan MicroRNA Reverse Transcription Kit and TaqMan MicroRNA assays for hsa-miR-143, hsa-miR-145, and human RNU6B for normalization to endogenous control. [score:2]
miR-143 and miR-145 impact on cell proliferation and morphology and miR-143 -induced oxidative stress contributes to oxaliplatin -mediated apoptosis in HCT116 human colon cancer cells. [score:1]
Next, we evaluated the endogenous production of ROS in cells overexpressing miR-143 or miR-145 (Fig 4B). [score:1]
The miR-143/miR-145 cluster is composed of two co-transcribed miRNAs, miR-143 and miR-145, which have distinct roles in cellular function [12, 13]. [score:1]
To identify the differences between protein patterns across samples, the fold variation between HCT116 cells overexpressing miR-143, miR-145 or Empty vector control was calculated (S2 Table). [score:1]
Therefore, to better understand the involvement of these miRNAs in oxidative stress -induced cell death in colon cancer cells, we evaluated the levels of ROS in miR-143 and miR-145 overexpressing cells treated with the chemotherapeutic drug oxaliplatin. [score:1]
The relative amount of miR-143 or miR-145 was determined by the threshold cycle (2 [−ΔΔCT]) method, where ΔΔCT = (CT [miRNA]−CT [RNU6B]) sample − (CT [miRNA]−CT [RNU6B]) calibrator. [score:1]
Moreover, miR-143 and miR-145 sensitized colon cancer cells to oxaliplatin treatment by increasing apoptosis. [score:1]
0191607.g003 Fig 3HCT116 cells were stably transduced with miR-143, miR-145, or Empty vector. [score:1]
HCT116, HT29 and SW620 cells were transiently transfected with miR-143 (premiR-143), miR-145 (premiR-145), or control (premiR-C) precursors. [score:1]
HCT116 and SW620 cells may thus be more susceptible to miR-143 and miR-145 effects. [score:1]
The delivery of miR-143 and miR-145 in experimental cancer mo dels appears to be beneficial as a potential cancer therapy [15, 16]. [score:1]
Together, these findings suggest that miR-143 and miR-145 play an important role in colon cancer onset and sensitization to anti-cancer therapy, which highlights their potential as a miRNA -based therapeutic approach. [score:1]
HCT116 cells stably transduced with miR-143, miR-145, or Empty vector were transfected with pCI-neo (pCI) or pCI-neo-SOD1 (pCI-SOD1) plasmids, or exposed to NAC and treated with oxaliplatin (Ox). [score:1]
In addition, both miR-143 and miR-145 reduce cell proliferation and migration, and enhanced apoptosis during cetuximab -dependent cellular cytotoxicity by increasing caspase-3/7 activity and PARP cleavage, and by reducing Bcl-2 protein levels [25]. [score:1]
Importantly, we have previously shown that miR-143 acts as a sensitizer to 5-fluouracil [17], and either miR-143 or miR-145 induce tumour cell sensitization to cetuximab -mediated cellular cytotoxicity [25]. [score:1]
miR-143 and miR-145 impact on cell proliferation and morphology and sensitize to oxaliplatin -induced apoptosis. [score:1]
S4 FigHCT116 cells transiently transfected with miR-143 (premiR-143), miR-145 (premiR-145), or control (premiR-C) precursors were treated with oxaliplatin (Ox). [score:1]
Subsequently, we investigated the effects of miR-143 and miR-145 overexpression in colon cancer cell proliferation. [score:1]
HCT116 cells stably transduced with miR-143, miR-145, and Empty vector were treated with oxaliplatin (Ox) and transfected with pCI-neo (pCI) or pCI-neo-SOD1 (pCI-SOD1) plasmids (c), or exposed to NAC (d). [score:1]
HCT116 cells were stably transduced with miR-143, miR-145, or Empty vector. [score:1]
To further investigate the role of SOD1 in miR-143 or miR-145 -induced oxidative stress, we transfected cells with either a vector overexpressing human wild-type SOD1 or the respective control vector (Fig 4A). [score:1]
Mechanisms of miR-143 and miR-145 ROS -mediated cell death in cancer are not fully explored. [score:1]
Our data also show that miR-143 and miR-145 reduced cell proliferation and migration and increased apoptosis in HCT116 cells treated with oxaliplatin. [score:1]
0191607.g004 Fig 4HCT116 cells stably transduced with miR-143, miR-145, or Empty vector were transfected with pCI-neo (pCI) or pCI-neo-SOD1 (pCI-SOD1) plasmids, or exposed to NAC and treated with oxaliplatin (Ox). [score:1]
[1 to 20 of 89 sentences]
6
[+] score: 287
miR-143 downregulates the expression of c-Myc, cyclin D1 and c-jun through inhibiting ERK5 expression, and upregulates miR-145, probably by elevating the common transcript of endogenous pri-miR-143/pri-miR-145. [score:13]
Forced Expression of miR-143 Induced miR-145 Expression in the Small Intestine Tumors of Apc [Min/+] Mice and Suppressed the Tumor DevelopmentTo express miR-143 ubiquitously in whole body, we made a construct which carried ∼300 bp human pri-miR-143 fragment under the CAG regulatory unit, composed of CMV enhancer and chicken β-actin promoter, and injected it into the fertilized mice eggs [17] (Fig. 1A). [score:11]
Since Sachdeva et al. recently revealed that miR-145 when activated by p53 directly suppressed c-Myc expression, it is likely that miR-143 and miR-145 complement each other to downregulate c-Myc expression in our experimental systems [24]. [score:11]
The data of our transfection experiments, together with these previous studies, suggest that miR-143 probably inhibits tumor development by downregulating c-Myc expression in cooperation with miR-145 in our transgenic mice. [score:9]
As shown in Fig. 5B (3 [rd] panel), miR-145 mimic inhibited p72 expression, while neither miR-143 mimic nor siRNA for ERK5 seemed to have significant effect, which data demonstrate that the downregulation of p72 in the small intestine tumors of Tg/APC may be mainly elicited by miR-145. [score:8]
Effect of miR-143 and miR-145 converge on the repression of c-Myc, leading to the decrease of p68 expression, while miR-145 directly inhibits p72 expression. [score:8]
Forced Expression of miR-143 Induced miR-145 Expression in the Small Intestine Tumors of Apc [Min/+] Mice and Suppressed the Tumor Development. [score:8]
These findings suggest that miR-143 and miR-145 might act in concert to inhibit both ERK5/c-Myc and p68/p72/β-catenin signaling, and thereby suppress the expression of cyclin D1, c-jun and c-Myc itself. [score:7]
Moreover, Suzuki et al. reported that the processing of pri-miR-143 and pri-miR-145 required the interaction of the tumor suppressor p53 and the Drosha complex through the association with p68/p72 in colon cancer cells, suggesting that the full expression of miR-143 and miR-145 might be involved in tumor suppressing signaling driven by p53 [14]. [score:7]
These data implied that failure of suppression of p68 expression by mimics of miR-143 and miR-145 in colon cancer cells might be due to insufficient c-Myc inhibition. [score:7]
We also present that the expression of c-Myc and p72 is downregulated by miR-143/miR-145 and miR-145, respectively, in a human colon cancer cell lines, DLD-1 and Lovo cells. [score:6]
Michael et al. initially reported that the expression of miR-143 and miR-145 was downregulated in many colorectal neoplasms, suggesting their potential action as tumorsuppresors [4]. [score:6]
Indeed, this notion was supported by the following studies, which revealed that the downregulation of miR-143 and miR-145 could be involved in B-cell malignancy [5] and that colon tumor cell proliferation was suppressed by transfection with miR-143 [6]. [score:6]
Figure 3B indicated that both of pri-miR-143 and pri-miR-145 expression was upregulated in the small intestine tumors of Tg/APC. [score:6]
Our results suggested the downregulation of p72 by miR-145 through binding to its 3′UTR might be at least one of the molecular basis for the decrease of its expression in the transgenic small intestine tumors. [score:6]
These results implied that the downregulation of p72 observed in the transgenic small intestine tumors could be at least in part a direct effect of miR-145. [score:5]
Here, we present that forced expression of miR-143, which is in vivo processed from pri-miRNA, induces miR-145 expression and represses the small intestine tumor formation in Apc [Min/+] mice. [score:5]
c-Myc expression was not significantly suppressed by either miR-143 or miR-145 mimic when individually transfected. [score:5]
Thus, the forced expression of miR-143 in the small intestine tumors may induce the transcription of a bicistronic pri-miR-143/miR-145 to promote the expression of miR-145, and possibly miR-143. [score:5]
As far as we examined, none of miR-143 and miR-145 mimics significantly inhibited p68 expression in DLD-1 cells and Lovo cells (Fig. 5B, 4 [th] panel, Fig. S3B, 3 [rd] panel). [score:5]
Analysis by TargetScan indicated that there existed one possible binding site of miR-145 in the 3′untranslated region (3′UTR) of p72 of many animal species. [score:5]
These data suggested that forced expression of miR-143 should be sufficient for ERK5 repression, but that miR-145 induction might be a crucial event for full inhibition of cyclin D1, c-jun and c-Myc through retardation of 68/p72/β-catenin signaling. [score:5]
However as most of these studies used synthetic miR-143 and miR-145 mimics, their expression was transient and usually far beyond the level normally expressed in living organisms. [score:5]
To examine whether miR-143 induces the miR-145 expression in human colon tumor cells, we introduced miR-143 mimic into DLD-1 cells and Lovo cells, and analyzed the miR-145 expression by qRT-PCR. [score:5]
miR-145 also suppressed the expression of p78 in Lovo cells (Fig. S3B, 2 [nd] panel). [score:5]
In summary, miR-143 and miR-145 likely work together to inhibit at least two signaling pathways involving ERK5/c-Myc and p68/p72/β-catenin in the intestine tumors of Apc [Min/+] mice, and thereby suppress their common downstream effectors. [score:5]
This synergistic effect of miR-143 and miR-145 on c-Myc downregulation was also observed in another human colon cancer cell line, Lovo (Fig. S3B, 1 [st] panel). [score:4]
Thus, miR-145 might directly bind the mRNA of p72 and restrain the expression of p72. [score:4]
The expression of mouse pri-miR-143 and pri-miR-145 of the small intestine tumors from Tg/APC (gray bars, n = 5) and their non-transgenic littermates (W/APC) (open bars, n = 4) was examined. [score:3]
Unexpectedly, the expression of miR-145 of transgenic small intestine tumors also increased in proportion to that of miR-143 (Fig. 3A). [score:3]
Hence, additional events other than miR-143 expression seemed necessary for substantial induction of miR-145 in colon cancer cells. [score:3]
D) Schematic depiction of pGL3-Promoter plasmids fused to the 3′UTR fragment of p72 containing a potential target site of miR-145 and its mutant. [score:3]
A) Polyacrylamide Northern blot analysis of expression of miR-143 and miR-145 of gut tumors. [score:3]
These data implicated that suppression of c-Myc might be at least partly involved in the elevation of miR-145 and probably of miR-143 in the transgenic intestine tumors. [score:3]
As shown in Figure S4A, the expression level of miR-145, as well as normal organs (Fig. 1B), was almost comparable between the transgenic mice and their littermates. [score:3]
The expression of mouse pri-miR-143 and pri-miR-145 of tumors from Tg/APC (gray bars, n = 3) and their non-transgenic littermates (W/APC) (open bars, n = 3) was examined in the same way as B). [score:3]
Figure 5F showed that c-Myc siRNA enhanced the expression of miR-145 to some extent in both cells. [score:3]
Possible Involvement of c-Myc in the Elevation of miR-145 Expression. [score:3]
miR-143 and miR-145 have emerged as tumor suppressing miRNAs, particularly for colon cancers. [score:3]
Complementary pairs of miR-145 and its target within the seed sequence are shown as vertical bars. [score:3]
In contrast, we detected only little enhancement of miR-145 in Tg/APC colon tumors even though one of the tumors examined strongly expressed miR-143 (see Fig. 3A #13). [score:3]
Thus, it is possible that p68 and c-Myc might form a positive feedback loop, which suggests that miR-143 and miR-145 might inhibit p68 in part through the repression of c-Myc. [score:3]
To examine whether the upregulation of miR-145 in Tg/APC tumors was due to the increase of pri-miRNA, we performed qRT-PCR analysis of the mouse endogenous pri-miR-143 and pri-miR-145 with two sets of primers covering each pre-miRNA region. [score:3]
The reporter assay shows that p72 could be a direct target of miR-145. [score:3]
0042137.g003 Figure 3 A) Polyacrylamide Northern blot analysis of expression of miR-143 and miR-145 of gut tumors. [score:3]
Hence, given qRT-PCR analysis of pri-miR-143/145 and Western blot analysis of transgenic tumors, forced -expression of miR-143 might trigger c-Myc/pri-miR-145 signal more easily in the small intestine tumors than in the colon tumors. [score:3]
Indeed, although miR-143 was strongly expressed in one colon tumor of transgenic mice, the induction of miR-145 was poor (Fig. 3A #13). [score:3]
E) % inhibition of luciferase reporter activity of the wild and mutant transfectants by miR-145 mimic is shown. [score:3]
Repression of p68/p72 may impair β-catenin signaling to repress the expression of c-Myc, cyclin D1 and c-jun, and concurrently retard the processing of pri-miR-143/miR-145 to prevent the overproduction of miR-143 and miR-145. [score:3]
Next, we examined the effect of miR-143, miR-145 or siRNA for ERK5 on c-Myc expression in DLD-1 cells. [score:3]
Hence, we examined the effect of miR-143 and miR-145 on p68/p72 expression in DLD-1 cells. [score:3]
Consistent with the transgenic intestine tumors, the expression of pri-miR-145 of c-Myc siRNA-introduced cells was increased (Fig 5H). [score:3]
Indeed, the p68/p72 knockout mice study demonstrated that p68/p72 were required for the processing of pri-miRNAs of a subset of miRNAs, such as miR-145 and miR-16 [13]. [score:2]
To test this idea, we constructed a fusion gene of luciferase reporter gene and the p72 3′UTR harboring one miR-145 target sequence, and subjected it to reporter assays. [score:2]
Since KRAS mutation is not a usual event in tumors of Apc [Min/+] mice [9], [10], the induction of miR-145 by miR-143 in our transgenic mice would be dependent on a molecular mechanism distinct from KRAS-RREB1 signaling. [score:2]
Nonetheless, our study with their report indicates that regulatory circuits between miR-143 and miR-145 might exert anti-tumor effect in a variety of neoplasms in living animals. [score:2]
To examine whether the regulation of miR-145 by c-Myc occurred at the transcriptional level, we performed qRT-PCR analysis of pri-miR-145. [score:2]
Other investigators recently reported that a positive feedback circuit between miR-143 and miR-145 could work through suppressing KRAS-RREB1 signaling in pancreatic cancer cells, although they did not mention the cross-regulation at the mature miRNA levels [36]. [score:2]
Fig. 5E demonstrated that miR-145 mimic decreased reporter activity of vector with the wild 3′UTR of p72 by 73% of that of the mutated 3′UTR. [score:1]
F) qRT-PCR of miR-145 (F), miR-143 (G) and pri-miR-145 (H) in DLD-1 cells and Lovo cells. [score:1]
The complex of p53, p68 and p72 with DGCR8 and Drosha reinforces the processing of pri-miR-143/pri-miR-145. [score:1]
For luciferase reporter assay, the 3′UTR fragments of the mouse p68 and p72 containing possible target sites for miR-145, miR-26a, miR-34a or miR-206 were amplified from genomic DNA of a C57BL/6 mouse by PCR using specific primers containing an XhoI site at the 5′end. [score:1]
There was, however, no obvious enhancement of miR-145 (data not shown). [score:1]
C) qRT-PCR analysis of the mouse endogenous pri-miR-143 and pri-miR-145 of the colon tumors. [score:1]
To construct CAG/EGFP, the insert fragment of pMXs-puro-EGFP -miR-145/miR-143 [39] was subcloned into XhoI site of pCAGGS vector, and pri-miR-145 fragment was excised by ClaI and NotI. [score:1]
miRNA mimics of miR-143, miR-145, miR-34a and miR-26a were purchased from Qiagen GmbH (Hilden, Germany), and miR-206 mimic was obtained from Ambion. [score:1]
The membrane was hybridized with the probes for miR-143(1 [st] panel), miR-145 (2 [nd] panel) and 5S rRNA (3 [rd] panel). [score:1]
B) Quantitative Real-Time PCR (qRT-PCR) analysis of the mouse endogenous pri-miR-143 and pri-miR-145. [score:1]
DEAD-box RNA helicase subunits p68/p72, which are components of Microprocessor, promote the processing of pri-miR-143 and pri-miR-145 [13], [14]. [score:1]
0042137.g006 Figure 6 The complex of p53, p68 and p72 with DGCR8 and Drosha reinforces the processing of pri-miR-143/pri-miR-145. [score:1]
Whereas miR-145 was induced in the small intestine tumors in Tg/APC, the molecular mechanisms remain to be obscure. [score:1]
10 p mol of each miRNA mimic was transfected for a combination of miR-143 and miR-145. [score:1]
The expression of mature miR-143 and miR-145 was assayed with the Taqman MicroRNA Assays (Applied Biosystems) specific for hsa-miR-143 (P/N: 4395360) and hsa-miR-145 (P/N: 4395389), respectively. [score:1]
On the other hand, neither of pri-miR-143 nor pri-miR-145 significantly increased in the transgenic colon tumors (Figure 3C). [score:1]
Hence, the failure of miR-145 induction in transgenic colon tumors seemed to occur at the transcriptional level. [score:1]
The membrane was hybridized with the probes for miR-143(upper panel), miR-145 (middle panel) and 5S rRNA (lower panel). [score:1]
Interestingly, endogenous miR-145 is also increased in these tumors. [score:1]
miR-143 and miR-145 were transcribed as a bicistronic unit, a common pri-miRNA, in DGCR8 -null embryo bodies [18]. [score:1]
Thus, the induction of endogenous miR-145 appears to work preferentially in the small intestine polyps. [score:1]
[1 to 20 of 79 sentences]
7
[+] score: 253
Additionally, the tumor suppressor gene p53, which is inactivate in approximately 50% of human cancers, upregulates miR-145 expression, whereas the Ras oncogene downregulates its expression [28, 29]. [score:13]
In the present study, our data show that miR-145 downregulates c-Myc and its target gene cyclin D1, as supported by the findings in other cancers that miR-145 represses the expression of c-Myc and its downstream targets in colon cancer and non-small cell lung cancer (NSCLC) [21, 37]. [score:10]
Importantly, our data showed that miR-145 downregulated the expression of c-Myc and Cdk6, which have previously been identified as two direct targets of miR-145. [score:9]
To date, a cohort of genes related to different cancer pathways have been identified and validated as targeted genes of miR-145, such as Pai-1, Fascin1, Oct-4, Sox-2, Klf4, c-Myc, IRS1, Muc1, Yes, Stat1, and p70S6K1[18- 25], suggesting that miR-145 is an oncosuppressor and plays an important role in the initiation and progression of tumor, as supported by several direct evidences that the ectopic expression of miR-145 in cancer cells leads to a loss in cell viability and induces cell death [13, 19, 26]. [score:8]
In line with this study, a previous study has shown that miR-145 inhibits Cdk6 expression by direct targeting its 3’-UTR in colon cancer cells [31]. [score:8]
Our data suggest that miR-145 exerts its tumor suppressor function by targeting c-Myc and Cdk6, leading to the inhibition of OSCC cell growth. [score:7]
We further confirmed that miR-145 was able to downregulate the target genes of c-Myc, cyclin D1, which were involved in cell cycle regulation. [score:7]
One major tumor suppressor miRNA, miR-145, which plays a crucial role in regulating smooth muscle cell differentiation [12] and inducing apoptosis [13], is downregulated in many cancers, including prostate, bladder and colon cancer, as well as B-cell malignancies [14- 17]. [score:7]
Our data show that compared with adjacent normal tissues, miR-145 expression in OSCCs is significantly downregulated, suggesting that miR-145 is a candidate tumor suppressor in the pathogenesis of OSCC. [score:7]
Moreover, miR-145 -mediated suppression of cell invasion and metastasis is in part caused by directly targeting MUC1 [23]. [score:6]
Down-regulation or silencing of miR-145 may abolish tumor suppression so as to contribute to oral tumorigenesis. [score:6]
To be consistent with our findings, a previous study shows that miR-145 inhibits the migration of microvascular cells in response to growth factor gradients by directly targeting a transcription factor Fli-1 [38]. [score:6]
Furthermore, miR-145 re -expression induces cell cycle arrest and apoptosis, further suggesting its tumor suppressor function. [score:5]
Taken together, miR-145 exhibits the growth inhibitory ability in Tca8113 cells and acts as a potential tumor suppressor. [score:5]
These data are supported by the findings in the other cancers that the ectopic expression of miR-145 in cancer cells leads to inhibition of cell proliferation and induces cell death [13, 19, 26]. [score:5]
Meanwhile, we find that miR-145 dramatically inhibits Cdk6 expression in Tca8113 cells. [score:5]
Thus, we attempt to explore whether miR-145 -mediated inhibition of cell growth is due to through targeting c-Myc oncogene. [score:5]
Restoring miR-145 expression in OSCC cells dramatically suppressed cell proliferation and colony formation, and induced G1 phase arrest and cell apoptosis. [score:5]
We also demonstrated the miR-145 suppressed OSCC cell growth by targeting c-Myc and Cdk6. [score:5]
To our knowledge, the present of study is the first to demonstrate that miR-145 inhibits OSCC cell growth by targeting c-Myc and Cdk6. [score:5]
These findings suggested that miR-145 suppressed OSCC cell growth, at least in part, by targeting c-Myc and Cdk6. [score:5]
Figure 6 MiR-145 inhibits the expression of c-Myc, Cyclin D1, and Cdk6 in Tca8113 cells. [score:4]
Prompted by numerous studies of miR-145 downregulation in several human cancers [14- 17], we sought to identify the role of miR-145 in oral carcinogenesis. [score:4]
Although downregulation of miR-145 is found in an animal OSCC mo del [30], its role in human oral carcinogenesis remains largely unknown. [score:4]
It has been well known that downregulation of miR-145 is caused by promoter hypermethylation in several cancers [27, 28]. [score:4]
MiR-145 restoration in Tca8113 cells shows significant growth-suppressing effect by inhibiting cell proliferation and colony formation in the present study. [score:4]
A recent study also shows that miR-145 affects cell migration of glioblastoma (GB) in vitro and in vivo by directly targeting NEDD9, implicating an important role of miR-145 in GB invasion [39]. [score:4]
Taken together, we propose that miR-145 regulates OSCC cell growth, at least partially, by targeting c-Myc and Cdk6, and that loss of miR-145 may provide a selective growth advantage during oral carcinogenesis. [score:4]
MiR-145 inhibits OSCC cell growth by targeting c-Myc and Cdk6. [score:4]
The biological functions of miR-145 in Tca8113 cells were determined by blotting c-Myc and its downstream target, cyclin D1, as well as Cdk6. [score:3]
We analyzed the expression levels of miR-145 in a cohort of OSCCs, adjacent normal tissues and normal mucosa tissues by RT-qPCR. [score:3]
To better understand the tumor suppressive effect of miR-145 in oral tumorigenesis, particularly inhibition of cell growth, we investigate the effect of miR-145 on c-Myc and Cdk6 in the present study. [score:3]
Additionally, miR-145 significantly decreased Cdk6, a major cyclin D -dependent kinase, which was identified as another putative target of miR-145 [31]. [score:3]
Although the evidences have highlighted the importance of miR-145 as an oncosuppressor in OSCCs, the precise molecular mechanisms remain largely unclear. [score:3]
Our data showed that miR-145 was significantly downregulated in OSCCs compared with normal oral tissues. [score:3]
The aim of this study is to determine expression levels of miR-145 in oral squamous cell carcinomas (OSCCs) and normal mucosa tissues, and explore its biological functions in OSCCs. [score:3]
MiR-145 is downregulated in OSCCs. [score:3]
We therefore examined the contribution of cell cycle arrest and apoptosis to the observed growth inhibition of miR-145 -transfected cells. [score:3]
Increasing evidences indicate that miR-145 acts a tumor suppressor in numerous human cancers. [score:3]
These observations suggest that miR-145 may be an oncosuppressor in this cancer. [score:3]
In summary, our data show that miR-145 is significantly downregulated in OSCCs compared with adjacent normal tissues. [score:3]
As this unique feature of miR-145 -mediated gene silencing in human cancers, including OSCC, miR-145 may thus prove to be a potential biomarker for cancer diagnosis and serves as a new target for cancer therapy. [score:3]
MiR-145 has been reported to be frequently downregulated in various kinds of cancers [14- 17]. [score:3]
We thus test the putative tumor suppressor function of miR-145 in OSCC. [score:3]
Notably, we find that miR-145 inhibits OSCC cell invasion in the present study. [score:3]
, Shanghai, China) were used to restore miR-145 expression: MiR-145 mimics, 5’-GUC CAG UUU UCC CAG GAA UCC CU-3’; MiRNA control, 5’-AGG UAG UGU AAU CGC CUU GTT-3’. [score:3]
As shown in Figure  6, c-Myc expression was dramatically decreased in miR-145 -transfected cells compared with miRNA control -transfected cells whatever the mRNA or protein level. [score:2]
Figure 2. (A) Restoration of MiR-145 expression in Tca8113 cells was evidenced by RT-qPCR. [score:2]
MiR-145 was frequently down-regulated in OSCCs compared with normal mucosa tissues. [score:2]
As demonstrated by MTT assays, miR-145 restoration dramatically inhibited OSCC cell proliferation (Figure  2B). [score:2]
MiR-145 inhibits OSCC cell growth. [score:2]
Increased expression of MiR-145 upon transfection was confirmed by RT-qPCR (Figure  2A). [score:2]
As shown in Figure  5, the Matrigel assays showed that the number of cells that passed through Matrigel-coated membrane into the lower chamber was significantly lower in the miR-145 -transfected cells than in the miRNA control -transfected cells (P <0.001), suggesting that miR-145 inhibited the invasive potential of Tca8113 cells. [score:2]
MiR-145 inhibits OSCC cell invasion. [score:2]
As shown in Figure  1, miR-145 expression was significantly decreased in OSCCs compared with adjacent normal tissues and normal mucosa tissues. [score:2]
In the present study, we investigated expression levels of miR-145 in primary OSCCs and adjacent normal oral tissues using reverse transcription quantitative real-time PCR (RT-qPCR). [score:1]
However, there is presently not very much known about miR-145 involvement in oral carcinogenesis. [score:1]
Given the invasive ability is one of the most important features of malignancies, and one of the causes of poor prognosis, thus, miR-145 appears to be a key factor for tumor aggressiveness. [score:1]
MiR-145 mimics and miRNA control (30 nM each) were used for each transfection. [score:1]
Cells were transfected with miR-145 mimics or control for 24 h. Forty-eight hours after transfection, cells were harvested and resuspended with 500 μL of binding buffer. [score:1]
As OSCC is a type of highly malignant tumor with a potent capacity to invade locally and distant metastasis, we next attempted to explore the effect of miR-145 restoration on OSCC cell invasion. [score:1]
Figure 1. Expression level of miR-145 in each individual case of OSCCs, adjacent normal tissues and normal mucosa tissues was evaluated using RT-qPCR. [score:1]
Representative flow cytometric histograms of cells transfected with miR-145 mimics and miRNA control from three independent experiments are shown in panel A. The fraction of cells in each cell cycle phase is indicated in panel B. PI, propidium iodide; *, P <0.05. [score:1]
Cells transfected with miR-145 mimics and miRNA control were starved overnight and harvested. [score:1]
Tca8113 cells were transiently transfected with miR-145 mimics and miRNA control. [score:1]
To test the effect of miR-145 on OSCC cell growth, we used miR-145 mimics to transfect human OSCC cell line Tca8113. [score:1]
Left panel showed the representative image of colony formation in Tca8113 cells transfected with miR-145 mimics and miRNA control. [score:1]
In the present study, we attempt to investigate miR-145 expression in OSCCs and adjacent normal tissues, and explore its biological function in oral carcinogenesis. [score:1]
[1 to 20 of 68 sentences]
8
[+] score: 251
In cells overexpressed both FSCN1 and miR-145, the anti-EMT effect of miR-145 as evidenced by upregulation of E-cadherin, downregulation of N-cadherin and vimentin (Figure 4C), and attenuation of migration and invasion (Figure 4D) was largely reversed by ectopic expression of FSCN1. [score:11]
miR-145 has been downregulated in many cancers [15– 19], functioning as tumor suppressor to inhibit tumor cell growth and survival, induce cell apoptosis and cell cycle arrest, and attenuate tumor cell migration and invasion via targeting various molecules [16– 18, 20– 23]. [score:10]
Figure 6 20(S)-Rg3 down-regulated DNMT3A to demethylate pre-miR-145 and thus upregulated mature miR-145 that targeted FSCN1 and finally blocked EMT to attenuate cell migration and invasion. [score:9]
Transfection of miR-145 inhibitor (Supplementary Figure 2) into 20(S)-Rg3 -treated cells (Figure 1C) reversed 20(S)-Rg3-rendered E-cadherin upregulation and N-cadherin and vimentin downregulation (Figure 1D, Supplementary Figure 3). [score:9]
20(S)-Rg3 down-regulated DNMT3A to demethylate pre-miR-145 and thus upregulated mature miR-145 that targeted FSCN1 and finally blocked EMT to attenuate cell migration and invasion. [score:9]
Figure 3 (A) qRT-PCR showed that ectopic expression of miR-145 had negligible effect on DNMT3A expression in DNMT3A -overexpressed cells. [score:7]
Ectopic expression of miR-145 in DNMT3A -overexpressed cells (Figure 3A) did not in turn affect DNMT3A expression (Figure 3B), but blunted the EMT-inducible activity of DNMT3A as shown by restoration of E-cadherin, loss of N-cadherin and vimentin (Figure 3C), and attenuation of cell motility and invasion (Figure 3D). [score:7]
In this study, we found that miR-145 was under control of DNMT3A -mediated DNA methylation, and 20(S)-Rg3 inhibited DNMT3A expression to demethylate pre-miR-145 and thus increase miR-145 expression. [score:7]
20(S)-Rg3 upregulated miR-145 via suppressing DNMT3A -mediated methylation of pre-miR-145. [score:6]
20(S)-Rg3 upregulated miR-145 via suppressing DNMT3A to demethylate pre-miR-145 gene. [score:6]
DNMT3A plasmid was transfected into 20(S)-Rg3 -treated cells to restore the expression of DNMT3A (Figure 2C), which reversed the 20(S)-Rg3-triggered upregulation of miR-145 (Figure 2D). [score:6]
miR-145 directly targeted FSCNI to inhibit EMT. [score:6]
These results indicated that 20(S)-Rg3 enhanced miR-145 via inhibiting DNMT3A expression and thus relieved the methylation restrain on pre-miR-145 transcription. [score:5]
Inhibition of miR-145 also blocked the inhibitory effect of 20(S)-Rg3 on the migration and invasion of both S KOV3 and 3AO cells (Figure 1E). [score:5]
Additionally, western blot analysis showed that miR-145 overexpression diminished FSCN1 expression level (Figure 4B). [score:5]
In conclusion, we found that 20(S)-Rg3 reversed EMT to inhibit ovarian cancer cells migration and invasion via antagonizing DNMT3A -mediated methylation of pre-miR-145 to promote inhibition of miR-145 on FSCN1. [score:5]
We provided evidence that miR-145 inhibited EMT by suppressing FSCN1, however, the detailed mechanism about function of FSCN1 in EMT occurrence still necessitated further elucidation. [score:5]
We first predicted putative target genes of miR-145 by searching the TargetScan database (release 5.1, http://www. [score:5]
Meanwhile, overexpression of miR-145 largely inhibited migration and invasion of both S KOV3 and 3AO cells (Figure 1H). [score:5]
The promotion of miR-145 by 20(S)-Rg3 directly targeted FSCN1 to reverse EMT in vitro and vivo. [score:4]
These results not only uncovered the novel anti-cancer mechanism of 20(S)-Rg3, but also revealed the regulatory pathway for miR-145 expression. [score:4]
Since miR-145 was reported downregulated in ovarian cancer cells and involved in EMT in many types of cancer, we explored the effect of 20(S)-Rg3 on miR-145. [score:4]
20(S)-Rg3 reversed EMT via upregulating miR-145. [score:4]
These results showed that 20(S)-Rg3 upregulated miR-145 to reverse EMT in ovarian cancer cells. [score:4]
These data indicated the direct suppressive effect of miR-145 on FSCN1. [score:4]
We then examined the inhibitory effect of miR-145 on the intraperitoneal dissemination of ovarian cancer. [score:3]
miR-145-up S KOV3 cells (transfected by miR-145 -expressing lentivirus) or negative control cells (NC) were subcutaneously inoculated into nude mice. [score:3]
In the present study, we discovered that 20(S)-Rg3 enhanced miR-145 expression by downmodulating DNMT3A to attenuate the methylation level in the promoter region of miR-145 precursor gene. [score:3]
miR-145 inhibited ovarian cancer EMT in vivo. [score:3]
Next we explored the target of miR-145 to block EMT. [score:3]
Taken together, our data suggested that miR-145 blocked EMT by targeting FSCN1 in ovarian cancer cells. [score:3]
To generate mutant 3′-UTR fragment of miR-145 target gene, we adopted the two-step PCR method as reported previously. [score:3]
Decreased expression and anti-tumor function of miR-145 have been observed in several cancers [41, 42]. [score:3]
miR-145 mimic (inhibitor) and negative control were purchased from Ribo-Bio Co. [score:3]
We next overexpressed miR-145 to examine its effect on EMT of ovarian cancer cells. [score:3]
In parallel, MSP results showed that overexpression of DNMT3A increased the methylation level in the promoter region of pre-miR-145 in 20(S)-Rg3 -treated S KOV3 and 3AO cells (Figure 2E). [score:3]
miR-145 inhibited DNMT3A-promoted EMT. [score:3]
These results showed that DNMT3A induced EMT via inhibiting miR-145. [score:3]
These data reproduced the suppressive action of miR-145 on ovarian cancer cell in vivo. [score:3]
miR-145 inhibited ovarian cancer EMT in vivoTo determine the effect of miR-145 on ovarian cancer progression in vivo, the primary tumor growth in nude mice were examined. [score:3]
FSCN1 [47] is a newly identified miR-145 target in a few cancers. [score:3]
S KOV3 and 3AO cells were seeded into 6-well plates to reach 40%–50% confluency after 24 h and then transiently transfected with 60 nM miR-145 mimic (S KOV3) or 100 nM miR-145 inhibitor or negative control using the X-treme GENE siRNA Transfection Reagent (Roche, Indianapolis, IN, USA). [score:3]
In the present study, we showed that DNMT3A induced EMT via decreasing miR-145 expression. [score:3]
miR-145 overexpression (Figure 1F) increased E-cadherin while decreased N-cadherin and vimentin (Figure 1G). [score:3]
The wild-type 3′-UTR sequence of the target gene carrying a putative miR-145 binding site was amplified by PCR. [score:3]
Here we provided the evidence that overexpression of FSCN1 was sufficient to confer EMT to ovarian cancer cells, and its aberrant elevation in ovarian cancer tissues was possibly benefited from miR-145 diminution. [score:3]
The mechanistic studies about miR-145 inhibition on cancer progression have initially focused on its roles in cell apoptosis, cell cycle and cell proliferation [43, 44]. [score:3]
In both S KOV3 and 3AO cells, 20(S)-Rg3 stimulated miR-145 expression (Figure 1B). [score:3]
S KOV3 cells were infected with miR-145 -expressing lentivirus GV209-miR145 (GENECHEM, Shanghai, China) or negative control lentivirus GV209 (GENECHEM, Shanghai, China). [score:3]
The luciferase reporter assay showed that luciferase activity was significantly inhibited in cells co -transfected with miR-145 mimic and FSCN1 WT-3′ UTR vector, while no changes of luciferase activity were detected in cells transfected with miR-145 mimic and luciferase reporter plasmids containing the mutant seeding sequence (Figure 4A). [score:2]
However, to our knowledge, there have been no reports about the methylation regulation of miR-145 in ovarian cancer. [score:2]
miR-145 was normalized to small nuclear U6, while DNMT3A normalized to β-actin. [score:1]
Here, we first reported that the pathway composed of DNMT3A, miR-145, and FSCN1 was implicated in the anti-EMT mechanism of 20(S)-Rg3 (Figure 6), and that the methylation repression of miR-145 by DNMT3A played an important role in EMT occurrence. [score:1]
Since DNA hypermethylation has been connected to miR-145 deregulation in prostate cancer [27], we compared the methylation status of miR-145 precursor gene in 20(S)-Rg3 -treated cells relative to non -treated cells. [score:1]
Mice in miR-145-up group lost less body weight than NC group. [score:1]
Tumors in spleen fascia and diaphragm of miR-145-up mice were substantially smaller in size than those in NC mice, and immunohistochemistry analysis of metastatic tumor showed the tumors were from the intraperitoneal dissemination (Figure 5F). [score:1]
Since the role of FSCN1 in EMT was not fully explored, we investigated whether FSCN1 mediated the inhibitory effect of miR-145 on EMT. [score:1]
No differences in body weight were observed between NC and miR-145-up groups. [score:1]
The MSP results illustrated that the methylation level in the promoter region of pre-miR-145 promoter was decreased in 20(S)-Rg3 -treated S KOV3 and 3AO cells (Figure 2A). [score:1]
And less metastatic tumor nodules and ascites were developed in miR-145-up group (Figure 5E). [score:1]
The xenografts in miR-145-up group were obviously smaller in size than those in NC group. [score:1]
The initial assessment of potential CpG islands in the 2000 bp upstream genomic sequence encoding pre-miR-145 found no CpG islands but some CG sites. [score:1]
To determine the effect of miR-145 on ovarian cancer progression in vivo, the primary tumor growth in nude mice were examined. [score:1]
Lately, miR-145 has been inversely connected to cancer cell motility and invasiveness, and the mechanism may partly be attributed to its anti-EMT effect [45, 46]. [score:1]
NC or miR-145-up S KOV3 cells were inoculated into the abdomen of nude mice. [score:1]
During the 28-day observation, the average body weigh was higher in miR-145-up group than NC group, which became significant since day 22 (Figure 5D). [score:1]
We further studied the role of miR-145 in DNMT3A-promoted EMT. [score:1]
miR-145 blocked DNMT3A -induced EMT. [score:1]
Specifically, although 4 conserved miR-145 seeding sequences were predicted to exist in the 3′-UTR of FSCN1, only one of them was experimentally confirmed as an actual binding site which was cloned into a luciferase reporter plasmid in our study [28]. [score:1]
Some microRNAs including miR-145, miR-200, and miR-29b, to name a few, have been suggested as EMT repressors in various types of cancer [11– 14]. [score:1]
When reached 80%-90% confluency, cells were co -transfected with pRL-TK vector (20 ng), wild-type (WT-3′ UTR) or mutant (MUT-3′ UTR) reporter vectors (180 ng), along with miR-145 mimic or negative control at a final concentration of 20 nM using the X-treme GENE siRNA Transfection Reagent. [score:1]
Nevertheless, the correlation of miR-145-FSCN1 with EMT has not been compellingly proven in the published data. [score:1]
Figure 2 (A) MSP showed that the methylation level in the pre-miR-145 promoter of S KOV3 and 3AO cells was decreased by 20(S)-Rg3. [score:1]
3′-UTRs of FSCN1 containing the wild-type or mutant putative miR-145 binding site were cloned into a luciferase reporter plasmid, respectively. [score:1]
[1 to 20 of 74 sentences]
9
[+] score: 235
Other miRNAs from this paper: hsa-mir-143
As a tumor suppressor, miR-145 has been reported to have downregulated expression in various cancer tissues, although the targets of miR-145 have not been definitively identified [8– 11]. [score:10]
Lee et al. reported that low miR-145 expression in glial tumors predicted poor prognosis, and upregulated miR-145 significantly decreased the migration and invasion of glioma cells by targeting connective tissue growth factor [5]. [score:8]
Studies on miRNA expression profiles have indicated that downregulation of miR-145 is a common event in malignant disease [5, 21, 26]. [score:8]
In hepatocellular carcinoma (HCC), miR-145 was found to target a number of genes along the signaling pathway of insulin-like growth factor (IGF), including IGF-1 receptor, insulin receptor substrate-1 (IRS-1), and IRS-2, all of which are directly downregulated by miR-145 [8]. [score:7]
Figure 4 Forest plots of merged analyses for patient survival or disease progression associated with microRNA-145 (miR-145) expression in different subgroups of pathologic types and malignant diseases. [score:7]
Recent researches have shown that downregulation of miR-145 expression is significantly associated with poor survival and prognostic outcomes of patients with cancer [5– 9, 11, 21, 27, 29]. [score:6]
Our results showed that upregulated miR-145 significantly predicted a favorable overall survival (OS) (HR = 0.47, 95% CI 0.31 to 0.72), but failed to show a significant relation with disease prognosis. [score:6]
Recent studies show several underlying mechanisms playing key roles in regulating miR-145 expression, especially in relation to p53, the central tumor suppressor. [score:6]
In addition, a significantly favorable OS associated with upregulated miR-145 expression was observed in both squamous cell (SCC) (HR = 0.34, 95% CI 0.13 to 0.93) and glioblastoma (HR = 0.72, 95% CI 0.52 to 0.99). [score:6]
Our results showed that upregulated miR-145 expression was a significant predictor of favorable OS (pooled HR = 0.47, 95% CI 0.31 to 0.72) (Table  3; Figure  3A). [score:6]
Loss of miR-145 expression is also observed frequently in KRAS-mutated pancreatic cancer, and the downregulation of miR-145 requires Ras-responsive element -binding protein (RREB1) to repress its promoter [42]. [score:6]
Forest plots were used to estimate the effect of miR-145 expression on patient survival and disease progress. [score:5]
In addition, downregulated miR-145 expression was found in PCa tissue compared with benign prostatic hyperplasia tissue, and this was correlated with higher Gleason score, advanced clinical stage, larger tumor diameter, and higher levels of prostate-specific antigen. [score:5]
Based on the respective results of the analyzed studies, we found that genetic background, pathology, or disease type seemed to have specific effects on the association of miR-145 expression and patient prognosis. [score:5]
Figure 3 Forest plots of merged analyses for patient survival or disease progression associated with microRNA-145 (miR-145) expression, and Begg funnel plots of publication bias test. [score:5]
Our findings indicate that high miR-145 expression is better at predicting patient survival rather than disease progression for malignant tumors, especially for SCC and glioblastoma in Asians. [score:5]
Using Cox proportional regression analysis, Avgeris et al. demonstrated that patients with PCa who had lower miR-145 expression exhibited a significantly higher risk for disease recurrence. [score:5]
In head and neck squamous cell carcinoma (SCC), miR-145 also can target the SOX9/ADAM17 axis to inhibit tumor-initiating cells and IL-6 -mediated paracrine effects [11] (Figure  1). [score:5]
Extracted data elements included the following: 1) first author name and publication year; 2) characteristics of the studied population, including patient nationality, ethnicity, disease, pathological type, and sample category; 3) detection method and cut-off definition; 4) follow-up time; and 5) HRs of elevated miR-145 expression for overall survival (OS), recurrence-free survival (RFS), disease-free survival (DFS), metastasis-free survival (MFS), and progression-free survival (PFS), along with their 95% CIs and P values. [score:5]
Malignant neoplasm miR-145 Prognosis Overall survival Progression-free survival Emerging studies have demonstrated that deregulated expression of microRNAs (miRNAs) correlates with cancer prognosis because of the distinct expression profiles of these miRNAs in cancerous tissues compared with normal tissues [1– 3]. [score:5]
In addition, Sachdeva et al. suggested that a regulatory system of miR-145 involving the Akt and CCAAT/enhancer binding protein beta (C/EBP-β) may contribute to the downregulation of miR-145 in cancer cells [43] (Figure  1). [score:5]
Stratified analyses displayed that high miR-145 expression was a significantly favorable prediction for tumor progression in Asian subgroup of four studies (pooled HR = 0.43, 95% CI 0.21 to 0.89) by a random-effects mo del (P = 0.090, I [2] = 53.8%), but failed to show a significant association between miR-145 expression and tumor progression in White subgroup of seven studies (pooled HR = 1.27, 95% CI 0.71 to 2.26) (Table  3; Figure  3B). [score:5]
Suh et al. found that downregulation of miR-145 was mediated through DNA methylation and p53 mutation pathways [40], which frequently occur in various malignant tumors. [score:5]
Figure 1 Reported mechanisms for the anti-tumor effect and expression regulation of microRNA-145 (miR-145). [score:4]
By contrast, Huang et al. claimed that the downregulation of a combination of six miRNAs including miR-145 was significantly correlated with advanced stage, lymph node metastasis, and poor prognosis in small cell carcinoma of the cervix [26]. [score:4]
However, little is known about why miR-145 is often downregulated in tumors. [score:4]
Law et al. also reported that miR-145 independently coordinated the regulation of many components along the IGF pathway via its multigene targets, and was an independent prognostic predictor [9]. [score:4]
Tumor progression associated with miR-145 expression. [score:3]
In addition, the high expression of miR-145 can predict better PFS in Asians, but not in Whites. [score:3]
To fit the eligible criteria, selected studies had to be published in English, had to focus on human malignant tumors, and had to have performed stratified analyses on patient prognoses using the dichotomous expression levels of miR-145. [score:3]
A number of studies have shown significant associations between low miR-145 expression and poor cancer prognosis, but other studies did not find any significant association, and still others showed a negative correlation [12, 13] that might cast doubt on the anti-oncogenic role of miR-145. [score:3]
p53 can enhance post-transcriptional maturation of miR-145 in response to DNA damage, and transcriptionally inactive p53 mutants result in attenuation of miRNA biological processing activity and predict worse prognosis in patients with low miR-145 expression [41]. [score:3]
First, six studies in the White subgroup displayed a better OS associated with elevated miR-145 expression (pooled HR = 0.67, 95% CI 0.47 to 0.95) by a random-effects mo del (P = 0.032, I [2] = 59.1%). [score:3]
High miR-145 expression also predicted better progression-free survival (PFS) in Asians (HR = 0.43, 95% CI 0.21 to 0.89), but not in Whites. [score:3]
Campayo et al. found that low miR-145 expression independently predicted a shorter time to relapse in patients with NSCLC [7]. [score:3]
In stratified analyses, high miR-145 expression predicted favorable OS in both Whites and Asians but the intensity of the association in Whites (HR = 0.67, 95% CI 0.47 to 0.95) was not as strong as in Asians (HR = 0.35, 95% CI 0.19 to 0.64). [score:3]
Our results demonstrated that high miR-145 expression was significantly correlated with favorable OS in overall analyses (P < 0.001), but did not exhibit an obvious association with tumor progression (P = 0.596) (Table  3). [score:3]
Furthermore, this unfavorable prognosis, associated with low miR-145 expression, was independent of patient Gleason score, clinical stage, PSA levels, and age [20]. [score:3]
Overall survival associated with miR-145 expression. [score:3]
The combined application of miR-145 with other miRNAs might confer more specificity for predicting patient prognosis in various malignant diseases, but this hypothesis needs to be proved by more clinical research. [score:3]
CI Confidence interval DFS Disease-free survival HCC Hepatocellular carcinoma HNC Head and neck cancer HR Hazard ratioI [2] Higgins I-squared statistic MFS Metastasis-free survival miR-145 MicroRNA-145 miRNA MicroRNA NSCLC Non-small cell lung cancer OS Overall survival PCa Prostate cancer PFS Progression-free survival qRT-PCR Quantitative reverse transcription PCR RFS Recurrence-free survival. [score:3]
Our stratified analyses provide further confirmation that high miR-145 expression can predict favorable OS for patients both in White and Asian subgroups, but the association in Whites (HR = 0.67) is not as strong as in Asians (HR = 0.35). [score:3]
Fourth, the expression of miR-145 was detected by tissue samples in all of the analyzed articles except one, which used serum. [score:3]
High miR-145 expression was found to be significantly associated with favorable OS in both SCC (pooled HR = 0.34, 95% CI 0.13 to 0.93) and glioblastoma (pooled HR = 0.72, 95% CI 0.52 to 0.99). [score:3]
High expression of miR-145 seemed to be predict favorable OS in patients with SCC or glioblastoma but not adenocarcinoma, but these results need to be confirmed by further research. [score:3]
The other four studies in Asians also showed that high miR-145 expression was significantly associated with a favorable OS (pooled HR = 0.35, 95% CI 0.19 to 0.64) using a random mo del (P = 0.025, I [2] = 67.9%). [score:3]
Our meta-analysis results indicate that high miR-145 expression is more suitable as a biomarker to predict favorable patient survival rather than to predict tumor progression, especially for SCC and glioblastoma in Asians. [score:3]
In addition, p53 can induce miR-145 by binding directly to its promoter, after which miR-145 can silence c-Myc, demonstrating the role of miR-145 in p53 -mediated c-Myc repression [10]. [score:2]
Liu et al. also reported that Fascin Homolog 1 (FSCN1) could be co-regulated by miR-43 and miR-145, and suggested the combination of miR-143 and miR-145 as a potential biomarker for the prognosis of esophageal cancer [47]. [score:2]
These results indicate that miR-145 is a promising biomarker to predict prognosis for patients with cancers. [score:1]
Therefore, the association between patient prognosis and serum expression of miR-145 should be further investigated. [score:1]
Several combinations of the following keywords were simultaneously applied: ‘cancer’ , ‘carcinoma’ , ‘neoplasm’ , ‘tumour’ , ‘tumor’ , ‘microRNA-145’ , ‘microrna-145’ , ‘miRNA-145’ , ‘miR-145’ , ‘survival’ , ‘recurrence’ , ‘relapse’ , ‘metastasis’ , and ‘prognosis’. [score:1]
Therefore, we conducted a meta-analysis to clarify the preliminary predictive value of miR-145 in tumor prognoses. [score:1]
Given the current insufficient evidence, further investigations and more studies are needed to focus on the relationship between miR-145 expression and patient prognosis. [score:1]
Fifth, it remains unknown whether miR-145 should be used as an independent biomarker or as part of a combination of several biomarkers for predicting tumor prognosis. [score:1]
Law et al. also confirmed that miR-145 modulates the IGF signaling pathway by reducing its downstream mediator, the active β-catenin [9]. [score:1]
To clarify the preliminary predictive value of miR-145 for prognosis in various malignant neoplasms, we conducted a meta-analysis of 18 relevant studies. [score:1]
In total, 447 studies focusing on the relationship between miR-145 and cancer were identified from an initial online literature search, and 363 studies were excluded by manual screening of titles and abstracts. [score:1]
Pooled hazard ratios (HRs) with 95% confidence intervals (CIs) for patient survival and disease progress were calculated to investigate the association with miR-145 expression. [score:1]
Recent studies show that microRNA-145 (miR-145) might be an attractive tumor biomarker of considerable prognostic value. [score:1]
