sort by

542 publications mentioning hsa-mir-9-3 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-9-3. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 531
Other miRNAs from this paper: hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-155
[20] Overexpression of miR-9 using a mimic in CD133 [+] GBM stem cells promotes oligoneural and suppresses a more aggressive mesenchymal phenotype by downregulating expression of Janus kinases (JAK1 and JAK3), inhibiting activation of signal transducer and activator of transcription 3 (STAT3) and decreasing expression of the STAT3 transcriptional target CCAAT/enhancer -binding protein β (C/EBPβ) (Figure 1A). [score:16]
[16] Inhibitor of differentiation 4 (ID4) suppresses miR-9 [*] expression and upregulates the direct target of this miRNA SRY (sex determining region Y)-box 2 (SOX2). [score:13]
[77] CD99 downregulates the expression of miR-9 and upregulates a direct miR-9 target: positive regulatory domain 1 (PRDM1/BLIMP-1) (Figure 5B). [score:13]
miR-9 is highly expressed in HL cells and its downregulation by CD99 overexpression or a direct knockdown using miR-9 inhibitor augments PRDM1 levels that trigger B-cell differentiation into plasma cells. [score:12]
HDAC inhibitors treatment leads to upregulation of miR-9 and downregulation of its direct target IGF2BP3 (Figure 5C). [score:12]
[62, 63] In the human SCC-9 cell line, curcumin treatment leads to upregulation of miR-9, which in turn inhibits cell proliferation via downregulation of cyclin D1 and suppression of Wnt/β-catenin signaling (Figure 4B). [score:11]
Both miRNAs directly target a tumor suppressor calmodulin binding transcription activator 1 (CAMTA1), of which overexpression mimics the phenotype of miR-9/9 [*] inhibition. [score:10]
[70] This epigenetic downregulation leads to upregulation of predicted miR-9 and miR-9 [*] targets, fibroblast growth factor receptor 1 (FGFR1) and cyclin -dependent kinase 6 (CDK6). [score:9]
[11] MYC oncoprotein activates miR-9 expression, which consequently causes downregulation of miR-9 direct target E-cadherin (Figure 2C). [score:9]
[28– 30] In GBM cells that express ΔEGFR, miR-9 acts as a tumor suppressor that downregulates transcription factor forkhead box P1 (FOXP1) (Figure 1D). [score:8]
It has been shown that direct cell-cell contact between follicular dendritic cells and B cells leads to downregulation of miR-9 and upregulation of PRDM1. [score:8]
Knockdown of endogenous miR-9 expression with a miR-9 sponge inhibits MLL fusion–induced immortalization/transformation of normal hematopoietic progenitor cell, whereas its viral overexpression has the opposite effect. [score:8]
In normal keratinocytes, overexpression of HPV E6 and miR-9 leads to downregulation of miR-9 target genes involved in cell migration, such as activated leukocyte cell adhesion molecule (ALCAM) and follistatin-related protein 1 (FSTL1). [score:8]
It also provides information on the up- or downregulation of miR-9/9 [*] and lists putative mRNA targets and target-related pathways according to www. [score:8]
[84] AML1-ETO downregulates miR-9 and in this way promotes the expression of UBASH3B/Sts-1, a tyrosine phosphatase that inhibits CBL and enhances STAT5/AKT/ERK/Src signaling to promote myeloid proliferation (Figure 6A). [score:8]
In MCF-7 and MDA-MB-231 cells, miR-9 has been shown to downregulate the expression of another tumor suppressor gene FOXO1 that belongs to the FOXO family of Forkhead transcription factors. [score:8]
Its overexpression using pre-miR-9 [*] in WM cells inhibits the unbalanced HDAC activity by downregulation of HDAC4 and 5. This results in decreased proliferation, increased apoptosis and autophagy. [score:8]
In contrast to increasing colony numbers of CD133 [+] GBM stem cells via CAMTA1, miR-9 has been shown to inhibit proliferation of GBM cell lines by targeting the cyclic AMP response element -binding protein (CREB) but to promote migration by targeting neurofibromin 1 (NF1). [score:7]
In non-metastatic SUM159 cells, miR-9 -mediated downregulation of leukemia inhibitory factor receptor (LIFR) induces migration, invasion and metastatic colonization through deregulation of the Hippo-YAP pathway. [score:7]
[25] Additionally, the delivery of anti-miR-9 to the resistant GBM cells indirectly downregulates the expression of the multidrug transporter (MDR1) and sensitizes the GBM cells to chemotherapy. [score:7]
[54] Ectopic expression of miR-9 inhibits the JAK/STAT3 pathway by targeting interleukin 6 (IL-6). [score:7]
[12] In normal hematopoietic stem and progenitor cells, ectopic expression of miR-9/9 [*] inhibits myeloid differentiation by post-transcriptional regulation of ETS-related gene (ERG) (Figure 6A). [score:6]
In CA, miR-9 is downregulated due to frequent promoter-hypermethylation and has been shown to act as a tumor suppressor (Figure 3B). [score:6]
[37, 38] The expression of miR-9 in ER [+] BC has recently been linked to the level of lncRNA taurine -upregulated gene 1 (TUG1). [score:6]
In the past years, multiple studies have reported on the deregulated expression of miR-9/9 [*] in various types of human cancer and the relation of their aberrant expression levels with different processes, e. g. self-renewal, proliferation and differentiation. [score:6]
It is indicated whether miR-9 levels are increased (↑) or decreased (↓) together with a list of direct targets when miR-9 or 9* is expressed or re-introduced in the given cell type. [score:6]
In GBM cells that are resistant against alkylating agents, miR-9 is highly expressed and miR-9 [*] is downregulated. [score:6]
[58] In primary human SCC cells, high expression of miR-9 correlates with metastasis and the loss of a predicted direct target α-catenin. [score:6]
[89] Additionally, miR-9 expression is inversely correlated to the levels of hairy and enhancer of split-1 (HES1), a known tumor-suppressor (Figure 6A). [score:5]
Each graph schematically depicts the reported levels of expression of miR-9/9 [*] as well as their functional significance including relevant target genes and phenotypical effects in (A) acute myeloid leukemia cells. [score:5]
[61, 62] Overexpression using miR-9 mimic in human the UM-SCC22A cell line inhibits cell proliferation (Figure 4B). [score:5]
[45] In TNBC cells, treatment with a MEK1/2 inhibitor together with a miR-9 mimic increases cell proliferation, whereas treatment together with a miR-9 [*] mimic suppresses growth, migration and invasion of tumor cells (Figure 2B). [score:5]
[40] miR-9 has been suggested to play a tumor suppressive role by targeting mitochondrial bifunctional enzyme MTHFD2 and NOTCH1 receptor (Figure 2B). [score:5]
[13] miR-9 is part of a feedback minicircuitry that allows a tight control of the expression levels of target genes that coordinate the proliferation and migration of GBM cells (Figure 1B). [score:5]
[73] Figure 5miR-9 and miR-9 [*] functions in human lymphoid malignanciesEach graph schematically depicts the reported levels of expression of miR-9/9 [*] as well as their functional significance including relevant target genes and phenotypical effects in (A) acute lymphoblastic leukemia cells, (B) Hodgkin lymphoma cells, (C) multiple myeloma cells, (D) Waldenström macroglobulinemia cells. [score:5]
ΔEGFR activates Ras/PI3K/AKT, which in turn suppresses miR-9. Of note, the viral transduction as used here likely results in overexpression of both miR-9 and miR-9 [*] making it difficult to discern whether both or only a single miRNA display activity. [score:5]
Each graph schematically depicts the reported levels of expression of miR-9/9 [*] as well as their functional significance including relevant target genes and phenotypical effects in (A) cervical squamous cell carcinoma cells, (B) cervical adenocarcinoma cells. [score:5]
Figure 6miR-9 and miR-9 [*] functions in human myeloid malignanciesEach graph schematically depicts the reported levels of expression of miR-9/9 [*] as well as their functional significance including relevant target genes and phenotypical effects in (A) acute myeloid leukemia cells. [score:5]
[16] Each graph schematically depicts the reported levels of expression of miR-9/9 [*] as well as their functional significance including relevant target genes and phenotypical effects in (A) CD133 [+] stem cells, (B) glioblastoma cell lines, (C) chemoresistant glioblastoma cells, (D) ΔEGFR cells. [score:5]
Each graph schematically depicts the reported levels of expression of miR-9/9 [*] as well as their functional significance including relevant target genes and phenotypical effects in (A) metastatic skin squamous cell carcinoma cells, (B) non-metastatic oral squamous cell carcinoma cells. [score:5]
[11] In summary, the data show that in BC miR-9 can target two alternative metastatic suppressors: LIFR (which activates Hippo signaling, leading to inactivation of the transcriptional co-activator YAP) and E-cadherin (that maintains adherens junctions) [11, 46]. [score:5]
Figure 4miR-9 and miR-9 [*] functions in human skin and oral cavity squamous cell carcinomaEach graph schematically depicts the reported levels of expression of miR-9/9 [*] as well as their functional significance including relevant target genes and phenotypical effects in (A) metastatic skin squamous cell carcinoma cells, (B) non-metastatic oral squamous cell carcinoma cells. [score:5]
Figure 2miR-9 and miR-9 [*] functions in human breast cancerEach graph schematically depicts the reported levels of expression of miR-9/9 [*] as well as their functional significance including relevant target genes and phenotypical effects in (A) ER [+] cells, (B) triple -negative cells, (C) metastatic cells. [score:5]
Each graph schematically depicts the reported levels of expression of miR-9/9 [*] as well as their functional significance including relevant target genes and phenotypical effects in (A) acute lymphoblastic leukemia cells, (B) Hodgkin lymphoma cells, (C) multiple myeloma cells, (D) Waldenström macroglobulinemia cells. [score:5]
[17] Inhibition of miR-9 as well as miR-9 [*] using 2’- O-methylated antisense inhibitors results in reduced colony numbers (Figure 1A). [score:5]
Figure 3miR-9 and miR-9 [*] functions in human cervical cancerEach graph schematically depicts the reported levels of expression of miR-9/9 [*] as well as their functional significance including relevant target genes and phenotypical effects in (A) cervical squamous cell carcinoma cells, (B) cervical adenocarcinoma cells. [score:5]
Each graph schematically depicts the reported levels of expression of miR-9/9 [*] as well as their functional significance including relevant target genes and phenotypical effects in (A) ER [+] cells, (B) triple -negative cells, (C) metastatic cells. [score:5]
Figure 1miR-9 and miR-9 [*] functions in human glioblastoma multiformeEach graph schematically depicts the reported levels of expression of miR-9/9 [*] as well as their functional significance including relevant target genes and phenotypical effects in (A) CD133 [+] stem cells, (B) glioblastoma cell lines, (C) chemoresistant glioblastoma cells, (D) ΔEGFR cells. [score:5]
It is evident that miR-9/9 [*] expression affects many biochemical pathways commonly deregulated in human cancer such as the PI3K/AKT, JAK/STAT, NOTCH1, Wnt/β-catenin, Ras and ERK signaling pathways. [score:4]
Another miR-9 target that contributes to reduced proliferation and tumor growth is stathmin (STMN1), which regulates microtubule formation dynamics during cell-cycle progression. [score:4]
Ectopic expression of miR-9 in t(8;21) AML cells reduces leukemic growth and enhances monocytic differentiation induced by calcitrol by direct repression of the oncogenic LIN28B/HMGA2 axis. [score:4]
[51] miR-9 expression is activated by HPV E6 – an essential oncogene in cervical cancer development. [score:4]
[90, 91] Knockdown of miR-9 by lentiviral infection decreases leukemic cell proliferation and survival by increasing HES1 expression in vitro and in vivo [89]. [score:4]
miR-9/9 [*] are mainly expressed in the nervous system and were initially studied as regulators of neurogenesis. [score:4]
[15, 16, 24, 25] miR-9 has been shown to contribute to the chemoresistance of GBM cells by direct targeting of patched homolog 1 protein (PTCH1) and subsequent activation of sonic hedgehog (SHH) signaling pathway (Figure 1C). [score:4]
[12, 83] MLL fusion proteins may promote miR-9 expression by direct binding to the promoter regions of MIR9 genes. [score:4]
[40] miR-9 [*] activity is mediated through downregulation of β [1] integrin(ITGB1), which is important for growth factor receptor and extracellular matrix-related signaling. [score:4]
Furthermore, the potency of miR-9/9 [*] requires careful toxicity studies complemented with development of reliable and safe delivery methods to specifically target distinct cancer cell populations with miRNA mimics or antimiRs. [score:4]
In non-metastatic human oral SCC specimens, miR-9 is downregulated probably due to frequent promoter hypermethylation. [score:4]
miR-9/9 [*] are both aberrantly upregulated in most of human AML cases. [score:4]
In the ER [+] MCF-7 cell line, miR-9 has been shown to directly target ER and to influence, not only ER signaling but also other steroid receptor pathways (Figure 2A). [score:4]
[#]: miR-9 has been reported to influence the direction of differentiation – it promotes oligoneural and suppresses more aggressive mesenchymal phenotype. [score:4]
[49] In CSCC, a chromosomal gain of 1q results in upregulation of miR-9 (1q23.3) and is linked with malignant progression (Figure 3A). [score:4]
[14, 41] In line with this, knockdown of MTHFD2 recapitulates the anti-invasive effect of miR-9. NOTCH1 is known to be involved in the pathogenesis of TNBC and its inhibition reduces the migratory potential of MDA-MB-231 cells. [score:4]
[68, 69] In acute lymphoblastic leukemia (ALL), low miR-9 expression is associated with hypermethylation of MIR9 gene family (Figure 5A). [score:3]
[46] Additionally, miR-9 has been reported to be higher expressed in metastatic than in non-metastatic primary human breast cancer. [score:3]
Beside chromosomal gain, an elevated expression of miR-9 in CSCC is caused by human papillomavirus (HPV) infection (Figure 3A). [score:3]
In TNBC cells, miR-9/9 [*] are expressed at low levels due to promoter hypermethylation of the MIR-9 loci. [score:3]
[50] Overexpression of miR-9 in normal keratinocytes blocks epithelial differentiation, and induces proliferation and migration. [score:3]
Smad4 [–/–] cancer stem cell-enriched population, viral overexpression of miR-9 leads to the expansion of metastatic cell population resulting in increased invasion and metastasis (Figure 4A). [score:3]
[12, 92, 93] In patients with AML, expression of miR-9 has no prognostic significance, whereas miR-9 [*] predicts favorable outcome. [score:3]
[70] MIR9 genes have been reported to be also frequently methylated in chronic lymphocytic leukemia (CLL) and overexpression of miR-9 using a mimic decreases CLL cell proliferation. [score:3]
In the past years, several studies have reported on the relationship of miR-9/9 [*] expression with different cellular processes, such as differentiation, proliferation, migration and metastasis. [score:3]
[20] In CD133 [+] GBM stem cells, miR-9/9 [*] are highly expressed and needed for stem cell renewal. [score:3]
Only when these technical issues are adequately addressed and we have a better understanding of miR-9/9 [*] biology both in health and disease, we can consider the full therapeutic potential of these miRNAs. [score:3]
Neither adherence to primary BM stromal cells nor growth factors protected against the miR-9 [*] -dependent growth inhibition. [score:3]
[11– 14] Interestingly, miR-9 and miR-9 [*], although concomitantly expressed from one precursor miRNA, may be preferentially retained and can play synergistic or opposite roles within one malignancy. [score:3]
[20] miR-9 is considered a regulator of a subtype-specific gene expression network and drives subtype-specific cell decisions. [score:3]
In acute myeloid leukemia (AML), miR-9 has been reported to be differentially expressed between AML subtypes. [score:3]
The highest expression of miR-9 has been found in the oligoneural subclass of GBM. [score:3]
miR-9 is highly upregulated in MLL-rearranged leukemic cells as compared to non- MLL-rearranged cells and normal controls (Figure 6A). [score:3]
[48] By targeting E-cadherin in breast tumor cells, miR-9 enables non-metastatic cells to form pulmonary micrometastasis. [score:3]
However, α-catenin depletion alone does not cause SCC metastasis suggesting that additional targets are required for miR-9 -mediated effect. [score:3]
[14, 41] Overexpression using pre-miR-9 or lentiviral constructs decreases the invasiveness and migration of TNBC MDA-MB-231 cells. [score:3]
miR-9 [*], has been reported to have a tumor suppressive role in Waldenström macroglobulinemia (WM) (Figure 5D). [score:3]
[59] miR-9 has been reported to be expressed at high levels in patients with recurrent head and neck SCC [60]. [score:3]
Summary of the reported oncogenic or tumor suppressor functions of miR-9 and 9 [*] in human cancer. [score:3]
[31] Viral overexpression of miR-9 or silencing of FOXP1 antagonizes ΔEGFR -dependent tumor growth in vivo. [score:3]
miR-9 function may be mediated by the two predicted targets: RING1 and YY1 -binding protein (RYBH) and Ras homolog family member H (RHOH). [score:3]
[8] Interestingly, aberrant expression of miR-9/9 [*] has been found in various types of human cancer revealing an unanticipated functional versatility. [score:3]
The expression of miR-9 has been wi dely related to BC metastasis. [score:3]
In AML patients with a normal karyotype, miR-9 is expressed at higher levels in leukemic stem/progenitor cells (LSPCs) than in normal hematopoietic stem cells derived from the same patient. [score:3]
It has been proposed that TUG1 and miR-9 may co-regulate each other to impact cell proliferation [39]. [score:2]
[15] miR-9 [*] is part of an ID4-miR-9 [*]-SOX2-ABCC3/ABCC6 regulatory pathway. [score:2]
miR-9 [*] is expressed at reduced levels in WM CD19 [+] cells compared to normal CD19 [+] counterparts. [score:2]
Initially discovered as versatile regulators of neurogenesis, miR-9/9 [*] quickly became a focus of attention in cancer research. [score:2]
Gene copy amplification of miR-9 hinders the balance of this regulatory minicircuitry and contributes to motility of GBM cells. [score:2]
More research is needed that incorporates: 1) systems biology to delineate and integrate the miR-9/9 [*] regulatory networks; 2) in vivo experiments performed under physiological conditions and 3) the need to address miR-9 and miR-9 [*] functions separately. [score:2]
Interestingly, miR-9 and miR-9 [*] serve as an example of miRNAs that, although co-transcribed and derived from the same precursor, may fulfill different and sometimes opposing functions. [score:1]
[20, 21] In GBM cell lines, miR-9 has been reported to play a critical role in determination of the so-called “go or grow” phenotype. [score:1]
These insights are critical to improve our understanding of the functional significance of miR-9/9 [*] in the context of cancer. [score:1]
miR-9 and miR-9 [*] functions in human cervical cancer. [score:1]
[22, 23] U87MG GBM cells transfected with miR-9 mimic are characterized by decreased expression of STMN1 and form smaller tumors than control cells. [score:1]
[43] Recently, it has been reported that miR-9 may influence TNBC aggressiveness by taking part in cross-talk between cancer cells and cancer -associated fibroblasts [44]. [score:1]
miR-9 and miR-9 [*] functions in human glioblastoma multiforme. [score:1]
[7] All vertebrate miR-9/9 [*] orthologs have an identical mature sequence. [score:1]
miR-9 and miR-9 [*] functions in human myeloid malignancies. [score:1]
In mammals, miR-9/9 [*] are encoded by three genes: MIR9-1, MIR9-2 and MIR9-3. In humans, these genes are located on the chromosomes 1 (1q22), 5 (5q14.3) and 15 (15q26.1), respectively. [score:1]
We outline the mechanisms through which miR-9/9 [*] are involved in tumorigenesis and the cellular context in which these miRNAs operate. [score:1]
[9– 11] The high level of sequence conservation and the fact that miR-9/9 [*] are encoded by three different genomic loci points to important functional roles of these miRNAs that may be exploited by cancer cells. [score:1]
As of yet, not much is known about the functional relationship between miR-9 and miR-9 [*] and which factors determine their individual stability and functionality. [score:1]
Table 1 summarizes the different reported functions of miR-9/9 [*] in various cell and tumor types. [score:1]
The picture that emerges from the current literature is still fragmentary impeding firm conclusions about the role(s) of miR-9/9 [*] in cancer. [score:1]
Functions attributed to miR-9 [*] are marked in red. [score:1]
[15– 17] Here, we summarize the diverse functions of miR-9/9 [*] in the biology of human cancer. [score:1]
[94] Recently, it has been proposed that miR-9 [*] may sensitize tumor cells to chemotherapy in chronic myelogenous leukemia [95]. [score:1]
In 2010, Ma et al. reported that miR-9 plays an important role in metastasis of MYC -driven breast tumors. [score:1]
[32– 35] A vast amount of data concerning the diverse roles of miR-9/9 [*] have been obtained for breast cancer. [score:1]
Moreover, the capacity of miR-9/9 [*] to impact tumor formation does not necessarily predict their influence on the metastatic potential of tumor cells. [score:1]
miR-9 and miR-9 [*] functions in human skin and oral cavity squamous cell carcinoma. [score:1]
miR-9 and miR-9 [*] functions in human breast cancer. [score:1]
Additionally, the transcription of both miR-9 and NF1 is under CREB’s control. [score:1]
This underscores the relevance and intricate involvement of miR-9/9 [*] in human cancer biology. [score:1]
These facts make future miR-9/9 [*] -based anticancer therapies challenging. [score:1]
[4– 6] miR-9 (miR-9-5p) and miR-9 [*] (miR-9-3p) are two miRNAs that originate from the same precursor and are highly conserved during evolution from flies to humans. [score:1]
miR-9 and miR-9 [*] functions in human lymphoid malignancies. [score:1]
However, as the presented outcome is in line with the previously mentioned reports concerning the function of miR-9 [*] in chemoresistant GBM cells the expression of miR-9 [*] and its influence on tumorigenicity of ΔEGFR GBM cells needs to be further investigated. [score:1]
[96– 100] As demonstrated in this review, miR-9/9 [*] may exert gross functional effects and change cellular phenotypes. [score:1]
[47] FOXO1 3’ UTR may sequester miR-9 from E-cadherin 3’ UTR. [score:1]
The precise functional role of miR-9/9 [*], however, depends on a specific cellular context and may consequently vary in different cell populations within one malignancy. [score:1]
[1 to 20 of 130 sentences]
2
[+] score: 503
This effect is mediated by an up-regulation of calmodulin -binding transcription activator 1 (CAMTA1), a tumor suppressor whose 3'UTR is targeted by miR-9. However another study suggests that miR-9* inhibits the expression of Sox2, a factor which, in contrast to CAMTA1, confers self-renewal properties and drug resistance to GSC (Jeon et al., 2011). [score:12]
miR-9 was shown to be down-regulated in a mouse mo del of motoneuron disease and its over -expression can repress the expression of a neurofilament heavy subunit previously linked to motoneuron degeneration. [score:10]
Specific inhibition of miR-9 binding on the Map1b 3'UTR both in vitro and in vivo using target protectors could mimic this effect of miR-9. Thus miR-9 regulates neuronal maturation through modulating the expression level of this gene, which is an important regulator of microtubules dynamics. [score:9]
Foxp2 protein is expressed in the embryonic cortex, but its expression starts much later than miR-9. Furthermore, while miR-9 expression spans most layers of the cortex, being however enriched in ventricular progenitors, Foxp2 expression is restricted to post-migratory neurons (Shibata et al., 2011; Clovis et al., 2012). [score:9]
Moreover, the reduction of proliferation induced by miR-9 can be rescued by overexpressing TLX, suggesting that the inhibition of this target could participate in this phenotype (Zhao et al., 2009). [score:7]
The bifunctional microRNA miR-9/miR-9* regulates REST and CoREST and is downregulated in Huntington’s disease. [score:7]
Other genes of the miR-9 family might also play a role here, as miR-4 and miR-79 have been shown to regulate the expression Notch target genes, such as E(spl) or Brd. [score:6]
Further studying the link between miR-9 activity and RNA binding proteins, which can either regulate miR-9 expression and processing or alter its effect of mRNA targets, will refine our understanding of miR-9 action (Shibata et al., 2011; Xu et al., 2011; Li et al., 2013). [score:6]
Considering the number of targets of miR-9/9*, their down-regulation could also impact more wi dely the transcriptional landscape in HD patients brains. [score:6]
Chromosomal amplifications can account for increased miR-9 expression in some cervical cancers (Wilting et al., 2013), while the up-regulation of miR-9-3 transcription is caused by the MYC oncogene in some breast cancers (Ma et al., 2010). [score:6]
Surprisingly however, miR-9 was shown to also downregulate the expression of genes with differentiation promoting activities. [score:6]
Differential expression of mRNA targets or the synergy between miR-9 and other mRNA regulating factors could account for this phenomenon. [score:6]
One target of miR-9, the truncated form of the neurotrophin receptor TrkC (t-TrkC), is up-regulated in MB and was shown to promote proliferation of MB cells. [score:6]
This could contribute to disease progression as inhibition of miR-9 in MB cell lines increases their proliferation. [score:5]
Among miR-9 targets is her5, which in zebrafish embryos is specifically expressed at the MHB. [score:5]
For instance, using target protector morpholinos, a cryptic role of miR-9 in inhibiting elavl3, a proneural differentiation factor, was revealed in zebrafish embryos (Coolen et al., 2012). [score:5]
Genome-wide miRNA expression profiling identifies miR-9-3 and miR-193a as targets for DNA methylation in non-small cell lung cancers. [score:5]
Transcription of miR-9 genes is repressed by Nr2e2/Tlx, Hes1 and REST, and its effect on mRNA targets can be modulated by Elavl proteins, also targeted by this microRNA (Zhao et al., 2009; Laneve et al., 2010; Shibata et al., 2011; Bonev et al., 2012). [score:5]
All along the CNS, miR-9 expression is predominantly associated with ventricular neural progenitors areas (Darnell et al., 2006; Leucht et al., 2008; Shibata et al., 2008, 2011; Bonev et al., 2011; Coolen et al., 2012), although some differentiated neurons also express miR-9, notably in the dorsal telencephalon and spinal cord (Leucht et al., 2008; Otaegi et al., 2011; Shibata et al., 2011). [score:5]
In the brain of HD patients, miR-9/9* expression decreases with increasing disease grades (Packer et al., 2008). [score:5]
miR-9 can also inhibit the expression of Sirt1, a member of the class III nicotinamide adenine dinucleotide (NAD+) -dependent histone deacetylases (Delaloy et al., 2010). [score:5]
MiR-9 downregulates CDX2 expression in gastric cancer cells. [score:5]
The deregulation of t-TrkC following down-regulation of miR-9 could therefore play a role in sustaining proliferation of MB cells. [score:5]
miR-9 is expressed at the ventricular zone, and excluded from differentiated neurons expressing the protein HuC (magenta). [score:5]
For most targets studied so far in vertebrates, miR-9 binding sites are highly conserved and are thus part of an ancestral set of miR-9 targets. [score:5]
For instance the RNA binding proteins Elavl1 and Musashi1 can synergize with miR-9 to increase the expression of some of its targets (Shibata et al., 2011). [score:5]
Altogether this suggests that miR-9 expression may account for the low expression of lamin A in the neural tissue, thus protecting it from the deleterious effects of Progerin in HGPS patients. [score:5]
In zebrafish and frog embryos, target protector morpholinos (Choi et al., 2007) that block the miR-9 binding site on the hes1/ her6 3'UTR, induce an increased proliferation, mimicking the effect of miR-9 blockade (Bonev et al., 2011; Coolen et al., 2012) and thus demonstrate that miR-9 targeting of this gene is crucial to properly balance progenitor proliferation. [score:5]
Probing more directly the impact of miR-9 deregulation on neurodegenerative disease progression is a challenging task, which will need to be addressed in the future. [score:5]
Interestingly, miR-9 expression appears similarly regulated in the retina. [score:4]
As the expression of miR-9 suggests, functional analyses uncovered a prominent role of miR-9 in the regulation of embryonic neural progenitors states. [score:4]
In situ hybridization analyses in different vertebrate mo del organisms have revealed very similar spatiotemporal patterns of miR-9 expression during (CNS) development (Darnell et al., 2006; Deo et al., 2006; Leucht et al., 2008; Shibata et al., 2008; Walker and Harland, 2008). [score:4]
Regulation of neural progenitors proliferation by miR-9. miR-9 targets in neural progenitors reveal a complex interacting network. [score:4]
CAMTA1 is a novel tumour suppressor regulated by miR-9/9* in glioblastoma stem cells. [score:4]
Lamin A and C encoding transcripts possess different 3'UTR sequences, but only lamin A transcripts can be down-regulated by miR-9 through a functional binding site. [score:4]
The repression of these transcription factors by miR-9 could explain the anti-proliferative effect it exerts in neural progenitors, while their up-regulation could participate in miR-9 the depletion phenotype. [score:4]
A few studies have unraveled additional functions of miR-9 at later steps of neural development, linked to its expression in some populations of post-mitotic neurons. [score:4]
These MN are characterized by the expression of FoxP1 and Isl1/2, both of which are putative targets of miR-9. In this context, manipulating miR-9 levels impairs the differentiation and axonal projections of spinal motoneuron lineages, possibly through a de-regulation of FoxP1 protein levels. [score:4]
miR-9 controls the timing of neurogenesis through the direct inhibition of antagonistic factors. [score:4]
The proximal causes of miR-9 up-regulation have been identified only in a few cases. [score:4]
In contrast, in depletion experiments using antisense oligonucleotides, like the one performed in zebrafish or Xenopus embros, only miR-9 (miR-9-5p) is down-regulated. [score:4]
The down-regulation of miR-9/9* could be linked to the excessive activity of REST and may also amplify REST activity by increasing REST and coREST protein levels. [score:4]
miR-9 expression starts at mid-embryogenesis stages, after the specification of the major brain subdivisions and the development of the primary neuronal scaffold. [score:4]
A role of miR-9 in the maturation of cortical neurons was more directly demonstrated by another study in which miR-9 expression could be detected in axons and dendrites of differentiated neurons (Dajas-Bailador et al., 2012). [score:4]
Another striking feature emerging from the analyses of miR-9 targets is that they often exert feedback regulation on miR-9 (Figure 3C). [score:4]
microRNA-9 regulates axon extension and branching by targeting Map1b in mouse cortical neurons. [score:4]
However, in Drosophila, although miR-9a does influence the development of peripheral nervous system sensory organs, its function is encoded negatively, through miR-9 restricted expression in non-neural epidermal cells (Li et al., 2006). [score:4]
MicroRNA-9 modulates Cajal-Retzius cell differentiation by suppressing Foxg1 expression in mouse medial pallium. [score:4]
Indeed miR-9 can inhibit the pluripotent factors Lin28A and Lin28B, RNA binding proteins that block the processing of some microRNAs, including let-7 (Eda et al., 2009; La Torre et al., 2013). [score:3]
Sagittal section through a zebrafish embryo at 48 h post fertilization, showing the expression of miR-9 as revealed by in situ hybridization (blue). [score:3]
A better appreciation of the spatial and temporal variations of miR-9 function in vivo awaits the development of more refined conditional knock-down tools. [score:3]
Reducing miR-9 expression in glioblastoma primary culture leads to a reduction of the number of cells with in vitro self-renewing potential (Schraivogel et al., 2011). [score:3]
MicroRNA9 regulates neural stem cell differentiation by controlling Hes1 expression dynamics in the developing brain. [score:3]
miR-9 is highly expressed and appears to favor progression of Hodgkin lymphomas (Leucci et al., 2012), breast cancers (Ma et al., 2010), cervical cancers (Wilting et al., 2013), colon cancers (Lu et al., 2012) and stomach cancers (Rotkrua et al., 2011). [score:3]
Prospero homeobox 1 promotes epithelial-mesenchymal transition in colon cancer cells by inhibiting E-cadherin via miR-9. Clin. [score:3]
Conversely a high expression of miR-9 was detected in a subclass of glioblastoma, the most common but also the most aggressive type of adult brain tumors (Kim et al., 2011). [score:3]
Unique preservation of neural cells in Hutchinson- Gilford progeria syndrome is due to the expression of the neural-specific miR-9 microRNA. [score:3]
In this study, inhibition of miR-9 led to a decrease in neural progenitor proliferation, concomitant with increased migratory capacities. [score:3]
During vertebrate evolution, miR-9 seemingly had the time to accumulate a large set of mRNA targets, and is deeply embedded in the gene network controlling the behavior of neural progenitors. [score:3]
Interestingly, miR-9 expression was particularly associated with tumor cells possessing stem-like features (Schraivogel et al., 2011). [score:3]
Altogether the study of miR-9 targets point to a role of this microRNA to facilitate, pace and stabilize the transition of progenitors towards neural differentiation. [score:3]
Interestingly, miR-9* seems to be able to facilitate this exchange, via repressing the expression of BAF53a (Yoo et al., 2009). [score:3]
Other targets of miR-9 are linked with the epigenetic machinery, which is subjected to drastic remo deling during the course of neuronal differentiation. [score:3]
In vertebrates, Zic5 mRNA possesses a very conserved binding site for miR-9, and moreover, in the zebrafish embryonic hindbrain, injection of a target protector morpholino restricting binding to this site leads to an increase in progenitor proliferation (Coolen et al., 2012). [score:3]
It could be linked to differential expression of paralogous miR-9 genes, leading to subfunctionalization between copies (Berezikov, 2011). [score:3]
The miR-9 expressing neurogenic progenitor is in an ambivalent state, poised to respond to proliferation or differentiation cues. [score:3]
In an in vitro mo del, the dampening of Hes1 expression by miR-9 was shown to be necessary for oscillations of Hes1 to occur (Bonev et al., 2012; Tan et al., 2012). [score:3]
Of note, in over -expression experiments or in mouse mutants, the effects observed result from the combined gain or loss of both miR-9 strands. [score:3]
It would be interesting now to start to explore species-specific targets of miR-9 and see how they could participate in the diversification of the nervous system. [score:3]
Overexpression of miR-9/9* duplexes in the zebrafish embryo (Leucht et al., 2008), mouse embryonic cortex (Zhao et al., 2009), and chick spinal cord (Yoo et al., 2011) leads to a reduction in the number of proliferating progenitors. [score:3]
In contrast, in vertebrates, miR-9 displays a conserved expression pattern in the CNS. [score:3]