Furthermore, as a cancer biomarker, detection of miR-145 ub serum samples is more convenient, faster and more acceptable for patients to dynamically monitor their prognosis and therapeutic effects through their lifetime. [score:1]
Quantitative reverse transcription PCR (qRT-PCR) was used to measure miR-145 expression in 17 studies, while the remaining study used microarray. [score:1]
Pathological types also had a considerable impact on the prognostic role of miR-145. [score:1]
The loss of the anti-oncogenic miR-145 may result in higher risk of biochemical recurrence, shorter DFS, and worse OS in patients with PCa [20]. [score:1]
The anti-tumor effects of miR-145 with various mechanisms have been demonstrated by abundant clinical and basic studies [8– 11]. [score:1]
All of these data demonstrated that the pooled results of overall analyses are crude and cannot give accurate values of miR-145 for prognosis. [score:1]
Different results might be obtained for detection of miR-145 in peripheral blood samples. [score:1]
In these reported protective miRNAs, miR-145 has been studied relatively intensively and thoroughly for cancer prognosis. [score:1]
[1 to 20 of 68 sentences]
10
[+] score: 234
We have previously published that ectopic expression of miR-145 led to significant growth inhibition through the suppression of PI3K/Akt and MAPK signaling pathways in bladder cancer cells [21]. [score:7]
As shown in Figure 7B and 7C, the expression levels of KLF4 were inversely correlated with the expression level of miR-145 and were strongly correlated with the expression levels of PTBP1. [score:7]
MiR-145 downregulates KLF4 and c-Myc in bladder cancer, and KLF4 and c-Myc directly regulate the expression of PTBP1. [score:7]
It is well known that c-Myc, which positively regulates the expression of PTBP1 in the upstream [24], is a direct target of miR-145 [14]. [score:7]
Figure 10 MiR-145 downregulates KLF4 and c-Myc in bladder cancer, and KLF4 and c-Myc directly regulate the expression of PTBP1. [score:7]
Also, KLF4 expression was highly correlated with that of PTBP1 (r = 0.6769, P < 0.0001, Figure 7B); KLF4 expression was inversely correlated with that of miR-145 (r = −0.3638, P = 0.0369, Figure 7B); as was PTBP1 expression (r = −0.3429, P = 0.0467, Figure 7C). [score:7]
We previously reported that ectopic expression of miR-145 induces apoptosis through the downregulation of c-Myc and socs7 in bladder cancer cells [9– 11]. [score:6]
We have previously reported that miR-145 is downregulated and acts as a tumor suppressor in colon adenomas [4, 5] and colon cancers [6], gastric cancers [7], chronic lymphocytic leukemias, B-cell lymphomas [8], and bladder cancer cells [9, 10]. [score:6]
In the current study, we show that miR-145 was significantly decreased in BC clinical samples compared with its expression in NBEs (Figure 1A) and that the ectopic expression of miR-145 inhibited cell growth in the BC cell lines tested (Figure 2A). [score:6]
Ectopic expression of miR-145 induced growth inhibition through impaired Warburg effect. [score:5]
Effects of ectopic expression of miR-145 on cell viability (A) and expression of various proteins estimated by Western blot analysis (B) at 48 h after transfection of T24 and 253J B-V cells with miR-145 (10, 40 nM). [score:5]
Furthermore, treatment with antagomiR-145 reversed the growth inhibition elicited by miR-145 and the increased expression level of KLF4 in 253J B-V cells (Figure 4C and 4D). [score:5]
Taken together, these results indicated that miR-145 targeted KLF4 at the translational level in BC cells. [score:5]
Figure 2Effects of ectopic expression of miR-145 on cell viability (A) and expression of various proteins estimated by Western blot analysis (B) at 48 h after transfection of T24 and 253J B-V cells with miR-145 (10, 40 nM). [score:5]
ND, no down-regulation of miR-145 relative ratio (tumor tissue/adjacent normal tissue ≧ 0.67). [score:4]
Thus, miR-145 affected the Warburg effect through the downregulation of c-Myc, leading to the decreased PKM2/PKM1 ratio in these cell lines. [score:4]
Therefore, we sought to clarify whether KLF4 was a direct target of miR-145 and if KLF4 affected the Warburg effect. [score:4]
Interestingly, a different group recently reported that miR-145 targets hexokinase 2, which regulates the first step of glycolysis, in renal cancer cells [30]. [score:4]
It is also known that miR-145 targets c-Myc [14], which regulates PTBP1, leading to impairment of the Warburg effect (PTBP1/PKMs axis). [score:4]
In addition, the ectopic expression of miR-145 partly induced apoptosis by regulating the PTBP1/PKM1/PKM2 axis through the silencing of KLF4 in BC cells. [score:4]
Ectopic expression of miR-145 or knockdown of KLF4 induces apoptosis in BC cells. [score:4]
[c]D,down-regulation of miR-145 relative ratio (tumor tissue/adjacent normal tissue < 0.67). [score:4]
As a result, the introduction of miR-145 induced downregulation of c-Myc and reduced PKM2/PKM1 ratio in either cell line (Figure 2B and 2C). [score:4]
Ectopic expression of miR-145 or knockdown of KLF4 induced apoptosis in BC cells. [score:4]
In order to examine whether miR-145 or siR-KLF4 could suppress the growth of solid tumors, we used the in vitro 3D spheroid system. [score:3]
Since apoptosis requires ATP [48], the increase in the intracellular ATP levels after the ectopic expression of miR-145 may have contributed to the induction of apoptosis. [score:3]
In addition, the expression levels of miR-145 were significantly decreased in the human bladder cancer T24 and 253J B-V cell lines (Figure 1B). [score:3]
Therefore, we examined the effects of ectopic expression of miR-145 on the c-Myc/PTBP1 network in the BC cell lines. [score:3]
As shown in Figure 2A, exogenous miR-145 also significantly suppressed the growth of T24 and 253J B-V cells. [score:3]
Taken together, these results indicate that miR-145 targets c-Myc, resulting in an impaired Warburg effect, at least in part by negatively affecting the c-Myc/PTBP1/PKMs axis. [score:3]
KLF4 is a target of miR-145 in the Warburg effect in BC cells. [score:3]
Figure 2D shows the decreased expression of PKM2 at the single-cell level in the cells transfected with miR-145. [score:3]
The expression of miR-145 was significantly decreased in clinical tumor samples from BC patients and BC cell lines. [score:3]
The sequence region 2161–2520, containing the putative binding sequence of miR-145, was inserted into a pMIR-REPORT [TM] Luciferase miRNA Expression Reporter Vector (Applied Biosystems) according the manufacturer's protocol. [score:3]
Among the targeted genes (mRNAs) of miR-145, we focused on Kruppel-like factor 4 (KLF4) in relation to the Warburg effect. [score:3]
Moreover, the ectopic expression of miR-145 increased the ATP level significantly by causing the switching from PKM2 to PKM1 (Figure 6B). [score:3]
Although the spheroids of 253J B-V cells in the control group exhibited a rapid growth, the growth of the tumor cells in the spheroids was significantly suppressed by treatment with either miR-145 or siR-KLF4 (100 nM; Figure 6F). [score:3]
However, the ectopic expression of miR-145 increased lactate production significantly (Figure 6A). [score:3]
Expression of miR-145 is decreased in clinical BC-tumor samples and BC cell lines. [score:3]
KLF4 was a target mRNA of miR-145 in BC cells. [score:3]
org/) indicated that miR-145 targets KLF4. [score:3]
Growth inhibition of 3-D tumor spheroids by treatment either with miR-145 or siR-KLF4. [score:3]
The protein expression of KLF4 in T24 and 253J B-V cells at 48 h after the transfection with miR-145 (10, 40 nM) is shown. [score:3]
Figure 1(A) Relative expression levels of miR-145 in clinical BCs and NBEs. [score:3]
We found that not only the miR-145/c-Myc/PTBP1/PKMs axis, but also the novel miR-145/KLF4/PTBP1/PKMs cascade operated in the regulation of cancer energy metabolism. [score:2]
We hypothesize that miR-145 regulates the Warburg effect through silencing both KLF4 and c-Myc. [score:2]
In the current study, we examined whether or not miR-145 could affect the regulation of the Warburg effect through silencing KLF4 in bladder cancer cells. [score:2]
Results indicate that the expression of miR-145 were significantly decreased in BCs compared with those in the normal bladder epithelium (NBE) adjacent to the tumors (Figure 1A). [score:2]
Figure 4(A) MiR-145 silenced KLF4 expression in T24 and 253J B-V cells. [score:2]
On the other hand, a mutation in the KLF4 3′-UTR -binding site markedly abolished the ability of miR-145 to affect the luciferase activity (Figure 4B). [score:2]
To determine the expression levels of miR-145, we conducted quantitative RT-PCR (qRT-PCR) by using TaqMan MicroRNA Assays (Applied Biosystems) and THUNDERBIRD Probe qPCR Mix (TOYOBO Co. [score:2]
We demonstrated that miR-145 regulates the Warburg effect through the miR-145/KLF4/PTBP1/PKMs axis. [score:2]
Hoechst33342 nuclear staining showed the typical apoptotic features, such as condensed chromatin and nuclear fragmentation, in the miR-145 -treated 253J B-V cells (Figure 6D and 6E). [score:1]
org/) to find algorithm -based binding sites of miR-145, we found a predicted binding site to be at positions 278–284 in the 3′-UTR of KLF4 mRNA. [score:1]
We next examined the intracellular levels of lactate and ATP after switching PKM isoforms from PKM2 to PKM1 by the transfection with miR-145. [score:1]
We have already reported that intravesical administration of exogenous miR-145 exhibits an anti-tumor effect in a human bladder cancer xenograft mo del [11]. [score:1]
We are thus now aiming to compare the efficacy of intravesical delivery of exogenous miR-145 to that of BCG in the xenografted mo del mice. [score:1]
Based on these results, we focused on the role of miR-145 in carcinogenesis of BC from the viewpoint of cancer energy metabolism. [score:1]
253J B-V cells were incubated with miR-145 for 48 h and then immunostained with PKM2 antibody according to the immunofluorescence protocol of Cell Signaling Technology. [score:1]
Approximately 3000 253J B-V cells were suspended in 1× Spheroid Formation ECM reagent and transfected with miR-145 (100 nM). [score:1]
We thus first reconfirmed the decrease of miR-145 in BC samples by performing real-time RT-PCR. [score:1]
These results suggest that exogenous miR-145 functioned as an anti-oncomir in these cells. [score:1]
T24 cells or 253J B-V cells were collected at 48 h after transfection with miR-145 (20 nM). [score:1]
We also reported that intravesical administration of exogenous miR-145 has an anti-tumor effect on orthotropic xenograft human bladder cancer tumors [11]. [score:1]
We therefore transfected T24 and 253J B-V cells with miR-145. [score:1]
The upper panel shows the region of the 3′-UTR of human KLF4 mRNA complementary to the mature miR-145. [score:1]
In this context, we explored the so far unaddressed function of miR-145 in the Warburg effect. [score:1]
We thus confirmed that miR-145 acts as an anti-oncomiR in BC cells. [score:1]
These findings furthermore suggest that miR-145 deeply contributes to impairing the Warburg effect. [score:1]
253J B-V cells were transfected with non-specific control, miR-145 (10 nM), miR-145 (10 nM) + antagomiR-145 (10 nM) or miR-145 (10 nM) + antagomiR-145 (20 nM). [score:1]
Moreover, we made another pMIR construct encompassing a mutated seed sequence for miR-145 (Wild type, GACTGGAA; mutant, GACGTCAA) by using a PrimeSTAR [®] Mutagenesis Basal Kit (TaKaRa). [score:1]
The box indicates the predicted binding sites for miR-145. [score:1]
The results suggested that KLF4 plays a pivotal role in the maintenance of the Warburg effect via c-Myc and/or PTBP1 and is a crucial gene in miR145/Warburg effect pathways. [score:1]
The mature type of miR-145 (mirVana [TM] miRNA mimic; Ambion, Foster City, CA, USA) was used for the transfection of the cells, which was achieved by using cationic liposomes, Lipofectamine [TM] RNAiMAX (Invitrogen), according to the manufacturer's protocol. [score:1]
Taken together, these findings demonstrate that transfection with miR-145 or siR-KLF4 negatively contributes to cell proliferation and induced apoptosis. [score:1]
Therefore, exogenous miR-145 would affect the Warburg effect more than gene silencing of KLF4. [score:1]
” (D) Immunofluorescence of PKM2 (lower panels) in 253J B-V cells transfected with miR-145 (20 nM). [score:1]
The sequence of the mature type of miR-145 used in this study was 5′-GUCCAGUUU UCCCAGGAAUCCCUU-3′; that of siR-KLF4, 5′-UUC AAGGGAAUUCUGGUCUUCCCUC-3′; that of siR-PTBP1, 5′-AUCUCUGGUCUGCUAAGGUCACUUC-3′; and that of siR-c-Myc, 5′-UUUGUGUUUCAACUGU UCUCGUCGU-3′. [score:1]
We showed that either exogenous miR-145 or gene silencing of KLF4 decreased PTBP1, resulting in a switching of PKM isoforms from PKM2 to PKM1 (Figures 2B and 5B). [score:1]
The cells were co -transfected with either reporter vector (0.01 μg/well each) and 20 nM miR-145 or nonspecific non-coding siRNA (Dharmacon, Tokyo, Japan). [score:1]
As expected, the amount of cleaved PARP tended to increase in the miR-145 -transfected cells (Figure 6C). [score:1]
Schematic diagram of dual pathways, miR-145/KLF4/PTBP1/PKMs axis and miR-145/c-Myc/PTBP1/PKMs axis. [score:1]
The effects manifested by the introduction of miR-145 into the cells were assessed 48 h after the transfection. [score:1]
MiR-145 is one of the representative anti-oncomiRs in various kinds of cancers. [score:1]
It was already reported by us and others that miR-145 is decreased in BC samples [17– 19] and BC cell lines [20]. [score:1]
[1 to 20 of 85 sentences]
11
[+] score: 233
Furthermore, western blotting assays indicated that the effect of linc-ROR overexpression on EMT phenotypes of HCC cells could be partially rescued by miR-145/mimics, and re -expression of miR-145/inhibitor could induce EMT in HCCLM3/shROR (or MHCC97-H/shROR) cells by downregulating epithelial markers and upregulating mesenchymal markers (Fig.   6C and Fig.   S1C). [score:12]
Meanwhile, immunofluorescence analysis showed that downregulated epithelial markers and upregulated mesenchymal markers induced by linc-ROR overexpression in HepG2 (or SMMC-7721) cells was partially reversed by miR-145/mimics, and vice versa in the transfected HCCLM3 (or MHCC97-H) cells (Fig.   6D and Fig.   S1D). [score:9]
The migratory and invasive effect of linc-ROR overexpression in HepG2 (or SMMC-7721) cells was also partially rescued by co-transfection with miR-14/mimics, whereas the anti-metastasis effect induced by linc-ROR downregulation in HCCLM3 (or MHCC97-H) cells could be partially reversed by miR-145/inhibitors (Fig.   6B and Fig.   S1B). [score:8]
Linc-ROR competitively binds to miR-145, and subsequently up-regulates the expression of its target gene ZEB2 to promote the migration and invasion of HCC cells. [score:8]
In order to prove the hypothesis, we first examined the expression level of miR-145 in HepG2 and SMMC-7721 cells stably transfected with linc-ROR, finding that miR-145 expression was significantly downregulated (Fig.   4A). [score:8]
The upregulation or downregulation of miR-145 in those transfected cells was confirmed by qRT-PCR (Fig.   5A). [score:7]
Inhibition of miR-145 mimics the biological functions of linc-ROR upregulation in HCC cells. [score:6]
qRT-PCR results showed that miR-145 expression level was downregulated by linc-ROR in HCC cells. [score:6]
Meanwhile, miR-145 expression levels in both cells transfected with shROR were significantly upregulated (Fig.   4B). [score:6]
Moreover, western blotting analysis was performed to observe the function of miR-145 on EMT phenotypes of HCC cells, and results showed that the expression of epithelial markers were decreased while the mesenchymal markers were increased following transfection of the miR-145/inhibitor into HepG2 (or SMMC-7721) cells. [score:5]
Similarly, miR-145/inhibitors restored the decrease of ZEB2 expression in the HCC cells transfected with shROR (Fig.   7B). [score:5]
And miR-145/inhibitor was transfected into HepG2 and SMMC-7721 cells, miR-NC/inhibitor as a negative control. [score:5]
In a word, the miR-145 expression level correlated negatively with linc-ROR expression level. [score:5]
Linc-ROR fragment containing the predicted miR-145 binding site was cloned into a pmirGlO Dual-luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA) to form the reporter vector pmiRGLO-ROR-wild-type (ROR-WT). [score:5]
It was proved that linc-ROR acted as a sponge for miR-145 to de-repress the expression of the target gene ZEB2, thereby inducing EMT and promoting HCC metastasis. [score:5]
In the present study, our findings showed that miR-145 suppression yielded very similar effects to ectopic linc-ROR expression in HCC cells. [score:5]
The above results suggest that inhibition of miR-145 mimics the functions of linc-ROR overexpression in HCC cells. [score:5]
MiR-145/inhibitor or miR-NC/inhibitor was transfected into HCCLM3 or MHCC97-H cells stably transfected with shROR, while miR-145/mimics or miR-NC/mimics was transfected into HepG2 or SMMC-7721 cells stably transfected with linc-ROR. [score:5]
MiR-145 has been reported to inhibit EMT and tumor metastasis by directly targeting 3′-UTRs of ZEB2, which is a key transcription factor of EMT [25]. [score:5]
Also, miR-145 has been implicated to function as tumor suppressor and inhibit cell invasion, migration and metastasis in HCC 22, 23. [score:5]
Hsa-miR-145 mimic/negative control mimics and hsa-miR-145 inhibitor/negative control inhibitor were purchased from Applied Biological (ABM, Canada). [score:5]
Co-transfection of linc-ROR overexpression plasmid and miR-145/mimics could significantly reduce ZEB2 expression level (Fig.   7A). [score:5]
Linc-ROR positively regulates the miR-145 target gene ZEB2 in HCC cells. [score:4]
Additionally, we also found that there was no difference in linc-ROR levels after knockdown of miR-145 or ectopic expression (Fig.   4C,D). [score:4]
Collectively, our research implicates the relevance of linc-ROR/miR-145/ZEB2 regulatory network as a potential therapeutic target for the highly aggressive and malignant HCC cancers. [score:4]
It has been reported that miR-145 represses EMT, tumor migration and invasion by directly targeting the 3′-UTRs of ZEB2 in tumors [25]. [score:4]
Also, we found that there was no difference in linc-ROR levels after ectopic expression or knockdown of miR-145. [score:4]
To determine whether linc-ROR was regulated by miR-145 in such a manner, we conducted anti-Ago2 RIP in HepG2 cells transiently overexpressing miR-145. [score:4]
These results revealed that linc-ROR could function as a ceRNA to regulate the expression of ZEB2 in a miR-145 -dependent manner. [score:4]
Yang, P. et al. The long non-coding RNA-ROR promotes the resistance of radiotherapy for human colorectal cancer cells by targeting the P53/miR-145 pathway. [score:3]
Besides, linc-ROR expression was negatively correlated with miR-145, but positively associated with ZEB2 in HCC tissues. [score:3]
Previous reports have proved that miR-145 possesses a tumor suppressive role in many cancers, including lung cancer, pancreatic cancer, breast cancer, HCC and colorectal cancer 34– 38. [score:3]
showed that endogenous linc-ROR pull-down was specifically enriched in miR-145 transfected cells (Fig.   4F), supporting that miR-145 is a bona fide linc-ROR -targeting miRNA. [score:3]
Fluorescent reporter assay and RIP analysis showed that linc-ROR was a direct target of miR-145 and could act as a sponge for miR-145. [score:3]
revealed enhanced mobility of HepG2 (or SMMC-7721) cells transfected with miR-145/inhibitor and the opposite effects for HCCLM3 (or MHCC97-H) cells transfected with miR-145/mimics (Fig.   5B and Fig.   S1A). [score:3]
Furthermore, we demonstrated that miR-145 expression level in HCC tissues was significantly lower than those in the adjacent normal tissues. [score:3]
Identification of miR-145 as a target of linc-ROR. [score:3]
As expected, the in vitro migration and invasion of HepG2 (or SMMC-7721) cells in the presence of miR-145/inhibitor could be significantly increased. [score:3]
As a result, we found that in HCCLM3 cells, the expression level of miR-145 was only about 30 copies per cell, whereas linc-ROR level was approximately 200 copies per cell. [score:3]
Taken together, these data strongly suggested that miR-145 is a bona fide linc-ROR -targeting miRNA. [score:3]
Collectively, these findings indicated that there is a regulatory signaling pathway in which linc-ROR regulates ZEB2 by competitively sponging up miR-145, inducing increased invasion, metastasis and an EMT phenotype in HCC cells (Fig.   7E). [score:3]
PCR primers were designed as follows: linc-ROR forward: 5′- CAGAAGCTGGAGTGGACAGGATTA-3′, and reverse: 5′- GTTCTATTTGTGGCCTGAAGATGTG-3′; ZEB2 forward: 5′- CGCTTGACATCACTGAAGGA-3′ and reverse: 5′- CTTGCCACACTCTGTGCATT-3′; miR-145 forward: 5′- GTCCAGTTTTCCCAGGAATC-3′, and reverse: 5′- AGAACAG-TATTTCCAGGAAT-3′; GAPDH forward: 5′- CTGGGCTACACTGAGCACC-3′, and reverse: 5′- AAGTGGTCGTTGAGGGCAATG-3′; U6 forward: 5′- CGCTTCGGCAGCACATATACTA-3′, and reverse: 5′- CGCTTCACGAATTTGCGTGTCA-3. The linc-ROR overexpression plasmid was a gift from Dr Wang Yue (College of Basic Medicine, Second Military Medical University, China). [score:2]
Our study demonstrated that miR-145 could reverse the reduction of ZEB2 caused by linc-ROR knockdown. [score:2]
In contrast, the opposite results were obtained for HCCLM3 (or MHCC97-H) cells treated with miR-145/mimics (Fig.   5C and Fig.   S1B). [score:1]
Additionally, by linear regression analysis, miR-145 level and linc-ROR level were negatively correlated (Fig.   7C). [score:1]
Then, we performed rescue experiments to determine whether linc-ROR influenced HCC cell invasion, migration, and the induction of EMT in a miR-145 -dependent manner. [score:1]
Right: luciferase activity in HepG2 cells co -transfected with miR-145/mimics and luciferase reporters containing empty vector, ROR-WT, ROR-MUT1, ROR-MUT2, ROR-MUT1 + 2. Data are presented as the relative ratio of firefly luciferase activity to Renilla luciferase activity. [score:1]
These results showed that linc-ROR influences EMT, invasion and metastasis in HCC cells in vitro, at least partially in a miR-145 -dependent manner. [score:1]
Figure 4Linc-ROR acts as a molecular sponge for miR-145. [score:1]
Figure 7Linc-ROR acts as a ceRNA for ZEB2 by releasing miR-145 in HCC cells. [score:1]
We then focused on miR-145, which exhibited the greatest change. [score:1]
showed that miR-145/mimics reduced the luciferase activity of wild-type (WT) linc-ROR reporter vector but not of empty vector and complete mutant reporter vector (Fig.   4E). [score:1]
In HH cells, miR-145 was up to about 300 copies per cell, whereas linc-ROR level was no more than 40 copies per cell. [score:1]
Meanwhile, immunofluorescence studies further suggested that miR-145 reversed EMT in HCC cells (Fig.   5E and Fig.   S1D). [score:1]
We hypothesized that the functions of linc-ROR in HCC cells might be mediated by miR-145. [score:1]
The two miR-145 binding sites on linc-ROR were both mutagenized to form the vector ROR-MUT1 + 2. PmirGLO vector, ROR-WT, ROR-MUT1, ROR-MUT2, ROR-MUT1 + 2 were co -transfected with miR-145 mimics or miRNA-NC into HEK293 cells by Lipofectamine 2000 (Invitrogen, USA) mediated gene transfer. [score:1]
Figure 6The function of linc-ROR in invasion and migration of HCC cells in vitro was dependent on miR-145. [score:1]
The function of linc-ROR in HCC cells in vitro was partially reversed by miR-145. [score:1]
Besides, rescue experiments showed that linc-ROR influences cell invasion, metastasis and EMT in HCC cells in vitro, partially in a miR-145 -dependent manner. [score:1]
To validate the direct binding between linc-ROR and miR-145 at endogenous levels, luciferase reporter assays were constructed, which contain wild-type (WT) or mutated (MUT) miR-145 binding sites. [score:1]
Besides, based on previously studies and function analysis of linc-ROR, we chose miR-145 for further study. [score:1]
Previously studies have revealed that linc-ROR could act as a sponge for miR-145 in various cancers, such as colorectal cancer, pancreatic cancer and breast cancer 9, 12, 21. [score:1]
The function of linc-ROR in HCC cells in vitro was partially reversed by miR-145Then, we performed rescue experiments to determine whether linc-ROR influenced HCC cell invasion, migration, and the induction of EMT in a miR-145 -dependent manner. [score:1]
Moreover, miR-145 wi dely participates in cell proliferation, apoptosis, migration and invasion 39– 42. [score:1]
We mutagenized the miR-145 binding site on linc-ROR at nucleotide positions to form the pmiRGLO-ROR-mutated-type (ROR-MUT1, ROR-MUT2, ROR-MUT1 + 2). [score:1]
We therefore used quantitative real-time PCR to quantify the exact copy numbers of linc-RoR and miR-145 per cell in normal HH cells and HCCLM3 cells (Fig.   4G). [score:1]
s showed that the enhanced mobility induced by linc-ROR in HepG2 (or SMMC-7721) cells was in part abolished by the introduction of miR-145/mimics, and vice versa in the transfected HCCLM3 (or MHCC97-H) cells (Fig.   6A and Fig.   S1A). [score:1]
These data revealed that miR-145 binds to linc-ROR, not inducing the degradation of linc-ROR. [score:1]
The opposite results were obtained for HCCLM3 (or MHCC97-H) cells transfected with miR-145/mimics (Fig.   5D and Fig.   S1C). [score:1]
This result implied that linc-ROR may be able to function as a sponge for miR-145. [score:1]
We proposed that linc-ROR and ZEB2 interact with miR-145 by functioning as competing endogenous RNAs (ceRNAs). [score:1]
To serve as a sponge, the abundance of linc-RoR should be comparable to or higher than miR-145. [score:1]
Also, the interaction among linc-ROR, miR-145 and ZEB2 was studied to reveal the underlying mechanisms in HCC metastasis. [score:1]
[1 to 20 of 73 sentences]
12
[+] score: 229
Consistent with reports, Sathyanarayanan A et al found that ectopic miR-145 expression or SIP1 siRNAs inhibited C33A and SiHa cell proliferation, migration and invasion, and altered the expression of EMT -associated biomarkers, and miR-145 could inhibit the expression of the SMAD-interacting protein 1 in human cervical cancer cells [22]. [score:11]
Our study demonstrated that up-regulation of miR-145 facilitated the expression E-cadherin, and reduced the expression of N-cadherin, Vimentin and Snail, indicating that miR-145 indeed regulated EMT. [score:9]
Moreover, western blot assay revealed that ectopic miR-145 expression mediated by miR-145 mimics the E-cadherin protein expression, and suppressed the expression of N-cadherin, vimentin and Snail (Figure 6). [score:8]
As expected, we found that the expression of ADAM19 was increased in U87 and U251 cells transfected with pCDNA-ADAM19 plasmids, and ADAM19 plasmids can decrease the expression of E-cadherin, and increase the expression of N-cadherin, Vimentin and Snail (Figure 7c, 7d), indicating that miR-145 has a negatively regulatory effect on ADAM19 in U87 and U251 cells. [score:8]
This work suggested that high miR-145 expression inhibited EMT of GBM cells by targeting ADAM19. [score:7]
Notably, over -expression of ADAM19 did not totally abrogate miR-145 -inhibited EMT, indicating that there exist some other potential targets of miR-145. [score:7]
Increasing miR-145 expression in U87 and U251celllines suppressed cell migration and inhibited cell invasion. [score:7]
Figure 4Increasing miR-145 expression in U87 and U251celllines suppressed cell migration and inhibited cell invasion. [score:7]
miR-145 overexpression can enhance the E-cadherin expression and repress the expression of N-cadherin, Vimentin and Snail in U87 (a) and U251 (b) cells as determined by Western blot. [score:7]
RT-PCR assay revealed that ectopic miR-145 expression mediated by miR-145 mimics promoted the expression of E-cadherin protein, and repressed the expression of N-cadherin, vimentin and Snail in U87 and U251 cells (Figure 5). [score:6]
To further demonstrate the involvement of ADAM19 in miR-145 -induced EMT, we tried to up-regulate the expression of ADAM19 in U87 and U251 cells with miR-145 mimics using transfection of pCDNA-ADAM19 plasmids. [score:6]
Li Y et al demonstrated that miR-145 expression was downregulated in osteosarcoma tissues, and was remarkably correlated with the occurrence of aggressive osteosarcoma [19]. [score:6]
In recent years, miR-145 has been reported to play an important role in regulating normal cellular functions, while the deregulated miRNAs expression might result in the initiation of tumors and malignant progression [12– 14]. [score:5]
Consistent with reports, Mo D et al reported that miR-145 expression was diminished in lung adenocarcinom, and obviously related to the lymph node metastasis, and was negatively associated with N-cadherin mRNA expression [18]. [score:5]
To further figure out the effect of miR-145 over -expression on EMT of U87 and U251 cells, we detected the mRNA and protein expression changes of EMT biomarkers, including N-cadherin, vimentin, Snail and E-cadherin in U87 and U251 cells transfected with miR-145 mimics or miR-NC. [score:5]
In this work, we found that the expression of miR-145 was significantly down-regulated in GBM tissues as compared with normal brain tissues. [score:5]
We found that the expression of miR-145 was significantly down-regulated in two cases of GBM tissues as compared with normal brain tissues (Figure 1a). [score:5]
ADAM19 3′-UTR is a direct target of miR-145. [score:4]
miR-145 regulates ADAM19 expression. [score:4]
Finally, we explored whether the 3′-UTR of ADAM19 mRNA was a direct target for miR-145. [score:4]
These results indicated that miR-145 inhibits U87 and U251 cell proliferation via regulation cell cycle. [score:4]
In this study, the wound healing assay validated that ectopic miR-145 expression induced by miR-145 mimics obviously inhibited the wound width of U87 and U251 cell than control (Figure 4a). [score:4]
Firstly, we demonstrated that the expression of miR-145 was obviously increased in U87 and U251 cells according to RT-PCR analysis (Figure 3a). [score:3]
Firstly, we detected the expression level of miR-145 and ADAM19 in human GBM cells and tissues. [score:3]
Han Q also demonstrated that miR-145 can specifically bind to the 3′-UTR of the connective tissue growth factor and markedly inhibited the luciferase activity, and repressed the proliferation, migration, invasion, and EMT of esophageal squamous cell carcinoma cells [23]. [score:3]
According to statistics, we demonstrated that the expression level of miR-145 was inversely proportional to that of ADAM19 mRNA (r=-0.821, p=0.005). [score:3]
Our results validated that over -expression of miR-145 indeed affects EMT progression of U87 and U251 cells. [score:3]
At the same time, the transwell assay validated that ectopic miR-145 expression induced by miR-145 mimics obviously inhibited the invasion number of U87 and U251 cells as compared with miR-NC (Figure 4b). [score:3]
The expression of miR-145 in GBM tissues and cell lines. [score:3]
In addition, the expression of miR-145 was obviously decreased in U87, U251 and T98G cell lines in comparison with normal NHA cells. [score:3]
ADAM19 restoration reverses miR-145 -inhibited EMT. [score:3]
In conclusion, miR-145 inhibited GBM cell proliferation, migration, invasion and EMT. [score:3]
These findings revealed that miR-145 expression exerts a vital effect on GBM progression. [score:3]
In addition, the expression of miR-145 was obviously decreased in U87, U251 and T98G cell lines in comparison with normal NHA cells (all p<0.001) (Figure 1b). [score:3]
miR-145 affected the protein expression of EMT biomarkers. [score:3]
Thus miR-145/ADAM19 can be suggested as a novel target for GBM patients. [score:3]
In the present study, miR-145 over -expression repressed U87 and U251 cell proliferation, migration and invasion, indicating that miR-145 might affect EMT. [score:3]
miR-145 significantly suppressed the luciferase activity that carried 3′-UTRwt but not 3′-UTR-mut of ADAM19. [score:3]
In general, the results from 30 cases of glioblastoma tissues revealed that miR-145 expression was significantly reduced in the GBM tissues in comparison with normal tissues (p<0.001). [score:3]
miR-145 expression and U87 and U251 cell migration and invasion. [score:3]
Likewise, the expression level of miR-145 was inversely proportional to that of ADAM19 protein (r=-0.810, p=0.003). [score:3]
miR-145 affected the mRNA expression of EMT biomarkers. [score:3]
miR-145 inhibits U87 and U251 cell cycle. [score:3]
Ectopic miR-145 expression affects cell cycle. [score:3]
Figure 1 (a) The RT-PCR analysis of miR-145 expression was conducted in representative 2 cases of GBM tissues (C. T. ) and matched normal tissues (N. T. ). [score:3]
However, the specific role of miR-145 in the development of GBM is still unclear. [score:2]
These studies indicated that miR-145 was involved into the development of GBM. [score:2]
Thus, our findings suggested that miR-145 is closely related to the development of human GBM. [score:2]
Figure 3 (a) The U87 and U251 cells transfected with miR-145 mimics showed high expression of miR-145 using RT-PCR assays. [score:2]
To confirm whether miR-145 directly binds to the 3′-UTR of ADAM19 mRNA, we cloned a full-length 3′-UTR (wt/mut) of ADAM19 mRNA, which was inserted into a luciferase reporter vector with downstream from the firefly luciferase gene. [score:2]
MiR-145 expression level in GBM tissues and cells. [score:2]
These studies suggested that miR-145 might be an effective and useful way to treat human tumors [10, 11]. [score:1]
In this study, pCDNA-ADAM19 plasmids, pCDNA-vector plasmids, miR-145 mimics (50 nM) and NC miRNAs were purchased from Ambion (Austin, TX). [score:1]
Besides, miR-145 also serves as a new biomarker for colorectal cancer [12], pancreatic cancer [13] and breast cancer [14, 15]. [score:1]
Quantification analysis was defined as the relative density of miR-145 to U6. [score:1]
Besides, western blot assay further revealed that the expression of ADAM19 protein was obviously decreased in U87 and U251 cell lines co -transfected with miR-145 mimics and ADAM19-3′-UTR-wt as compared with those with miR-145 mimics and ADAM19-3′UTR-mut (Figure 7b). [score:1]
miR-145 represses EMT of GBM cells. [score:1]
We also found that miR-145 mimics obviously decreased the luciferase activity of ADAM19-3′UTR-wt. [score:1]
In the present study, we evaluated the expression of miR-145 and ADAM19 in GBM tissues and cells. [score:1]
Figure 7 (a) The sequences of miR-145 binding sites within the human ADAM19 3′-UTRs and schematic reporter constructs, in this panel, ADAM19-wt represent the reporter constructs containing the entire 3′-UTR sequences of ADAM19. [score:1]
By contrast, miR-145 mimics did not affect the luciferase activity of ADAM19-3′UTR-mut (Figure 7a). [score:1]
The luciferase reporter assay revealed that miR-145 mimics -induced miR-145 overexpression obviously decreased the luciferase activity of ADAM19-3′UTR-wt as compared with control (p<0.001) (Figure 7a). [score:1]
miR-145 represses GBM cell migration and invasion. [score:1]
By contrast, miR-145 mimics did not affect the luciferase activity of ADAM19-3′UTR-mut. [score:1]
To explore the biological effect of miR-145 in the development of GBM, we carried out RT-PCR assay using GBM tissues and cells. [score:1]
[1 to 20 of 65 sentences]
13
[+] score: 226
Other miRNAs from this paper: hsa-mir-143
Although the inhibition of granzyme B abrogated the cytotoxicity of effector cells and cetuximab regardless of miRNA expression levels, the extent of caspase and nuclear fragmentation inhibition was higher in cells overexpressing miR-143 or miR-145, which also display reduced Bcl-2 protein steady-state levels. [score:9]
In addition, miR-143 is also chemosensitizer to docetaxel in prostate cancer by targeting KRAS and subsequently targeting EGFR/RAS/MAPK pathway [27], while miR-145 inhibits EGFR mutant lung cancer cell growth, sensitizing to gifitinib [25]. [score:7]
In contrast, Bcl-2 steady-state expression levels in HCT116-miR-145 cells only slightly decreased following cetuximab treatment, which may be attributable to the fact that Bcl-2 is a miR-143 direct target [41]. [score:6]
miR-143 and miR-145 are tumor suppressor miRNAs reported downregulated in several cancer types, including in colon cancer adenomas and carcinomas [17– 19, 23]. [score:6]
To gain insight into the biological effect of miR-143 or miR-145 in colon cancer cell response to cetuximab, HCT116 cells were transduced with retroviral particles containing MSCV-Neo constructs expressing miR-143 or miR-145, respectively, resulting in HCT116 overexpressing miR-143 (HCT116-miR-143) and miR-145 (HCT116-miR-145), and the respective Empty vector control cell line (HCT116-Empty). [score:5]
Figure 1miR-143 or miR-145 overexpressing cells were produced by transducing HCT116 cell line with viral particles containing MSCV-Neo constructs expressing miR-143, miR-145 or empty vector, as control. [score:5]
MSCV-Neo retroviral expression constructs expressing miR-143 or miR-145 were kindly provided by Dr. [score:5]
For this purpose, SW48 cells were stably transduced with the same retroviral particles used to generate HCT116 stable miRNAs overexpressing cells, resulting in cells overexpressing miR-143 (SW48-miR-143) and miR-145 (SW48-miR-145), and the respective Empty vector control cell line (SW48-Empty). [score:5]
HCT116, SW480 and SW48 cells with stable overexpression of miR-143 and miR-145, and empty control cells, were used as target cells (T), HCT116 and SW480 cells were plated onto a 96-well E-plate at 5,000 cells/well and SW48 cells were plated at 15,000 cells/well, and allowed to attach and grow for 24 h. Cells were then incubated in duplicate with cetuximab or effector cells at E:T of 6:1, 10:1 and 20:1 alone, and also with cetuximab or trastuzumab together with PBMCs, and vehicle control. [score:5]
In this study, we demonstrated that miR-143 or miR-145 overexpression increased the growth inhibitory effect of cetuximab in cetuximab-resistant HCT116 colon cancer cells, upon exposure to high doses of cetuximab (Figure 2). [score:5]
Indeed, reduced levels of Bcl-2 in our HCT116-miR-143 and HCT116-miR-145 overexpressing cells following treatment with effector cells and cetuximab (Figure 5), could promote the release of proapoptotic proteins, such as Smac/DIABLO and Omi/HtrA2 [66], thus contributing to granzyme B -induced apoptotic pathway by relieving caspase inhibition. [score:5]
miR-143 or miR-145 overexpressing cells were produced by transducing HCT116 cell line with viral particles containing MSCV-Neo constructs expressing miR-143, miR-145 or empty vector, as control. [score:5]
For this purpose, SW480 cells were stably traduced with retroviruses overexpressing miR-143 or miR-145, and the control Empty vector, similarly to HCT116 and SW48 cell mo dels, in order to generate SW480 cells overexpressing miR-143 (SW480-miR-143), and miR-145 (SW480-miR-145), and the respective Empty-vector control (SW480-Empty). [score:5]
Importantly, caspase inhibition abrogated cell killing induced by effector cells and cetuximab in HCT116 cells overexpressing miR-143 or miR-145 (Figure 4), confirming the involvement of caspases in cetuximab -mediated ADCC. [score:5]
To generate miR-143 or miR-145 stable overexpression cells, HCT116, SW480 and SW48 cells were seeded in 6-well plates at 3 × 10 [5] cells/well, and 24 h later, transduced with retroviral particles carrying MSCV-Neo constructs overexpressing miR-143, miR-145 or empty vector. [score:5]
Importantly, 100 μg/ml cetuximab concentration, which we previously found ineffective in reducing HCT116 cell viability (Figure 2), when combined with effector cells, significantly decreased cell index values, resulting in higher growth -inhibitory effects on miRNA overexpressing cell lines, HCT116-miR-143 and HCT116-miR-145, compared to HCT116-Empty vector cells (Figure 3C). [score:4]
The results obtained suggest that miR-143 or miR-145 overexpression modulates cetuximab cell sensitivity independently of KRAS mutation status. [score:4]
Cetuximab showed a higher growth -inhibitory effect on cells overexpressing miR-143 or miR-145, with IC [50] values of 832,22 and 668,42 μg/ml, respectively, compared to Empty control cells which displayed an IC [50] of 1719,66 μg/ml (Table 1). [score:4]
In order to investigate the molecular mechanism of miR-143 or miR-145 activity in colon cancer and cetuximab sensitization, we examined the expression levels of Bcl-2, which was shown to be reduced following miR-143 overexpression [18, 19], and may be relevant in this cetuximab-sensitization context, due to role in apoptosis regulation. [score:4]
Similarly, miR-145 is also implicated in Ras/MAPK signaling pathway by targeting RREB1 protein, which negatively regulates the miR-143/145 promoter and potentiates signaling through Ras effector pathway [49]. [score:4]
miR-143 overexpression significantly decreased cell viability for cetuximab concentrations higher than 1200 μg/ml (p < 0.01), while miR-145 overexpression had a similar sensitization effect for cetuximab concentrations higher than 600 μg/ml (p < 0.05), both compared to Empty control cells (Figure 2B). [score:4]
miR-143 or miR-145 overexpression sensitizes colon cancer cells to cetuximab by increasing antibody -dependent cellular cytotoxicity. [score:3]
In this context, miR-143 or miR-145 overexpression significantly increased cell death of SW480 cells exposed to cetuximab together with effector cells, and again, exposure to control antibody rituximab, and effector cells only increased cell cytotoxicity to a similar extent of that elicited by PBMCs (Figure S3F). [score:3]
miR-143 or miR-145 overexpressing cells are more sensitive to cetuximab -mediated ADCC -induced apoptosis. [score:3]
HCT116 cells with stable overexpression of miR-143 or miR-145, and empty control cells, were seeded on 6-well plates for 24 h, and next serum starved for 16 h by replacing the media with serum-free medium. [score:3]
miR-143 and miR-145 are co-transcribed miRNAs that have been wi dely studied as potential tumor suppressors. [score:3]
miR-143 or miR-145 overexpression increases cetuximab -mediated ADCC in HCT116 cells. [score:3]
For this purpose, HCT116 cells stably expressing miR-143 or miR-145 were seeded on 96-well plates at 5,000 cells/well, and exposed to 100 μg/ml cetuximab or vehicle control, PBMCs (20:1), or cetuximab with PBMCs (20:1). [score:3]
Importantly, overexpression of miR-143 and miR-145 significantly reduced cell viability of cells exposed to cetuximab concentrations higher than 1 μg/ml (p < 0.01) (Figure S1B). [score:3]
Bcl-2 is involved in cetuximab sensitization induced by miR-143 or miR-145 overexpression, increasing cell susceptibility to cetuximab -mediated ADCC. [score:3]
miR-143 or miR-145 overexpression reduces HCT116 colon cancer cell doubling time and migration. [score:3]
miR-143 or miR-145 overexpression sensitizes HCT116 mutant KRAS colon cancer cells to cetuximab. [score:3]
Our results indicate that overexpression of miR-143 or miR-145 significantly sensitized HCT116 cells to cetuximab (Figure 2B). [score:3]
Briefly, 10 or 20 μg of total RNA isolated from HCT116, SW480 and SW48 cells with stable overexpression of miR-143 and miR-145 and empty control cells were loaded onto a 15% SequaGel (National Diagnostics, Atlanta, GA), electrophoresed, and transferred to nylon membranes at 15 V for 60 min using a Trans-Blot SD semidry transfer system (Bio-Rad Laboratories, Hercules, CA). [score:3]
In this study, we observed that miR-143 or miR-145 overexpression reduced cell proliferation and migration of mutant KRAS HCT116 colon cancer cells, and sensitized both mutant KRAS (HCT116 and SW480), as well as wild-type KRAS (SW48) cells to cetuximab. [score:3]
miR-143 or miR-145 overexpression sensitizes colon cancer cells to cetuximab. [score:3]
On the other hand, the combination of cetuximab and effector cells resulted in a significant increase of cytotoxicity in cetuximab-resistant (HCT116 and SW480) and -sensitive (SW48) colon cancer cells overexpressing miR-143 or miR-145, at clinically achievable cetuximab doses (Figure 3, S2 and S3). [score:3]
These data clearly show that miR-143 or miR-145 overexpression in HCT116 cells led to a reduction of the IC [50] value of cetuximab of nearly 40% (p < 0.01) (Figure 2A), indicating that these miRNAs may be involved in HCT116 cell response to cetuximab. [score:3]
Importantly, inhibition of granzyme B in PBMCs almost completely abrogated miR-143 or miR-145 increase in cetuximab -mediated ADCC in HCT116 cells (p < 0.001) (Figure 6B). [score:3]
Therefore, miR-143 or miR-145 overexpression triggered cetuximab -mediated ADCC inducing caspase -dependent apoptosis. [score:3]
HCT116 cells stably expressing miR-143 or miR-145, and empty control cells, were seeded on 12-well plates over 18 mm glass coverslips, at a density of 5 × 10 [4] cells/well. [score:3]
Apoptosis is increased in miR-143 or miR-145 overexpressing cells during cetuximab -mediated ADCC. [score:3]
HCT116 cells with stable overexpression of miR-143 and miR-145 and empty control cells were seeded on 35 mm [3] dishes at 3 × 10 [6] cells/dish, and allowed to grow to confluence. [score:3]
Our results showed that miR-143 or miR-145 overexpression increased the sensitivity of colon cancer cells to cetuximab by enhancing cetuximab -mediated ADCC and apoptosis. [score:3]
Further, combined overexpression of miR-143 and miR-145 decreases squamous carcinoma proliferation while sensitizing to cisplatin, and also sensitizes colon cancer cells to 5-FU, irinotecan and oxaliplatin treatment [23]. [score:3]
Importantly, caspase inhibition following exposure to cetuximab and effector cells, resulted in a significant cell kill reduction of 65 and 57%, respectively in HCT116-miR-143 and HCT116-miR-145, compared to the 17% reduction in HCT116-Empty cell line (p < 0.001) (Figure 4E, Upper Panel). [score:2]
This increased apoptosis could be explained in part by the reduced Bcl-2 levels in miR-143 and miR-145 overexpressing cells compared to empty control cells following cetuximab and PBMCs exposure, increasing the susceptibility of cells to effector cell -mediated apoptosis. [score:2]
However the addition of trastuzumab and effector cells significantly increased death of cells overexpressing miR-143 and miR-145, observed in both xCELLigence and LDH released assays (p < 0.01). [score:2]
Bcl-2 knock-down is involved in miR-143 or miR-145-increased cetuximab -mediated ADCC. [score:2]
Therefore, our data suggests that caspase activation in response to cetuximab and PBMCs proceeds through a granzyme B -dependent pathway, regulated by Bcl-2. Nevertheless, additional studies should be performed to deeply understand the involvement of these proteins in miR-143 or miR-145 -mediated cetuximab sensitivity. [score:2]
Corroborating these results, LDH release was significantly increased in cells overexpressing miR-143 or miR-145 treated with cetuximab combined with effector cells, compared to Empty-vector control (p < 0.05) (Figure S2E). [score:2]
Considering that the presence of mutations in KRAS gene renders tumor cells inherently resistant to anti-EGFR therapy, our results indicate that miR-143 or miR-145 may be key players in mitigating cetuximab resistance in mutant KRAS colon cancer cells. [score:2]
In addition, the cleavage of the endogenous substrate of active caspase-3, PARP, was substantially increased up to ~ 4- and 6-fold, respectively in HCT116-miR-143 and HCT116-miR-145, compared to HCT116-Empty control cells (p < 0.01) (Figure 4D), further confirming that miR-143 and miR-145 overexpression increased apoptosis induced by cetuximab -mediated ADCC in HCT116 cells. [score:2]
Importantly, exposure to 100 μg/ml cetuximab and effector cells at 20:1 E:T, resulted in higher growth -inhibitory effects in HCT116-miR-143 and HCT116-miR-145, ~ 65% cell kill, compared to 42% cell kill in HCT116-Empty cells (p < 0.01). [score:2]
Importantly, higher growth -inhibitory effects were observed on SW48-miR-143 and SW48-miR-145, ~ 40% cell kill, compared to 29% cell kill in SW48-Empty cells (p < 0.01) (Figure S2D). [score:2]
Interestingly, this effect was abrogated in cells overexpressing miR-143 or miR-145, in which Bcl-2 levels were reduced in almost 50% compared to empty control cells (p < 0.01) (Figure 5A, lanes 11 and 12 versus 10). [score:2]
Similarly to HCT116-derived cells, exposure of SW480-derived cells to PBMCs at a 20:1 E:T ratio did not induce high levels of cell killing (Figure S3C), while exposure to 100 μg/ml cetuximab and PBMCs, significantly decreased cell index values (Figure S3D), resulting in higher growth -inhibitory effects in SW480-miR-143 and SW480-miR-145 cells, ~ 50% cell kill, compared to 28% cell kill in SW480-Empty cells (p < 0.05). [score:2]
Importantly, in experimental cancer mo dels, the delivery of anti-tumorigenic miRNAs, including miR-143 and miR-145, appears to be beneficial for cancer therapy [21, 22]. [score:1]
Sequences of the oligonucleotide probes were GAGCTACAGTGCTTCATCTCA (miR-143) and AGGGATTCCTGGGAAAACTGGAC (miR-145). [score:1]
Figure 3HCT116-Empty, HCT116-miR-143 and HCT116-miR-145 cells were plated on 96-well E-Plate and used on xCELLigence System, allowed to grow for 96 h. Cells were grown in medium alone or treated with increasing concentrations of cetuximab, and or PBMCs. [score:1]
Figure 4HCT116-Empty, HCT116-miR-143 and HCT116-miR-145 cells were exposed to 100 μg/ml cetuximab, 100 μg/ml rituximab or PBMCs (10:1 or 20:1) alone, or co-treatment of cetuximab or rituximab together with PBMCs (10:1 or 20:1), or vehicle (control). [score:1]
HCT116-Empty, HCT116-miR-143 and HCT116-miR-145 stably transduced cells were plated onto a 96-well E-Plate of xCELLigence System. [score:1]
The differential cetuximab sensitivity of colon cancer cells with stable overexpression of miR-143 or miR-145 and empty control cells, was evaluated through the assessment of cell death and cell viability. [score:1]
We next investigated whether miR-143 or miR-145 overexpression could alter the sensitivity of HCT116 cells to cetuximab therapy. [score:1]
Next, we evaluated the effect of miR-143 or miR-145 overexpression in HCT116 cell proliferation in real-time, using the xCELLigence system. [score:1]
Figure 6HCT116-Empty, HCT116-miR-143 or HCT116-miR-145 cells were exposed to 100 μg/ml cetuximab or PBMCs (20:1) alone, or co-treatment of cetuximab together with PBMCs, or vehicle (control). [score:1]
HCT116-Empty, HCT116-miR-143 and HCT116-miR-145 cells were exposed to 100 μg/ml cetuximab, 100 μg/ml rituximab or PBMCs (10:1 or 20:1) alone, or co-treatment of cetuximab or rituximab together with PBMCs (10:1 or 20:1), or vehicle (control). [score:1]
Interestingly, we found that miR-143 or miR-145 are also able to increase trastuzumab -mediated ADCC (Figure S4), expanding the therapeutic relevance of these miRNAs and demonstrating that their effect is not restricted to cetuximab -mediated ADCC. [score:1]
We next ascertained if miR-143 or miR-145 increased cetuximab -mediated ADCC also occurred in other colon cancer cell lines, including cetuximab-sensitive cells. [score:1]
Figure 5(A) HCT116-Empty, HCT116-miR-143 and HCT116-miR-145 cells were exposed to 100 μg/ml cetuximab or PBMCs (10:1) alone, or co-treatment of cetuximab together with PBMCs (10:1), or vehicle (control) for 48 h to evaluate Bcl-2 protein expression, by immunoblot. [score:1]
Collectively, our data indicates that restoration of miR-143 or miR-145 reduces the aggressiveness of mutant KRAS HCT116 cells. [score:1]
HCT116-Empty, HCT116-miR-143 or HCT116-miR-145 cells were exposed to 100 μg/ml cetuximab or PBMCs (20:1) alone, or co-treatment of cetuximab together with PBMCs, or vehicle (control). [score:1]
Therefore, miR-143 and miR-145 modulation may constitute relevant candidates for future therapeutic interventions in combination with cetuximab treatment, and possibly also with other therapeutic antibodies with ADCC-inducing capability. [score:1]