MicroRNA-9 regulates neurogenesis in mouse telencephalon by targeting multiple transcription factors. [score:3]
A first set of miR-9 targets are members of the Hes gene family (Leucht et al., 2008; Bonev et al., 2011, 2012; Coolen et al., 2012). [score:3]
Inhibition of miR-9 de-represses HuR and DICER1 and impairs Hodgkin lymphoma tumour outgrowth in vivo. [score:3]
As previously mentioned, REST was shown to repress miR-9 transcription and REST and its co-repressor coREST are targets of miR-9/9* (Packer et al., 2008; Laneve et al., 2010). [score:3]
miR-9 can promote neural differentiation via the inhibition of proliferation factors and progenitor specific epigenetic factors. [score:3]
Large scale analysis of microRNAs expression revealed that miR-9 is highly enriched in both the developing and mature nervous system of vertebrates (Miska et al., 2004; Sempere et al., 2004; Wienholds et al., 2005; Heimberg et al., 2010). [score:3]
Several other validated targets of miR-9 are also transcription factors that were previously shown to promote progenitor proliferation. [score:3]
Moreover, inhibition of miR-9 in cultured neurons increased axonal length and reduced axonal branching. [score:3]
This will constitute a major challenge, especially since miR-9 targets are functionally interconnected. [score:3]
miR-9 is transiently expressed during the differentiation of spinal cord motoneurons (MN), located in the lateral motor column and innervating limb muscles, but not in neighboring MN (Otaegi et al., 2011). [score:3]
miR-9 regulation of neural development. [score:3]
Inhibition of miR-9 in neural cells in vitro lead to increased levels of lamin A transcripts. [score:3]
ID4 imparts chemoresistance and cancer stemness to glioma cells by derepressing miR-9* -mediated suppression of SOX2. [score:3]
Finally, miR-9 was suggested to participate in amyotrophic lateral sclerosis (ALS), a neurodegenerative disease affecting MN (Haramati et al., 2010). [score:3]
In doing this, miR-9 dampens the expression of factors favoring antagonist fates. [score:3]
This suggests that miR-9 could prevent excessive expression of the protein FoxP2 in the cortex, which was shown to severely impair neuronal migration. [score:3]
The first large scale microRNA expression profiles performed in vertebrates soon identified miR-9 as a brain enriched microRNA (Lagos-Quintana et al., 2002; Krichevsky et al., 2003; Miska et al., 2004; Sempere et al., 2004). [score:3]
In vertebrates, the transcription factors that were shown to bind miR-9 promoters are all repressors (Tlx, REST, Hes1); the factors that can induce miR-9 expression are still unknown. [score:3]
The expression of miR-9/9* in human fibroblasts, in synergy with miR-124, is sufficient to convert them into neurons, placing miR-9/9* at the core of the gene network controlling the neural fate (Yoo et al., 2011). [score:3]
In silico algorithms predict several hundred targets for miR-9, a high figure typical of ancient microRNAs (Bartel, 2009). [score:3]
The reason why lamin A expression would need to be restricted by miR-9 in a healthy brain remains to be discovered. [score:3]
In some cases, miR-9 behaves like an oncogene, in some others like a tumor suppressor. [score:3]
There miR-9 expression is also restricted to late progenitors (La Torre et al., 2013) and shows a dependence on Notch activity (Georgi and Reh, 2010). [score:3]
miR-9 is a very ancient microRNA and its function and set of targets seem to have undergone dramatic changes during the evolution of Bilateria. [score:3]
miR-9 could therefore promote a transition towards neurogenesis via influencing the mode of Hes1 expression. [score:3]
miR-9 expression is preferentially associated with neurogenic progenitors. [score:3]
Figure 3 miR-9 regulates progenitor states in Vertebrates. [score:2]
Functional analyses in vertebrate mo del species have highlighted a prominent role of miR-9 in regulating the behavior of neural progenitors, as well as the differentiation of some neuronal populations (see further sections). [score:2]
However, the function of other miR-9 genes, and in particular of miR-4 and miR-79, which use the opposite strand, has yet to be directly addressed in drosophila. [score:2]
A feedback regulatory loop involving microRNA-9 and nuclear receptor TLX in neural stem cell fate determination. [score:2]
miR-9 expression is reduced in MB samples compared to neighboring brain tissues (Ferretti et al., 2009). [score:2]
Additional roles of miR-9 in neural development: miR-9 in post-mitotic neurons. [score:2]
miR-9 regulation of neural progenitors. [score:2]
The presence of miR-9 in the central nervous system can explain, at least in part, the low levels of Lamin A detected in this tissue compared to Lamin C. In HGPS patients, miR-9 repression of Progerin expression protects the CNS from this harmful protein. [score:2]
Regulation of prelamin A but not lamin C by miR-9, a brain-specific microRNA. [score:2]
A reduction of miR-9 expression compared to normal tissue was also observed in other types of cancer, including leukemia (Senyuk et al., 2013), lung cancers (Heller et al., 2012) and colon cancers (Bandres et al., 2009). [score:2]
Alternatively, indirect effects of miR-9 depletion could also explain the reduction of TLX protein. [score:2]
FXR1P but not FMRP regulates the levels of mammalian brain-specific microRNA-9 and microRNA-124. [score:2]
miR-9 was also found to be deregulated in other neurodegenerative disorders. [score:2]
MicroRNA miR-9 modifies motor neuron columns by a tuning regulation of FoxP1 levels in developing spinal cords. [score:2]
In deuterostomes, miR-9 genes demonstrate a strong evolutionary plasticity, in terms of strand usage and developmental function. [score:2]
The implication of miR-9 in tumorigenesis in such a variety of tissues suggests that miR-9 may regulate general processes and define a specific cellular state that could exist outside the nervous system. [score:2]
Studies in the developing brain demonstrated that miR-9 is deeply rooted in gene networks controlling the regulation of neural progenitors proliferation. [score:2]
miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasis. [score:2]
Figure 2 Role of miR-9 in the development of drosophila sensory organs. [score:2]
Altogether these data show that strand preference in miR-9 genes has been quite labile during the course of evolution which certainly influenced the regulation and functional evolution of the gene family. [score:2]
In contrast, studies in vertebrate mo del species point to highly conserved functions of miR-9, especially in the regulation of neural progenitor proliferation. [score:2]
In addition, to better understand the full repertoire of miR-9 actions, it will be necessary to identify the set of miR-9 targets in different cellular contexts and evaluate the functional impact of these interactions individually. [score:1]
Conversely, miR-9 loss-of-function consistently induces an increased proliferation of embryonic neural progenitors (Bonev et al., 2011; Shibata et al., 2011; Coolen et al., 2012) or mouse adult neural stem cells (Zhao et al., 2009). [score:1]
The individual role of the other miR-9* (miR-9-3p) has yet to be assessed. [score:1]
Convergent repression of Foxp2 3'UTR by miR-9 and miR-132 in embryonic mouse neocortex: implications for radial migration of neurons. [score:1]
miR-9 protects neural tissue from deleterious Progerin. [score:1]
In zebrafish embryos, miR-9 was shown to participate in the late patterning of the midbrain/hindbrain region. [score:1]
miR-9/9* was also shown to promote differentiation of adult neural stem cells in vitro, albeit only if they were primed for differentiation beforehand using forskolin or retinoic acid (Zhao et al., 2009). [score:1]
Both miR-9 putative binding sites can mediate the repression of a reporter transgene by endogenous miR-9 present in the cortex (Clovis et al., 2012). [score:1]
Nevertheless they suggest exciting links between miR-9 and the epigenetic landscape of neural progenitor cells. [score:1]
In Vertebrates, the amplification of miR-9 genes parallels the whole genome duplication events that occurred in the phylum and thus likely results from them. [score:1]
A better understanding of miR-9 function will certainly arise from the characterization of its set of targets and the analysis of the impact of these interactions in vivo. [score:1]
In deuterostomes, miR-9 genes always show a preferential usage of the 5' strand (miR-9-5p), although the 3' strand (miR-9-3p) is still present at detectable levels. [score:1]
Two recent studies demonstrated a role of miR-9 in this process (Jung et al., 2012; Nissan et al., 2012). [score:1]
This explains why miR-9-5p is often referred to as miR-9, while miR-9-3p is referred to as miR-9*. [score:1]
The authors could show that the differential levels of lamin A versus lamin C in brain tissues was not linked to differences in alternative splicing, but rather that it is likely linked to the presence of miR-9 in neural tissues. [score:1]
Altogether, a comprehensive knowledge of how miR-9 function can be modulated across different species and cellular contexts will be necessary to unravel its contribution in human pathologies. [score:1]
Interestingly miR-9 could also participate in remo deling the microRNAs landscape in neural cells. [score:1]
These cells are also characterized by high levels of miR-9. Over -expression of miR-9 in mesenchymal cells of HGPS patients could reduce the levels of lamin A and progerin, an effect mediated by the 3'UTR of the lamin A transcripts. [score:1]
The level of sequence conservation of pre-miR-9 among animals is strikingly high, in particular at the level of both 5' and 3' mature microRNA strands. [score:1]
miR-9 has been shown to influence various tumorigenic processes, including cellular proliferation (Rotkrua et al., 2011; Wilting et al., 2013), migration (Ma et al., 2010; Lu et al., 2012) and inflammation (Leucci et al., 2012). [score:1]
Thus, these in vitro data show that miR-9 alone is not sufficient to induce neuronal differentiation. [score:1]
So far, only a few of these interactions have been confirmed in vitro or in vivo, but these studies have shed light on the complex mode of action of miR-9 in neural progenitors. [score:1]
Altogether this data suggests that miR-9 does not act as a necessary and sufficient differentiation switch, but rather could favor the transition of progenitors from a proliferative mode to a neurogenic mode. [score:1]
Moreover, in human embryonic stem cell-derived neural progenitors, and rat embryonic cortical progenitors, miR-9 was shown to have a completely opposite role (Delaloy et al., 2010). [score:1]
Critical role of miR-9 in myelopoiesis and EVI1 -induced leukemogenesis. [score:1]
There is in contrast a high variability in strand preference among miR-9 copies (see Figure 1A). [score:1]
The activity of miR-9 on both sides of the MHB restricts the extent of the pool of non-neurogenic progenitors located at this boundary (Leucht et al., 2008). [score:1]
The different effects observed on neural progenitors in culture might be linked to a different timing of miR-9 depletion during in vitro differentiation (Zhao et al., 2009; Delaloy et al., 2010). [score:1]
The miR-9 gene is ancient in animal evolution, as it appeared at the transition towards triploblasty (Wheeler et al., 2009). [score:1]
It is therefore hard to draw a conclusion on the potential functional consequences of miR-9 repression of Sirt1 at this stage. [score:1]
MicroRNA-9 directs late organizer activity of the midbrain-hindbrain boundary. [score:1]
miR-9 impact on GSCs and tumor growth seems therefore to be variable among glioblastoma samples, an observation likely to reflect the high heterogeneity of these tumors. [score:1]
In this area miR-9 restricts the size of the MHB progenitor pool through repressing her5 while simultaneously limiting the signaling activity of the MHB progenitors by repressing Fibroblast growth factor (FGF) pathway genes (Leucht et al., 2008). [score:1]
Implication of miR-9 in human pathologies. [score:1]
Hes1/her6 genes also harbor a miR-9 binding site in their 3'UTR, which is conserved across vertebrates. [score:1]
In contrast, miR-9 seems to be specifically excluded from progenitor pools located at boundaries between brain compartments, such as the Midbrain-Hindbrain Boundary (MHB) or rhombomeres boundaries (Figure 3A; Leucht et al., 2008; Coolen et al., 2012). [score:1]
The paralog gene Foxp2 also possesses functional miR-9 binding sites on its 3'UTR. [score:1]
However, miR-9 has a more general influence on the behavior of neurogenic progenitors along the neural tube. [score:1]
Additionally, infecting human neonatal fibroblasts with lentiviral vectors containing miR-9/9* and miR-124 induces their conversion into postmitotic neurons. [score:1]
miR-9 in neurodegenerative disorders. [score:1]
miR-9 in cancer. [score:1]
To obtain a full picture of its gene network a thorough characterization of miR-9 targets and validation of the impact of individual interactions should be conducted. [score:1]
Surprisingly, miR-9 was also linked with cancers originating outside the nervous system. [score:1]
Figure 4 miR-9 protects the brain from Progerin. [score:1]
In this species of mollusk there is only one miR-9 gene with no preferential strand usage, mature microRNAs being equally recovered from both 5' and 3' strands of the duplex (Rajasethupathy et al., 2009). [score:1]
Links between neurodegenerative disorders and microRNAs, especially brain enriched microRNAs such as miR-9, have started to emerge in the literature (Lau and de Strooper, 2010). [score:1]
miR-9*, derived from the 3' strand of miR-9 genes, is also present at detectable levels in vertebrate neural tissues. [score:1]
These results indicate that miR-9 can inversely impact the proliferation of neural progenitors depending on the cellular context. [score:1]
The 3'UTR of repressor-element-1 silencing transcription factor (REST) and the corepressor CoREST, were shown to harbor functional binding sites for miR-9 and miR-9* respectively (Packer et al., 2008). [score:1]
These duplication events likely account for the presence of multiple miR-9 genes in vertebrates. [score:1]
Figure 1 History of the miR-9 gene family. [score:1]
This discrepancy could be linked to the presence of the RNA binding proteins Elavl1 or Msi1, which were shown in vitro to be able to convert miR-9 to an activator (Shibata et al., 2011). [score:1]
Structural evolution of the miR-9 gene familyThe miR-9 gene is ancient in animal evolution, as it appeared at the transition towards triploblasty (Wheeler et al., 2009). [score:1]
Structural evolution of the miR-9 gene family. [score:1]
This led in particular to the presence of five miR-9 genes in Drosophila, three of which are clustered in the same gene complex (Lai et al., 2004). [score:1]
However neural progenitors resume differentiation even under miR-9 depletion conditions, their cell cycle exit being only delayed (Shibata et al., 2011; Coolen et al., 2012). [score:1]
Strikingly, functional studies of miR-9 point to a highly versatile action. [score:1]
Functional evolution of miR-9: implication of miR-9a in fly neurogenesis. [score:1]
No miR-9 gene has been recovered so far from genomes of cnidarian species, such as the sea anemone or hydra, suggesting that the emergence of a miR-9 gene occurred at the transition towards triploblasty. [score:1]
In contrast, miR-9 is excluded specifically from boundary regions, containing long-lasting neural progenitors, such as the MHB (big arrowhead) or rhombomere boundaries (small arrowheads). [score:1]
miR-9 was also detected in adult brain neurogenic areas, in both fish and mouse (Deo et al., 2006; Kapsimali et al., 2007; Tozzini et al., 2012), and in primary cultures of mouse adult stem cells (Zhao et al., 2009). [score:1]
Eutherian mammals lost one class of miR-9 genes (corresponding to miR-9-4, also called miR-9b). [score:1]
[1 to 20 of 180 sentences]
3
[+] score: 425
Indeed, RNA sequencing of osteoblasts possessing enforced expression of miR-9 demonstrated that miR-9 modulated the expression of several genes, including downregulation of putative miR-9 targets whose transcripts contain 3’-UTR consensus binding sites for miR-9. Among these predicted targets, several transcription factors (HOX6B, TCF19) showed significant decreases in expression and putative HOXB binding sites were found in the promoter region of the canine gelsolin (GSN) gene, indicating a possible mechanism through which miR-9 induces upregulation of gelsolin. [score:17]
Taken together, our findings support the idea that miR-9 induces a pattern of gene expression that promotes increased cell motility and invasiveness and suggest that miR-9 -mediated up-regulation of gelsolin may in part play a role in mediating the biological consequences of miR-9. As miR-9 overexpression is associated with upregulation of gelsolin at the transcript and protein level, it is possible that miR-9 alters transcription factors responsible for repressing gelsolin expression. [score:13]
TGFBI has several highly conserved predicted miR-9 binding sites within the 3’UTR indicating direct regulation of expression by miR-9. Concordant with our RNA sequencing results, real time PCR demonstrated downregulation of TGFBI transcript expression in canine osteoblasts overexpressing miR-9 (Fig.   6c). [score:12]
Consensus binding sites for miR-9 were identified within the 3’-UTR of 37 genes that were significantly downregulated following miR-9 overexpression, suggesting that miR-9 may regulate the expression of these putative target genes (Additional file 6: Table S2, bolded). [score:11]
Four of the protein spots were unable to be definitively identified, and 2 of the proteins found to be significantly down-regulated following miR-9 overexpression did not have putative miR-9 binding sites within their 3’-UTR, implying that miR-9 may indirectly regulate their expression. [score:10]
We confirmed significant upregulation of gelsolin transcript and protein in normal osteoblasts expressing miR-9 and found that knockdown of miR-9 in the OSA8 cell line resulted in decreased expression of gelsolin with a concomitant decrease in cell invasion and migration. [score:9]
RNA sequencing identified 55 transcripts that were significantly up-regulated (>2-fold) and 139 transcripts were significantly down-regulated in osteoblasts overexpressing miR-9 (Additional file 6: Table S2). [score:9]
With respect to the role of miR-9 in spontaneous canine neoplasia, we have previously shown that overexpression of miR-9 is associated with aggressive, metastatic behavior in primary canine mast cell tumors and that enforced expression of miR-9 expression in normal and malignant mast cells enhances their invasive capacity and induces a pattern of gene expression that promotes cellular invasion [28]. [score:9]
Three independent experiments were performed using cells from 3 separate transduction experiments and all reactions were performed in triplicate We compared the gene expression profile of osteoblasts possessing enforced miR-9 expression to that of cells expressing empty control vector and observed significant differences in transcript expression. [score:8]
Three independent experiments were performed using cells from 3 separate transduction experiments and all reactions were performed in triplicate We compared the gene expression profile of osteoblasts possessing enforced miR-9 expression to that of cells expressing empty control vector and observed significant differences in transcript expression. [score:8]
For example, miR-9 overexpression in normal osteoblasts downregulated expression of TGF-β -induced (TGFBI), an extracellular matrix protein and known mediator of osteoblast adhesion by virtue of its interactions with αvβ3 and αvβ5 integrin heterodimers [73]. [score:8]
Alternatively, miR-9 may downregulate epigenetic factors that suppress gelsolin expression through DNA methylation or acetylation. [score:8]
To gain further mechanistic insight into miR-9 -dependent cell signaling events that may promote the invasive phenotype of osteoblasts, we evaluated the proteomic and gene expression profiles of canine osteoblasts expressing high levels of miR-9. We did not identify predicted miR-9 targets among the proteins that were found to be down-regulated in our proteomic analysis. [score:8]
Three independent experiments were performed and all reactions were performed in triplicate To assess the biological consequences of miR-9 expression in normal osteoblasts or malignant OS cell lines, canine osteoblasts and the OSA16 cell line that exhibits low endogenous expression of miR-9 were transduced with a pre-miR-9-3 lentiviral expression vector. [score:7]
One possible explanation for this is that while the miRNA target prediction tools (TargetScan, miRanda, miRWalk, PicTar) used in this study identified miR-9 canonical binding sites in the 3’UTR, because miRNAs are known to target other non-canonical sites, coding regions or 5’ UTRs these would not be detected in our analysis. [score:7]
Proteomic and gene expression profiling of normal canine osteoblasts with enforced miR-9 expression was performed using 2D-DIGE/tandem mass spectrometry and RNA sequencing and changes in protein and mRNA expression were validated with Western blotting and quantitative PCR. [score:7]
Other studies have shown that in human HOS and U2OS osteosarcoma cells express significantly higher levels of miR-9 compared to human mesenchymal stem cells or normal osteoblasts and demonstrate a functional role for miR-9 regulating osteosarcoma cell proliferation by targeting the GCIP tumor suppressor protein [64]. [score:7]
Concordant with these results, GSN protein expression was substantially reduced following down-regulation of miR-9 in OSA8 cells transduced with anti-miR-9 vector as compared to cells expressing control vector (Fig.   6a). [score:7]
Proteomic and transcriptional profiling of normal canine osteoblasts overexpressing miR-9 identified alterations in numerous genes, including upregulation of GSN, an actin filament-severing protein involved in cytoskeletal remo deling. [score:6]
A functional approach would be required to confirm direct targeting of putative gene targets by miR-9 and validate regulation of gene expression by miR-9. Furthermore, loss or gain of function studies evaluating components of the miR-9 regulatory circuit would further elucidate their contribution to osteoblast invasion and represents an ongoing area of investigation. [score:6]
Altered gene transcripts in canine osteoblasts overexpressing miR-9 (DOCX 18 kb) 2D-DIGE Two-dimensional difference-in-gel electrophoresis 3’-UTR 3’-untranslated region ALP alkaline phosphatase BMP2 bone morphogenic protein-2 CASC5 cancer susceptibility candidate 5 COL4A1 collagen type IV, alpha 4–1 COL4A2 collagen type IV, alpha 4–2 FFPE Formalin-fixed paraffin-embedded GSN gelsolin HOXB6 homeobox B6 KIF23 kinesin family member 23 miRNA microRNA MME membrane metallo-endopeptidase NSUN7 NOL1/NOP2/Sun domain family, member 7 OP osteopontin OS osteosarcoma PRC1 protein regulator of cytokinesis 1 STMN1 stathmin 1 TCF19 transcription factor 19 TGFBI TGF-β -induced The authors would like to thank Tim Vojt of the OSU College of Veterinary Medicine Biomedical Media Services for his assistance in figure preparation and the OSU College of Veterinary Medicine Comparative Oncology Biospecimen Repository for their assistance in tumor sample acquisition. [score:6]
Interestingly, miR-9 induced up-regulation of several proteins involved in actin dynamics and cytoskeletal remo deling, including gelsolin and cofilin-1. To independently validate these changes in protein expression, western blotting was performed for gelsolin, an actin binding protein implicated in neoplastic transformation and metastasis [46, 47]. [score:6]
Transduced cells were sorted based on GFP expression and miR-9 expression was assessed by quantitative PCR to confirm mature miR-9 knockdown (Fig.   5c). [score:6]
Prediction of miR-9 binding to the 3’-UTR of genes down-regulated by miR-9 was performed with computer-aided algorithms obtained from TargetScan (http://www. [score:6]
Consistent with our 2D-DIGE results, gelsolin (GSN) was up-regulated in miR-9 expressing osteoblasts (Fig.   6a). [score:6]
Lastly, stable downregulation of miR-9 in OS cell lines reduced GSN expression with a concomitant decrease in cell invasion and migration; concordantly, cells transduced with GSN shRNA demonstrated decreased invasive properties. [score:6]
Two-dimensional difference-in-gel electrophoresis (2D-DIGE) identified 10 protein spots that were differentially expressed in osteoblasts overexpressing miR-9 compared to cells expressing empty control vector (Additional file 5: Figure S4). [score:6]
To validate changes in mRNA expression for selected genes affected by miR-9 expression, total RNA was collected and cDNA was generated as described above. [score:5]
To gain further mechanistic insight into miR-9 -dependent cell signaling events that may promote the invasive phenotype of osteoblasts, we analyzed the proteomic and gene expression profiles of canine osteoblasts expressing control or miR-9 lentiviral constructs. [score:5]
To determine the impact of miR-9 expression on normal or malignant osteoblast cell proliferation and apoptosis, canine osteoblasts and the OSA16 cell line expressing control or pre-miR-9-3 lentiviral constructs were cultured for 24, 48, and 72 h and cell proliferation and caspase-3,7 activity was assessed. [score:5]
Our data demonstrate that miR-9 expression is significantly upregulated in canine primary OS tumors compared to normal osteoblast cells or primary osteoblast cultures. [score:5]
To assess the contribution of tumor microenvironment on miR-9 expression in primary canine OS tissues, we identified homogenous OS tumor cells regions in FFPE primary OS tumor specimens and isolated RNA from targeted tumor core samples. [score:5]
Our data indicate that overexpression of miR-9 in normal osteoblasts and OS cell lines contributes to the aggressive biological behavior of OS as demonstrated by enhanced cellular invasiveness and motility and alteration in gene and protein expression profiles associated with cellular invasion, thereby promoting the metastatic phenotype. [score:5]
Furthermore, we found that OS cells isolated from FFPE canine primary OS tumors express high levels of miR-9 compared to normal canine bone, canine osteoblasts and primary osteoblast cultures, suggesting that increased expression of miR-9 in OS tumors is primarily influenced by OS tumor cells and not stroma/inflammatory cells present in the tumor microenvironment. [score:4]
These findings demonstrate that the observed overexpression of miR-9 in canine OS tumor samples is not secondary to non-neoplastic cells infiltrating the tumor microenvironment, but derived directly from the malignant osteoblasts. [score:4]
These results are concordant with data generated in human OS tumors, suggesting that dysregulation of miR-9 may be fundamental to the disease process in both species. [score:4]
Furthermore, real time PCR demonstrated an increase in GSN mRNA expression in osteoblasts overexpressing miR-9 compared to empty vector controls, which was further validated with RNA sequencing (0.4-fold increase, p = 0.05) (Fig.   6b). [score:4]
As shown in Fig.   5a, overexpression of miR-9 in normal osteoblasts or malignant OSA16 cells significantly enhanced their invasion after 24 h of culture compared to cells expressing empty vector. [score:4]
Interestingly, our proteomic analysis identified several proteins upregulated by miR-9, including gelsolin, an actin filament severing and capping protein implicated in promoting the metastatic phenotype [46, 65]. [score:4]
The transcripts identified as predicted targets of miR-9 are involved in a variety of cellular processes, including transcription (transcription factor 19, TCF19 and homeobox B6, HOXB6), RNA methyltransferases (NOL1/NOP2/Sun domain family, member 7, NSUN7), cytokinesis/microtubule assembly (protein regulator of cytokinesis 1, PRC1; kinesin family member 23, KIF23; stathmin 1, STMN1; and cancer susceptibility candidate 5, CASC5), endopeptidase activity (membrane metallo-endopeptidase, MME), and extracellular matrix organization (TGF-β -induced, TGFBI and collagen type IV, alpha 4–1 and −2, COL4A1, COL4A2). [score:4]
Our data also show that miR-9 negatively regulates the expression of several other factors that may cooperatively enhance invasion and motility in normal osteoblasts. [score:4]
In murine pre-osteoblasts and pluripotent stem cells, miR-9 expression is reduced following BMP2 -induced osteoblastic differentiation, implying that miR-9 may be an important regulatory factor in osteoblastic differentiation [62, 63]. [score:4]
Given the established role of gelsolin in the regulation of actin polymerization and cycling, our data indicate that miR-9 may enhance invasion in canine neoplastic osteoblasts, in part, through increased expression of this protein. [score:4]
Our previous findings support the notion that miR-9 promotes cell invasion and migration in canine osteoblasts, in part, through up-regulation of GSN. [score:4]
1.3.2 miR-9 is up-regulated in canine OS tumor tissues and cell lines. [score:4]
In concordance with our findings in normal canine osteoblasts and OSA16 cells overexpressing miR-9, inhibition of miR-9 in OSA8 cells significantly decreased cell invasion and migration compared to control cells (Fig.   5c, d), providing further support for the role of miR-9 in OS invasion. [score:4]
As such, miR-9 represents a novel target for therapeutic intervention in OS. [score:3]
However, our data indicate that while enforced miR-9 expression in normal canine osteoblasts and the OSA16 cell line enhanced cellular invasion and migration, miR-9 had no impact on cellular proliferation or viability. [score:3]
Furthermore, transduction of the canine OSA8 cell line expressing high basal levels of miR-9 with an anti-miR-9 construct subsequently decreased invasion and migration, supporting the assertion that miR-9 promotes a metastatic phenotype in osteoblasts and OS cell lines. [score:3]
Our findings demonstrate that miR-9 promotes a metastatic phenotype in normal canine osteoblasts and malignant OS cell lines, and that this is mediated in part by enhanced GSN expression. [score:3]
Furthermore, increased serum miR-9 concentrations in human OS patients and miR-9 expression in primary OS tumors strongly correlates with tumor size, clinical stage, distant metastasis, and poor clinical outcome [45, 56]. [score:3]
MicroRNA miR-9 Osteosarcoma Canine Comparative oncology Osteosarcoma (OS) is the most common form of malignant bone cancer in dogs and children, although the incidence of disease in the canine population is approximately ten times higher than in people [1– 3]. [score:3]
Anti-miR-9 expression decreases cell invasion and migration in OSA8 cells. [score:3]
Real-time PCR confirmed differential expression of 5 representative miRNAs (miR-1, miR-9, miR-10b, miR-122, miR-200c) in normal canine tissues (brain cortex, liver, lymph node, kidney, skeletal muscle, spleen, thyroid; N = 3 per tissue) (Bars: SD. [score:3]
Three independent experiments were performed and all reactions were run in triplicate Of the miRNAs found to be dysregulated in canine OS, miR-9 expression levels were significantly higher in primary canine tumor samples as compared to normal canine osteoblasts. [score:3]
FACS -mediated cell sorting based on GFP expression was performed 72 h post-transduction and miR-9 expression was evaluated by real-time PCR (Applied Biosystems). [score:3]
Protein lysates from canine osteoblasts transduced with control or pre-miR-9-3 lentivirus and OSA8 cells stably expressing scramble or miRZip-9 lentiviral constructs were prepared and quantified, separated by SDS-PAGE, and western blotting was performed as previously described [43]. [score:3]
This finding was independently validated by real-time PCR for miR-9 in fresh primary canine OS tumors, canine OS cell lines, normal canine bone, osteoblast cell lines, and primary osteoblast cultures (Fig.   3), demonstrating significantly higher levels of miR-9 expression in the tumors and OS cell lines relative to normal bone or osteoblasts. [score:3]
Primary osteosarcoma tumor specimens exhibit significant cellular heterogeneity; it was therefore possible that expression levels of miR-9 in tumor samples were influenced by the proportion of tumor cells to stroma/inflammatory cells. [score:3]
Future work to more thoroughly characterize how miR-9 expression imparts a metastatic phenotype in OS is ongoing with the ultimate goal of identifying novel targets for therapeutic intervention. [score:3]
Additionally, high miR-9 expression was demonstrated in tumor-specific tissue obtained from primary OS tumors. [score:3]
Stably transduced GFP + cells were sorted and real-time PCR was used to confirm miR-9 overexpression (Fig.   4a). [score:3]
These data are concordant with published data demonstrating overexpression of miR-9 in human OS [45]. [score:3]
MiR-9 levels were assessed by real-time PCR in wild-type, empty vector, and miR-9 expressing cells (Bars: SD. [score:3]
a Normal canine osteoblasts and OSA16 cells transduced with pre-miR-9-3 lentivirus or empty vector control were sorted to greater than 95 % purity based on GFP expression. [score:3]
After 20 h, cell migration was evaluated by digital photography To determine whether inhibition of miR-9 would impair cell migration and invasion, the canine OSA8 cell line that expresses high basal levels of miR-9 was transduced with miRZip-9 (anti-miR-9) or control lentivirus. [score:3]
Overexpression of miR-9 had no observed effects on cell proliferation or apoptosis in either normal osteoblast cells or malignant OS cell lines (Fig.   4b, c). [score:3]
miR-9 expression enhances invasion and migration in normal osteoblasts and the OSA16 cell line. [score:3]
b Canine osteoblasts expressing pre-miR-9-3 lentivirus or empty vector control were collected and real-time PCR for gelsolin and (c) TGFBI was performed (Bars: SD. [score:3]
Furthermore, the actin filament-severing protein gelsolin was identified as a mediator of the miR-9 induced invasive phenotype in normal osteoblasts and OS cell lines, providing a potential mechanism for the relationship between miR-9 expression and metastasis. [score:3]
Furthermore, miR-9 expression levels were shown to be significantly increased in distant metastases compared to corresponding primary tumors, suggesting that miR-9 is directly involved in the metastatic process [60, 61]. [score:3]
Quantitative PCR was used to validate the nanoString findings and to assess miR-9 expression in canine OS tumors, OS cell lines, and normal osteoblasts. [score:3]
Fig. 4Overexpression of miR-9 has no effect on cell proliferation or apoptosis of normal osteoblasts or OS cell lines. [score:3]
Overexpression of pre-miR-9 does not alter cellular proliferation or caspase-3,7 dependent apoptosis in normal canine osteoblasts or the OSA16 cell line. [score:3]
The student’s t-test was used to compare protein expression for each spot between empty vector and miR-9-transduced osteoblast samples and p-values of < 0.05 were considered significant. [score:2]
These findings are consistent with recent studies demonstrating that miR-9 expression is significantly increased in primary human OS tumors compared to paired non-cancerous bone tissues [45]. [score:2]
To quantify miR-9 expression, cDNA was generated and real-time PCR was performed using Human Taqman miRNA assays (Applied Biosystems) as described above. [score:2]
MiR-9 is known to confer multiple, often divergent, functions to various cell types including inhibition of human ovarian tumor cell growth [57] and stimulation of proliferation of gastric cancer cell lines [58]. [score:2]