Rituximab was used as a control antibody, and its addition alone or together with effector cells at 20:1 E:T, did not significantly increase cell kill, indicating that ADCC is a mechanism of cell death induction for cetuximab, and that miR-143 and miR-145 are modulators of this mechanism of antibody -mediated cell death (p < 0.01) (Figure 3D). [score:1]
To evaluate the role of miR-143 or miR-145 in cetuximab -mediated ADCC, we used our cell mo del HCT116-miR-143, HCT116-miR-145 and HCT116-Empty cell lines (target cells) and peripheral blood mononuclear cells (PBMCs) isolated from human healthy donors (effector cells). [score:1]
We further ascertained if the role of miR-143 or miR-145 on increasing cetuximab sensitivity also occurs in KRAS wild-type SW48 colon cancer cells, which are sensitive to cetuximab. [score:1]
Granzyme B activity is involved in miR-143 or miR-145-increased cetuximab -mediated ADCC. [score:1]
HCT116-Empty, HCT116-miR-143 and HCT116-miR-145 cells were plated on 96-well E-Plate and used on xCELLigence System, allowed to grow for 96 h. Cells were grown in medium alone or treated with increasing concentrations of cetuximab, and or PBMCs. [score:1]
Therefore, taken together, these results unveil the importance of miR-143 and miR-145 in modulating ADCC as a mechanism of cell death induced by cetuximab in presence of PBMCs. [score:1]
Similarly, no significant increase in PARP cleavage was observed in HCT116-miR-143 and HCT116-miR-145 cells treated control antibody rituximab together with PBMCs (Figure 4D). [score:1]
[1 to 20 of 80 sentences]
14
[+] score: 221
Quantitative real-time RT-PCR (qRT-PCR) showing that overexpression of CCAT2 by stable transfection of pcDNA4/CCAT2 plasmid (a and c) downregulates miR-145 and upregulates miR-21 in HCT-116 and CR-HT-29 cells (b and d). [score:9]
qRT-PCR showing the expression of pre-miR-145 and pre-miR-21 in stable clones over -expressing or knockout CCAT2 HCT-116 cells (a), and the relative pre-miR-145 expression in the whole cell and in nuclear and cytoplasmic fraction in HCT-116 cells (b). [score:8]
Downregulation of CCAT2 through transfection of si-CCAT2 (e) or by CRISPR/Cas9 (f) increased the expression of miR-145 and negatively regulates miR-21 (g and h). [score:7]
All the data represent means ± SEM, * P < 0.001, compared to the control Based on above results, we hypothesized that CCAT2 downregulates miR-145 expression by selectively suppressing its maturation process in colon cancer cells. [score:7]
We observed overexpression of CCAT2 to cause downregulation of miR-145 and to stimulate miR-21 (Fig. 1b and d). [score:6]
In contrast, stable up-regulation of CCAT2 decreases mature miR-145 and increases the expression of several CSC markers in colon cancer cells. [score:6]
All the data represent means ± SEM, * P < 0.001, compared to the control Fig. 6CCAT2 regulates miR-145 expression by directly suppressing its processing. [score:6]
We have observed that modulated expression of CCAT2 regulates the expression of miR-145 in colon cancer HCT-116 and HT-29 cells. [score:6]
The expression of CCAT2 positively correlated with expression of pre-miR-145 but negatively with mature miR-145 that indicating that CCAT2 regulates miR-145 maturation process. [score:6]
We observed that the expression of pre-miR-145 was 97-fold higher in stable clones expressing CCAT2, and 90% lower in CCAT2 knockout HCT-116 cells compared with corresponding HCT-116 cells. [score:5]
As expected, CCAT2 knockdown increased the expression of miR-145 and negatively regulated miR-21 in HCT-116 cells (Fig.   2g and h). [score:5]
miR-145 may function in tumor suppression, since its expression is reduced in most human cancer cells and particularly so in aging colon and prostate cancers [10, 11]. [score:5]
CCAT2 over -expression decreases mature miR-145 expression and increases pre-miR-145. [score:5]
The image shows that Dicer cleaves more than ~80–90% of Dig-labed pri-miR-145 (Fig. 6b lane 1 and 2), and RNA which comes from CCAT2 overexpressing clones (Fig. 6b lanes 4 and 6) suppressed the digestion reaction compared with the corresponding controls (lanes 3 and 5) or CCAT2 knockout HCT-116 cells (lane 7). [score:5]
The enforced expression of miR-145 in human colon or gastric cancer cells significantly inhibits their growth. [score:5]
However, it is enriched in the nucleus and correlates with the expression of pre-miR-145 but not pre-miR-21(Fig. 3a) which indicates that CCAT2 selectively inhibits some pre-miRNA export to cytoplasm. [score:5]
Thus, we examined miR-21 and miR-145 levels in CCAT2 overexpressing colon cancer cells as well as in knock down/knockout cells. [score:5]
In addition, miR-145 and miR-21 regulate stem cell growth and dedifferentiation via their targets, OCT4, SOX2, NANOG and TGFβR2 [12, 15]. [score:4]
Finally, the dig-labeled pri-miR-145 was mixed with the RNA which was isolated from over -expression or knock out CCAT2 colon cancer CR-HT-29 and HCT-116 cells or corresponding controls, and digested by recombinant human Dicer enzyme. [score:4]
lncRNA CCAT2 is over-expressed in colorectal cancer and promotes tumor growth, metastasis and reduces sensitivity to chemotherapy that is associated with colon CSC and regulated by cooperation of miR-145 and miR-21 [34, 37]. [score:4]
Fig. 1CCAT2 regulates the expression of miR-21 and miR-145 in colon cancer HCT-116 and CR-HT-29 cells. [score:4]
Here, we report that CCAT2 selectively blocks miR-145 processing, resulting in decreased mature miR-145 expression and regulation of colon CSC proliferation and differentiation. [score:4]
All the data represent means ± SEM, * P < 0.001, compared to the control The next set of experiments was carried out to determine whether knockdown or knockout of CCAT2 increased the expression of miR-145. [score:4]
Digoxigenin labeled 200 ng of pri-miR-145 (668 base) containing 1 μg of total RNAs from the CCAT2 overexpressing or knockout (KO) colon cancer cells was incubated at 25 °C for 5 min; 1unit of recombinant Dicer was added and incubated at 37 °C for 60 min. [score:4]
On the other hand, knockdown of CCAT2 by siRNA or by CRISPR/Cas9 increased the expression of miR-145. [score:4]
All the data represent means ± SEM, * P < 0.001, compared to the control The next set of experiments was carried out to determine whether knockdown or knockout of CCAT2 increased the expression of miR-145. [score:4]
These results indicate CCAT2 selectively blocks miR-145 maturation by inhibiting pre-miR-145 export to cytoplasm. [score:3]
CCAT2 is enriched in the nucleus and correlates with expression of pre-miR-145 but not pre-miR-21, which implies that CCAT2 may selectively produce or block export of pre-miR-145 to cytoplasm. [score:3]
We have also observed that CCAT2 is enriched in the nucleus and correlates with the expression of pre-miR-145 but not pre-miR-21 in HCT-116 cells. [score:3]
In conclusion, our study demonstrates that CCAT2 selectively blocks miR-145 maturation process by inhibiting pre-miR-145 export to cytoplasm and blocks cleavage of pre-miR-145 in cell extract or by Dicer in vitro. [score:3]
These data demonstrate that CCAT2 interacts with nascent miR-145 and inhibits its maturation process. [score:3]
Knockout of CCAT2 increases miR-145 and negatively regulates miR-21 in HCT-116 cells, impairs proliferation and differentiation. [score:3]
Taken together, our results suggest that CCAT2 negatively controls the expression of miR-145. [score:3]
Quantitative RT-PCR was performed to examine the expression of CCAT2 and pri-, pre- and mature miR-145/21. [score:3]
The miR-145 in turn targets pluripotency factors such as OCT4, SOX2, and KLF4, and contributes in the processes of stem cell growth and dedifferentiation [12]. [score:3]
Fig. 4CCAT2 inhibits maturation process of miR-145. [score:3]
The results of qRT-PCR show that in the presence of CCAT2 the expression of miR-145 was decreased by more the 50% (Fig. 4a and b). [score:3]
In the next set of experiments we tested whether the pre-miR-145 level was associated with expression and location of CCAT2 in the modulated colon cancer cells. [score:3]
The qRT-PCR results showing pri-, pre- and mature miR-145 levels following recombinant Dicer reaction containing the total RNAs isolated from either CCAT2 overexpressing or CCAT2- KO (a) CR-HT-29 or (b) HCT-116 cells. [score:3]
CCAT2 regulates miR-145 maturation process in vitro. [score:2]
The relative levels of pri-, pre- and mature miR-145 within individual reaction are listed in Table 1. qRT-PCR shows that the pri-miR-145 was ~35–100 fold higher in reaction containing RNA from CCAT2 over -expressing cells compared with the corresponding controls (Fig.   5a and b). [score:2]
We noted a down regulation of miR-145. [score:2]
Moreover, we have recently reported that cooperation of miR-145 and miR-21 regulates colon CSCs proliferation and differentiation [34]. [score:2]
The results imply lncRNA CCAT2 as a negative regulator of miRNA-145 biogenesis, and expose a novel mechanism of lncRNA-miRNA crosstalk. [score:2]
To expose the mechanism of CCAT2 regulating miR-145, we have analyzed the location of CCAT2 in vivo and in vitro. [score:2]
Our results identify CCAT2 as a negative regulator of miRNA-145 biogenesis, and expose a novel mechanism of lncRNA-miRNA crosstalk. [score:2]
Recently, we reported that miR-145 and miR-21 cooperate to regulate colon cancer stem cell (CSC) proliferation and differentiation. [score:2]
Moreover, we revealed that CCAT2 blocks cleavage of DIG-Labeled pri-miR-145 (pre-miR-145 with 250–300 nts up and down-stream flanking sequence) in cell extract or by recombinant Dicer in vitro (Figs.   4, 5 and 6). [score:1]
Our current data demonstrating that CCAT2 blocks miR-145 maturation process resulting in reduced mature miR-145, has supported our hypothesis and exposed a novel mechanism for lncRNA and miRNA crosstalk. [score:1]
Further, we revealed that CCAT2 blocks cleavage of pre-miR-145 by Dicer in vitro. [score:1]
Fig. 3Localization of pre-miR-145 in colon cancer HCT-116 cells by qRT-PCR. [score:1]
DIG-labeling of pri-miR-145. [score:1]
However, the reason for disproportionate change in miR145 levels between the transient siRNA transfection and stable KO using CRISPR/Cas9 is not clear. [score:1]
Quantitation of miRNA-21 and miR-145. [score:1]
Considering that CCAT2 is mainly located in the nucleus and miRNA maturation process begins in the nucleus, we hypothesize that CCAT2 selectively blocks miR-145 maturation process, resulting in decreased mature miR-145 affecting colon CSC proliferation and differentiation. [score:1]
The mature miR-145 was highly increased in the reaction containing cytoplasmic fraction (Fig.   4a), which agrees with an earlier observation [35]. [score:1]
In vitro processing of pri-miRNA-145 was performed using T7 RNA polymerase and recombinant human Dicer. [score:1]
Alternately, the synthesized pri-miR-145 was cleaved by recombinant human Dicer enzyme with or without CCAT2. [score:1]
The rationale for analyzing CCAT2 and miR-145 cooperation is because CCAT2 promotes tumor growth and metastasis [19, 26], causing a reduced sensitivity to chemotherapy [25] which is the property related to cancer stem cells (CSCs) [29, 30]. [score:1]
The ability of miR-145 -overexpressing and parental HCT-116 cells to form spheres in suspension was evaluated as described previously [41]. [score:1]
The pri-miR-145 containing pre-miR-145 and up and down-stream flanking sequence was synthesized, subsequently incubated with nuclear or cytosolic fraction in the presence or absence of CCAT2. [score:1]
The results of agarose gel clearly show that the level of pre-miR-145 correlated with CCAT2 in the reactions (Fig.   6a). [score:1]
RNA was extracted from the reaction mixture by phenol extraction and was assessed by quantitative RT-PCR for determination of mature miR-145, pre-miR-145 and pri-miR-145. [score:1]
M: 100 bp DNA (A) or RNA ladder (B), Lane-1: pri-miR-145, Lane-2: pri-miR-145 + Dicer, Lane-3: pri-miR-145 + RNA of CR-HT29 + Dicer, Lane-4: pri-miR-145 + RNA of CR-HT29/CCAT2 + Dicer, Lane-5: pri-miR-145 + RNA of HCT-116 + Dicer, Lane-6: pri-miR-145 + RNA of HCT-116/CCAT2 + Dicer, Lane-7: pri-miR-145 + RNA of HCT-116/ KO-CCAT2 + Dicer To avoid the effect of endogenous production of pri-, pre- and miR-145, the RNAs digested by Dicer were also separated on denaturing polyacrylamide gel, transferred to the PVDF membrane and detected with anti-digoxigenin antibody. [score:1]
These findings indicate an anti-oncogenic role for miR-145 especially in gastrointestinal cancers. [score:1]
First, the synthesized pri-miR-145 was digested by the nuclear or cytoplasmic fractionations of HCT-116 cells separately. [score:1]
To test this hypothesis, the pri-miR-145 containing pre-miR-145 and up and down-stream flanking sequence (total 668 nucleotide) was synthesized in vitro by T7 RNA polymerase and labeled by incorporation of digoxigenin-UTP. [score:1]
The samples were divided into two parts: (a) performed RT-PCR to detect CCAT2, pri-, pre- and mature miR-145. [score:1]
Briefly, 10 μL of processing reaction contained 4ul dicer reaction buffer, 2 μL of recombinant dicer enzyme, 2.5 mM MgCl [2], 1 mM ATP, and 0.2 μg of Digxigenin labeled pri-miR-145. [score:1]
Zaman MS, Chen Y, Deng G, Shahryari V, Suh SO, Saini S, et al. The functional significance of microRNA-145 in prostate cancer. [score:1]
pCMV-miR-145 plasmid carrying pre-microRNA-145 and 250–300 nts up and down-stream flanking sequence (Origene, Nockville, MD) was linearized with the restriction enzyme (Not I and Xho I) to make a template for in vitro transcription. [score:1]
M: 100 bp DNA (A) or RNA ladder (B), Lane-1: pri-miR-145, Lane-2: pri-miR-145 + Dicer, Lane-3: pri-miR-145 + RNA of CR-HT29 + Dicer, Lane-4: pri-miR-145 + RNA of CR-HT29/CCAT2 + Dicer, Lane-5: pri-miR-145 + RNA of HCT-116 + Dicer, Lane-6: pri-miR-145 + RNA of HCT-116/CCAT2 + Dicer, Lane-7: pri-miR-145 + RNA of HCT-116/ KO-CCAT2 + Dicer To avoid the effect of endogenous production of pri-, pre- and miR-145, the RNAs digested by Dicer were also separated on denaturing polyacrylamide gel, transferred to the PVDF membrane and detected with anti-digoxigenin antibody. [score:1]
The pri-miR-145 was synthesized and labeled by incorporation of digoxigenin-UTP (Roche Molecular Biochemicals, Indianapolis, IN) using a Maxiscript T7 in vitro transcription kit (Invitrogen). [score:1]
Together, the results from current investigation show that CCAT2 selectively blocks miR-145 biogenesis process, resulting in decreased mature miR-145 expression. [score:1]
Considering the biogenesis of miR-145, we used bioinformatics tool LncTar (38) to predict CCAT2 interaction with pre-miR-145 (Fig.   7a). [score:1]
pre-miR-145 was enriched in the nuclear fraction of cells (Fig. 3b). [score:1]
[1 to 20 of 76 sentences]
15
[+] score: 212
Other miRNAs from this paper: hsa-mir-143, rno-mir-143, rno-mir-145
Down-regulation of miR-145 and up-regulation of BNIP3 expression in gliomas. [score:9]
Second, down-regulation of miR-145 and up-regulation of BNIP3 increased the protein expression of Notch1, Hes1, and p21 in glioma cells. [score:9]
Together, our results indicate that miR-145 increases apoptosis of glioma cells by directly inhibiting BNIP3, resulting in the inhibition of Notch signaling, and suggest that miR-145 may serve as a novel therapeutic target in malignant gliomas. [score:8]
Figure 12 (A) Protein expression of Notch1, p21, Hes1 was determined by western blot analysis in U87 and U251 cells co -transfected with miR-145 inhibitor and BNIP3-siRNA, or with miR-145 inhibitor. [score:7]
First, up-regulation of miR-145 and knockdown of BNIP3 decreased the protein expression of Notch1, Hes1, and p21 in glioma cells. [score:7]
Here, we present a strong evidence that miR-145 inhibits the expression of BNIP3 by binding to its 3′-UTR in glioma cells, and we demonstrate an inverse correlation between miR-145 and BNIP3 expression in glioma tissues. [score:7]
Figure 11 (A, B) Protein expression of Notch1, p21 and Hes1 was determined by western blot analysis in U87 and U251 cells transfected with miR-145 mimics and mimics-NC, or miR-145 inhibitor and inhibitor-NC. [score:7]
To support these results, the protein expression of Notch1, p21, and Hes1 was also analyzed in U87 and U251 cells that were co -transfected with miR-145 inhibitor and BNIP3-siRNA, compared with miR-145 inhibitor. [score:6]
MiR-145 is a putative tumor suppressor miRNA that is down-regulated in various types of cancers [4, 9]. [score:6]
Lastly, co-transfection of down-regulated miR-145 and knockdown of BNIP3 decreased the protein levels of the Notch1-regulated proteins. [score:6]
Co-transfection of luciferase reporter with the miR-145 mimics into U87 and U251 cells decreased expression of BNIP3 (Figure 7B), indicating that BNIP3 is a direct target of miR-145 in glioma cells. [score:6]
For example, miR-145 has been found to inhibit migration and invasion of gliomas stem cells by targeting ABCG2 [29]. [score:5]
miR-145 inhibits Notch pathway by targeting BNIP3. [score:5]
miR-145 inhibits mRNA and protein expression of BNIP3. [score:5]
Figure 5 (A) Western blot was performed to detect the expression levels of Bax, Bcl-2 and Active Caspase-3. (A, B) Transfection effect of miR-145 mimics or inhibitor was confirmed by quantitative real-time PCR. [score:5]
Figure 5 (A) Western blot was performed to detect the expression levels of Bax, Bcl-2 and Active Caspase-3. We then searched for the target genes of miR-145 using microRNA. [score:5]
Stable cell lines were derived from U251 and U87 cells by transfection with miR-145 mimics, inhibitor, BNIP3 siRNA, BNIP3-pEX-2 expression vector, or corresponding control RNA using Lipofectamine 2000 for 48 h. Total RNA was extracted from brain tissues or glioma cells using TRIzol reagent (Invitrogen) and reverse transcribed to cDNA using a Thermoscript RT-PCR reagent kit. [score:5]
confirmed that miR-145 expression was increased after miR-145 mimics transfection, and decreased after miR-145 inhibitor transfection (Figure 4A, 4B). [score:5]
In addition, consistent with previous studies [26], cells transfected with miR-145 mimics exhibited decreased expression of the anti-apoptotic protein Bcl-2, increased expression of the pro-apoptotic proteins Bax, and Active Caspase-3, and an elevated Bax/Bcl-2 ratio (Figure 5A). [score:5]
miR-145 inhibits expression of BNIP3 via binding to its 3′-UTR. [score:5]
BNIP3 mRNA expression was decreased by miR-145 mimics (Figure 6B), and increased in cells transfected with miR-145 inhibitor (Figure 6C). [score:5]
Over -expression of miR-145 in U87 and U251 cells decreased protein levels of Notch1 and its downstream targets, p21 and Hes1 (Figure 11A). [score:5]
MiR-145 promotes apoptosis of glioma cells by inhibiting BNIP3, resulting in the inhibition of Notch signaling. [score:4]
miR-145 can regulate Notch signaling pathway by targeting BNIP3. [score:4]
It was reported that the tumor suppressors miR-143 and miR-145 could modulate vascular smooth muscle cell differentiation by inactivating Notch-1 signaling [15], but the specific role of miR-145 in regulating the Notch signaling in malignant glioma is unknown. [score:4]
To test if BNIP3 is a direct target of miR-145, the 3′-UTR was cloned into a luciferase expression vector to evaluate its response to miR-145. [score:4]
miR-145 regulates Notch signaling by targeting BNIP3. [score:4]
Importantly, our results show that miR-145 induces apoptosis in glioma cells, suggesting that it functions as a tumor suppressor miRNA. [score:3]
Figure 4 (A, B) Transfection effect of miR-145 mimics or inhibitor was confirmed by quantitative real-time PCR. [score:3]
Immunofluorescence revealed that BNIP3 was localized in the nucleus of U87 and U251 cells, and its expression was decreased after miR-145 transfection (Figure 6E). [score:3]
confirmed that the nuclear levels of BNIP3 were decreased in cells transfected with miR-145 mimics and increased in cells transfected with miR-145 inhibitor. [score:3]
In this study, we demonstrate that the miR-145 expression is decreased in gliomas. [score:3]
In this study, we have identified BNIP3 as a target gene of miR-145. [score:3]
Our results demonstrate that BNIP3 is localized in the nucleus of glioma cells, and serves as a target of miR-145. [score:3]
Interestingly, the cytoplasmic levels of BNIP3 in cells transfected with miR-145 inhibitor were also increased (Figure 7A). [score:3]
To explore whether the effect of miR-145 on the Notch pathway was related to BNIP3, protein levels of Notch1, p21, and Hes1 were analyzed in cells transfected with BNIP3 siRNA or the BNIP3 expression vector. [score:3]
Correspondingly, Notch1, p21, and Hes1 protein levels increased in the presence of miR-145 inhibitor (Figure 11B). [score:3]
Taken together, these data indicate that miR-145 inhibits Notch signaling partly through BNIP3. [score:3]
Figure 7 (A) Western analysis of BNIP3, which is localized in the nucleus or the cytoplasm in U87 and U251 cells treated with miR-145 mimics and inhibitor for 48 h. (B) Wild-type 3′-UTR of BNIP3 gene was cloned into the firefly and Renilla reporter plasmid. [score:3]
BNIP3 expression inversely correlates with miR-145 in gliomas. [score:3]
These observations imply that BNIP3 acts as an oncogene and is involved in the regulation of miR-145 -mediated apoptosis in gliomas. [score:2]
MiR-145 expression is decreased in gliomas. [score:2]
Several miRNAs regulate the activation of glioma cells, including miR-145. [score:2]
Target screening assays have linked miR-145 and BNIP3 [31- 34]. [score:2]
Figure 2 (A) of miR-145 expression in glioma samples (n = 19) compared with normal samples (n = 10). [score:2]
To investigate the potential function of miR-145 in glioma cells apoptosis, U87 and U251 cells were transiently transfected with miR-145 mimics or inhibitor. [score:1]
However, the function of miR-145 in gliomas has not yet been elucidated. [score:1]
Indeed, miR-145 has been reported to play a pivotal role in Notch signaling [15]. [score:1]
In addition, miR-145 promotes the phenotype of Human Glioblastoma Cells selected for invasion [30]. [score:1]
We found that the 3′-UTR of BNIP3 contains putative binding sites for miR-145 (Figure 6A). [score:1]
Protein levels of BNIP3 also inversely correlated with miR-145 levels (Figure 6D). [score:1]
Figure 6 (A) Bioinformatics analysis shows the seed sequence of miR-145 binding to the 3′-UTR of BNIP3 mRNA. [score:1]
miR-145 induces apoptosis of glioma cells. [score:1]
miR-145 induces glioma cells apoptosis. [score:1]
To define the role of miR-145 in glioma, we analyzed miR-145 levels in human glioma samples, rat glioma tissues, and glioma cell lines by quantitative real-time PCR analysis. [score:1]
[1 to 20 of 55 sentences]
16
[+] score: 212
To confirm miR-145 regulated ITGB8 expression by direct targeting the 3′UTR, we cloned the full-length wildtype ITGB8 3′UTR fragment downstream of psiCHECK-2 luciferase reporter gene and introduced mutated miR-145 target sites: 28–34 [th] and 4421–4427 [th], by site-directed mutagenesis. [score:10]
In primary human CEPCs, transfection of miR-145 up-regulated cytokeratin-3/12 and connexin-43 and concomitantly suppressed p63 and ABCG2 expression. [score:8]
When entering into specific lineages, the differentiated cells express miR-145, which promotes differentiation and targets on Oct4 to suppress the self-renewal capability. [score:7]
With a 5-fold difference compared to cells with scrambled sequences, miR-145 up-regulated 324 genes (containing genes for immune response) and down-regulated 277 genes (containing genes for epithelial development and stem cell maintenance). [score:7]
This expression pattern of corneal differentiation markers, i. e., reduced ABCG2 and p63α expression, and its expression in parabasal layers of limbal epithelium, indicated that miR-145 might be involved in corneal epithelial differentiation. [score:7]
Real-time PCR analysis in 4 transfection experiments consistently showed that miR-145 markedly down-regulated integrin β8, ITGB8 (P = 0.00024, paired Student's t test) and up-regulated interferon β1 (IFNB1) (P<0.005) but not other candidate genes, such as Wnt7A, SOCS7 and Klf4 (Fig. 5A). [score:7]
0021249.g005 Figure 5(A) Gene expression analysis by qPCR showing that ITGB8 was significantly down-regulated (P = 0.00024, paired Student's t-test) and IFNB1 was induced after miR-145 transfection (P<0.005). [score:6]
In two separate array experiments, miR-145 up-regulated 324 genes and down-regulated 277 genes by a five-fold difference compared to cells transfected with scrambled sequences (Tables S3A–B). [score:6]
Oct4 down-regulates miR-145 expression through repressive binding to its promoter. [score:6]
MiR-145 is faintly expressed in self-renewing human ES cells but up-regulated during differentiation, indicating an inductive role on ES cell differentiation [25]. [score:5]
Further experiments using lentivirus to obtain a long-term over -expression of miR-145 or specific miR-145 knockdown will be carried out to study the biological mechanism how miR-145 regulates corneal cell proliferation, migration and differentiation. [score:5]
Together with the reduced ITGB8 expression in the resulting epithelium, this likely showed that some cells could maintain miR-145 expression after culture for a month. [score:5]
Distinct ITGB8 expression was observed in epithelial layers generated from CEPCs transfected with scrambled sequences whereas reduced expression was found in epithelia from pre-miR-145 -transfected CEPCs. [score:5]
We observed miR-145 down-regulated ITGB8 in human corneal epithelial cells and this might influence epithelium development and formation. [score:5]
Instead, over -expressing miR-145 in human CEPCs promoted CK3/12 and Cnx43 expression, which indicated the onset of corneal epithelial differentiation. [score:5]
This restricted the proof-of-concept study of miR-145 targets by knock-down experiments. [score:4]
Our results also showed that miR-145 regulated the corneal epithelium formation and maintenance of epithelial integrity, via ITGB8 targeting. [score:4]
Among them, miR-145 (43.6 folds, P = 0.00029) and 143 (27.2 folds, P = 0.0006) were the most significantly up-regulated microRNAs in LPC epithelia. [score:4]
In addition, miR-145 -transfected HCE cells had up-regulated IFNB1, which is known with anti-inflammatory activity. [score:4]
0021249.g002 Figure 2By qPCR analysis, (A) miR-143 and (B) miR-145 was up-regulated (compared to U6 expression) in LPC epithelia, when compared to CC (P<0.001, Mann Whitney U-test). [score:4]
The wildtype pCHECK-ITGB8_3′UTR construct was used as template to generate specific substitution (AACT to TTCT) of miR-145 target site using QuikChange II Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA, US) and oligonucleotides (28–34 [th] site: GATTTTTAAACACTTAATGGGA TTCT GGAATTGTTAATAATTGC; and 4421–4427 [th] site: TCTCACTTTTAAACAAAATT TTCT GGAAAAATATTACATGG). [score:4]
By qPCR analysis, (A) miR-143 and (B) miR-145 was up-regulated (compared to U6 expression) in LPC epithelia, when compared to CC (P<0.001, Mann Whitney U-test). [score:4]
Western blot analysis showed Cnx-43 upregulation in CEPCs transfected with miR-145 by about 15 folds more than those with scrambled sequences (Fig. 3L). [score:4]
Meanwhile, disruption of binding site in ITGB8 3′UTR by site-directed mutagenesis eradicated the inhibition caused by miR-145. [score:4]
This morphological alteration could be caused by miR-145 via the direct targeting on ITGB8. [score:4]
As validated by qPCR and luciferase reporter assay, our results showed miR-145 suppressed integrin β8 (ITGB8) expression in both human corneal epithelial cells and primary CEPCs. [score:4]
Luciferase expression, which represented promoter activity, was examined in HeLa cells co -transfected with the vectors and pre-miR-145 or scrambled sequences. [score:3]
Similar reduction of ITGB8 expression was observed in primary human CEPCs transfected with miR-145 (Fig. 3M). [score:3]
The absence of Oct4 facilitates miR-145 expression. [score:3]
Among them, miR-143 and miR-145 were expressed predominantly in the limbal epithelium but at very low levels in the central corneal epithelium. [score:3]
Target gene identification of miR-145 in human corneal epithelium. [score:3]
Negative staining of the parabasal layers was coincident with positive miR-145 expression as shown by in situ hybridization (Figs. 2E and F). [score:3]
Over -expressions of miR-143 and miR-145 were shown by GFP live imaging (Figs. 3A–B, miR-143; 3C–D, miR-145) and qPCR (Fig. 3E). [score:3]
Interestingly, it was negligibly expressed in the parabasal region where miR-145 was detected. [score:3]
These findings strongly indicated that miR-145 suppressed the progenitor cell pool, and the cells were prone to differentiate, resulting in an underdeveloped epithelium with fewer cuboidal basal cells. [score:3]
Validation of miR-143 and miR-145 expression in limbal epithelium. [score:3]
With about 88% efficiency in our PCR amplification system, LPC had miR-143 and miR-145 expressions 26.6-fold and 36.5-fold higher than CC epithelia respectively. [score:3]
Hence, influence of miR-145 on ITGB8 expression could be species-specific. [score:3]
On the other hand, miR-145 -transfected cells showed relatively stronger Cnx-43 expression (Fig. 3K), which was mild in cells transfected with scrambled sequences (Fig. 3I) or miR-143 (Fig. 3J). [score:3]
Hence, in ES cells, high Oct4 level suppresses miR-145 and the cells are capable of self-renewing. [score:3]
Table S4 Significant Gene Ontology (GO) terms enriched in differential expressed gene list of miR-145- versus scrambled sequence -transfected cells (fold change ≥5). [score:3]
A feedback mechanism has been proposed between miR-145 and Oct4 regulation [25]. [score:2]
With holoclone forming ability, CEPCs transfected with lentiviral plasmid containing mature miR-145 sequence gave rise to defective epithelium in organotypic culture and had increased cytokeratin-3/12 and connexin-43 expressions and decreased ABCG2 and p63 compared with cells transfected with scrambled sequences. [score:2]
We selected these cells for organotypic culture, which had demonstrated the influence of miR-145 on corneal epithelium development. [score:2]
We hypothesized that miR-145 could be an important regulatory molecule for human corneal epithelial differentiation. [score:2]
Transcriptional regulation by miR-145. [score:2]
Previous study using a zebrafish platform illustrated that miR-145 knockdown resulted in underdeveloped gut and heart [29]. [score:2]
However, this was not observed in the epithelia generated from miR-145 -transfected CEPCs (Fig. 4B). [score:1]
As shown in Figures 2D and F under higher magnification, miR-143 and miR-145 were present predominantly in the parabasal layers, with the intensity reducing towards the superficial layers. [score:1]
ITGB8 was strongly detected in cultured epithelia generated from CEPCs transfected with scrambled sequences but mild in those from pre-miR-145 -transfected CEPCs (Fig. 5E). [score:1]
Yellow shaded regions represent the conserved complementary nucleotides of miR-145 seed sequence in different species. [score:1]
At higher magnification, (D) miR-143 and (F) miR-145 were present in parabasal layers. [score:1]
0021249.g003 Figure 3 (A–D) Human P2 CEPCs transfected with (A and B) Lenti-miR-143 and (C and D) Lenti-miR-145. [score:1]
In contrast to U6 as the positive control and scrambled sequence as the negative control, miR-143 and miR-145 were more intensively detected in the limbal epithelium, but low to negligible in the corneal epithelium. [score:1]
We hybridized the corneal rim cryosections with denatured DIG-labeled LNA-miRCURY oligo probes for miR-143 (Fig. 2C), miR-145 (Fig. 2E), scrambled sequences (Fig. 2G) and U6 (Fig. 2H). [score:1]
Reduced luminescence was also found in cells co -transfected with miR-145 and mutated 3′UTR at site 28–34 [th] but not with mutated site at 4421–4427 [th]. [score:1]
The epithelium generated from miR-143 -transfected CEPCs had morphology and compactness intermediate between control and miR-145 epithelia (8.3±1.6 layers) (Fig. 4C). [score:1]
MiR-145 could be an important regulatory molecule for human corneal epithelial progenitor cell proliferation and differentiation. [score:1]
MiR-145 regulated corneal epithelial differentiation. [score:1]
Transfection analysis of miR-143 and miR-145. [score:1]
Human P2 CEPCs transfected with miR-143, miR-145 or scrambled sequences were expanded to monolayer cell sheet on denuded AM in submerged culture, followed by air-lifting to induce cell stratification. [score:1]
Localization of miR-143 and miR-145 in human corneal rim specimens was shown by LNA -based in situ hybridization. [score:1]
Similarly, ΔCT of miR-145 was 4.5±0.7 in LPC and 10.2±0.7 in CC epithelia (P = 0.0004, Mann Whitney U-test) (Fig. 2B). [score:1]
org), 2 conserved sites for miR-145 binding: 28–34 [th] and 4421–4427 [th] was found in the 3′UTR, equivalent to 3043–3049 [th] and 7436–7442 [nd] of human ITGB8 (NM_002214) (Fig. 5B). [score:1]
[1 to 20 of 64 sentences]
17
[+] score: 193
More importantly, a significant negative correlation was observed between miR-145 and NEDD9 expression in PC tissues, and the expression of NEDD9 was decreased in Panc-1 cells accompanied by suppressed cell proliferation, invasion and migration when overexpressing miR-145, suggesting that miR-145 may be involved in the regulation of NEDD9 in PC. [score:10]
For the validation of NEDD9 as a direct target of miR-145, an miRNA target luciferase reporter assay was performed using a target reporter plasmid containing wild-type (WT) NEDD9 3′-untranslated region (UTR) and mutant NEDD9 3′UTR. [score:9]
Notably, it was identified that neural precursor cell expressed, developmentally downregulated 9 (NEDD9, also termed HEF1 or Cas-L), a non-catalytic scaffolding protein implicated in the invasive ability of several types of cancer (15, 16), is a novel target of miR-145 in PC. [score:9]
To elucidate the molecular mechanism underlying miR-145 mediated regulation of proliferation, invasion and migration, in silico analysis was performed based on the computer-aided algorithms: PicTar, Targetscan, miRWalk and miRanda in conjunction with the miRGen Target program for predicted target genes. [score:8]
In conclusion, data from the present study has demonstrated that miR-145 is downregulated in PC, restoration of miR-145 may inhibit the proliferation, migration and invasion capacity of PC cells by negatively regulating NEDD9 at the post-transcriptional level via directly binding to non-coding regions of NEDD9. [score:8]
In the present study, it was identified that miR-145 expression in PC tissues is significantly downregulated compared with that in adjacent normal pancreatic tissues, suggesting that miR-145 is a candidate tumor suppressor in the pathogenesis of PC. [score:7]
The results suggested that miR-145 downregulates NEDD9, while NEDD9 down-regulates miR-145, forming a double -negative feedback loop in GB-NS (25). [score:7]
miR-145 was identified as a tumor-suppressive miRNA, which is downregulated in several types of cancer, including prostate, bladder, breast, lung and ovarian cancer (7– 12). [score:6]
Downregulation or silencing of miR-145 may eliminate tumor suppression so as to contribute to tumorigenesis. [score:6]
miR-145 expression is downregulated in PC. [score:6]
Recently, Speranza et al (25) identified that miR-145 is markedly downregulated whereas NEDD9 is significantly upregulated in glioblastoma specimens and corresponding glioblastoma-neurospheres (GB-NS) compared with normal brain and low-grade gliomas. [score:6]
Cell proliferation is suppressed by re -expression of miR-145 in Panc-1 cells. [score:5]
These data demonstrated that miR-145 may inhibit cell growth, invasion and migration of PC by targeting NEDD9. [score:5]
This hypothesis was further supported by the luciferase activity assay, in which the data demonstrated that miR-145 was able to directly target the 3′UTR of NEDD9 and the binding site was consistent with the seed region predicted by Targetscan. [score:5]
Subsequently, the biological function of miR-145 in PC cells was examined and the results demonstrated that restoration of miR-145 in Panc-1 cells can significantly inhibit cell proliferation, invasion and migration, confirming previous studies suggesting a tumor-suppressive role for this miRNA. [score:5]
These observations indicated that miR-145 directly targeted NEDD9 through interacting with the predicted binding site in its 3′UTR. [score:4]
Microarray studies have revealed that miR-145 is also down-regulated in PC (13, 14). [score:4]
In addition, a close association between downregulated miR-145 and cancer invasion/metastasis has been observed (7– 12). [score:4]
Microarray studies have identified that miR-145 was also downregulated in PC (13, 14). [score:4]
miR-145 directly targets 3′UTR of NEDD9. [score:4]
Transfection of Panc-1 cells with miR-145 mimics significantly decreased the expression of NEDD9 mRNA (Fig. 7) by 51% and the NEDD9 protein by 52.21% (Fig. 8) compared with levels in the control miR expressing cells (P<0.05). [score:4]
Aberrant expression of miR-145 has been observed in several types of cancer, including prostate, bladder, lung, breast and ovarian cancer. [score:3]
Firstly, the bioinformatics analysis indicated that NEDD9 may be one of the potential targets for miR-145. [score:3]
The expression of miR-145 was examined in different grades of PC using RT-qPCR. [score:3]
In the present study, it was identified that miR-145 is downregulated in PC tissues compared with matched normal adjacent pancreatic tissues. [score:3]
As shown in Fig. 5A, there is a putative 8-mer -binding site for miR-145 in the 3′UTR of the NEDD9 transcript [in addition to 7-mer sites, TargetScan predicts 8-mer sites defined as: An exact match to positions 2–8 of the mature miRNA (the seed+position 8) followed by an ‘A’]. [score:3]
However, the exact mechanism by which this treatment may aid therapy remains to be elucidated, largely due to the limited knowledge of miR-145 targets. [score:3]
miR-145 has been observed to be underexpressed in various types of cancer; however, its expression in PC has not been previously investigated, to the best of our knowledge. [score:3]
A significant inverse correlation was observed between NEDD9 and miR-145 expression in PC tissues and adjacent noncancerous tissues. [score:3]
The miR-145 mimics caused a 40-fold increase of the miR-145 expression in Panc-1 cells (data not shown). [score:3]
Therefore, approaches to introduce miR-145 into cancer cells may potentially be feasible in the clinical treatment of PC, particularly for patients with lower levels of miR-145 expression in their tumor tissues. [score:3]
To identify whether miR-145 directly targets NEDD9, dual-luciferase reporter gene assays were performed. [score:3]
Restoration of miR-145 suppresses Panc-1 cell proliferation, invasion and migration through reducing levels of NEDD9. [score:3]
miR-145 expression is inversely correlated with NEDD9 in PC. [score:3]
The results revealed that the re -expression of miR-145 significantly decreased cell invasion and migration in Panc-1 cells (P<0.05; Figs. 3 and 4). [score:3]
These data support the hypothesis that miR-145 may act as a tumor suppressor in PC. [score:3]
Cell invasion and migration are significantly decreased by re -expression of miR-145. [score:3]
is suppressed by re -expression of miR-145 in Panc-1 cellsInitially, the effects of miR-145 on the proliferation of PC cells were investigated using an MTT assay. [score:2]
As shown in Fig. 1, the expression of miR-145 was significantly lower in PC tissues compared with paired adjacent normal pancreatic tissues (P<0.05). [score:2]
However, little is known about the function of NEDD9 in PC, and to the best of our knowledge, there are no previous studies investigating whether NEDD9 expression is regulated by specific miRNAs, such as miR-145, in PC. [score:2]
These results provided substantial evidence that miR-145 may be involved in the invasive and metastatic progression of PC. [score:1]
The present data suggested that miR-145 may be useful as a novel potential therapeutic approach for the treatment of PC. [score:1]
The MTT value of cells transfected with miR-145 mimics was significantly lower than that of cells transfected with miR-NC at 48 h post-transfection (P<0.05; Fig. 2). [score:1]
In the present study, an important molecular association between miR-145 and NEDD9 was demonstrated. [score:1]
After 24 h of culturing, the cells were transfected with 75 nM miR-145 mimics or miR-NC using Lipofectamine 2000. [score:1]
As PC is a malignant type of cancer with a potent capacity to invade locally and cause distant metastases, the effect of miR-145 restoration on Panc-1 cell invasion and migration was subsequently examined. [score:1]
However, the biological function of miR-145 in PC remains to be fully elucidated. [score:1]
A total of 1×10 [4] Panc-1 cells/well were seeded into six-well plates and then cells were transfected in a solution with 75 nM miR-145 mimics or miR-NC (Yingrun Biotechnology Inc. ) [score:1]
However, the role of miR-145 in PC remains to be fully elucidated. [score:1]
Panc-1 cells were transfected with 75 nM miR-145 mimics or miR-NC. [score:1]
A total of 100 ng WT or mutant (MT) reporter constructs were co -transfected with Lipofectamine 2000 transfection reagent into the PC cells with 50 nM miR-145 mimics or miR-NC according to the manufacturer’s instructions. [score:1]
miR-145 mimics and negative control miRs (miR-NC) were synthesized by Yingrun Biotechnology Inc. [score:1]
As shown in Fig. 5B, miR-145 significantly decreased the firefly luciferase activity in the reporter with wild type 3′UTR (P<0.05); however the activity of the mutant 3′UTR vector remained unaffected (P>0.05). [score:1]
[1 to 20 of 53 sentences]
18
[+] score: 182
By contrast, Xu et al reported that endogenous miR-145 represses the 3′-untranslated regions (3′-UTRs) of Oct4, Sox2 and Klf4, and that increased miR-145 expression inhibits human embryonic stem cell self-renewal, represses expression of pluripotency genes and induces lineage-restricted differentiation (18). [score:9]
Therefore, it was hypothesized that miR-145 suppresses the human choriocarcinoma cell line JAR by downregulation of Sox2 expression. [score:8]
Examples include, miR-15a, which has been associated with chronic lymphocytic leukemia (2, 5, 6), and also miR-21 and miR-17, which are upregulated, while miR-143 and miR-145 are down-regulated in colorectal cancer (11, 12). [score:7]
The luciferase activity of the Sox2 3′-UTR sites was significantly inhibited by wt miR-145 (Fig. 1), while the luciferase activity of the mutated Sox2 3′-UTR sites was not inhibited, suggesting that Sox2 was targeted by miR-145. [score:7]
It may be speculated that inhibition or loss of miR-145 expression results in excessive Sox2 expression, and therefore influences tumor growth. [score:7]
These values were significantly higher than those for the wt miR-145 transfected group (JAR: 0.429±0.019; JEG-3: 0.547±0.040 relative to GAPDH), which indicated that exogenous miR-145 down-regulated Sox2 expression. [score:6]
Plasmid DNA encoding each Sox2 mRNA 3′-UTR site [wild-type (wt) Sox2, empty plasmid and mutant Sox2] was co -transfected with the miR-145 expression lentivirus (wt miR-145, empty lentivirus and mutant miR-145 lentivirus) into the mouse embryonic fibroblast cell line NIH-3T3, to examine regulation of Sox2 gene expression by mature miR-145. [score:6]
In view of this evidence, in the current study, the miR-145 expression vector was transfected into the human choriocarcinoma cell lines JAR and JEG-3 to determine its specific role in Sox2 regulation and inhibition of cell proliferation, and invasion. [score:6]
By contrast, certain studies have also shown that miR-145 may specifically regulate the target gene Sox2 expression (21). [score:6]
Therefore, miR-145 expression may influence endogenous Sox2 expression. [score:5]
Putative miRNA target sites in the 3′-UTR of Sox2 mRNA were used to construct a wt miR-145 expression lentivirus, which was then transfected into the JAR human choriocarcinoma cell line. [score:5]
Expression of wt miR-145 in JAR cells inhibited subcutaneous tumor growth in nude mice. [score:5]
The effectiveness of miR-145 overexpression not only as an inhibitor of endogenous Sox2 expression, but also as a suppressor of proliferation and invasion in human choriocarcinoma cell lines, was investigated in several ways, including cell proliferation, invasion and infiltration assays, and tumorigenicity assays in nude mice. [score:5]
qRT-PCR and western blot analyses were used to determine the effect of exogenous and endogenous miR-145 expression on Sox2 expression. [score:5]
The survival rates remained unchanged for untransfected cells and mutant miR-145 transfected cells for the remainder of the time course, which indicated that induced exogenous miR-145 expression inhibited the growth of human choriocarcinoma JAR and JEG-3 cell lines in vitro. [score:5]
These results suggested that miR-145 expression in the human choriocarcinoma cell line suppressed in vivo tumor growth. [score:5]
Finally, xenograft experiments indicated that miR-145 expressed in the JAR cell line also suppressed tumor growth in vivo. [score:5]
FCM analysis revealed that the majority of wt miR-145 -transfected cells were arrested in the G [0]/G [1] phase of the cell cycle with reduced percentages in the S and G [2]/M phases, which suggested that miR-145 expression affected the cell cycle regulation of choriocarcinoma cells in vitro. [score:4]
The results suggested that wt miR-145 expression affected cell cycle regulation in human choriocarcinoma cells in vitro. [score:4]
Luciferase activity assays indicated that the activity of the Sox2 3′-UTR site was significantly inhibited by wt miR-145, while that of the mutated Sox2 3′-UTR site was unchanged, which suggested that miR-145 targeted Sox2. [score:4]
Similarly, exogenous miR-145 expression was shown to inhibit the growth of the JAR cell line in vitro using MTT assays. [score:4]
qRT-PCR analyses revealed decreased Sox2 mRNA expression in wt miR-145 lentivirus -transfected JAR and JEG-3 cells than in untransfected and mutant miR-145 -transfected cells. [score:3]
Furthermore, miR-145 expression in the JAR cell line was associated with a significant decrease in tumor volume (Fig. 4). [score:3]
Therefore, we investigated whether the expression of endogenous Sox2 in human choriocarcinoma was silenced when the miR-145 overexpression might weaken the proliferation and invasion of carcinoma. [score:3]
However, no studies have linked miR-145 expression with the proliferation and invasion capacity of human choriocarcinoma cells (2). [score:3]
Proliferation and invasion of human choriocarcinoma cell lines were inhibited by miR-145. [score:3]
This study focused on human miR-145, which targets the human Sox2 3′-UTR, although conservation in this sequence indicates the possibility of binding to varying degrees, across species (Fig. 1). [score:3]
The results suggest that not only proliferation, but also invasion and infiltration were reduced following miR-145 overexpression in the human choriocarcinoma cell lines, JAR or JEG-3. In comparison with the wt cell lines, the tumorigenicity in nude mice of JAR cells transfected with exogenous miR-145 was reduced. [score:3]
In the present study, it was observed that miR-145 interfered with Sox2 expression via putative sites located in the 3′-UTR region. [score:3]
The relative mRNA expression after normalization to 18S ribosomal RNA (rRNA), which served as an internal control, is shown in Fig. 1. Notably, western blotting revealed that Sox2 levels in untransfected cells (JAR or JEG-3 cell lines) and mutant miR-145 transfected cells (JAR or JEG-3 cell lines) were 0.667±0.026 or 0.876±0.036, and 0.669±0.020 or 0.879±0.028 relative to those of GAPDH, respectively (Fig. 1). [score:3]
org) (28, 29), the precursor miRNA (pre-miRNA) sequences, mature miRNA sequences, chromosomal locations and length of miR-145 and the target gene Sox2 were analyzed. [score:3]
miR-145 specifically influences expression of Sox2 protein in human choriocarcinoma cell lines. [score:3]
For vector pLL3.7-mir145 (pre-miRNA of miR-145 expression element), oligonucleotide pairs for pre-miRNA of miR-145 and linker sequences with HpaI and XhoI sites were chemically synthesized. [score:3]
These results indicate that the repression of Sox2 expression by miR-145 significantly attenuates the invasion and migration ability of human choriocarcinoma cells. [score:3]
The negative control plasmid pLL3.7-mir145-Mut was similarly constructed, with the exception that 23 nucleotides in sequences corresponding to miR-145 were mutated (GTC CAG TTT TCC CAG GAA TCC CT to Gaa Ct Gaa TTa gCA cGA AgC aCT, mutations shown in lower-case). [score:2]
In addition, qRT-PCR and western blot analysis demonstrated that Sox2 protein expression was reduced in wt miR-145 lentivirus -transfected JAR cells compared with the levels detected in mutant miR-145 lentivirus -transfected or untransfected cells. [score:2]
Further studies are required to fully elucidate the function of miR-145 in this process. [score:1]
Although both groups developed tumors, the tumors formed by wt miR-145 -transfected cells grew more slowly than those in the mutant miR-145 -transfected group (Fig. 4). [score:1]
In addition, miR-145 transfected, mutant miR-145 -transfected and untransfected JAR or JEG-3 cells were stained with PI, and analyzed by flow cytometry to detect changes in cell cycle progression. [score:1]
The effect of miR-145 expression on tumor growth was investigated in vivo by subcutaneous inoculation of the miR-145 lentivirus -transfected JAR cells and mutant miR-145 lentivirus -transfected JAR cells into two groups of nude mice. [score:1]
The corresponding viruses were designated Ldv-mir145 and Ldv-mir145-Mut. [score:1]
However, it is clear that miR-145 and Sox2 play potentially important roles in the pathogenesis of human choriocarcinomas. [score:1]
NIH-3T3 cells were seeded at 3×10 [4] per well in 48-well plates and co -transfected with 400 ng pLL3.7-mir145, pLL3.7 or pLL3.7-mir145-Mut, 20 ng pGL3cm-Sox2-3UTR-WT or pGL3cm-Sox2-3UTR-Mut, and pRL-TK (Promega, Madison, WI, USA) using Lipofectamine 2000 reagent according to the manufacturer’s instructions. [score:1]
The sequences of the oligonucleotides were: top strand, 5′-CG g tta acC ACC TTG TCC TCA CG G TCC AGT TTT CCC AGG AAT CCC TTA GAT GCT AAG ATG GGG ATT CCT GGA AAT ACT GTT CTT GAG GTC ATG GTT ctc gag CG-3′; and bottom strand, 5′-CG c tcg agA ACC ATG ACC TCA AGA ACA GTA TTT CCA GGA ATC CCC ATC TTA GCA TCT AAG GGA TTC CTG GGA AAA CTG GAC CGT GAG GAC AAG GTG gtt aac CG-3′ (sequences corresponding to miR-145 seed sequences are capitalized and bold, and restriction enzyme sites are lower case and bold) (18). [score:1]
As shown in Fig. 3, the majority of the wt miR-145 -transfected JAR cells were arrested in the G [0]/G [1] phase of the cell cycle and the percentage of cells in the S phase were markedly decreased. [score:1]
By contrast, no differences in viability were observed in untransfected cells, mutant miR-145 -transfected cells and wt miR-145 transfected cells 1 and 2 days post-transfection. [score:1]
Hybridization was performed with the miR-145 antisense starfire probe, 5′-AGG GAT TCC TGG GAA AAC TGG AC-3′ (IDT, Coralville, IA, USA), to detect the 22-nt miR-199a fragments according to the manufacturer’s instructions. [score:1]
By contrast, no significant differences were observed in the cell cycle distribution of the mutant miR-145 -transfected and untransfected JAR cells. [score:1]
The pLL3.7-mir145 or pLL3.7-mir145-Mut was recombined in the package cell line 293T to create lentiviruses. [score:1]
Northern blot analysis demonstrated that the hybridized signal of mutant miR-145 in the JAR and JEG-3 choriocarcinoma cell lines was weaker than in cells transfected with wt miR-145. [score:1]
Co-transfection of human iPS cells used 4×10 [7] PFU/ml Ldv-mir145 or Ldv-mir145-Mut lentivirus according to the manufacturer’s instructions. [score:1]