Cell migration activity was assessed in normal osteoblasts overexpressing miR-9 using the wound-healing assay (scratch test). [score:2]
Fig.   5b demonstrates that miR-9 enhanced cell motility and scattering following gap formation in normal osteoblasts compared to osteoblasts expressing control vector (Fig.   5b). [score:2]
We identified a unique miRNA signature associated with primary canine OS and identified miR-9 as being significantly overexpressed in canine OS tumors and cell lines compared to normal osteoblasts. [score:2]
We found that miR-9 expression was markedly increased in OS tumor cells as compared to normal canine bone, normal canine osteoblasts and primary osteoblast cultures (Fig.   3). [score:2]
Furthermore, primary canine OS tumor specimens and OS cell lines express significantly higher levels of miR-9 compared to normal canine osteoblasts and primary osteoblast cultures. [score:2]
Real time PCR confirmed overexpression of miR-9 in canine OS tumors and OS cell lines as compared to normal canine osteoblasts (p < 0.001). [score:2]
Canine osteoblasts and OS cell lines were stably transduced with pre-miR-9 or anti-miR-9 lentiviral constructs to determine the consequences of miR-9 on cell proliferation, apoptosis, invasion and migration. [score:1]
Total RNA was extracted from canine osteoblast cells transduced with either empty lentivirus (n = 3) or pre-miR-9-3 lentivirus (n = 3) using the TRIzol method and RNA sequencing was performed at the OSU Comprehensive Cancer Center Genomics Shared Resource. [score:1]
MZIP000-PA-1) or miRZip-9 anti-miR-9 lentivirus (catalog no. [score:1]
To assess the effects of miR-9 and GSN on invasion, cell culture inserts (8-μm pore size; Falcon) were coated with 100 μL of diluted (1:10) Matrigel (BD Bioscience, San Jose, CA, USA) to form a thin continuous layer and allowed to solidify at 37 °C for 1 h. Canine osteoblasts, OSA8 and OSA16 cell lines (5 × 10 [4]/mL) transduced with control lentivirus, pre-miR-9-3 lentivirus, miRZip-9 lentivirus, or shGSN lentivirus were prepared in serum-free medium and seeded into each insert (upper chamber) and medium containing 10 % fetal bovine serum was placed in the lower chamber. [score:1]
2D-DIGE electrophoresis and RNA sequencing identifies miR-9 -induced alterations to the proteome and transcriptome of canine osteoblasts. [score:1]
The following day, the medium was changed to Stemline (Gibco) with transfection agent TransDux (Systems Biosciences) and either empty control or pre-miR-9-3 virus (osteoblasts) or miRZip-9 or negative control scrambled virus (OSA8) was added to cells according to manufacturer’s protocol. [score:1]
Collectively, these findings demonstrate that miR-9 promotes an invasive phenotype in normal and malignant canine osteoblasts. [score:1]
Previous studies have identified a role for miR-9 in promoting the metastatic phenotype in human breast cancer cell lines through its ability to enhance cell invasion and enable otherwise non-metastatic breast tumor cells to form pulmonary micrometastases in mice [59]. [score:1]
Canine osteoblasts and OSA16 cells (2.5 × 10 [3]) transduced with either empty lentivirus or pre-miR-9-3 lentivirus were plated in triplicate in 96-well plates for 24 and 48 h prior to analysis. [score:1]
b Canine osteoblasts or OSA16 cells were transduced with either empty vector or pre-miR-9-3 lentivirus vector and cell proliferation was analyzed at 24, 48, and 72 h using the CyQUANT method. [score:1]
CD511B-1) or pre-miR-9-3 lentivirus (catalog no. [score:1]
miR-9, anti-miR-9, and shGSN lentivirus infection. [score:1]
In normal osteoblasts and OS cell lines transduced with miR-9 lentivirus, enhanced invasion and migration were observed, but miR-9 did not affect cell proliferation or apoptosis. [score:1]
a Protein lysates were generated from normal canine osteoblasts stably transduced with either empty vector (EV) or pre-miR-9-3 (miR-9) lentivirus and canine OSA8 cells stably transduced with miRZip-9 (anti-miR-9) or scramble vector control. [score:1]
Proteins with greater abundance in the miR-9 -transfected sample appear green and proteins with greater abundance in the EV -transfected samples appear red. [score:1]
Canine osteoblasts and OSA16 cells (2.5 × 10 [3]) transduced with control lentivirus or pre-miR-9-3 lentivirus were seeded in triplicate in 96-well plates; non-transduced cells served as negative controls. [score:1]
c Canine OSA8 cells were transduced with miRZip-9 (anti-miR-9) or scramble vector and miR-9 levels were assessed by real-time PCR to confirm transduction efficiency (* p < 0.0009). [score:1]
RNA was collected from primary canine osteoblast cultures (CBDC, n = 5), normal canine osteoblast cell lines (Ob, n = 2, corresponding to 2 different commercially available lots), normal canine bone (n = 5), canine OS cell lines (n = 8), FFPE canine OS tumor cores (n = 5), and fresh primary canine OS tumors (n = 20) and real-time PCR was performed to evaluate miR-9 expression. [score:1]
Cell invasion was assessed in canine OSA8 cells transduced with scramble or miRZip-9 (anti-miR-9) lentivirus using standards as described above. [score:1]
Protein lysates prepared from canine osteoblast cells transduced with either empty lentivirus (n = 4) or pre-miR-9-3 lentivirus (n = 4) were purified using the 2-D Clean-Up Kit (GE Healthcare, Uppsala, Sweden). [score:1]
[1 to 20 of 104 sentences]
4
[+] score: 416
Bioinformatic analysis identified putative miR-9 target sites within the 3’-UTR of 40 gene transcripts that were significantly down-regulated with miR-9 overexpression, suggesting that miR-9 may directly target and regulate expression of these candidate genes (Table  3, bolded). [score:14]
Indeed, miR-9 overexpression in normal mast cells resulted in increased expression of CMA1 with a concomitant decrease in the expression of secretory leukocyte peptidase inhibitor (SLPI), a direct inhibitor of chymase [49]. [score:12]
Furthermore, down-regulation of peroxisome proliferator-activated receptor δ (PPARG) was observed in BMMCs following enforced miR-9 expression, a finding consistent with recent studies demonstrating that regulation of PPARG expression is mediated by miR-9 through direct targeting of its 3’-UTR [25]. [score:12]
In contrast, miR-9 is downregulated in human ovarian tumor cells and overexpression of miR-9 suppresses their proliferation, in part by downregulating NFκB1 [40, 42]. [score:11]
Bioinformatic analysis identified putative miR-9 target sites within the 3’-UTR of 15 gene transcripts that were significantly down-regulated following miR-9 overexpression, suggesting that miR-9 may directly regulate these genes (Table  5, bolded). [score:10]
Real-time PCR demonstrated that expression of SERPINF1 and MLANA transcript was up-regulated in P815 cells overexpressing miR-9, whereas CD200R1 and CD200R4 was down-regulated compared to empty vector controls (Figure  6B). [score:10]
To draw firm conclusions regarding direct regulation of target gene expression by miR-9, a functional approach for each gene would be required to validate whether these genes are true miR-9 targets, which although relevant, was outside the scope of this study. [score:9]
In BMMCs overexpressing miR-9, 321 transcripts were significantly up-regulated (>2-fold) and 129 transcripts were significantly down-regulated (Table  3, Table  4). [score:9]
Real time PCR confirmed that one of these genes, peroxisome proliferator-activated receptor δ (PPARG) was down-regulated, a finding consistent with recent studies demonstrating regulation of PPARG by miR-9 through direct targeting of its 3’-UTR [25]. [score:8]
These findings are consistent with the notion that that miR-9 promotes a pattern of gene expression contributing to enhanced invasion and suggests a role for chymase in mediating the biologic functions of miR-9. Interestingly, miR-9 modulated the expression of other proteases in normal mast cells, including up-regulation of heparinase (HSPE). [score:8]
MiR-9 modulated the expression of a large number of gene transcripts, including down-regulation of several putative miR-9 targets identified by computational prediction programs. [score:8]
Consistent with our microarray results, we found that transcripts for HSPE and TLR7 were significantly up-regulated in BMMCs expressing miR-9, whereas transcripts for PPARG, PERP, and SLPI were significantly down-regulated compared to empty vector controls (Figure  6A). [score:8]
Furthermore, enforced miR-9 expression in murine mastocytoma cell lines and normal murine BMMCs with low basal levels of miR-9 enhanced invasion and induced the expression of several target genes associated with metastasis, including chymase (CMA1) and heparinase (HSPE). [score:7]
Furthermore, overexpression of miR-9 is associated with aggressive biologic behavior of canine MCTs, possibly through the promotion of a metastatic phenotype as demonstrated by enhanced invasive behavior of normal and malignant mast cells and alteration of gene expression profiles associated with cellular invasion in the presence of enforced miR-9 expression. [score:7]
While some studies have shown that miR-9 promotes metastasis formation [33, 36- 39] other contrasting studies suggest that increased expression of miR-9 suppresses metastasis formation [40, 41] and that miR-9 inhibits tumor growth [42]. [score:7]
Overexpression of miR-9 significantly altered gene expression in both BMMCs and P815 cells, however, most gene transcripts affected by miR-9 expression differed between normal and malignant mast cells. [score:7]
Transcriptional profiling of normal mouse BMMCs and P815 cells possessing enforced miR-9 expression demonstrated dysregulation of several genes, including upregulation of CMA1, a protease involved in activation of matrix metalloproteases and extracellular matrix remo deling. [score:7]
In our study, we identified gene transcripts that showed similar changes in expression following miR-9 overexpression in both normal and malignant mast cells and validated several genes demonstrating significant changes in expression (interferon -induced transmembrane protein protein 3, IFITM3; PDZK1 interacting protein 1, PDZK1IP1) or implicated in promoting the metastatic phenotype (mast cell chymase, CMA1). [score:7]
In transformed mouse malignant mast cell lines expressing either wild-type (C57) or activating (P815) KIT mutations and mouse BMMCs, miR-9 overexpression significantly enhanced invasion but had no effect on cell proliferation or apoptosis. [score:6]
Consistent with our microarray results, real-time PCR confirmed that enforced miR-9 expression significantly upregulated CMA1, IFITM3, and PDZK1IP1 transcripts in mouse BMMCs and P815 cells (Figure  6C). [score:6]
Previous studies have demonstrated that miR-9 is overexpressed in CDX2 -negative primary gastric cancers and miR-9 knockdown inhibits proliferation of human gastric cancer cell lines [43]. [score:6]
miR-9 expression is up-regulated in canine malignant mast cell lines. [score:6]
Prediction of miR-9 binding to the 3’-UTR of genes down-regulated by miR-9 was performed with computer-aided algorithms obtained from TargetScan (http://www. [score:6]
The opposing roles of miR-9 in various tissues may be explained by the expression of different mRNA targets in distinct cellular and developmental contexts. [score:6]
To gain insight into possible mechanisms underlying the observed miR-9 -dependent invasive behavior of mast cells, we compared the transcriptional profiles of murine BMMCs overexpressing miR-9 to those expressing empty vector and found marked changes in gene expression (Figure  5). [score:6]
Furthermore, miR-9 expression correlates with tumor grade and metastatic status in human breast cancer, providing further support for the idea that altered miR-9 expression may be an important regulator of aggressive biological behavior in MCTs (33). [score:6]
Transcriptional profiling of cells overexpressing miR-9 was performed using Affymetrix GeneChip Mouse Gene 2.0 ST arrays and real-time PCR was performed to validate changes in mRNA expression. [score:5]
We identified 7 gene transcripts (IFITM3, PDZK1IP1, CMA1, MGL1, TMEM223, SLAMF1, CLEC4E) that showed similar changes in expression following miR-9 overexpression in both BMMCs and P815 cells. [score:5]
We performed real-time PCR to validate changes in gene expression for several transcripts altered by miR-9 overexpression, including mast cell chymase (CMA1), interferon -induced transmembrane protein 3 (IFITM3), and PDZK1 interacting protein 1 (PDZK1IP1). [score:5]
Real-time PCR was performed to validate changes in mRNA expression for selected genes affected by miR-9 over expression. [score:5]
We performed real-time PCR to validate changes in gene expression for several transcripts altered by miR-9 overexpression in BMMCs. [score:5]
Our data show that normal mast cells overexpressing miR-9 exhibit markedly increased HSPE expression, supporting the assertion that miR-9 may promote the metastatic phenotype by enhancing the proteolytic activity of a number of proteases important in physical remo deling of the extracellular matrix and activate mediators responsible for cell dissemination. [score:5]
The differences in the biology of these diseases may account for the observed differences in miR-9 expression in canine and murine cell lines. [score:5]
To investigate the functional consequences of miR-9 overexpression in malignant mast cell lines, we stably expressed miR-9 in the mouse P815 and C57 cell lines that exhibit low basal levels of this miRNA using an empty or pre-miR-9-3 expressing lentivirus vector. [score:5]
These data suggest that miR-9 overexpression may contribute to the invasive phenotype of malignant mast cells thereby providing a potentially novel pathway for therapeutic intervention in malignant mast cell disease. [score:5]
Hierarchical clustering was performed for 450 genes differentially expressed (p < 0.05) in mBMMCs expressing either empty vector (EV) or miR-9 (miR9) as determined by one-way ANOVA comparison test (p < 0.05). [score:5]
Furthermore, we found that miR-9 expression was significantly upregulated in aggressive MCTs compared to benign MCTs. [score:5]
Real-time PCR was performed to validate changes in gene expression for transcripts (HSPE, TLR7, PERP, PPARG, SLPI) altered by miR-9 overexpression in mBMMCs (*p < 0.05). [score:5]
Figure 5 Overexpression of miR-9 in normal mouse bone marrow-derived mast cells significantly alters gene expression. [score:5]
Real-time PCR was performed to independently validate expression levels of genes (SERPINF1, MLANA, CD200R1, CD200R4) altered by enforced miR-9 expression in P815 cells (*p < 0.05). [score:5]
Our data demonstrate that overexpression of miR-9 in the C57 and P815 mouse malignant mast cell lines and normal mouse BMMCs significantly enhanced the invasive behavior of mast cells and indicate that miR-9 induces a pattern of gene dysfunction associated with an invasive phenotype regardless of KIT mutation status. [score:4]
As shown in Figure  3B, enforced expression of miR-9 in C57 and P815 mast cell lines significantly enhanced their invasion compared to cells expressing empty vector. [score:4]
These findings provide further support for the notion that miR-9 induces alterations in gene expression that may contribute to the development of an invasive phenotype. [score:4]
Our data demonstrate that unique miRNA expression profiles correlate with the biological behavior of primary canine MCTs and that miR-9 expression is increased in biologically high grade canine MCTs and malignant cell lines compared to biologically low grade tumors and normal canine BMMCs. [score:4]
More recently, miR-9 expression was found to be significantly increased in paired primary tumors and distant metastatic sites, suggesting direct involvement of miR-9 in the metastatic process [34, 35]. [score:4]
We found that unique miRNA expression profiles correlate with the biological behavior of primary canine MCTs and that miR-9 was significantly overexpressed in aggressive MCTs compared to benign MCTs. [score:4]
Figure 6 Identification of transcripts dysregulated by miR-9 overexpression in normal murine BMMCs and P815 malignant mast cells. [score:4]
Consistent with findings in the P815 and C57 cell lines, enforced expression of miR-9 in mouse BMMCs significantly enhanced their invasive capacity compared to cells expressing empty vector (Figure  4B). [score:4]
Mouse mast cell lines and BMMCs were transduced with empty or pre-miR-9 expressing lentiviral constructs and cell proliferation, caspase 3/7 activity, and invasion were assessed. [score:3]
Given the role of chymase in the activation of matrix metalloproteases and extracellular matrix degradation, our findings suggest that miR-9 enhances invasion, in part, through increased expression chymase. [score:3]
A comparison of the transcriptional profiles both from normal BMMCs and malignant P815 cells overexpressing miR-9 found that most gene transcripts altered by miR-9 were specific to normal or malignant mast cells. [score:3]
In our studies, miR-9 expression in mast cell lines did not provide a survival advantage or prevent apoptosis, but it did alter the invasive phenotype, supporting the contextual nature of miR-9 induced effects. [score:3]
Low miR-9 expression in P815 cells may reflect the fact that these cells represent a true leukemia, in contrast to the BR and C2 cell lines which are derived from cutaneous tumors that would metastasize via the lymphatic system. [score:3]
miR-9 expression enhances invasion in normal mouse BMMCs. [score:3]
Taken together, these findings suggest a correlation between miR-9 expression levels in primary canine MCTs and metastatic behavior. [score:3]
Normal mBMMCs transduced with pre-miR-9-3 lentivirus or empty vector control were sorted based on GFP expression. [score:3]
miR-9 is overexpressed in biologically high-grade canine MCTs. [score:3]
Interestingly, one of the primary tumor samples collected from a dog with a biologically low-grade MCT expressed high levels of miR-9 and the unsupervised hierarchial clustering of all 24 MCTs demonstrated that this dog’s tumor clustered with the biologically high-grade tumors (Figure  1). [score:3]
FACS -mediated cell sorting based on GFP expression was performed 72 hours post-transduction and miR-9 expression was evaluated by real-time PCR (Applied Biosystems). [score:3]
Furthermore, inhibition of miR-9 in canine mast cell lines would provide further convincing evidence of its importance in mast cell invasion. [score:3]
Following transduction, GFP + cells were sorted and miR-9 expression was confirmed by real-time PCR (Figure  3A). [score:3]
Figure 3 Overexpression of miR-9 enhances invasion of malignant mast cells and has no effect on cell proliferation or apoptosis. [score:3]
To investigate whether overexpression of miR-9 in malignant mast cells affected their capacity to proliferate or survive, mouse C57 and P815 cell lines expressing pre-miR-9-3 lentivirus or empty vector control were cultured for 24, 48, and 72 hrs and the impact on cell proliferation and apoptosis was assessed. [score:3]
Given the potential link between miR-9 expression and biological behavior of MCTs, we next evaluated miR-9 expression in canine (BR and C2) and murine (C57 and P815) mast cell lines and normal canine and murine BMMCs by real-time PCR. [score:3]
To assess the effect of ectopic miR-9 expression on the invasive capacity the BMMCs, a was again performed. [score:3]
Overexpression of pre-miR-9 enhances invasion of malignant mast cell lines. [score:3]
Figure 4 Overexpression of miR-9 enhances invasion in normal mouse bone marrow-derived mast cells. [score:3]
To assess the effect of miR-9 expression on invasion, cell culture inserts (8-μm pore size; Falcon) were coated with 100 μL of Matrigel (BD Bioscience, San Jose, CA, USA) to form a thin continuous layer and allowed to solidify at 37°C for 1 hour. [score:3]
MiR-9 levels were assessed by real-time PCR in wild-type, empty vector, and miR-9 expressing cells (*p < 0.05). [score:3]
Future work to dissect the exact mechanisms through which miR-9 exerts the invasive phenotype is ongoing with the ultimate goal of identifying potential druggable targets for therapeutic intervention. [score:3]
Given prior work from our laboratory showing that the C2 line exhibits invasive behavior in vitro while the P815 line does not [24], it was possible that miR-9 expression was associated with the invasive behavior of mast cells. [score:3]
Furthermore, dysregulation of miR-9 is associated with MCT metastasis potentially through the induction of an invasive phenotype, identifying a potentially novel pathway for therapeutic intervention. [score:2]
MiR-9 overexpression in transformed BMMCs was confirmed by quantitative real-time PCR (Figure  4A). [score:2]
This finding was confirmed by real-time PCR in which a 3.2-fold increase in miR-9 expression was identified in biologically aggressive MCTs as compared to benign MCTs (Figure  2A). [score:2]
Mature miR-9 expression was performed using Taqman miRNA assays (Applied Biosystems). [score:2]
Taken together, these data support the notion that dysregulation of miR-9 may contribute to the aggressive biologic behavior of some canine MCTs. [score:2]
As shown in Figure  2B, canine mastocytoma cells exhibited higher levels of miR-9 expression when compared with normal canine BMMCs. [score:2]
No effects of miR-9 on proliferation or apoptosis were observed in either cell line when compared to cells expressing empty vector (Figure  3C and D). [score:2]
In concordance with the potential role of miR-9 in malignant mast cell behavior, the BR and C2 canine malignant cell lines expressed high levels of miR-9 compared to normal canine BMMCs. [score:2]
Figure 2 MiR-9 is highly expressed in biologically high grade canine MCTs and malignant mast cell lines. [score:2]
P815 and C57 cell lines, and mouse BMMCs (5 × 10 [5]/mL) transduced with control lentivirus or pre-miR-9-3 lentivirus were prepared in serum-free medium and seeded into each insert (upper chamber) and media containing 10% fetal bovine serum was placed in the lower chamber. [score:1]
These observed differences likely reflect variations in the impact of miR-9 that are dependent on cellular context. [score:1]
miR-9 has no effect on cell proliferation or caspase-3,7 dependent apoptosis in malignant mast cells. [score:1]
In contrast, both mouse C57 and P815 cells and mouse BMMCs demonstrated low basal levels of miR-9. The mouse P815 mastocytoma cell line is a leukemia of mast cell origin, whereas the canine BR and C2 mastocytoma cells are derived from cutaneous tumors. [score:1]
P815 and C57 cells (5.0 × 10 [4]) transduced with either empty lentivirus or pre-miR-9-3 lentivirus were plated for 24 and 48 hours in 96-well plates prior to analysis. [score:1]
To characterize the biological consequences of miR-9 overexpression in normal mast cells, we transduced murine BMMCs with pre-miR-9-3 lentivirus or empty control vector. [score:1]
CD511B-1) or pre-miR-9-3 lentivirus (catalog no. [score:1]
We evaluated the miRNA expression profiles from biologically low-grade and biologically high-grade primary canine MCTs using real-time PCR -based TaqMan Low Density miRNA Arrays and performed real-time PCR to evaluate miR-9 expression in primary canine MCTs, malignant mast cell lines, and normal bone marrow-derived mast cells (BMMCs). [score:1]
RNA was extracted from mouse BMMCs and P815 cells transduced with empty lentivirus or pre-miR-9-3 lentivirus from three separate transduction experiments using TRIzol (Invitrogen). [score:1]
P815 and C57 cells (15 × 10 [4]) transduced with control lentivirus or pre-miR-9-3 lentivirus were seeded in 96-well plates for 24, 48, and 72 hours prior to analysis. [score:1]
RNA was harvested from mouse BMMCs transduced with empty vector or pre-miR-9-3 lentivirus from three separate transduction experiments. [score:1]
To gain insight into possible mechanisms underlying the observed miR-9 -dependent invasive behavior of mast cells, we evaluated the effects of miR-9 expression on the transcriptional profiles of BMMCs and P815 cells. [score:1]
As such, identifying proteins altered by miR-9 that promote cell invasion and validating these targets in canine cell lines/tumors represents an area of ongoing investigation. [score:1]
Microarray analysis identified genes affected by miR-9. Discussion. [score:1]
Together, these data suggest that miR-9 promotes an invasive phenotype in mast cells. [score:1]
Interestingly, miR-9 was identified as a pro-metastatic miRNA in human breast cancer cell lines through its ability to enhance cell motility and invasiveness in vitro and metastasis formation in vivo[33]. [score:1]
Transcriptional profiling of cells transduced with miR-9 lentivirus. [score:1]
The present study investigated alterations in gene transcript expression affected by miR-9; however, these changes were not demonstrated at the protein level. [score:1]
[1 to 20 of 98 sentences]
5
[+] score: 400
Other miRNAs from this paper: hsa-mir-9-1, hsa-mir-9-2
We also identified miR-9 as a new target of erlotinib, based on our findings that (1) erlotinib downregulated miR-9 expression in several NSCLC cells; (2) overexpression of miR-9 decreased the growth inhibitory effects of erlotinib. [score:12]
However, miR-9 overexpression only partially reversed erlotinib’s anti-growth effects, suggesting that downregulation of miR-9 expression is one of the mechanisms of erlotinib in addition to EGFR inhibition or is the consequence of EGFR inhibition. [score:12]
Upregulation of FoxO1 by erlotinib is mediated partially through miR-9. Erlotinib downregulates miR-9 expression through activating the DNA methylation and subsequently suppressing the transcription of miR-9-1. Discussion. [score:11]
As shown in Fig. 2C, stable cell lines with successful upregulation of miR-9 expression promoted cell growth significantly, whereas stable cell lines with miR-9 suppression inhibited cell growth. [score:10]
Erlotinib upregulated FoxO1 expression through downregulation of miR-9.. [score:9]
Furthermore, exogenous overexpression of miR-9 promoted cells growth significantly, whereas inhibition of endogenous miR-9 expression inhibited cell growth, even though slightly (Fig. 2B). [score:9]
Since erlotinib downregulated miR-9 expression and miR-9 negatively regulated FoxO1 protein levels, we further determined the effects of erlotinib on FoxO1 expression. [score:9]
These results suggest that erlotinib downregulates miR-9 expression through suppressing the transcription of miR-9-1 and enhanced DNA methylation may be involved. [score:8]
Even though transiently transfection of synthesized miR-9 inhibitors only slightly inhibited cell growth, the stable cell lines with downregulated miR-9 grew slowly than the control cells. [score:8]
Moreover erlotinib downregulates miR-9 expression through suppress of primary miR-9-1 transcription. [score:8]
Erlotinib downregulated miR-9 expression mainly through enhancing DNA methylation mediated inhibition of miR-9-1 transcription. [score:8]
Heller et al. reported that in non-small cell cancers, miR-9 expression was downregulated based on a genome-wide miRNA expression profiling. [score:8]
Several molecules that are critical in cancer development have been reported as direct downstream targets of miR-9. In gastric cancer, miR-9 targets CDX2 (caudal-related homeobox) to promote cell proliferation 14. [score:7]
It suggests that erlotinib upregulates FoxO1 protein levels but not mRNAs, and the regulatory pattern is similar to miR-9. To clarify the role of miR-9 in erlotinib -induced FoxO1 expression, we detected FoxO1 protein levels in A549 cells transfected with miR-9 mimic or it control, and then treated with or without erlotinib. [score:7]
It suggests that erlotinib upregulates FoxO1 protein levels but not mRNAs, and the regulatory pattern is similar to miR-9. To clarify the role of miR-9 in erlotinib -induced FoxO1 expression, we detected FoxO1 protein levels in A549 cells transfected with miR-9 mimic or it control, and then treated with or without erlotinib. [score:7]
In gastric 14, endometrial 11, brain cancer 15, and leukemia 9, miR-9 is observed upregulated and oncogenic, whereas in cervical cancer 16, colorectal cancer 17, and ovarian cancer 18 it is observed downregulated and anti-tumorigenic. [score:7]
These results suggest that miR-9 regulated FoxO1 expression is a target of erlotinib in NSCLCs. [score:6]
In summary, these results suggest that downregulation of oncogenic miR-9 expression play an important role in mediating the anticancer effect of erlotinib. [score:6]
Erlotinib downregulated miR-9 expression. [score:6]
Furthermore, we found that DNA methyltransferase inhibitor 5-Azacytidine upregulated mature miR-9 (Fig. 6B) and pri-miR-9-1 significantly (Fig. 6C). [score:6]
A549 stable cell lines with miR-9 overexpression and its control (A549-OE-miR-9/A549-OE-Ctrl), or with miR-9 downregulation and its control (A549-dMAN-miR-9/A549-Cel-Ctrl) were established by infection of A549 cells with lentivirus aforementioned in 6-well plates for 48 h, selected with 2 μg/mL puromycin (P8833) purchased from Sigma for 14 days, and withdrew of puromycin for another 14 days as we previously described 27. [score:6]
In summary, the currently study identifies miR-9-regulated FoxO1 expression plays an important roles in promoting NSCLCs and suppression of this axis contributes to erlotinib’s anticancer efficacy. [score:6]
As well, NF-κB was negatively regulated by miR-9. These results suggest that miR-9 negatively regulated FoxO1 translation through directly binding to its 3′-UTR. [score:6]
Considering that miR-9 seed region did not completely match with the 3′-UTR region of FoxO1, we hypothesized that miR-9 may regulated FoxO1 protein levels through inhibition of mRNA translation but not mRNA degradation (Fig. 3B). [score:6]
Figure 5A showed that erlotinib decreased miR-9 expression without parallel increase of FoxO1 mRNA expression. [score:5]
And overexpression of FoxO1 partially inhibited miR-9 mimics transfection induced cell growth (Fig. 4D). [score:5]
We also revealed that miR-9 functions through suppressing FoxO1 translation but not mRNA degradation, based on our findings that miR-9 decreased protein levels, but not mRNA levels of FoxO1. [score:5]
Senyuk et al. has reported that ecotropic viral integration site (EVI1) - induced suppression of miR-9 is determined by the hypermethylation of miR-9-3 promoter and involves induction of DNA-methyltransferase 3-β (DNMT3b) 9. Considering that erlotinib inhibits two major surviving pathways in malignancy - PI3K/Akt and Ras/MAPK, it is possible that erlotinib activates DNA-methyltransferase through some molecules downstream of Akt or ERK. [score:5]
Additionally, only 7 bases in the 3′UTR region of FoxO1 matches the seed region of miR-9, this incomplete match indicates translational inhibition theoretically (Fig. 3B). [score:5]
However, the mRNAs of NF-κB, another direct target of miR-9, were negatively regulated. [score:5]
Furthermore, there exists much more predicted target genes of miR-9 by the software, such as TargetScan, Pictar. [score:5]
Figure 3A showed that transfection of miR-9 mimics or inhibitors had no effect on FoxO1 mRNA expression. [score:5]
In this study, we found that erlotinib -induced suppression of miR-9 was resulted from inhibition of miR-9-1 transcription, possibly involving a mechanism of enhanced DNA methylation. [score:5]
In this study, we identified the tumor suppressor - FoxO1 as a direct downstream target of miR-9 based on the luciferase reporter assay, which is in concomitant with that miR-9 is oncogenic in NSCLCs. [score:5]
MiR-9 is oncogenic in NSCLCs and overexpression of miR-9 reduced the growth inhibitory effect of erlotinib. [score:5]
FoxO1 inhibited the growth of A549 cells and overexpression active FoxO1 partially reversed the effects of miR-9 on cell growth. [score:5]
In ovarian cancer, miR-9 targets NF-κB to inhibit cell growth 18. [score:5]
In leukemia, miR-9 targets FoxOs (FoxO1 and FoxO3) to promote cell differentiation 9. In breast cancer, miR-9 targets E-cadherin to promote EMT (Epidermal-mesenchymal transition) and metastasis 25. [score:5]
Figure 2B showed that transiently transfection of miR-9 mimic, or its inhibitor successfully increased or decreased miR-9 expression levels in A549 cells, respectively. [score:5]
As an EGFR inhibitor, the mechanism of erlotinib on decreasing miR-9 expression is unknown. [score:5]
And DNA hypermethylation of primary miR-9-3 accounts for the downregulation of mature miR-9 19. [score:4]
In parallel, stable cell lines with miR-9 downregulation were established by dMAN-miR-9 lentivirus and its control Cel-ctrl. [score:4]
And cotreatment with erlotinib and 5-Azacytidine abrogated mature miR-9 expression in parallel with pri-miR-9-1 expression when compared with erlotinib single treatment (Fig. 6B,C). [score:4]
The results that NF-κB mRNA was negatively regulated by miR-9 suggest that miR-9 expression was successful and it was functional in our experimental system. [score:4]
We first detected the effects of miR-9 on FoxO1 expression. [score:3]
In this study, since miR-9 is oncogenic, we predict that miR-9 - modulated tumor suppressor gene - FoxO1 plays a more critical role than miR-9 - modulated oncogene NF-κB under erlotinib treatment in NSCLCs. [score:3]
Accumulating evidences have shown that the target genes of miR-9 include NF-κB, FoxO1, CDX2 et al. in other types of cancers. [score:3]
Erlotinib also decreased miR-9 expression in HCC827 (with mutant EGFR), H157, and Calu-1 cells, but not in H460 cells (Fig. 1B). [score:3]
And only one case showed decreased miR-9 expression in cancer tissues (Fig. 2A). [score:3]
miR-9 has been identified as both an oncogene and a tumor suppressor depending on different cancer types. [score:3]
Since miR-9 was identified as an oncogene in lung cancer, we suspected that its target genes were tumor repressors. [score:3]
showed that miR-9 decreased exogenous overexpressed FoxO1 protein by Ad-CA FoxO1 infection (Fig. 4C). [score:3]
These results suggest that FoxO1 is a downstream target of miR-9 in NSCLCs. [score:3]
Lentivirus encoding miR-9 mimic and its control (OE-miR-9/OE-Ctrl), or miR-9 inhibitor and its control (dMAN-miR-9/Cel-Ctrl) were purchased from Shenzhen Ongran Biotech Co,Ltd. [score:3]
Aberrant miR-9 expression has been detected in several types of human cancer tissues. [score:3]
To understand the mechanism of erlotinib other than EGFR inhibition in NSCLCs, we investigate its effect on miR-9 expression. [score:3]
Second, overexpression of miR-9 transiently by transfection of exogenous synthesized miR-9, or permanently by establishing stable cell lines, promoted the growth of NSCLC cells. [score:3]
Synthetic miR-9 transfection and adenovirus infection were conducted simultaneouly when overexpression of both miR-9 and FoxO1 were required. [score:3]
To identify the role of miR-9 in erlotinib induced cell growth inhibition, we transiently transfected miR-9 mimic in A549 cells and then treated the cells with different concentrations of erlotinib. [score:3]
We first detected the primary miR-9 (pri-miR-9) expression after erlotinib treatment. [score:3]
The synthetic miR-9 mimic, miR-9 inhibitor, and their relative control were purchased from Dharmacon. [score:3]
Manipulating miR-9 expression transiently by synthetic miR-9 transfection or lentivirus infection. [score:3]
Next, we determined whether overexpression of FoxO1 abrogated the pro-growth effect of miR-9. A549 cells were transfected with miR-9 mimic and infected with Ad-CA FoxO1 or its control. [score:3]
How to cite this article: Chen, X. et al. Oncogenic miR-9 is a target of erlotinib in NSCLCs. [score:3]
Further western blot analysis showed that miR-9 mimic decreased, while miR-9 inhibitor increased FoxO1 protein levels (Fig. 3D). [score:3]
Figure 2D showed that miR-9 mimic partially abrogated the inhibitory effects of erlotinib on cell growth. [score:3]
We next determined the effects of manipulating miR-9 expression on the growth of NSCLC cells. [score:3]
It suggests that miR-9 play a critical role in erlotinib -induced FoxO1 expression. [score:3]
To confirm the pro-growth effect of miR-9, we established stable cell lines with miR-9 overexpression and its control by infection with lentivirus OE-miR-9 and OE-ctrl, respectively. [score:3]
FoxO1 is a target of miR-9.. [score:3]
The 3′-untranslated region (3′-UTR) of FoxO1 (170 nt) containing the predicted miR-9 binding site were synthesized by Vazyme Biotech Co. [score:3]
The fluorescence reporter assay showed that miR-9 mimic cotransfection decreased the fluorescence intensity in cells transfected with the wild type 3′UTR of FoxO1 plasmid significantly compared with the miR-9 control cotransfection, while it could not decreased the fluorescentce intensity of cells with mutant 3′UTR plasmid transfection, suggesting that FoxO1 was a direct target of miR-9 (Fig. 3C). [score:2]
showed that FoxO1 mRNA was not regulated by miR-9 as well (See supplementary information). [score:2]
It suggests that miR-9 is regulated by erlotinib in NSCLCs. [score:2]
MiR-9 is a target of erlotinib in NSCLC cells. [score:2]
It showed that FoxO1 mRNA was not regulated by miR-9 (See supplementary information). [score:2]
To further confirm this finding, we detected NF-κB mRNA levels in the same samples, because it has been demonstrated that NF-κB was regulated by miR-9 at the mRNA level. [score:2]
19/20 cases showed significant elevated miR-9 expression compared with the normal tissues. [score:2]
miR-9 expression was examined in lung cancer tissues and their matched peripheral normal tissues of 20 NSCLC patients using qRT-PCR assay. [score:2]
Since erlotinib mainly blocks EGFR, we examined the regulation of miR-9 by erlotinib in both A549 cells, containing wild-type EGFR, and HCC827 cells, containing an active mutant form of EGFR, our findings indicats that it is a common phenomenon. [score:2]
First, we detected increased miR-9 expression in 19/20 human NSCLC tissues compared with peripheral normal tissues. [score:2]
Since both FoxO1 and NF-κB were regulated by miR-9 in NSCLCs, we next determined the critical role of FoxO1 in mediating the oncogenic function of miR-9 in NSCLCs. [score:2]
Cells after transfection of the synthetic miR-9 or FoxO1 siRNA, or infection of the lentivirus or adenovirus for 24 h were reseeded to 96-well plates at 1,500 and cultured for 5 days, or at 2,000 cells/well and treated with erlotinib or its vehicle on the second day for 3 days. [score:1]
Figure 1A showed that erlotinib decreased miR-9 levels in a dose -dependent manner in A549 cells, which contains wild type EGFR. [score:1]
Mature miR-9 comes from three miR-9 genes, located on Chromosomes 1, 5, and 15, named primary miR-9-1, -2, and -3, respectively. [score:1]
MiR-9 comes from three precursors named miR-9-1, -2, and -3, located in chromosome 1, 5, and 15, respectively 25. [score:1]
These results suggest that miR-9 functions as an oncogene in lung cancer. [score:1]
We then constructed two plasmids inserted with the wild type 3′ -UTR of the FoxO1 containing the seed region recognized by miR-9 (FoxO1 3′-UTR WT), or the mutant 3′-UTR containing 4 nucleotides deletion in seed region (FoxO1 3′UTR mut) (Fig. 3B). [score:1]
Therefore, our findings suggest miR-9 as an oncogene at least in some of the lung cancer patients and possibly in early stages. [score:1]
Relative expression of miR-9 was calculated using the 2 [−ΔΔCt] method. [score:1]
In this study, we defined the oncogenic effect of miR-9 in lung cancer. [score:1]
However, our results that miR-9 promotes the growth of A549 cells suggest that miR-9 is oncogenic in NSCLCs. [score:1]
showed that erlotinib increased FoxO1 protein levels, whereas erlotinib and miR-9 mimic cotreatment decreased FoxO1 (Fig. 5C). [score:1]
Among these 19 cases, 15 cases showed more than 3 folds increase of miR-9. These results suggest that miR-9 maybe oncogenic in NSCLCs. [score:1]
These data suggest that miR-9 is oncogenic in NSCLCs. [score:1]
[1 to 20 of 95 sentences]
6
[+] score: 360
Other miRNAs from this paper: hsa-mir-9-1, hsa-mir-9-2
For the purpose of more comprehensive screening for novel miR-9 targets, we overlapped the miR-9 target gene list predicted by bioinformatics analysis (2414 genes, Supplementary Table S1) with gene lists acquired using three different strategies: (1) upregulated genes in 6 pairs of primary HCC tissues by gene expression profiling (Supplementary Table S2); (2) previously reported upregulated genes in HCC [14]; (3) miR-9 target genes confirmed in HeLa cells by our lab [15]. [score:15]
The pink area indicates miR-9 target genes confirmed in HeLa cells; the blue area indicates upregulated genes in 6 pairs of primary HCC tissues by gene expression profiling; the green area indicates previously reported upregulated genes in HCC by RNA sequencing. [score:11]
Besides, microRNAs regulate their downstream targets in a rather delicate way, and each target usually has more than one upstream regulatory factor, so it's understandable that we couldn't establish such correlation between miR-9 and its targets in clinical samples. [score:9]
In the current study, we have proved that IL-6 is a direct target of miR-9 in HCC by demonstrating miR-9 could inhibit IL-6 at the translational level. [score:8]
Our results revealed the efficient tumor suppressive role of miR-9 in HCC, and more importantly, the newly identified miR-9 targets might serve as potential therapeutic targets and novel prognosis indicators in HCC. [score:7]
Targeting ONECUT2 therefore inhibiting EMT could well explain miR-9 mediated migratory inhibition, but the detailed molecular mechanism still needs further study. [score:7]
Next, real-time RT-PCR revealed that miR-9 significantly suppressed the endogenous mRNA expression of 5 genes (AP3B1, TC10, IGF2BP1, MYO1D and ANXA2) in SMMC7721, but did not inhibit the mRNA level of ONECUT2 (Figure 3C). [score:7]
Furthermore, we speculated a novel mechanism in which re -expression of miR-9 could inhibit AKT and ERK phosphorylation by targeting IGF2BP1. [score:7]
These phenomena led us to hypothesize that in HCC cell lines as well as in the primary HCC tissues with low expression of miR-9, miR-9 exerts its tumor suppressive function by targeting a set of genes that are different from those in Sk-hep-1. On the other hand, unlike other HCC cell lines that are derived from hepatocellular carcinoma, Sk-hep-1 was derived from liver adenocarcinoma [29]; therefore the opposite function of miR-9 in Sk-hep-1 might also be caused by different cell origins. [score:7]
In this study, by using a HCC patient cohort, we demonstrated that miR-9 was remarkably downregulated in HCC tissues, which was largely contributed by epigenetic silencing of mir-9-1. In addition, functional assays showed that miR-9 overexpression in HCC cell lines could inhibit their oncogenic properties in vitro. [score:7]
More importantly, exogenous IGF2BP1 expression could abrogate miR-9 -mediated AKT, ERK and GSK-3β (Ser9) phosphorylation inhibition (Figure 5C), suggesting IGF2BP1 indeed plays a part in miR-9 -induced ERK and AKT signaling pathway suppression. [score:7]
Taken together, our observations suggested that miR-9 plays a tumor suppressor role in HCC, partially via targeting IGF2BP1 to inhibit ERK and AKT oncogenic pathways. [score:7]
Ectopic miR-9 expression inhibited HCC oncogenic properties in vitroTo further confirm our inference that miR-9 might suppress HCC tumor growth, SNU449, SMMC7721 and Huh-7 cell lines were used to determine the effects of miR-9 restoration on HCC oncogenic properties. [score:7]
Since we have already confirmed the capability of miR-9 to downregulate IGF2BP1, the potential suppressive effect of miR-9 on AKT and ERK phosphorylation in SMMC7721 and Huh-7 cells was also explored. [score:6]
However, in the current study, data derived from primary HCC specimens have suggested that the expression of miR-9 is downregulated in tumor tissues. [score:6]
To mechanically understand the anti-tumor function of miR-9, we have identified a series of miR-9 target genes in HCC by comprehensively profiling its downstream candidate targets using multiple strategies. [score:5]
Since microRNAs function in not only mRNA degradation but also translational repression, we proceeded to detect ONECUT2 protein level change after miR-9 overexpression. [score:5]
Validation of miR-9 targets expression level in HCC tissues. [score:5]
PI3K/AKT and ERK pathways are well known for their oncogenic properties [24, 25], and targeting them could well explain the tumor suppressive effect of miR-9 in HCC. [score:5]
For instance, miR-9 has been shown to target NF-κB in ovarian cancer and gastric cancer leading to inhibition of cell proliferation and metastasis [9, 10]. [score:5]
These observations indicated that miR-9 not only inhibited HCC cell proliferation, but also significantly suppressed the migratory ability of HCC cells. [score:5]
Figure 2MiR-9 inhibited HCC oncogenic properties in vitro A. The growth curve of miR-9 overexpressing HCC cells and control cells. [score:5]
Ectopic miR-9 expression inhibited HCC oncogenic properties in vitro. [score:5]
To construct the miR-9 expression vector, human mir-9-1 gene and its 5′ and 3′ flanking region (120bp and 150bp, respectively) was amplified and cloned into pRNA-U6.1/Neo-siFluc to create the U6 driven mir-9-1, namely U6-mir-9-1. Stably miR-9 expressing HCC cell lines were established by transfection with the plasmid and then selection with G418. [score:5]
On the other hand, some groups have also discovered its oncogenic function: miR-9 overexpression has been shown to enhance metastasis in esophageal squamous cell carcinoma by targeting E-cadherin [11]. [score:5]
Four bioinformatic softwares were used to predict potential target genes of miR-9 and are as following: TargetScan (http://www. [score:5]
For miR-9 target genes' mRNA expression, CTBP was used as an internal control. [score:5]
It showed that miR-9 greatly suppressed IL-6 expression in SMMC7721 (Figure 3E). [score:5]
As expected, re -expression of miR-9 significantly inhibited cell proliferation in all three cell lines (Figure 2A). [score:5]
The result showed that 7 of them (IL-6, AP3B1, TC10, ONECUT2, IGF2BP1, MYO1D and ANXA2) presented reduced luciferase activities (up to 20% suppression rate) when miR-9 was overexpressed (Figure 3B). [score:5]
The expression status of validated miR-9 targets in HCC tissues. [score:5]
The suppressive function of miR-9 for ERK and AKT pathways by targeting IGF2BP1 in HCC. [score:5]
Collectively, our preclinical results indicated that hypermethylation -mediated downregulation of miR-9 contributes to the proliferation and migration of HCC cells. [score:4]
In this study, we provide first evidence that as an important pro-tumorigenic factor in HCC, IGF2BP1 was directly inhibited by miR-9 at its mRNA level. [score:4]
In cervical cancer, human papillomavirus (HPV) -induced miR-9 activation led to significantly increased cell motility by downregulating FSTL1 and ALCAM [12]. [score:4]
Methylation contributed to miR-9 aberrant down-regulation in HCC. [score:4]
Methylation of miR-9 contributed to its aberrant down-regulation in HCC. [score:4]
Among these genes, AP3B1, ONECUT2 and IL-6 were already confirmed to be direct targets of miR-9 in breast cancer, insulin-producing cells, and cervical adenocarcinoma, respectively [15– 17], which demonstrated the reliability of our screening strategy. [score:4]
The in vitro functional assay demonstrated an anti-tumor growth ability of ectopic miR-9 expression in HCC cell lines including SMMC7721, SNU449, and Huh-7 with very low endogenous miR-9 expression. [score:4]
Among these seven genes, AP3B1, ONECUT2, and IL-6 were already confirmed to be the direct targets of miR-9 [15– 17]; ANXA2 and IL-6 are well-established oncogenes in HCC [30– 32]. [score:4]
We also performed ELISA to directly detect the secretion of IL-6 in the cell supernatant after miR-9 overexpression. [score:4]
However, only hypermethylation of mir-9-1 was detected and was the main contributor to miR-9 downregulation in HCC tissues from Chinese population in our study, while no methylation of mir-9-2 and mir-9-3 was detected in HCC cell lines as well as 20 primary HCC tissues (data not shown). [score:4]
MiR-9 inhibited ERK and AKT pathway through targeting IGF2BP1 in HCC. [score:4]
E. The relative expression level of miR-9 in 58 pairs of HCC tumor tissues and adjacent non-tumor tissues. [score:3]
Figure 3 A. Systematic identification of miR-9 targets based on multiple selection strategies. [score:3]
Certainly, there are additional target genes contributing to the anti-tumor function of miR-9 in HCC; therefore, further effort should be made in the future to expand the miR-9 downstream functional network. [score:3]
Comprehensive screening for miR-9 downstream target in HCC. [score:3]
To further demonstrate the negative correlation between mir-9-1 methylation and miR-9 expression, we divided the 58 tumor samples into methylated group (MI ≥ 10%) and unmethylated group (MI < 10%) according to mir-9-1 methylation status as we previously described [13]. [score:3]
Recent studies have revealed that microRNA-9 (miR-9) is aberrantly expressed in many cancer types including breast cancer, colorectal cancer, lung cancer, etc. [score:3]
Preliminary screening for novel miR-9 targets in HCC. [score:3]
Furthermore, demethylation treatment of cultured SMMC7721 and SNU182 cells using 5-aza-2′-deoxycytidine restored miR-9 expression in both cells (Figure 1C). [score:3]
We have identified seven miR-9 target genes (IL-6, AP3B1, TC10, ONECUT2, IGF2BP1, MYO1D, and ANXA2) in HCC. [score:3]
To construct pGL3-Luc-3′-UTR plasmids, 3′-UTR segments of predicted target genes containing the putative miR-9 binding site were amplified and cloned into a pGL3 vector downstream of firefly luciferase gene. [score:3]
Concordantly, the expression level of miR-9 was significantly higher in Sk-hep-1 than in the other four cell lines (Figure 1B). [score:3]
C. Real-time RT-PCR results of validating the relative mRNA level change of potential miR-9 target genes in SMMC7721 (mean ± SEM; N = 3). [score:3]
Figure 1 A. The methylation intensity (MI) of mir-9-1 in SMMC7721, SNU449, SNU182, Huh-7 and Sk-hep-1. B. The relative expression level of miR-9 in 5 HCC cell lines (mean ± SEM; N = 3). [score:3]
A. The methylation intensity (MI) of mir-9-1 in SMMC7721, SNU449, SNU182, Huh-7 and Sk-hep-1. B. The relative expression level of miR-9 in 5 HCC cell lines (mean ± SEM; N = 3). [score:3]
Taken together, all data here indicated a tumor suppressor role of miR-9 in HCC. [score:3]
A. Systematic identification of miR-9 targets based on multiple selection strategies. [score:3]
As expected, the expression level of miR-9 was significantly lower in the methylated group than that of in the unmethylated group (P = 0.027) (Figure 1F). [score:3]
The novel target genes of miR-9 have provided new insights into the pathogenesis of HCC, and they might serve as potential predictive and prognostic markers for HCC patients. [score:3]
A. The growth curve of miR-9 overexpressing HCC cells and control cells. [score:3]
Indeed, ONECUT2 protein level was found decreased in SMMC7721 cells overexpressing miR-9 (Figure 3D). [score:3]
*represents the previously reported target genes of miR-9. B. The results of luciferase activity detection. [score:3]
B. Western blot result of indicated protein level before and after miR-9 expression in Huh-7 and SMMC7721. [score:3]
However, our efforts to establish a significantly negative correlation between miR-9 expression level and the level of ONECUT2, IGF2BP1, and ANXA2 in HCC tissues were unsuccessful (data not shown). [score:3]
D. Western blot results of detecting ONECUT2 protein levels before and after miR-9 expression in SMMC7721. [score:3]
Next, we detected the expression level of miR-9 in 58 pairs of human primary HCC tissues and the adjacent non-tumor liver tissues by real-time qPCR. [score:3]
The above results indicated that IL-6, AP3B1, TC10, ONECUT2, IGF2BP1, MYO1D and ANXA2 are potential target genes of miR-9 in HCC. [score:3]
The results showed that migratory cells were dramatically decreased in ectopic miR-9 expressing cell lines (Figure 2B– 2D). [score:3]
The result showed that the expression of miR-9 in tumor tissues was significantly lower than that of in non-tumor tissues (P = 0.0127, Figure 1E). [score:3]
To further confirm our inference that miR-9 might suppress HCC tumor growth, SNU449, SMMC7721 and Huh-7 cell lines were used to determine the effects of miR-9 restoration on HCC oncogenic properties. [score:3]
F. The expression level of miR-9 in methylated group (MI ≥ 10%) and unmethylated group (MI < 10%). [score:3]
The expression of mature miR-9 was detected using the Taqman MicroRNA Assays (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's protocol. [score:2]
MiR-9 inhibited HCC oncogenic properties in vitro. [score:2]
Although the deregulation of miR-9 in carcinogenesis has been discussed in several kinds of cancer, the function of miR-9 in cancer biology is still not well understood and the role of miR-9 in HCC has not been fully explored. [score:2]
To investigate whether methylation caused miR-9 downregulation in HCC, firstly, the methylation intensity (MI) of all three members of miR-9 family (mir-9-1, 2 and 3) was detected in SMMC7721, SNU449, SNU182, Huh-7, and Sk-hep-1 (adenocarcinoma originated) cells. [score:2]
Two previous studies conducted in German population have suggested that mir-9-2 and mir-9-3 were frequently methylated in HCC [8, 26]. [score:1]
In the human genome there are three miR-9 genes (mir-9-1 on chromosome 1, mir-9-2 on chromosome 5 and mir-9-3 on chromosome 15) with an identical mature miR-9 sequence [5]. [score:1]
The role of miR-9 in cancers remains controversial. [score:1]
MiR-9 has been reported to exert pro-metastasizing function in Sk-hep-1, which has a relatively high level of endogenous miR-9 [28]. [score:1]
In previous studies, miR-9 was reported to be methylated in various tumors including HCC. [score:1]
E. ELISA results of measuring the concentration of IL-6 in the SMMC7721 cell supernatant before and after ectopic expression of miR-9 (mean ± SEM; N = 3). [score:1]
miR-9+3′UTR’ and ‘control+3′UTR’ means SMMC7721 cells co -transfected with pGL3-Luc-3′-UTR-WT and U6-mir-9-1 or U6-control vector (see Materials and Methods section for details). [score:1]
In this study, we investigated the aberrant status of miR-9 and its potential target genes to explore this microRNA's cancer-related functions in HCC. [score:1]
C. Western blot result of indicated protein level in SMMC7721 cells transfected with vector control, miR-9 only, or the combination of miR-9 and IGF2BP1. [score:1]
C. The relative miR-9 level in SMMC7721 and SNU182 before and after demethylation treatment using 5-aza-2′-deoxycytidine (mean ± SEM; N = 3). [score:1]
As for mir-9-2 and mir-9-3, no methylation was detected (data not shown). [score:1]
Therefore, the discordance of miR-9 precursors' methylation statuses in HCC from different studies could be contributed by distinct etiologies, tumor origins, and backgrounds of the patient cohort. [score:1]
Western blot results revealed that in both cell lines, restoration of miR-9 could block the phosphorylation of AKT (Ser473) and ERK (Thr202/Tyr204) as well as GSK-3β (Ser9) (Figure 5B). [score:1]
These facts strongly supported the reliability of our selection strategy and indicated the importance of miR-9 in HCC carcinogenesis. [score:1]
The newly identified miR-9/IGF2BP1/AKT&ERK axis represents one of the anti-tumor mechanisms of miR-9 in HCC. [score:1]
[1 to 20 of 92 sentences]
7
[+] score: 342
Furthermore, both the NF-κB1 mRNA and protein levels were affected by miR-9. Finally, knockdown of NF-κB1 inhibited MGC803 cell growth in a time -dependent manner, while ectopic expression of NF-κB1 could rescue MGC803 cell from growth inhibition caused by miR-9. These findings indicate that miR-9 targets NF-κB1 and regulates gastric cancer cell growth, suggesting that miR-9 shows tumor suppressive activity in human gastric cancer pathogenesis. [score:13]
Finally, in MGC803 cells, suppression of NF-κB1 expression by specific small interfering RNA (siRNA) could also inhibit MGC803 cell growth, while ectopic expression of NF-κB1 could rescue MGC803 cell from growth inhibition caused by miR-9. Nine pairs of gastric samples, including nine human gastric adenocarcinoma tissue samples and nine matched normal gastric tissue samples, were obtained from the Tumor Bank Facility of Tianjin Medical University Cancer Institute and Hospital and the National Foundation of Cancer Research (TBF of TMUCIH & NFCR) with patients' informed consent. [score:11]
Finally, endogenous NF-κB1 expression, both mRNA and protein, is decreased in pri-miR-9 -treated MGC803 cells, suggesting that miR-9 may regulate NF-κB1 protein expression by inducing mRNA degradation and/or translational suppression. [score:10]
It was shown that the amount of NF-κB1 protein was decreased after overexpression of miR-9 (figure 4D), suggesting that miR-9 negatively regulates endogenous NF-κB1 protein expression through translational repression mechanism. [score:8]
Suppression of Gastric Adenocarcinoma Cell Proliferation by Overexpression of miR-9 in vitroTo determine the role of miR-9 in tumor cell proliferation, a miR-9 overexpression vector, pcDNA3/pri-miR-9 (pri-miR-9), was constructed. [score:7]
To determine whether miR-9 suppresses endogenous NF-κB1 through translational repression, MGC803 cells were transfected with pri-miR-9 and the expression of NF-κB1 protein was examined by Western blot. [score:7]
In an EGFP reporter system, overexpression of miR-9 downregulated EGFP intensity, and mutation of the miR-9 binding site abolished the effect of miR-9 on EGFP intensity. [score:7]
These results suggested that NF-κB1 is a direct target of miR-9. Figure 4 NF-κB1 is a direct target of miR-9. (A) The predicted miR-9 binding site on NF-κB1 mRNA 3'UTR is shown. [score:7]
The target genes of miR-9 were predicted using three programs, known as PicTar, TargetScan, and miRBase Targets. [score:7]
These results suggested that NF-κB1 is a direct target of miR-9. Figure 4 NF-κB1 is a direct target of miR-9. (A) The predicted miR-9 binding site on NF-κB1 mRNA 3'UTR is shown. [score:7]
Overexpression of miR-9 Inhibits Xenograft Tumor Growth in vivoTo further determine whether miR-9 is involved in tumorigenesis, we established a stable miR-9-overexpression cell line as well as a control cell line. [score:7]
Experimental evidence indicated that NF-κB1 is a target of miR-9. First, the ability of miR-9 to regulate NF-κB1 expression is likely direct, because it binds to the 3'UTR of NF-κB1 mRNA with complementarity to the miR-9 seed region. [score:7]
In this study, knockdown of NF-κB1 suppressed the growth of MGC803 cells, which was consistent with the results of miR-9 overexpression. [score:6]
Although underexpression of miR-9 in some types of tumors suggested its role in cancer development, the underlying mechanism is still unclear because little is known of miR-9 targets. [score:6]
These results were consistent with the effects of miR-9 overexpression in vitro and strongly suggested that miR-9 could inhibit gastric cancer cell growth. [score:5]
Tumor suppressive miRNAs, such as miR-9, are usually underexpressed in tumors and may fail to control some of the oncogenic genes. [score:5]
The oncogenic role of NF-κB1 in gastric cancer may explain why overexpression of miR-9 can inhibit gastric cancer cell growth. [score:5]
Since miR-9 expression is decreased in cancer tissues, we expected that overexpression of miR-9 would result in the arrest of cell growth. [score:5]
In summary, we show that miR-9 expression is decreased in gastric adenocarcinoma tissues and that pri-miR-9 inhibits gastric cancer cell growth in vitro and in vivo. [score:5]
Ectopic expression of NF-κB1 could also rescue MGC803 cells from growth inhibition caused by miR-9. However, the underlying mechanisms by which NF-κB1 affects gastric cancer cell growth remain to be established. [score:5]
Overexpression of miR-9 Inhibits Xenograft Tumor Growth in vivo. [score:5]
Suppression of Gastric Adenocarcinoma Cell Proliferation by Overexpression of miR-9 in vitro. [score:5]
Overexpression of miR-9 suppressed the growth of human gastric adenocarcinoma cell line MGC803 cell as well as xenograft tumors derived from them in SCID mice. [score:5]
Subsequently, we predicted and confirmed that the tumor-related transcription factor NF-κB1 was a direct target of miR-9 and was negatively regulated by miR-9 at the post-transcriptional level. [score:5]
Hence, the high frequency of aberrant regulation of miR-9 in different types of cancer tissues and cells suggests that downregulation of miR-9 might play an important role in oncogenesis. [score:5]
It was unclear as to how miR-9 affects cell growth and proliferation, because little is known about the physiologic targets of miR-9. Although bioinformatic tools may help to reveal putative mRNA targets of miRNAs, experimental procedures are required for their validation. [score:5]
Figure 2Overexpression of miR-9 suppresses tumor cell growth in vitro. [score:5]
Consistent with this hypothesis, we observed that overexpression of miR-9 inhibited the growth of the gastric adenocarcinoma cell line MGC803 in vitro and in vivo. [score:5]
In this study, we detected differential expression of miR-9 in human gastric adenocarcinoma and adjacent normal tissues through quantitative RT-PCR, and hypothesized miR-9 as a tumor suppressor. [score:5]
Figure 3 Suppression of growth activity of xenograft gastric adenocarcinoma derived from MGC803 cells in SCID mice by overexpression of miR-9. (A) The graphs show the differences between tumor volume in pri-miR-9 group and control group. [score:5]
The validity of miR-9 ectopic expression was confirmed by quantitative RT-PCR, which revealed a 13-fold increase of miR-9 expression in pri-miR-9 -transfected cells than in the control group (figure 2A). [score:5]
Furthermore, the expression of NF-κB1 can be negatively regulated by miR-9. This study extends our knowledge about the regulation of NF-κB1, a tumor-related protein. [score:5]
These data suggested that miR-9 negatively regulate the expression of NF-κB1 through mRNA cleavage mechanism. [score:4]
Interestingly, taking advantage of miRNA expression analysis and real-time TaqMan PCR, it was also found that miR-9 expression was decreased in recurrent ovarian cancer tissues compared to primary cancer tissues [21]. [score:4]
Therefore, identification of miR-9-regulated targets is a necessary step to understand miR-9 functions. [score:4]
Although pri-miR-9 suppressed the EGFP fluorescence intensity of EGFP- NF-κB1 3'UTR, mutation of the miR-9 binding site abolished the effect of miR-9 on the EGFP fluorescent intensity. [score:4]
We showed that miR-9 was downregulated in human gastric adenocarcinoma. [score:4]
To further determine whether miR-9 is involved in tumorigenesis, we established a stable miR-9-overexpression cell line as well as a control cell line. [score:3]
Bioinformatics analysis indicated a putative miR-9 binding site in the 3'-untranslated region (3'UTR) of the tumor-related gene NF-κB1 mRNA. [score:3]
Furthermore, overexpression of miR-9 in MGC803 cells could also decrease the endogenous NF-κB1 mRNA level (figure 4E). [score:3]
At the concentration of 2.5 ng/μl and 15 ng/μl of pri-miR-9 plasmid, cell growth was inhibited by 15% and 45%, respectively (figure 2C). [score:3]
To establish the stable miR-9-overexpression cell line and the control cell line, MGC803 cells were transfected with pcDNA3/pri-miR-9 (pri-miR-9) or pcDNA3 (control), followed by selection for 20-30 days in complete medium supplemented with 800 μg/ml of G418 (Invitrogen). [score:3]
Figure 1 Identification of differential expression of miR-9 in gastric tissues. [score:3]
The stable miR-9-overexpression MGC803 cells or control cells were inoculated with 4 × 10 [6 ]cells per site bilaterally on the axillary fossae of female athymic nude mice aged 6-8 weeks. [score:3]
U6 snRNA was regarded as an endogenous normalizer and the relative miR-9 expression level of the nine pairs of gastric tissues as well as the combined result (mean ± SD) is shown (* P < 0.05). [score:3]
Second, the EGFP fluorescence intensity of EGFP- NF-κB1-UTR was specifically responsive to miR-9 overexpression. [score:3]
The expression level of miR-9 in the nine pairs of gastric adenocarcinoma tissues (Ca) and matched normal tissues (N) was detected by quantitative RT-PCR. [score:3]
In this study, we show that miR-9 targets the NF-κB1 mRNA, thus revealing a potential mechanism associated with gastric tumorigenesis. [score:3]
To determine the role of miR-9 in tumor cell proliferation, a miR-9 overexpression vector, pcDNA3/pri-miR-9 (pri-miR-9), was constructed. [score:3]
Meanwhile, another study provided evidence that miR-9 acts as a tumor suppressor gene in recurrent ovarian cancer [21]. [score:3]
Furthermore, a recent study described aberrant hypermethylation as a mechanism for miRNA genes including miR-9 inactivation and downexpression in human breast cancer [20]. [score:3]
In vivo Tumor Xenograft StudiesTo establish the stable miR-9-overexpression cell line and the control cell line, MGC803 cells were transfected with pcDNA3/pri-miR-9 (pri-miR-9) or pcDNA3 (control), followed by selection for 20-30 days in complete medium supplemented with 800 μg/ml of G418 (Invitrogen). [score:3]
Third, mutation of the miR-9 binding site abolished the effect of miR-9 on the regulation of EGFP fluorescence intensity. [score:3]
Single colonies were picked and amplified, and the expression level of miR-9 was detected by real-time RT-PCR. [score:3]
We discovered that from a total of nine pairs of matched advanced gastric adenocarcinoma tissue samples, the level of miR-9 was downregulated in tumor tissues compared to the matched normal tissues. [score:3]
Moreover, ectopic expression of NF-κB1 could rescue MGC803 cell from growth inhibition caused by miR-9, both in MTT assay (figure 2B) and colony formation assay (figure 2D). [score:3]
We used a three-step consequential approach to identify miR-9 target genes. [score:3]
Quantitative Analysis of miR-9 Expression in Human Gastric Adenocarcinoma. [score:3]
Fourth, we observed an inverse correlation between the expression of miR-9 and NF-κB1 in gastric adenocarcinoma tissues. [score:3]
It was shown that miR-9 expression level was generally and significantly lower in gastric adenocarcinoma tissues than in matched normal gastric tissues (figure 1). [score:3]
Of the predicted target genes, the oncogene NF-κB1, whose mRNA 3'UTR contained a putative binding site of miR-9, was identified. [score:3]
These results indicated that overexpression of miR-9 showed an anti-proliferative effect. [score:3]
The mRNA 3'UTR of candidate miR-9 target gene NF-κB1 carries a putative miR-9 binding site (figure 4A). [score:3]
NF-κB1 is a Candidate Target Gene of miR-9. NF-κB1 Carries a Functional miR-9 Binding Site. [score:3]
Hence, these results indicate that gastric adenocarcinoma cells transfected with pri-miR-9 showed deletion of malignant phenotypes, suggesting a role for miR-9 in the growth suppression of cancer cells. [score:3]
Therefore, we hypothesized that miR-9 is a growth inhibition factor in human gastric adenocarcinoma. [score:3]
The 3'-untranslated region of NF-κB1 mRNA containing the miR-9 binding site was amplified by PCR using the following primers: NF-κB1 sense, 5'-CGC GGATCCTCAACAAAATGCCCCATG-3'; and NF-κB1 antisense, 5'-CG GAATTCAGTTAAATCGAGAATGATTCAGGCG-3'. [score:2]
Several studies on the role of miR-9 deregulation in human oncogenesis have been reported. [score:2]
It may suggest that miR-9 plays important roles in diverse biological processes by regulating NF-κB1. [score:2]
To test the expression of miR-9 in human gastric adenocarcinoma and adjacent normal tissues, real-time RT-PCR assay was performed in nine pairs of gastric tissue samples. [score:2]
In colony formation assay, we observed that the colony formation activity of MGC803 cells transfected with pri-miR-9 was significantly inhibited. [score:2]
To construct the pcDNA3/pri-miR-9 (pri-miR-9) expressing vector, we first amplified a 386-bp DNA fragment carrying pri-miR-9 from genomic DNA using the following PCR primers: miR-9-sense, 5'-CGG AGATCTTTTCTCTCTTCACCCTC-3', and miR-9-antisense, 5'-CAA GAATTCGCCCGAACCAGTGAG-3'. [score:2]
To confirm that this site was responsible for the negative regulation by miR-9, we cloned the putative 3'UTR binding site into the downstream of an enhanced green fluorescence protein (EGFP) reporter gene (EGFP-NF-κB1 3'UTR) and co -transfected this vector with pri-miR-9 or the control vector into MGC803 cells. [score:2]
First, we examined miR-9 expression in gastric adenocarcinoma and matched normal gastric tissues by real-time RT-PCR assay as previously described [24]. [score:2]
To further confirm the effect of miR-9 overexpression on the growth of gastric cancer cells, colony formation assay was performed. [score:2]
Furthermore, we found that the growth rate of tumors derived from MGC803 cells transfected with pri-miR-9 in SCID mice was lower than that of control tumors. [score:1]
MGC803 cells were transfected with pri-miR-9 as well as pcDNA3/NF-κB1 or control vector. [score:1]
As a result, pri-miR-9 had no effect on the intensity of EGFP fluorescence in this 3'UTR mutant vector (figure 4C), highlighting the importance of this miR-9 binding site. [score:1]
MiR-9 Negatively Regulates NF-κB1 at the Post-Transcriptional Level. [score:1]
UTR) reporter vector as well as pri-miR-9 or control vector. [score:1]
MGC803 cells were transfected with pri-miR-9, control vector or pri-miR-9 with pcDNA3/NF-κB1, and then seeded in 12-well plates. [score:1]
When tumors were harvested, the average volume of tumors derived from the pri-miR-9 group was only half of that in the control group (figures 3A & 3C). [score:1]
MGC803 cells were transfected with pri-miR-9 or control vector pcDNA3 in 24-well plates, and then with the reporter vector pcDNA3/EGFP- NF-κB1 3'UTR or pcDNA3/EGFP- NF-κB1 3'UTRmut on the next day. [score:1]
Here, we focused on the role of miR-9 in the pathogenesis of human gastric adenocarcinoma. [score:1]
We also found that the anti-proliferative activity of pri-miR-9 transfection was dose -dependent. [score:1]
Also, four nucleotides at the miR-9 seed sequence binding site of the NF-κB1 3'UTR were deleted using PCR side-directed mutagenesis assay. [score:1]
To detect the dose -dependent effects, we gradually increased concentration of pri-miR-9 from 0 ng/μl to 15 ng/μl. [score:1]
The cDNA was used for the amplification of mature miR-9 and an endogenous control U6 snRNA for all PCR reactions. [score:1]
The cells were transfected with pri-miR-9 or control vector at a final concentration of 5 ng/μl as described above. [score:1]
The colony formation rate of MGC803 cells transfected with pri-miR-9 was significantly lower than the control group (figure 2D). [score:1]
Using the MTT assay, we found that MGC803 cells transfected with the miR-9 overexpression vector (pri-miR-9) exhibited decreased growth compared to control cells. [score:1]
To further determine the function of the miR-9 binding site, we constructed another EGFP reporter vector containing the NF-κB1 3'UTR but with a mutated miR-9 binding site (figure 4B). [score:1]
[1 to 20 of 92 sentences]
8
[+] score: 321
Up-regulation of TGFBR2 had the similar effect as down-regulation of miR-9. Down-regulation of TGFBR2 in HCFs partially reversed the protective effect of miR-9 overexpression on HG -induced cardiac fibrosis in HCFs. [score:12]