In addition, the majority of wt miR-145 -transfected JEG-3 cells were arrested in the G [0]/G [1] phase of the cell cycle and the percentage of cells in the G [2]/M phase were markedly decreased. [score:1]
In the current study, exogenous miR-145 was transfected into the two human choriocarcinoma cell lines, JAR and JEG-3 using a lentiviral system. [score:1]
All the mice in the mutant miR-145 group developed tumors ∼37 days after injection, whereas tumors were detected in only one in four mice from the miR-145 transfected group at this time. [score:1]
However, no significant differences were observed in the cell cycle distribution of the mutant miR-145 -transfected and untransfected cells. [score:1]
miR-145 binding with the 3′-UTR sites in Sox2. [score:1]
In addition, when the mice were sacrificed 62 days after injection, tumor weights in the mutant miR-145 transfected group were significantly heavier than those in the wt miR-145 lentivirus -transfected group. [score:1]
[1 to 20 of 57 sentences]
19
[+] score: 180
Importantly, inhibition of gap junctional transfer from HMEC to SW480 through the down-regulation of Cx43 expression in HMEC improved endothelial tube formation in the presence of SW480, suggesting that expression of miR-145-5p in SW480 was required to inhibit the proangiogenic effect of the co-culture (Figure 3C). [score:12]
Here, we show that these gap junction channels permit the passage of miR-145-5p from endothelial cells to cancer cells which in turn up-regulates Cx43 expression in cancer cells and inhibits their proangiogenic effect. [score:8]
E. Down-regulation of Cx43 expression in HMEC does not affect loading of miR-145 mimic but suppresses transfer of miR-145 to SW480. [score:8]
That gap junction channels formed by Cx43 mediate the transfer of miR-145 from endothelial to cancer cells, which is demonstrated here by: (1) exosomes or other secreted structures are not involved as this transfer is prevented by the absence of cell-to-cell contact; (2) the exosome inhibitor, GW4869, does not reduce the transfer of miR-145 from HMEC to SW480, as previously described for its transfer from smooth muscle cells to endothelial cells [23]; (3) the functional inhibition of gap junctions using either a chemical blocker or siRNA mediating Cx43 down-regulation, prevents miR-145 transfer from HMEC to SW480; and (4) miR-145 transfer is also observed from cancer cells to endothelial cells. [score:8]
The dysregulation of miRs expression, i. e. with an early down-regulation of miR-145, in colorectal cancer biopsy is associated with a worse tumor grading. [score:7]
This is the case of the early step in colon cancer progression where miR-145 expression is usually down-regulated [21, 25, 26, 31]. [score:6]
We report here that miR-145 up-regulates the expression of Cx43 in SW480. [score:6]
MiR-145, which is downregulated in early stage of colorectal cancer [21, 24] and acts as tumor suppressor [25– 27], is used as an example. [score:5]
Thus it is possible that downregulation of miR-145 is associated with an increased angiogenesis in tumors because the stabilizing effect on endothelium is decreased or lost [23]. [score:4]
The down-regulation of Cx43 in HMEC prevented the transfer of miR-145-5p to SW480 within 12 hours of co-culture (Figure 1E). [score:4]
D. Tumor growth development induced by miR-145 inhibitor, after 24 hours of co-culture. [score:4]
Taken together, these experiments suggest that the transfer of miR-145 from HMEC to SW480 could down-regulate colon cancer cell growth by preventing the formation of new vessels. [score:4]
D. Transfer of miR-145 to SW480 is inhibited by a gap junction blocker. [score:3]
Cell donors were loaded or not with miR-145 -mimic (60 nM) or miR-145 -inhibitor (60 nM). [score:3]
This is in agreement with previous reports showing the inhibitory effect of miR-145 on angiogenesis and, consequently, tumor growth [19, 22, 30]. [score:3]
Levels of miR-145 were expressed relative to levels of U6 snRNA, commonly used as an internal control in miRs analysis (means ± SD; * P<0.05; n = 3). [score:3]
These effects were not observed with the miR-145-5p inhibitor. [score:3]
These experiments were repeated in the presence of the exosome release inhibitor, GW4869 (10 μM) [15], which did not significantly modify the low level of miR-145-5p in SW480. [score:3]
Immunoblot analyses identified approximately a 2-fold increase in Cx43 expression in non -transfected SW480 after 7 h of co-culture with miR-145-5p transfected HMEC cells. [score:3]
Clearly, inhibition of GJIC prevented the increase in miR-145-5p in SW480 (Figure 1D). [score:3]
In contrast to these oncogenic miRs, miR-145 increases Cx43 expression. [score:3]
Figure 1 A. Expression profile of miR-145 in HMEC (black) and SW480 (hatched), separately cultured (left) or co-cultured (right) for 12 hours. [score:3]
Both HMEC and SW480 expressed high levels of miR-145-5p (Figure 1D). [score:3]
The transfer of miR-145-5p to cancer cells inhibits their proangiogenic effect in vitro. [score:3]
Thus miR-145-5p acts as a potent anti-angiogenic factor, inhibiting the tubulogenesis induced by cancer cells (Figure 3B). [score:3]
Importantly, the transfer of miR-145-5p from endothelial to colon cancer cells could decrease tumor growth along the capillary-like network, which can be reversed by the miR-145-5p inhibitor (Figure 3D). [score:3]
B. miR-145 expression in receiver cells, SW480 (left panel) and HMEC (right panel), after co-culture for 7 hours with donor cells, HMEC and SW480, respectively. [score:3]
In contrast, a 20% decrease in Cx43 expression was observed in non -transfected HMEC cells co-cultured with miR-145-5p transfected SW480 cells (Figure 2C). [score:3]
To test the selectivity of the GJIC, we transfected either SW480 or HMEC with the same dose of miR-145-5p mimic or miR-145-5p inhibitor (60 nM). [score:3]
Human hsa-miR-145-5p mimics (mirVana TM miRNA mimic, 4464066-MC11480) and hsa-miR-145-5p inhibitors (mirVana TM miRNA mimic, 4464084-MH11480) were purchased from Ambion (Invitrogen; Life Technologies, Saint-Aubin, Fr). [score:3]
A. Expression profile of miR-145 in HMEC (black) and SW480 (hatched), separately cultured (left) or co-cultured (right) for 12 hours. [score:3]
Note that carbenoxolone does not affect the miR-145 expression in transfected HMEC or in cancer cells cultured separately. [score:3]
When miR-145-5p mimic -transfected HMEC were co-cultured with non -transfected SW480, the formation of a capillary-like network was inhibited, suggesting an anti-angiogenic effect of miR-145-5p. [score:3]
Expression of miR-145 was determined using TaqMan miRNA assay (Invitrogen) according the manufacturer's protocols. [score:2]
In vitro tubulogenesis assay of HMEC loaded or not (empty) with miR-145-5p mimic (60 nM) or inhibitor (60 nM). [score:2]
Right panels: Receiver SW480 were exposed to the cell conditioned medium collected from direct co-cultures of miR-145 -loaded HMEC / SW480 for 7 hours (medium). [score:2]
Figure 3Antiangiogenic effect of miR-145 transfer in vitro In vitro tubulogenesis assay of HMEC loaded or not (empty) with miR-145-5p mimic (60 nM) or inhibitor (60 nM). [score:2]
The transfer of miR-145-5p to cancer cells inhibits their proangiogenic effect in vitroWe subsequently used an in vitro matrigel tube formation assay to explore if miR-145-5p could modulate the formation of capillary-like structures by HMECs [29]. [score:2]
The miR-145 transfer between HMEC and SW480 is bi-directional. [score:2]
of miR-145-5p mimic did not affect the ability of HMEC to form these structures when plated alone in homotypic cultures for 7 hours (Figure 3A). [score:1]
To determine whether miR-145 is transferred from endothelial to cancer cells, we transfected HMEC with miR-145-5p mimic (30 nM) then we cultured them with DiL-C18 -labelled SW480 (ratio 1:1). [score:1]
Gap junctions mediate miR-145 transfer from endothelial to colon cancer cells. [score:1]
The miR-145-5p transfer appeared to be slightly more efficient from HMEC to SW480 than the other way around (i. e. after co-culture, miR-145 level was 3,840±192 in non -transfected SW480 co-cultured with transfected HMEC, and 2,580±129 in non -transfected HMEC co-cultured with transfected SW480; P<0.05, n=3). [score:1]
Accordingly, in co-culture experiments reported in Figure 1, 7 hours were sufficient to observe miR-145-5p cell transfer (not shown). [score:1]
Level of miR-145 was expressed relative to the level of U6 snRNA (Ambion, 4427975-001973), used as internal control for each measurement. [score:1]
Levels of miR-145 expression relative to U6 snRNA were measured in SW480 after 7 hours of cell incubation. [score:1]
HMEC loaded with miR-145-5p mimic (30 nM) were co-cultured with SW480, in the presence or the absence of carbenoxolone (carb. [score:1]
The miR-145 transfer from endothelial to cancer cells prevents vessel tube formation in vitro. [score:1]
Note that values measured by qPCR are biased in cell loaded with miR inhibitor due to the sequence similarity with miR-145-5p. [score:1]
These results indicate that SW480 do not ingest extracellular miR-145-5p, either free or incorporated into soluble exosomes. [score:1]
We first determined the basal level of miR-145-5p in HMEC and SW480 cells, cultured separately for 12 hours. [score:1]
In both conditions, we failed to detect any increase in miR-145-5p level in SW480 (Figure 2A, lower panels). [score:1]
SW480 were labelled with the fluorescent dye DiL-C18 (red cells), then plated with unlabeled HMEC in a ratio of 1:1. C. Scheme illustrating the procedure to determine the transfer of microRNA (miR-145) through hetero-cellular gap junction channels established between HMEC and SW480. [score:1]
Gap junction channels, not exosomes, mediated miR-145 transfer between cells. [score:1]
Left panels: Receiver SW480 were co-cultured with miR-145 -loaded HMEC with no physical contact (non-contact). [score:1]
We observed that miR-145-5p level was lower in SW480 than in HMEC (Figure 1A, left panel). [score:1]
It can be speculated that to maintain the proangiogenic phenotype of endothelial cells, the level of miR-145 in the surrounding tissue has to be low. [score:1]
A high level of miR-145 was measured in non -transfected cells co-cultured with mimic -transfected cells, but not with the inhibitor (Figure 2B). [score:1]
The mir145-5p levels increased by 20% in HMEC and by 60% in SW480 cells after co-culture (Figure 1A, right panel). [score:1]
D, E. Values of miR-145-5p expression relative to U6 snRNA in each cell type and condition, are means ± SD of triplicate measurements from three experiments; * P<0.5 vs donors (Mann-Whitney U test and Kruskal-Wallis test; n = 3). [score:1]
After 12 hours of co-culture, the cell types were sorted by flow cytometry and miR145-5p level was determined in each population (Figure 1C). [score:1]
A. Antiangiogenic effects of miR-145. [score:1]
We first cultured SW480 with miR-145-5p -transfected HMEC in transwell plates to prevent any cell-cell contact. [score:1]
HMEC loaded with miR-145-5p mimic (60 nM). [score:1]
Note that the siRNA Cx43 transfection of HMEC does not affect their loading with miR-145-5p mimic. [score:1]
The same observation was made when miR-145-5p mimic -transfected SW480 were co-cultured with HMEC (not shown). [score:1]
We conclude that gap junction channels are the main route for the passage of miR-145 between adjacent cells in blood capillaries. [score:1]
Antiangiogenic effect of miR-145 transfer in vitro. [score:1]
[1 to 20 of 68 sentences]
20
[+] score: 180
Other miRNAs from this paper: hsa-mir-143, hsa-mir-664a
These results may in part explain some of the inhibitory effects we observed in cell lines transfected with miR-145, but our experiments also demonstrated inhibition of proliferation and invasion in the TN p53 mutant MDA-MB-231 and the ER- p53 mutant SK-BR-3. These results argue for a different tumor suppressive pathway than described by Spizzo et al. However, the list of verified miR-145 target genes involved in tumor progression is wide-ranging (S2 Table), and the dominant active pathway(s) at any given time would be challenging to predict. [score:9]
Further, high HER3 expression could rescue the cells from the inhibitory effects of miR-143 and miR-145, underlining the importance of the cellular context and active signaling pathways on the net effect of miRNA up- or downregulation. [score:8]
Relative to MCF-10A, endogenous expression levels of miR-143 and miR-145 were downregulated in all BC cell lines. [score:6]
The overexpression of miR-145 led to inhibition of both proliferation and invasion, which is in accordance with the general consensus [19, 20, 22– 24, 44– 51]. [score:5]
Noteworthy, the coexpression of miR-143 and miR-145 led to inhibition of proliferation and invasion, which is also described in previous publications [52– 55]. [score:5]
In this study, we used 5 nM miR-145-5p target probe, 10 nM miR-143-3p target probe, 10 nM scramble miR negative control probe and 0.5 nM U6 positive control probe. [score:5]
In our study, the expression of both miR-143 and miR-145 was elevated in the least aggressive tumor types, which is in line with the tumor suppressor functions described for these miRNAs in previous publications [15– 19, 43]. [score:5]
MicroRNA-145 suppresses cell invasion and metastasis by directly targeting mucin 1. Cancer Res. [score:5]
Spizzo et al. verified miR-145 to directly target ER, and at the same time activate TP53, and in turn apoptosis [51]. [score:4]
MiR-145 inhibits cell proliferation of human lung adenocarcinoma by targeting EGFR and NUDT1. [score:4]
miR-145 inhibits proliferation in vitro. [score:3]
Expression of miR-143 and miR-145 in benign and malignant breast tissue and according to histopathological parameters: microarray and PCR-results. [score:3]
miR-145 inhibits proliferation in vitroAll three studied BC cell lines demonstrated a dramatic drop in proliferation when transfected with miR-145 (Fig 2A–2C). [score:3]
MicroRNA-145: a potent tumour suppressor that regulates multiple cellular pathways. [score:3]
Scatterplot of miR-143 and miR-145 expression in breast tumor tissue. [score:3]
Endogenous levels of miR-143 and miR-145 in the selected cell lines were quantified relative to the stably expressed reference snRNA RNU6 using real-time PCR and the miScript SYBR® Green PCR Kit (cat. [score:3]
The means plot for miR-143 and miR-145 in Fig 6A and 6B, respectively, illustrates the distribution of expression across molecular subtypes. [score:3]
Using ISH, we found the highest expression of miR-145 in myoepithelial cells in benign breast tissue. [score:3]
The endogenous expression of miR-143 and miR-145 in the studied BC cell lines was quantified relative to the non-cancerous cell line MCF-10A (Fig 1). [score:3]
There were no significant differences in miR-143 and miR-145 expression between tumor groups stratified according to tumor size or lymph node metastases. [score:3]
Means plot for the expression of miR-143 (panel A) and miR-145 (panel B) according to molecular subgroup, using PCR. [score:3]
Additionally, the expression levels of miR-143 and miR-145 were highly correlated (R = 0.88, p<0.001, Fig 3). [score:3]
Cotransfection of miR-143 and miR-145 results in a tumor suppressor phenotype. [score:3]
0186658.g006 Fig 6 Means plot for the expression of miR-143 (panel A) and miR-145 (panel B) according to molecular subgroup, using PCR. [score:3]
In contrast to the cytoplasmatic staining pattern for miR-143, miR-145 was expressed in the nuclei and with the strongest staining intensity in the myoepithelial cells in benign breast tissue (Fig 7). [score:3]
Using microarray and PCR, we found a significant downregulation of miR-143 and miR-145 in malignant tumors compared to normal tissue, which is in line with previously published studies in breast cancer [29– 31] and other tissues, especially colorectal carcinomas [32]. [score:3]
Relative expression of miR-143 and miR-145 in breast cancer. [score:3]
Cotransfection of miR-143 and miR-145 had an inhibitory effect on invasion, in line with the observations made for each individual miRNA (Fig 2D). [score:3]
Stromal ISH expression of miR-143 and miR-145 was also correlated (p = 0.049) (Table 6). [score:3]
MiR-145 displayed higher expression in luminal A tumors compared to the other molecular subtypes, and the expression of both miRNAs was lower in basal-like tumors compared to the other major subtypes (Table 5 and Fig 5). [score:3]
Using microarray and PCR, we found miR-145 to be significantly higher in ER+ tumors, which is in line with a previous study on lymph-node negative tumors where ER status was based on gene expression using microarray [42]. [score:3]
MiR-143 and miR-145 constitute a miRNA cluster and appear to have tumor suppressor functions in a variety of organ systems, both as individual miRNAs and as a cluster [15– 24]. [score:3]
S1 and S2 Tables present the validated mRNA targets for miR-143 and miR-145, based on searches using the online database miRTarBase [58]. [score:3]
ISH expression of miR-143 and miR-145 in benign and malignant breast tissue. [score:3]
Of note, microarray- and PCR -based expression levels were significantly correlated for both miR-143 (r = 0.60, p<0.001) and miR-145 (r = 0.72, p<0.001). [score:3]
miR-143 and miR-145 inhibits invasion in vitro. [score:3]
List of miR-145 target genes verified by reporter assay and western blot. [score:2]
miR-143 and miR-145 inhibits invasion in vitroThe cells’ invasive abilities were studied using a Boyden chamber assay. [score:2]
The results in this study, including the differential effects in vitro of miR-143 in BC cell lines, the effects of cotransfecting miR-143 and miR-145, and the nuclear enrichment of miR-145 in breast tissue, underline the complexity of miRNA regulation and function. [score:2]
Further, we observed a distinct nuclear enrichment of mature miR-145, as has been previously reported in both breast and other tissues [34– 36]. [score:1]
0186658.g003 Fig 3 Scatterplot of miR-143 and miR-145 expression in tumor tissue, measured by PCR. [score:1]
Functional studies on miR-143 and miR-145 in vitro. [score:1]
The proliferation of cells cotransfected with miR-143 and miR-145 was dramatically reduced in all three cell lines and was similar to the proliferation pattern of cells transfected with miR-145 alone (Fig 2A–2C). [score:1]
In order to study the cellular and subcellular location of miR-143 and miR-145 in benign and malignant breast tissue, we analyzed the miRNA in situ hybridization (ISH) staining in full histological slides of 16 tumors with adjacent normal tissue. [score:1]
on miR-143 and miR-145 in vitroThe potential functional role of miR-143 and miR-145 in breast cancer tumorigenesis was explored by a series of in vitro experiments. [score:1]
This study evaluates the miR-143 and miR-145 expression profile in an unselected cohort of BC within the Norwegian Women and Cancer Study (NOWAC) postgenome cohort [25]. [score:1]
The experiments were performed by introducing miR-143 mimic or miR-145 mimic, alone or in combination, alongside a miRNA negative control into various BC cell lines. [score:1]
The BC cell lines were simultaneously transfected with 50 nM of both miR-143 and miR-145. [score:1]
The cellular and subcellular expression of miR-143 and miR-145 in benign and malignant breast tissue was evaluated in full histological slides of 16 tumors with adjacent benign breast tissue. [score:1]
Means plot of miR-143 and miR-145 in breast tumors according to molecular subtype. [score:1]
MiR-143 and miR-145 in situ hybridization staining pattern in breast tissue. [score:1]
# PM10883, Thermo Fisher Scientific, USA) and/or 100 nM hsa-miR-145-5p Pre-miR™ miRNA Precursor (cat. [score:1]
0186658.g001 Fig 1 Endogenous expression of miR-143 and miR-145 in breast cancer cell lines compared to the non-cancerous breast cell line MCF-10A and in breast cancer tumors compared to benign breast tissue, analyzed using PCR or microarray technology. [score:1]
The potential functional role of miR-143 and miR-145 in breast cancer tumorigenesis was explored by a series of in vitro experiments. [score:1]
Tumor cells and stromal fibroblasts were scored for staining intensity as illustrated in Fig 8. Noteworthy, all 16 tumors had positive staining for both miR-143 and miR-145 in both tumor cells and fibroblasts. [score:1]
Correlations of miR-143 and miR-145 in situ hybridization staining intensities in tumor and stromal cells. [score:1]
This study characterizes the functional properties and expression pattern of the miRNA cluster miR-143 and miR-145 in BC. [score:1]
0186658.g002 Fig 2 on BC cell lines after transfection with miR-143 and/or miR-145. [score:1]
0186658.g007 Fig 7MiR-143 and miR-145 in situ hybridization staining pattern in breast tissue. [score:1]
In situ hybridizationIn order to study the cellular and subcellular location of miR-143 and miR-145 in benign and malignant breast tissue, we analyzed the miRNA in situ hybridization (ISH) staining in full histological slides of 16 tumors with adjacent normal tissue. [score:1]
There was higher expression of both miR-143 and miR-145 in low and intermediate grade tumors compared to the high grade tumors, as shown in Tables 2 and 3 and Fig 4, and in ER -positive compared to ER -negative tumors (Table 4). [score:1]
Proliferation and invasion were assessed after transfecting BC cell lines with either miR-143, miR-145, or miR-143 and miR-145 in combination. [score:1]
MiR-143 and miR-145 in situ hybridization staining intensities in tumor and stromal cells. [score:1]
ER+ MCF7 cells (panel A), HER2+ SK-BR-3 cells (panel B) and triple negative MDA-MB-231 cells (panel C) were transfected with miR-143 mimic, miR-145 mimic, either alone or in combination, or with control mimic, and cell proliferation monitored in real time using xCelligence. [score:1]
Using Spearman’s rho, the staining intensity in tumor cells and stromal fibroblasts was found to be positively correlated for both miR-143 (p = 0.006) and miR-145 (p = 0.006). [score:1]
Synergistic effects of miR-143 and miR-145 on BC cell proliferation have been demonstrated in MCF7 and MBA-MD-231 cells and in a mouse mo del using MCF7 xenografts [53]. [score:1]
All slides were denaturated for 8 min at 90°C, hybridization with probes took place for 60 min at 50°C for miR-145, 55°C for miR-143, 57°C for scramble miR and 55°C for U6. [score:1]
0186658.g008 Fig 8MiR-143 and miR-145 in situ hybridization staining intensities in tumor and stromal cells. [score:1]
The proliferation promoting effects observed for miR-143 in the ER+ cell line and the TN cell line were cancelled by the simultaneous transfection of miR-145 (Fig 2A and 2C). [score:1]
Illustrative examples of miR-143 and miR-145 in situ hybridization staining pattern in benign breast tissue (x400 magnification) and adjacent benign and malignant breast tissue (x200 magnification). [score:1]
All three studied BC cell lines demonstrated a dramatic drop in proliferation when transfected with miR-145 (Fig 2A–2C). [score:1]
Interestingly, both miRNAs, although not sharing sequence homology, were demonstrated to bind to the 3’-UTR region of HER3, the most potent effects were demonstrated by miR-145. [score:1]
Also in tumor cells and stromal fibroblasts, miR-145 staining was predominantly nuclear. [score:1]
Functional studies on BC cell lines after transfection with miR-143 and/or miR-145. [score:1]
Both miR-143 and miR-145 had a profound effect on cell invasion (Fig 2D). [score:1]
*** signifies P<0.001 using one-way ANOVA and the Benjamini & Hochberg correction comparing miR-143 and/or miR-145 transfected cells to controls. [score:1]
The mean staining intensity for miR-143 in tumor cells was 2.17 and in stromal fibroblasts 2.06 whereas mean miR-145 staining intensity was 2.10 in tumor cells and 1.69 in stromal fibroblasts. [score:1]
Endogenous expression of miR-143 and miR-145 in breast cancer cell lines compared to the non-cancerous breast cell line MCF-10A and in breast cancer tumors compared to benign breast tissue, analyzed using PCR or microarray technology. [score:1]
In situ hybridization staining of miR-143 and miR-145 in tumor cells (panel A-C and panel D-F, respectively) and stromal fibroblasts (panel G-I and panel J-L, respectively) with examples of staining intensities corresponding to score weak, moderate and strong. [score:1]
[1 to 20 of 79 sentences]
21
[+] score: 179
To determine whether miRNA inhibitor conjugates could be used to promote growth signalling in human placental tissue, first trimester and term placental explants were cultured with scrambled-, miR-145 inhibitor- or miR-675 inhibitor conjugates, or with commercially available scrambled- or miR-145 inhibitors that lacked the CCGKRK targeting sequence. [score:11]
Placental explants were incubated with the scrambled inhibitor PNA conjugate, the miR-145 inhibitor PNA conjugate, the miR-675 inhibitor PNA conjugate, the scrambled miR inhibitor or the selective miR-145 inhibitor (50nM) for 24 or 48h. [score:11]
In this proof of principle study, we have explored the feasibility of using a miRNA inhibitor as putative therapeutic in pregnancy, designed placental homing peptide-microRNA inhibitor conjugates synthesised from peptide nucleic acids, and demonstrated that targeted inhibition of miR-145 and miR-675 expression within the placenta leads to enhanced CTB turnover in human first trimester explants and increased fetal and placental weights in mice. [score:11]
After 24h of culture, miR-145 expression was significantly reduced in first trimester explants treated with the miR-145 inhibitor conjugate, and the reduction in expression was comparable to explants treated with the non -targeted miR-145 inhibitor (Figure 6A), as previously reported 16. [score:11]
In contrast, there was no significant reduction in miR-145 expression in term placental explants exposed to either the targeted or non -targeted miRNA inhibitor conjugate (Figure 6B). [score:9]
PCR analysis of miRNA expression in placentas harvested at E18.5 showed that treatment with the miR-675 inhibitor conjugate significantly reduced miR-675 expression (Figure 4G), but median placental miR-145 expression was not significantly changed at this time point (Figure 4H). [score:9]
Three homing peptide-miRNA inhibitor peptide nucleic acid (PNA) conjugates were synthesised by Cambridge Research Biochemicals: (i) a scrambled miRNA inhibitor sequence conjugated to the peptide CCGKRK via a disulphide linkage (5'- ACCACGCCTCTCGCCAGTGTCAC-Cys-Cys-Gly-Lys-Arg-Lys-3'); (ii) a miR-145 inhibitor sequence conjugated to the peptide CCGKRK via a disulphide linkage (5'-CAGGTCAAAAGGGTCCTTAGGGA-Cys-Cys-Gly-Lys-Arg-Lys-3'); and (iii) a miR-675 inhibitor sequence conjugated to the peptide CCGKRK via a disulphide linkage (5'-ACCACGCCTCTCCCGGGTGTCAC-Cys-Cys-Gly-Lys-Arg-Lys-3'). [score:9]
This could be achieved by two approaches: firstly, as demonstrated in our study, miRNAs that are highly expressed in the first trimester (such as miR-145 and miR-675), and are negative regulators of growth and development, could be targeted for inhibition in women identified as being at high risk of impaired placentation. [score:9]
Both miRNA inhibitor conjugates significantly enhanced CTB proliferation in first trimester explants, compared to those treated with the scrambled inhibitor conjugate (Figure 7M), and this increase was comparable to that observed with the non -targeted miR-145 inhibitor. [score:8]
A commercially available scrambled miRNA inhibitor and a selective inhibitor of miR-145, both lacking targeting peptide sequences were purchased from Exiqon and were used as negative and positive controls, respectively. [score:7]
miR-145-5p target sequence: 5' GUCCAGUUUUCCCAGGAAUCCCU 3' (conserved sequence between mouse and human); mmu miR-675-5p target sequence: 5' UGGUGCGGAAAGGGCCCACAGU 3'; hsa miR-675-5p target sequence: 5' UGGUGCGGAGAGGGCCCACAGUG 3'. [score:7]
C57/BL6J mice were intravenously injected with PBS, a scrambled miRNA inhibitor conjugate (1mg/kg), a miR-145 inhibitor conjugate or a miR-675 inhibitor conjugate at three-time points during pregnancy. [score:7]
Mice were intravenously injected with 100 µl of vehicle (PBS) or 1 mg/kg of the scrambled inhibitor PNA conjugate, the miR-145 inhibitor PNA conjugate or the miR-675 inhibitor PNA conjugate on E12.5, E14.5 and E16.5 of pregnancy. [score:7]
Analysis of placental weight distribution indicated that 6 placentas weighed below the 10 [th] centile in PBS treated mice, and 5 placentas weighed below the 10 [th] centile in mice treated with the scrambled inhibitor conjugate, but no placentas fell below the 10 [th] weight centile in either miR-145 or miR-675 inhibitor conjugate -treated mice, suggestive of a growth-promoting effect. [score:5]
As these molecules have been shown to modulate implantation 47, trophoblast invasion 48 and spiral artery remo delling 49 respectively, miR-145 inhibition in the early stages of gestation has the potential to regulate multiple aspects of human pregnancy and placental development. [score:5]
As many of these miRNAs, including miR-145, have been detected in the peripheral blood of women with pregnancy complications 42, the potential for their use as biomarkers of disease and signposts for development of miRNA-specific personalised therapies also remains to be explored. [score:4]
Levene's test for homogeneity of variance confirmed that treatment with miR-145 inhibitor conjugate significantly reduced the variance in fetal/placental weight ratio, compared to that of mice treated with PBS (P<0.05) or the scrambled inhibitor conjugate (P<0.05). [score:4]
We demonstrate expression of miR-145 in mouse placenta for the first time, propose that this molecule controls placental weight gain and validate a previous report that miR-675 is a negative regulator of murine placental growth 25. [score:4]
In other tissues miR-145 has been identified as a putative tumour suppressor gene 43 and as a negative regulator of angiopoietin-2 44, MUC-1 45 and ADAM-17 46. [score:4]
miR-145 was also detected in the fetus (Figure 1B), and in the maternal heart, liver and uterus (Figure 1C); however, the level of expression did not change with gestation. [score:3]
As observed in human placental explants 16, increased miR-145 expression correlated with a decrease in the number of Ki67 -positive cells throughout the placenta and decidua (Figure 1D, E). [score:3]
microRNA-145 (miR-145) expression has previously been documented in the human placenta 16; however, no corresponding data exists in the mouse. [score:3]
3'UTRs 3'-untranslated region CTB cytotrophoblasts DMEM Dulbecco's modified Eagle medium EVT extravillous trophoblast FAM 5(6)-carboxyfluorescein FGR fetal growth restriction IGF-I insulin-like growth factor-I IGF-II insulin-like growth factor-II miR-145 microRNA-145 miR-675 microRNA-675 miRNA microRNA. [score:3]
No inhibitor significantly altered the median fetal/placental weight ratio, a measure of placental efficiency; however, the miR-145 inhibitor conjugates appeared to normalise efficiency, such that fewer placentas exhibited extremes of efficiency (Figure 4E). [score:3]
Moreover, as miR-145 limits tumour angiogenesis 50, 51, miR-145 inhibition may promote the normal physiological processes of decidual angiogenesis and uterine spiral artery remo delling which are key to pregnancy success in both humans and mice 52, 53. [score:3]
These wide-ranging effects may highlight some of the ways in which miR-145 inhibition may have enhanced fetal growth in our study, without significantly increasing placental weight. [score:3]
Quantitative RT-PCR analysis of mouse placental lysates confirmed miR-145 expression (Figure 1A), and demonstrated that miR-145 levels significantly increased between E12.5 and E18.5 of gestation. [score:3]
We have also identified a number of downstream targets of miR-145 in the human placenta, including IGF receptor-1, cyclin D1 and p38 MAPK 16, all of which promote growth signalling. [score:3]
The miR-145 inhibitor conjugate did not significantly alter median placental weight, but it appeared to normalise placental weight, such that there were fewer of the heaviest and lightest placentas within that treatment group (Figure 4E). [score:3]
Levene's test for homogeneity of variance confirmed that the miR-145 inhibitor conjugate significantly reduced the variance in placental weights, compared to mice treated with PBS (P<0.05). [score:2]
The miR-145 and miR-675 inhibitor conjugates also significantly increased median fetal weight at E18.5, compared to mice injected with PBS (Figure 4C); however, fetal weight distribution curves showed that the number of fetuses falling below the 10 [th] centile remained unchanged. [score:2]
Work by our group and others has identified numerous miRNAs, including miR-675, miR-145, let-7a, miR-377 and miR-483, that influence events in early pregnancy 15, and can either positively or negatively regulate CTB proliferation in explants of human placental tissue 16- 19. [score:2]
Indeed, analysis of the relative area of the labyrinth and junctional zone is indicative of a possible growth-promoting effect of the miR-145 inhibitor conjugate within the junctional zone, although this requires further investigation. [score:1]
[1 to 20 of 33 sentences]
22
[+] score: 172
Furthermore, gene expression analysis of metastatic versus non-metastatic isogenic cell lines indicated that miR-145 targets involved in cell cycle and neuregulin pathways were significantly down-regulated in the metastatic context. [score:8]
Pathway analysis of these differentially expressed genes identified the G1/S cell cycle checkpoint and neuregulin pathways as being significantly down-regulated in SW620 compared to SW480 cells thus providing an explanation as to why miR-145 has oncogenic effects in the metastatic context in contrast to tumor suppressor effects in the non-metastatic setting. [score:7]
Bioinformatic analysis provided insight into the biological pathways controlled by miR-143 and miR-145 and comparison of gene expression profiles has indicated that miR-145 targets are differentially expressed between metastatic and non-metastatic isogenic cell line mo dels. [score:7]
The expression of these genes may therefore be related to the tumor suppressor effects observed in non-metastatic cells, while their absence in SW620 cells may cause miR-145 to act on other, yet to be determined, anti-proliferative signaling targets. [score:7]
When this analysis was performed specifically for miR-145 and miR-143 targets, no significant overlap of pathways was found indicating that the two co-expressed miRNAs target different biological pathways, possibly explaining the opposing phenotypes observed. [score:7]
Expression levels of 12% (55/450) of the predicted miR-145 target mRNAs were found to be significantly different between these cell lines. [score:5]
The first study showing de-regulation of miRNAs reported the down-regulation of miR-143 and miR-145 as early as the pre-adenomatous polyp stage, suggesting a possible role for these miRNAs in early stages of CRC [24]. [score:5]
Through functional studies, we also show that re -expression of miR-143 or miR-145 leads to tumor suppressor and oncogenic phenotypes in a metastatic CRC mo del, respectively. [score:5]
Over -expression of miR-143 and miR-145 has previously been shown to result in a tumor suppressor effect in non-metastatic CRC cell lines [21, 27, 32]. [score:5]
Moreover, the G1/S cell cycle checkpoint (represented by MYC and CCND2) and neuregulin (represented by MYC and ADAM17) pathways that are targeted by miR-145, were found to be significantly under-expressed in the metastatic setting. [score:5]
To confirm that the changes in SW620/miR-145 cells were due to miR-145 expression we performed miR-145-specific 2'O-methyl (2'Ome) antisense RNA knock down experiments. [score:4]
Our observation that miR-143 and miR-145 were down-regulated in CRC confirmed earlier reports [21- 25]. [score:4]
Other deregulated miR-145 targeted pathways included axonal guidance signaling and the ERK/MAPK pathways. [score:4]
A set of 22 miRNAs were found to be differentially expressed between normal and early stage (mostly stage II) CRC including increases in miR-21 and miR-224 and decreases in miR-133a and miR-145 (Table 2). [score:3]
Indeed previous reports have shown that miR-145 leads to a tumor suppressor effect in non-metastatic CRC cell lines (DLD1, HCT116, SW480, LS174T) [21, 27]. [score:3]
miRNA fold change location CRC Fragile site* hsa-miR-20a up 13q31.3 gain hsa-miR-19a up 13q31.3 gain hsa-miR-17-5p up 13q31.3 gain hsa-miR-93 up 7q22.1 gain hsa-miR-25 up 7q22.1 gain hsa-miR-31 up 9p21.3 hsa-miR-106a up Xq26.2 hsa-miR-143 down 5q32 loss hsa-miR-145 down 5q32 loss hsa-miR-125a down 19q13.41 gain hsa-miR-1 down 18q12.3 or 20q13.33 loss (18q) or gain (20q)* Summarized from [41- 43] Figure 4 Expression of 14 miRNAs in 8 CRC cell lines and normal colon total RNA. [score:3]
However, we have shown here that the steady state level of miR-145 targets is significantly altered between metastatic and non-metastatic cells. [score:3]
The presence and absence of these pathways in the non-metastatic and metastatic cells may account for the dual tumor suppressor and oncogenic effects of miR-145, respectively. [score:3]
A stable pooled population of SW620 cells expressing detectable steady-state levels of mature miR-145 (designated SW620/miR-145) was generated (Fig. 6A). [score:3]
The pathways targeted by miR-143 and miR-145 showed no significant overlap. [score:3]
MiR-143 and miR-145 consistently displayed reduced expression levels in CRC clinical samples and were undetectable in CRC cell line mo dels. [score:3]
In contrast to the miR-143 tumor suppressor effects, replacing miR-145 activity in the same cells led to an elongated cell phenotype, increased E-cadherin, and increased cell proliferation/metabolism (all consistent with a mesenchymal-like phenotype). [score:3]
We therefore investigated the expression profiles of miR-145 target genes in the isogenically matched SW480 (non-metastatic) and SW620 (metastatic) cell lines [34]. [score:3]
Importantly, our results highlight that delivery of miR-143, in isolation, may be a potential therapeutic modality for CRC, and that a strategy involving over -expression of miR-145 alone should be approached with caution. [score:3]
SW620 CRC cells were stably transduced with miR-143 or miR-145 expression vectors and analyzed in vitro for cell proliferation, cell differentiation and anchorage-independent growth. [score:3]
A total of 100 nM of FAM -labelled 2'O-methyl antisense miR-145 RNA (IDT) was transfected with Lipofectamine 2000 (Invitrogen) into 1.2 × 10 [5 ]SW620 cells expressing miR-145. [score:3]
Over -expression of miR-145 in the presence of sense control RNA resulted in increased cell proliferation in serum, and more markedly in serum-free medium (Fig. 6C and 7B). [score:3]
miRNA fold change location CRC Fragile site* hsa-miR-20a up 13q31.3 gain hsa-miR-19a up 13q31.3 gain hsa-miR-17-5p up 13q31.3 gain hsa-miR-93 up 7q22.1 gain hsa-miR-25 up 7q22.1 gain hsa-miR-31 up 9p21.3 hsa-miR-106a up Xq26.2 hsa-miR-143 down 5q32 loss hsa-miR-145 down 5q32 loss hsa-miR-125a down 19q13.41 gain hsa-miR-1 down 18q12.3 or 20q13.33 loss (18q) or gain (20q)* Summarized from [41- 43] Figure 4 Expression of 14 miRNAs in 8 CRC cell lines and normal colon total RNA. [score:3]
The above data indicated that over -expression of miR-145 leads to an oncogenic phenotype in metastatic CRC cells, the opposite effect of miR-143. [score:3]
In vitro functional studies indicated that miR-143 and miR-145 appear to function in opposing manners to either inhibit or augment cell proliferation in a metastatic CRC mo del. [score:3]
Antisense -mediated suppression of miR-145. [score:3]
Figure 6 Over -expression of miR-145 in SW620 cell line affects cell morphology and proliferation. [score:3]
The depleted RNA was ethanol precipitated and analyzed for miR-145 and U6 snRNA expression by Northern analysis. [score:3]
These results indicated that it was the specific ectopic expression of miR-145 that induced changes in cell differentiation and increased the proliferative potential of this cell line mo del. [score:3]
Genetic network analysis of miR-143 and miR-145 targets. [score:3]
The oncogenic effects of miR-145 were enhanced when cells were grown in serum-free medium suggesting that cell growth factors may affect the activity of miR-145 and/or modify the endogenous activity of pathways targeted by this miRNA. [score:3]
Genetic network analysis of miR-145 targets in metastatic versus non-metastatic cells. [score:3]
We hypothesized that the differential steady state level of mRNA targets between metastatic and non-metastatic cells might result in this observed dual function of miR-145. [score:3]
The observed oncogenic effects of miR-145 were associated with the down-regulation of the G1/S cell cycle checkpoint and neuregulin pathways in the CRC metastatic setting compared to its isogenically matched non-metastatic mo del. [score:3]
However, the commonly deregulated miRNAs included miR-31, members of the miR-17-92 cluster, miR-1, miR-143 and miR145, thereby validating the findings of previous studies. [score:2]
This pathway analysis may explain the observed oncogenic effects of miR-145 in metastatic CRC compared to its reported tumor suppressor effects in the non-metastatic context. [score:2]
MiR-145 was depleted in SW620/miR-145 cells receiving the miR-145-specific 2'Ome antisense RNA but not in the sense control (Fig. 7A). [score:1]
A major distinguishing feature of the SW620/miR-145 cell population was the change from the round single cells of SW620 to elongated cells with extended processes typical of fibroblast-like cells (Fig. 6B). [score:1]
The SW620/miR-145 cells also showed a 50% to 95% increase in cell proliferation/metabolic activity when grown in the presence or absence of serum, respectively (Fig. 6C). [score:1]
Mature miR-145 was detected by Northern analysis in a pooled population of SW620 cells following transfection. [score:1]
However, when antisense miR-145 RNA was transfected into SW620/miR-145 cells there was a reversion of the high proliferative potential of the cells (Fig. 7B). [score:1]
Transfection efficiency of the FAM -labelled 2'O-methyl antisense miR-145 RNA oligonucleotide was conducted in parallel with the depletion experiments. [score:1]
We therefore performed bioinformatic analyses to help elucidate the difference between miR-143 and miR-145 biology. [score:1]
miR-145 has an oncogenic effect in metastatic CRC cells. [score:1]
The level of miR-145 approximated those observed in normal colonic epithelial tissue as determined by U6 snRNA-normalized Northern analysis (Fig. 4 and Fig. 6a). [score:1]
We have now established that miR-145 can also act in this dual manner. [score:1]
We elucidated the opposing phenotypic effects of miR-143 and miR-145 in metastatic CRC cells. [score:1]
Figure 7 Antisense -mediated reversion of miR-145 -induced proliferation. [score:1]
Biotinylated 2'-O-methyl antisense miR-145 RNA or controls were delivered to SW620 using Lipofectamine 2000 (Invitrogen) as detailed in the Supplementary. [score:1]
A total of 100 nM of biotinylated 2'-O-methyl antisense miR-145 RNA (5' AAG GGA UUC CUG GGA AAA CUG GAC 3') (IDT) or the reverse control (5' CAG GUC AAA AGG GUC CUU AGG GAA 3') (IDT) were transfected with Lipofectamine 2000 (Invitrogen) into 2 × 10 [6 ]SW620/miR-145 cells. [score:1]
When treated with miR-145 antisense RNA, a reduction in proliferation was seen in both SW620/vector and SW620/miR-145 pools. [score:1]
To generate stable clones using pSilencer 2.1 (miR-143) and pSilencer 4.1 (miR-145) plasmids, 1-5 × 10 [6 ]SW620 cells were seeded in a single well of a 6-well plate. [score:1]
Therefore miR-145 may be an activator of the transition to a more mesenchymal-like phenotype thus advancing tumor evolution, whereas miR-143 may contribute as a guardian of the epithelial-like state (both consistent with their opposing impacts on the metastatic cell mo del SW620). [score:1]
[1 to 20 of 58 sentences]
23
[+] score: 171
However, this effect seems to be secondary to TNF-α expression rather than a direct miRNA -mediated effect, since PDE3B down-regulation occurred at later time-points (24 h and 48 h) after miR-145 over -expression. [score:9]
The observations that miR-145 over -expression resulted in a time -dependent decrease in ADAM17 mRNA expression as well as a significant increase in the ratio of membrane-bound/soluble TNF-α, suggests that miR-145 may increase TNF-α activity in human adipocytes, at least in part, through inhibition of ADAM17. [score:7]
Since miRNAs are down-regulators of gene expression, there are probably several steps up-stream of NF-κB activation linking miR-145 to TNF-α production which could include one or more negative regulators of NF-κB. [score:7]
In a time-course experiment, ADAM17 mRNA was significantly down-regulated by miR-145 in a temporal manner (Figure 3A) while over -expression of miR-145 lead to a marked increase in the ratio of membrane-bound (26 KDa) vs. [score:6]
Additional experiments demonstrated that there was a positive and highly significant correlation between glycerol release and the levels of TNF-α secretion (Figure 2D) or TNF-α mRNA (Figure 2E) in miR-145 overexpressing adipocytes at 48 h. Recent studies have shown that miR-145 binds to the 3′UTR of ADAM17 mRNA and thereby regulates its expression [21], [25]. [score:6]
Finally, the inhibition of PDE3B gene expression might constitute an additional mechanism through which miR-145 affects adipocyte lipolysis. [score:5]
In miR-145 over -expression experiments, relative values of glycerol, TNF-α secretion and mRNA expression were corrected by transfection efficiency and analysed by linear regression. [score:5]
0086800.g003 Figure 3(A) mRNA expression levels of ADAM17 after miR-145 over -expression at 6 h –12 h –24 h –48 h. presented are obtained from three biological/independent experiments. [score:5]
To test this hypothesis, we attenuated the expression of human fat cell TNFR1, the primary receptor mediating the lipolytic effect of TNF-α in human fat cells [3], alone or in combination with miR-145 over -expression, and assessed effects on basal lipolysis. [score:5]
miR-145 increases HSL phosphorylation at activating residues (but does not change total protein content of HSL) and down-regulates PDE3B. [score:4]
Interestingly, it has recently been shown in human non-adipose cells (renal and hepatic cancer) that miR-145 decreases ADAM17 expression by direct binding to the 3′UTR of the gene [21], [25]. [score:4]
Furthermore, TNFR1 down-regulation attenuated the effect of miR-145 on glycerol release. [score:4]
However, we cannot exclude the possibility that other genes targeted by miR-145 might contribute to regulate TNF-α production as well and/or that miR-145 may also exert TNF-α-independent effects on lipolysis. [score:4]
This indicates that NF-κB induction may be a mechanism through which miR-145 regulates TNF-α expression. [score:4]
ADAM17 is a miR-145 target that regulates TNF-α processing in human adipocytes. [score:4]
Recent studies have shown that miR-145 binds to the 3′UTR of ADAM17 mRNA and thereby regulates its expression [21], [25]. [score:4]
ADAM17 is a miR-145 Target that Regulates TNF-α Processing in Human Adipocytes. [score:4]
MiR-145 was over-expressed in human differentiated adipocytes for 6 h –12 h –24 h –48 h. Cells were harvested for RNA and PDE3B mRNA expression levels were determined. [score:4]
Cells were harvested for RNA and relative miR-145 expression levels were determined. [score:3]
Moreover, since TNF-α induction by miR-145 was not dependent on TNFR1 expression, it is plausible that the TNF-α/NF-κB feedback loop might be mediated via TNFR2 while TNF-α -induced lipolysis is primarily induced via TNFR1. [score:3]
Figure S3 Quantification of PDE3B mRNA levels miR-145 over -expression time-course. [score:3]
Additional experiments demonstrated that there was a positive and highly significant correlation between glycerol release and the levels of TNF-α secretion (Figure 2D) or TNF-α mRNA (Figure 2E) in miR-145 overexpressing adipocytes at 48 h. (A) Human differentiated adipocytes were transfected with mimics miR-145 or Neg. [score:3]
0086800.g005 Figure 5(A) Representative blot of total protein content of PLIN1 after miR-145 over -expression in human differentiated adipocytes for 48 h. PLIN1 protein content was corrected by tubulin as described in experimental procedures. [score:3]
Over -expression of miR-145 for 48 h induced a significant increase in phosphorylation of HSL at activating residues (Ser-552 and Ser-650) (Figure 4A and 4B) but did not alter total HSL protein levels (Figure 4C). [score:3]
Figure S1 Quantification of over -expression of miR-145 in human differentiated pre-adipocytes. [score:3]
0086800.g004 Figure 4(A) Representative blots of protein expression levels of phosphorylated HSL (Ser-552 and Ser-650) and total HSL in human differentiated adipocytes transfected with miR-145 mimics for 48 h. (B) Relative quantification by densitometry of above depicted blots for p-HSL (Ser-552, dark grey; Ser-650, light grey) and (C) total HSL. [score:3]
Importantly, the concentration of TNF-α in conditioned media from miR-26a, let-7d and miR-145 overexpressing cells varied between 0.2 pg/mL (for miR-26a) and 1.1 pg/mL (for miR-145) which is within the physiological concentration interval of TNF-α in the interstitial space of human adipose tissue [27], [28]. [score:3]
MiR-145 Regulates HSL (but not PLIN1) Phosphorylation and PDE3B mRNA Expression. [score:3]
This was observed despite a significant and similar increase in TNF-α mRNA levels in miR-145 over -expressing cells transfected with or without TNFR1 siRNA (Figure 2C). [score:3]
Transfection efficiency showed ∼2×10 [4] fold-change up-regulation of individual miR-145 as compared to control (see Figure S1). [score:3]
Fourth, NF-κB, which stimulates TNF-α transcription in an auto−/paracrine loop, was activated prior to the peak in TNF-α secretion/mRNA expression following miR-145 transfection. [score:3]
MiR-145 over -expression levels were similar at all studied time-points (see Figure S1). [score:2]
MicroRNA-145 enhances the production/release of TNF-α and increases the amount of membrane bound TNF-α via inhibition of ADAM17. [score:2]
Therefore, we investigated whether alterations in ADAM17 expression might be involved in the regulation of TNF-α secretion by miR-145. [score:2]
Second, TNFR1 knock down abrogates miR-145 -induced lipolysis suggesting a causal relationship between the effects of miR-145 and TNFR1 -mediated signaling. [score:2]
Nevertheless, the direct link between miR-145 and NF-κB is not clear at the moment. [score:2]
This fact further emphasizes that the increase in TNF-α production by miR-145 is not only mediated by a direct effects on TNF-α transcription but also probably through an alteration of pre-existing levels within the cell (e. g. TNF-α processing). [score:2]
The TNF-α concentrations in the conditioned media varied between 0.2 pg/mL (for miR-26a) and 1.1±0.2 pg/mL (for miR-145). [score:1]
Seven miRNAs (miR-26a, let-7d, -143, -92a, let-7a, -193a-5p, -193b) significantly decreased while only one (miR-145) significantly increased TNF-α levels in the conditioned media. [score:1]
miR-145 alters TNF-α signaling and induces tightly correlated changes in lipolysis and TNF-α. [score:1]
miR-145 does not affect phosphorylation and protein content of PLIN1. [score:1]
We evaluated whether miR-145 -induced changes of TNF-α (mRNA and protein) were related to increased transcriptional activity of the NF-κB complex by assessing nuclear translocation of p65 following miR-145 over -expression. [score:1]
Several lines of evidence suggest that miR-145 stimulates lipolysis by increasing the endogenous production of TNF-α. [score:1]
We found that three (miR-26a, let-7d and miR-145) of the eleven tested miRNAs had a concordant effect on TNF-α secretion and glycerol release. [score:1]