MiR-9 can directly target TGFBR2 in HCFsThe online database (TargetScan 6.2) predicted that TGFBR2 was a binding target of miR-9, we performed qRT-PCR to detect the expression of TGFBR2 on mRNA level in HG -induced HCFs transfected with miR-9 inhibitor or mimic. [score:12]
From all above results, we clearly demonstrated that up-regulation of miR-9 improved HG -induced increases in cell proliferation, differentiation and collagen synthesis of HCFs by down-regulation of TGFBR2, and that inhibition of TGFBR2 was essential for the protective effect of miR-9 overexpression HG -induced cardiac fibrosis in HCFs. [score:11]
Mutation of the miR-9 -binding site in the TGFBR2 3′-UTR abolished the effect of miR-9, which suggested that TGFBR2 was directly and negatively regulated by miR-9. Figure 4TGFBR2 was a direct target of miR-9HCFs were transfected with miR-9 inhibitor or mimic, and then treated with 5.5 or 25 mM glucose for 24 h. (A) The mRNA level of TGFBR2 was determined by qRT-PCR in HCFs. [score:9]
Moreover, HG -induced TGFBR2 expression was down-regulated by miR-9 up-regulation. [score:9]
Next, down-regulation of TGFBR2 had the similar protective effects as miR-9 overexpression, whereas the protective effects of miR-9 up-regulation were partially abolished by transfection with pcDNA-TGFBR2. [score:9]
The online database (TargetScan 6.2) predicted that TGFBR2 was a binding target of miR-9, we performed qRT-PCR to detect the expression of TGFBR2 on mRNA level in HG -induced HCFs transfected with miR-9 inhibitor or mimic. [score:9]
Mutation of the miR-9 -binding site in the TGFBR2 3′-UTR abolished the effect of miR-9, which suggested that TGFBR2 was directly and negatively regulated by miR-9. Figure 4TGFBR2 was a direct target of miR-9HCFs were transfected with miR-9 inhibitor or mimic, and then treated with 5.5 or 25 mM glucose for 24 h. (A) The mRNA level of TGFBR2 was determined by qRT-PCR in HCFs. [score:9]
Our results indicated that up-regulation or down-regulation of miR-9 significantly inhibited or promoted the luciferase activity of pGL3-TGFBR2 3′-UTR WT (Figure 4C). [score:9]
TGFBR2 was a direct target of miR-9. Down-regulation of TGFBR2 had similar effects with miR-9 overexpression. [score:9]
Wang et al. [22] had reported that forced overexpression of miR-9 inhibited proliferation and collagen production of CFs by down-regulation of PDGFR. [score:8]
These results indicated that overexpression of miR-9 down-regulated the expression of TGFBR2, thus protecting HCFs from HG -induced cardiac fibrosis. [score:8]
Up-regulation of miR-9 evidently inhibited the increase in HG -induced α-SMA expression at mRNA and protein levels (Figure 2A). [score:8]
Our findings showed that up-regulation of miR-9 ameliorates HG -induced proliferation, differentiation and collagen accumulation of HCFs by down-regulation of TGFBR2. [score:7]
And another paper showed that increased expression of miR-9-5p abrogated TGF-β1 -dependent myofibroblast phenotypic transformation via down-regulation of TGFBR2 [33]. [score:6]
Taken together, these outcomes confirmed that up-regulation of miR-9 protected HCFs from HG -induced cardiac fibrosis by targeting TGFBR2. [score:6]
Analysis by Brdu-ELISA assay indicated that down-regulation of TGFBR2 in cells transfected with the miR-9 mimic decreased HG -induced the proliferation of HCFs by up-regulation of miR-9 (Figure 6B). [score:6]
Moreover, the results also showed that up -regulating TGFBR2 expression could reverse the protective effect of miR-9 overexpression on HG -induced cardiac fibrosis in HCFs (Figures 6C and 6D). [score:6]
We found that mRNA level of TGFBR2 was remarkably decreased after up-regulation of miR-9 (Figure 4A), but was evidently increased after down-regulation of miR-9 compared with HG -treated HCFs (Figure 4A). [score:6]
Down-regulation of TGFBR2 had similar effects with miR-9 overexpressionTo explore the function of TGFBR2, HCFs were transfected with si-TGFBR2. [score:6]
On the contrary, miR-9 down-regulation could promote HG-stimulated expressions of α-SMA (Figure 2B). [score:6]
The promoted effect on viability and proliferation of HCFs induced by HG was abolished by up-regulation of miR-9, suggesting the protective function of miR-9 overexpression in HG -induced cardiac fibrosis. [score:6]
Most importantly, our results showed that miR-9 up-regulation inhibited HG -induced viability and proliferation of HCFs. [score:6]
Compared with untreated controls, HG significantly increased cell viability and promoted cell proliferation, whereas miR-9 up-regulation significantly decreased cell viability and inhibited proliferation of HG -treated HCFs (Figures 1A and 1B). [score:5]
In the present study, we found that miR-9 overexpression inhibited HG -induced synthesis of collagen I, III and VI in HCFs. [score:5]
Inhibition of TGFBR2 is essential for protective effect of miR-9 on HG -induced cardiac fibrosis in HCFsNext, to determine whether miR-9 overexpression protected HCFs from HG -induced cardiac fibrosis in an TGFBR2 -dependent manner, we cotransfected HCFs with miR-9 mimic and pcDNA-TGFBR2. [score:5]
The miR-9 inhibitor, the miR-9 mimic, miR -negative control of inhibitor (anti-miR-NC), miR -negative control of mimic (miR-NC), siRNA for TGFBR2 (si-TGFBR2), siRNA -negative control (si-NC), pcDNA3.1-TGFBR2 and pcDNA3.1 vector were synthesized and purified by RiboBio. [score:5]
Our findings showed that miR-9 overexpression could inhibit the HG -induced differentiation of HCFs. [score:5]
Moreover, we found that transforming growth factor-β receptor type II (TGFBR2) was the direct target of miR-9 in HCFs. [score:4]
To further demonstrate whether TGFBR2 was a direct target of miR-9, TGFBR2 3′-UTR was cloned into a luciferase reporter vector and the putative miR-9 binding site in the TGFBR2 3′-UTR was mutated (Figure 4B). [score:4]
In the present study, we demonstrated that the level of miR-9 was evidently down-regulated in HCFs during the process of HG -induced cardiac fibrosis. [score:4]
However, there has been no report on whether miR-9 is differentially expressed in pathological HCFs, or if there are any functional roles of miR-9 in regulating HG -induced cardiac fibrosis. [score:4]
In the present paper, up-regulation of miR-9 had the protective effect on HG -induced proliferation, differentiation and collagen accumulation of human cardiac fibroblasts (HCFs). [score:4]
Taken together, our findings indicated that miR-9 up-regulation reversed HG -induced proliferation, differentiation and collagen synthesis of HCFs, resulting in protecting HG -induced cardiac fibrosis. [score:4]
A previous study showed that miR-9 negatively regulated HG -induced cardiac fibrosis by targeting PDGFR-β [22]. [score:4]
Next, cell viability and proliferation were also measured in HG-stimulated HCFs after transfection with 0, 25, 50 or 100 nM miR-9 inhibitor for 24 h. As shown in Figures 1(C) and 1(D), down-regulation of miR-9 evidently enhanced HG -induced cell viability and proliferation of HCFs. [score:4]
miR-9 inhibitor (100 nM), mimic (50 nM), anti-miR-NC (100 nM), miR-NC (50 nM), si-NC (100 nM) and si-TGFBR2 (100 nM) were transfected into HCFs by using Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer's protocols. [score:3]
After 24 h, we removed the medium and transfected cells with miR-9 mimic or inhibitor at 37°C for 24 h. cell proliferation was detected by using Cell Proliferation ELISA-BrdU Kit (Millipore) following the manufacturer's protocols. [score:3]
These findings indicated that miR-9 overexpression protected HCFs from HG -induced differentiation. [score:3]
Point mutations in the putative miR-9 binding seed regions were carried out using the Quick-ChangeSite-Directed Mutagenesis kit (SBS Genetech) following the manufacturer's instruction. [score:3]
Inhibition of TGFBR2 is essential for protective effect of miR-9 on HG -induced cardiac fibrosis in HCFs. [score:3]
HCFs were transfected with either miR-9 mimic with pcDNA-TGFBR2 or pcDNA3.1, and then treated with 5.5 or 25 mM glucose for 24 h. (A) The protein expression of TGFBR2 was determined by Western blot. [score:3]
Figure 6TGFBR2 was involved in the effects of miR-9 on HG -induced cell proliferation, differentiation and collagen accumulation in HCFsHCFs were transfected with either miR-9 mimic with pcDNA-TGFBR2 or pcDNA3.1, and then treated with 5.5 or 25 mM glucose for 24 h. (A) The protein expression of TGFBR2 was determined by Western blot. [score:3]
Then, pGL3-TGFBR2-3′-UTR wild-type or mutant reporter plasmid, miR-9 inhibitor and anti-miR-NC, or miR-9 mimic and miR-NC, and pRL-TK Renilla luciferase reporter (Promega) were cotransfected into cells by using Lipofectamine 2000 (Invitrogen). [score:3]
HCFs were transfected with miR-9 inhibitor or mimic, and then treated with 5.5 or 25 mM glucose for 24 h. (A and B) The mRNA and protein levels of α-SMA were determined by qRT-PCR and Western blot respectively. [score:3]
Figure 3Effects of miR-9 on HG -induced collagen deposition in HCFsHCFs were transfected with miR-9 inhibitor or mimic, and then treated with 5.5 or 25 mM glucose for 24 h. The mRNA levels of collagen I, III and VI were determined by qRT-PCR. [score:3]
After that, cells were transfected with miR-9 inhibitor or mimic for 24 h. Then, cells were treated with HG for 24 h, and then incubated with WST-8 substrate at 37°C for 2 h. Absorbance (450 nm) of the medium was detected using a spectrophotometer by assessing the cell viability. [score:3]
MiR-9 can directly target TGFBR2 in HCFs. [score:3]
Figure 2Effects of miR-9 on HG -induced differentiation in HCFsHCFs were transfected with miR-9 inhibitor or mimic, and then treated with 5.5 or 25 mM glucose for 24 h. (A and B) The mRNA and protein levels of α-SMA were determined by qRT-PCR and Western blot respectively. [score:3]
Thus, this is the first report to show differential expression of miR-9 and the functional role of miR-9 in HG -induced cardiac fibrosis. [score:3]
Next, to determine whether miR-9 overexpression protected HCFs from HG -induced cardiac fibrosis in an TGFBR2 -dependent manner, we cotransfected HCFs with miR-9 mimic and pcDNA-TGFBR2. [score:3]
HCFs were transfected with miR-9 inhibitor or mimic, and then treated with 5.5 or 25 mM glucose for 24 h. (A) The mRNA level of TGFBR2 was determined by qRT-PCR in HCFs. [score:3]
These results provide further evidence for protective effect of miR-9 overexpression on HG -induced cardiac fibrosis. [score:3]
HCFs were transfected with miR-9 inhibitor or mimic, and then treated with 5.5 or 25 mM glucose for 24 h. The mRNA levels of collagen I, III and VI were determined by qRT-PCR. [score:3]
However, miR-9 inhibitor specifically increased HG -induced collagen synthesis (Figure 3B), further confirming the effect of miR-9 in collagen synthesis. [score:3]
We found that the expression of TGFBR2 was significantly increased after transfection with miR-9 mimic and pcDNA-TGFBR2 compared with miR-9 mimic and pcDNA3.1 in HCFs (Figure 6A). [score:2]
HCFs were transfected with miR-9 inhibitor or mimic, and then treated with 5.5 or 25 mM glucose for 24 h. (A and C) Cell viability of HCFs was detected by CCK-8 assay. [score:2]
Figure 1Effects of miR-9 on HG -induced cell viability and proliferation in HCFsHCFs were transfected with miR-9 inhibitor or mimic, and then treated with 5.5 or 25 mM glucose for 24 h. (A and C) Cell viability of HCFs was detected by CCK-8 assay. [score:2]
To demonstrate the effect of miR-9 in collagen synthesis, HCFs transfected with miR-9 mimic were exposed to HG for 24 h, and mRNA levels of collagen I, III and VI were analysed by qRT-PCR analysis. [score:1]
However, the precise mechanism and role of miR-9 in HG -induced cardiac fibrosis remain unknown. [score:1]
We then detected the level of miR-9 in HG -induced HCFs. [score:1]
Effect of miR-9 on HG -induced myofibroblasts differentiation of HCFs. [score:1]
Effects of miR-9 on HG -induced cell viability and proliferation in HCFs. [score:1]
Effect of miR-9 on HG -induced myofibroblasts differentiation of HCFsTo investigate the function of miR-9 in the differentiation of HCFs into myofibroblasts in vitro, we treated HCFs with HG for 24 h after transfection with miR-9 mimic or inhibitor. [score:1]
Effects of miR-9 on HG -induced differentiation in HCFs. [score:1]
To investigate the function of miR-9 in the differentiation of HCFs into myofibroblasts in vitro, we treated HCFs with HG for 24 h after transfection with miR-9 mimic or inhibitor. [score:1]
The 3′-UTR sequences of TGFBR2 gene, containing the putative miR-9 binding site, was amplified by PCR and cloned into the pGL3-control vector (Promega), which was named wild-type 3′-UTR (WT 3′-UTR). [score:1]
This result means that the importance of miR-9 in the pathogenesis of cardiac fibrosis. [score:1]
Effect of miR-9 on HG -induced proliferation of HCFs. [score:1]
In the present study, we studied the effects of miR-9 on cell viability and proliferation of HG -treated HCFs. [score:1]
TGFBR2 was involved in the effects of miR-9 on HG -induced cell proliferation, differentiation and collagen accumulation in HCFs. [score:1]
Effect of miR-9 on HG -induced collagen synthesis of HCFsTo demonstrate the effect of miR-9 in collagen synthesis, HCFs transfected with miR-9 mimic were exposed to HG for 24 h, and mRNA levels of collagen I, III and VI were analysed by qRT-PCR analysis. [score:1]
The outcomes showed that HG could dramatically decrease the level of miR-9 in a time -dependent manner (Figure 1E). [score:1]
Effects of miR-9 on HG -induced collagen deposition in HCFs. [score:1]
Therefore, our outcomes showed critical roles for miR-9 in the pathogenesis of diabetic cardiac fibrosis and suggested its possible application in treatment for HG -induced cardiac fibrosis. [score:1]
Effect of miR-9 on HG -induced collagen synthesis of HCFs. [score:1]
[1 to 20 of 76 sentences]
9
[+] score: 287
We report that miR-9-5p expression levels are increased in TGF-β-activated human dermal fibroblasts, while the over -expression of this miRNA abrogates TGF-β signaling through the down-regulation of TGFBR2 expression in these cells. [score:10]
As an individual miRNA may modulate multiple target genes, the potential effect of miR-9-5p on other targets aside from TGFBR2 down-regulation cannot be excluded as part of the anti-fibrotic response. [score:8]
Where and as indicated, 40-nM pre-miR miRNA precursor of miR-9-5p (pre-miR-9-5p) (AM17100, Ambion, Carlsbad, CA) or 40 nM of a non -targeting sequence pre-miR miRNA precursor negative control #1 (pre-miR-NC) (AM17110, Ambion, Carlsbad, CA), miR inhibitor-9, miR inhibitor-NC (4464088, Ambion Company, USA), and 0.8 % Lipofectamine 2000 (Invitrogen, Carlsbad, CA) were separately mixed in 500 μl of Opti-MEM (Gibco, Grand Island, NY) for 5 minutes (min). [score:7]
from the present study suggest that TGF-β1 -induced miR-9-5p up-regulation functions as a negative feedback loop in the regulation of TGFBR2 expression in an attempt to reduce the excessive pro-fibrotic signals promoted by TGF-β1 (Fig.   6). [score:7]
In keeping, over -expression of miR-9-5p significantly delayed TGF-β1 -dependent transformation of dermal fibroblasts, decreasing the expression of ECM protein collagen, type I, alpha 1 (Col1α1), and fibronectin (FN), the amount of secreted collagen proteins, and the expression of the archetypal myofibroblast marker alpha-smooth muscle actin (α-SMA). [score:7]
The higher degree of inhibition of Col1α1 transcription compared to that of FN could be attributed to the fact that Col1α1 is a potential direct target of miR-9-5p according to TargetScan database [48]. [score:7]
As TGF-β blockers are not devoid of serious unwanted effects and inhibitory molecules directed towards its inhibition may involve pleiotropic effects, it is tempting to speculate that miR-9-5p could represent an advantageous therapeutic alternative. [score:6]
TGFBR2 was previously proposed by our group as a direct target of miR-9-5p not only by in silico analysis and further molecular validation but also by the reduced action of this miRNA in the presence of exogenously enhanced expression of this protein [34]. [score:6]
Consistently, over -expression of miR-9-5p in HDFs down-regulated TGFBR2 at both the mRNA and protein levels and reduced the phosphorylation of Smad2 and the translocation of Smad2/3 to the nucleus. [score:6]
In summary, this study supports that miR-9-5p has anti-fibrotic effects in dermal fibroblasts through the down-regulation of the TGF-β pathway via TGFBR2 silencing and provides a novel potential strategy to manage cutaneous fibrotic diseases. [score:6]
Consistently, miR-9-5p down-regulated TGFBR2 expression at both the mRNA and protein levels by approximately 50 % in HDFs. [score:6]
We found that miR-9-5p expression was up-regulated 20-fold in HDFs after their treatment with TGF-β1. [score:6]
miR-9-5p is also up-regulated in skin and plasma samples from the bleomycin mouse mo del and shows an anti-fibrotic effect in skin fibrosis, thus providing a novel potential strategy to manage cutaneous fibrotic diseases. [score:6]
This suggests that both mRNA translation repression and degradation mechanisms could be involved in the negative regulation of the expression of TGFBR2 by miR-9-5p. [score:6]
It is also possible that biologically relevant up-regulation of miR-9-5p may occur at a later stage than α-SMA expression after TGF-β1 stimulation, thus hampering an effective prevention of this crucial pro-fibrogenic event. [score:6]
Consistently, miR-9-5p significantly abrogated the phosphorylation of Smad2 and the translocation of Smad2/3 to the nucleus that usually occurs after TGF-β1 stimulation, visible after both short and prolonged periods of exposure (Fig.   3a–c, 1: Figure S1C), without affecting the expression of the inhibitory Smad, Smad7 (Additional file 1: Figure S1B). [score:5]
Although we excluded the effect of miR-9-5p on TGFBR1, other potential in silico TGF-β-related targets such as transforming growth factor, beta -induced (TGFBI), Smad4, or NADPH oxidase 4 (NOX4) remain as potential unexplored proteins whose functional inhibition could account for part of the observed effects. [score:5]
Examination of miR-9-5p function revealed that over -expression of this miRNA followed by treatment with TGF-β1 decreased the abundance of α-SMA -positive fibroblasts and the α-SMA and ECM-related gene, Col1α1 and FN, expression. [score:5]
To validate if miR-9-5p also modulates TGFBR2 expression in HDFs and to determine if this miRNA affects its mRNA stability and/or its translation, we performed gain-of-function experiments. [score:5]
Fierro-Fernandez M, Busnadiego O, Sandoval P, Espinosa-Diez C, Blanco-Ruiz E, Rodriguez M et al. miR-9-5p suppresses pro-fibrogenic transformation of fibroblasts and prevents organ fibrosis by targeting NOX4 and TGFBR2. [score:5]
Altogether, these results suggest that miR-9-5p exerts an inhibitory effect on TGF-β1 -dependent fibroblast differentiation, which is mediated, at least in part, by the negative regulation of the Smad -dependent pathway related to TGF-β signaling. [score:4]
In this regard, reported targets of miR-9 in other cell lines such as E-cadherin or the transcription factor SOX2 have been shown to regulate the Wnt pathway [53, 54]. [score:4]
The capacity of miR-9-5p to inhibit the pro-fibrogenic transformation induced by TGF-β1 not only in skin fibrosis but also in pulmonary fibroblasts and peritoneal mesothelial cells [34] confers miR-9-5p a more general counter-regulatory role in organ fibrosis. [score:4]
TGFBR2 is a transmembrane serine/threonine kinase receptor necessary for TGF-β signal transduction whose 3′-UTR contains two target sites for miR-9-5p, of which one is highly conserved among vertebrates and has been implicated in the development of fibrotic processes. [score:4]
To determine the possible effect of this miRNA in the development of experimental dermal fibrosis, lentiviral vectors expressing a scramble negative control construct (lenti-SC) or miR-9-5p (lenti-miR-9) were subcutaneously administrated in mice 4 days before bleomycin administration. [score:4]
Over -expression of miR-9-5p in dermal fibroblasts resulted in a significant decrease of about 50 % in both TGFBR2 mRNA and protein levels (Fig.   1b, c), indicating the negative regulation of TGFBR2 by miR-9-5p in HDFs. [score:4]
TGFBR2 down-regulation constitutes one of the plausible mechanisms to explain the anti-fibrotic action of miR-9-5p. [score:4]
In keeping, miR-9-5p has been reported to be up-regulated in dermal fibroblasts isolated from SSc patients [28] and in TGF-β -treated lung fibroblasts and omentum-derived mesenchymal cells [34]. [score:4]
miR-9-5p is up-regulated in TGF-β1 -treated human dermal fibroblasts (HDFs). [score:4]
b qRT-PCR analysis for mRNA expression of TGFBR2 in HDFs transfected with 40-nM pre-miR-9-5p or pre-miR-NC. [score:3]
In silico identification of miR-9-5p targets spotted the type II TGF-β receptor (TGFBR2) as a potential TGF-β signaling-related effector for this miRNA. [score:3]
In silico analysis of the 3′-UTR shows that it bears two seed target sites for miR-9-5p, one poorly and the other well conserved across several vertebrate species. [score:3]
Consequently, lenti-miR-9 administration also significantly reduced the elevated expression of ECM-related genes, such as Col1α1 and FN, elicited by bleomycin administration (Fig.   5e, f). [score:3]
The lentivector -based miRNA precursor constructs expressing the miR-9-5p (lenti-miR-9) (MMIR-9-1-PA-1) and the scramble negative control (lenti-SC) (MMIR-000-PA-1) were purchased from SBI System Biosciences (Mountain View, CA). [score:3]
a– c qRT-PCR analysis for mRNA expression of α-SMA (a), Col1α1 (b), and FN (c) in HDFs transfected with 40-nM pre-miR-9-5p or pre-miR-NC and treated with TGF-β1 (5 ng/ml) for the indicated times. [score:3]
By contrast, specific inhibition of miR-9-5p resulted in enhanced presence of fibrosis markers. [score:3]
TGFBR1 is also an in silico predicted target of miR-9-5p. [score:3]
Over -expression of miR-9-5p in dermal fibroblasts blocks TGFBR2 expression, preventing myofibroblast differentiation and skin fibrosis In addition, miRNAs have been recently reported to circulate in body fluids representing a non-invasive biomarker in the diagnosis, prognosis, and evaluation of skin fibrosis [3]. [score:3]
Similarly, MMP-13 and MMP-14 are validated miR-9-5p targets that are involved in ECM degradation [55, 56]. [score:3]
The expression of miR-9-5p was also detected in the skin and plasma in the mouse mo del of bleomycin -induced dermal fibrosis. [score:3]
Histological and expression analysis revealed that in vivo miR-9-5p over -expression promoted attenuation of the bleomycin -induced increase in dermal thickness measured by accumulation of collagen. [score:3]
Using lentiviral constructs, we demonstrated that miR-9-5p over -expression was also capable of deterring fibrogenesis in this same mo del. [score:3]
Additionally, other miR-9-5p-predicted target genes implicated in alternative signaling activated during skin fibrosis, such as the Wnt/β-catenin pathway, or related to the inflammatory immune response may also form part of the mechanisms underlying miR-9-5p action. [score:3]
miR-9-5p does not affect TGF-β -induced TGFBR1 and Smad7 expression and attenuates long-term Smad2 phosphorylation. [score:3]
Analysis by qRT-PCR showed that miR-9-5p was significantly up-regulated approximately threefold in skin samples from animals after 28 days of bleomycin treatment compared to those from untreated animals (Fig.   5a), indicating the possible implication of this miRNA in SSc. [score:3]
c Western blot analysis (left) and quantification (right) of TGFBR2 expression in HDFs transfected with 40-nM pre-miR-9-5p or pre-miR-NC (a. u., arbitrary units). [score:3]
Fig. 6 TGF-β1 induces miR-9-5p expression in an attempt to self-limit the promotion of a skin fibrotic program. [score:3]
To determine the expression level of miR-9-5p in skin samples of bleomycin -treated mice, bleomycin was injected subcutaneously and its effect analyzed after different time periods. [score:3]
To study the possible implication of miR-9-5p in skin fibrosis, HDFs were treated with 5 ng/ml TGF-β1 for the indicated times and its expression was analyzed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). [score:3]
TGFBR2 has been previously validated as a target of miR-9-5p [34]. [score:3]
Nevertheless, off-target effects cannot be excluded, and only large in vivo studies will help to confirm the safety and specificity of miR-9-5p. [score:3]
e, f qRT-PCR analysis for mRNA expression of Col1α1 (e) and FN (f) in skin samples from mice administered 1 × 10 [8] ifu of lenti-SC (control) or lenti-miR-9 for 4 days followed by daily subcutaneous injections of 10 μg bleomycin for 4 weeks. [score:3]
As shown in Fig.   2, over -expression of miR-9-5p significantly abolished TGF-β1 -induced transcription of α-SMA, Col1α1, and FN after 24- and 48-h treatments (Fig.   2a–c). [score:3]
In consistence with in cellulo results and beyond the caveats in the mouse mo del to reproduce some skin fibrotic diseases [57], by using lentiviral vectors containing miR-9-5p precursors, we found significant abrogation of dermal fibrogenesis. [score:3]
miR-9-5p is induced by TGF-β1 and reduces TGFBR2 expression in human dermal fibroblasts. [score:3]
de/apps/zmf/mirwalk/) were used to identify in silico miR-9-5p targets. [score:3]
The bar graphs show mean ± SEM of three independent experiments, * P < 0.05 and *** P < 0.001 compared to control cells To assess if miR-9-5p-related reduction in TGFBR2 expression was associated with a decrease in the TGF-β -induced pro-fibrogenic transformation of fibroblasts, HDFs were transfected with 40-nM precursor of miR-9-5p (pre-miR-9-5p) and incubated with 5 ng/ml TGF-β1 for different times. [score:2]
An increase of miR-9-5p expression of approximately sixfold was observed in plasma samples from mice after 28 days of bleomycin treatment compared to those from untreated animals (Fig.   5b), suggesting that this miRNA could be a novel biomarker for SSc. [score:2]
a miR-9-5p expression was assayed by qRT-PCR in HDFs stimulated with TGF-β1 (5 ng/ml) at the indicated times. [score:2]
This regulation of miR-9-5p by TGF-β could potentially occur via primary miRNAs (pri-miRNAs) due to the in silico identification of at least two Smad -binding elements (SBEs) in the putative promoter region of miR-9-1 and at least another two for miR-9-3 [34]. [score:2]
a, b miR-9-5p expression was assayed by qRT-PCR in the skin (a) and plasma (b) after daily subcutaneous injections of 10 μg bleomycin for 14 and 28 days. [score:2]
These data suggest that miR-9-5p can prevent the TGF-β1 -dependent differentiation of dermal fibroblasts into myofibroblasts by regulating the TGF-β signaling pathway. [score:2]
One reason by which TGF-β1 -induced increase in miRNA levels may fail to prevent human dermal fibroblast activation is probably related to the relatively smaller increase of miR-9-5p after TGF-β1 stimulation compared with the magnitude of the response during miR-9-5p over -expression. [score:2]
These results may pave the way for future diagnostic or therapeutic developments for skin fibrosis based on miR-9-5p. [score:2]
Importantly, pre-administration of lentiviral vectors carrying miR-9-5p effectively attenuated dermal thickness (Fig.   5d). [score:1]
Noteworthy, there is no information, to our knowledge, implicating miR-9-5p in skin fibrosis. [score:1]
d Western blot analysis (top) and quantification (bottom) of α-SMA levels in HDFs transfected with 40-nM pre-miR-9-5p or pre-miR-NC and treated with TGF-β1 (5 ng/ml) for the indicated times (a. u., arbitrary units). [score:1]
This study aimed to analyze the potential role of miR-9-5p in skin fibrosis by using human dermal fibroblasts (HDFs) in culture and a mouse mo del of bleomycin -induced skin fibrosis. [score:1]
c H&E staining and Masson’s trichrome blue staining for collagen in skin samples from mice administered 1 × 10 [8] ifu of lenti-SC (control) or lenti-miR-9 for 4 days followed by daily subcutaneous injections of 10 μg bleomycin for 4 weeks. [score:1]
These particular data in the skin pave the way to explore miR-9-5p as a therapeutic agent. [score:1]
We have recently reported the protective role of microRNA-9-5p (miR-9-5p) in lung and peritoneal fibrosis [34]. [score:1]
We evaluated the possibility that plasma miR-9-5p levels can be a disease marker in the mouse mo del of SSc. [score:1]
All bar graphs represent mean ± SEM (n = 6 mice in each group), * P < 0.05 and *** P < 0.001 compared to mice given control lentivirus and saline -treated and [#] P < 0.05 compared to mice given control lentivirus and bleomycin -treated To study the possible implication of miR-9-5p in skin fibrosis, HDFs were treated with 5 ng/ml TGF-β1 for the indicated times and its expression was analyzed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). [score:1]
e Western blot analysis (top) and quantification (bottom) of FN levels in HDFs transfected with 40-nM pre-miR-9-5p or pre-miR-NC and treated with TGF-β1 (5 ng/ml) for the indicated times (a. u., arbitrary units). [score:1]
A dose of 1 × 10 [8] ifu/ml of lentivirus (lenti-miR-9 or lenti-SC) in 40 μl saline serum was subcutaneously delivered 4 days before bleomycin administration. [score:1]
This result suggests the potential involvement of miR-9-5p in the TGF-β1-related signaling responses in dermal fibroblasts. [score:1]
miR-9-5p significantly prevents fibrogenesis in skin fibrosis. [score:1]
All these results together suggest a possible protective role for miR-9-5p in skin fibrosis and a possible use of this miRNA as a diagnostic marker for this condition. [score:1]
The level of miR-9-5p was increased 20-fold after treatment with TGF-β1 whereas its levels augmented 40-fold after in vitro transfection (data not shown). [score:1]
Human miR-9 is encoded by three distinct genomic loci, located in chromosomes 1, 5, and 15, generating three mature miR-9 species with identical sequences. [score:1]
We found that miR-9-5p prevents the transformation of human fibroblasts into myofibroblasts by blocking TGF-β signaling and significantly attenuates bleomycin -induced skin fibrosis. [score:1]
We found that plasma levels of miR-9-5p in the bleomycin -induced skin fibrosis mo del were significantly increased. [score:1]
miR-9-5p attenuates TGF-β1 pro-fibrogenic signaling in human dermal fibroblasts. [score:1]
miR-9-5p prevents bleomycin -induced skin fibrosis. [score:1]
c Western blot analysis after nuclear/cytoplasmic fractionation (left) and quantification (right) of Smad2/3 protein levels in HDF cells transfected with 40-nM pre-miR-9-5p or pre-miR-NC and treated with TGF-β1 (5 ng/ml) at the indicated times (a. u., arbitrary units). [score:1]
b Immunofluorescence staining of Smad2/3 (green) in HDFs treated with TGF-β1 (5 ng/ml) for 30 min after transfection with 40-nM pre-miR-9-5p or pre-miR-NC. [score:1]
MicroRNA-9-5p (miR-9-5p) has been shown to exert a protective role in lung and peritoneal fibrosis. [score:1]
Moreover, increasing levels of miR-9-5p also abrogated Smad2 phosphorylation and nuclear translocation of Smad2/3. [score:1]
Further correlation between miR-9-5p in skin and/or plasma level and skin fibrosis degree in skin fibrotic connective tissue disorders will determine its potential use as a biomarker. [score:1]
All bar graphs represent mean ± SEM of three independent experiments, ** P < 0.01 compared to control cells and [#] P < 0.05 compared to its corresponding negative control time point Fig. 4Inhibition of miR-9-5p enhances TGF-β1 -induced transformation of human dermal fibroblasts into myofibroblasts. [score:1]
Similarly, increasing levels of miR-9-5p strongly reduced TGF-β1 -induced α-SMA, FN, and collagen type I-V protein abundance (Fig.   2d–f), as well as the amount of α-SMA -positive fibroblasts in the presence of TGF-β1 for 24 h (Fig.   2g). [score:1]
a Western blot analysis (left) and quantification (right) of pSmad2 protein levels in HDF cells transfected with 40-nM pre-miR-9-5p or pre-miR-NC and treated with TGF-β1 (5 ng/ml) at the indicated times (a. u., arbitrary units). [score:1]
g Immunofluorescence staining of α-SMA (green) in HDFs treated with TGF-β1 (5 ng/ml) for 48 h after transfection with 40-nM pre-miR-9-5p or pre-miR-NC. [score:1]
[1 to 20 of 93 sentences]
10
[+] score: 285
The transcription factor REST, a silencer of neuronal gene expression, is also a target of miR-9 whose expression is downregulated in Huntington’s disease [4]. [score:12]
The expression of miR-9 is altered in brains affected by Alzheimer disease, and BACE1/beta-secretase is a target for translational inhibition by this microRNA [14, 15]. [score:11]
The 4HPR treatment increased the expression of miR-16, miR-26b, miR-23a, and miR-15b in ARPE-19 cells, although these increases were modest when compared to the increase in the expression of miR-9. Our studies demonstrate that miR-9 is expressed in the RPE cell line ARPE-19, and its expression is increased by a retinoic acid derivative and by an inhibitor of promoter hypermethylation. [score:10]
Thus, it is possible that these transcription factors could regulate the expression of miR-9. As shown in Figure 4, the increase in the expression of miR-9 due to 4HPR is associated with parallel increases in the expression of CEBPA and CEBPB, the genes encoding CEBP-α and CEBPB-β, respectively. [score:8]
Recent studies have identified miR-9 as one such miRNA with an important role in cell growth, differentiation, neurogenesis, immunity and oncogenesis due to its ability to target translational inhibition of many genes, including ONECUT2 (one cut homeobox 2), REST (RE1-silencing transcription factor), TLX (NR2E1, nuclear receptor subfamily 2, group E, member 1), and NFKB1 (nuclear factor of kappa light polypeptide gene enhancer in B-cells) [3- 9]. [score:7]
There appears to be a large number of potential targets for this microRNA; 936 conserved targets of miR-9 are reported in TargetScan release 5.2. [score:7]
We reasoned that miR-9 expression could be altered during this process since its expression is reported to be regulated by both retinoic acid and oxidative stress [9, 17, 18]. [score:6]
Potential binding sites for these transcription factors were present in the putative promoter regions of all three genes encoding miR-9. The miR-9 expression in ARPE-9 cells was also increased in response to treatment with 5-aza-2’-deoxycytidine, a methyl transferase inhibitor, thus indicating that the gene(s) encoding this microRNA could be epigenetically regulated via hypermethylation of their promoter regions. [score:6]
Our observation that the expression of genes encoding CEBP-α and CEBP-β increased in ARPE-19 cells in response to 4HPR treatment suggests that these transcription factors could be involved in the regulation of miR-9 expression. [score:6]
The ability of miR-9 to target many genes for translational repression makes it a potentially effective regulator of cell growth, differentiation, neurogenesis, immunity and cancer. [score:6]
Both of these agents induced HMOX1 expression as expected, but the miR-9 expression was not affected significantly (Figure 2). [score:5]
However, our results eliminate oxidative stress as a direct regulator of the miR-9 expression in ARPE-19 cells. [score:5]
5-Aza-2’-deoxycytidine, a methyl transferase inhibitor, also increased the expression of miR-9 in ARPE-19 cells. [score:5]
Figure 1Increased miR-9 expression in ARPE-19 cells during 4HPR -induced apoptosis and the expression of HMOX1 and GADD153. [score:5]
In summary, we have shown that miR-9 is expressed in the RPE cell line known as ARPE-19 and that its expression increases during 4HPR -induced apoptosis. [score:5]
Another target for miR-9 is BACE1/beta-secretase, whose activity is elevated in brains affected by Alzheimer disease [14]. [score:5]
The 4HPR -dependent increase in miR-9 expression paralleled increases in the expression of HMOX1and GADD153. [score:5]
Here we demonstrate that miR-9 is expressed in ARPE-19 cells, and that its expression is increased when these cells are exposed to 4HPR. [score:5]
MiR-9 is reported to control the secretory response of insulin-producing cells by diminishing the expression of the ONECUT2 transcription factor, a regulator of Granuphilin expression [3]. [score:5]
The 4HPR -induced miR-9 expression was associated with parallel increases in the expression of CEBPA and CEBPB transcription factor genes. [score:5]
The expression of miR-9 is generally suppressed in cases of cancer due to hypermethylation of the promoter regions of genes encoding it [10- 13]. [score:5]
Figure 44HPR -induced expression of miR-9 in ARPE-19 cells is associated with increased expression of CEBPA and CEBPB. [score:5]
The expression of miR-9 genes could be suppressed by the hypermethylation of their promoter regions [10]. [score:5]
The increase in miR-9 expression by 4HPR was associated with apoptosis, as indicated by mono- and oligonucleosomes formation, and with large increases in HMOX1 and GADD153 expression. [score:5]
ARPE-19 cells were treated with menadione and sodium arsenite, agents known to cause oxidative stress, and the miR-9 expression and HMOX1 expression were then analyzed. [score:5]
Potential binding sites for the transcription factors encoded by CEBPA and CEBPB genes were found to be present in the putative promoter regions of all three genes encoding miR-9. 4HPR -induced miR-9 expression was associated with parallel increases in the expression of these transcription factor genes. [score:5]
This epigenetic repression of miR-9 expression has been reported to be a contributing factor to breast and colorectal cancer development [10- 12]. [score:4]
4HPR is a derivative of all-trans-retinoic acid, which has been shown to be a regulator of miR-9 expression [17]. [score:4]
Our results show that the miR-9 expression in ARPE-19 cells is regulated by this mechanism. [score:4]
MiR-9 is reported to accelerate neural stem cell differentiation by suppressing the expression of the nuclear receptor TLX [5]. [score:4]
We examined the possibility that the observed increase in the expression of miR-9 in 4HPR -treated cells is mediated by oxidative stress, rather than by 4HPR directly. [score:4]
Treatment of the ARPE-19 cells with 5-aza-2’-deoxycytidine to block DNA methylation resulted in increased expression of both miR-9 and TGM2, a gene known to be regulated by hypermethylation [28]. [score:4]
Several components of the Fgf signaling pathway are targeted by miR-9 during late embryonic development in zebrafish [8]. [score:4]
Expression of miR-9 is also known to be regulated by hypermethylation of the promoter regions of genes encoding this microRNA. [score:4]
Previous studies have reported that the expression of microRNA-9 (miR-9) is regulated by retinoic acid and reactive oxygen species (ROS). [score:4]
Dimethyl sulfoxide, the vehicle used in this study to dissolve 4HPR, had no effect on the miR-9 expression by itself. [score:3]
ARPE-19 cells from passages 20 to 24 did not show detectable variation in miR-9 expression or its response to 4HPR treatment (data not shown). [score:3]
Decreased expression of miR-9 is observed in presenilin-1 null mice [16]. [score:3]
Therefore, we investigated the expression of miR-9 in ARPE-19 cells in response to 4HPR -induced HMOX1 and GADD153 expression and apoptosis. [score:3]
Indeed, increase of miR-9 expression following oxidative stress induced by metal sulfates has been reported [18]. [score:3]
Thus, treatment of ARPE-19 cells with 4HPR induces expression of miR-9 along with established markers of oxidative stress and apoptosis. [score:3]
The microarray analysis failed to detect the miR-9 expression in ARPE-19 cells. [score:3]
Thus, oxidative stress per se does not appear to mediate the effect of 4HPR on miR-9 expression. [score:3]
However, this validation was performed using PCR, and like miR-9 in the present study, the expression of miR-135 and miR-200 may be undetectable by hybridization. [score:3]
Menadione and arsenite, agents well known to cause oxidative stress, failed to increase the miR-9 expression in these cells. [score:3]
The expression of miR-9 in ARPE-19 cells increased approximately threefold in response to the treatment (Figure 5). [score:3]
Cells were treated with 1 μM 5-aza-2’-deoxycytidine for 3 days, and miR-9 expression was estimated using real time RT–PCR. [score:3]
ARPE-19 cells were treated with indicated concentrations of 4HPR for 24 h, and real-time RT–PCR was employed to analyze the expression of miR-9, HMOX1 and GADD153. [score:3]
An increase in miR-9 expression was observed with increasing concentration of 4HPR (Figure 1). [score:3]
We analyzed the expression of miR-9 in ARPE-19 cells in response to 4HPR treatment. [score:3]
It should be noted that microarray analysis did not detect miR-9 expression in ARPE-19 cells. [score:3]
The aim of the present study was to investigate the expression of miR-9 in ARPE-19 cells in response to 4HPR treatment, and to identify other miRNAs normally expressed in these cells. [score:3]
A ~2 fold increase in miR-9 expression was detected when the concentration of 4HPR reached 10 µM. [score:3]
A: 5-aza-2’-deoxycytidine increased miR-9 expression. [score:3]
A: 4HPR increased miR-9 expression. [score:3]
A twofold increase in the expression of miR-9 was also observed during this response. [score:3]
The expression of miR-9 and HMOX1, a marker for oxidative stress, was analyzed using real-time RT–PCR. [score:3]
Figure 5Expression of miR-9 increases in ARPE-19 cells following treatment with 5-aza-2’-deoxycytidine. [score:3]
Translational repression by miR-9 is also reported for E-cadherin in the SK-Hep-1 hepatoma cell line [42], Foxg1 in developing mouse brains [43] and the BK channel splice variant in rat striatal neurons during alcohol adaptation [19]. [score:3]
The potential role of epigenetic regulation of miR-9 or other microRNAs in RPE pathophysiology is not yet known, although it has been implicated in cancer and aging [40, 41]. [score:2]
A: MiR-9 expression was not affected by menadione and arsenite. [score:2]
Increases in the expression of miR-16, miR-26b, miR-23a, and miR-15b were observed following 4HPR treatment; however, these increases were modest when compared to the approximately twofold increase observed for miR-9. The 5′-flanking regions (~1 kb) of genes generating miR-16, miR-26b, miR-23a, miR-15b, miR-223, and let-7a were analyzed for the presence of consensus binding sites for CEBP-α and CEBP-β. [score:2]
We analyzed the putative promoter regions of three genes encoding miR-9 for regulatory elements. [score:2]
Thus, miR-9 and other miRNAs could be important in maintaining RPE cell function. [score:1]
The cells were treated with varying concentrations of 4HPR for 24 h, and the miR-9 expression was measured using real-time RT–PCR. [score:1]
DNA sequences (1 kb) upstream of the genes transcribing miR-9 or other miRNAs were examined for the presence of potential transcription factor binding sites. [score:1]
The miR-9 expression in ARPE-19 cells in response to 4HPR treatment was further investigated. [score:1]
The miR-9 and other microRNAs could play an important role in maintaining RPE cell function. [score:1]
As shown in Figure 3, potential binding sites for CCAAT/enhancer binding protein (CEBP) transcription factors, CEBP-α and CEBP-β, are present in the 5′-flanking regions of MIR9–1, MIR9–2, and MIR9–3 genes. [score:1]
Taken together, these facts are consistent with a mo del of miR-9 activation due to reactive oxygen species generated from 4HPR treatment. [score:1]
DNA sequences (1 kb) upstream of the miR-9 genes were analyzed for the presence of potential transcription factor binding sites, as described in the METHODS. [score:1]
Our sequence analysis indicated that putative CEBP binding sites are present on potential promoter regions of all three genes encoding miR-9 precursors (MIR9–1, MIR9–2, and MIR9–3). [score:1]
Figure 3 Sequences matching putative binding sites for CEBP transcription factors are present in the 5′-flanking regions of all three human miR-9 genes. [score:1]
[1 to 20 of 73 sentences]
11
[+] score: 274
Overexpression of miR-9 suppressed significantly CDH1 mRNA levels, while inhibition of miR-9 expression by an antisense-miR-9 resulted in up-regulated of CDH1 mRNA levels, in both SNU-449 and HepG2 liver cancer cells, assessed by qPCR analysis (Fig.   4c). [score:12]
Interestingly, we found that miR-9 suppressed CDH1 mRNA expression levels, directly through binding in its 3′UTR and indirectly through regulation of PPARA expression levels. [score:10]
Inhibition of PPARA suppressed CDH1 mRNA levels, suggesting that miR-9 regulates CDH1 expression directly through binding in its 3′UTR and indirectly through PPARA. [score:10]
Taken together, these data suggest that miR-9 regulates CDH1 expression directly through binding to its 3′UTR and indirectly by controlling PPARA expression. [score:8]
First, miR-9 directly suppresses CDH1 mRNA levels through binding on its 3′UTR and in the second indirect mechanism miR-9 suppresses PPARA mRNA levels directly, resulting in decreased CDH1 levels. [score:8]
On the other hand, miR-9 inhibition of overexpression suppressed HCC tumorigenicity and invasiveness. [score:7]
Here, we have found that miR-9 inhibition of expression by an antisense-miR-9 suppressed the ability of liver cancer cells to form colonies in soft agar, tumor spheres and decreased their invasiveness, suggesting that targeting miR-9 could be a promising strategy to be further evaluated for the treatment of HCC. [score:7]
MiR-9 was found to be 6.5-fold up-regulated in HCC relative to control tissues (Fig.   2a) and miR-21 expression levels were increased 4.4-fold in HCC relative to controls (Fig.   2b). [score:6]
A TargetScan algorithm was used to identify miR-9 downstream direct targets. [score:6]
In the same study, CDH1 levels were found to be up-regulated after miR-9 inhibition. [score:6]
This analysis revealed that miR-9 is the microRNA that has the highest ability to induce HCC invasiveness, it is highly expressed in HCC tumors and its expression correlates with HCC tumor stage, suggesting both its functional and human relevance in HCC. [score:5]
We found that miR-9 overexpression suppressed both CDH1 and PPARA 3′UTR luciferase activities, having a stronger effect on CDH1 (Fig.   4b). [score:5]
On the other hand, inhibition of miR-9 expression blocks the tumor properties of liver cancer cells, including cell growth and migration, suggesting its therapeutic potential. [score:5]
In addition, we provided evidence that inhibition of miR-9 suppresses HCC cell growth and invasiveness. [score:5]
First, we found that miR-9 inhibition suppressed significantly the ability of SNU-449 cells to form colonies in soft agar (Fig.   5a), reduced their invasiveness (Fig.   5b) and also their ability to form liver tumor spheres (Fig.   5c). [score:5]
To further validate the miR-9/PPARA interaction, we examined PDK4 expression levels after miR-9 overexpression in liver cancer cells. [score:5]
Bioinformatics analysis by using the TargetScan algorithm revealed that miR-9 has very strong and highly conserved binding sites on the 3′ untranslated regions (UTRs) of PPARA and CDH1 genes. [score:5]
Mutation of the miR-9 binding sites in the 3′UTR PPARA and CDH1 luciferase vectors abolished the suppressive effects of miR-9. These data validate at the molecular level of the direct interactions between miR-9 and PPARA or CDH1 genes. [score:5]
To examine the direct interactions between miR-9 and these potential downstream direct targets, we performeds. [score:5]
This observation is very interesting and novel, since miR-9 is using two discrete molecular pathways to suppress CDH1 expression in HCC. [score:5]
In addition, we found that miR-9 overexpression resulted in increased vimentin levels, which is a well-known mesenchymal marker correlated with CDH1 loss of expression in HCC [39]. [score:5]
On the other hand, inhibition of miR-9 by an anti-sense microRNA-9 molecule, suppressed the growth of SNU-449-derived tumor spheres. [score:5]
PPARA and E-cadherin (CDH1) as direct downstream targets of miR-9 in HCC. [score:4]
Fig. 4CDH1 and PPARA as direct targets of miR-9 in HCC. [score:4]
Consistent with our findings, Tan HX et al. showed that miR-9 was significantly up-regulated in primary HCC tumors with metastases in comparison with those without metastases [37]. [score:4]
Furthermore, we found that miR-9 exerts its oncogenic activities through direct regulation of PPARA and CDH1 genes. [score:3]
MiR-9, miR-21 and miR-224 were the top inducers of HCC invasiveness and also their expression was increased in HCC relative to control liver tissues. [score:3]
In addition, miR-9 overexpression reduced PPARA mRNA levels in SNU-449 cells (Fig.   4e). [score:3]
Recently, high miR-9 expression levels were found to be correlated with poor prognosis in HCC patients [31]. [score:3]
Suppression of the miR-9 signaling pathway on HCC cell properties. [score:3]
Overexpression of miR-9 was found to be the top inducer of SNU-449 cell invasiveness (Fig.   1d). [score:3]
showed that miR-9 overexpression increased significantly vimentin mRNA levels (Fig.   4d). [score:3]
Third, miR-9 overexpression induced significantly the ability of both SNU-449 and HepG2 cells to form colonies in soft agar (Fig.   3d, 1: Figure S2d). [score:3]
Effects of miR-9 overexpression on HepG2 cancer properties. [score:3]
Fig. 3Effects of miR-9 overexpression on liver cancer cellular properties. [score:3]
e Effects of miR-9 overexpression on the number of SNU-449 liver tumor spheres. [score:3]
Our screen revealed five microRNAs (miR-9, -224, -21, -24, -27a) as HCC invasion inducers and 23 microRNAs (miR-29a, -145, -29b, -507, -26a, -122a, -375, -195, -203, -26b, -199b, -125a, -223, -1, -101, -199a, -124a, -125b, let-7b, let-7a, miR-148a, -152, -148b) as HCC invasion suppressors. [score:3]
Next, we have examined if there is any correlation between miR-9, miR-21 and miR-224 expression levels and HCC tumor stage. [score:3]
Integration of the microRNA screen and expression data revealed miR-9 as the top microRNA, having both functional and clinical significance. [score:3]
Furthermore, miR-9 overexpression induced ~2.3-fold HepG2 cell invasiveness, revealing that the effects of miR-9 on liver cancer cell invasiveness are not SNU-449 cell line specific. [score:3]
All these data reveal the therapeutic potential of targeting miR-9 in liver cancer. [score:3]
Fig. 5Effects of miR-9 inhibition on liver cancer cellular properties. [score:3]
We found that miR-9 overexpression increased the ability of SNU-449 cells to form spheres in suspension (Fig.   3e). [score:3]
Quantitative real-time RT-PCR was performed to determine the expression levels of miR-9, miR-21 and miR-224 in 24 human HCC (stage I n = 5; stage II n = 9; stage III n = 6; stage IV n = 4) and 11 liver control tissues. [score:3]
Student’s t-test was used to examine the statistical difference in miR-9 expression between control and HCC tissues. [score:3]
MiR-9 levels correlated with HCC tumor stage and miR-9 overexpression induced SNU-449 and HepG2 cell growth, invasiveness and their ability to form colonies in soft agar. [score:3]
a MiR-9, (b) miR-21 and (c) miR-224 expression levels in 24 HCC tumors and 11 control liver tissues assessed by real-time RT-PCR analysis. [score:3]
a Relative miR-9 expression levels in SNU-449 cells after transfection with miR control or miR-9, 48 h post-transfection. [score:3]
Bioinformatics and molecular analyses revealed that miR-9 is involved in HCC pathogenesis through direct regulation of CDH1 and PPARA genes, by binding on their 3′UTR regions. [score:3]
Here, we are describing that miR-9 is potentially a novel oncogene in liver cancer, regulating the tumor initiation, growth and metastatic potential of liver cancer cells. [score:2]
Bioinformatics and 3′UTR luciferase analyses identified E-cadherin (CDH1) and peroxisome proliferator-activated receptor alpha (PPARA) as direct downstream effectors of miR-9 activity. [score:2]
d Soft agar colony assay in SNU-449 overexpressing miR-9 or miR-Control. [score:2]
MiR-9 overexpression induced SNU-449 invasiveness (Fig.   3c, 1: Figure S2c), consistent with our primary microRNA library screen analysis. [score:2]
Taken together, our study identified a novel microRNA signaling pathway, consisting of miR-9, PPARA and CDH1 that is deregulated in HCC patients affecting liver cancer cellular invasiveness. [score:2]
Finally, due to the fact that miR-9 may function as an oncogene, we examined its ability to regulate liver tumor sphere formation. [score:2]
d MiR-9 expression levels in different stages of HCC tumors relative to controls. [score:2]
MiR-9/PPARA/CDH1 pathway expression levels in HCC tissues. [score:2]
MiR-9 overexpression resulted in ~50 % reduction of PDK4 mRNA levels, assessed by real-time PCR analysis (Fig.   4f). [score:2]
MiR-9 was overexpressed in SNU-449 cells that were co -transfected with a construct harboring the 3′UTR of PPARA or CDH1 under luciferase activity. [score:2]
The constructs harbored the seed sequence of miR-9 (wildtype) or had a deletion of this sequence (miR-9 mutant). [score:1]
d Correlation analysis between miR-9 and PPARA mRNA levels in 24 HCC tissues. [score:1]
Taken together, these findings reveal the human relevance of the miR-9 signaling pathway in HCC oncogenesis. [score:1]
Second, we studied miR-9 effects on HCC invasiveness. [score:1]
c Correlation analysis between miR-9 and CDH1 mRNA levels in 24 HCC tissues. [score:1]
First, we examined if miR-9 affects liver cancer cell growth properties. [score:1]
SNU-449 liver cancer cell lines were transfected with miR-9 or anti-miR-9 were plated in ultra-low attachment plates (Corning), 24 h post-transfection and were grown in DMEM F12 (Invitrogen) medium supplemented with B-27 (Gibco), bFGF and EGF in the culture medium containing 1 % methyl cellulose to prevent cell aggregation. [score:1]
Taken together, this study reveals a novel role for the miR-9/PPARA/CDH1 signaling pathway in HCC oncogenesis. [score:1]
Specifically, miR-9 has sequence complementarity in the position 7624-31 nt of the 3′UTR of PPARA and also in the position 1327-33 nt of the 3′UTR of CDH1 (Fig.   4a). [score:1]
We found that miR-9 induced liver cancer cell growth in both cell lines, more significantly 72 h post transfection. [score:1]
c Invasion of SNU-449 after transfection with miR negative control (miR-Control) or miR-9, 48 h post-transfection. [score:1]
b CDH1 and PPARA activity in SNU-449 cells transfected with miR-Ctrl or miR-9, 48 h post-transfection. [score:1]
d SNU-449 cells stained with crystal violet in BioCoat Matrigel invasion chambers after treatment with miR-NC1, miR-NC and miR-9. Invading cells were fixed and stained with 0.1 % crystal violet, 24 h post-seeding. [score:1]
Consistent with our in vitro findings, miR-9 was inversely correlated with both CDH1 (R [2] = 0.5824) (Fig.   6c) and PPARA (R [2] = 0.7131) (Fig.   6d) mRNA levels in HCC tissues. [score:1]
Specifically, miR-9 was overexpressed in SNU-449 and HepG2 liver cancer cells and the total cell number was measured 48 and 72 h post-transfection (Fig.   3b, 1: Figure S2b). [score:1]
Integration of high throughput microRNA library screening and microRNA profiling in HCC tissues revealed that miR-9 has both functional and clinical significance in HCC. [score:1]
SNU-449 and HepG2 liver cancer cell lines were transfected with miR-9 or the respective control and plated on a 96-well plate (5×10 [3] cells/well). [score:1]
On the other hand the role of miR-9, miR-148b, miR-203 and miR-507 in HCC pathobiology is not well understood. [score:1]
a Sequence complementarity between miR-9 seed sequence and the 3′UTRs of PPARA and CDH1. [score:1]
MiR-9 sequence was wildtype or mutated (miR-9 mut). [score:1]
Here, we evaluated for the first time the role of miR-9 to affect the growth of these liver tumor spheres and identified that miR-9 overexpression induced the formation of liver spheres derived from SNU-449 cells, suggesting its potential involvement in early stages during HCC oncogenesis. [score:1]
miR-9 Hepatocellular oncogenesis Functional screen PPARA E-cadherin Hepatocellular cancer (HCC) is the most frequent type of malignancy originating from the liver with a recently rising incidence in the United States [1]. [score:1]
Taken together, this study revealed the involvement of the miR-9/PPARA/CDH1 signaling pathway in HCC oncogenesis. [score:1]
The red circle represents miR-9, while the blue and yellow circles the microRNA negative controls (miR-NC1, miR-NC2). [score:1]
b Cell growth of SNU-449 liver cancer cells transfected with miR negative control (miR-Control) or miR-9, 48 h and 72 h post-transfection. [score:1]
Here, we provide evidence that miR-9 affects different liver cancer cell properties, including liver tumor sphere formation. [score:1]
The screen above revealed that the top three microRNAs as statistically significant inducers of liver cancer cell invasiveness were miR-9, miR-224 and miR-21. [score:1]
c CDH1 mRNA levels in SNU-449 and HepG2 cells transfected with miR-9 or anti-miR-9, 48 h post-transfection, assessed by real-time RT-PCR. [score:1]
d Vimentin, (e) PPARA and (f) PDK4 mRNA levels in SNU-449 cells transfected with miR-9, 48 h post-transfection, assessed by real-time PCR. [score:1]
PPARA and CDH1 mRNA levels were decreased in HCC relative to controls and were inversely correlated with miR-9 levels. [score:1]
[1 to 20 of 89 sentences]
12
[+] score: 270
Consistent with this, increased apoptosis of articular chondrocytes and PRTG level by DMM surgery was also inhibited with over -expression of miR-9 and stimulated with suppression of miR-9. From previously reported miRNA array data by inhibition of JNK signaling [11], we identified 14 up-regulated miRNAs and 12 down-regulated miRNAs whose expressions were altered during chondrogenesis (Additional file 1). [score:17]
Here, for the first time, we found that PRTG exhibits chondro -inhibitory action in limb mesenchymal cells and that PRTG is a direct target of miR-9. From previously reported miRNA array data by inhibition of JNK signaling [11], we identified 14 up-regulated miRNAs and 12 down-regulated miRNAs whose expressions were altered during chondrogenesis (Additional file 1). [score:16]
Second, the luciferase intensity of PRTG-UTR was specifically responsive to miR-9 over -expression suggesting that miR-9 may regulate PRTG protein expression by inducing translational suppression. [score:10]
As well, inhibited precartilage condensation by JNK inhibition and PRTG over -expression was recovered by co-electroporation of PRTG-specific siRNA or co-introduction of miR-9 (Figure 3D) confirmed its efficiency with PRTG over-expressed cells (Figure 3C lower panel). [score:9]
Target genes of miR-9 were predicted using miRNA target prediction algorithms, including TargetScan and miRDB and PRTG was identified as a potential target. [score:9]
Consistent with this, increased apoptosis of articular chondrocytes and PRTG level by DMM surgery was also inhibited with over -expression of miR-9 and stimulated with suppression of miR-9. During development, most of our bones form through endochondral ossification in which bones are first laid down as cartilage precursor [1] and mitogen-activated protein kinase (MAPK) cascades are known to play essential roles in regulating mesenchymal cell chondrogenesis [2, 3]. [score:9]
Using these cells, we analyzed the changes in the expression of genes and proteins, tested the expression level of miR-9, and applied a target validation system. [score:7]
And chondrocytes isolated from normal human articular cartilage expressed miR-9, and this expression was significantly reduced in OA chondrocytes, especially decreased its expression in parallel with the degree of cartilage degradation. [score:7]
To validate the role of miR-9 in chondrocyte apoptosis during OA cartilage destruction in vivo, we overexpressed miR-9 in cartilage tissue by injecting miR-9 -expressing or si-miR-9 expressing lentiviruses into DMM mouse knee joints (Figure 6E). [score:7]
Experimental evidence indicates that PRTG is a target of miR-9. First, the ability of miR-9 to regulate PRTG expression is likely direct, because it binds to the 3′UTR of PRTG mRNA. [score:7]
And these inhibitory actions of PRTG on precartilage condensation and chondrogenic differentiation were recovered by co-introduction of miR-9. These data suggested that miR-9 suppresses sulfated proteoglycan accumulation and cartilage nodule formation for chondrogenic differentiation possibly by targeting PRTG. [score:7]
To confirm that PRTG is a target for miR-9, we cloned the entire 3′ UTR of PRTG into a luciferase reporter vector, electroporated the vector into chondrogenic progenitors along with the precursor of miR-9 or a cognate non -targeting negative control, and assayed cell lysates for luciferase expression. [score:6]
Figure 2 miR-9 targets PRTG and inhibits chondrogenic differentiation. [score:5]
The RNA level of PRTG was also significantly decreased at 3, 6, and 9 days of culture i. e. at the time of proliferation and condensation with increased expression level of miR-9 and significantly increased at 12, 15, and 18 days of culture, i. e. at the time of hypertrophy and apoptosis with a decreased expression level of miR-9 (Figure 2F). [score:5]
Apoptotic cell death, as assessed by FACS analysis (left panel) and by caspase-3 activity (right panel), was increased by the introduction of PRTG or treatment of JNK inhibitor and inhibited by co-induction of miR-9 (Figure 3C). [score:5]
Apoptotic genes including ABL1, ATP6V1GNOL3, CASP1, 3, 7, CD40, CYLD, and FAS were induced with IL-1β treatments or PRTG over -expression whereas expression levels of those genes were decreased with miR-9 introduction. [score:5]
In support of this prediction, we observed a significant induction in PRTG protein level in miR-9 inhibitor -treated or JNK inhibitor -treated chondroprogenitor cells. [score:5]
Our results revealed that miR-9 inhibitor -induced apoptotic cell death may be responsible for JNK blockade -induced chondro -inhibitory action on precartilage condensation. [score:5]
Among them, miR-9 was one of miRNA whose expression was substantially altered with inhibition of chondrogenic differentiation (determined using a P-value of 0.01 as a cutoff for significance). [score:5]
Our study provides evidence for the mechanism through which miR-9 affects the survival/proliferation of chondrocytes and PRTG is one of the physiologic targets of miR-9 in the regulation of chondrocyte survival. [score:4]
In addition, co-introduction of PRTG or inhibition of miR-9 significantly increased apoptosis in cells treated with TGF-β3 (Figure 4F), a known positive regulator of chondrocytes [27]. [score:4]
In order to examine the involvement of miR-9 during chondrogenesis, we exposed mesenchymal cells to 200 nM peptide nucleic acid -based antisense oligonucleotides (ASOs) against miR-9 (miR-9 inhibitor) whose knockdown efficiency was monitored by real time PCR (Figure 1C, upper panel). [score:4]
Consistent with the results obtained with PRTG over -expression, knock-down of miR-9 promoted the apoptotic death of limb chondroblasts. [score:4]
In sum, here, for the first time, we found that PRTG is regulated by miR-9, resulting in an inhibition of cell proliferation and survival in chondrogenic progenitors and articular chondrocytes. [score:4]
This study shows that PRTG is regulated by miR-9, plays an inhibitory action on survival of chondroblasts and articular chondrocytes during chondrogenesis and OA pathogenesis. [score:4]
MiR-9 is known as a growth inhibition factor and plays a role as in anti-proliferative activity in human gastric adenocarcinoma cells by negatively targeting NF-κB1 at the post-transcriptional level [35]. [score:4]
Down-regulation of miR-9 by blockade of JNK signaling was confirmed by quantitative RT-PCR (Figure 1B). [score:4]
Most significant degeneration was observed in the combination of IL-1β and PRTG -treated cell or in the combination of IL-1β and miR-9 inhibitor -treated cell. [score:3]
Change in expression level of miR-9 in was analyzed by real-time PCR. [score:3]
Consisted with these observations, the protein level of PRTG was increased by co-treatment of miR-9 inhibitor (Figure 4B) and decreased by co-introduction of miR-9 (Figure 4C). [score:3]
Figure 5 miR-9 and its target, PRTG is involved in chondrocyte apoptosis. [score:3]
Treatment of cells with a miR-9 inhibitor caused a significant decrease in total cell numbers (Figure 1D) with significant increases in apoptotic cell death (Figure 1E) and caspase-3 activity (Figure 1F). [score:3]
Human articular chondrocytes isolated from biopsy normal cartilage were electroporated with Prtg or miR-9 in the absence or presence of IL-1β and expression levels of apoptotic genes were examined and represented as heat-map. [score:3]
To further investigate miR-9 involvement in limb formation, 18 HH stage chick embryos were treated with JNK inhibitor in the absence or presence of miR-9 inhibitors. [score:3]
Studies have shown the roles of miR-9 and its validated target, protogenin (PRTG) in the differentiation of chondroblasts to chondrocyte and in the pathogenesis of osteoarthritis (OA). [score:3]
And increased protein level of PRTG by JNK inhibitor treatment was significantly reduced with co-introduction of miR-9 (Figure 2A). [score:3]
Most severe cartilage destruction was observed with the infection of si-miR-9 expression lentiviruses (MFC score of 3, MTP score of 3). [score:3]
Seed sequences of putative targets for miR-9 (Figure 2B upper panel) were exchanged a purine for a pyrimidine and a pyrimidine to a purine. [score:3]
This malformation was overcome by co-treatment of miR-9 inhibitor (Figure 3E). [score:3]
The expressions of type II collagen (Col II), PRTG, and miR-9 were analyzed by real-time PCR (lower panel). [score:3]
Furthermore, decreased in total cell number by JNK inhibitor or PRTG was reversed by co-introduction of PRTG siRNA or miR-9, respectively (Figure 3B, right panel). [score:3]
We confirmed that IL-1β exposure to cells decreased the expression level of miR-9 (Figure 4A). [score:3]
Our laboratory is currently undergoing study on the relationships between miR-9, PRTG, and MMP-13 to verify whether chondrocyte apoptosis by PRTG, a target for miR-9, is down-stream, up-stream, or independent of MMP-13 induction. [score:3]
However, over -expression of miR-9 significantly reduced cartilage destruction (MFC score of 0, MTP score of 0.5). [score:3]
Mice were killed 8 weeks after DMM surgery or 2 weeks after intraarticular injection (1 × 10 [9] plaque-forming units (PFU)) of miR-9 -expressing lentiviruses (lenti-miR-9) for histological and biochemical analyses. [score:3]
A more significant degenerative phenotype and decreased level of type II collagen were observed in co-treatment of miR-9 inhibitor with IL-1β (Figure 4B) and IL-1β -induced degenerative changes were prevented by co-introduction of miR-9 (Figure 4C). [score:3]
Here, we show that miR-9 targets PRTG, thus revealing a potential mechanism for apoptotic death of limb chondroblasts during endochondral ossification. [score:3]
For further validation for apoptotic involvement of miR-9 and PRTG, normal chondrocytes were introduced with miR-9 in the absence or presence of IL-1β or PRTG and expression levels of genes involved in apoptosis was examined (Figure 5). [score:3]
For miRNA target validation, chondroblasts were electroporated with 200 ng of a firefly luciferase reporter construct, 50 pmol of pre-miR-9 or pre-miR -negative (Ambion). [score:3]
It has been shown that miR-9 is responsible for regulating viability of chondrocytes and reduction of miR-9 was observed in generative chondrocytes and this could be a reason for decreasing cell viability. [score:2]
We found that cells transfected with the PRTG-3′ UTR vector plus miR-9 exhibited significantly less luciferase activity compared to cells that received the vector plus the non -targeting negative control (Figure 2B). [score:2]
MiR-9 induces chondro -inhibitory action during chondrogenic differentiation of chick limb mesenchymal cells. [score:2]
MiR-9 stimulated chondrogenic differentiation by regulating protogenin. [score:1]
A more significant decrease was observed with co-treatment of miR-9 or PRTG (Figure 4D). [score:1]
However, the co-treatment with the miR-9 precursor or PRTG-specific siRNA blocked this apoptotic signaling. [score:1]
Figure 4 miR-9 is also involved in the degeneration of articular chondrocytes. [score:1]
Furthermore, we suggested that miR-9 is one of important players in OA pathogenesis. [score:1]
Reduction of miR-9 induction, which results in increased PRTG levels in OA pathogenesis, may be responsible for chondrocyte apoptosis, a typical hallmark of OA. [score:1]
However, IL-1β -induced degeneration was significantly blocked by co-introduction of miR-9. We also observed that increased apoptotic cell death by IL-1β was blocked by co-introduction of miR-9 (Figure 4E right panel). [score:1]
We hypothesized that miR-9 plays a distinct role in endochondral ossification and OA pathogenesis and the present study was undertaken to identify this role. [score:1]
Induction of miR-9 successfully reduced PRTG protein level in myc-tagged PRTG/pCAGGS vector electroporated cells (Figure 2C). [score:1]
We also performed functional study of miR-9 and PRTG. [score:1]
The expression of mir-9 was measured with real-time PCR (upper panel) and Precartilage condensation was analyzed by PA staining at day 3 and Alcian blue staining at day 5 of culture (lower panel). [score:1]
Here, we found another miRNA, miR-9 involved in JNK -induced chondrogenic differentiation. [score:1]
Decreased intensities of PA at day 3 and Alcian blue staining at day 5 were observed with treatment of anti-miR-9 oligonucleotides (Figure 1C, lower panel). [score:1]
In order to further study the role of miR-9 in survival of chondrocytes, dedifferentiation of articular chondrocytes was induced by IL-1β exposure. [score:1]
Here, we also suggest the involvement of miR-9 in OA pathogenesis as well as chondrogenic differentiation of limb mesenchymal cells. [score:1]
Here, we also found that cell viability was decreased in degenerated rabbit and human articular chondrocytes and miR-9: PRTG interplay is involved in the apoptotic process of IL-1β -induced degeneration. [score:1]
Jones and colleagues (2009) suggest the involvement of miR-9 in OA bone and cartilage by mediating the IL-1β -induced production of TNF-α [36]. [score:1]
The protein and RNA levels of type II collagen and miR-9 were decreased whereas those levels of PRTG were increased as the progression of cartilage damage (Figure 6D). [score:1]
For further investigation of involvement of miR-9 or PRTG, macroscopically normal human cartilage from 10 adult donors from both genders (mean age 37.4 years; age range 20–60 years), without history of joint disease was confirmed that the specimens were histological normal cartilage and used for isolating primary articular chondrocytes. [score:1]
With the progression of chondrogenesis, decreased miR-9 level was observed at the time of numerous apoptotic cell deaths. [score:1]
[1 to 20 of 72 sentences]
13
[+] score: 263
[43, 44] However, the current study reported that in knee OA tissues, upregulated NF-kB expressions because of inhibited miR-9 expressions were associated with increased knee OA cell proliferation. [score:10]