After appropriate transfection time with mimics of miR-145, in vitro differentiated adipocytes were harvested and nuclear extracts were prepared as described previously [23] with some modifications. [score:1]
Our results suggest that HSL but not PLIN1 phosphorylation is involved in miR-145 stimulated lipolysis through TNF-α at least under the conditions and time-points (48 h) used in this study. [score:1]
This finding would support the hypothesis that the effect of miR-145 on lipolysis is complex, involving several intermediates and complementary interactions between them. [score:1]
The results in Figures 1– 2 indicate that the ability of miR-145 to stimulate adipocyte lipolysis, may be secondary to increased TNF-α production. [score:1]
Cntl/miR-145) for additional 48 h in human differentiated adipocytes. [score:1]
To determine the temporal order of miR-145 effects on lipolysis rate and TNF-α production, we performed a time-course experiment where miR-145 was over-expressed and TNF-α mRNA/protein secretion and glycerol release were measured at several time-points (6, 12, 24 and 48 h) post-transfection (Figure 1B). [score:1]
In order to study the axis miRNA-TNF-α lipolysis more in detail, we selected miR-145 because it was the only miRNA that stimulated both TNF-α and glycerol release. [score:1]
All these events promote lipolysis activation and taken together, suggest that the effects of miR-145 on lipolysis are, at least in part, mediated by the effects on TNF-α. [score:1]
Third, miR-145 -induced effects on adipocyte lipolysis occurred after induction of TNF-α gene and protein secretion. [score:1]
This suggests that the effects of miR-145 on adipocyte lipolysis are preceded by an increased production of TNF-α and that the quantitative effects on glycerol release correlate with TNF-α levels. [score:1]
Human differentiated adipocytes were transfected with miR-145 Mimics and collected at several time-points post-transfection (6 h –12 h –24 h –48 h) as described in material and methods. [score:1]
A significant ∼30% increase in p65 translocation was observed 15 h after transfection of miR-145 mimics (Figure 2A). [score:1]
0086800.g002 Figure 2(A) Human differentiated adipocytes were transfected with mimics miR-145 or Neg. [score:1]
To determine NF-κB activation by miR-145, we used TransAM NF-κB p65 kit from Active Motif (Tokyo, Japan). [score:1]
On average, the pro-lipolytic effects of miR-145 resulted in an approximate 50% increase in glycerol levels in transfection screening (Figure 1). [score:1]
We also measured PDE3B mRNA expression at different time points up to 48 h after transfection with miR-145 mimics (Figure 4D). [score:1]
Cntl and miR-145 -treated adipocytes and its relative quantification graph of three biological/independent experiments. [score:1]
In contrast, we did not observe any effects on PLIN1 phosphorylation status as miR-145 did not induce any shift in the protein bands towards a higher molecular weight. [score:1]
Since it is more feasible to determine mechanisms underlying increased (in contrast to attenuated) basal lipolysis, further studies were focused on miR-145. [score:1]
Statistical differences were analyzed by Student t-test comparing Mimics miR-145 vs. [score:1]
Cntl/miR-145) for additional 48 h. Glycerol release into cell culture medium was determined as an index of lipolysis using a bioluminescence method as described [3] and/or using Free Glycerol Reagent (Sigma Aldrich, St. [score:1]
MiR-145 Alters TNF-α Signaling and Induces Tightly Correlated Changes in and TNF-αNF-κB pathway is an important regulator for TNF-α -induced lipolysis in human adipocytes [6]. [score:1]
[1 to 20 of 66 sentences]
24
[+] score: 166
The miR-145-5p mimic transfection induced mRNA and protein expression of RUNX3, whereas the miR-145-5p inhibitor transfection reduced RUNX3 expression, suggesting that miR-145-5p positively activates RUNX3 expression. [score:9]
The miR-145-5p mimic induced mRNA and protein expression of RUNX3 whereas miR-145-5p inhibitor suppressed mRNA and protein expression of RUNX3 in IHOK(S) and YD15 (Figure 4C and 4D). [score:9]
In our study, to validate whether RUNX3 expression is regulated by targeting of miR-145-5p, miR-145-5p mimic or inhibitor was transfected. [score:8]
To validate whether miR-145-5p modulates RUNX3 expression, three miRNA target prediction algorithms (TargetScan, miRanda, and PicTar) were applied and putative binding sites for miR-145-5p were revealed in the RUNX3-3’UTR (Figure 4B). [score:7]
With miRNA array -based expression analysis, several miRNAs were significantly down-regulated: the five miRNAs with the largest decreases were miR-32-5p, miR-143-3p, miR-145-5p, miR-338-3p, and miR-451a. [score:6]
Only miR-145-5p was consistently down-regulated after Pa-PDT, lending support that miR-145-5p can be a target molecule to enhance PDT efficacy. [score:6]
Our data showed that Bim expression increased with reduced expression of miR-145 and RUNX3 by PDT. [score:5]
The cell lines (IHOK(S) and YD15) showing higher endogenous expression of miR-145-5p revealed higher sensitivity to Pa-PDT than each paired cell line showing lower expression (Figure 2B). [score:5]
Taken together, the miR-145-5p expression enhances PDT efficacy via activating RUNX3 expression. [score:5]
Figure 2Cytotoxicity and by miR-145-5p expression (A) Endogenous expression levels of miR-145-5p in IHOK and OSCC cells using real-time PCR. [score:5]
The miR-145 is able to suppress cancer proliferation, invasion and metastases through suppression of mucin-1[18], RTKN[19], c-Myc[20], and EGFR[21]. [score:5]
Corresponding to miR-145-5p expression, IHOK(S) and YD15 cells showed the highest expression level of RUNX3. [score:5]
Only miRNA-145-5p was consistently down-regulated by Pa-PDT in all cell lines (Figure 1C). [score:4]
RUNX3 regulation by targeting of miR-145-5p (A) Endogenous protein levels of RUNX3 in IHOK and OSCC cells. [score:4]
We found that miR-145-5p was predominantly down-regulated (Figure 1B). [score:4]
Like miR-145-5p, RUNX3 expression was reduced by Pa-PDT. [score:3]
In our results, each pair of cell lines showed a difference in expression of miR-145-5p. [score:3]
The miR-145 has been acknowledged to be a tumor suppressor. [score:3]
For searching the binding region of miR-145-5p in the RUNX3-3’UTR, the “conserved” predictions were used in TargetScan. [score:3]
Ultimately, controlling miR-145-5p expression or activity could contribute to enhanced sensitivity of PDT in oral cancer. [score:3]
Cytotoxicity and by miR-145-5p expression. [score:3]
RUNX3 activation by targeting of miR-145-5p. [score:3]
Before PDT, the cell viability by transfection of a miR-145-5p mimic or inhibitors showed no difference (data not shown). [score:3]
To maximize the beneficial effects of PDT, the expression level of miR-145-5p can be a useful biomarker to predetermine patients’ sensitivity to PDT. [score:3]
Given our results that the expression of miR-145-5p and RUNX3 was reduced by PDT, we could extrapolate that miR-145-5p and RUNX3 may also act as oncogene in oral cancer. [score:3]
However, only IHOK(S) and YD15 cells, which showed higher miR-145-5p expression, had statistically significant differences in (Figure 2D). [score:3]
The overexpression of miR-145-5p strengthens PDT efficacy. [score:3]
To evaluate whether miR-145-5p activates RUNX3 expression, miR-145-5p mimic or inhibitor was transfected into IHOK(S) and YD15. [score:3]
Given the data that apoptotic cell death showed no difference in YD15M after treatment with the miR-145-5p mimic (data not shown), we extrapolate that the metastatic cell lines may interact with different target molecules from its original cell lines, eventuating in different outcome. [score:3]
The miR-145-5p mimic (#MSY0000437) and the miR-145-5p inhibitor (#MIN0000437) (Qiagen, Hilden, Germany) were diluted to a final concentration of 20 nM in 200 μl of culture medium without serum. [score:3]
In particular, expression of miR-145-5p, an apoptosis-related miRNA, was markedly reduced, and treatment with a miR-145-5p mimic enhanced phototoxicity. [score:3]
These data suggested that the higher expression of miR-145-5p exerts the more potent PDT effect. [score:3]
Apoptosis-related proteins, e. g., cleaved forms of caspase-9 and caspase-3, increased after treatment with the miR-145-5p mimic (Figure 3C), confirming that the high expression of miR-145-5p promotes apoptotic cell death in cancer cells by Pa-PDT. [score:3]
We found that enhanced photosensitivity and corresponded to increased expression of apoptosis-related miR-145-5p. [score:3]
To understand the mechanism why miR-145-5p expression enhances PDT efficacy in oral cancer cells, we attempted to see whether miR-145-5p can bind to RUNX3, which was found to be a biomarker to determine the sensitivity of PDT effect in OSCC in our previous study [17]. [score:3]
Regarding that each pair of IHOK cell lines and YD15 and YD15M (a metastatic cell line of YD15) cell lines showed a difference in expression of miR-145-5p, we selected them and examined their cell viabilities. [score:3]
To determine whether miR-145-5p has a major role in the efficacy of PDT, 2 types of IHOK cell lines and 7 oral cancer cell lines were screened for endogenous expression of miR-145-5p (Figure 2A). [score:3]
However, considering context dependency of miRNA function, whether miR-145 may interact with other target sites by PDT should be further illuminated. [score:3]
However, cleaved forms of caspase-9 showed no difference in YD15M after treatment with the miR-145-5p mimic (data not shown). [score:1]
increased in all 4 cell lines after treating a miR-145-5p mimic. [score:1]
In addition, the combined treatment of a miR-145-5p mimic and Pa-PDT elicited higher phototoxicity than the simple treatment of Pa-PDT. [score:1]
Before PDT, the cell viability by transfection of a miR-145-5p mimic showed no difference in all 4 cell lines (data not shown). [score:1]
Figure 4(B) tools were used to predict the binding region of miR-145-5p in the RUNX3-3’UTR. [score:1]
Figure 3Apoptosis induction by combined treatment of miR-145-5p mimic and PDT (A) Cells were transfected with the miR-CONT or miR-145-5p mimic and then treated with Pa-PDT (0.3 μM, 0.5 J/cm [2]). [score:1]
To investigate the downstream pathway causing apoptosis in miR-145-5p-RUNX3 axis, the expression of several apoptosis-related proteins was examined. [score:1]
We also found that Pa -based PDT followed by transfection of a miR-145-5p mimic could significantly increase the induction of apoptosis. [score:1]
Upon treating a miR-145-5p mimic, cell viabilities of all 4 cell lines were significantly reduced (Figure 2C). [score:1]
Induction of apoptosis by combined treatment of miR-145-5p mimic and PDT. [score:1]
[1 to 20 of 48 sentences]
25
[+] score: 159
Other miRNAs from this paper: hsa-mir-93, hsa-mir-143
Lee et al. [22] have used an amplicon system to show that miR-143 and miRNA-145 inhibit the expression of the ICP4 gene at the translational level by targeting the corresponding 3′-UTR in a dose -dependent manner and thus selectively enable HSV-1 mutant replication in prostate cancer cells. [score:9]
miRNA-145 is reportedly down-regulated in various lung cancer tissues [26], which suggests that the 3′-UTR of miRNA-145 might regulate the expression of viral replication genes for selective targeting of tumor cells but not normal tissues. [score:9]
Because miRNA-145 expression in NSCLC cells is lower than that in normal cells, we constructed an miRNA-145 target sequence to regulate ICP27 expression and promoted viral replication in NSCLC cells. [score:8]
We incorporated 4 copies of miRNA-145 target sequences into the 3′-untranslated region of an HSV-1 essential viral gene, ICP27, to create AP27i145 amplicon viruses and tested their target specificity and toxicity on normal cells and lung cancer cells in vitro. [score:7]
Therefore, tumor-specific targeting of oncolytic HSV-1 may be achieved at the translational level by incorporating multiple copies of miRNA-145 target sequences into the 3′-UTR of an essential IE gene such as infection cell protein 27 (ICP27) or infection cell protein 4 (ICP4). [score:7]
Because miRNA-145 expression was down-regulated (see Figure 1) and the AP27i145 HSV-1 was more cytotoxic in NSCLC cells (see Figure 3) than in normal cells, we further investigated whether the replication of AP27i145 correlated with miRNA-145 expression in cells. [score:6]
miRNA-145 is down-regulated in several malignancies including lung cancer [14, 16, 17], colon cancer [18], ovarian cancer [19], and prostate cancer [20, 21], and has been identified as a tumor-suppressive miRNA. [score:6]
miRNA-145 is highly expressed in normal cells, including human umbilical vein endothelial cells (HUVECs) and cells obtained from pneumonia/heart failure associated pleural effusions (PL1 and PL2), but it is significantly down-regulated in human NSCLC cells A549, H460, H838, and H1975 (Figure 1). [score:6]
Furthermore, the relatively higher expression level of miRNA-145 in normal cells significantly decreased the cytotoxicity of AP27i145, which suggests that the 4 copies of the 3′-UTR miRNA binding site sufficiently and selectively inhibit oncolytic HSV-1 replication in normal cells. [score:5]
A strong negative correlation was found between the replication of AP27i145 and miRNA-145 expression in AP27i145-infected cells, confirming that the expression level of miRNA-145 may affect AP27i145 HSV-1 replication in cells. [score:5]
Differential expression of miRNA-145 expressed in various cell lines. [score:5]
Four copies of miRNA-145 complementary target sequences in the 3′-UTR of ICP27 gene may result in restricted replication of virus owing to the high miRNA-145 expression in normal cells. [score:5]
The ICP27 gene, including 4 copies of miRNA-145 complementary target sequences in the 3′-UTR, was controlled by the CMV promoter for expression. [score:5]
miRNA-145 is reportedly down-regulated in lung cancer tissues [23, 24]. [score:4]
In conclusion, this study demonstrates that regulating ICP27 expression with miRNA-145 can control HSV-1 to kill NSCLC cells selectively in vitro. [score:4]
The correlation of AP27i145 replication and miRNA-145 expression was normalized at log 10, and the data were analyzed using SPSS software. [score:3]
Comparisons of cytolytic effects between 5dl1.2 and AP27i145 HSV-1The HSV-1 amplicon AP27i145 was generated by carrying the ICP27 gene under a cytomegalovirus (CMV) promoter with 4 copies of miRNA-145 complementary target sequences in the 3′-UTR. [score:3]
The miRNA-145 expression levels in HUVECs, PL2, A549, H460, H838, and H1975 were 0.376, 0.763, 0.0308, 0.01278, 0.0328, and 0.0392, respectively, relative to PL1 cells. [score:3]
Figure 4 Correlation of miRNA-145 expression and virus replication in normal and NSCLC cells. [score:3]
The data indicated that the AP27i145 HSV-1 replicated highly in NSCLC cells with low miRNA-145 expression. [score:3]
These data indicate that miRNA-145 expression is a biomarker for differentiating normal cells and NSCLC cells. [score:3]
The HSV-1 amplicon AP27i145 was generated by carrying the ICP27 gene under a cytomegalovirus (CMV) promoter with 4 copies of miRNA-145 complementary target sequences in the 3′-UTR. [score:3]
We analyzed the expression of miRNA-145 in normal and NSCLC cells using real-time quantitative RT-PCR. [score:3]
As expected, the expression of miRNA-145 in NSCLC cells was much lower than that in normal cells (see Figure 1). [score:3]
Figure 4 shows the strong negative correlation between the replication of AP27i145 HSV-1 and miRNA-145 expression in AP27i145-infected cells (r = -0.842). [score:3]
We studied the correlation between the replication of AP27i145 and miRNA-145 expression in AP27i145-infected cells. [score:3]
Accordingly, the cytotoxicity of AP27i145 at an MOI of 0.01 in H460 and A549 was significantly more efficient than that in H838 and H1975 (see Figure 3), which is consistent with the lower expression of miRNA-145 in A549 and H460 cells (see Figure 1). [score:3]
Based on this lower miRNA-145 expression pattern in cancer cells, a new class of oncolytic HSV-1 was developed and designated as AP27i145. [score:3]
miRNA-145 expression in normal cells was higher than that in NSCLC cells. [score:3]
AP27i145 replication was inversely correlated with the expression of miRNA-145 in infected cells. [score:3]
These data suggest that the infection of AP27i145 and the lower expression of miRNA-145 lead to considerably stronger oncolysis in NSCLC cells. [score:3]
In principle, this system should also permit unimpeded translation of the ICP27 gene in lung cancer cells and subsequent oncolysis but protect normal cells owing to degradation of the amplicon transcript by miRNA-145. [score:3]
Comparisons of cytolytic effects between 5dl1.2 and AP27i145 HSV-1. Correlation of miRNA-145 expression and AP27i145 replication in cells. [score:3]
In the present study, we investigated the expression of miRNA-145 in normal cells and NSCLC cells and tested miRNA145-regulated ICP27 oncolytic HSV-1 for its capacity to kill NSCLC cells. [score:2]
Expression levels of miRNA-145 in various cell lines were determined using quantitative reverse transcription polymerase chain reaction assay. [score:2]
miRNA-145-regulated oncolytic HSV-1 is a promising agent for the treatment of NSCLC. [score:2]
Expression levels of miRNA-145 were normalized to an internal control (miRNA-93) to obtain ΔCT values, and then all ΔCT values were compared with cells obtained from pneumonia/heart failure associated pleural effusions (PL1) to give -ΔΔCT. [score:2]
Real-time quantification of miRNA-145 using stem-loop RT-PCR. [score:1]
To investigate the level of miRNA-145 expression in normal and lung cancer cell lines, we extracted total RNA with TRIzol® and measured the miRNA-145 expression level using quantitative reverse transcription polymerase chain reaction (RT-PCR). [score:1]
Four copies of miRNA-145 complementary sequences (miRNA-145T) were constructed as described previously [22]. [score:1]
The results of the present study are compatible with those of Lee et al. [22], who reported miRNA-145 -dependent replication of the CMV-ICP4-145T virus in a prostate cancer cell line. [score:1]
The correlation of AP27i145 replication and miRNA-145 expression was normalized at log 10 and calculated using SPSS software. [score:1]
For miRNA-145 quantification, the pulsed reverse transcription (RT) reaction described by Chen et al. [32, 33] was performed to convert all miRNAs into corresponding complementary DNAs in a single RT reaction. [score:1]
[1 to 20 of 43 sentences]
26
[+] score: 156
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-145b
Next, to validate the growth suppression of xenografted tumor by intravesical injection of miR-145, we examined the expression level of miR-145 in xenografted tumors by qRT-PCR and the expression levels of possible miR-145 -targeted genes by analysis. [score:9]
Figure 4 and assessment of protein expression of miR-145 -targeted and related genes in the xenografted tumor samples A. Relative expression levels of miR-145 in xenografted tumors treated with miR-145 or control miR. [score:7]
Also, recently, we found that miR-145 inhibits cell migration through the down-regulation of Fascin-1 (FSCN1), E-cadherin, β-catenin, and catenin δ-1 in various cancer cells [8, 9]. [score:6]
analysis showed that the expression levels of all FSCN1, E-cadherin, β-catenin, and catenin δ-1 were also significantly down-regulated in the miR-145 -treated 253J B-V cells (Figure 1C). [score:6]
Previously, we reported that miR-145 is down-regulated and acts as a tumor suppressor in colon adenomas [2, 3], colon cancers [4], gastric cancers [5], chronic lymphocytic leukemias and B-cell lymphomas [6], several cancer cell lines [7- 9], and of course in bladder cancer cells [10, 11]. [score:6]
analysis showed that the protein levels of miR-145 -targeted genes such as c-Myc, socs7, FSCN1, E-cadherin, and β-catenin were significantly down-regulated (Figure 4B). [score:6]
Recently, we found that ectopic expression of miR-145 induces apoptosis through the down-regulation of c-Myc and socs7 in bladder cancer cells [10, 11]. [score:6]
MiR-145 can reach xenografted tumors by intravesical injection and assessment of protein expression of miR-145 -targeted and related genes in the xenografted tumor samples. [score:5]
In conclusion, the present findings for the first time showed that miR-145 was an effective tumor suppressor miRNA against bladder cancer and that its intravesical delivery effectively inhibited the tumorigenic phenotypes without any adverse effects. [score:5]
As a result, the expression level of miR-145 in 253J B-V cells was markedly down-regulated compared with that in normal human urothelial cells (HUC; Figure 1A). [score:5]
Expectedly, the expression level of miR-145 was significantly up-regulated in the xenografted tissues compared with that in the control group (Figure 4A). [score:5]
Moreover, we found that down-regulation of miR-145, which is caused by extracellular disposal via microvesicles, is related to 5-FU resistance in colon cancer cells [13]. [score:4]
Exogenous miR-145 induces apoptosis in and inhibits cell migration of 253J B-V cells. [score:3]
To avoid serious general side effects, bladder instillation is an apparently better way for microRNA to reach diseased tissue, where bladder cancer arises from the epithelial lining even in liposome-encapsulated miR-145. [score:3]
These results underscore complementary roles of the PI3K/Akt and Erk1/2 pathways for bladder cancer proliferation and motility in vitro and raise implications for a solid inhibitory effect of these signaling pathways induced by intra-vesical miR-145 in vivo. [score:3]
Intravesically administered miR-145 inhibits orthotopic bladder tumor growth in vivo. [score:3]
A. Relative expression levels of miR-145 in HUC and 253 J B-V cells. [score:3]
Figure 3Intravesically administered miR-145 inhibits orthotopic bladder tumor growth in vivo A. Schema of our mouse orthotopic bladder cancer mo del. [score:3]
C. Expression of various proteins estimated by Western blot analysis at 48 h after transfection of 253 J B-V cells with miR-145. [score:3]
As shown in Figure 2B, the ectopic expression of miR-145 significantly decreased cell migration of 253J B-V cells approximately 30%. [score:3]
To examine the growth inhibitory effect of miR-145 on in vivo growth of bladder tumors, we used our mouse mo del bearing 253J B-V bladder xenografted tumors that had been established by transplanting the tumor cells orthotopically in the bladder wall of nude mice [14, 15] (Figure 3A). [score:3]
As a result, miR-145 significantly inhibited the tumor growth of orthotopic 253J B-V xenografts when used at a dose of 100 nM (Figure 3B and 3C). [score:3]
A. Relative expression levels of miR-145 in xenografted tumors treated with miR-145 or control miR. [score:3]
Transfection of human 253J B-V cells with miR-145 resulted in a pronounced growth suppression that occurred in a dose -dependent fashion (Figure 1B). [score:3]
Figure 1 A. Relative expression levels of miR-145 in HUC and 253 J B-V cells. [score:3]
Furthermore, we showed an additional anti-tumor mechanism, i. e., suppression of compensatory molecular pathways, by continuous intravesical instillation therapy with miR-145 achieved with 8 periods of administration (Figure 4B) as opposed to the increased activity of these compensatory pathways found in vitro (Figure 1C). [score:3]
These analyses demonstrated that transfection with miR-145 was an effective way to accomplish growth suppression in 253J B-V cells. [score:3]
B. Effects of ectopic expression of miR-145 on cell viability. [score:3]
When compared with the untreated group, the mice treated with miR-145 showed 76% inhibition of tumor growth (Figure 3B and 3C, P = 0.0021). [score:2]
To determine the expression levels of miR-145, we conducted quantitative RT-PCR (qRT-PCR) by using TaqMan MicroRNA Assays (Applied Biosystems) and THUNDERBIRD Probe qPCR Mix (TOYOBO Co. [score:2]
MiR-145 acts as a tumor suppressor in 253 J B-V cells. [score:2]
We concluded that 253J B-V cells would be suitable for validating the anti-tumor effects of miR-145 in our mouse orthotopic human bladder cancer xenograft mo del. [score:1]
Firstly, however, we examined the in vitro anti-tumor effects of miR-145 on 253J B-V cells, as previously observed in various cancer cells including bladder cancer ones [8- 11]. [score:1]
MiR-145 is one of the representative anti-oncomiRs in various cancers. [score:1]
The mature type of miR-145 (mirVana™ miRNA mimic; Ambion, Foster City, CA, USA) was used for the transfection of the cells, which was achieved by using cationic liposomes, Lipofectamine™ RNAiMAX (Invitrogen), according to the manufacturer's Lipofection protocol. [score:1]
Therefore, we examined 253J B-V cells by analysis and after transfection of them with miR-145. [score:1]
In this current study, we validated whether miR-145 would have anti-tumor effects in a xenografted mouse. [score:1]
These findings suggested that miR-145 has the potential to be an anti-cancer drug against various cancers including bladder cancer. [score:1]
Likewise, miR-145 given this way will mainly affect the cells lining the inside of the bladder, with little to no effect on cells elsewhere. [score:1]
Synthetic miR-145 (100 nM) complexed with 100 μl of Lipofectamine [TM] RNAiMAX reagent (Invitrogen) was added to 50 μl of PBS and delivered 8 times intravesically every other day. [score:1]
The sequence of the mature type of miR-145 used in this study was 5′-GUCCAGUUUUCCCAGGAAUCCCUU-3′. [score:1]
A. Hoechst 33342 staining at 48 h after transfection of 253 J B-V cells with miR-145 at a concentration of 20 nM. [score:1]
Thus we propose that the use of miR-145 by the intravesical approach can become a successful therapeutic strategy for bladder cancer. [score:1]
Therefore, we regard that miR-145 therapy would be more suitable for patients when we consider the side effects. [score:1]
Also, to further enhance the anti-tumor effects, we are making chemically -modified miR-145 that can possibly be given in its naked form. [score:1]
The effects manifested by the introduction of miR-145 into the cells were assessed at 48 h after the transfection. [score:1]
These findings taken together suggested that the intravesical administration of miR-145 effectively exhibited its anti-tumor effect in the xenografted tumor through overcoming the serious immunological side effects caused by liposome-encapsulated miRNA. [score:1]
Transurethral administration of miR-145 prevented the intravesical growth of bladder cancer. [score:1]
We conducted intravesical instillation of liposome-encapsulated miR-145 after emptying the residual urine from the bladder. [score:1]
Figure 2 A. Hoechst 33342 staining at 48 h after transfection of 253 J B-V cells with miR-145 at a concentration of 20 nM. [score:1]
Exogenous miR-145 reduces cellular viability of human bladder 253J B-V cells. [score:1]
The concentration of miR-145 was 10 or 20 nM in each experiment. [score:1]
253J B-V cells were seeded into six-well plates at a concentration of 1.0 × 10 [5]cells/well and transfected with miR-145 (10 nM). [score:1]
253J B-V cells were collected at 48 h after transfection with miR-145 (20 nM). [score:1]
Cells (5 × 10 [3]) were plated in 96-well plates for 24 hours and then incubated for 48 hours with or without miR-145 at various concentrations for a total volume of 100 μL. [score:1]
We are comparing the anti-tumor effects between BCG and miR-145 in our mouse mo del now and plan to begin a clinical phase-one trial by using this system in the near future. [score:1]
Hoechst33342 nuclear staining indicated a typical apoptotic appearance such as condensed chromatin and nuclear fragmentation in the miR-145 -treated 253J B-V cells (Figure 2A). [score:1]
We consider that clinical application of miR-145 therapy may be realized in the near future by combining present knowledge with new techniques. [score:1]
B. The anti-tumor effect of miR-145 was analyzed after intravesical administration of miR-145 to established 253 J B-V tumors. [score:1]
Once tumors had developed (average volume 70 mm [3]), they were treated with 8 intravesical injections of miR-145. [score:1]
In this study, we showed that miR-145 could reach xenografted tumors by intravesical injection and have anti-tumor effects in our mouse mo del. [score:1]
These findings taken together suggested that miR-145 had the same anti-tumor effects in 253J B-V cells as previously found in other cancer cells [8, 9, 11]. [score:1]
Now, we are comparing the anti-tumor effects between BCG and miR-145 therapy in our mouse mo del (Figure 4C). [score:1]
[1 to 20 of 63 sentences]
27
[+] score: 152
We designated the median miR-145 expression as a cutoff point, and the 92 LAC patients were divided into two groups according the miR-145 expression in tumors: a high miR-145 expression group (n = 46) and a low miR-145 expression group (n = 46). [score:9]
To explore the epigenetic mechanism regulating miR-145 in LAC, we compared the expression of miR-145 in three LAC cell lines before and after the treatment of 5-aza-CdR and found that de-methylation treatment induced remarkable miR-145 expression recovery, indicating hyper-methylation plays an important role in the regulation of miR-145 gene expression in LAC. [score:8]
Down-regulated miRNA145 exhibited oncogenic or tumor suppressor properties by regulating multiple mRNAs, highlighting a powerful mechanism for the regulation of tumorigenesis in LAC. [score:8]
Down-regulated expression of miR-145 predicts poor prognosis in LAC patients. [score:6]
As expected, the results revealed that miR-145 expression is commonly down-regulated in LAC tissues in association with increased DNA methylation, which was further confirmed in a large cohort from TCGA database. [score:6]
Aberrant CpG methylation down-regulates the expression level of miR-145 in LAC. [score:6]
Picking the methylation level as x-axis and miR-145 expression as y-axis, a significant negative correlation between the miR-145 expression and methylation levels was observed (Spearman r = −0.7272, p < 0.001; Fig. 1D). [score:5]
Our previous studies also demonstrated that miR-145 suppressed the tumorigenesis and EMT process of LCICs by targeting Oct4 13 14. [score:5]
As shown in Fig. 1A, pretreatment with 5-aza-CdR in LAC cell lines (A549, H1975 and Spc-A-1) for 3 or 7 days led to remarkably elevated miR-145 expression, indicating that there was a reverse correlation between DNA methylation and miR-145 expression. [score:5]
tw) revealed that miR-145 is commonly down-regulated in human LAC accompanied by increased DNA methylation of its 300-upstream region (Fig. 2B). [score:4]
As far as we knew that miR-145 was firstly reported to be down-regulated owing to DNA methylation in LAC in our present study. [score:4]
Taken together, these data indicated that DNA hyper-methylation in the upstream region of miR-145 might play an important role in the down-regulation of miR-145 in LAC. [score:4]
As a pluripotency repressor, miR-145 directly targets and silences OCT, SOX2 and KLF4 in human embryonic stem cells (ESC), which are required for self-renewal and pluripotency 29. [score:4]
Data from TCGA database confirm that DNA methylation is a common mechanism of miR-145 down-regulation in LAC. [score:4]
Therefore, the data from our LAC samples, as well as external LAC cohort (n = 482) at TCGA database, strongly support the point that DNA methylation is a common mechanism of miR-145 down-regulation in LAC. [score:4]
In comparison, the upstream mechanism of which miR-145 was down-regulated in LAC still remained less well understood. [score:4]
As shown in Fig. 3C,D, patients with lower miR-145 expression exhibited poor OS (HR = 2.128, P = 0.004) and DFS (HR = 2.182, P = 0.003). [score:3]
Lower miR-145 expression was also correlated with advanced TNM staging (P = 0.025, P = 0.015, P = 0.032, respectively, Fig. 3B). [score:3]
Relationship between miR-145 expression and their clinic-pathologic parameters in 92 of NSCLC patients. [score:3]
The univariate and multivariate analysis further revealed that miR-145 expression level was an independent risk factor for both OS and DFS in LAC patients (Fig. 3E,F and Tables 3 and 4). [score:3]
MethHC revealed that expression of miR-145 was negatively correlated with DNA methylation of its 300-upstream region. [score:3]
miR-145 expression level might serve as a novel prognostic biomarker in LAC. [score:3]
The group with the lower expression of miR-145 also displayed shorter OS and DFS rates (OS: HR = 1.787, 95% CI = 1.021–3.128, p = 0.042; DFS: HR = 1.833, 95% CI = 1.048–3.206, p = 0.034). [score:3]
Data from TCGA database validates that miR-145 expression is associated with DNA methylation in human LAC. [score:3]
Expression levels of miR-145 were detected by ISH with probes (Exiqon, Vedbaek, Denmark). [score:3]
In situ hybridization (ISH) analysis Expression of miR-145 in 92 pairs of LAC tissues were detected by ISH with probes for miR-145 (Exiqon, Vedbaek, Denmark). [score:3]
As shown in Table 2, correlation regression analysis indicated that expression of miR-145 was negatively correlated with differentiation (P = 0.011), lymph node metastasis (P = 0.003), pleural invasion (P = 0.035) and TNM staging (P = 0.029). [score:3]
A linear regression was performed to infer the correlation between the methylation percentage and expression of miR-145. [score:3]
The results also provided the possibility that miR-145 expression might be used to design optimal treatment for LAC patients, for instance, distinguishing locally advanced LAC patients who would benefit much from surgery. [score:3]
Expression of miR-145 in 92 pairs of LAC tissues were detected by ISH with probes for miR-145 (Exiqon, Vedbaek, Denmark). [score:3]
Aberrant hyper-methylation of the CpG sites silences the expression of miR-145 in LAC. [score:3]
MiR-145 expression in the lymph node metastasis (stage N1-2) and pleural metastasis groups were remarkably lower than those in the non-metastasis groups. [score:2]
As shown in Fig. 3A, we observed that well differentiated LACs showed higher miR-145 expression, as compared with those in poorly differentiated LACs samples. [score:2]
In conclusion, our present study demonstrates that miR-145, which is regulated by DNA methylation, might be a valuable prognostic marker in LAC patients. [score:2]
Meanwhile we investigated the correlation between mean methylation levels and miR-145 expressions in LAC. [score:1]
In consideration of the limited sample size of our study, we tried to dig into the newly available TCGA database for LAC to evaluate whether the depressed miR-145 expressions are in association with elevated DNA methylation. [score:1]
Slides were hybridized with 1000 nmol/L miR-145 probe in a hybridization buffer for 20 min at 50 °C then washed with SSC buffers. [score:1]
The intensity of miR-145 staining was scored by 0–2, according to the standards of 0–0.5 (weak staining), 0.5–1.5 (medium staining) and 1.5–2 (strong staining). [score:1]
Based on these results, miR-145 might serve as a potential prognostic marker during the follow up of LAC patients. [score:1]
Subsequently, DNA methylation level of 13 CpG sites (which were divided into 10 CpG units) upstream of the miR-145 gene location were assessed using Sequenom EpiTYPER MassArray in 20 paired LAC and their matched para-tumor tissues. [score:1]
The down-stream mechanisms of miR-145 altering cellular processes were partially confirmed in several published studies. [score:1]
As depicted in Fig. 2A, miR-145 is located in chr5:148810209-148810296. [score:1]
How to cite this article: Xia, W. et al. DNA methylation mediated silencing of microRNA-145 is a potential prognostic marker in patients with lung adenocarcinoma. [score:1]
The Sequenom MassARRAY platform (CapitalBio, Beijing, China) was used for quantitative analysis of miR-145 methylation. [score:1]
TCGA database included methylation status of three CpG sites in the 5′ end of miR-145 (cg11671363, cg22941668, cg08537847), which are also parts of our assessed 13 CpG sites (Fig. 2A). [score:1]
Moreover, Kaplan-Meier survival analysis and multivariate analysis revealed that reduced miR-145 level in LAC tumors was an independent predictor of shorter OS and DFS. [score:1]
The associations between clinical characteristics and miR-145 expressions were analyzed by the chi 2 test. [score:1]
Importantly, the novel finding in our present study was that decreased miR-145 level correlated with poor differentiation, lymph node metastasis, pleural invasion, and advanced TNM staging in LAC. [score:1]
In addition, we assessed the DNA methylation status of 13 CpG sites upstream of miR-145 using MassARRAY -based quantitative methylation analysis in 20 paired LAC and adjacent normal samples. [score:1]
[1 to 20 of 49 sentences]
28
[+] score: 148
Given our observation of significant downregulation of miR-143 and miR-145 and upregulation of miR-223 in cells treated with 3.5 mM Pi, we used RT-qPCR to determine the expression levels of representative VSMC phenotypic marker genes - most of which are targeted by these miRNAs [8], [10]. [score:11]
Elevated Pi significantly downregulates expression of miR-143 and miR-145 and upregulates miR-223. [score:9]
These changes were evidenced by significant downregulation of miRNA-143 (miR-143) and miR-145 and concomitant upregulation of their targets and key markers in synthetic VSMCs, such as Krüppel-like factors−4 and −5 and versican. [score:9]
In contrast, some of the synthetic phenotypic markers (such as Krüppel-like factor 4 [KLF4], KLF5, platelet derived growth factor receptor-α [PDGFR α] and versican [VSCN]) which are all targeted by miR-143 and/or miR-145 [7] were significantly upregulated; this was expected, given the observed downregulation of the corresponding miRNAs (Figure 2A). [score:9]
Furthermore, downregulation of miR-143 and miR-145 in the presence of high Pi implies the upregulation of their targets (such as KLF4, KLF5, PDGFRα and VSCN). [score:9]
To complement these in vitro findings, we also observed significant downregulation of miR-143 and miR-145 and upregulation of miR-223 in aorta samples collected from ApoE knock-out mice, which display vascular calcification. [score:8]
miR-143 and miR-145 are downregulated and miR-223 is upregulated in ApoE- KO mice. [score:7]
Our in vivo results in a well-established murine mo del thus reflected our in vitro findings, i. e. downregulation of miR-143 and miR-145 and upregulation of miR-223 in the presence of calcium-Pi deposits. [score:7]
Evidence from our studies suggests that Pi alters cell proliferation and migration, reduces the amount of the actin cytoskeleton, downregulates miR-143 and miR-145 and upregulates miR-223. [score:7]
Here, we showed that high Pi treatment results into downregulation of SMαA and MYO, with a concomitant downregulation of miR-143 and miR-145. [score:7]
There was significant downregulation of miR-143 and miR-145 and concomitant upregulation of miR-223 in 20-week-old ApoE- KO mice. [score:7]
These events affected downstream processes by reducing the size of the actin cytoskeleton, disturbing cell morphology, upregulating miR-143 and miR-145 targets and, ultimately, leading to increased calcification and a greater VSMC migration rate. [score:6]
The expression of miR-143 and miR-145 was also downregulated in Pi -treated cells. [score:6]
The latter authors also determined that expression levels of miR-143 and miR-145 are low in the aortas of apolipoprotein E gene knockout (ApoE- KO) mouse. [score:4]
MiR-143 and miR-145 (the most extensively studied species) have been correlated with human cardiovascular diseases, since VSMC maintenance and vascular homeostasis are altered in mir-143 and mir-145 knock-out (KO) mice [8]. [score:4]
Interestingly, we also found that miR-143 and miR-145 are downregulated in vivo in the aortas of ApoE- KO mice. [score:4]
Here, we expanded on Elia et al. results by finding that downregulation of miR-143 and miR-145 in mouse aortas was not detected in younger mice but became significant in 20-week-old mice (which also display vascular calcification [23]). [score:4]
We found significant downregulation of the vascular miRNAs miR-143 and miR-145 and a number of contractile phenotypic marker genes, such as MYO and SMαA [7]– [10]. [score:4]
MiR-143 and miR-145 negatively regulate the expression of many genes that are specific for the VSMC synthetic phenotype [7], [10]. [score:4]
RNAs extracted from mouse aorta collected from 8- and 20-week-old ApoE- KO and wild-type mice were used for the qPCR expression analysis of miR-143, miR-145 and miR-223. [score:3]
Expression of miR-143, miR-145 and miR-223 in wild-type and ApoE- KO mice. [score:3]
Additionally, a detailed study by Cordes et al. [10] showed that miR-145 can direct the fate of smooth muscle and regulate the synthetic phenotype of smooth muscle cells. [score:3]
There was a significant downregulation (20–25%) of both miR-143 and miR-145 in 3.5 mM Pi treated cells, when compared with control cells (Figure 1E). [score:3]
0047807.g006 Figure 6 RNAs extracted from mouse aorta collected from 8- and 20-week-old ApoE- KO and wild-type mice were used for the qPCR expression analysis of miR-143, miR-145 and miR-223. [score:3]
As observed with VSMCs in culture, the expression levels of both miR-143 and miR-145 were significantly lower in ApoE- KO mice than in WT mice. [score:3]
We thus investigated the expression of miRNAs miR-143 and miR-145 in the presence of high Pi. [score:1]
Lastly, we sought to study the fate of miR-143, miR-145 and miR-223 under in vivo vascular calcification conditions. [score:1]
Our results suggest that miR-143, miR-145 and miR-223 are potential biomarkers of vascular calcification. [score:1]
In our in vitro and in vivo mo dels, we confirmed the previously described impacts of miR-143 and miR-145 on normal and pathological cardiovascular events. [score:1]
[1 to 20 of 29 sentences]
29
[+] score: 146
Other miRNAs from this paper: hsa-mir-1-2, hsa-mir-126, hsa-mir-149, hsa-mir-1-1
In this study, we demonstrate that miR-145 in bladder cancer cells down-regulates syndecan-1 expression, inhibits cell proliferation by inducing senescence, and promotes differentiation into glandular, squamous, and neuroendocrine cells. [score:8]
Finally, expression of miR-145 was down-regulated in high-grade urothelial carcinomas, but not in low-grade tumors. [score:6]
indicate that miR-145 suppresses syndecan-1 and, by this mechanism, up-regulates stem cell factors and induces cell senescence and differentiation. [score:6]
b,c,d mRNA expression of squamous markers (p63, TP63 and cytokeratin 5 : b, glandular markers (MUC-1, MUC-2 and MUC-5 AC : c and neuroendocrine markers (NSE and UCHL-1 : d was increased under conditions of miR-145 overexpression in T24 cells. [score:5]
miR-145 appears to be a tumor suppressor, the expression of which is reduced in various carcinomas including colon, lung, prostate, and breast cancer [34– 37]. [score:5]
b Syndecan-1 mRNA expression was suppressed by transfection of miR-145 precursor. [score:5]
Overexpression of miR-145 induced cell senescence, and thus significantly inhibited cell proliferation in T24 and KU7 cells. [score:5]
However, our data show that miR-145 overexpression induces E-cadherin, but not p53, and that miR-145 is more abundantly expressed in low-grade urothelial carcinomas than in high-grade cancers. [score:5]
For example, miR-145 has been found to inhibit cancer cell growth, invasion, and metastasis by suppressing EGFR and NUDT1 in lung adenocarcinoma, FSCN-1 in esophageal squamous cell carcinoma, N-cadherin in gastric carcinoma, and IGF in hepatocellular carcinoma [38– 41]. [score:5]
Fig. 3 a mRNA expression of stem cell markers (SOX2, NANOG, Oct4, and E2F3) was increased but not CD44 under conditions of overexpression of miR-145 in T24 cells (Left panel). [score:5]
Figure  1a shows that miR-145 overexpression significantly suppressed cell proliferation. [score:5]
Taken together, the data suggest that miR-145 regulates cell proliferation and differentiation in urothelial carcinoma cells by down -regulating syndecan-1 while up -regulating some stem cell markers. [score:4]
We found miR-145 to regulate expression of syndecan-1, a heparin sulfate proteoglycan. [score:4]
miR-145 also up-regulated markers of differentiation into squamous (p63, TP63, and CK5), glandular (MUC-1, MUC-2, and MUC-5 AC), and neuroendocrine cells (NSE and UCHL-1). [score:4]
Moreover, miR-145 and syndecan-1 were found to be up-regulated in low-grade urothelial carcinoma, but not in high-grade tumors. [score:4]
Fig. 4Expression of miR-145 in urothelial carcinoma tissues. [score:3]
In addition, miR-145 induces expression of stem cell markers such as SOX2, OCT4, NANOG, and E2F3. [score:3]
As reduced E-cadherin expression is associated with high-grade, invasive carcinomas, and correlates with poor prognosis [21, 22], the data indicate that miR-145 facilitates differentiation into various cell types, but not invasion. [score:3]
Thus, miR-145 is a potential diagnostic or prognostic marker, as well as a target for therapy. [score:3]
In the current study, miR-145 provided to suppress cell proliferation and reverse urothelial carcinomas to the pluripotent cells with stem cell features through induction of senescence, then prompted differentiation to multiple lineages such as squamous, glandular and neuroendocrine cells. [score:3]
Together with these observations, miR-145 provides the basis for differentiation into multiple cell types, and for suppression of tumor-initiating cells. [score:3]
Analysis of TUR tissue specimens clearly shows that expression of miR-145 is statistically lower in high-grade tumors than in low-grade, non-invasive, or superficially invasive tumors (Fig.   4b). [score:3]
was suppressed by transient transfection of miR-145 precursor. [score:3]
b qRT-PCR analysis of the urothelial carcinoma tissues showed that miR-145 highly expressed in low grade than high grade carcinomas. [score:3]
miR-145 significantly decreases syndecan-1 expression. [score:3]
T24 or KU7 were seeded at a density of 1x10 [4] cells/well and transfected for 72 h with Anti-miR™ miRNA Inhibitor, Pre-miR™ miRNA Precursor (hsa-miR-145, Life Technologies), or 100 ng/L siRNA against syndecan-1. was performed in Lipofectamine RNAiMAX (Life Technologies) according to the manufacturer’s protocol. [score:3]
Expression of miR-145 in clinical bladder cancer tissues. [score:3]
E-cadherin expression was increased, but not p53 under transfection of miR-145 precursor (Right panel). [score:3]
In our experiments, miR-145 expression in the urothelial carcinoma cell lines T24 and KU7 induces cell senescence without apoptosis. [score:3]
miR-145 suppresses cell proliferation in bladder cancer cells. [score:3]
In addition, miR-145 transfection increased mRNA expression of some differentiation markers, including p63, TP63, and cytokeratin 5, which are markers of squamous cells, as well as MUC-1, MUC-2, and MUC-5 AC, which are markers of glandular cells. [score:3]
Therefore, miR-145 may additionally suppress tumors by enhancing cell-cell adhesion through E-cadherin. [score:3]
In vitro results imply that miR-145 is suppressive, and impedes progression of urothelial carcinoma cells. [score:3]
Taken together, the data demonstrate that miR-145 regulates cell proliferation in urothelial carcinoma cells by inducing senescence, but not apoptosis. [score:2]
We first examined whether miR-145 regulates cell proliferation in urothelial carcinoma cells by transfecting the miR-145 precursor into T24 and KU7 cells. [score:2]
miR-145 also induced E-cadherin, but not p53 (Fig.   3a, 1: Figure S1C). [score:1]
These results suggest that miR-145 can be used as a novel molecular marker for histological diagnosis of bladder cancer. [score:1]
Fig. 2 a Morphological comparison of miR-145 precursor transfected T24 cells cultured under adherent conditions. [score:1]
Senescent cells with SA-β-galactosidase activity was significantly induced, on the other hand, apoptotic cells were not increased by miR-145 overexpression (* p < 0.05) miR-145 transfection slightly changed the morphological characteristics of T24 and KU7 cells. [score:1]
In conclusion, miR-145 utilizes syndecan-1 to modulate cell proliferation, re-programming, and differentiation in urothelial carcinomas. [score:1]
A number of recent studies have focused on the role of miR-145 in multiple cellular pathways underlying carcinogenesis. [score:1]
Taken together, miR-145 might contribute to the early step of divergent differentiation for invasive urothelial carcinomas. [score:1]
miR-145 significantly induces NANOG, SOX2, OCT4, and E2F3. [score:1]
We propose that miR-145 may confer stem cell-like properties on urothelial carcinoma cells and thus facilitate differentiation into multiple cell types. [score:1]
Therefore, miR-145 might be a novel marker to accurately detect carcinoma cells in surgical tissue specimens. [score:1]
Similarly, T24 cells transfected with miR-145 precursor for 72 h were harvested and stained with ApopTag Plus Peroxidase In Situ Apoptosis Detection Kit (Millipore Corporation, CA). [score:1]
Papanicolaou stain of T24 cells showed slightly enlarged by transient transfection of miR-145 precursor in T24 cells. [score:1]
[1 to 20 of 47 sentences]
30
[+] score: 146
The level of expression of oncogenic miR-21, miR-221, miR-210 including the tumor suppressor miR Let-7a were found to be consistently up-regulated in TNBC tissues as well as in their corresponding sera and cancer cell lines, MDA-MB-231, MCF-7, whereas miR-145 and miR-195 were regularly downregulated (p<0.001) (Table 2a and 2b, Figs 1A, 2A and 2D). [score:11]
Of six miRNAs, the expression of four miRNAs, miR-21, miR-221, miR-210 and Let-7a were found to be significantly upregulated while the other two miRNAs, miR-195 and miR-145 were downregulated in both paired tumor tissue and sera of triple negative breast cancer patients. [score:9]
A screening approach employing any of these four significantly overexpressed miRNAs individually can still reveal a good but lower diagnostic accuracy when compared to the three upregulated miRNAs (miR-21; miR-221; miR-210) and/or two downregulated miRNAs (miR-195 and miR-145) combined together (Fig 4G–4I). [score:8]
Out of six microRNAs screened, four of them, miR-21; miR-221; miR-210 including the tumor suppressor miR Let-7a were consistently upregulated whereas two miR-145 and miR-195 were regularly downregulated in TNBC tissue as compared to that of adjacent normal tissue (Table 2a). [score:8]
The expression of two miRNAs (miR-195 and miR-145) was found to be significantly downregulated and when we correlated the expression of these two miRs with the above clinicopathological and demographic variables, we also found a good negative correlation. [score:8]
In contrast, the two downregulated miRs (miR-195 and miR-145) showed inverse correlation, (r = −0.464 and r = −0.438, p < 0.0001) for tissue and (r = −0.451 and r = −0.379, p<0.0001) for sera as their expression decreased with the severity of the disease (Fig 3E and 3F). [score:8]
In contrast, the expression of miR-195 and miR-145 in all subtypes of breast cancer showed a consistent and significant downregulated expression which changed inversely as a function of the severity of breast cancer (Table 2a). [score:8]
We find that three oncogenic miRNAs, miR-21, miR-221 and miR-210 were consistently overexpressed while two tumor suppressor miRNAs, miR-195 and miR-145 were always downregulated in paired tumor tissue and sera as well as cell lines of TNBC compared to TPBC or other subtypes of breast cancer. [score:7]
The results showed a significant correlation of the panel of five miRNAs, three over expressed miR-21, miR-221, miR210 and two downregulated miR-195 and miR-145 in the tissues (Pearson’s r = 0.881, r = 0.858, r = 0.748, r = −0.464 and r = −0.438 respectively, p<0.0001) and in their corresponding sera (r = 0.758, r = 0.647, r = 0.767, r = −0.451 and r = −0.379 respectively, p<0.0001). [score:6]
Radojicic et al.,[16] demonstrated overexpression of miR-21, miR-210 and miR-221 while miR-10b, miR-145, miR-205, miR-122a were significantly downregulated in TNBC. [score:6]
The expression of miR-195 and miR-145 was found to be down-regulated in paired serum samples of TNBC patients and the difference was found to be statistically significant (Table 2b; Fig 2B). [score:6]
Also, several target genes of miR-145, such as c-Myc and MMP-11 (matrix metallopeptidase 11) have been identified and its critical role as a tumor suppressor in the p53 regulatory network has been demonstrated [31]. [score:6]
Despite being a tumor suppressor and in contrast to miR-195 and miR-145, miR Let-7a showed increased expression in TNBC tissue and sera and also showed a good correlation with tumor grades (r = 0.629 for tissue and r = 0.668 for sera, p<0.0001). [score:5]
The expression of miR-195 and miR-145 also showed significant decreased expression in these two breast cancer cell lines. [score:5]
The AUC value, sensitivity and specificity of the two downregulated microRNAs, miR-195 and miR-145 are presented in Table 4a and 4b; Fig 4D and 4E. [score:4]
We observed that while miR-21, miR-221, miR-210 and Let-7a were overexpressed as a function of severity of lesion or tumor grade and stage of tissue and paired sera, miR-145 and miR-195 showed down regulation. [score:4]
The combination of two downregulated miRNAs (miR-195 and miR-145) also revealed a good AUC of 0.899 (95% CI: 0.8082 to 0.9873) with an optimal sensitivity of 78% and specificity of 87% (Fig 4I). [score:4]
Even scoring with the two downregulated miRNAs (miR-195 and miR-145), the accuracy was improved with an AUC of 0.899, and 78% sensitivity and 87% specificity. [score:4]
A (miR-21); B (miR-221); C (miR-210); D (miR-195); E (miR-145); F (Let-7a); (G) comparative ROC of all six miRNAs (miR-21; miR-221; miR-210; miR-195, miR-145 and Let-7a); (H) combined ROC of three miRs (miR-21; miR-221 and miR-210); (I) combined ROC of two downregulated miRNAs (miR-195 and miR-145). [score:4]
0158946.g001 Fig 1 (A) The expression level of miR-21, miR-221, miR-210, miR-195, miR-145 and Let-7a in total breast tumour and adjacent normal tissues. [score:3]
We analyzed the expression pattern of a set of six selected microRNAs- miR-21, miR-221, miR-210, miR-145, miR-195 and Let-7a in four subtypes of breast cancer tissues including adjacent normal tissues. [score:3]
0158946.g002 Fig 2(A) Expression level of selected miRNAs (miR-21, miR-221, miR-210, miR-195, miR-145 and Let-7a) in total serum samples from breast cancer patients and healthy individuals. [score:3]
The fold change expression level of miR-195 and miR-145 is presented in Fig 1A which showed a significant decrease as a function of hormone receptor negativity/severity of TNBC (Table 2a; Fig 1B). [score:3]
Although several reports indicate an alteration in expression of miR-21, miR-145, miR-221, miR-195 and Let-7a in a variety of breast cancer types [16, 50– 54] but none is specific to TNBC. [score:3]
The expression of miR-195 and miR-145 also decreased with increasing histopathological grade and clinical stage and all other risk factor associated with TNBC (Fig 1C and S1 Table). [score:3]
Since an altered expression level of six selected microRNAs, miR-21, miR-221, miR-210, miR-145, miR-195 and Let-7a is known to be frequently involved in breast carcinogenesis, these have been examined in paired TNBC tissue and serum samples in comparison to that of adjacent normal tissue margins and normal serum. [score:3]
Reverse transcription as well as Real-Time PCR for miRNA expression analysis was carried out using primers for hsa-miR-21, hsa-miR-221, hsa-miR-210, hsa-miR-195, hsa-miR-145 and hsa-miR-Let-7a and SnRNA U6 was used as a reference control. [score:2]
86 up0.0001 * 27.82±4.52 up0.001 * miR-195 0.78±0.08 down0.007 * 0.41±0.07 down0.001 * 0.27±0.06 down0.001 * 0.14±0.04 down0.001 * miR-145 0.76±0.09 down0.008 * 0.52±0.15 down0.001 * 0.41±0.12 down0.001 * 0.27±0.08 down0.001 * Let-7a 0.67±0.13 down0.001 * 8. 25±1.07 up0.001 * 15.61±1.76 up0.001 * 17.90±2.93 up0.001 * (b) In breast cancer sera (n = 85) miRNA Types TPBC (n = 21) SNBC (n = 20) DNBC (n = 21) TNBC (n = 23) FC±S. [score:1]
9570)p = 0.0004 * miR-210 100% 100% 0.9979 (0.9911–1.000)p < 0.0001 * miR-195 78% 65% 0.6767 (0.5098–0.8437)p = 0.0400 * miR-145 78% 91% 0.8837 (0.7862–0.9812)p < 0.0001 * Let-7a 91% 86% 0.9660 (0.9237–1.008)p < 0.0001 * AUC: Area Under the Curve; CI: Confidence Interval; * Significant. [score:1]
[1 to 20 of 29 sentences]
31
[+] score: 146
Other miRNAs from this paper: hsa-let-7b, hsa-mir-26a-1, hsa-mir-132, hsa-mir-26a-2
Shi et al(27) reported that, in colon cancer cells, miR-145 is directly bound to the insulin receptor substrate-1 (IRS-1) 3′-untranslated region and downregulates IRS-1 protein, inhibiting the growth of colon cancer cells. [score:9]
Specifically, it has been indicated that miR-145 is a tumor suppressor capable of inhibiting tumor cell growth (12) and expression levels of miR-145 have been found to be decreased in human lung adenocarcinoma (13). [score:7]
Overall, these results indicate that, as a tumor suppressor, miR-145 inhibits not only tumor growth but also cell invasion and metastasis, and miR-145 is a promising new therapeutic target for the treatment of various types of cancer, including oral cancer. [score:7]
Upregulation of miR-145 resulted in a suppression of tumor cell proliferation, migration and invasion. [score:6]
Gregersen et al(19) employed a microarray -based approach to identify miR-145 targets in colon cancer cells, and YES and STAT1 were verified as direct miR-145 targets. [score:6]
Downregulated expression levels of miR-145 in oral cancer have been shown previously in a hamster oral squamous cell cancer mo del (22). [score:6]
Microarray analysis of miR-145 -overexpressing PC3 cells showed upregulation of the pro-apoptotic gene, TNFSF10. [score:6]
Studies have shown that miR-145 is closely associated with tumorigenesis and the expression levels of miR-145 have been found to be significantly downregulated in bladder (17), breast (18), colorectal (19), esophageal (20) and gastric cancers (21). [score:6]
A further study (12) showed that miR-145 significantly suppresses cell invasion in MCF-7 and HCT-116 cells, and that miR-145 is also able to suppress lung metastasis in an experimental metastasis animal mo del. [score:5]
In HCT-116 and MCF-7 cells, Sachdeva et al(23) showed that c-Myc is a direct target of miR-145. [score:4]
In addition, the blockade of miR-145 by anti-miR-145 was able to reverse p53 -mediated c-Myc repression, defining a role for miR-145 in the post-transcriptional regulation of c-Myc by p53 and indicating that miR-145 provides a direct link between p53 and c-Myc in this gene regulatory network. [score:4]
In the future, studies of the regulation of target genes by miR-145 in oral cancer TCA8113 cells are likely to continue to identify the action mechanisms of miR-145, which may be significant for the diagnosis and treatment of oral cancer through miR-145. [score:4]
Patients with low intratumoral post-therapeutic expression had a significantly poorer response to neoadjuvant therapy compared with patients with a high expression of miR-145 (25). [score:4]
The miR-145 expression vector (miRNASelect pEP-miR-145) and miRNA negative control vector (miRNASelect pEP-miR-Null) were obtained from Cell Biolabs Inc. [score:3]
This miR-145 -mediated suppression of cell invasion is, in part, due to the silencing of the metastasis gene, mucin 1 (MUC1). [score:3]
These result indicate that miR-145 is involved in the suppression of TCA8113 cell invasion. [score:3]
Expression of miR-145 in hNOK and TCA8113 cells. [score:3]
These data are consistent with previous studies showing decreased miR-145 expression in a variety of malignant tumors. [score:3]
Chen et al also reported that the expression levels of miR-145 declined gradually from the tumorigenesis to the progression stage in prostate cancer (24). [score:3]
Thus, miR-145 is a potential therapeutic target for the treatment of oral cancer. [score:3]
These data are consistent with the hypothesis that miR-145 may serve as a tumor suppressor. [score:3]
Sachdeva et al showed that the expression levels of miR-145 decreased gradually during the transition from normal breast tissue to cancer tissue (23). [score:3]
In the PC3 prostate cancer cell line, Zaman et al(28) found that overexpression of miR-145 by transfection resulted in increased apoptosis and an increase in cells in the G2/M phase. [score:3]
Due to its decreased expression in TCA8113 cells, we hypothesize that miR-145 may be used as a potential biomarker in the early diagnosis of oral cancer. [score:3]
In conclusion, our data indicate that the expression levels of miR-145 in TCA8113 cells are significantly lower than those of hNOK cells. [score:3]
Furthermore, suppression of MUC1 by miR-145 causes a reduction of β-catenin as well as oncogenic cadherin 11. [score:3]
In addition, a previous study by Drebber et al showed that, in patients with advanced colon cancer undergoing neoadjuvant chemoradiotherapy, a significant upregulation of miR-145 in post-therapeutic tumor tissue was noted compared with that in pre-therapeutic tumor tissue. [score:3]
As demonstrated by qPCR, the expression levels of miR-145 in human oral cancer TCA8113 cells were ~50% of those of the hNOK cells (0.342±0.029 vs. [score:3]
As shown in Fig. 1, compared with the blank control, reagent and negative control group cells, the expression of miR-145 in the miR-145 group cells was significantly increased at 48 h following transfection (P<0.05), which continued for at least 96 h (data not shown). [score:2]
miR-145 was also found to play a negative regulatory role in cell growth through RTKN (29), OCT, SOX-2 and KLF4 pathways (30). [score:2]
qPCR analysis indicated that miR-145 expression levels were significantly lower in TCA8113 cells compared with hNOK cells, indicating that miR-145 may be associated with the genesis of human oral cancer. [score:2]
At 24 h following miR-145 transfection, cells were detached by trypsinization and 1×10 [5] cells were seeded into Transwell filters in 100 ml starvation medium. [score:1]
In the present study, the expression levels of miR-145 were investigated in the human TCA8113 oral cancer line and the effect of miR-145 transfection on the proliferation, migration and invasion abilities of TCA8113 cells was determined. [score:1]
Cellular proliferation, migration and invasion abilities in miR-145 -transfected TCA8113 cells were significantly decreased, indicating that miR-145 may participate in oral cancer genesis and progression. [score:1]
The following four groups were established in this study: blank control, reagent (cells treated with transfection reagent), negative control (cells treated with transfection reagent plus pEP-miR-Null) and miR-145 group (cells treated with transfection reagent plus pEPmiR-145). [score:1]
These results indicate that miR-145 may be an important molecular biomarker in early diagnosis and prediction of treatment response and prognosis of tumors. [score:1]
qPCR was used to measure miR-145 expression levels in hNOK and TCA8113 cells. [score:1]
Quantitative PCR (qPCR) of miR-145. [score:1]
Transfection with miR-145 reduces cell migration in TCA8113 cells. [score:1]
However, the role of miR-145 in human oral cancer tumorigenesis remains poorly understood. [score:1]
Transfection with miR-145 decreases cell proliferation in TCA8113 cells. [score:1]
Our observations are consistent with previous studies on the functional roles of miR-145. [score:1]
In the present study, the expression of miR-145 was investigated in the human TCA8113 oral cancer line, and the effect of miR-145 transfection on the proliferation, migration and invasion abilities of TCA8113 cells was also observed. [score:1]
qPCR was performed to validate the transfection of miR-145 in TCA8113 cells. [score:1]
At 24 h following miR-145 transfection, cells were digested with trypsin and the cell density was adjusted to 1×10 [6] cells/ml using serum-free RPMI-1640 medium. [score:1]
TCA8113 cell transfection with miR-145. [score:1]
Transfection with miR-145 reduces the invasive ability of TCA8113 cells. [score:1]
Serum miR-132, miR-26a, let-7b and miR-145 have been reported as potential candidates for novel biomarkers in serous ovarian cancer (26). [score:1]
miR-145 may be a valuable molecular biomarker for the early diagnosis of oral cancer. [score:1]
Validation of miR-145 transfection in TCA8113 cells. [score:1]
Expression levels of miR-145 were evaluated using the comparative threshold cycle method and normalized against U6. [score:1]
However, the role of miR-145 in human oral cancer remains largely unknown. [score:1]
[1 to 20 of 52 sentences]
32
[+] score: 142
In addition, RT-qPCR showed that expression levels of miR-34a -targeted and miR-145 -targeted genes (MDM4, SIRT1, ADAM17, and NEDD9) were downregulated in H9-shcircB and rescued by re -expressing circBIRC6 in H9-circB-res, supporting the notion that circ BIRC6 acts as an miRNA sponge (Supplementary Fig.   7d). [score:12]
Expression of circBIRC6, with mutations in miR-34a and miR-145 binding sites (circB4m), failed to rescue miR-34a -mediated and miR-145 -mediated in vitro differentiation and the decrease of miR-34a -targeted and miR-145 -targeted gene expression levels, further confirming that miRNA– circBIRC6 interactions are necessary for circBIRC6 function (Fig.   6a–d). [score:10]
RT-qPCR demonstrated that expression of circBIRC6-promoted expression of the PATFs, miR-34a, and miR-145 -targeted genes (MDM4, SIRT1, ADAM17, and NEDD9) in hESCs ectopically expressing miR-34a and miR-145. [score:9]
RT-qPCR results showed that overexpression of miR-34a or miR-145 significantly reduced expression of miR-34a target genes (MDM4 and SIRT1) and miR-145 target genes (ADAM17 and NEDD9), thus confirming that miR-34a and miR-145 mimics were functional in hESCs (Supplementary Fig.   7a, b). [score:9]
Among the 95 miRNAs having multiple targeting sites on circBIRC6, miR-34a, and miR-145 have been reported to induce hESC differentiation by directly suppressing the expression of pluripotency -associated genes 18, 19. [score:8]
The reduction in PATFs caused by ectopic expression of miR-34a or miR-145 was accompanied by upregulated expression of the LRTFs Brachyury, GSC, MIXL1, SOX17, SOX1, and PAX6 (Fig.   6b, d), as well as PAX6, Brachyury, and SOX17 proteins (Fig.   6e). [score:8]
It is possible that circBIRC6 may contribute to improving reprogramming efficiency by blocking P53, a major roadblock of pluripotency reprogramming [35], through upregulation of the P53 suppresser MDM2, which is a common target of miR-145 [36]. [score:8]
Accordingly, Northern blotting using probes specific for circBIRC6 showed the downregulation of circBIRC6 expression in differentiated hESCs (Supplementary Fig.   6) and RT-qPCR showed that miR-34a and miR-145 expression levels were lower than that of circBIRC6 in undifferentiated hESCs, but were higher than those of circBIRC6 in differentiated hESC derivatives (Fig.   5g). [score:8]
Furthermore, we showed that circBIRC6 is enriched in the RNA -induced silencing complex (RISC), containing the catalytic subunit AGO2, and promotes the pluripotent state by inhibiting miR-34a -mediated and miR-145 -mediated suppression of NANOG, OCT4, and SOX2 expression. [score:7]
Furthermore, ICC staining showed that circBIRC6 expression results in an increased number of NANOG [+] and OCT4 [+] cells in hESCs ectopically expressing miR-34a or miR-145, and a decreased number of Brachyury [+], SOX17 [+], and PAX6 [+] cells (Fig.   6e), suggesting that circBIRC6 suppresses miR-34a -mediated and miR-145 -mediated hESCs differentiation. [score:7]
Similar to miR-145, miR-34a has also been described as a suppressive factor for reprogramming, and inhibition of miR-34a expression has been shown to enhance reprogramming efficiency [18]. [score:7]
RT-qPCR and immunoblot analyses further showed that overexpression of miR-34a or miR-145 significantly reduced expression of the PATFs (NANOG, OCT4, and SOX2) at both mRNA and protein levels (Fig.   5h, i). [score:5]
Next, we carried out luciferase reporter assays and showed that miR-34a or miR-145 expression significantly reduced the luciferase activity of a reporter containing the complete circBIRC6 sequence appended to the 3′-untranslated region of luciferase (luc-circB), whereas the luciferase activity of luc-circB containing mutated miR-34a and miR-145 binding sites (luc-circBm1-m4) was not noticeably affected (Fig.   5d–f). [score:4]
P-values were determined by two-tailed two-sample t-tests (* P < 0.05; ** P < 0.01; *** P < 0.001) C ircBIRC6 acts as a sponge for miR-34a and miR-145 in hESCsIt is known that circRNAs can act as miRNA sponges to regulate gene expression in different cell types 6, 13, 26. [score:4]
Mechanistically, we found that circBIRC6 suppressed miR-34a -mediated and miR-145 -mediated differentiation by directly interacting with these miRNAs. [score:4]
c, d RT-qPCR analysis of the expression of the indicated c pluripotency -associated genes and d early lineage -associated genes in hESCs transfected with miR-145 mimics, or co -transfected with circBIRC6 minigene construct (miR-145+circB (1 μg or 3 μg)) or co -transfected with circB4m. [score:3]
h RT-qPCR and i immunoblot analyses of the indicated gene and protein expression in hESCs transfected with miR-34a or miR-145 mimics, or scrambled oligonucleotide 3 days post transfection. [score:3]
We then examined whether the expression of circBIRC6 was capable of rescuing the loss of pluripotency and/or in vitro differentiation caused by miR-34a or miR-145 mimics in hESCs. [score:3]
g RT-qPCR analysis of circBIRC6, miR-34a, and miR-145 expression during hESC differentiation. [score:3]
a, b RT-qPCR analysis of the expression of the indicated a pluripotency -associated genes and b lineage -associated genes in hESCs transfected with miR-34a mimics, or co -transfected with circBIRC6 minigene construct (miR-34a+circB (1 μg or 3 μg)) or circBIRC6 minigenes harboring deleted miR-34a and miR-145 binding sites (circB4m). [score:3]
Taken together, these results suggest that circBIRC6 may exert its function through direct interactions with miR-34a and miR-145. [score:2]
Thus, we asked whether circBIRC6 was capable of regulating pluripotency in hESCs through interactions with miR-34a and/or miR-145. [score:2]
Furthermore, our results confirmed that circBIRC6 can interact with and sequester at least two miRNAs, miR-34a and miR-145, to prevent in vitro differentiation. [score:1]
To this end, we transfected 3′ terminal-biotinylated miR-34a and miR-145 mimics into H9-circB, and precipitated RNA transcripts that interact with these mimics by streptavidin beads. [score:1]
The miR-34a and miR-145 mimics or scrambled oligonucleotides (MDBio) were transfected into hESCs using Lipofetamine RNAiMAX (Thermo) at a final concentration of 20 nM. [score:1]
P-values were determined by two-tailed two-sample t-tests (* P < 0.05; ** P < 0.01; *** P < 0.001) To ascertain whether circBIRC6 contributes to pluripotency maintenance by acting as a sponge for miR-34a and miR-145, we transfected hESCs with miR-34a or miR-145 mimics, and examined their impact on hESC status. [score:1]
Collectively, our results support the conclusion that circBIRC6 promotes pluripotency maintenance in hESCs by reducing the activity of miR-34a and miR-145. [score:1]
Fig. 5 C ircBIRC6 interacts with and sequester miR-34a and miR-145. [score:1]
Fig. 6 C ircBIRC6 serves as a sponge for miR-34a and miR-145 in hESC. [score:1]
C ircBIRC6 acts as a sponge for miR-34a and miR-145 in hESCs. [score:1]
P-values were determined by two-tailed two-sample t-tests (* P < 0.05; ** P < 0.01; *** P < 0.001) To ascertain whether circBIRC6 contributes to pluripotency maintenance by acting as a sponge for miR-34a and miR-145, we transfected hESCs with miR-34a or miR-145 mimics, and examined their impact on hESC status. [score:1]
Conversely, miR-34a and miR-145 are known to repress pluripotency -associated genes to promote in vitro differentiation of hESCs 18, 19. [score:1]
e ICC analysis of the indicated pluripotency -associated markers and lineage -associated markers in hESCs transfected with miR-34a or miR-145 mimics, or co -transfected with a circBIRC6 minigene construct (miR-34a+circB or miR-145+circB). [score:1]
c RT-qPCR analysis of circBIRC6 or circCORO1C pulled-down by biotinylated miR-34a or miR-145 mimics in hESCs. [score:1]
d Schematic illustration showing the 3′ UTR of luciferase reporters containing the complete circBIRC6 sequence (luc-circB) or circBIRC6 sequence with deletions of miR-34a (luc-circBm1 and luc-circBm2) or miR-145 (luc-circBm3 and luc-circBm4) binding sites. [score:1]
[1 to 20 of 35 sentences]
33
[+] score: 139
Other miRNAs from this paper: hsa-mir-204
We demonstrated that miR-145 down-regulated a pattern of mesenchymal-like transcription factor (Snail and Slug) and up-regulated epithelial protein (E-cadherin) in AOE cells, were reversed by Oct4/Sox2 overexpression (Figure 6H). [score:9]
miR-145 ablated arecoline -induced cancer stemness and in vivo tumorigenesisMicroRNAs (miRNAs), a class of small noncoding RNAs regulating the gene expression by binding to the 3′ untranslated region (UTR) of target mRNAs, have been involved in cancer stemness and EMT during carcinogenesis [17]. [score:8]
miR-145 directly targets Oct4 and Sox2 and Oct4/Sox2 co -expression mediates miR-145-regulated cancer stemness and EMT. [score:7]
miRNAs microarray analyses identified miR-145, the known tumor suppressive microRNA, is significant down-regulated in AOE cells (Figure 5A). [score:6]
Consistent with the miRNA microarray results, long-term arecoline exposure dose -dependently led to the marked down-regulation of miR-145 expression by miRNA real-time RT-PCR analysis (Figure 5B). [score:6]
However, when the potential Oct4 and Sox2 targeting site was mutated, miR-145 no longer inhibited the luciferase activity (Figure 6B and Figure 6C). [score:5]
miR-145 suppressed spheres-forming capability in AOE cells, which would be rescued by Oc4/Sox2 over -expression (Figure 6E). [score:5]
Furthermore, Oc4/Sox2 over -expression in miR-145 -overexpressing AOE cells partially counteracted clonogenicity (Figure 6F) and invasion phenomenons (Figure 6G). [score:5]
qRT-PCR analysis shows a negative correlation between miR-145 expression and Sox2 mRNA expression in OSCC specimen revealed by linear regression analysis (Figure 7A). [score:5]
A significant inverse correlation between miR-145 expression and Oct4 expression was also found using the OSCC tumor samples (Figure 7B). [score:5]
The formation of soft agar colonies (Figure 5E) and invasiveness ability (Figure 5F) was suppressed in AOE cells after miR-145 over -expression. [score:5]
The expression of miR-145 in OSCC tissues was significantly decreased in the recurrent tumor specimens, while miR-145 expression in primary OSCC tissues was higher relative to the recurrent OSCC tissue (Figure 7C). [score:5]
miR-145 has been found to be key role in suppressing tumor for OSCC development. [score:4]
miR-145 regulated by long-term arecoline treatment targets Sox2 and Oct4. [score:4]
We also found down-regulation of miR-145 in chemo-resistant than in chemo-sensitive OSCC tissues (Figure 7D). [score:4]
Negative correlation of miR-145 and Oct4/Sox2 expression in areca nut -associated OSCC patients. [score:3]
Cells from each stable miR-145 -overexpressing or miR-Scramble cells will injected subcutaneously into BALB/c nude mice (6–8 weeks). [score:3]
Protein levels of Oct4 and Sox2 were also decreased in the miR-145 -overexpressing AOE cells (Figure 6D). [score:3]
To pinpoint the miR-145 target sequences in the 3’UTRs of Oct4 and Sox2, reporter plasmids which contained either full-length or mutated forms of the 3′UTR region of Oct4 and Sox2 were constructed (Figure 6A). [score:3]
To determine significant correlation between miR-145 and Oct4/Sox2, the expression of miR-145 and Oct4/Sox2 among OSCC patients was analyzed by qRT-PCR and Spearman rank correlation tests. [score:3]
qRT-PCR analysis showing miR-145 in long-term arecoline exposed OE cells (B) and theses cells were transfected with miR-145 overexpression vector (C). [score:3]
miRNA real-time RT-PCR analysis confirmed the miR-145 over -expression effect in AOE cells (Figure 5C). [score:3]
Additionally, we found that Oct4/Sox2 stemness genes are targets of miR-145 through its binding to the Oct4 and Sox2 3′-UTR (Figure 6A). [score:3]
miR-145 inhibits cancer stemness in various cancer types, including lung cancer [32], hepatocarcinoma [33], prostate cancer [34], and glioma [35]. [score:3]
miR-145 overexpression plasmid constructs were generated according to our previous methods [9]. [score:3]
The functional involvement of Oct4 and Sox2 in miR-145 -mediated cancer stemness and EMT in AOE cells was further clarified through Oc4/Sox2 overexpression. [score:3]
A significant decrease in miR-145 expression is found in long-term arecoline -treated oral epithelial cells. [score:3]
The sphere-forming ability among the primary, secondary and tertiary spheres was consistently impaired in AOE cells with miR-145 overexpression (Figure 5D). [score:3]
Co-overexpression of Sox2 and Oct4 rescued the repression effect of miR-145 on cancer stemness (Figure 6E–6G). [score:3]
It is also well known that dysregulation of miR-145 has been reported in several human solid tumors [31]. [score:2]
Here, we confirmed that miR-145 negatively regulates cancer stemness in chronic arecoline-exposed OE (AOE) cells. [score:2]
miR-145 ablated arecoline -induced cancer stemness and in vivo tumorigenesis. [score:1]
An inverse correlation can be seen between miR-145 /Sox2 (A) and miR-145 /Oct4 (B) in OSCC patients’ tissues. [score:1]
In vivo recipients of xenografts of AOE cells that received delivery of miR-145 lentivirus exhibited attenuated tumor formation (Figure 5G). [score:1]
Clinical relevance of miR-145 in OSCC patients. [score:1]
miR-145 effectively reverses long-term arecoline treatment -induced cancer stemness in vitro and in vivo. [score:1]
miR-145 might be partial mechanism of areca nut -induced OSCC. [score:1]
To the best of our knowledge, we found that long-term arecoline treatment enhanced the in vitro and in vivo tumorigenicity of OE cells, which could be blocked by miR-145 delivery. [score:1]
Subsequently, we illustrate complementarity between the 3′UTR regions of Oct4 and Sox2 and miR-145. [score:1]
Figure 7An inverse correlation can be seen between miR-145 /Sox2 (A) and miR-145 /Oct4 (B) in OSCC patients’ tissues. [score:1]
The wild-type and mutated (Mut) Oct4 (B) and Sox2 (C) reporter plasmids were co -transfected with miR-145 or empty vector. [score:1]
[1 to 20 of 41 sentences]
34
[+] score: 138
Furthermore, overexpression of miR-145 reduced the protein expression of P-gp as well as inhibited FasL -induced upregulation of P-gp (Figures 6D, 6E and 6F), whereas downregulation of miR-145 promoted P-gp expression and repressed cell apoptosis induced by SN-38 (Supplementary information, Figure S4). [score:15]
We found that Fas activation promoted the chemoresistance in GI cancer through induction of P-gp expression via upregulating nuclear β-catenin and downregulating miR-145 expression. [score:11]
Mitogen-activated protein kinase (MAPK) signaling is deregulated in most cancers and downregulates miR-145 expression via Ras-responsive element -binding protein (RREB1), which directly binds and suppresses miR-145 promoter [40]. [score:10]
In conclusion, our study has demonstrated that, in addition to promoting cancer cell invasion and metastasis, Fas signaling enhances drug resistance by upregulating the expression of ABC transporters, especially P-gp, via increasing nuclear β-catenin through ERK1/2 MAPK-GSK3β signaling axis and downregulating miR-145. [score:9]
Taken together, these data revealed that Fas signaling induces P-gp expression partially through downregulation of miR-145 expression in GI cancer both in vivo and in vitro. [score:8]
miR-145 is downregulated after FasL -induced ERK1/2 activation and inhibits P-gp expression. [score:8]
Recently, several miRNAs including miR-508-5p [18], miR-451 [19], miR-145 [20], miR-298 [21], miR-1253 [21], and miR-338 [21], have been proposed to target the P-gp mRNA 3′UTR and inhibit its translation. [score:7]
To date, lots of miRNAs have been proposed to target the P-gp mRNA 3′UTR and inhibit its translation, such as miR-508-5p [18], miR-451 [19], miR-145 [20], miR-298 [21], miR-1253 [21], and miR-338 [21]. [score:7]
In addition, this pathway upregulates P-gp expression via decreasing miR-145 (Figure 6L). [score:6]
We found that FasL stimulation downregulated miR-145 expression in an ERK1/2 MAPK dependent manner. [score:6]
Additionally, FasL -induced chemoresistance to SN-38 was also inhibited by miR-145 overexpression (Figures 6G, 6H and 6I). [score:5]
miR-145 suppresses P-gp expression through interaction with the 3′UTR of P-gp mRNA. [score:5]
Ectopic overexpression of miR-145 inhibited P-gp 3′UTR luciferase activity and prevented FasL -induced increase of P-gp 3′UTR reporter activity. [score:5]
Among these miRNAs, we found that only miR-145 was downregulated and dependent on FasL -induced ERK1/2 MAPK activation (Figures 6A, 6B and 6C). [score:4]
These results demonstrated that P-gp is a direct target of miR-145. [score:4]
We further validated that P-gp is a direct target of miR-145. [score:4]
The expression of miR-145 decreased smoothly among precancerous samples but sharply in cancer in various stages of CRC (Figure 6J) and GC (Figure 6K; Supplementary information, Tables S1 and S2). [score:3]
Similarly, miR-145 expression was demonstrated significantly decreased in breast, colon, stomach, and bladder cancers and also involved in the progression of these cancers[35– 39]. [score:3]
SW480 (G), DLD1 (H), and AGS (I) stably expressing miR145 precursor or control precursor were seeded in 96-well plate (10000 cells/well) and cultured overnight, and then treated with FasL for 24 hours. [score:3]
To elucidate the functional linkage between miR-145 and P-gp, we detected the expression of miR-145 in fresh GI precancerous and cancer samples by qRT-PCR. [score:3]
A P-gp 3′UTR reporter was transduced into SW480 (D), DLD1 (E), and AGS (F) cells stably expressing either miR-145 precursor or control precursor, and luciferase activity was assessed after treatment with FasL (12 h) and/or U0126. [score:3]
The predicted miR-145 and β-catenin binding sites on P-gp 3′UTR region and promoter were mutated using Quick Change Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA), respectively. [score:2]
Further investigation will be needed to elucidate how Fas signaling regulates miR-145 expression. [score:2]
Moreover, a significantly negative correlation between miR-145 and FasL or P-gp was found in human GI cancer samples. [score:1]
Moreover, miR-145 was negatively correlated with FasL or P-gp according to the ranking by qRT-PCR (Supplementary information, Tables S3 and S4). [score:1]
The miR-145 or control precursors (GeneCopoeia) were stably transfected into SW480, DLD1 and AGS cells. [score:1]
Finally, when the miR-145 binding site (seed sequence) in the 3′UTR region of P-gp was mutated, miR-145 precursor or FasL stimulation couldn't decrease or increase the P-gp 3′UTR reporter activity (Supplementary information, Figure S5). [score:1]
miR-145 levels were determined by qRT-PCR with U6 RNA as internal control. [score:1]
[1 to 20 of 28 sentences]
35
[+] score: 124
A; miR-145 expression in fresh CD34 [+] cells, B; Expression of miR-145 in CD34 [+] cells in the presence of cytokines, C; Expression of miR-145in CD34 [+] cells indirectly cultured on the feeder layer, D; Expression of miR-145 in CD34 [+] cells directly cultured on the feeder layer. [score:11]
Suzuki et al. (18) reported that a central tumor suppressor, p53, enhanced the post-transcriptional maturation of several microRNAs with growth-suppressive function, including miR-143 and miR-145, and miR-16-1. Suh et al. (19) have found that miR-145 is regulated by DNA methylation and p53 gene mutation in some cancers, and p53 increased the expression level of miR-145. [score:9]
There is a new relation between p53 (tumor suppressor gene) and miR-145 (suppressor of cell growth) upregulation. [score:8]
In terms of the tumor suppressive role of miR-145 and p53, reduced expression of these two genes in the present study indicated that ASDCs could cause growth induction by inhibition of apoptosis. [score:7]
p53 significantly downregulated in HSCs cultured on ADSCs, whereas miR-145 significantly upregulated in HSCs cultured on ADSCs. [score:7]
It is well known that p53 upregulates miR-145 expression (12). [score:6]
miR-145 was reported to inhibit various cancers by targeting several protein coding genes such as c-Myc. [score:5]
Tumor suppressor p53 has been shown to direct regulation of a number of microRNAs such as the miR-34 family and miR-145 (17). [score:5]
Improvement of HSCs self-renewal direct cultured on ADSCs is associated with reduced expression of miR-145 and p53. [score:4]
Downregulation of p53 and consequently miR-145 in HSCs could cause increased proliferation of HSC. [score:4]
Analysis of miR-145 expression in fresh CD34 [+] cells by real-time polymerase chain reaction compared to the other groups has shown in Figure 6. Fig. 1Flow cytometry analysis of adipose-derived stem cell (ADSCs), markers showed positive expressions of 98.4% of ADSCs, CD105 [+], 87.3% cells are CD73 [+], 80.5% are CD90 and 0.303% are CD45 positive. [score:4]
Our results showed that the expression of miR-145 and p53 gene on a Thin Cert™ plate with 0.4 μm pore sized groups were lower than HSCs cultured directly on the ASCs feeder layer group. [score:4]
Fig. 4Analysis of p53 and miR-145 expressions by reverse transcription PCR in A, B, C, and D groups. [score:3]
p53 represses c-Myc through induction of the tumor suppressor miR-145 (14). [score:3]
Sachdeva and Mo (6) have reported miR-145 mediated suppression of cell growth, invasion, and metastasis. [score:3]
Human miR-145 is broadly expressed in germline and mesoderm-derived tissues such as the breast (8), ovaries (9), testes, uterus, prostate, heart, and spleen (6). [score:3]
Sachdeva et al. (13) reported suppression of c-Myc by p53 -induced miR-145. [score:3]
Based on these findings, they proposed that as a tumor suppressor, miR-145 might be a valuable biomarker for cancer diagnosis. [score:3]
The results of the present study suggested that suppression of miR-145 of HSCs cultured on ASCs altered the p53 -mediated cell cycle arrest. [score:3]
Real-time polymerase chain reaction (PCR) was used to determine the expressions of the p53 and miR-145 genes. [score:3]
In this study, we have assessed how adipose-derived stem cells (ADSCs) affect the expansion of hematopoietic stem cells (HSCs), as well as miR-145 and p53 expressions. [score:3]
It was reported that in various cancers, miR-145 prevents tumor angiogenesis and metastasis by targeting c-Myc (10, 11). [score:3]
Dong et al. (17) established a new link between p53 and miR-145 in tumor growth regulation and metastasis in ovarian carcinoma. [score:2]
Our findings showed lower expression levels of p53 and miR-145 in HSCs cultured on ADSCs compared to the groups without feeder layers. [score:2]
On the other hand it has been shown that miR-145 is induced during differentiation, and it directly silences stem cell self-renewal and pluripotency (20). [score:2]
Fig. 6Analysis of miR-145 expression in fresh CD34 [+] cells by real-time polymerase chain reaction compared to the other groups. [score:2]
Fresh CD34 [+] cells showed significant increase in miR-145 expression compared to the other groups, and *; P<0.05. [score:2]
Defining the role of ADSCs in controlling the HSC self-renewal through reduced miR-145 and p53 may lead to the treatment and prevention of hematopoietic disorders. [score:1]
The sequences for GAPDH, p53, and MiR-145 are as follows: p53: F: 5′-TCCTCAGCATCTTATCCGAGTG-3́ R: 5́-AGGACAGGCACAAACACGCACC-3 ´ GAPDH: F: 5′-ATGGGGAAGGTGAAGGTCG-3 ´ R: 5 ´-GGGGTCATTGATGGCAACAATA-3 ´miR-145: F: 5′-GTCCAGTTTCCCABGGAA-3′ R: 5́-TGACCCCAGGTAACTCTGAGTGT-3 ´ Data are presented as mean standard deviation (SD). [score:1]
Starczynowski et al. (7) reported that deletion of chromosome 5q in patients with 5-q32-33 syndrome correlated with the loss of miR-145 and miR-146a, two microRNAs frequently observed in HSCs. [score:1]
Although various numbers of microRNAs have been studied in HSCs, there are few reports that pertain to the function of miR-145. [score:1]
In this study, we investigated the expression levels of p53 and miR-145 in HSCs after culture on a feeder layer of ADSCs. [score:1]
The sequences for GAPDH, p53, and MiR-145 are as follows: p53: F: 5′-TCCTCAGCATCTTATCCGAGTG-3́ R: 5́-AGGACAGGCACAAACACGCACC-3 ´ GAPDH: F: 5′-ATGGGGAAGGTGAAGGTCG-3 ´ R: 5 ´-GGGGTCATTGATGGCAACAATA-3 ´miR-145: F: 5′-GTCCAGTTTCCCABGGAA-3′ R: 5́-TGACCCCAGGTAACTCTGAGTGT-3 ´ Data are presented as mean standard deviation (SD). [score:1]
Previous studies have shown the transcriptional induction of miR-145 by p53 in response to anticancer drugs or serum starvation. [score:1]
miR-145 appears to increase proliferation of HSC cultured on ADSCs by impairing p53 function. [score:1]
ADSCs might increase HSCs proliferation and self-renewal through miR-145, p53, and their relationship. [score:1]
In the present research, we have investigated the expression levels of p53 and miR-145 in HSCs after culture on feeder layers of ASDCs. [score:1]
[1 to 20 of 37 sentences]
36
[+] score: 104
Although we observed upregulation of miR-143 and miR-145 in squamous mucosa from individuals with ulcerative oesophagitis, we did not observe altered expression of other miRNAs, miR-21, miR-194 and miR-215, which have previously been shown to be increased in Barrett’s oesophagus mucosa. [score:6]
In support of the proposal that alterations in miR-143 and miR-145 expression occur at an early stage in the development of Barrett’s oesophagus, we also observed positive correlations in expression between miR-143 and CK8, and miR-143 and BMP-4, in the oesophageal mucosa from individuals with ulcerative oesophagitis. [score:6]
This extends our previous observation of elevated miR-143 and miR-145 expression in Barrett’s oesophagus epithelium [15], and suggests that increased expression of these miRNAs occurs prior to the development of Barrett’s oesophagus. [score:6]
Very recently, van Baal and colleagues reported that forced expression of miR-145 in Het-1A squamous oesophageal cells results in reduced cell counts and reduced expression of proliferating cell nuclear antigen [25]. [score:5]
miR-203 and miR-205 are expressed at higher levels in squamous mucosa, and miR-143, miR-145, miR-194 and miR-215 are expressed at higher levels in Barrett’s oesophagus. [score:5]
It is possible that up-regulation of miR-143, miR-145 or miR-205, and the associated anti-proliferative effect, might counterbalance hyperplasia in the basal layer of the oesophageal epithelium. [score:4]
Therefore miR-143, miR-145 and miR-205 may regulate gene expression in the nucleus of oesophageal epithelial cells to exert the effects observed in our study. [score:4]
Previous work from our laboratory which compared normal squamous oesophageal mucosa with Barrett’s oesophagus showed increased expression of miR-21, miR-143, miR-145, miR-194 and miR-215, and decreased expression of miR-203 and miR-205 in Barrett’s oesophagus. [score:4]
However, support for the argument that miR-143 and miR-145 might have a role in promoting the development of Barrett’s oesophagus does not actually require the expression of other columnar miRNAs to be altered in our current study. [score:4]
Interestingly, this group also showed that miR-145 can modulate BMP-4 expression and alter BMP-4 signalling in Het-1A cells, thus providing in-vitro data suggestive of a role for miR-145 in regulating squamous to columnar cell differentiation. [score:4]
Spatial expression of miR-143, miR-145 and miR-205 in oesophageal biopsies. [score:3]
To assess the impact of selected miRNAs on proliferation and apoptosis in oesophageal epithelial cells miR-143, miR-145 or miR-205 were overexpressed in Het-1A cells, a non-neoplastic oesophageal keratinocyte derived cell line [1, 17]. [score:3]
We sought to identify the spatial expression of miR-143, miR-145 and miR-205. [score:3]
Restoring miR-143, miR-145 or miR-205 expression in other cell mo dels has also been shown to reduce cell proliferation and increase apoptosis [20- 24]. [score:3]
These changes in miR-143, miR-145 and miR-205 expression appear to be most pronounced in the basal layer of the oesophageal epithelium. [score:3]
In oesophageal mucosal biopsies from individuals with ulcerative oesophagitis, the expression of miR-143, miR-145 and miR-205 was predominantly most intense in the basal layer of the epithelium (Figure 1). [score:3]
Taken together, these results suggest that miR-143, miR-145 and miR-205 might suppress proliferation or promote apoptosis in the basal layer of the oesophageal epithelium. [score:3]
Endogenous miR-143, miR-145 and miR-205 expression was localised to the basal layer of the oesophageal epithelium. [score:3]
Staining for miR-143 (Figure 1B), miR-145 (Figure 1C) and miR-205 probes (Figure 1D) revealed similar expression patterns, with the most intense staining seen in the basal layer of the epithelium. [score:3]
Due to limited RNA, miR-145 expression was only assessed in ten of the 13 controls. [score:3]
Elevated miR-143, miR-145 and miR-205 expression was observed in oesophageal squamous mucosa of individuals with ulcerative oesophagitis. [score:3]
In ulcerative oesophagitis miR-143, miR-145 and miR-205 staining intensity was greatest in the basal layer of the oesophageal epithelium, and it is possible that these miRNAs might direct anti-proliferative and pro-apoptotic effects within this layer. [score:2]
The expression of miR-143, miR-145, and miR-205 were significantly higher in oesophageal squamous mucosa from subjects with ulcerative oesophagitis compared to squamous mucosa from subjects without pathological reflux. [score:2]
Our study demonstrated elevated miR-143 and miR-145 levels in the oesophageal squamous mucosa from subjects with ulcerative oesophagitis (and without Barrett’s oesophagus) compared to subjects without gastro-oesophageal reflux disease. [score:2]
Figure 2 Normalised median fold increase in miR-143, miR-145 and miR-205 levels at 24 hours after transfection with respective mimics. [score:1]
Cells were transfected with either miR-143, miR-145 or miR-205 mimics or a negative control duplex. [score:1]
Cell numbers at each time point were assessed to compare cell groups transfected with either miR-143, miR-145 or miR-205 with cells transfected with the negative control duplex. [score:1]
In addition RNA was extracted from the transfected cells using TRIzol®, and miR-143, miR-145 and miR-205 levels were assessed in transfected cell lines using the methods described above. [score:1]
Cells were transfected using miRNA mimic or negative control duplexes at 33 nM concentration (miR-143 #2988, miR-145 #8480, miR-205 #3391, negative control duplex #1733 all from GenePharma, Shanghai, China). [score:1]
In-situ hybridisation staining for miR-143, miR-145 and miR-205 appeared to be both nuclear and cytoplasmic. [score:1]
Figure 3 Cell proliferation (A) and apoptosis (B) levels in Het-1A cells 48 h after transfection with miR-143, miR-145 or miR-205. [score:1]
Increasing miR-143, miR-145 and miR-205 activity in Het-1A cells. [score:1]
miRNA levels were increased by transfecting cells with miR-143, miR-145 or miR-205 mimics using the Lipofectamine™ 2000 system (Invitrogen, Mulgrave, Victoria) as per the manufacturer’s protocol. [score:1]
Nuclear staining has been reported for miR-145 [26] in breast myoepithelium, but our study is the first to show nuclear staining for miR-143, miR-145 and miR-205 in the oesophagus. [score:1]
B, C, D and E: Hybridisation with LNA-probes for miRNAs miR-143 (B), miR-145 (C) and miR-205 (D), and LNA -negative control (E). [score:1]
Taken together with our in-vivo observations of elevated levels of miR-145 in squamous oesophageal mucosa from individuals with ulcerative oesophagitis, the data suggest that miRNAs have a real functional role in controlling cellular identity in oesophageal mucosa in the setting of gastro-oesophageal reflux. [score:1]
We observed reduced proliferation and increased apoptosis in the cells following transfection with miR-143, miR-145 and miR-205 mimics. [score:1]
The median fold increase in miR-143, miR-145 and miR-205 levels, 24 hours after transfection, is presented in Figure 2. Figure 3 summarises the effect of elevating miR-143, miR-145 or miR-205 activity in the Het-1A cell line. [score:1]
The pro-apoptotic effects of transfection with miR-143, miR-145 or miR-205 mimics may reflect the physiological apoptotic response observed in the oesophagus following reflux exposure. [score:1]
Our data are consistent with the reported anti-proliferative effect of miR-145, and in addition, demonstrate apoptotic induction as a miR-145 mediated process in oesophageal squamous cells. [score:1]
The LNA-probes used include miR-143 (#38515-15), miR-145 (#38517-15), miR-205 (#18099-15) and miR-SCR (#99004-15). [score:1]
[1 to 20 of 41 sentences]
37
[+] score: 101
miR-145 and miR-195 were commonly downregulated in colorectal and liver cancers whereas let-7a is commonly downregulated in gastric and colorectal cancers. [score:7]
In this regard, the downregulation of two predicted miR-145 targets, namely ARF6 and CHMP2B, involved in the endocytic pathway upon transfection with miR-145 was validated by (Fig.   6). [score:6]
Cho WC Chow AS Au JS Restoration of tumour suppressor hsa-miR-145 inhibits cancer cell growth in lung adenocarcinoma patients with epidermal growth factor receptor mutationEur. [score:6]
Figure 6 Downregulation of two predicted targets, namely ARF6 and CHMP2B, involved in the endocytic pathway by miR-145 was confirmed by. [score:6]
miR-145, which inhibited EGFR endocytosis, also prolonged EGFR membrane signaling and altered responsiveness of colon cancer cells to EGFR -targeting drugs. [score:5]
In this study, we estimated that this putative tumor suppressing process was deregulated by 13 out of 58 (22.4%) dysregulated miRNAs, including miRNAs miR-17 and miR-145, in gastric, colorectal and liver cancers (Table  1). [score:5]
Sachdeva M Mo YY MicroRNA-145 suppresses cell invasion and metastasis by directly targeting mucin 1Cancer Res. [score:5]
However, further experiments by overexpressing a labeled endocytic marker to visualize endocytic vacuoles in the EGF internalization assay would be needed to fully confirm the endocytic internalization of EGFR in miR-17- and miR-145 -expressing cells. [score:4]
Consistent with our findings, Zhong and colleagues demonstrated that miR-145 sensitized lung cancer cells to gefitinib [54], in which direct targeting of EGFR by miR-145 has been demonstrated 55, 56. [score:4]
Cho WC Chow AS Au JS MiR-145 inhibits cell proliferation of human lung adenocarcinoma by targeting EGFR and NUDT1RNA Biol. [score:4]
To understand the effect of inhibited EGFR endocytosis by miR-145 on EGFR signaling, we examined the activation status of its downstream signaling mediators. [score:3]
Nevertheless, the involvement of individual predicted miRNA targets in the action of miR-17 and miR-145 on EGFR endocytosis has not been verified experimentally. [score:3]
We observed that miR-17 promoted whereas miR-145 inhibited the endocytosis of EGFR upon EGF binding to plasma membrane in SW1116 (Fig.   4). [score:3]
Figure 7Prolongation of EGFR membrane signaling and alteration of sensitivity to EGFR -targeting drugs by miR-145. [score:3]
miR-145 altered responsiveness of colon cancer cells to EGFR -targeting drugs. [score:3]
An interesting finding of our study is the paradoxical effect of miR-145, a well-established tumor-suppressing miRNA, on EGFR endocytosis. [score:3]
We next assessed the clinical relevance of miR-145 -mediated alteration of EGFR endocytosis by measuring cellular response to two classes of EGFR -targeting drugs, namely anti-EGFR antibodies and tyrosine kinase inhibitors (TKIs). [score:3]
Figure 5Predicted targets of (A) miR-17 and (B) miR-145 in the endocytosis pathway. [score:3]
Both miR-17 and miR-145 have been identified as two of the most common differentially expressed miRNAs across digestive cancers in our meta-analysis of small RNA sequencing data from The Cancer Genome Atlas [16]. [score:3]
The predicted targets of miR-17 and miR-145 involved in the endocytosis pathway were shown in Fig.   5A,B, respectively. [score:3]
In contrast, ectopic miR-145 expression induced a larger reduction in cell viability upon gertifinib treatment compared to control miRNA -transfected cells treated corresponding doses of gertifinib. [score:2]
MiR-17 and miR-145 alte red epidermal growth factor receptor endocytosisAmong these unexpected signaling pathways, the regulation of endocytosis by miRNA in relation to tumorigenesis is the least understood. [score:2]
Since deregulation of epidermal growth factor receptor (EGFR) signaling commonly occurs in colorectal cancer and contributes to its progression, we decided to study how two selected miRNAs, namely miR-17 and miR-145, would affect EGFR endocytosis. [score:2]
miR-145 prolonged EGFR membrane signaling. [score:1]
As shown in Fig.   7A, in control group, activation of Akt, i. e. phosphorylated Akt (pAkt) level, was the highest 5 min after EGF stimulation and started to fade afterwards, whereas in the miR145 -transfected group, p-Akt remained at high level after 60 min. [score:1]
Cetuximab induced a significant decrease in cell viability in control miRNA group, whereas no such effect was observed in miR-145 group. [score:1]
For instances, we estimated that about one-fifth of dysregulated miRNAs contribute to the deregulation of Wnt/β-catenin signaling in gastrointestinal cancers, among which the effects of miR-34a, miR-145 and miR-221 on Wnt/β-catenin signaling have been confirmed experimentally by other investigators 19– 21. [score:1]
Similarly, pERK1/2 level peaked at 15 min post EGF stimulation and started to drop afterwards in the control group, while in miR145 -transfected group, higher levels of p-ERK1/2 were observed at 60 and 180 min post EGF treatments. [score:1]
Concordant with the literature, miR-145, which blocked EGFR endocytosis and prolonged EGFR membrane signaling, conferred resistance to cetuximab (an anti-EGFR antibody) but increased sensitivity to gertifinib (an EGFR TKI) in SW1116 (Fig.   7B). [score:1]
Colon cancer cells were transiently transfected with pre-miR-17, pre-miR145 or miRNA precursor negative control for 48 h. Transfected cells were trypsinized and allowed to grow on coverslips in 6-well plates. [score:1]
The increased levels of miR-17 and miR-145 after transfection with miRNA precursors were confirmed by RT-qPCR (Fig.   3). [score:1]
Figure 3The levels of miR-17 and miR-145 upon transfection with microRNA precursors or negative control were determined by qPCR. [score:1]
The functional consequence of such a disruption of balance between membrane and nuclear EGFR signaling and its relation to the tumor-suppressing action of miR-145, however, warrant further investigation. [score:1]
These miRNAs include miR-20a, miR-21, miR-93, miR-106b, miR-130b, miR-145 and miR-200b 30– 36. [score:1]
SW1116, a KRAS-wild-type colon cancer cell line, was transfected with control miRNA, miR-17 or miR-145. [score:1]
MiR-17 and miR-145 alte red epidermal growth factor receptor endocytosis. [score:1]
[1 to 20 of 36 sentences]
38
[+] score: 96
Other miRNAs from this paper: mmu-mir-145a, hsa-mir-34a, mmu-mir-34a, mmu-mir-145b
of small inhibitory oligonucleotides to counter expression of targeted miRNAs (anti-miRNAs), anti- miR-34a and anti- miR-145, resulted in ∼80% miRNA depletion (Figure S6C), and had specific effects on expression of stem cell factors: inhibition of miR-34a led to increased expression of OCT4, KLF4, LIN28A, and SOX2 proteins, and to a lesser extent SIRT1 (Figure 6E), as well as SOX2 and SIRT1 RNA (Figure 6D). [score:13]