[14, 35– 37] Furthermore, our study discovered that miR-9 mimics suppressed the NF-κB1 protein expression level in knee OA chondrocytes and the downregulation of miR-9 could trigger an increase in NF-κB1 expressions occurred at both gene and transcription levels in chondrocytes. [score:10]
[5– 7] Certain noncoding RNA molecules (microRNAs), such as miR-9, miR-22 (Gene ID: 407004), and miR-146 (Gene ID: 406938), have been reported to modify target gene expressions by targeting their mRNA 3′untranslated regions (UTR). [score:9]
[9] Besides, miR-9 has been ascertained to negatively regulate NF-kB1 expressions, thereby indicating that downregulated miR-9 would accelerate NF-kB expressions and restrain cell proliferation. [score:9]
Upregulation of miR-9 or downregulation of NF-κB1 could promote cell proliferation and suppress cell apoptosis. [score:9]
Thus, this study displayed that reduced expressions of IL-6 and MMP-13 were attributed to regulated NF-κB1expressions targeted by miR-9. Interestingly, multiple studies have documented that NF-kB could turn on genes that keep cells proliferating. [score:8]
These findings indicated that miR-9 could inhibit the apoptosis of chondrocytes and downregulation of NF-κB1 also could suppress the apoptosis of chondrocytes. [score:8]
Hence, we concluded that the expression of NF-κB1 at both mRNA and protein levels were modulated by miR-9. Besides, the interaction between miR-9 and NF-κB1 was hypothesized to suppress apoptosis during chondrogenesis,[9] since the caspase-3 experiments conducted in this study[38] exhibited that higher caspase-3 levels along with increased apoptosis were observed in cells transfected with miR-9 inhibitors, whereas lower caspase-3 activity accompanied by decreased apoptosis were present in cells transfected with miR-9 mimics and p50 siRNA. [score:7]
Previous studies showed that miR-9 modulated the secretion of MMP-13[10] and that miR-9 was able to inhibit tumorigenesis by suppressing the activity of IL-6. [39] In addition, NF-κB1, IL-6, and catabolic marker protein MMP-13, which is the matrix-degrading enzyme, were also overexpressed in patients with knee OA. [score:7]
Conclusively, downregulated miR-9 can facilitate proliferation and antiapoptosis of knee OA chondrocytes by directly binding to NF-kB1, implying that stimulating miR-9 expressions might assist in treatment of knee OA. [score:7]
3.6The expression levels of NF-κB1 were significantly inhibited by miR-9 mimics and increased by miR-9 inhibitor. [score:7]
The expression levels of NF-κB1 were significantly inhibited by miR-9 mimics and increased by miR-9 inhibitor. [score:7]
However, one expression profiling asserted that miR-9 was upregulated in OA cartilages and OA bones. [score:6]
[8] Interestingly, Song and his colleagues[9] found that miR-9 expressions were significantly decreased in OA chondrocytes in comparison to normal ones, and chondrocytes’ apoptosis was thereby regulated due to miR-9's targeting protein (PRTG, Gene ID: 283659). [score:6]
Since the NF-κB1 signaling pathway is involved in the apoptosis and proliferation of tumor cells, we suspected that miR-9 may promote the proliferation of chondrocytes and suppress the apoptosis of human pituitary knee OA chondrocytes through regulating the NF-κB1 signaling pathway by targeting NF-κB1 and this is consistent with the results from the western blotting. [score:6]
Besides that, the protein levels of IL-6 and MMP-13 were suppressed by miR-9 mimics and NF-κB1 siRNA, while they were promoted by miR-9 inhibitor (Fig. 7). [score:5]
Figure 3NF-κB1is a target gene of miR-9. (A) Binding of miR-9 to NF-κB1 3′-UTR predicted by Target Scan. [score:5]
Western blot showed that miR-9 could suppress the NF-κB1 expression to decrease the NF-κB1 signaling pathway related proteins including IL-6 and MMP-13 in human knee OA chondrocytes. [score:5]
The targeting of miR-9 to NF-κB1 may enhance proliferation and suppress apoptosis of knee OA chondrocytes through modification of IL-6 and MMP-13. [score:5]
In fact, miR-9 was documented to be lowly expressed in the knee OA chondrocytes and its low expression was correlated to increased chondrocyte apoptosis. [score:5]
Targeting NF-κB1 by miR-9. MiR-9 targeted NF-κB1 to promote chondrocytes proliferation. [score:5]
MiR-9 targeted NF-κB1 to inhibit cell apoptosis. [score:4]
In conclusion, miR-9 exhibited significantly lower expressions in knee OA tissues when compared with normal tissues, while NF-κB1, IL-6, and MMP-13 expressions were relatively higher in knee OA tissues. [score:4]
Subsequently, assessment of rat mo dels also demonstrated reduced miR-9 expressions (Fig. 2A) as well as increased NF-κB1, IL-6, and MMP-13 expressions (Fig. 2B, C) in OA rats’ cartilage tissues when compared with normal rats’ cartilage tissues. [score:4]
[21– 23] Nonetheless, so far deficient studies can explain clearly how miR-9 regulates NF-κB1 and whether the regulation could influence development of knee OA. [score:4]
Figure 5The apoptosis of chondrocytes was inhibited by miR-9. The apoptosis ability of chondrocytes at 48 hours after transfection was detected by the flow cytometric analysis. [score:3]
In retrospect, such miRNAs as miR-9, miR-27 (Gene ID: 407018), miR-140 (Gene ID: 406932), and miR-146 have been indicated to be abnormally expressed in OA patients. [score:3]
2.5Chondrocytes were divided into 4 different groups, including the scramble group, miR-9 mimics group, miR-9 inhibitor group, and NF-κB1 siRNA group. [score:3]
They were transfected with scramble miRNA mimics as the negative control, miR-9 mimics, miR-9 inhibitor, and NF-κB1siRNA, respectively (purchased from Gene Pharma, Shanghai, China). [score:3]
A putative conserved binding site for miR-9 at nucleotide position 29–35 of human NF-κB13′UTR is predicted using the Target Scan. [score:3]
Figure 1The relative expressions of miR-9 and related genes (NF-κB1, IL-6, and MMP-13) detected in human knee OA and normal cartilage tissues. [score:3]
Figure 2The relative expressions of miR-9 and related genes (NF-κB1, IL-6, and MMP-13) detected in knee OA and normal cartilage tissues of rat mo dels. [score:3]
Chondrocytes were divided into 4 different groups, including the scramble group, miR-9 mimics group, miR-9 inhibitor group, and NF-κB1 siRNA group. [score:3]
As a result, miR-9 and NF-κB1 could potentially serve as diagnostic biomarkers and therapeutic targets for patients with knee OA. [score:3]
3.2A putative conserved binding site for miR-9 at nucleotide position 29–35 of human NF-κB13′UTR is predicted using the Target Scan. [score:3]
chondrocyte IL-6 knee osteoarthritis miR-9 MMP-13 NF-kappaB1 pathway Osteoarthritis (OA) is classified as a degenerative disease that affects both cartilage and its adjacent issues. [score:3]
According to results from human OA samples and rat OA mo dels, miR-9 was significantly downregulated in knee OA cartilage tissues compared with normal cartilage tissues (P < 0.01). [score:3]
In addition, it was demonstrated that miR-9 could suppress proliferation and invasion of diverse cancer cells (e. g., nasopharyngeal carcinoma, ovarian cancer, and gastric cancer), by binding to corresponding genes, such as C-X-C motif chemokine receptor 4 (CXCR4, Gene ID: 7852), talin 1 (TLN1, Gene ID: 7094), and nuclear factor kappa-B1 (NF-κB1, Gene ID: 4790). [score:3]
Figure 7 The effect of miR-9 on the NF-κB1 signaling pathway via the inhibition of NF-κB1. [score:3]
The expression of miR-9 in knee OA cartilage tissues was significantly lower than that in normal tissues (P < 0.01). [score:3]
Both RT-PCR and western blot assays showed that the expression levels of NF-κB1 mRNA and protein were significantly decreased in the miR-9 mimics group and increased in the miR-9 inhibitor group when compared with the scramble group (P < 0.05) (Fig. 3C, D). [score:3]
Figure 6The analyzed caspase-3 activity in cells after 48-hour transfection with scramble sequence, miR-9 mimics, miR-9 inhibitor, or NF-κB1 siRNA. [score:3]
Knee OA chondrocytes were transfected with miR-9 mimics, miR-9 inhibitor, and NF-κB1 siRNA, respectively, and changes in cellular proliferation and apoptosis were detected via and flow cytometric analysis, respectively. [score:3]
The apoptosis rate in the miR-9 inhibitor group was 16.01 ± 2.23%, which was significantly higher than those in the other three groups (all P < 0.01) (Fig. 5). [score:3]
Therefore, the present study was designed to systematically clarify the potential correlations of miR-9/NF-κB1 and knee OA development, which may be conducive to exploitation of novel diagnostic and therapeutic strategies for knee OA. [score:2]
Dual luciferase reporter gene assay showed that miR-9 could bind to the 3′UTR of NF-κB1 and significantly inhibit the luciferase activity by 37% (P < 0.01). [score:2]
Thus, 2 [−ΔΔCt] was considered equal to the fold of expressions of miR-9 or NF-κB1 RNA or IL-6 RNA or MMP-13 RNA and those of U6 snRNA. [score:2]
It has been suggested that microRNA-9 (miR-9) is associated with the development of knee osteoarthritis (OA). [score:2]
Finally, animal mo dels with knockout of specific genes (e. g., miR-9 and NF-κB1) could also be the following research focus. [score:2]
The proliferation of chondrocytes was significantly decreased after they were transfected with miR-9 inhibitor for 48 hours compared with the other three groups (all P < 0.05) (Fig. 4). [score:2]
The caspase-3 activity of cells transfected with miR-9 inhibitor was 2.33 ± 0.24, exhibiting significant difference when compared with those of the other three groups (all P < 0.01). [score:2]
In addition, more exploration of NF-κB1 pathway with aid of Ingenuity Pathway Analysis would make roles of miR-9 and NF-κB1 in development of knee OA more convincible. [score:2]
MiR-9 expressions in both knee OA cartilage and normal cartilage samples were detected using quantitative real-time PCR. [score:2]
MiR-9 and related genes expression in knee OA clinical specimens and knee OA rat mo dels. [score:2]
Real-time quantitative RT-PCR assay was conducted using the ABI7500 quantitative PCR instrument (Applied Biosystems, Foster City, CA, USA) in order to detect the relative expression levels of miR-9 and mRNA of NF-κB1, IL-6, and MMP-13. [score:2]
The dual-luciferase reporter assay in this study displayed that NF-κB1 expressions were modulated by miR-9 in chondrocytes, which was consistent with results drawn from uveal melanoma cells, ovarian cancer cells, and gastric adenocarcinoma cells. [score:2]
To elucidate effects of miR-9 and NF-κB1 on downstream molecules, expressions of IL-6 and MMP-13 were also compared between normal tissues and knee OA tissues. [score:2]
3.5The caspase-3 activity of cells transfected with miR-9 inhibitor was 2.33 ± 0.24, exhibiting significant difference when compared with those of the other three groups (all P < 0.01). [score:2]
from flow cytometric analysis revealed that the apoptosis rate (mean ± SD) of cells transfected with miR-9 mimics and NF-κB1 siRNA were 4.46 ± 0.58% and 4.34 ± 0.62% without significant difference (P > 0.05). [score:1]
Moreover, both IL-6 and MMP-13 were significantly decreased after chondrocytes were transfected with NF-κB1 siRNA, which was consistent with the trend observed in the miR-9 mimics group. [score:1]
[10] The controversy enabled us to further explore inherent correlations between miR-9 and OA chondrocytes. [score:1]
Perfect base pairing was observed between the seed sequence of mature miR-9 and the 3′UTR of NF-κB1 mRNA (Fig. 3A). [score:1]
Quantitative real-time PCR was used to evaluate the expression level of miR-9 in 25 knee OA cartilage tissues and 10 normal cartilage tissues (Fig. 1A). [score:1]
All in all, the molecular mechanism of miR-9 and NF-κB1 pathway with respect to the formation and progression of knee OA should be further studied. [score:1]
MiR-9 regulated the NF-κB1 signaling pathway. [score:1]
The relative expression level of miR-9 and mRNA of p50, IL-6, and MMP-13 were calculated using the 2 [−ΔΔCt] method. [score:1]
The caspase-3 activities of cells transfected with miR-9 mimics and NF-κB1siRNA were 0.57 ± 0.05 and 0.53 ± 0.06 with no significant difference (P > 0.05), while they were significantly lower than that in the scramble group (1.00 ± 0.10) (P < 0.01) (Fig. 6). [score:1]
[33, 34] Hence, the current study was aimed to build internal relations among miR-9, NF-κB1, IL-6, and MAP-13 in knee OA cartilages. [score:1]
3.1Quantitative real-time PCR was used to evaluate the expression level of miR-9 in 25 knee OA cartilage tissues and 10 normal cartilage tissues (Fig. 1A). [score:1]
3.4Results from flow cytometric analysis revealed that the apoptosis rate (mean ± SD) of cells transfected with miR-9 mimics and NF-κB1 siRNA were 4.46 ± 0.58% and 4.34 ± 0.62% without significant difference (P > 0.05). [score:1]
Although the relationship between miR-9 and NF-κB1 with respect to knee OA formation has been demonstrated, this study has a small sample size which is the main limitation. [score:1]
However, miR-9 mimics or NF-κB1 siRNA did not have significant effect on promoting cell proliferation (P > 0.05). [score:1]
[26] In particular, we determined the Ct values of all studied samples to calculate ΔCt, which equaled the difference between Ct-value of target mRNAs (miR-9 or mRNAs of NF-κB1, IL-6, and MMP-13) and that of U6 snRNA. [score:1]
This study was aimed to investigate the association between the mechanism of miR-9 targeting nuclear factor kappa-B1 (NF-κB1) and the proliferation and apoptosis of knee OA chondrocytes. [score:1]
[1 to 20 of 74 sentences]
14
[+] score: 231
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Some of the miR-9 and miR-200-class targets upregulated in the mutant OE (Qk, Foxf2) are mesenchymally-expressed rather than OE-expressed, while other targets were actually downregulated in the absence of Dlx5 (Akap6, Elmod1, Snap25) (Table 1C). [score:15]
We found eight miRs differentially expressed, six down-regulated (miR-9, miR-141, miR-200a, miR-200b, miR-429 and miR-376a) and two up-regulated (miR-450a-5p and miR130b*) in the Dlx5 [−/−] OE (Fig.  1a). [score:9]
In summary, since miR-9 and miR-200-class are down-modulated in the absence of Dlx5, while Foxg1 protein level is up-regulated, and since the 3′ UTR of the Foxg1 mRNA is a predicted target of these miRs, we can infer that the Dlx5-miR-Foxg1 regulation is most likely a direct one. [score:8]
Thus, Dlx5 is likely to regulate the expression of miR-9.3 directly, and the expression of miR-200a/ b/ miR-429 indirectly. [score:8]
To determine whether the forced expression of DLX5 may result in an upregulation of miR-9 and miR-200-class RNAs, SH-SY5Y cells were transfected with myc-tagged wild-type DLX5 or Q178P mutant DLX5 expression vectors, and the relative abundance of miR-9 and miR-200 was quantified by Real-Time qPCR. [score:8]
Two possible explanations: either changes in the abundance of miR-9 and miR-200-class cause changes in the abundance of target RNAs that are too modest to pass the imposed cut-off value, or these miRs preferentially affect translation and not stability of the target mRNAs. [score:7]
For chromatin immunoprecipitation (ChIP) we used the human SHSY-5Y neuroblastoma cells, which express low endogenous levels of Dlx5, miR-9 and miR-200, transfected with 5 μg of DLX5-myc-tag expression vector (from Open-Biosystem) or with the same vector in which the Q178P mutation (Shamseldin et al., 2012) was introduced (BioFab, Rome, sequence verified). [score:6]
A significant enrichment of miR-9 and miR-200-class target sequences was detected in the 3′ UTR of genes up-regulated in the Dlx5 [−/−] OE (Table 1A, B). [score:6]
To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
myc-tagged version of either the WT or the Q178P mutant DLX5 were expressed in the SH-SY5Y human neuroblastoma cells, which express DLX5, miR-9 and miR-200 endogenously. [score:5]
We also show that Dlx5 promotes expression of miR-9 and miR-200 class, thereby tends to repress Foxg1 protein translation. [score:5]
• Altered expression of miR-9 and -200 might contribute to the Kallmann disease. [score:5]
miR-9 expression is medio-laterally graded, being most intense in the cortical hem; it contrasts with the Foxg1 expression in a reciprocal gradient. [score:5]
2.9To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
miR-9 over -expression in developing forebrain at E11.5 resulted in ectopic Reelin + cells over the cortex beyond the marginal zone, while conversely the inhibition of endogenous miR-9 function caused the regression of Wnt3a positive cortical hem and reduction of Reelin+, p73+ and NeuroD1+ cells (Shibata et al., 2008). [score:5]
The expression of pre -miR-9 induced a 6-fold reduction in Foxg1 protein level, while expression of anti -miR-9 induced a 2-fold increase in Foxg1 level (Fig.  3a,b). [score:5]
•Dlx5 controls the expressions of miR9 and miR-200, which target the Foxg1 mRNA • miR-9 and -200 are needed for olfactory neurons differentiation and axon extension • miR-9 and -200 are required for the genesis and position of GnRH neurons. [score:5]
We observed a reduction of miR-9, miR-141 and miR-429 signal in the Dlx5 [−/−] OE, compared to the WT (Fig.  1c), while hybridization with two positive controls, Sp8 (expressed in the OE) and Sox5 (expressed in chondrogenic condensations), yielded an equivalent positive signal in both genotypes, indicating adequate RNA preservation. [score:4]
Indeed Foxg1 has been experimentally shown to be negatively regulated by miR-9. The mouse miR-9 targets Foxg1 mRNAs for proper generation of Cajal–Retzius neurons in the medial pallium (Shibata et al., 2008). [score:4]
3.3 miR-9 is wi dely expressed in the forebrain and olfactory sensory system of the mouse embryo and has been implicated in neural development (La Torre et al., 2013; Shibata et al., 2011; C. Zhao et al., 2013). [score:4]
Next we intersected the predicted miR-9 and miR-200-class targets with the coding mRNAs found to be differentially expressed in the Dlx5 [−/−] OE compared to the WT (Garaffo et al., 2013). [score:4]
miR-9 is wi dely expressed in the forebrain and olfactory sensory system of the mouse embryo and has been implicated in neural development (La Torre et al., 2013; Shibata et al., 2011; C. Zhao et al., 2013). [score:4]
With these two tools, we predicted the most reliable miR-9 targets, and functionally classified the top scoring ones, to search for significantly enriched categories. [score:3]
The 3′ UTR of tetrapod and zebrafish Foxg1 mRNAs hosts miR-9 and miR-200 target sequences. [score:3]
The results presented here indicate that loss of Dlx5 causes a down-modulation of miR-9 and of miR-200-class, which results in the over -expression of the Foxg1 protein. [score:3]
We also show that miR-9 and miR-200-class target (amongst others) the foxg1 mRNA, through which they likely exert their functions. [score:3]
Here we show that mouse and fish foxg1 mRNA is a target of miR-9 and miR-200 class, both of which are down-modulated in the Dlx5 null embryonic OE. [score:3]
Fig. 2), and Foxg1 mRNA has been proposed as a valid target of miR-9 (Shibata et al., 2008). [score:3]
The sequence of miR-9 and mi-200-class shows a high degree of identity between mouse and zebrafish (95% to 100%), as well as high similarity in their expression territories in early embryos ((Choi et al., 2008; Wienholds et al., 2005) and public databases). [score:3]
To overexpress miR-9 and miR-200 exogenously we used commercially available Ambion pre-miR precursors (Life Technologies). [score:3]
3.6To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
Searching for functionally relevant targets of miR-9 and miR-200 clsss in the OE. [score:3]
These results indicate that higher expression of foxg1 has similar effects as Dlx5, miR-9 and - 200 depletions on olfactory differentiation, in vivo. [score:3]
We also determined the level of endogenous Foxg1 mRNA, by Real-Time qPCR, upon expression of pre -miR-9 or anti- miR-9, and observed, respectively, a 2-fold decrease and a 2.5-fold increase in the relative Foxg1 mRNA abundance (data not shown). [score:3]
We raised the hypothesis that, in the absence of Dlx5 and reduced levels of miR-9 and - 200-class, Foxg1 protein level is increased due to higher stability/translation of the Foxg1 mRNA. [score:3]
3.7To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
We screened for miR expression in ORNs, comparing wild-type vs Dlx5 mutant tissues, and identified miR-9 and miR 200-class as the molecular link between Dlx5 and Foxg1. [score:3]
For miR-9 we detected only three enriched categories: regulation of cell differentiation, cell junction assembly and neuron development (Suppl. [score:3]
To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
The over -expression of DLX5 induced a 2.5–3 fold increase in the abundance of miR-9 in this system, while the Q178P mutant DLX5 did not (Fig.  2d). [score:3]
The knock-down of miR-9 in zebrafish embryos, via injection of a MO previously shown to be specific and effective (Leucht et al., 2008) (sequence in Suppl. [score:2]
Thus, both miR-9 and miR-200 negatively regulate Foxg1 protein level. [score:2]
Genomic regulation of miR-9 and miR-200 by Dlx5. [score:2]
In this work we define the role of miR-9 and miR-200-class in the development of the olfactory system, with functions ranging from ORN differentiation to axon guidance, glomerulus formation and GnRH neuron migration. [score:2]
Examining olfactory development more thoroughly we now can implicate the miR-9 and miR-200-class networks in a more complex phenotype reminiscent of the Kallmann syndrome (see below). [score:2]
miR-9 and miR-200-class regulate Foxg1. [score:2]
To determine whether miR-9 and miR-200-class may modulate Foxg1 protein level, the effect of introduction of pre-miR-9 or depletion of endogenous miR-9 on Foxg1 protein level was assayed by Western blot analysis in SH-SY5Y cells, which express DLX5, miR-9, miR-200-class and Foxg1 endogenously. [score:2]
We injected anti- miR-9 and anti- miR200 (or control) MOs in WT zygotes, then at 48 hpf we extracted total -RNA from these and carried out Real-Time qPCR analyses. [score:1]
3.2The three loci miR-9.1, -9.2 and - 9.3, located on chromosomes 3, 13 and 17 respectively, generate identical mature miR when transcribed, referred to as “ miR-9”. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in delayed ORN differentiation. [score:1]
The most altered miR was miR-9, with a fold change of -2, while the other miRs showed a fold-change between − 1.9 and + 1.3. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in altered GnRH neuron genesis and position. [score:1]
Table III), led to a significant and dose -dependent reduction of the endogenous miR-9, relative to control -injected ones, accompanied by a 3.5-fold increase of the endogenous z- foxg1 mRNA (Fig.  5d, e). [score:1]
z-foxg1 mRNA level increased by three-folds when either miR-9 or miR-200-class were depleted (Figs.  5e and 6f). [score:1]
3.4The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
Hybridization was carried out with DIG -labelled riboprobes that specifically detect the mature form of mouse miR-9 and miR-141 (Exiqon) in according with manufactory instruction. [score:1]
Thus, our results provide the first evidence of the participation of miR-9 and miR-200-class in these early events. [score:1]
As a further confirmation, we carried out in situ hybridization on sections of WT and Dlx5 [−/−] embryonic OE, at the age E12.5, to detect miR-9, miR-141 and miR-429, using specific mouse DIG -labelled probes. [score:1]
Upon injection of the anti- miR-9 MO, only approximately 45% of the embryos were found to be CFP + (72% in the control injected), and in these we observed a clear reduction of the CFP + signal. [score:1]
In control embryos, we counted an average of 13 (+/− 2) GnRH3::GFP + neurons/embryo at 72 hpf, while in miR-9 and miR-200 MO injected embryos the average number was, respectively, 5 (+/− 1) and 6 (+/− 1) (Suppl. [score:1]
Anti- z-miR-9 MO was designed with the on-line dedicated tool https://oligodesign. [score:1]
Using reporter zebrafish strains to visualize the embryonic olfactory axons (Miyasaka et al., 2005; Sato et al., 2005; Yoshida et al., 2002) or the GnRH + neurons (Abraham et al., 2008, 2009, 2010), we show that miR-9 and miR-200-class play a role in ORN differentiation and axonal organization. [score:1]
To test whether the DLX5 protein physically occupies the Dlx5 sites near the miR-9.3 and miR-200a/ b/ miR-429 loci, Chromatin Immuno-Precipitation (ChIP) analysis on these sites was performed. [score:1]
We previously verified that the depletion of miR-9 and miR-200-class in zebrafish embryos leads to higher level of z-foxg1 mRNA (no Ab efficiently recognizes the z-foxg1 protein). [score:1]
The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
The majority of anti -miR-9 injected embryos displayed a normal placode organization, a normal pattern of olfactory axon fasciculation, extension and connectivity, and normal glomeruli formation. [score:1]
Starting from profile data obtained from a mouse mo del of Kallmann syndrome, we functionally examined this pathway in zebrafish showing that miR-9 and miR-200-class are required for normal differentiation of the ORNs, for the extension and connectivity of the olfactory axons, and for the migration of the GnRH neurons from the nasal primordium to the forebrain. [score:1]
This possibility is clearly consistent with the results reported by Shibata et al. (2008), in which they show that the depletion of miR-9 resulted in abnormally high levels of Foxg1 proteins, and this caused a delayed differentiation of the Cajal–Retzius neurons in the cortex. [score:1]
We predicted one Dlx5 binding site near the miR-9.2 locus, located about 1.5 kb downstream, three sites near the miR-9.3 locus, located about 4, 5 and 6 kb downstream, and two sites near the miR-200a–200b-429 locus, located about 5 kb upstream (Fig.  2a). [score:1]
The three loci miR-9.1, -9.2 and - 9.3, located on chromosomes 3, 13 and 17 respectively, generate identical mature miR when transcribed, referred to as “ miR-9”. [score:1]
No Dlx5 binding site was predicted within a 50 kb range from the miR-9.1, miR-141, miR-200c and miR-376a loci. [score:1]
We used the same MOs indicated above to deplete miR-9 and miR-200 class in GnRH3::GFP zygotes, and examined the effect on the number and position of the GFP + neurons associated to the terminal nerves, between 36 and 72 hpf. [score:1]
These data indicate that the depletion of miR-9 results in a delayed or absent differentiation of the OMP + type ORN, with only a minimal effect of the Trpc2 + type neurons, and minimal consequences on axon/glomeruli organization. [score:1]
This provides an indication that the differentiation delay observed upon depletion of miR-9 is specific for the olfactory and anterior brain regions. [score:1]
miR-9 and miR-200 mediate the Dlx5-Foxg1 cascade. [score:1]
[1 to 20 of 76 sentences]
15
[+] score: 223
Other miRNAs from this paper: hsa-mir-9-1, hsa-mir-9-2, hsa-mir-155
Taken together, the results suggest a mo del in which upregulation of miR-9 upon LPS stimulation in monocytes results in a decrease in PPARδ expression thereby suppressing its corresponding target genes at an early time-point (4–8 h), indicating that PPARδ is regulated by miR-9 in monocytes after LPS treatment. [score:11]
Suppression of miR-9 upregulates the mRNA expression of PPARδ and its target gene PLIN2 in human primary monocytes. [score:10]
This result suggests that miR-9 downregulates the expression of PPARδ and its target gene PLIN2 and further confirms the regulatory link between PPARδ and miR-9. PPARδ has been suggested to play a role in the switch from pro-inflammatory M1 phenotype to anti-inflammatory M2 phenotype in macrophages. [score:9]
Here, we show that miR-9 is upregulated in human monocytes after LPS treatment while PPARδ and its target genes PLIN2, CPT1A and ANGPTL4 are downregulated 4–8 h after LPS-treatment compared with untreated cells. [score:8]
Overexpression of miR-9 reduced the luciferase activity down to 64% (P<0.001), whereas inhibition of endogenous miR-9 increased the luciferase activity up to 130% (P<0.001) compared with scrambled pre-miR or anti-miR control nucleotides, respectively (Fig. 1B), indicating that miR-9 directly targets PPARδ. [score:7]
PPARδ is the direct target of miR-9. PPARδ mRNA expression is regulated by miR-9 in monocytes after LPS treatment. [score:7]
Taken together, these results demonstrate that miR-9 directly regulates PPARδ expression by binding to the target site in the 3′-UTR of PPARδ mRNA. [score:7]
The inhibition of PPARδ by miR-9 at the early time-points might be a mechanism to delay the effect of PPARδ action early in inflammation to prevent PPARδ from suppression of NF-κB since NF-κB and PPARδ have been shown to be able to crosstalk and inhibit the function of each other (32). [score:7]
In conclusion, we have identified miR-9 as a regulator of PPARδ expression in monocytes through direct targeting of a specific sequence with the 3′-UTR of PPARδ. [score:7]
The inhibitory effect by miR-9 on PPARδ expression was confirmed by transfection of anti-miR-9 that sequesters mature miR-9 thus inhibiting its biologic function into monocytes, which resulted in induction of PPARδ and PLIN2 mRNA levels. [score:7]
In this study, we show that PPARδ is also regulated at the post-transriptional level by miR-9. Upregulation of miR-9 results in the direct repression of PPARδ, the mRNA levels of which are found to be higher in pro-inflammatory M1 than in anti-inflammatory M2 macrophages. [score:6]
Mutation of the miR-9 seed-matching sequence led to a complete restoration of luciferase activity and reversed the inhibitory effect of miR-9 in the 3′-UTR of PPARδ (Fig. 1D), which shows that the effects are mediated through the identified miR-9 target site. [score:6]
However, the miR-9 expression was not induced at any of the different time-points of treatment with GW501516 (Fig. 6B), nor was there any difference of miR-9 expression in M1 or M2 macrophages after GW501516 treatment (Fig. 6C). [score:5]
MiR-9 is involved in the immune response by fine tuning the expression of a key member of the NF-κB family in monocytes and polymorphonuclear neutrophils (4) while the expression of miR-155 is increased during inflammation and has been implicated in macrophage polarization, where miR-155 modulates the switch between pro-inflammatory M1 and anti-inflammatory M2 phenotypes. [score:5]
Putative target genes of PPARδ can also be found on the miR-9 target list, such as ABCA1, ABCD1, GOT1 and PDK4. [score:5]
As expected TNFα expression was higher in M1 than in M2 macrophages and the PPARδ ligand, GW501516, did not influence the expression of miR-9 in M1 macrophages. [score:5]
Hence, the miR-9 mediated inhibition of PPARδ expression in monocytes may constitute a negative feedback loop, modulating the levels of the receptor during inflammation. [score:5]
This finding regarding miR-9 expression in monocytes is in agreement with a previous study, which showed that the expression of miR-9 is dramatically increased after treatment with LPS (4). [score:5]
To study whether miR-9 expression was involved in the polarization of M1 and M2 macrophage phenotypes through modulation of PPARδ expression, human primary monocytes were differentiated into M1 and M2 macrophages, respectively. [score:5]
The long list of putative miR-9 targets identified by computational prediction programs contains genes working in a close network with PPARδ, for example PPARα, RXRα, PGC1α, FOXO and BCL-6. If all these genes are miR-9 regulated, the outcome of miR-9 regulation would be due to effects on the whole network rather than only to PPARδ. [score:5]
To estimate the corresponding effects due to changes in human PPARδ protein expression, we analysed PPARδ target genes, such as perilipin-2 (PLIN2), carnitine palmitoyltransferase 1α (CPT1A) and angiopoietin-related protein 4 (ANGPTL4), none of which had putative miR-9 target sites as evaluated by bioinformatic analyses (24). [score:5]
As shown in Fig. 3, specific inhibition of miR-9 significantly increased PPARδ and PLIN2 mRNA expression 40 and 70%, respectively, compared to scrambled control oligonucleotides (anti-miR-ctrl). [score:4]
Since miR-9 has been shown to play an important role in the inflammatory response in monocytes, where it serves as a feedback controller of inflammation by suppressing NFκB1 signaling (4), the relevance of miR-9 regulation in relation to PPARδ expression was investigated in monocytes. [score:4]
The importance of miR-9 in monocytes and macrophages as a response to proatherogenic factors is further demonstrated by a recent report showing that miR-9 is significantly upregulated in monocytes and macrophages after exposure to oxLDL (38). [score:4]
Other studies have confirmed the regulatory function of miR-9 on the mRNA of NF-κB in both ovarian and gastric cancers where miR-9 has been shown to act as a tumor suppressor (33, 34). [score:4]
The identified target site for miR-9 in PPARδ 3′-UTR is highly conserved in many mammals including human, mouse, rat and dog (Fig. 1A). [score:3]
Expression of miR-9 in relation to PPARδ agonist treatment. [score:3]
One purpose of the inhibition of PPARδ by miR-9 in monocytes could be to induce a block in monocyte expansion. [score:3]
Next, we explored whether PPARδ activation could induce miR-9 expression in human monocytes and/or macrophages using the specific PPARδ agonist, GW501516. [score:3]
One putative miRNA target site for miR-9 was identified by all four programs. [score:3]
This reporter construct was transiently co -transfected with miR-9 mimic (pre-miR-9) or the specific inhibitor of miR-9 (anti-miR-9) as well as their respective control oligonucleotides into HEK293 cells and relative luciferase activities were determined 24 h after transfection (Fig. 1B). [score:3]
The influence of miR-9 on PPARδ expression in monocytes during the inflammatory response is unknown. [score:3]
In this study, both the expression of PPARδ and miR-9 were higher in pro-inflammatory M1 than in anti-inflammatory M2 macrophages, indicating the potential involvement of PPARδ and miR-9 in modulating the M1 macrophage phenotype. [score:3]
Human primary monocytes were transfected with the specific anti-miR-9 or its control oligonucleotides for 24 h, followed by LPS stimulation for 4 h. In order to measure the effect of miR-9 the mRNA expression of PPARδ and its target gene PLIN2 was quantified by qRT-PCR. [score:3]
The suppression, intriguingly, was abolished after 8–24 h of LPS stimulation despite the presence of continued high levels of miR-9. One possible explanation might be that the effect and activity of miR-9 are influenced due to interactions with RNA -binding proteins (30). [score:3]
In order to verify whether PPARδ is a direct target of miR-9, we performed 3′-UTR luciferase activity assays. [score:3]
To draw firm conclusions, however, a functional approach for each gene would be required in order to validate whether these genes are true miR-9 targets, which although relevant, was outside the scope of this study. [score:3]
Both PPARδ mRNA and miR-9 expression are higher in M1 than in M2 macrophages. [score:3]
These results indicate that the pro-inflammatory cytokines are responsible for the induction of both miR-9 and PPARδ expression, which is in agreement with previous studies (4, 36, 37). [score:3]
Bazzoni et al showed that the miR-9 targeting of NF-κB at the mRNA level constitutes a feedback loop of the inflammatory response. [score:3]
To examine whether the effects on transcription are mediated by the predicted miR-9 target site in the 3′-UTR of PPARδ, we changed 6 nucleotides within the miR-9 seed-matching sequence of the 3′-UTR of PPARδ to generate a construct named MUT (Fig. 1C). [score:3]