siRNA targeting human TP53, CDKN1A (p21), HDM2, TRIM24 (Table S1) and non-target (control) were purchased from Dharmacon and anti-miRNA oligonucleotides targeting human miR-34a, miR-145, and miR-nonspecific were purchased from Applied Biosystems. [score:7]
miR-145 is known to be a p53 target in somatic cells [54]; however, the mechanisms that lead to miR-145 up-regulation during differentiation of hESCs have not been defined. [score:6]
In parallel, p53 activates specific microRNAs, miR-34a and miR-145, that inhibit the expression of several stem cell factors and prevent differentiated cells from backsliding to pluripotency. [score:5]
Inhibition of miR-145 induced protein levels of OCT4, SOX2, and KLF4, as well as increased RNA expression of SOX2 and KLF4 (Figure 6D and 6E). [score:5]
Pluripotency genes targeted by mir-145 are known [53]; additionally, we found that mir-34a has predicted target sites within the 3′ UTRs of KLF4 and LIN28A, which are conserved across species (Figure 6G). [score:5]
miR-145 targets c-Myc [54], which is known to repress p21 [55]; thus, miR-145 represses pluripotency factors and likely contributes to regulation of the hESC cell cycle by decreasing c-Myc and indirectly activating p21 during differentiation. [score:5]
In silico analysis by TargetScan [56], PicTar [57], miRanda [58], and miRBase [59] of genes potentially regulated by miR-34a and miR-145 identified several genes significant to ESC biology (Figure S7E). [score:4]
Putative p53 targets included miRNAs; among these, we focused on miR-34a and miR-145 as likely significant in the p53 -mediated regulation of hESCs. [score:4]
In response to RA treatment and differentiation of hESCs, miR-34a and miR-145 were significantly up-regulated in a p53 -dependent manner (Figure 6A and 6B), an induction which also occurs with a DNA-damaging agent, Adr (Figure S7A). [score:4]
On the other hand, miR-145 targets OCT4, KLF4, and SOX2 and antagonize pluripotency. [score:3]
Quantitative determination of OCT4/SSEA4 -positive cells by flow cytometry analysis revealed that hESCs could differentiate with RA after inhibition of miR-34a but not in the presence of anti- miR-145 (Figure 6F). [score:3]
miR-145 was discovered to be a direct repressor of pluripotency factors, but was not shown to be regulated by p53 in stem cells [53]. [score:3]
However, since DNA damage induced miRNAs miR-34a and miR-145 but did not promote accumulation of hESCs in G [1] and differentiation of hESCs, as seen with RA treatment or ectopic p53 expression, it is clear the miRNAs alone are insufficient to induce differentiation of hESCs. [score:3]
Activation of p53 elongates the G [1] phase of the cell cycle by p21 induction, and increases miR-34a and miR-145, which target specific stem cell factors for repression. [score:3]
Here we show that p53 activates miR-34a and miR-145 expression during RA -mediated differentiation of hESCs. [score:3]
p53 Regulates miR-34a and miR-145 to Drive Differentiation of hESCsTo understand the mechanism underlying p53 -mediated differentiation of hESCs, we performed high-throughput sequencing analysis of hESCs incubated with RA (unpublished data). [score:2]
In contrast, a role for miR-145 in differentiation of hESCs is known, where miR-145 acts by negatively regulating levels of pluripotency genes, OCT4, SOX2, and KLF4 [53]. [score:2]
p53 regulates miR-34a and miR-145 to drive differentiation of hESCs. [score:2]
Thus, p53 exerts a cumulative pro-differentiation effect by elongating hESC G [1] phase via p21 and synergistically up -regulating miR-34a and miR-145 to counteract pluripotency. [score:2]
p53 Regulates miR-34a and miR-145 to Drive Differentiation of hESCs. [score:2]
1001268.g006 Figure 6p53 regulates miR-34a and miR-145 to drive differentiation of hESCs. [score:2]
We found that miR-145 has a more significant role in differentiation of hESCs, with miR-34a acting to augment its functions. [score:1]
Differentiation induces acetylation at Lys373 of p53 via CBP/p300, p53K373ac then activates transcription by binding to p53REs on CDKN1A (p21), miR-34a, and miR-145. [score:1]
hESCs transfected with either anti- miR-NS (control) or anti- miR-145 oligonucleotides and treated with RA were stained with PI and subjected to flow cytometry analysis. [score:1]
RA treatment led to a time -dependent enrichment of p53 at predicted p53REs of both miR-34a and miR-145 (Figure 6C), in parallel with the transient activation of p53. [score:1]
Depletion of miR-145 also significantly affected accumulation of hESCs in G [1] after RA treatment (Figure S7D). [score:1]
miRNAs were analyzed using total RNA from hESCs with probes specific for human miR-34a and miR-145 and were normalized to RNU6B as internal control (*, p<0.01). [score:1]
The collective effects of p53 activation elongate the G [1] phase and antagonize pluripotency by induction of miR-34a and miR-145 (Figure 7). [score:1]
p53-bound chromatin was immunoprecipitated from hESCs, and p53 enrichment on miR-34a and miR-145 promoters was analyzed by qRT-PCR (*, p<0.05). [score:1]
[1 to 20 of 30 sentences]
39
[+] score: 94
Other miRNAs from this paper: hsa-mir-143
The high variability that we have shown in methylation makes it incredibly unlikely that changes in methylation are responsible for the persistent and, more importantly, consistent up-regulation of miR-145 expression in T2DM-SMC; however, we cannot discount that methylation of miR143HG may contribute to these differences. [score:6]
Because we have previously demonstrated robust, consistent up-regulation of miR-145 expression with sample sizes of 10 per patient population, [19] the fact that we would require up to 200 for methylation studies adds weight to our argument that differential methylation of the miR-145 promoter is not the causative factor for its elevation in T2DM-SMC. [score:6]
[6] Given our previous report of elevated miR-145 expression in T2DM-SMC, [19] we determined the expression of miR-145 in RNA samples that were prepared in equivalent cells from the same patient cohort. [score:5]
A long-held consensus indicates that promoter methylation and gene expression are inversely related; [29] the observed subtle reduction in methylation would support this hypothesis, given higher expression levels of miR-145 we reported in T2DM-SMC. [score:5]
Figure 4. Correlation of miR-145 methylation and expression: (a) correlation of miR-145 expression with methylation at CpG −189 and (b) mean methylation across the entire region (n = 22 of each population). [score:5]
3, 6 miR-145 modulates cellular proliferation 2, 7 and our observations together with the aforementioned cancer studies support a role for increased miR-145 methylation (and lower expression) in hyper-proliferative disorders such as cancer and reduced methylation (and higher expression) in T2DM-SMC in which we unambiguously demonstrated reduced proliferation. [score:5]
A common promoter lies upstream of the miR143HG start site to regulate expression of both miRs; [8] however, individual promoters for miR-143 [9] and miR-145 [2] have also been described. [score:4]
We previously demonstrated a consistent up-regulation of miR-143 in parallel with miR-145 in T2DM-SMC. [score:4]
[19] It is plausible that expression and regulation of the host gene miR143HG is more critical for the enrichment of both miR-143 and miR-145, although methylation within the miR143HG promoter has not yet been studied. [score:4]
[1] miR-145 has also been described as a putative tumour suppressor [2] and a large body of work has highlighted its dysregulation in multiple forms of cancer including prostate, brain and lung. [score:4]
Importantly, epigenetic signatures are not limited to DNA methylation – it is likely that a complex interplay between methylation, chromatin and histone modifications and transcription factors are involved in regulating miR-145 expression. [score:4]
Importantly, maintenance of the phenotype throughout serial passaging 19, 20 supports the idea of epigenetic regulation at the level of differential miR-145 expression, which itself may be modulated via DNA methylation. [score:4]
of the miR143HG promoter regionAs methylation at the miR143HG promoter region could conceivably modulate expression of both miR-143 and miR-145, we proceeded to interrogate six CpG sites (Figure 1, Table 1). [score:3]
Expression of miR-145 is complex, being encoded in a bicistronic unit with miR-143 on human chromosome 5q32. [score:3]
Correlation of miR-145 expression with methylation. [score:3]
Methylation of this region of the miR-145 gene has previously been reported to correlate with its expression. [score:3]
Methylation at any individual site (e. g. CpG −189; the site with the lowest p-value of 0.113), and methylation across all sites, did not correlate with miR-145 expression in human SV-SMC (Figure 4(a) and (b)). [score:3]
As methylation at the miR143HG promoter region could conceivably modulate expression of both miR-143 and miR-145, we proceeded to interrogate six CpG sites (Figure 1, Table 1). [score:3]
All experiments were performed on cells between passages 3 and 5, across which miR-145 expression is stable. [score:3]
RNA extraction and miR-145 expression. [score:3]
[24] Expression of miR-145 was determined using Taqman MicroRNA Reverse Transcription Kit and Taqman assays specific to human miR-145-5p and snoU6 (housekeeper) in triplicate according to manufacturer’s instructions. [score:2]
Methylation levels at the miR-145 promoter in SMC isolated from ND and T2DM patients. [score:1]
Figure 1. Schematic representation of the miR-145 locus. [score:1]
[7] A primary transcript (pri-miR-143/145) is generated from the miR-143 host gene (miR143HG, Figure 1) which is then cleaved by DGCR8/Drosha into the two individual pre-miRs, pre-miR-143 and pre-miR-145. [score:1]
Therefore, the aim of this study was to interrogate potential methylation sites immediately upstream of the miR-145 coding region and to determine whether there were any differences between SMC cultured from patients with or without T2DM. [score:1]
Since methylation at CpG −189 was most divergent between ND and T2DM cells, we investigated whether this correlated with miR-145 expression. [score:1]
Due to its involvement in cancer, a number of studies have examined methylation immediately upstream of miR-145. [score:1]
Analysis of the mean methylation across all 11 sites revealed no significant differences in miR-145 methylation in T2DM-SMC (Figure 3(b)). [score:1]
We focussed our attention on the region immediately upstream of miR-145 as this is the only area that has previously been interrogated. [score:1]
The key finding of this study was the marked variability in miR-145 methylation, irrespective of T2DM. [score:1]
18– 22 Specifically, we discovered an aberrant SMC phenotype from the SV of T2DM patients which was characterised by increased spread cell area, cytoskeletal disarray and reduced proliferation, and driven by elevated expression levels of miR-145. [score:1]
miR-145 is a short, non-coding RNA that plays an essential role in differentiation of smooth muscle cells (SMC) from stem cells and maintenance of a quiescent, contractile phenotype in mature SMC. [score:1]
Figure 3. Interrogation of miR-145 methylation in ND and T2DM-SMC. [score:1]
[1 to 20 of 33 sentences]
40
[+] score: 89
Other miRNAs from this paper: hsa-mir-221, hsa-mir-222, hsa-mir-143
This has revealed that both EBNA3A and EBNA3C –but not EBNA3B –are required for the transactivation of the oncomiRs miR-221 and miR-222, while concurrently silencing the expression of the tumour suppressor miR-143/miR-145 cluster. [score:5]
In contrast to miR-143/miR-145, functions of the miR-221/miR-222 cluster is relatively well characterised, with wide agreement that two of the major targets are mRNAs for CIP/KIP CDKIs p57 [KIP2] and p27 [KIP1], the translation of which are robustly inhibited by these miRs in various types of cell (see ). [score:5]
Analysis of the same lines for expression of miR-143 and miR-145 confirmed the TLDA result showing that in the absence of EBNA3A or functional EBNA3C (by washing out 4HT) there was an increase in the expression of miR-143 and miR-145 (Fig 1B). [score:5]
The details of how the tumour suppressors miR-143 and miR-145 might inhibit cell proliferation are poorly understood. [score:5]
Although various target mRNAs have been proposed, there appears to be a lot of cell-type specificity and a general lack of consensus on precisely how miR-143/miR-145 act as tumour suppressors. [score:5]
In contrast to miR-221/miR-222, miR-143 and miR-145 are tumour suppressor miRs that have been reported to inhibit the proliferation of many cancer-and non-cancer-derived cell lines. [score:5]
Here—following a relatively unbiased array screen for miRs regulated by EBNA3A and/or EBNA3C in the context of latent infection with EBV—we identified the oncogenic miR-221/miR-222 cluster as being activated and the tumor suppressor miR-143/miR-145 cluster as being repressed by EBNA3A together with EBNA3C. [score:4]
Our interpretation of these data is that transcriptional regulation of pri-miR-143/145 (and hence mature miR-143/miR-145) is unlikely to be due to EBNA3A/EBNA3C binding to cis-regulatory elements and is therefore probably a secondary, trans-acting effect of the regulation of an unknown gene(s). [score:4]
There are very few data available on the activities of miR-143/miR-145 in B cells, although there has been one report of their down-regulation in EBV-transformed, but not in mitogen-stimulated B cells [84]. [score:4]
1005031.g002 Fig 2(A) MiR-143, miR-145 and RNU48 expression were analysed by qPCR from p16 -null LCL 3CHT established without the presence of 4HT (never HT) or 30 days after 4HT was added to culture medium (+HT). [score:3]
S7 FigThe expression level of the non-coding RNA precursor of miR-143/miR-145 was determined (A) in EBNA3A- KO and-REV LCLs; (B) in EBNA3A-ERT2 LCLs cultured with (+HT) or without 4HT (Washed); (C) in p16 -null LCLs 3CHT with (+HT) or without 4HT (Washed); (D) in LCL EBNA3A-ERT2 (never HT) cultured for 28 days with (+HT) or without 4HT; (E) and p16 -null LCL 3CHT (never HT) and cultured for 30 days with (+HT) or without 4HT. [score:3]
When EBNA3A was deleted there was particularly robust expression of both miR-143 and miR-145. [score:3]
Consistently on removal of 4HT (washed), miR-221 and miR-222 were expressed at a lower level (Fig 4B), whereas miR-143 and miR-145 were modestly induced (Fig 4C). [score:3]
Activation of EBNA3C represses miR-143/miR-145 expression. [score:3]
The same two EBV proteins silence a tumour-suppressor miR cluster miR-143/miR-145. [score:3]
Activation of EBNA3A represses miR-143/miR-145 expression. [score:3]
Therefore, in order to determine whether the regulation of miR-221/miR-222 and/or miR-143/miR-145 might result from direct binding of either EBNA3A or EBNA3C –or both—to chromatin at the genomic locus of each miR cluster, genome-wide chromatin immunoprecipitation (ChIP) data sets were interrogated. [score:3]
1005031.g005 Fig 5(A) MiR-143/miR-145 and RNU48 expression were determined by qPCR in EBNA3A-ERT2 LCL established without the presence of 4HT (never HT) and 28 days after addition of 4HT to culture medium (+HT). [score:3]
Positive leads that were of particular interest—because they have been reported in the literature to have either oncogenic activity (the miR-221/miR-222 cluster) or tumour suppressor activity (the miR-143/miR-145 cluster)–were chosen for more detailed analysis. [score:3]
Expression of miR-143/miR-145, miR-221/miR-222 and control RNA RNU48 are not affected by the treatment of LCL WT by 4HT. [score:3]
Expression of miR-221, miR-222, miR-143, miR-145 and two snRNAs, RNU6B and RNU48 were quantified by qPCR using the TaqMan MicroRNA Assay listed in S2 Table (Applied Biosystem). [score:2]
Regulation of miR-221/miR-222 and miR-143/miR-145 in EBNA3A-ERT2 conditional LCLs. [score:2]
It may be significant that miR-143 and miR-145 are also repressed by the E7 oncoprotein in epithelial cells infected with human papillomavirus (HPV)-31 [83]. [score:1]
MiR-143/miR-145 coding sequences are located in a cluster on chromosome 5 and are co-transcribed as a single pri-miR transcript [61, 63]. [score:1]
S9 Fig ChIP-seq data at the miR-143/miR-145 cluster genomic locus generated from LCL 3A-TAP and LCL 3C-TAP (Paschos et al., manuscript in preparation) were displayed using UCSC Genome Browser. [score:1]
In contrast, interrogation of ChIP-seq data corresponding to the miR-143/miR-145 locus (chromosome 5q. [score:1]
Silencing of the miR-143/miR-145 locus by the combined action of EBNA3A and EBNA3C remains poorly understood. [score:1]
EBNA3A and EBNA3C both repress the pri-miR transcript for miR-143/miR-145. [score:1]
Consistent with this, when 4HT was added to a p16 -null EBNA3C-conditional LCL that had been established in its absence (never HT), there was a substantial repression of the miR-143/miR-145 cluster (Fig 2A and S1 Fig). [score:1]
ChIP-seq and ChIP-qPCR analysis of the miR-221/miR-222 and miR-143/miR-145 loci. [score:1]
As with the experiments using conditional EBNA3C, when EBNA3A-conditional cells that had been grown into LCLs in the absence of 4HT (never HT), there was a substantial repression of miR-143 and miR-145 when 4HT was added to the culture medium (Fig 5A and S1 Fig). [score:1]
The non-coding pri-miR-143/145 (called MIR143-HG in the genome browser) as well as miR-143/miR-145 are highlighted by inclusion in a red box. [score:1]
[1 to 20 of 32 sentences]
41
[+] score: 88
In summary, the expression of pcDNA6.2-GW-miR-145 downregulated the expression of CDK6 and inhibited the proliferation of HeLa cervical cancer cells, providing a basis for the further study of the effects of miR-145 on the biological behaviors of cervical cancer cells and the associated mechanisms. [score:10]
In the present study, an miR-145 expression vector was constructed using the eukaryotic expression vector pcDNA™6.2-GW, and was transfected into HeLa cervical cancer cells to examine the regulatory effect of miR-145 on its downstream target gene cyclin -dependent protein kinase 6 (CDK6). [score:8]
This suggests that miR-145 may directly target the expression of CDK6 to inhibit the proliferation of cervical cancer cells. [score:8]
miR-145 has an important role as a tumor suppressor gene, with low expression in esophageal (7), bladder (8), colorectal and numerous other human cancer types, and affects the biological functions of tumor cells by regulating the expression of numerous downstream genes. [score:8]
This demonstrates that miR-145 inhibited the mRNA and protein expression of CDK6 in the HeLa cervical cancer cells at the transcriptional and translational levels. [score:7]
The present study demonstrates that a good nucleotide complementary relationship exists between miR-145 and the CDK6 3′ untranslated region, by revealing that the expression of CDK6 is significantly inhibited by miR-145 transfection. [score:7]
This indicates that the high expression level of miR-145 inhibited the proliferation of HeLa cells. [score:5]
Data in Fig. 1A demonstrate that the expression level of miR-145 in the miR-145 group was significantly higher than that in the blank group (P=0.001), while no significant difference was observed in the expression level of miR-145 between the NC group and blank group (P=0.412). [score:5]
miR-145 inhibits the expression of CDK6. [score:5]
Construction of miR-145 eukaryotic expression vector. [score:3]
The 2 [−ΔΔCt] method was used to quantify the expression of miR-145 and CDK6. [score:3]
To investigate whether the overexpression of miR-145 in HeLa cells affects the expression of CDK6, qPCR and western blotting analysis were employed. [score:3]
Successful construction of the miR-145 eukaryotic expression vector. [score:3]
To examine whether miR-145 inhibits HeLa cervical cancer cell proliferation 24, 48 and 72 h following transfection, an was conducted. [score:3]
To identify whether miR-145 was expressed in the HeLa cervical cancer cells, qPCR was used. [score:3]
miR-145 inhibits cervical cancer HeLa cell proliferation. [score:3]
Following transfection by the recombinant pcDNA6.2-GW-miR-145, the mRNA and protein levels of the downstream CDK6 in the HeLa cells were significantly lower than those in the NC and blank HeLa cells (P=0.001; Fig. 2). [score:1]
The miR-145 group was transfected with a pcDNA [TM]6.2-GW-miR-145 recombinant plasmid. [score:1]
As demonstrated in Fig. 1B, the proliferation of miR-145 -transfected HeLa cells was significantly lower than that of the blank group (P<0.05), whereas no marked difference was observed between the NC group and the blank group (P>0.05). [score:1]
However, to the best of our knowledge, no study has reported the role of miR-145 in cervical cancer until now. [score:1]
[1 to 20 of 20 sentences]
42
[+] score: 87
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200c, hsa-mir-429, hsa-mir-638
Indeed, hsa-miR-145 mediates gene upregulation during muscle differentiation [55] and gene downregulation in osteosarcoma [56]. [score:7]
Hsa-miR-145 is an interesting candidate as TP53 activates expression of hsa-miR-145 which in turn represses SOX2 expression in embryonic stem cells [19– 21]. [score:5]
b Protein expression was semiquantitatively analysed by densitometry using Image J. Bars indicate mean ± SE, n = 3. ***indicating p < 0.001 and **indicating p < 0.01 was obtained from one-way ANOVA Fig. 4Effects of silencing of the TP53 and SOX2 genes on the expression of SOX2, TP53 and hsa-miRNA-145-5p in pulmonary adenocarcinoma A427 cells. [score:5]
This prompts for further studies on the mechanisms behind TP53 -induced regulation of SOX2 expression and the possible importance of hsa-miR-145 in lung cancer development. [score:5]
Furthermore, TP53 knockdown reduced the miRNA hsa-miR-145, which has previously been shown to regulate SOX2 expression. [score:5]
As hsa-miR-145 has previously been shown to regulate SOX2 expression, we propose that one mechanism for the TP53 regulation of SOX2 may be through hsa-miR-145. [score:5]
Campayo et al. demonstrated that TP53 may play a role in modulating hsa-miR-145 expression in NSCLC, and that patients with mutations in TP53 and low hsa-miR-145 levels had lower survival in respect to patients with TP53 wild-type or only mutations in TP53 [22]. [score:5]
Furthermore, SOX2 and TP53 expression were correlated in lung tumors and reduction in TP53 resulted in decreased SOX2 and hsa-miR-145 expression in lung adenocarcinoma cells. [score:5]
Avgeris M Stravodimos K Fragoulis EG Scorilas A The loss of the tumour-suppressor miR-145 results in the shorter disease-free survival of prostate cancer patientsBr J Cancer. [score:5]
In contrast, the levels of hsa-miR-145-3p, hsa-miR-200b and hsa-miR-200c remained unchanged in TP53 knockdown cells, whereas hsa-miR-429 was not expressed in these cells (data not shown). [score:4]
This prompts for further studies on the mechanisms behind the TP53 -induced regulation of SOX2 expression and the possible importance of hsa-miR-145 in lung cancer. [score:4]
TP53 signaling may be important in the regulation of SOX2 copy number and expression in NSCLC tumors, and the miRNA hsa-miR-145-5p may be one potential driver. [score:4]
Moreover, hsa-miR-145-5p expression was significantly reduced in TP53 knockdown cells (p = 0.004, Fig.   4a). [score:4]
Based on our findings, we suggest a possible role of hsa-miR-145 as an inducer of SOX2 expression in NSCLC. [score:3]
Hsa-miR-145 expression has also been suggested as a novel marker responsible for relapse in surgically treated NSCLC [22]. [score:3]
Of these five previously known targets of TP53; hsa-miR-145-5p, hsa-miR-145-3p, hsa-miR-200b-3p, hsa-miR-200c-3p, hsa-miR-429-1p; were selected for further analysis. [score:3]
a TP53 was silenced using siRNA technology and expression of SOX2 and hsa-miR-145-5p was analyzed by qPCR. [score:3]
TP53 affects SOX2 expression and hsa-miRNA-145-5p levels in human lung cells in vitro. [score:3]
miRNAs are important mediators of TP53-signaling and in embryonic stem cells TP53 represses SOX2 expression through the activation of hsa-miR-145 [19– 21]. [score:3]
We here demonstrated that TP53 knockdown repressed hsa-miR-145-5p expression in the lung adenocarcinoma cell line A427, whereas the other miRNAs investigated were unaffected. [score:2]
It is known that hsa-miR-145 exhibits opposite effects on RNA regulation in different cell types. [score:2]
This is of interest as a recent study showed that low levels of hsa-miR-145 are associated with unfavorable prognosis in NSCLC [22]. [score:1]
Bars indicate mean ± SE, n = 9 and n = 12 for SOX2 and hsa-miR-145-5p, respectively. [score:1]
[1 to 20 of 23 sentences]
43
[+] score: 86
In microvascuiature, miR-145 expressed in pericytes and repressed the migration of microvascular cells by directly targeting Fli-1 [70]. [score:6]
In breast cancer, miR-145 was identified to suppress cell invasion and metastasis by directly targeting MUC1 [27]. [score:6]
Upregulation of miRs-143 and -145 reduced the skeletal aggressiveness of PC-3 cells in vitro and in vivo To investigate the role of miRs-143 and -145 in the development and progression of PCa metastasis, miRs-143 and -145 over -expressing cell lines (PC-3/miR-143, PC-3/miR-145, LNCaP/miR-143 and LNCaP/miR-145) were established by retrovirus transfection. [score:5]
By direct deregulation of FSCN1, miR-145 inhibited invasion of esophageal squamous cell [71]. [score:5]
The invasive property of PC-3 cells was significantly inhibited by miR-143 and -145, even more obviously inhibited by miR-145. [score:5]
The expression of three miRNAs (miRs-145, -143, -612) was obviously decreased in bone metastasis, especially the expression of miR-145 and miR-143 with the reduction of 5.4-fold and 2.7-fold, respectively. [score:5]
Plenty of studies identified several miR-143 targets including DNMT3A and KRAS [65], [66], as well as miR-145 targets including BNIP3, IRS, C-MYC, YES and STAT1 [10], [67], [68], [69]. [score:5]
Figure 4, B and E ), and a significant inverse correlation between the expression of miR-145 and total PSA level (Spearman correlation = −0.456, p = 0.033, Figure 4 F ); whereas no correlation between the expression of miR-143 and total PSA level (Spearman correlation = −0.403, p = 0.063). [score:5]
Moreover, fibronectin, which is a sort of mesenchymal markers and should be up-regulated during EMT, was repressed in stably expressing miR-143 or miR-145 transfected PC-3 cells, compared to PC-3 cells transfected with vector. [score:5]
The result illustrated that E-cadherin, which is one of epithelial markers and supposed to be down-regulated during EMT, was increased in PC-3 cells transfected with miR-143 or miR-145. [score:4]
Moreover, up-regulation of miR-145 in PC-3 cells exhibited the same effects on these proteins except for vimentin. [score:4]
Furthermore, Sachdeva M, et al. found that miR-145 could target multiple metastasis-related genes including MMP-11 and ADAM-17 [72]. [score:3]
Int J Cancer 72 Sachdeva M Mo YY 2010 miR-145 -mediated suppression of cell growth, invasion and metastasis. [score:3]
To further investigate whether the expression tendency of miR-145 and miR-143 was identical in the same sample, the relative expression of miR-145 and miR-143 in the same sample was plotted from the real-time PCR in all 22 samples of primary PCa (including 6 microarray samples) (Figure 3 A ) and 20 samples of bone metastases (including 7 microarray samples) (Figure 3 B ), respectively. [score:3]
Moreover, we want to figure out whether one controls the expression of the other one, but there's no study about the interaction between miR-143 and miR-145. [score:3]
Conversely, miR-335, miR-206, miR-31, miR-145, miR-661 and miR-126 have been identified as metastasis suppressor miRNAs in human breast cancer [21], [22], [23], [24], [25], [26], [27]. [score:3]
The miR-145 also showed lower expression by microarray analysis in primary tumor than in normal prostate tissue [63], [64]. [score:3]
To investigate the role of miRs-143 and -145 in the development and progression of PCa metastasis, miRs-143 and -145 over -expressing cell lines (PC-3/miR-143, PC-3/miR-145, LNCaP/miR-143 and LNCaP/miR-145) were established by retrovirus transfection. [score:2]
Briefly, miRNA was reverse transcribed using sequence specific stem-loop primers (invitrogen) to the following miRNAs: hsa-miR-125b, hsa-miR-145, hsa-miR-153, hsa-miR-210, hsa-miR-143, hsa-miR-100, hsa-miR-363, hsa-miR-451, hsa-miR-572 and hsa-miR-508-5p, based on microarray analysis and their predicted target genes. [score:2]
Sections at lower panel showed the location of miR-143 (left) and miR-145 (right) in PCa cells by LNA-ISH. [score:1]
F, The level of total PSA is also correlated with miR-145 (Spearman correlation = −0.456, p = 0.033). [score:1]
Animals were randomized into two groups equally, where each 5 animals were treated with PC-3/miR-143 or PC-3/miR-145 on right tibias respectively. [score:1]
The sequence of pri-miR-143 and pri-miR-145 were cloned into pMSCV-puromycin plasmid with restriction enzyme Bgl II and EcoR I (New England Biolabs). [score:1]
The significant correlations of miR-145 and miR-143 were found in primary PCa (kendall correlation = 0.850, p<0.001) and bone metastases (kendall correlation = 0.765, p<0.001). [score:1]
However, LNCaP/miR-143 and LNCaP/miR-145 cells and LNCaP/vector cells did not show significant difference in cell migration, invasion and adhesion (data not shown). [score:1]
After washed by 0.2% glycine/PBS for 1 min and fixed with 4% paraformaldehyde, the sections were incubated in hybridization buffer (50% formamide, 5×SSC, 0.1% Tween, 9.2 mM citric acid for adjustment to pH 6.0, 50 µg/mL heparin, 500 µg/mL yeast RNA) at 37°C for 2 h. Digoxigenin-labeled, LNA -modified probes of miR-143 (20 nmol/L; 5′-GAGCTACAGTGCTTCATCTCA-3′, Exiqon) and miR-145 (20 nmol/L; 5′-AGGGATTCCTGGGAAAACTGGAC-3′, Exiqon) were added respectively and incubated at 55°C for 18 h. Sections were washed with 2×SSC twice, then with 2×SSC and 50% formamide at 50°C thrice (30 min each). [score:1]
All the stable cell lines, including PC-3/vector, PC-3/miR-143, PC-3/miR-145, LNCaP/vector, LNCaP/miR-143 and LNCaP/miR-145, were seeded in 100 mm tissue culture dishes. [score:1]
Moreover, these results of cell migration, invasion and adhesion indicated that the ability of ectopic miR-145 repressing aggressiveness was more significant than that of miR-143. [score:1]
[1 to 20 of 28 sentences]
44
[+] score: 85
Specifically, miR-205 and miR-200 family members (in particular miR-200b and miR-200c) were exclusively expressed by pancreatic cancer epithelial cells, and miR-145 and miR-199 family members (miR-199a and miR-199b) were exclusively expressed by TAS cells [8]. [score:5]
Assessment of ex vivo miR-145 expressionmiR-145 expression in FFPE samples were quantified by in situ hybridization (ISH) performed by BioGenex Laboratories Inc. [score:5]
Specific to PDAC, miR-145 expression in PDAC cells suppresses growth and invasion, and increases sensitivity to gemcitabine chemotherapy [20, 32]. [score:5]
The percentage of viable cells (Q3) decreased by 17.45 ± 6.37% (p < 0.05) and 32.80 ± 6.40% (p < 0.001) with miR-145 exogenous expression at concentration of 1.25 nM and 5 nM respectively; apoptotic/necrotic cells (Q2 + Q4) increased 15.68 ± 6.37% (p < 0.05) and 33.00 ± 6.38% (p < 0.001) with miR-145 exogenous expression at concentration of 1.25nM and 5nM respectively. [score:5]
Considering that one microRNA can target hundreds of genes, we suspect that the mechanism of miR-145 regulation may be cell type specific. [score:4]
Exosomes derived from TAS cells induced PDAC cell death is mitigated by a miR-145 inhibitor. [score:3]
Another limitation is we utilized highly -expressing miR-145 TAS cells in this study. [score:3]
As shown in Figure 2C and 2D, expression of TAS-specific miR-145 was detected by qPCR in PDAC cells co-cultured in inserts with TAS cells, and vice versa, epithelium-specific miR-205 and miR-200b/-200c were also detected in TAS cells. [score:3]
Our work supports and builds upon the putative, tumor suppressor role of miR-145 that has been experimentally supported by numerous authors [29– 31]. [score:3]
Evidence that miR-145 is a tumor suppressor in PDAC has been forwarded by others, but predominantly represents observations in animal mo dels [19, 20]. [score:3]
We thus extended our study to explore miR-145-5p expression in human tissue samples of normal healthy pancreas, non-malignant pancreas remote from the malignancy, and PDAC. [score:3]
Future study to examine the role of miR-145 in large cohorts of patient’s tissues, especially its correlation with prognosis of the disease, will further define the potential therapeutical value of this miRNA. [score:3]
Perhaps most important, a miR-145 inhibitor was able to prevent/rescue this apoptotic population. [score:3]
miR-145 inhibits PDAC cell viability and induces cell death. [score:3]
miR-145 expression in FFPE samples were quantified by in situ hybridization (ISH) performed by BioGenex Laboratories Inc. [score:3]
These data demonstrated that highly concentrated EXOs derived from TAS cells may have the capacity to confer a tumor suppressive role on adjacent PDAC cells via the delivery of miRNAs such as miR-145. [score:3]
miR-145 inhibits PDAC cell proliferation and induces cell death. [score:3]
Cells were transfected with synthetic miRNA hsa-miR-145-5p mimics or miRCURY LNA hsa-miR-145-5p inhibitors (Exiqon, Vedbaek, Denmark) using RNAiMAX transfection reagent (Thermo Scientific, Waltham, MA). [score:3]
Assessment of ex vivo miR-145 expression. [score:3]
Our data reproduce and expand upon these prior findings demonstrating over -expression of miR-145 in PDAC cells results in cell death. [score:3]
Compared to controls (untreated cells and cel-miR-39-3p transfected cells), PDAC cells with exogenous over -expression of human hsa-miR-145-5p mimic (final concentration of 0.625–10 nM) showed a dose -dependent decrease in cell proliferation rates and impaired cell viability (Figure 5A and 5B). [score:2]
However, we further expand upon this finding by identifying that the source of miR-145 in the tumor microenvironment is actually from TAS cells that is transmitted to the PDAC cells via EVs. [score:1]
We previously identified the presence of TAS-specific miRNAs, such as miR-145, in PDAC cells following in vitro co-culture, and vice versa [8]. [score:1]
However, significant, moderate intensity of miR-145-5p staining was observed in adjacent TAS in these samples of PDAC (Figure 5D). [score:1]
Based on the above data, we asked the question whether EVs derived from TAS cells could similarly impact PDAC cells via miR-145 cargo. [score:1]
miR-145 levels during the 6-days of transfection period were representatively demonstrated using 1.25 nM transfection concentrations (bottom panel). [score:1]
Conversely, ductal-like cancer cells in cases of PDAC lack any staining for miR-145-5p. [score:1]
A miRNA exchange occurs between cell types in an in vitro mo del of the tumor microenvironmentWe previously identified the presence of TAS-specific miRNAs, such as miR-145, in PDAC cells following in vitro co-culture, and vice versa [8]. [score:1]
Taken together, our data suggest that miR-145-5p exerts an anti-tumor role in PDAC. [score:1]
Post-transfection levels of miR-145 did persist at least 6 days (Figure 5A bottom). [score:1]
Although both TAS-MVs and TAS-EXOs contain miR-145 (detected by qPCR), TAS-MV failed to show the consistent and significant induction of apoptosis of PDAC cells. [score:1]
As expected, miR-145, a TAS signature miRNA, was present in PDAC cells fed with TAS-MVs or TAS-EXOs (Figure 4C). [score:1]
The mechanism of miR-145 in apoptosis is complicated and mediated through multiple cellular pathways, including caspase -dependent and -independent cell death [29, 33]. [score:1]
Likewise, TAS miRNA signature miR-145 and miR-199 family members miR-199a/199b were present in MVs and EXOs derived from TAS cells, and miR-145 concentrations were augmented in comparison to parental cell levels (difference = 4.04 ± 0.58, p < 0.001 for PDAC-MVs; and 5.95 ± 0.75, p < 0.001 for PDAC-EXOs) (Figure 3D). [score:1]
miR-145 -induced PDAC cell death was quantified using annexin V/7-AAD bivariate flow cytometric analysis and EthD-1 staining of necrotic cells (Figure 5C). [score:1]
[1 to 20 of 35 sentences]
45
[+] score: 80
Other miRNAs from this paper: hsa-mir-143
The results showed that the miR-143 was up-regulated in EC compared to EU (p=0.016), and also the miR-145 was up-regulated (p=0.008). [score:6]
And also the expression of miR-145 in EC was up-regulated (p=0.000). [score:6]
The results showed the miR-143 and/or miR-145 in proliferative endometrium was up-regulated compared to secretory endometrium in EN group, but proliferative endometrium was down-regulated compared to secretory endometrium in EC group. [score:5]
Compared to EN, the expression level of miR-145 in EU was up-regulated (p=0.004). [score:5]
After comparison, in EN group, the expression levels of miR-143 and/or miR-145 in proliferative endometrium were up-regulated compared to secretory endometrium, but the difference did not reach statistically significance (p=0.085, 0.173, respectively Table II). [score:5]
Compared to EU, the expression of miR-145 in EC was up-regulated, but the difference did not reach statistically significance (p=0.020). [score:5]
Then they used the miR-143 or -145 precursor miRNAs for transfection of the human colon cancer DLD-1 and SW480 cells, the cell growth of both cell lines was significantly inhibited in a dose -dependent manner at 48 h. Also, both MiR-143 and miR-145 are frequently down regulated in tumors deriving from breast, lung, colon, the gastrointestinal system, ovary, cervix, bladder tissue and in human cancer cell lines, suggesting anti-oncogenic nature of miR-143 and -145 (7, 8). [score:4]
The value of R [2] >1.0 was considered to represent increased expression of miR-143 and/or miR-145 in EC tissues to the paired EU tissues, and R [2] <1.0 represent decreased expression. [score:4]
In our study, we analyzed three types of samples, even paired EU and EC samples to identify the differential expression of miR-143 and miR-145. [score:3]
To further compare the overall level of miR-143 and/or miR-145 expression in EC tissues to the paired EU tissues, we got a second analysis using R [2]. [score:3]
The results had not yet found that the expression of miR-143 and/or miR-145 in EN or EC changed with menstrual cycle. [score:3]
In previous studies, miR-143 and miR-145 were also found differentially expressed in endometriosis, although some with a bit difference from our results (9, 10, 16- 18). [score:3]
However, in the future, more and more studies should be performed to discover the relationship between miR-143/miR-145 and clinicopathological features of endometriosis, such as disease stages or clinical parameters, especially CA125 in endometriosis. [score:3]
As shown above, we found that miR-145 in EC group was up-regulated compared to EU group, but the difference did not reach statistically significance (p=0.020) when we used the Wilcoxon rank sum test. [score:3]
Using equation, we got the expression of miR-143 and/or miR-145 in all the samples (1). [score:3]
In this study, we employed stem-loop RT-PCR to quantify the miR-143 and miR-145 expression in endometrium of women with endometriosis, along with the endometrium of women without endometriosis. [score:3]
The body of expression data for miR-143 and miR-145 in endometriosis suggests that they may have a diagnostic and therapeutic potential. [score:3]
So the lack of knowledge about the targets for miR-143 and miR-145 hampered a full understanding on the biological functions and clinicopathological features. [score:3]
Real-time PCR analysis for miRNAs expression The miR-143 and miR-145 and endogenous control U6 primers (Table I) were purchased from the Invitrogen. [score:2]
To generate cDNA of miR-143, miR-145 and U6, 1μg of RNA and 10 μl DEPC H [2]O were first denatured at 70 [o]C for 10 min before quenching on ice, and then 50nM stem-loop RT primer with 1mM final of each of the four deoxynucleotide triphosphates, 2 U/ μl ribonuclease inhibitor, 5 U/ μl M-MLV reverse transcriptase and 1 ×M-MLV RT buffer (Toyobo Co. [score:2]
Taken together, the results imply that the miR-143 and/or miR-145 may play a certain role in the development and progression of endometriosis. [score:2]
MiR-143 and miRNA-145 are located within approximately 1.8 kb of each other in the chromosome 5q32 region, which led us to speculate that both precursors originate from the same primary miRNA (6). [score:1]
And we have selected miR-143 and miR-145 here for further analyses (data not shown). [score:1]
Our aim was to investigate the miR-143 and miR-145 expression in endometriosis and their relationships to clinicopathological variables in the patients. [score:1]
We drew a similar conclusion with miR-145. [score:1]
[1 to 20 of 25 sentences]
46
[+] score: 80
Actually, VEGF expression level also decreases when miR-145 expression is downregulated [17]. [score:8]
First, miR-145, which is downregulated in early stages of glioma progression [22] and behaves as a tumor suppressor [17], can migrate from endothelial to tumor cells and function as an “antiangiogenic” signal. [score:6]
Re -expression of miR-145 in U87 can inhibit glioma cells proliferation, invasion and angiogenesis in vitro and reduce glioma growth in vivo [17]. [score:5]
We used the U87 human glioblastoma cell line and HMEC, and focused on two human mature miRs, namely miR-145-5p which is expressed in HMEC but not in U87 [17], and miR-5096 which is expressed in U87 [4] but not reported in HMEC. [score:5]
Human hsa-miR-145-5p mimics (mirVana TM miRNA mimic, 4464066-MC11480), hsa-miR-145-5p inhibitors (mirVana TM miRNA mimic, 4464084-MH11480), hsa-miR-5096 mimics (mirVana TM miRNA mimic, 4464066-MC22429) and hsa-miR-5096 inhibitors (mirVana TM miRNA mimic, 4464084-MH22429) were purchased from Ambion (Invitrogen). [score:5]
Expression levels of miR-145 and miR-5096 in glioblastoma and microvascular endothelial cells. [score:3]
We first explored the basal expression level of miR-145-5p and miR-5096 in HMEC and U87 cells, in homotypic cultures. [score:3]
The cell-to-cell transfer of these miRs is inhibited by the loss of contact between HMEC and U87 cells and by the presence of the GJIC blocker, carbenoxolone, indicating that miR-145 and miR-5096 use the same intercellular transfer pathway (GJIC) to mediate their opposite effects on angiogenesis. [score:3]
This effect of miR-145 was initially related to its ability to decrease vascular endothelial growth factor (VEGF) expression levels [17]. [score:3]
Expression of mature miR-145-5p and miR-5096 in microvascular endothelial cells (HMEC) and glioblastoma cell line (U87). [score:3]
In these non-contact conditions, we failed to detect any increase in miR-145-5p expression level in U87 (Figure 2B). [score:3]
It is to note that carbenoxolone also prevented the transfer of miR-145-5p from HMEC to U87; the miR-145 expression levels in U87 were 2.2742±0.43 and 2.21±0.1 × 10-4, respectively in the absence and in the presence of carbenoxolone (means ± SD; P<0.05; n = 3), i. e. a miR-145 level similar to homotypic U87 culture (2.601±0.1 × 10-4, n=3; P>0.5). [score:3]
After 12 hours of co-culture, mir145-5p expression level was increased in both U87 (by 40%) and HMEC (by 20%) (Figure 1A). [score:3]
The opposite effect was observed when miR-145-5p mimic -transfected HMEC were co-cultured with U87, as this transfection inhibited the formation of capillary-like structures (Figure 4B, see supplementary Figure S1). [score:3]
Both HMEC and U87 expressed high levels of miR-145-5p (Figure 2A). [score:3]
Donor HMEC were loaded or not (empty; E) with miR-145 mimic (M; 30 nM) or inhibitor (I; 30 nM), and co-cultured with U87 for 5 h (left). [score:3]
We observed that miR-145-5p was almost exclusively expressed in HMEC and could not be detected at a significant level in U87 (Figure 1A). [score:3]
Expression of miR-145 was determined using TaqMan miRNA assay (Invitrogen) according the manufacturer's protocols. [score:2]
To determine whether miR-145-5p was transferred from endothelial to cancer cells, we transfected HMEC with a miR-145-5p mimic (30 nM) before culturing them with DiL-C18 -labelled U87 (ratio 1:1) for 12 hours. [score:1]
Level of miR-145 was expressed relative to the level of U6 snRNA (Ambion, 4427975-001973), used as internal control for each measurement. [score:1]
Figure 1 A, B. Expression level of miR-145-5p and miR-5096 was measured by qPCR in HMEC (black) and U87 (dashed), cultured separately (left) or co-cultured (right) for 12 h (means ± SD; * P<0.05; n = 3). [score:1]
A. Transfer of miR-145 from HMEC to U87. [score:1]
The observation that miR-145 can be transferred from HMECs to U87 enforces our previous demonstration that functional gap junctions between colon carcinoma cells and HMEC could permit the transfer of miR-145-5p from cell to cell [18]. [score:1]
B. Abolition of miR-145 transfer to U87 when cells are co-cultured in transwell plates (non-contact). [score:1]
These results indicate that U87 do not ingest extracellular miR-145-5p, either free or incorporated into soluble exosomes [18]. [score:1]
As previously reported [17], miR-145-5p mimic also decreased U87 cell proliferation (not shown). [score:1]
We have recently reported that miR-145-5p, which reduces glioma growth [17], could be exchanged between HMEC and colon cancer cells through gap junctions formed by Cx43 [18]. [score:1]
The two cell types were subsequently sorted by flow cytometry and miR145-5p expression was measured in each population. [score:1]
B. Comparative effects of miR-145 and miR-5096. [score:1]
A, B. Expression level of miR-145-5p and miR-5096 was measured by qPCR in HMEC (black) and U87 (dashed), cultured separately (left) or co-cultured (right) for 12 h (means ± SD; * P<0.05; n = 3). [score:1]
Altogether, these results suggest that, by modulating the tumor associated capillary-like network, the transfer of miR-145-5p from endothelial to cancer cells may decrease tumor growth whereas the transfer of miR-5096 from cancer to endothelial cells may have opposite effects by promoting angiogenesis. [score:1]
[1 to 20 of 31 sentences]
47
[+] score: 79
In Chinese sporadic gastric cancer tissues, the expressions of the oncogenic miR-21 and miR-155 were significantly up-regulated, while the expression of the tumor suppressor miR-145 was decreased, although this decrease was not statistically significant. [score:10]
Down-regulation of miR-145 expression has been reported in breast cancer [42], primary liver cancer [43], colorectal cancer [44]- [46], chronic lymphocytic leukemia, B-cell lymphomas, and Burkitt lymphoma [47]. [score:6]
In this paper, two potential oncogenic miRNAs (miR-21 and miR-155) and one potential tumor suppressor miRNA (miR-145) [12], [17] were chosen to investigate the relationship between miRNA expression level and Chinese gastric cancer, with the aim of elucidating possible differences in miRNA expression patterns within the Chinese population. [score:5]
All 12 cases of decreased miR-145 expression were found in poorly differentiated tumors, including 6 cases of intestinal-type gastric cancer, 6 cases of diffuse-type gastric cancer, 6 cases of less than 50 years old, 8 cases of tubular adenocarcinoma, 8 cases of lymph node metastasis, 8 cases of Hp infection, and 11 cases of progressive gastric cancer. [score:3]
miR-145 expression of paired cancerous and non-cancerous samples. [score:3]
But, in general, the expression of miR-145 in tumor tissue (6.215) was lower than that in non-cancerous tissue (11.924). [score:3]
But, our data showed that there was no significant difference in miR-145 expression between cancerous gastric tissue and non-cancerous gastric tissue from the same patient. [score:3]
In this study, there was no significant difference in the miR-145 expression between gastric cancer tissue and paired non-cancerous tissue. [score:3]
The expressed miR-145 content in cancerous tissues was 0.521 that in non-cancerous tissues (Fold=2 [−AverageΔCt (cancer tissues)] / 2 [−AverageΔCt (non-tumor tissues)]. [score:3]
There was no statistically significant difference in expression levels of miR-145 between cancerous and non-cancerous tissues (P > 0.05). [score:3]
Our results also demonstrated that expression of miR-21 and miR-145, whether in gastric cancer tissue or in noncancerous tissue, had a higher abundance than that of miR-155. [score:3]
miR-145 has been regarded as a tumor suppressor gene [17], [41]. [score:3]
These results mean that miR-145 expressions in non-cancerous and cancerous gastric tissue were not significantly different. [score:3]
This may indicate that miRNA-145 is expressed differently in different racial groups. [score:3]
The treatment of human colon cancer cells with miR-145 caused growth arrest and miR-145 was identified as a miRNA that inhibits the growth of human cancer cells [48]. [score:3]
However, there was no significant correlation between the expression of miR-145 and miR-155. [score:3]
Expression levels of miR-21, miR-145 and miR-155 were detected by quantitative reverse transcriptase PCR using a specific stem-loop primer, with U6 as the internal reference gene. [score:2]
The content of miR-145 in cancerous tissues was, however, not significantly lower than that in non-cancerous tissues (P = 0.134) (Table 2). [score:1]
In gastric non-cancerous tissues, the content of miR-21 and miR-145 were significantly higher than that of miR-155 (P = 0.001, P= 0.003, respectively), but there was no difference between the content of miR-21and that of miR-145 (P = 0.123). [score:1]
Value of ΔCt and the respective 2 [−ΔCt] of miR-145 in gastric tumor tissue (TT) and non-tumor tissue (NTT). [score:1]
The Ct values for miR-145 ranged from 24.343 to 34.352 in cancerous tissues and from 24.005 to 35.291 in non-cancerous tissues. [score:1]
The average ΔCt and the average miR-145 content (2 [−ΔCt]) for non-cancerous and cancerous gastric tissues were -2.137 and -1.640, and 11.924 and 6.215, respectively. [score:1]
A0: miR-21 in NTT; A1: miR-21 in TT; B0: miR-145 in NTT; B1: miR-145 in TT; C0: miR-153 in NTT; C1: miR-153 in TT. [score:1]
Increased contents of miR-21 and -155, and changes in miR-145 content in gastric cancer were not associated with age (>50 vs <50), Lauren classification (intestinal vs diffuse), WHO classification (tubular adenocarcinoma, signet-ring cell carcinoma, mucinous adenocarcinoma), differentiation (moderate-well + moderate, moderate-poor, poor), lymph node status (N0, N1, N2+N3), TNM stage (I, II, III, IV), or helicobacter pylori (Hp) infection (negative vs positive) (data not shown). [score:1]
In cancerous tissues, the content of miR-21 was significantly higher than that of miR-145 and miR-155 (P = 0.001, P = 0.001, respectively), and the content of miR-145 was significantly higher than that of miR-155 (P = 0.004). [score:1]
The mean RQ of miR-21 was 5.161±6.908; The mean RQ of miR-145 was 3.014±7.719; The mean RQ of miR-155 was 4.696±5.690. [score:1]
In non-cancerous tissues of the 20 cases, the Ct value of miR-145 was less than that of miR-155. [score:1]
Fig. 5The mean RQ of miR-21 was 5.161±6.908; The mean RQ of miR-145 was 3.014±7.719; The mean RQ of miR-155 was 4.696±5.690. [score:1]
We sought to investigate the expression patterns of the miRNAs, miR-21, miR-145 and miR-155 in sporadic gastric cancer in a Chinese population. [score:1]
Fold change (RQ=2 [−ΔΔCt]) values of miR-21, -145, -155 are shown in Fig. 5. Spearman rank test data showed that there were significant correlations among the fold changes of miR-21 and miR-145, and miR-21 and miR-155. [score:1]
The Ct value of miR-21 was less than that of miR-155, except one case (data test undetermined) in non-cancerous tissues, and the Ct value of miR-145 was less than that of miR-155 in the cancerous tissue of 19 cases. [score:1]
Fig. 3Value of ΔCt and the respective 2 [−ΔCt] of miR-145 in gastric tumor tissue (TT) and non-tumor tissue (NTT). [score:1]
The correlation between RQ of miR-21 and RQ of miR-145: P = 0.013, r = 0.558 (Spearman Rank test, 2-tailed); The correlation between RQ of miR-21 and RQ of miR-155: P = 0.000, r = 0.904 (Pearson test, 2-tailed); The correlation between RQ of miR-145 and RQ of miR-155: P = 0.110, r = 0.368 (Spearman Rank test, 2-tailed). [score:1]
-ΔCt and 2 [−ΔCt] values of miR-145 of non-cancerous and cancerous tissue are presented in Fig. 3. ΔCt = Ct [(miR−145)]–Ct [(U6)]. [score:1]
[1 to 20 of 34 sentences]
48
[+] score: 74
Carrier DiseaseTarget miRNA (s) and role in cancer Viruses Adeno -associated viruses(AAV8)Hepatocellular cancer miR-26 tumor suppressor[140] Adenoviruses Lung cancer let-7 tumor suppressor[141] Adenoviruses Glioblastoma miR-145 tumor suppressor [144] Adenoviruses Glioblastoma miR-221-222 oncogene[145] Lentiviruses Prostate cancer miR-15-16 tumor suppressor[142] Lentiviruses Pancreatic cancer miR-21 oncogene [143] Lipid -based nanoparticles Cationic liposomes Breast cancer miR-34a tumor suppressor[124] Cationic liposomes Pancreatic cancer miR-34a, miR-143-145 tumor suppressors[146] Neutral lipid emulsion © Lung cancer miR-34a, let-7 tumor suppressors[147] Stable nucleic acid lipid particles Glioblastoma miR-21 oncogene[148] Polymer -based nanoparticles Polyurethane Glioblastoma miR-145 tumor suppressor[149] Poly(lactic-co-glycolic acid) Lymphoma miR-155 oncogene[96] Polyamidoamine Glioblastoma miR-21 oncogene[150]Viral vectors have also been applied in miRNA -based therapeutic strategies towards GBM. [score:21]
Carrier DiseaseTarget miRNA (s) and role in cancer Viruses Adeno -associated viruses(AAV8)Hepatocellular cancer miR-26 tumor suppressor[140] Adenoviruses Lung cancer let-7 tumor suppressor[141] Adenoviruses Glioblastoma miR-145 tumor suppressor [144] Adenoviruses Glioblastoma miR-221-222 oncogene[145] Lentiviruses Prostate cancer miR-15-16 tumor suppressor[142] Lentiviruses Pancreatic cancer miR-21 oncogene [143] Lipid -based nanoparticles Cationic liposomes Breast cancer miR-34a tumor suppressor[124] Cationic liposomes Pancreatic cancer miR-34a, miR-143-145 tumor suppressors[146] Neutral lipid emulsion © Lung cancer miR-34a, let-7 tumor suppressors[147] Stable nucleic acid lipid particles Glioblastoma miR-21 oncogene[148] Polymer -based nanoparticles Polyurethane Glioblastoma miR-145 tumor suppressor[149] Poly(lactic-co-glycolic acid) Lymphoma miR-155 oncogene[96] Polyamidoamine Glioblastoma miR-21 oncogene[150] Viral vectors have also been applied in miRNA -based therapeutic strategies towards GBM. [score:21]
Lee and colleagues took advantage of the abundant expression of the enzyme telomerase reverse transcriptase (hTERT) in cancer cells and developed a multimodal GBM -targeting approach, combining hTERT -targeting ribozyme-controlled HSV-tk expression with overexpression of miR-145, a miRNA that is usually downregulated in GBM [144]. [score:14]
Moreover, PU-PEI -mediated miR-145 expression in CD133 [+] cells suppressed the expression of anti-apoptotic and drug-resistance genes, while increasing the cell sensitivity to radiation and temozolomide (TMZ). [score:7]
HSVtk and miR-145 under control of the CMV promoter, to ensure high expression of the transgene in the target cells. [score:5]
Lee S. J. Kim S. J. Seo H. H. Shin S. P. Kim D. Park C. S. Kim K. T. Kim Y. H. Jeong J. S. Kim I. H. Over -expression of mir-145 enhances the effectiveness of hsvtk gene therapy for malignant glioma Cancer Lett. [score:3]
In a xenograft mice mo del, the intratumoral administration of the adenovirus harboring the HSV-tk expression cassette plus miR-145, combined with intraperitoneal injection of ganciclovir, resulted in increased animal survival, when compared to that observed with the administration of virus coding for HSV-tk or miR-145 per se [144]. [score:2]
Using PU-PEI as a delivery vehicle, Yang and colleagues reported efficient delivery of miR-145 to CD133 [+] GBM cells, which resulted in a significant decrease in their tumorigenic potential and facilitated differentiation into CD133 -negative cells [149]. [score:1]
[1 to 20 of 8 sentences]
49
[+] score: 72
Primary findings of interest include: (1) the placental amnion and the reflected amnion of TIL cases also have distinct miRNA expression patterns as is the case with transcriptome; (2) the miR-143/miR-145 cluster is among the down-regulated miRNAs in the reflected amnion with labor; (3) miR-143/miR-145 expression is significantly higher in AMCs than in AECs; (4) miR-143 targets PTGS2 3′ UTR in amnion cells; and (5) miR-143 regulation of PTGS2 occurs largely by translational repression. [score:13]
When we confirmed their expressions by qRT-PCR, the miR-143/miR-145 expression was significantly lower in the reflected amnion of both TNL and TIL cases (p<0.05 for each); and its expression in the reflected amnion also significantly decreased with labor (p<0.05). [score:7]
Furthermore, expression patterns of the miR-143/miR-145 cluster strongly suggest that miRNA -mediated regulation of gene expression in the amnion is a cell type-specific event. [score:6]
miR-143 and miR-145 expression levels were normalized with 5S rRNA expression. [score:5]
Among miRNAs down-regulated with labor in the reflected amnion, we found the presence of miR-143 and miR-145 as well as their relative abundance in AMCs intriguing and relevant. [score:4]
Thirty-one (97%) miRNAs, which included miR-143 and miR-145, a cardiovascular-specific miRNA cluster, were down-regulated in the reflected amnion. [score:4]
In this context, it is also possible that the difference in miR-143/miR-145 expression between placental amnion and reflected amnion can be related to a potential difference in the ratio of amnion epithelial and mesenchymal cells between placental amnion and reflected amnion. [score:3]
Analyses of miR-143 and miR-145 by qRT-PCR confirmed microarray results, and further demonstrated their decreased expression in the reflected amnion with labor. [score:3]
B, The differential expression patterns of miR-145 are basically identical to those of miR-143. [score:3]
Interestingly, expression of miR-143 and miR-145 was higher in AMCs than in AECs (p<0.05). [score:3]
miR-143/miR-145 cluster expression in PA and RA. [score:3]
This cluster was the transcriptional target of the serum response factor, myocardin and NK2 transcription factor related, locus 5 (Nkx2-5), especially miR-145 could induce smooth muscle differentiation of neural crest stem cells. [score:3]
Higher expression of miR-143/miR-145 in AMCs than in AECs, therefore, could be explained by intrinsic phenotype of the cells and is biologically quite relevant. [score:3]
The miR-143 and miR-145 expressions were 7.7-fold and 5.7-fold higher in the placental amnion than in the reflected amnion of TIL cases, respectively (p<0.005 for each). [score:3]
The miR-143 and miR-145 expressions in the TNL reflected amnion were 3.2-fold and 2.4-fold higher than in the TIL reflected amnion, respectively (p<0.005 for each) (Figure 1A and 1B). [score:3]
For miRNA expression analysis, miR-143 (002146) and miR-145 (002149) TaqMan assays were used with 5S ribosomal RNA (4332078) as a normalizer. [score:2]
In miR-143/miR-145 knockout mice, vascular neointima formation after injury is blocked due to perturbations in actin stress fiber formation [38]. [score:2]
The miR-143/miR-145 cluster has been wi dely studied in vascular smooth-muscle cells [36]. [score:1]
Cordes et al have demonstrated that the miR-143/miR-145 cluster is abundant in the developing heart and in their localization in smooth muscle cells and neural crest stem cell-derived vascular smooth muscle cells [37]. [score:1]
[1 to 20 of 19 sentences]
50
[+] score: 68
For example, downregulation of miRNAs, such as miR-145, -195, -383 and miR-378, was found in CRC relative to their expressions in normal mucosa, whereas, some upregulated miRNAs, like miR-96, -135b, miR-493 and miR-133a, have also been found associated with CRC [19], [20]. [score:9]
The expressions of 17 of the dysregulated miRNAs (miR-145*, -145, -214, -4770, -378*, -99a, -193b, -100, -125b, -3195, -30e*, -9, -125a-5p, let-7b, miR-24-1*, -1979, and -768-3p) were significantly lower in both colon and rectal cancers compared with normal tissues, but of the remaining 5, miR-133a and miR-140-3p were found significantly downregulated (P<0.05) only in rectal cancers, and miR-27b*, miR-30a, and miR-29b-2* were significantly downregulated only in colon cancers (P<0.05; Figure 1). [score:9]
Among the downregulated, miR-145* had the highest fold change (23.8-fold), while others that were downregulated more than 5-fold included miR-145, -101*, -133a, -214, -4768-3p, -4770, let-7e, miR-378*, -99a, -193b, -100, and -1185. [score:7]
Secondly, 320 significantly dysregulated miRNAs were identified in stage III tumors, among which there were 282 downregulated miRNAs, including miR-145* with a −18.9-fold change. [score:5]
Altogether, 17 dysregulated miRNAs that have similar expression patterns in both colon and rectal cancer were identified, including miR-145*, -145, -214, -4770, -378*, -99a, -193b, -100, -125b, -3195, -30e*, -9, -125a-5p, let-7b, miR-24-1*, -1979, and -768-3p. [score:4]
These consisted of 206 downregulated miRNAs, in which miR-145 had the highest fold-change, −18.15-fold (Table S3). [score:4]
The 22 overlapping miRNAs were miR-145*, -145, -133a, -214, -4770, -378*, -99a, -193b, -100, -125b, -3195, -30e*, -9, -29b-2*, -125a-5p, let-7b, miR-24-1*, -27b*, -30a, -1979, -140-3p, and -768-3p, all of which were downregulated. [score:4]
Altogether, 23 overlapped miRNAs in the paired t-tests were found, all downregulated, including miR-145*, -145, -101*, -133a, -214, -4770, -378*, -99a, -193b, -100, -125b, -3195, -30e*, -9, -29b-2*, -125a-5p, let-7b, miR-24-1*, -27b*, -30a, -1979, -140-3p, and -768-3p. [score:4]
To confirm the reproducibility of our findings, we performed an independent sample test for expression levels of miR-145*,-30e*,-378*,-125a-5p,-3195 and -4770. [score:3]
To confirm microRNA profiling results, we performed an independent sample test to compare the expression levels of 6 altered miRNAs (miR-145*, -30e*, -378*, -125a-5p, -3195, and -4770) between tumor and paired normal tissues. [score:3]
Expression levels of miR-145*, -30e*, -378*, -125a-5p, -3195, and -4770 in an independent sample test. [score:3]
For example, the expression pattern of miR-145 reported in Hamfjord et al. 's [19] study is the same as our findings, but that of miR-7 differs. [score:3]
The pattern of altered miRNAs was confirmed by an independent sample test that verified the expression levels of miR-145*,-30e*,-378*,-125a-5p,-3195 and -4770. [score:3]
Among the dysregulated miRNAs, the fold changes of miR-1 and miR-145 were greatest (>15-fold). [score:2]
Our findings, as mentioned above, indicated that 22 dysregulated miRNAs (miR-145*, -145, -133a, -214, -4770, -378*, -99a, -193b, -100, -125b, -3195, -30e*, -9, -29b-2*, -125a-5p, let-7b, -24-1*, -27b*, -30a, -1979, -140-3p, and -768-3p) had good potential as biomarkers for distinguishing CRC patients from normal individuals. [score:2]
Among 17 identified miRNAs, some have been reported previously, such as miR-145 and miR-214, consistent with our findings [15], [16]. [score:1]
Most importantly, several identified miRNAs in our study, such as miR-145*, -30e*, -378*, -125a-5p, -3195, and -4770, have been rarely mentioned in the literature. [score:1]
Others with fold changes greater than 6-fold included miR-145*, -137, -133a, -4470, -143, -163, and miR-490-5p. [score:1]
[1 to 20 of 18 sentences]
51
[+] score: 68
Expression of ROCK1 and EIF2AK1 was up-regulated in the clinical GBM TCGA samples conforming to down-regulated miR-145. [score:9]
Increased miR-145 expression inhibits self-renewal, represses expression of pluripotency genes, and induces lineage-restricted differentiation in human embryonic stem cells [27]. [score:7]
The predicted targets of miR-145, ROCK1 and EIF2AK1, were proliferation-reducing siRNA hits in our study resembling the miR-145 proliferation effect and thus proving these experimentally as novel putative miRNA targets. [score:5]
0060930.g004 Figure 4 Significant survival difference with p<0.005 is seen between the hsa-miR-145 low expression group (group denoted with −1, n = 53) who have poor survival and the high or normal expression group (denoted with 0, n = 215) with a threefold change threshold between patient groups. [score:5]
Significant survival difference with p<0.005 is seen between the hsa-miR-145 low expression group (group denoted with −1, n = 53) who have poor survival and the high or normal expression group (denoted with 0, n = 215) with a threefold change threshold between patient groups. [score:5]
ROCK1 and EIF2AK1 are highly predicted miRNA targets of mir-145 from Target Scan (see Table 3). [score:5]
miRNA Expressionp-value Expression fold change (log2) Survivalp-value hsa-miR-136 7.52E-14 −1.69 NS hsa-miR-145 5.88E-04 −1.04 0.005 hsa-miR-155 1.18E-21 1.94 NS hsa-miR-181b 5.44E-02 −0.22 NS hsa-miR-342 4.35E-10 −1.25 NS hsa-miR-129 1.29E-16 −3.39 NS hsa-miR-376a 4.35E-07 −0.63 NS hsa-miR-376b 7.37E-02 0.07 NS Survival p-value was calculated from miRNA expression data with Kaplan-Meier analysis. [score:5]
Higher hsa-miR-145 expression in GBM tumors yielded significantly longer survival (p-value<0.005, fold-change threshold = 3, n = 53 and n = 215 in groups) in a small subset of patients; the longest survival time was 120 months, whereas in the miR-145 low expression group, the longest survival time was only 40 months. [score:5]
Previously, the pluripotency factors OCT4, SOX2, and KLF4 were shown to be direct targets of miR-145. [score:4]
Hsa-miR-145 was expressed at significantly lower levels in GBM patient tissue samples and cell lines when compared to normal brain tissue, and low expression of miR-145 in GBM tumors was significantly associated with poor survival based on a Kaplan-Meier analysis of the TCGA GBM data. [score:4]
In glioblastoma multiforme, SOX2 down-regulates miR-145, and both are probably involved in a double -negative feedback loop in maintaining the stemness of glioma stem cells [27], [28]. [score:4]
Overexpression of the miR-145 precursor reduced cell proliferation in the A172 and LN405 cell lines and increased apoptosis in the A172 cell line. [score:3]
Low expression of hsa-miR-145 in GBM tumors was significantly associated with poor survival based on a Kaplan-Meier analysis (Figure 4). [score:3]
The mean survival time for patients with high or low levels (high level: 0 group, low level: –1 group) of hsa-miR-145 was 14.9 months and 10.7 months, respectively. [score:1]
Kaplan-Meier analysis of the hsa-miR-145 miRNA in clinical TCGA GBM samples (n = 268 in total). [score:1]
The clearest effects were observed for miR-145, which caused an S phase block to the cell cycle in the A172 cell line and a similar effect in the LN405 cell line although this was not significant (Figure S2). [score:1]
Most of these same miRNA precursors were tested and caused reduction in cell confluency of the A172 and LN405 cell lines, except miR-145, which had a significant effect in time-lapse phase contrast microscopy only in the A172 cell line (Figure 2). [score:1]
[1 to 20 of 17 sentences]
52
[+] score: 68
Inhibition of KRAS [mut] colon tumors with miR145, an embryonic SC inhibitor, suppresses their malignant growth. [score:7]
Global inhibition of the embryonic SC-like program, by epigenetic regulators such as miRNAs (e. g., mir145), or inhibitors of multiple key pathways involved in embryonic SC signaling represents novel therapeutic strategies for blocking KRAS [mut] colon tumor development. [score:7]
We have linked the activation of the embryonic SC-like program in KRAS [mut] colon cancer cells with its potential for malignant transformation by showing that miR145, a well established repressor of embryonic SC development [31], increased the expression of differentiation markers and suppressed their ability to initiate tumors. [score:6]
In particular, miR145 was demonstrated to induce human embryonic SC lineage-restricted differentiation through direct inhibition of pluripotency genes and suppression of human embryonic SC self-renewal [31]. [score:6]
Because colon cancer cells are of endodermal origin, KRAS [mut] SW48 cells had high basal expression of endoderm differentiation markers that were not increased further by miR145 expression (Figure 4B). [score:5]
B. Relative gene expression levels of differentiation marker genes in KRAS [mut] SW48 cells expressing lenti-pCCL-Scramble or lenti-pCCL-miR145 as quantified by RT-PCR and normalized to parental KRAS [mut] SW48 cells. [score:5]
miR145 promotes gene expression of differentiation markers in KRAS [mut] colon cancer cells and inhibits tumorigenesis. [score:5]
Figure 4miR145 promotes gene expression of differentiation markers in KRAS [mut] colon cancer cells and inhibits tumorigenesis A. Relative U6 and miR145 levels in KRAS [mut] SW48 cells expressing lenti-pCCL-Scramble and lenti-pCCL-miR145 as measured by quantitative RT-PCR and normalized to parental SW48 cells. [score:5]
The expression of lenti-miR145 in KRAS [mut] SW48 cells reduced their clonogenic growth in soft agar by 43% (Figure 4C). [score:3]
In comparison to lenti-Scramble control, transduction of lenti-miR145 into KRAS [mut] SW48 cells increased the relative gene expression of well-known mesoderm and ectoderm differentiation markers (Figure 4A and 4B). [score:3]
D. Tumor xenografts of KRAS [mut] SW48 cells expressing lenti-pCCL-Scramble and lenti-pCCL-miR145 with representative tumor images (upper). [score:3]
Just like human embryonic SC, human colon tumors and the parental KRAS [wt] SW48 cells, KRAS [mut] SW48 cells, which harbor the embryonic SC-like program, did not express miR145 (Figure 4A) [31, 32]. [score:3]
Furthermore, miR145 inhibited the tumor growth of KRAS [mut] SW48 cells by 51% (Figure 4D). [score:3]
To test the ability of miR145 to inhibit tumorigenic growth, we performed both in vitro soft agar growth assays and in vivo tumor xenograft experiments in immunocompromised mice. [score:2]
Primers for quantitative RT-PCR of U6 snRNA and miR145 (target sequence 5′-GUC CAG UUU UCC CAG GAA UCC CU-3′) were obtained from Exiqon. [score:2]
C. Colony Growth of KRAS [mut] SW48 cells expressing lenti-pCCL-Scramble or lenti-pCCL-miR145 in soft agar assays with representative images (right). [score:2]
A. Relative U6 and miR145 levels in KRAS [mut] SW48 cells expressing lenti-pCCL-Scramble and lenti-pCCL-miR145 as measured by quantitative RT-PCR and normalized to parental SW48 cells. [score:1]
[1 to 20 of 17 sentences]
53
[+] score: 63
0033762.g004 Figure 4 Has-miR-100 and has-miR-125b down-regulation were significantly associated with poorer survival, and has-let-7c, has-miR-143, has-miR-145 and has-miR-199a-5p down-regulation tended to predict poorer survival, although these results were not statistically significant. [score:7]
Has-miR-100 and has-miR-125b down-regulation were significantly associated with poorer survival, and has-let-7c, has-miR-143, has-miR-145 and has-miR-199a-5p down-regulation tended to predict poorer survival, although these results were not statistically significant. [score:7]
Kaplan–Meier survival analyses revealed that the SCCC patients with low expression of has-miR-100 (P = 0.019) and has-miR-125b (P = 0.020) had a poorer prognosis compared to patients with high expression of these miRNAs, while has-let-7c (P = 0.071), has-miR-143 (P = 0.064), has-miR-145 (P = 0.072) and has-miR-199a-5p (P = 0.056) down-regulation tended to adversely affect survival. [score:7]
Several miR-143 targets, including DNMT3A and KRAS [32], [33], and miR-145 targets including BNIP3, IRS, C-MYC, YES and STAT1 [34]– [36], have been identified, indicating that miR-143 and 145 act as tumor suppressors to repress tumor proliferation or promote apoptosis. [score:7]
In this study, we observed that downregulation of six miRNAs (has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p) is associated with advanced tumor stage, lymph node metastasis and poorer survival in SCCC patients (Table 1 ), suggesting that clustering analysis based on miRNA expression may facilitate a detailed individual diagnosis of SCCC patients. [score:6]
In conclusion, this study has revealed that downregulation of has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p are significantly correlated with advanced tumor stage, lymph node metastasis and poorer survival in SCCC. [score:4]
Among, downregulation of six miRNAs, has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were significantly associated with lymph node metastasis and reduced survival in SCCC. [score:4]
Interestingly, of the nine miRNAs associated with metastasis, downregulation of has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were also significantly correlated with advanced tumor stage as described above. [score:4]
Seven miRNAs, has-let-7c, has-miR-10b, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were significantly down-regulated in advanced stage SCCCpatients (FIGO IB2-IV) compared to early stage SCCC patients (FIGOIB1). [score:3]
Sachdeva et al. observed that miR-145 targets multiple metastasis-related genes including MMP-11 and ADAM-17 [40], which may potentially contribute to increased metastasis in SCCC. [score:3]
Kaplan-Meier estimates of overall survival in 44 patients with stage small cell carcinoma of the cervix according to has-let-7c (A), has-miR-100 (B), has-miR-125b (C), has-miR-143 (D), has-miR-145 (E) andas-miR-199a-5p expression (F). [score:3]
0033762.g006 Figure 6The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.030); (B) has-miR-100 (P = 0.025); (C) has-miR-125b (P = 0.007); (D) has-miR-143 (P = 0.016); (E) has-miR-145 (P = 0.009); (F) has-miR-199a-5p (P = 0.008). [score:1]
The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.030); (B) has-miR-100 (P = 0.025); (C) has-miR-125b (P = 0.007); (D) has-miR-143 (P = 0.016); (E) has-miR-145 (P = 0.009); (F) has-miR-199a-5p (P = 0.008). [score:1]
0033762.g005 Figure 5The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.009); (B) has-miR-100 (P = 0.002); (C) has-miR-125b (P = 0.003); (D) has-miR-143 (P = 0.006); (E) has-miR-145 (P = 0.004); (F) has-miR-199a-5p (P = 0.015). [score:1]
Similarly, the sensitivity and specificity of discriminate presence or absence of lymph node metastasis for each miRNA were: has-let-7c (P = 0.030, has-miR-100 (P = 0.025), has-miR-125b (P = 0.007), has-miR-143 (P = 0.016), has-miR-145 (P = 0.009), has-miR-199a-5p (P = 0.008). [score:1]
Has-let-7c, has-miR-10b, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were significantly down- regulated in advanced stage SCCC, compared to early stage SCCC. [score:1]
We also identified nine miRNAs (has-let-7c, has-miR-31, has-miR-100, has-miR-125b, has-miR-143, has-miR-145, has-miR-199a-5p, has-miR-203 and has-miR-218) which could significantly discriminate between tumor tissues from patients with metastasis (M, n = 13) and without metastasis (NM, n = 31, P<0.05). [score:1]
The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.009); (B) has-miR-100 (P = 0.002); (C) has-miR-125b (P = 0.003); (D) has-miR-143 (P = 0.006); (E) has-miR-145 (P = 0.004); (F) has-miR-199a-5p (P = 0.015). [score:1]
The sensitivity and specificity of discriminate early from advanced tumour stages for each miRNA were plotted: has-let-7c (P = 0.009), has-miR-100 (P = 0.002), has-miR-125b (P = 0.003), has-miR-143 (P = 0.006), has-miR-145 (P = 0.004), has-miR-199a-5p (P = 0.015). [score:1]
[1 to 20 of 19 sentences]
54
[+] score: 60
The 6 upregulated miRNAs (mmu-miR-5132-5p, mmu-miR-3104-5p, mmu-miR-669c-5p, mmu-miR-705, mmu-miR-760-3p, mmu-miR-1962) and the 9 downregulated miRNAs (mmu-miR-146a, mmu-miR-138, mmu-miR-5123, mmu-miR-196b, mmu-miR-5099, mmu-miR-150, mmu-miR-145, mmu-miR-27a, mmu-miR-23a) chosen for validation were also based on their target genes predicted, whose functions are well relevant to inflammation and cancer. [score:9]
Only one patient (Sample 6) showed upregulation of miR-145, but the upregulation was not significant (Figure 3B, p>0.05). [score:7]
As shown in Figure 3, in overall, the expression level of miR-138, miR-145, miR-146a and miR-150 were downregulated by approximately 3.37, 3.39, 2.56 and 4.99 fold in colorectal cancers than those in the matched adjacent normal mucosa (p<0.0001). [score:6]
Among them, all the 16 colorectal cancers showed downregulated miR-138 and miR-150 levels (Figures 3A and 3D), and 15 out of the 16 colorectal cancers showed lower miR-145 and miR-146a expression levels than normal control (Figures 3B and 3C). [score:6]
Moreover, microRNA-145 induces apoptosis with the induction of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression, targeted oncogene socs7 and regulated interferon-β induction through STAT3 nuclear translocation in bladder cancer cells [45]. [score:6]
Please be noted that CCT3 and PAPPA were the common targets for miR-138, miR-146a and miR-150, and ZHX2 was the common target for miR-138, miR-145 and miR-150. [score:5]
As shown in Figure 5 and Table 2, there were 21, 13 and 25 common targets between miR-138 and miR-145, miR-146a and miR-150, respectively; there were 16 and 15 common between miR-145 and miR-146a and miR-150, respectively; and there were 7 common targets between miR-146a and miR-150. [score:5]
miR145 could target the SOX9/ADAM17 axis and inhibit tumor-initiating cells and IL-6 -mediated paracrine effects in head and neck cancer [44]. [score:5]
B, miR-145 was significantly downregulated in colorectal cancers. [score:4]
B, miR-145 was significantly downregulated in colitis. [score:4]
miR-145 is also a tumor suppressor gene. [score:3]
[1 to 20 of 11 sentences]
55
[+] score: 55
Therefore, in order to confirm the involvement of (1) hsa-miR-145 on the expression of its predicted target mRNA Cldn10 and of (2) hsa-miR-892b on Esrrg mRNA, we cloned the 3′UTR regions of these targets in a luciferase reporter system. [score:7]
Correlation between the expression of Cldn10 and Esrrg with the expression of miR-145 and miR-892b. [score:5]
Immortalized human epididymal epithelial cells [47] were used for experimental confirmation of the role of miR-145 on the expression of Cldn10 and miR-892b on the expression of Esrrg. [score:5]
Interestingly, a strong negative correlation (r = −0,89, P-value≤0.001) was found between the pattern of expression of miR-892b and its potential mRNA target Esrrg (Estrogen Related Receptor Gamma) and with miR-145 and Cldn10 mRNA (r = −0,92, P-value≤0.001). [score:5]
We confirmed that miR-145 and miR-892b inhibit the expression of the luciferase reporter via Cldn10 and Esrrg 3′ UTRs, respectively. [score:5]
The gene encoding for Claudin10 (Cldn10) is predicted to be regulated by miR-145 whose expression is negatively correlated with this gene (Fig. 6). [score:4]
Considering the role of Cldn10 in epididymal functions and the presumed importance of cluster miR-888 target genes such as Esrrg, we focused our interest on these two genes and conducted an experimental approach to determine if Cldn10 was regulated by miR-145 and Esrrg by miR-892b. [score:4]
Experimental confirmation of target genes regulation by miR-145 and miR-892b using a luciferase reporter system. [score:4]
24 hours later, co-transfection of 0.4 ug of plasmid DNA clones (control plasmid without miRNA target sequences, P-miR-Cldn10 or P-miR-Esrrg) with synthetic miRNAs that mimic endogenous miRNAs (5 nM Syn-hsa-miR-145 miScript miRNA Mimic or 5 nM Syn-hsa-miR-892b miScript miRNA Mimic (Qiagen, Toronto, ON, Canada)) was performed by using the Attractene transfection reagent (Qiagen) according to the manufacturer's protocol. [score:3]
In order to confirm the role of miR-145 on the expression of Cldn10 and miR-892b on Esrrg, we conducted a series of co-transfection experiments by using mimic Syn-hsa-miR-145 and Syn-hsa-miR-892b along with a luciferase reporter system containing the 3′UTR sequence of Cldn10 or Esrrg (Fig. 7). [score:3]
These results suggest that hsa-miR-145 significantly and specifically affects the expression of Cldn10 at the post-transcriptional level. [score:3]
We therefore confirmed the respective roles of miR-145 and miR-892b, in the post-transcriptional regulation of Cldn10 and Esrrg. [score:2]
Our observation regarding the regulation of Cldn10 by miR-145 therefore opens new avenues on the factors that can affect epididymal functions that are essential for proper sperm maturation. [score:2]
A control plasmid (P-miR), or plasmids containing the 3′UTR sequences of Cldn10 (P-miR-Cldn10) or Esrrg (P-miR-Esrrg) were co -transfected in the presence (+) or in the absence (−) of mimics Syn-Hsa-miR-145 or Syn-Hsa-miR-892b. [score:1]
0034996.g007 Figure 7 A control plasmid (P-miR), or plasmids containing the 3′UTR sequences of Cldn10 (P-miR-Cldn10) or Esrrg (P-miR-Esrrg) were co -transfected in the presence (+) or in the absence (−) of mimics Syn-Hsa-miR-145 or Syn-Hsa-miR-892b. [score:1]
Luciferase activity was not affected by the presence of hsa-miR-145 which does not bind the 3′UTR of Esrrg (Fig. 7, P-miR-Esrrg). [score:1]
[1 to 20 of 16 sentences]
56
[+] score: 54
Calin et al. reported that one of the most upregulated miRNAs is miR-106a, which is consistently reported in six studies, and the five most downregulated miRNAs are miR-30a-3p, miR-139, miR-145, miR-125a, and miR-133a, which are consistently reported and differentially expressed in four studies; these miRNAs may actually be of clinical use as diagnostic/prognostic biomarkers or therapeutic targets [3]. [score:11]
Notably, Panza A, et al., found that miR-145 is a novel target of PPARγ, acting as a tumor suppressor in CRC cell lines and being a key regulator of intestinal cell differentiation by directly targeting SOX9, a marker of undifferentiated progenitors in the colonic crypts [22]. [score:9]
In summary, our real-time PCR results identified alterations of miRNA expression in CRC with two down-regulated miRNAs (miR-378* and miR-145), which may be novel candidate biomarkers for CRC. [score:6]
For example, E Bandrés et al. reported that miR-31, miR-96, miR-133b, miR-135b, miR-145, and miR-183 are the most significantly deregulated miRNAs and the expression level of miR-31 was correlated with the stage of CRC tumor [2]. [score:4]
Furthermore, Cui SY et al. found that microRNA-145 as a potent tumour suppressor that regulates multiple cellular pathways [16]. [score:4]
Twelve miRNAs (hsa-miR-130b, hsa-miR-203, hsa-miR-1974, hsa-miR-592, hsa-miR-200a, hsa-miR-429, hsa-miR-183, hsa-miR-182, hsa-miR-1290, hsa-miR-141, hsa-miR-135b, and hsa-miR-96) were overexpressed, whereas 84 miRNAs (hsa-miR-1, hsa-miR-145, hsa-miR-145*, and so on) were downexpressed in tumor tissues compared with those in normal tissues. [score:4]
Conditional logistic regression results confirmed that miRNA-378 and miRNA-145 expression profile was statistically significant. [score:3]
Expression levels of miR-378* and miR-145 varied in different clinical stages. [score:3]
Most important is HouY et al. suggest that microRNA-145 as ideal biomarker for the diagnosis of various carcinomas [17]. [score:1]
Futher analysis reveals miR-378* and miR-145 exhibits potential as a good diagnostic and prognostic marker. [score:1]
A score of −1.167 (fold change 0.833) or greater for miR-145 had 93.3% specificity but had sensitivity of only 93.8% (See Figure  4, Table  4). [score:1]
Similarly,miR145 is also the kept variable with statistical significance to distinguish CRC from normal tissues (P < 0.05; odds ratio = 4.21; 95% CI of odds ratio = 1.17 to 15.13) (Table  2). [score:1]
Although, both miR-145 and miR-378* contribute to the probability of CRC, comparison between the roles of miR-145 and miR-378* in the CRC progression will give more information to the cell transcription mechanisms. [score:1]
MiRNA-145 and miRNA-378* are potential biomarkers for early detection of CRC, which may help in diagnosing CRC in early period. [score:1]
On the other hand, we found seven statistically significant miRNAs, namely, miR-145, miR-363, miR-378*, miR-137, miR-100, miR-125a-5p, miR-143 in conditional forward method. [score:1]
Logistic regression and fold change of miR-145 in different clinical stages. [score:1]
This result was consistent with Pagliu A. et al. ’s study who found that analysis of the combined action of miR-143 and miR-145 on oncogenic pathways in colorectal cancer cells reveals a coordinate program of gene repression [12]. [score:1]
Conditional logistic regression was used to screen the factors contributed to the occurrence of tumor, among which miR-145 and miR-378* were found being statistically significant. [score:1]
[1 to 20 of 18 sentences]
57
[+] score: 53
Two of them, miR-133b and miR-145 were down-regulated and the remaining four, miR-31, miR-96, miR-135b and miR-183, were up-regulated, suggesting that they may potentially act as tumor suppressor genes or oncogenes, respectively. [score:9]
In particular, miR-145 is progressively down-regulated from normal breast to cancer with high proliferation index and miR-21 is progressively up-regulated with high grade tumor stage. [score:7]
In this context, we detected an over -expression of miR-19a, miR-21, miR-29a, miR-92, miR-148a, miR-200b, and a down-regulation of miR-30c, miR-133a and miR-145 (figure 2). [score:6]
In our study, expression of miR-145 was not detected in any of 15 CRC cell lines tested and down-regulation was detected in all tumor samples. [score:6]
For both down-regulated miRNAs (miR-145 and miR-133b), it may be expected that potential targets could include oncogenes or genes encoding proteins with potential oncogenic functions. [score:6]
miR-145 was identified as a specific miRNA down-regulated in colorectal neoplasia and analysis of their pre-miRNA indicate that this reduction is due to posttranscriptional process [32]. [score:4]
Among the differentially expressed miRNAs, miR-31, miR-96, miR-133b, miR-135b, miR-145 and miR-183 as the most consistently deregulated in CRC. [score:4]
Recently, Cummins et al obtained similar results in CRC [9] and down-regulation of miR-145 have also reported in lung [8] and breast cancer [13]. [score:4]
Interestingly, the proto-oncogen YES1 and the transduction protein MAP3K3 were potential targets of both miR-145 and miR-133b. [score:3]
Indeed, among putative targets for miR-145 with potential oncogenic functions, Iorio et al [13] described MYCN, FOS, YES, and FLI, cell cycle promoters such as cyclins D2 and L1; and MAPK transduction proteins such as MAP3K3 and MAPK4K4. [score:3]
Mean fold-change (log [10] RQ) CRC patients samplesMean fold-change (log [10]RQ) CRC cell lines Chromosome localization Correlation with cancer hsa-miR-133b -1.01 -3.38 6p12.2 hsa-miR-145 -0.84 -4.95 5q32 ↓ CRC, lung, breast cancer. [score:1]
[1 to 20 of 11 sentences]
58
[+] score: 52
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Targets of the most remarkably down-regulated miRNAs (let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223) regulate proliferation, gene expression, stress response, apoptosis, and angiogenesis. [score:9]
In another study, an increased expression of miR-145 was negatively correlated with target gene expression of SMAD3 in nasal epithelium from CF patients, thus suggesting it may influence regulation of the inflammatory pathway of TGF-β1 and explain the abnormalities in SMAD3 -mediated TGF-β1 signaling observed in CF [58]. [score:8]
MiRNA expression profiling in sputum of subjects exposed to ozone inhalation revealed significantly up-regulated expression of 10 miRNAs: miR-132, miR-143, miR-145, miR-199a-3p, miR-199b-5p, miR-222, miR-223, miR-25, miR-424 and miR-582-5p [94]. [score:8]
Several analyses provided evidence that miRNA genes (miR-101, miR-145, miR-223, miR-384, miR-494, miR-509-3p, and miR-1246) regulate CFTR expression, as well as anion transport, particularly in patients with F508 del mutation [58, 59, 60, 61, 62]. [score:5]
Studies analyzing miRNA expression profile in the sputum from mild-to-moderate asthmatic patients demonstrated elevated expression of miR-223-3p, miR-629-3p, miR-142-3p, miR-338, and miR-145 [35, 36]. [score:5]
Megiorni F. Cialfi S. Cimino G. De Biase R. V. Dominici C. Quattrucci S. Pizzuti A. Elevated levels of miR-145 correlate with SMAD3 down-regulation in cystic fibrosis patientsJ. [score:4]
Another miRNA significantly elevated in CF brushings, miR-221, was found to down-regulate ATF6, along with miR-145 and miR-494 [70]. [score:4]
Oglesby I. K. Chotirmall S. H. McElvaney N. G. Greene C. M. Regulation of cystic fibrosis transmembrane conductance regulator by microRNA-145, -223, and -494 is altered in ∆F508 cystic fibrosis airway epitheliumJ. [score:3]
Increased expression of miR-145, miR-223, and miR-494 was found in bronchial brushings from CF patients as compared to non-CF brushings [61, 62] and demonstrated the complexity in post-transcriptional regulation of CFTR. [score:3]
Lacedonia D. Palladino G. P. Foschino-Barbaro M. P. Scioscia G. Carpagnano G. E. Expression profiling of miRNA-145 and miRNA-338 in serum and sputum of patients with copd, asthma, and asthma-copd overlap syndrome phenotypeInt. [score:3]
[1 to 20 of 10 sentences]
59
[+] score: 51
As a vehicle formicroRNA-145 delivery, PU-PEI mediates miR-145 overexpression and inhibits the properties of LAD-CSCs by repressing its downstream targets, Oct4, Sox2, and Fascin1 (Chiou et al. 2012), which provides a novel miRNA -based approach for the treatment of LAD by artificially enhanced expression of microRNA-145 (Fig.   2). [score:9]
Table 1 Regulatory miRNAs involved in LCSCs MicroRNAs Source Tumor type Correlated factors Target genes Cell surface markers Signaling pathway miR-145 Human lung cancer tissues Adenocarcinoma Sox2, fascin Oct4 SP/CD133 Oct4/sox2/fascinChiou et al. (2012), Zhang et al. (2011), Hu et al. (2014), miR-31 A549cell lines/side population cells Adenocarcinoma G0/G1 phase G0/G1 phase SP/CD133/326 UnknownHua et al. (2012), Lin et al. (2012) miR-7 A549cell lines/side population cells Adenocarcinoma G1/S phase G0/G1 phase SP/CD133/326 UnknownHua et al. (2012), Lin et al. (2012) miR-34a A549cell lines/H460/H1299/mice Non-small cell lung cancer p53/BCL2 p53/BCL2 CD44/CD133 p53/Notch1/Nontch2Shi et al. (2014), Bommer et al. (2007), Li et al. (2009), Pang et al. (2010b), Balca-Silva et al. (2012) miR-200b SPC-A1/H1299/human lung cancer tissues Adenocarcinoma HDAC1/Oct-4/SOX-2/Bmi-1 Suppressor of zeste-12 (Suz-12) CD133/326 The HDAC1/miR-200b/Suz-12-E-cadherin signalingChen et al. (2014) Fig.  1 The different miRNAs regulate properties of lung cancer stem cells (LCSCs). [score:7]
miR-145 targets sites of the 3′UTRs of Oct4, Sox2, and Fascin1 and represses Oct4, Sox2, and Fascin1 to inhibit the properties of LCSCs Encoded by a single genomic locus, microRNA-31 is expressed in a variety of tissues and cell types (Grimson et al. 2007; Landgraf et al. 2007). [score:7]
By targeting a variety of downstream signalling pathways, several miRNAsact synergistically to regulate several key biological properties of LCSCs including differentiation, relapse, regeneration, metastasis, chemoresistance and apoptosis miRNA-145 is an important regulator of tumourigenesis. [score:5]
miR-145 can suppress the cancer stem cell-like properties of LCICs and the EMT process by targeting Oct4. [score:5]
Previous research by Cho WC demonstrated that miRNA-145 inhibited cell proliferation of human lung adenocarcinoma by targeting EGFR and NUDT1 (Cho et al. 2011). [score:5]
miRNA-145 was found to be expressed at low levels in lung adenocarcinoma (LAD) -associated CSCs and was further validated to inhibit the proliferation of LAD-CSCs and be negatively correlated with the levels of Oct4/Sox2/Fascin1 in LAD patient specimens (Chiou et al. 2012; Zhang et al. 2011; Hu et al. 2014). [score:5]
miRNA-145 regulates lung CSCs. [score:2]
Hu et al. (2014) further verified the amazing effect of miR-145 on properties of lung CSCs and EMT in vivo by regulating Oct4. [score:2]
A previous study indicated that miRNA-145 reduced the capacity of proliferation, invasion and tumour sphere growth in lung adenocarcinoma-initiating cells. [score:1]
Fig.  2 miR-145 is transcribed by RNA polymerase II (Pol II) into long primary miRNA145 transcripts, which are cleaved in the nucleus by the RNase III enzyme Drosha, resulting in a hairpin precursor form called pre-miRNA. [score:1]
Guang-Yuh and his colleagues found that LAD patients with a microRNA-145 [low], Oct4 [high], Sox2 [high], or Fascin1 [high] phenotype had a poor prognosis and outcome, and microRNA-145 was proven to be the most relevant marker (Chiou et al. 2012). [score:1]
Pre-miRNA is exported from the nucleus to the cytoplasmby exportin 5 and is further processed by the enzyme Dicer, which produces a transient miRNA duplex that includes a mature miR-145. [score:1]
[1 to 20 of 13 sentences]
60
[+] score: 51
For example, although inhibition of luciferase activity in a vector containing the full-length human ATF6 3′UTR indicated that each of the three miRNAs were capable of decreasing luciferase expression, in order to demonstrate that miR-145, miR-221 and miR-494 directly target the human ATF6 3′UTR, additional experiments using reporter constructs in which the predicted MREs for the individual miRNAs are deleted or mutated would be required. [score:8]
Here, we report decreased expression of ATF6 mRNA in F508 del CF bronchial epithelium both in vitro and in vivo and correlate this observation with increased expression of miR-145, miR-221 and miR-494, three miRNAs predicted to target the ATF6 3′UTR. [score:7]
ATF6, a protein of interest to us, was predicted to be regulated by three of the upregulated miRNAs - miR-145, miR-221 and miR-494 (Figure  1). [score:5]
Three of these miRNAs, miR-145, miR-221 and miR-494, were upregulated in F508 del-CFTR homozygous CFBE41o- versus non-CF 16HBE14o- bronchial epithelial cells and also in F508 del-CFTR homozygous or heterozygous CF (n = 8) versus non-CF (n = 9) bronchial brushings. [score:4]
miR-145, miR-221 and miR-494 target human ATF6 via repression of an ATF6 3′UTR luciferase reporter. [score:3]
Expression of miR-145, miR-221 and miR-494 is increased in airway tissues from βENaC-transgenic versus wild-type mice. [score:3]
Figure  1A depicts the full-length human ATF6 3′UTR with predicted binding locations for miR-145, miR-221 and miR-494, and Figure  1B shows the locations and base pair matches of their proposed binding sites, adapted from TargetScan 6.2. [score:3]
Previously, we reported how altered levels of miR-145 and miR-494, together with other factors, can control decreased CFTR mRNA and protein expression in vivo and in vitro [13]. [score:3]
In order to determine whether human ATF6 is regulated by miR-145, miR-221 and miR-494, HEK293 cells were transiently transfected with a luciferase reporter vector containing the full-length wild-type 408 bp human ATF6 3′UTR and a reference Renilla luciferase reporter plasmid pRLSV40. [score:2]
Here, we extend our understanding of miR-145 and miR-494 in the context of CF bronchial epithelial cells by demonstrating their reciprocal relationship with ATF6 mRNA levels and provide evidence that miR-221 also contributes to the post-transcriptional regulation of ATF6. [score:2]
Interestingly, bioinformatic analysis of the murine ATF6 3′UTR revealed two predicted miRNA recognition elements for miR-221, whereas miR-145 and miR-494 were not identified as potential regulators. [score:2]
Taken together, the data here demonstrate a role for miR-145, miR-221 and miR-494 in regulating ATF6. [score:2]
These results implicate miR-145, miR-221 and miR-494 in the regulation of ATF6 in CF bronchial epithelium, with miR-221 demonstrating structural and functional conservation between humans and mice. [score:2]
miR-145, miR-221 and miR-494 are conserved in mammals. [score:1]
We have previously reported that miR-145 and miR-494 are increased in vitro and in vivo in CF versus non-CF bronchial epithelium [13]. [score:1]
HEK293 cells (1 × 10 [5] in triplicate) were transiently co -transfected for 24 h with a WT-ATF6 3′UTR (OriGene, Rockville, MD, USA) firefly luciferase reporter vector containing the full-length 3′UTR (250 ng), a constitutive Renilla luciferase vector (100 ng) and 30 nM synthetic premiR mimics (PM) for miR-145, miR-221 and miR-494 (Applied Biosystems, Foster City, CA, USA) as indicated or with a scrambled control. [score:1]
In this study, we observed that levels of miR-145, miR-221 and miR-494 are increased in CF bronchial epithelial cells in vitro and in vivo. [score:1]
It contains two predicted binding locations for miR-221, but none for miR-145 or miR-494. [score:1]
[1 to 20 of 18 sentences]
61
[+] score: 49
While common miRNA dysregulation in cancer seems to result in a gain of expression [29], some miRNAs such as miR-145 are downregulated in colorectal carcinomas [26, 30]. [score:7]
Using this approach, we quantified the expression of let-7b in different human cell lines as well as miR-145 and miR-21 expression in porcine intestinal samples. [score:5]
However, there was no distinct concordance of miR-21 expression in the two intestinal loci compared with miR-145 expression. [score:4]
Other miRNAs such as miR-143 or miR-145 are downregulated in colon carcinomas [26] or in human breast cancer [27]. [score:4]
As shown in Figure 6A and 6B, animal f exhibited the highest miR-145 expression among the ten samples, both in jejunum and ileum. [score:3]
Expression of miR-145 and miR-21 in porcine intestinal samples. [score:3]
B) Expression of miR-145 in jejunal samples from ten 31-day-old piglets. [score:3]
However, miR-145 expression levels in the two different intestinal loci showed similar tendencies. [score:3]
Interestingly, both intestinal loci of this animal featured the same miR-145:5S rRNA value, which was twice as high as the lowest expression ratios among the group. [score:3]
A) Expression of miR-145 in ileal samples from ten 31-day-old piglets. [score:3]
Subsequent miR-Q analysis demonstrated that both miR-145 and miR-21 were differentially expressed in the jejunal and ileal samples of all ten piglets (Figure 6). [score:3]
The expression profiles of two selected miRNAs (miR-145 and miR-21) were exemplified in 50 ng porcine total RNA isolated from the jejunum or ileum of ten piglets by means of the corresponding miR-Q assays (Figure 6). [score:2]
Expression values of miR-21 were enhanced in both the ileum and jejunum of all analysed animals compared with miR-145. [score:2]
According to miRBase sequence data [20], miR-145 has an extended length of 24 nt, displaying the longest molecule among the miRNAs in this study. [score:1]
Expression of miR-145 and miR-21 in analysed samples was first evaluated by performing initial miRNA-Microarray experiments (data not shown). [score:1]
A) Amplification plot of synthetic miR-145 with 50 ng bacterial total RNA present as complex background. [score:1]
The measured miR-145 and miR-21 expression values in porcine intestinal samples should basically rely on detection of mature miRNA molecules. [score:1]
[1 to 20 of 17 sentences]
62
[+] score: 48
In the host tissue of the liver metastases, we identified several miRNAs with significant correlations between expression and survival: downregulation of miR-125 (p = 0.05), miR-127 (p = 0.001), miR-145 (p = 0.005), miR-192 (p = 0.015), miR-194 (0.003), miR-199-5 (p = 0.008), miR-215 (p < 0.001), and miR-429 (p = 0.03) was associated significantly with poor survival (Table 4). [score:6]
Downregulation of miR-125 (p = 0.05), miR-127 (p = 0.001), miR-145 (p = 0.005), miR-192 (p = 0.015), miR-194 (p = 0.003), miR-199-5 (p = 0.008), miR-215 (p < 0.001), and miR-429 (p = 0.03) in the normal liver tissue was significantly associated with poor survival, suggesting oncosuppressive effects of these miRNAs. [score:6]
When combining the results of the expression of miRNAs in liver and lung metastases, only the expression of miR-145 and miR-215 in the host tissue was significantly associated with overall survival (p = 0.038 and p = 0.04, Figure 4). [score:5]
In the lung metastases, miR-145 showed a 14-fold upregulation in the stroma compartment compared to the tumor compartment (p < 0.0001) with no significant upregulation compared to the normal tissue. [score:5]
miR-145 was 200-fold upregulated in the stroma tissue of the liver metastases compared to tumor tissue (p < 0.0001) with no significant upregulation compared to the normal liver tissue. [score:5]
Our findings show consistent results with a downregulation of miR-125 and miR-145 in the cancer compartment. [score:4]
Furthermore, miR-145 can inhibit angiogenesis through post-transcriptional regulation of N-RAS and VEGF-A [28]. [score:4]
miR-194 showed a 1.5-fold; miR-125, miR-127, and miR-192 showed a 2.5-fold; miR-19 and miR-215 a 3-fold; miR-145, miR-199-3, and miR-429 a 5-fold; miR-21 a 7-fold; and miR-199-5 a 12.5-fold downregulation in the liver metastases compared to the lung metastases. [score:3]
miR-145 is a target of p53 and has been shown to repress c-Myc [27]. [score:3]
Sachdeva M. Zhu S. Wu F. Wu H. Walia V. Kumar S. Elble R. Watabe K. Mo Y. -Y. p53 represses c-Myc through induction of the tumor suppressor miR-145 Proc. [score:3]
The expressions of miR-145, miR-199-3, miR-429, and miR-21 showed similar results in liver and lung tissue (Figure 3, Table 3). [score:3]
The final selection of miRNAs for further analysis consisted of 11 miRNAs: miR-19b, miR-21, miR-125b, miR-127-3p, miR-145, miR-192, miR-194, miR-199a-3p, miR-199a-5p, miR-215, and miR-429. [score:1]
[1 to 20 of 12 sentences]
63
[+] score: 48
As discussed above, E7 suppresses miR-145 expression while E6 suppresses KLF4 phosphorylation and sumoylation. [score:7]
Suppression of miR-145 expression in suprabasal epithelial cells by HPV proteins is necessary for differentiation -dependent viral DNA amplification and late gene expression. [score:7]
E7 controls KLF4 levels post-transcriptionally by suppressing the expression of a cellular microRNA, miR-145, which targets KLF4 transcripts, leading to increased levels of KLF4 proteins. [score:7]
KLF4 levels are increased in HPV -positive cells through post-transcriptional mechanisms involving down regulation of miR-145 along with suppression of post-translational modifications that negatively affect its activity. [score:6]
miRNAs have multiple targets in cells and miR-145 is one of the only miRNAs that has target sequences in the E1 and E2 open reading frames of HPV-31 with similar elements present in most HPV types. [score:5]
miR-145 also regulates the expression of several host genes including KLF4 [26], which is a major downstream effector of the p63 pathway [29]. [score:4]
One HPV regulated cellular miRNA is miR-145 which has been shown to be a negative regulator of the HPV31 life cycle [26]. [score:3]
In addition, our previous studies suggest that E7 acts through NFκB to suppress miR-145 levels to increase KLF4 protein levels. [score:3]
Using transient reporter assays, we further demonstrated that increasing levels of p65 expression vector activated miR-145 promoter activity in a dose -dependent manner (S7B Fig). [score:2]
The active subunit of NFκB pathway, p65, activated miR-145 promoter in a dose -dependent manner. [score:1]
KLF4 levels are increased in HPV- positive cells, in part due to decreased levels of a cellular miRNA, miR-145, which we have previously shown to have recognition sites in the 3’UTR of KLF4 mRNA[26]. [score:1]
We observed a corresponding decrease in NFκB activity in HPV -positive cells (S7A Fig) and determined that the promoter of miR-145 contains two p65 (NFκB active subunit) binding sites. [score:1]
Previously, we showed that E7 decreases miR-145 levels [26] and additional studies demonstrated that E7 reduces NFκB activity [55]. [score:1]
[1 to 20 of 13 sentences]
64
[+] score: 48