Of note, in the monocytic cell line THP1, miR-9 is abundantly expressed and there is no induction of miR-9 upon LPS stimulation (unpublished data), therefore all the current experiments were carried out in human primary monocytes or macrophages. [score:3]
Thus, we further evaluated regulation by miR-9 of PPARδ expression in human primary monocytes stimulated with the pro-inflammatory agent LPS. [score:2]
Here, the regulation of PPARδ by miR-9 was examined in relation to the pro-inflammatory M1 and anti-inflammatory M2 macrophage phenotypes. [score:2]
Analyses of the expression of PPARδ mRNA and miR-9 showed that their levels are significantly increased in M1 compared with M2 macrophages (Fig. 5), which suggest that PPARδ and miR-9 might be of importance in modulating the pro-inflammatory M1 human macrophage phenotype. [score:2]
Our data show the regulation of PPARδ by miR-9 in monocytes. [score:2]
Since pri-mir-9-1 is the only primary miR-9 transcript induced by LPS (4), we set out to analyse whether a PPAR response element (PPRE) exists in the pri-mir-9-1 promoter region. [score:1]
Approximately 3 kb of the miR-9 promoter was analyzed for putative PPREs using the MatInspector software (http://www. [score:1]
Identified miRNAs that have been shown to play key roles in monocytes and/or macrophages during inflammation include microRNA-9 (miR-9) and microRNA-155 (miR-155). [score:1]
Cells were transfected with the luciferase reporters, 50 ng per well (Promega), together with pre-miR-9, 10 nM per well, or miRNA mimics negative control no. [score:1]
These data show that miR-9 and PPARδ are involved in central signalling pathways during the inflammatory response in monocytes. [score:1]
In line with the findings by Bazzoni et al(4), miR-9 levels increased rapidly after 2 h and remained increased until 24 h after treatment with LPS (Fig. 2A). [score:1]
Accordingly, 36 nucleotides encompassing the putative miR-9 binding site in the 3′-UTR of the PPARδ gene were cloned into a reporter plasmid containing the renilla luciferase gene. [score:1]
Monocytes were transfected with 50 nM anti-miR-9 or 50 nM anti-miR-CON (Exiqon) using Lipofectamine RNAiMAX (Invitrogen), following the manufacturer’s instructions. [score:1]
1 (pre-miR-CON, Ambion, Foster City, CA, USA), 10 nM per well; 50 nM LNA -based anti-miR-9 (Exiqon, Vedbaek, Denmark) or 50 nM universal LNA -based negative control (anti-miR-CON) (Exiqon). [score:1]
Expression of miR-9 and PPARδ was evaluated by qRT-PCR. [score:1]
The 36 nucleotides of PPARδ 3′-UTR containing the miR-9 binding site were cloned into psiCHECK-2 (Promega) using the restriction sites XhoI/ NotI. [score:1]
[1 to 20 of 57 sentences]
16
[+] score: 174
miR-9 regulates insulin secretion by targeting OC-2 mRNA and down-regulates its expression in insulin producing cells [18]. [score:9]
Specifically, it was shown that inhibition of miR-9, which is expressed in differentiated IPCs, led to glucose -induced insulin secretion by up-regulation of the transcription factor OC-2 and therefore results in a decrease in granuphilin/Slp4 protein that has important role in negative control of insulin exocytosis. [score:8]
On the other hand, down-regulation of miR-9 after induction into islet-like aggregates by lentivirus containing miR-375 could significantly increase cellular response to different concentrations of glucose by increasing OC-2 protein expression that may consequently lead to a decrease in levels of its target gene, granuphilin, which has negative role in insulin secretion. [score:8]
To determine whether up-regulation of miR-375 in MSCs [miR-375] and down-regulation of miR-9 in MSCs [miR-375+anti-miR-9] groups affected pancreatic islet cell differentiation, immunostaining of insulin, glucagon, PDX1 and Ngn-3 was performed. [score:7]
Effects of up-regulation of miR-375 and down-regulation of miR-9 on pancreatic markers. [score:7]
So, in this study, the researchers examined whether up-regulation of miR-375 and down-regulation of miR-9 could induce functional islet-like cellular aggregates differentiation in MSCs derived from human BM. [score:7]
It was found that over -expression of miR-375 led to a reduction in levels of Mtpn protein in derived IPCs, while treatment with anti-miR-9 following miR-375 over -expression had synergistic effects on MSCs differentiation and insulin secretion in a glucose-regulated manner. [score:6]
To assess the effect of over -expression of miR-375 and down-regulation of miR-9 on pancreatic islet-like differentiation, the researchers performed DTZ staining in the MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups. [score:6]
Expression levels of miR-375 and miR-9 on day 4 after transduction in tests and control groups by quantitative real-time PCR test indicated that the over- expression of miR-375 in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups increased mature miR-375 expression by 85-fold and 87-fold as compared with MSCs [null] and MSCs control groups respectively (p-value < 0.05 Fig 4A). [score:6]
However, in derived IPCs mediated by miR-375 over -expression and then miR-9 down-regulation (MSCs [miR-375+anti-miR-9] group), insulin and C-peptide secretion and content were enhanced by different concentrations of glucose from 5.5 to 25mM. [score:6]
Effect of miR-375 over -expression and miR-9 down-regulation on differentiated IPCs functions. [score:6]
miR-9 is another miRNA that has been involved in the control of insulin exocytosis by targets Onecut-2 (OC-2) mRNA and down regulates its expression in insulin producing cells. [score:6]
However, down-regulation of miR-9 in MSCs [anti-miR-9] group had no obvious effect on expression of above mentioned genes. [score:6]
Simultaneous over -expression of miR-375 and down- regulation of miR-9 had synergistic effect on MSCs differentiation and insulin secretion in a glucose-regulated manner. [score:5]
Down-regulation of miR-9 in MSCs [anti-miR-9] and MSCs [miR-375+anti-miR-9] groups decreased mature miR-9 expression by 6-fold and 5- fold as compared with MSCs [null] and MSCs control groups respectively (p-value < 0.05. [score:5]
On the other hand suppression of miR-9, that has inhibitory role in insulin secretion, could an effective way to give glucose response in vitro. [score:5]
Based on some studies on miRNAs pattern, the researchers in this paper investigated the pancreatic differentiation of human bone marrow mesenchymal stem cells (hBM-MSCs) by up-regulation of miR-375 and down-regulation of miR-9 by lentiviruses containing miR-375 and anti-miR-9. After 21 days of induction, islet-like clusters containing insulin producing cells (IPCs) were confirmed by dithizone (DTZ) staining. [score:5]
The protein expressions of target genes, Myotrophin and Onecut-2, were also detected after lentiviral mediated differentiation into IPCs in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups. [score:5]
The results revealed that all genes were expressed 7 days after infection and maximum levels of transcripts were detected on day 14 after induction and then gradually decreased in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups. [score:3]
G (containing VSV-G gene) and hsa-mir-375 (containing the CMV and SV40 promoters) (Applied Biological Materials, Canada, mh10566) inhibitor hsa-III-miR-9-off (abm. [score:3]
It was found that miR-375 and miR-9 were strongly expressed in human BM-MSCs. [score:3]
In addition western blot analysis also confirmed pancreatic endocrine expressions after induction in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups (Fig 8). [score:3]
Western blot analysis detected expressions of insulin (5KD), glucagon (46KD), PDX1 (31KD) and Ngn3 (23KD) in differentiated IPCs (1) MSCs [miR-375] and (2) MSCs [miR-375+anti-miR-9] (3) MSCs [control]. [score:3]
However, Onecut-2 protein expression was higher in MSCs infected with anti-miR-9 lentivirus (Fig 9). [score:3]
0128650.g008 Fig 8Western blot analysis detected expressions of insulin (5KD), glucagon (46KD), PDX1 (31KD) and Ngn3 (23KD) in differentiated IPCs (1) MSCs [miR-375] and (2) MSCs [miR-375+anti-miR-9] (3) MSCs [control]. [score:3]
The researchers showed that lentiviral mediated down -regulating of miR-9 in MSCs didn’t have any effect on differentiation and insulin secretion. [score:2]
Although the roles of miR-375 and miR-9 are well known in pancreatic development and insulin secretion, the use of these miRNAs in transdifferentiation was never demonstrated. [score:2]
Moreover, although the roles of miR-375 and miR-9 are well known in pancreatic development and insulin secretion, the use of these miRNAs in transdifferentiation was never demonstrated. [score:2]
On the other hand, miR-9 is a negative regulator in glucose stimulated insulin secretion [16]. [score:2]
As expected, when hMSCs cells were treated with empty lentiviruses, miR-375 and miR-9 expression levels showed no significant alteration as compared to MSCs control group. [score:2]
The researchers reported that silencing of miR-9 increased OC-2 protein in IPCs that may contribute to the observed glucose-regulated insulin secretion. [score:2]
Moreover, differentiated MSCs by miR-375 and anti-miR-9 lentiviruses simultaneously secreted insulin and c-peptide in a glucose -induced manner. [score:1]
In conclusion, we have shown that hMSCs can be induced by miR-375 and/or anti-miR-9 to differentiate into mature islet like clusters. [score:1]
0128650.g002 Fig 2 (A) The results of miR-375 and anti-miR-9 transduction examined by fluorescent microscopy (X100). [score:1]
0128650.g003 Fig 3 Spindle shaped and fibroblast-like cells (D0) were induced to islet-like cluster formation by miR-375 and/or anti-miR-9 transduction in 21 days. [score:1]
By contrast, insulin content and secretion were enhanced by increasing glucose concentrations from 5.5 to 25mM in MSCs [miR-375+anti-miR-9]. [score:1]
The study was performed in four groups; one group of cells was transduced with hsa-miR-375 lentiviruses carrying GFP (MSCs [miR-375]), another was infected with hsa-miR-9-off lentiviruses carrying GFP (MSCs [anti-miR-9]) (in this group the cells were briefly infected with hsa-miR-375 lentivirus and 7 days later the cells were exposed to hsa-miR-9-off lentivirus), the third was infected with both miRNAs (MSCs [miR-375+anti-miR-9)]) and the forth group was transduced with pLenti-empty lentiviruses carrying GFP (MSCs [null]). [score:1]
Changes in transcript levels of miR-375 and miR-9 after infection. [score:1]
0128650.g007 Fig 7Immunofluorescence analysis detected nuclei localization of PDX1, Ngn3, and cytoplasmic localization of insulin, and glucagon in differentiated IPCs by (A) MSCs [miR-375] and (B) MSCs [miR-375+anti-miR-9] on day 21. [score:1]
The researchers used the same tracer (GFP) for MSCs [miR-375] and MSCs [anti-miR-9]. [score:1]
0128650.g009 Fig 9Granuphilin: (A) MSCs [miR-375+anti-miR-9] (B) MSCs [miR-375] (C) Control hMSCs, OC-2: (A) Control hMSCs (B) MSCs [anti-miR-9] (C) MSCs [miR-375+anti-miR-9]. [score:1]
During 2 weeks, the round cells became aggregate and some new islet-like clusters began to appear in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups but they were not observed in MSCs [anti-miR-9] (Fig 3). [score:1]
The cells were transduced with miR-375 and/or miR-9 lentivirus and empty virus at a multiplicity of infection (MOI) of 10. [score:1]
Measuring the expression levels of miR-375 and miR-9 by qRT-PCR. [score:1]
It was reported for the first time that miR-375 has essential role in MSCs differentiation into IPCs, while anti-miR-9 lentiviruses separately didn’t have any effect on MSCs differentiation into IPCs and subsequently insulin secretion. [score:1]
detected nuclei localization of PDX1, Ngn3, and cytoplasmic localization of insulin, and glucagon in differentiated IPCs by (A) MSCs [miR-375] and (B) MSCs [miR-375+anti-miR-9] on day 21. [score:1]
2 as well as GLUT2 were observed in mature D14 IPCs in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups in comparison to undifferentiated hMSCs (p-value < 0.05). [score:1]
Spindle shaped and fibroblast-like cells (D0) were induced to islet-like cluster formation by miR-375 and/or anti-miR-9 transduction in 21 days. [score:1]
The maximum levels of SOX-17 in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups were 563-and 419- fold and HNF-3 beta/FoxA2 transcripts were 123- and 163- fold respectively and they were identified by day 7 in comparison to undifferentiated hMSCs (Fig 5). [score:1]
However, a protein level of OC-2 was increased following anti-miR-9 infections after 21 days. [score:1]
hMSCs transfected with lentivirus carrying miR-375 gene and/or anti-miR-9, control cells with empty lentivirus and hMSCs without any treatment were plated at a density of 10 [6] cells per well in a 6-well plate and maintained in culture media for 21 days. [score:1]
Granuphilin: (A) MSCs [miR-375+anti-miR-9] (B) MSCs [miR-375] (C) Control hMSCs, OC-2: (A) Control hMSCs (B) MSCs [anti-miR-9] (C) MSCs [miR-375+anti-miR-9]. [score:1]
The lentivirus miR-375 and anti-miR-9 were generated from the co-transfection of 70–80% confluent HEK 293T cells with lentiviral packaging plasmids, psPAX2 (containing gag and pol genes), pMD2. [score:1]
Mtpn: (A) Control hMSCs (B) MSCs [miR-375] (C) MSCs [miR-375+anti-miR-9]. [score:1]
The researchers tested whether miR-375 and/or anti-miR-9 lentiviruses infected cells were able to produce, store and secret insulin. [score:1]
The researchers used control MSCs (MSCs [control]) without any treatment to compare the effects of empty vectors without carrying miR-375 and miR-9 on cell lineage decisions. [score:1]
Therefore, the cells in MSCs [miR-375] and MSCs [miR-375+anti-miR-9] groups were selected for further studies. [score:1]
Significant amounts of insulin and C-peptide were obtained in MSCs [miR-375+anti-miR-9] group. [score:1]
Upon exposure to miR-375 and anti-miR-9 lentiviruses and serum free media, the adherent, spindle-like cells turned round and assembled together. [score:1]
[1 to 20 of 59 sentences]
17
[+] score: 167
Other miRNAs from this paper: hsa-mir-21, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-373
Figure 2D shows how all five genes are directly targeted by hsa-miR-9: four genes exhibited an inhibition trend while one gene, YWHAZ, upregulated upon hsa-miR-9. Furthermore, the results presented here highlight MAPK14/mapkapk2/mapkapk3 and their interaction with hsa-miR-9 as a possible molecular mechanism involved in the control of GBM progression. [score:9]
Figure 2D shows how all five genes are directly targeted by hsa-miR-9: four genes exhibited an inhibition trend while one gene, YWHAZ, upregulated upon hsa-miR-9. Furthermore, the results presented here highlight MAPK14/mapkapk2/mapkapk3 and their interaction with hsa-miR-9 as a possible molecular mechanism involved in the control of GBM progression. [score:9]
We then demonstrate a novel regulation mode by which a set of five key factors of the MAPKAP pathway are regulated by the same microRNA, hsa-miR-9. We demonstrate that hsa-miR-9 overexpression leads to MAPKAP signaling inhibition, partially by interfering with the MAPK14/MAPKAP3 complex. [score:7]
In the work presented here, we expanded our results and identified the specific players, their molecular interactions within the MAPKAP signaling pathway, their regulation by hsa-miR-9 and their control over the observed phenotype, using the presented results and by combining computational and experimental work we can catalyze targeted treatment, facilitate prognosis through network biomarkers and offer a novel perspective into hidden disease heterogeneity. [score:6]
In addition, we demonstrate that hsa-miR-9 overexpression leads to inhibition of MAPKAP signaling, partially by interfering with MAPK14/MAPKAP3 complex. [score:5]
This analysis revealed that the classification was indeed a consequence of miR9 expression levels and not a rearrangement of well-known clinical features, demographic features or disease history. [score:5]
Anti-miR-9 is miRCURY LNA miR inhibitor, which is an antisense oligonucleotides with perfect sequence complementary to its target. [score:5]
These results strengthen the demonstrated western blot results which showed a decrease in MAPK14 levels, induced by over expression of hsa-miR-9. Together, these results indicate that the hsa-miR-9 induced decrease in migration and invasion of GBM cells, is directly mediated through MAPKAP signaling. [score:4]
These results strengthen the demonstrated western blot results which showed a decrease in MAPK14 levels, induced by over expression of hsa-miR-9. Together, these results indicate that the hsa-miR-9 induced decrease in migration and invasion of GBM cells, is directly mediated through MAPKAP signaling. [score:4]
B. hsa-miR-9 targets MAPKAP pathway in a direct manner. [score:4]
We report that hsa-miR-9 alters MAPKAP signaling by directly targeting five genes within the pathway. [score:4]
hsa-miR-9 regulates the MAPKAP signaling pathway by regulating six pathway members. [score:3]
This binding may account for the opposite trend produced by miR-9 over expression. [score:3]
Upon hsa-miR-9 expression, MAPK14 activation is blocked by a reduction in the non-active form of MAPK14, as demonstrated in Figure 3A, 3B and 3C. [score:3]
Further, hsa-miR-9 overexpression initiates re-arrangement of actin filaments, which leads us to hypothesize a mechanism for the observed phenotypic shift. [score:3]
Figure 1 A. Kaplan-Meier curves generated from 357 glioblastoma patients using patient affiliation to groups parsed by expression levels of hsa-miR-9 in the TCGA dataset. [score:3]
Figure 1B is associated with patients in Group1 (low miR9 expression and low survival), while Figure 1C is associated with Group2 patients (high miR9 levels and high survival rates). [score:3]
C. hsa-miR-9 decreases MAPK14 expression levels. [score:3]
Results, shown in Figure 3A, 3B, demonstrate that upon hsa-miR-9 overexpression, endogenous levels of both MAPK14 and MAPKAP3 decrease. [score:3]
Genes highlighted in red are in the MAPKAP network, both computationally and experimentally, to be targeted by hsa-miR-9. Nodes highlighted in light red are the processes found to be interfered by the effect of the miR on the pathway. [score:3]
, shown in Figure 3A, 3B, demonstrate that upon hsa-miR-9 overexpression, endogenous levels of both MAPK14 and MAPKAP3 decrease. [score:3]
miR9 expression levels classification was performed using k-means clustering algorithm. [score:3]
Relative expression levels of miR9 were normalized to U6 snRNA. [score:3]
To see how hsa-miR-9 over -expression influences migration, three GBM cell lines, CRL-1690, U-251 and SF-295 were grown to full confluence and transfected with hsa-miR-9, an empty vector [37], anti-miR-9, or anti-control. [score:3]
In previous work [27], we identified a negative correlation between the expression levels of hsa-miR-9 and MAPKAP activity. [score:3]
miR-9 has been previously reported to be highly expressed in glioma cells [23– 26]. [score:3]
CRL-1690 cells were co -transfected with hsa-miR-9 or vector and the 3’UTR promoter of the indicated genes: CREB, MAPKAPK2 (MK2), MAPKAPK3 (MK3), SRF and YWHAZ fused to Firefly Luciferase and Renilla Luciferase expression vector or their respected mutated version of each 3’UTR promoters. [score:3]
We detected whether hsa-miR-9 interferes with the MAPK14 /MAPKAP3 complex formation by interfering with their expression levels. [score:3]
The work presented here exposes novel microRNA features and situates hsa-miR-9 as a therapeutic target, which governs metastasis and thus determines prognosis in GBM through MAPKAP signaling. [score:3]
Here, we show that the expression levels of hsa-miR-9 stratify patients’ survival (Figure 1A). [score:3]
We also identified a possible hsa-miR-9 target site on five genes within this pathway (CREB, MAPKAPK2 (MK2), MAPKAPK3 (MK3), SRF and YWHAZ) (Figure 2A). [score:3]
Upon miR9 transfection, most of the genes exhibited down regulation in their promoter activity. [score:2]
To study the association between hsa-miR-9 over expression and the observed reduction in the invasion and migration of the cancer cells, as well as the observed association with prognosis across cohort of patients, we conducted a western blot assay. [score:2]
In a previous work [27] using PITA [28] which is a microRNA prediction tool that scans the UTR of selected genes against all microRNAs and scores each site, we identified that hsa-miR-9 has the potential to regulate the MAPKAP network. [score:2]
hsa-miR-9 regulates cell migration and invasion of glioblastoma cell lines. [score:2]
hsa-miR-9 interferes with the MAPK14/MAPKAP3 complex production by down- regulating both MAPK14 and MAPKAP3 levels. [score:2]
In this case, YWHAZ is being regulated by miR-9 via 2 binding sites, both of which are non-canonical. [score:2]
In addition, by performing phenotypic assays to characterize hsa-miR-9 effects we identified significant inhibition of both cell migration and cell invasion in the presence of the exogenous hsa-miR-9. These findings offer a novel therapeutic target, hsa-miR-9, by demonstrating how it governs metastasis and thus determines prognosis in GBM through MAPKAP signaling. [score:2]
AxioimagerZ1 microscope monitored the actin filament patterns obtained upon vector or miR9 transfection. [score:1]
CRL-1690 cells grown on cover slips were transfected with hsa-miR9 or vector. [score:1]
hsa-miR-9 decrease MAPK14 and MAPKAP3 protein levels. [score:1]
1 × 10 [3] cells were seeded per 96-well plates and cotransfected with 0.7 μg miR-9 or miR-vector along with 0.3 μg of psiCHECK2 construct (representing the 3’ UTR of the 5 indicated genes). [score:1]
CRL1690 cells were transfected with hsa-miR9, vector, anti-miR9 or anti-control. [score:1]
demonstrated reduction in mRNA transcripts upon miR9 transfection, in four out of five cases. [score:1]
hsa-miR-9 thus controls a unique F-actin pattern. [score:1]
As Figure 3A shows, protein levels of MAPKAP3 decrease in the presence of hsa-miR-9. Surprisingly, the phosphorylated form of MAPK14 shows no significant changes upon introduction of hsa-miR-9 (band size 37kDa), while the un-phosphorylated form of MAPK14 was at undetectable levels (band size 25kDa), even though the 3’UTR of MAPK14 does not contain any hsa-miR-9 binding sites. [score:1]
Relative Luciferase values represent the ratio hsa-miR-9: vector for each detected promoter. [score:1]
CRL1690 cells were seeded on glass cover slips and transfected with hsa-miR-9 or vector. [score:1]
Figure 3CRL-1690 cells were transfected with hsa-miR9 or vector. [score:1]
CRL1690 cells were grown on coverslips in a 6-well plate and transfected with miR-9 or miR-vector. [score:1]
CRL-1690 cells were transfected with hsa-miR9 or vector. [score:1]
D. CRL1690 cells were co -transfected with hsa-miR9 or vector, and the 3’ UTR of the indicated genes (canonical MAPKAP pathway partners) fused to Firefly luciferase and Renilla Luciferase or their corresponding mutant 3’UTR promoters. [score:1]
Cells were seeded into 6-well plate and transfected with miR-9 or miR-vector. [score:1]
Thus, a decrease in this complex formation induced by hsa-miR-9 may result in a decline in cell motility, through interruption with the actin cytoskeleton. [score:1]
Relative Luciferase values represent the ratio miR9: vector for each detected promoter. [score:1]
In the work, we use in vitro systems to study the effects of hsa-miR-9 on MAPKAP signaling in three different GBM cell lines. [score:1]
The same trend is observed when we use anti-miR-9 and anti-con. [score:1]
hsa-miR-9 and its corresponding control (“Vector”) were both a generous gift from Reuven Agami. [score:1]
AxioimagerZ1 microscope monitored the MAPK14 patterns obtained upon vector or miR9 transfection D. hsa-miR-9 induces re-organization of Actin filaments via interfering with MAPK14/MAPKAP3 complex CRL-1690 cells grown on cover slips were transfected with hsa-miR9 or vector. [score:1]
hsa-miR-9 control patients survival and is associated with MAPKAP control mechanism. [score:1]
Cells were seeded into 10cm plates and transfected with miR-9 or miR-vector. [score:1]
These results highlight the strong effect of miR-9 on glioblastoma cells’ mobility. [score:1]
Anti-miRNA-9. Vector and hsa-miR-9. Plasmid constructs. [score:1]
hsa-miR-9 interferences with MAPK14/MAPKAP3 complex induces F-actin re-organization. [score:1]
We hypothesize that this disruption of the MAPK14-MAPKAP3 complex homeostatic function accounts for the decrease in cell migration, cell invasion and ultimately of the clinical phenotype associated with hsa-miR-9 levels, and especially of the clinical phenotype observed in conjunction with the MAPKAP pathway activity [27]. [score:1]
Our previous work identified the association between MAPKAP pathway and hsa-miR-9 using computational tools and algorithms. [score:1]
D. hsa-miR-9 reduces migration rates in GBM cell lines SF295, CRL-1690 and U251 GBM cell lines were transfected with hsa-miR-9,vector, anti-miR9 or anti-control and grown to 80-90% confluence. [score:1]
This mechanism thus suggests hsa-miR-9 as a possible therapeutic agent for treating GBM. [score:1]
Upon introduction of hsa-miR-9, four out of the five genes demonstrated reduction of their promoter activity, while their corresponding mutant 3’UTR demonstrated very low luminescence or not at all (Figure 2D). [score:1]
[1 to 20 of 69 sentences]
18
[+] score: 151
We also identified that miR-137 and miR-9 directly downregulate CUL4A expression by targeting the 3′-UTR of its mRNA, and indirectly regulate downstream Hippo-YAP signaling in GC. [score:11]
As shown by western blotting in Figure 6D, overexpressing miR-9 and miR-137 in HGC-27 cells resulted in the upregulation of LATS1 and p-YAP and downregulation of CUL4A, but no change in MST1/2. [score:9]
Western blotting results showed that overexpressing miR-9 and miR-137 significantly reduced CUL4A protein expression in HGC-27 cells; whereas, overexpressing miR-103 and miR-107 had no effect on CUL4A protein expression (Figure 5B). [score:9]
Furthermore, we verified that miR-9/137 indirectly regulated LATS1-Hippo signaling and suppressed GC cell proliferation and invasion by directly targeting CUL4A. [score:8]
Overexpressing 3′-UTR-less CUL4A rescues miR-9/137 -mediated inhibition of cell proliferation and invasion. [score:5]
Luciferase expression from the wild-type but not from mutant 3′-UTR constructs was significantly suppressed by miR-9 and miR-137 (Figure 5E). [score:5]
C. suggested an inverse correlation between miR-137 and miR-9 expression and CUL4A and YAP protein expression, respectively. [score:5]
Moreover, we showed that miR-9 and miR-137 targeted CUL4A in GC cells, thereby indirectly regulating the LATS1-Hippo signaling pathway and promoting cell proliferation and invasion. [score:5]
Moreover, qPCR results demonstrated that miR-9 decreased the expression of downstream targets of the Hippo pathway, such as CTGF, CYR61, CDX2 and AREG, but not of c-Myc (Figure 6F). [score:5]
This is supported by our observation that overexpressing miR-9 and miR-137 suppressed the proliferation and invasion of GC cells in vitro (Figure 6A, 6B, 6C). [score:5]
Our findings suggest that miR-9 and miR-137 might regulate Hippo-YAP signaling in GC cells by targeting CUL4A. [score:4]
Figure 7 A. Overexpression of CUL4A missing its 3′-UTR rescued miR-9/137 -mediated inhibition of MGC-803 and BGC-823 cell invasion in Transwell chamber assays. [score:4]
To determine whether miR-9 and miR-137 repressed CUL4A expression by targeting its 3′-UTR, wherein the predicted binding sites were disrupted, were cloned into luciferase reporter vectors and tested using luciferase activity assays (Figure 5D). [score:4]
B. Overexpression of CUL4A missing its 3′-UTR rescued miR-9/137 -mediated inhibition of MGC-803 and BGC-823 cell proliferation in CCK-8 assays. [score:4]
A. Overexpression of CUL4A missing its 3′-UTR rescued miR-9/137 -mediated inhibition of MGC-803 and BGC-823 cell invasion in Transwell chamber assays. [score:4]
These data support that the CUL4A 3′-UTR is a direct target of miR-9 and miR-137 in GC cells. [score:4]
CUL4A is a direct target of miR-9 and miR-137. [score:4]
Here, using bioinformatics and luciferase reporter assays, we identified that the miRNAs, miR-9 and miR-137, directly target the 3′-UTR of CUL4A transcripts. [score:3]
Taken together, our findings demonstrate the importance of a miR-9/137-CUL4A-Hippo signaling axis in GC, and suggest new therapeutic targets for future treatment of GC. [score:3]
An inverse correlation was also observed between miR-9 expression and CUL4A (Figure 8C, R=−0.718, P=0.004) and YAP (Figure 8C, R=−0.603, P=0.022) protein levels. [score:3]
Moreover, overexpression of miR-9 and miR-137 significantly reduced CUL4A protein levels in two other cell lines, SGC-7901 and BGC-823 (Figure 5B). [score:3]
Predicted miRNA binding regions for miR-9 and miR-137 in the 3′-UTR of CUL4A were subcloned into the pMIR-REPORT Luciferase miRNA expression vector (pLuc, Ambion, Waltham, MA, USA). [score:3]
Importantly, co-transfecting miR-9 or miR-137 with a CUL4A gene construct missing its 3′-UTR into MGC-803 or BGC-823 cells rescued miR-9/137 -mediated inhibition of GC cell invasion (Figure 7A), cell proliferation (Figure 7B) and EMT (Figure 7C) through the Hippo pathway (Figure 7C). [score:3]
B. Western blotting results showed that the overexpression of miR-9 and miR-137 significantly reduced CUL4A protein levels in HGC-27, SGC-7901 and BGC-823 cells; whereas, miR-103 and miR-107 had no effect on CUL4A protein levels. [score:3]
A. The relative levels of miR-9 and miR-137 expression in 14 fresh GC tissues were determined by qPCR. [score:3]
Four miRNAs, including miR-103, miR-107, miR-9, and miR-137 (Figure 5A), were predicted using two independent miRNA databases: TargetScan (http://www. [score:3]
We detected the expression of miR-9 and miR-137 in addition to CUL4A and YAP proteins in 14 fresh GC tissues, which included seven clinical stage I-II and seven clinical stage III-IV samples (Figure 8A, 8B). [score:3]
Several studies have demonstrated that miR-9 and miR-137 are decreased in human GC tissues and cell lines, suggesting that they function as tumor suppressors [23, 24]. [score:3]
Figure 8 A. The relative levels of miR-9 and miR-137 expression in 14 fresh GC tissues were determined by qPCR. [score:3]
C. miR-9 and miR-137 inhibited HGC-27 cell invasion in Transwell chamber assays. [score:2]
Taken together, these results suggest that a miR-9/137-CUL4A-Hippo signaling axis plays a vital role in the development and progression of GC (Figure 8D). [score:2]
miR-9 and miR-137 regulate the CUL4A-LATS-Hippo signaling pathway. [score:2]
E. In luciferase activity assays, miR-9 and miR-137 suppressed luciferase activity of the wild-type but not mutant CUL4A 3′-UTR constructs in 293 cells. [score:2]
miR-9 and miR-137 regulate Hippo-YAP signaling. [score:2]
F. Levels of mRNA for the indicated genes in the Hippo signaling pathway were decreased by miR-9 and miR-137 in HGC-27 cells. [score:1]
E. Immunofluorescence results of YAP in GC cells transfected with miR-9 and miR-137 mimics. [score:1]
C. Western blotting results of the levels of the indicated proteins in HGC-27 cells co -transfected with 3′-UTR-less CUL4A and miR-9 or miR-137. [score:1]
We also demonstrated that perturbations to a miR-9/137-CUL4A-Hippo signaling axis contributed to gastric tumorigenesis. [score:1]
Clinical relevance of the miR-9/137-CUL4A-Hippo signaling axis in fresh GC tissues. [score:1]
The miR-9/137-CUL4A-Hippo signaling axis we have described here may have important clinical implications, since we also observed highly significant correlations among miR-9/137, CUL4A and YAP in GC tissue samples. [score:1]
HEK293 cells were seeded in 24-well plates at a density of 1×10 [5] cells per well and transiently transfected with wild type or mutant luciferase reporter plasmids (miR-9, miR-137 and the negative control) at a final concentration of 50 nM. [score:1]
In addition, immunofluorescence results showed that the nuclear distribution of YAP was reduced after transfecting HGC-27 cells with miR-9 and miR-137 mimics (Figure 6E). [score:1]
D. Western blotting results ofthe levels of proteins in CUL4A-LATS1-Hippo signaling pathway in HGC-27 cells after transfecting with CUL4A-siR-1, miR-9 or miR-137, respectively. [score:1]
C. Quantitative PCR results of CUL4A mRNA levels after transfecting GC cells with miR-9 and miR-137 mimics. [score:1]
[1 to 20 of 44 sentences]
19
[+] score: 147
In OCCC cell lines used in this study, miR-9 knockdown significantly reduced invasion and migration abilities while upregulating E-cadherin expression, suggesting that aberrant miR-9 expression might play an important role in EMT activation in OCCC cells through direct binding to and subsequent downregulation of E-cadherin. [score:13]
Through in vitro knockdown experiments, we investigated the biological role of miR-9 overexpression in OCCC and found that miR-9 could modulate tumor cell invasion by directly targeting and downregulating E-cadherin expression. [score:10]
In JHOC-9 and OVISE cells, miR-9 suppression significantly increased E-cadherin expressions (Fig 3B, S2C Fig) and was associated with reduced mesenchymal marker (e. g., Vimentin and Fibronectin) and matrix metalloproteinase 9 (MMP-9) expressions. [score:7]
Although in vivo experiments with molecular analyses are needed to further refine the miR-9 involvement in the development and progression of OCCC, it is possible that OCCC cells with miR-9 overexpression could spread into the peritoneal cavity through the regulation of E-cadherin expression. [score:7]
Data from miRNA target prediction databases and a literature search identified numerous tumor suppressive targets of the oncogenic miR-9, including FOXO1 in both non-small cell lung cancer [33] and endometrial cancer [34] and CDX2 in gastric cancer [35]. [score:7]
JHOC-9 and OVISE cells were seeded into 6-well plates at a density that would yield 50% confluency after 24 h and were subsequently transfected with the mirVana [™] miRNA inhibitor (Thermo Fisher Scientific) that was specific for miR-9 (miR-9 inhibitor) or Anti-miR [™] miRNA Inhibitor Negative Control (anti-miR-NC; Thermo Fisher Scientific) at a final concentration of 100nM. [score:7]
miR-9 upregulation was found to facilitate metastasis in esophageal squamous cell carcinoma and breast cancer by inducing epithelial–mesenchymal transition (EMT) through direct targeting of E-cadherin [16, 17]. [score:7]
Notably, miR-9 targets other than E-cadherin may affect OCCC oncogenesis, thus warranting additional studies to explore possible roles for miR-9 upregulation and define the molecular mechanisms involved in the pathogenesis of this specific type of ovarian cancer. [score:6]
To elucidate the biological role of miR-9 overexpression in OCCC, we conducted miRNA inhibitor -based knockdown experiments in two OCCC cell lines (JHOC-9 and OVISE). [score:6]
The results of previous studies [16– 18] and web -based computational target prediction program assessments of miR-9 prompted us to examine whether miR-9 could target E-cadherin, a potential mediator of cell invasion. [score:5]
When we compared the relative expressions between OCCC and HGSC, the former expressed significantly higher levels of miR-9, miR-126, and miR-34a (Fig 2); of these, the most significant difference was observed for miR-9. In addition, miR-132 expressions were clearly elevated in OCCC compared with HGSC, although this difference was only marginally significant (Fig 2). [score:5]
Altogether, these findings support the idea that miR-9 upregulation in OCCC could be explained in part by somatic copy number alterations. [score:4]
In conclusion, miR-9 upregulation may be involved in OCCC pathogenesis, a unique ovarian cancer subtype, by inducing EMT through E-cadherin modulation. [score:4]
Altogether, these results indicate that E-cadherin is a direct target of miR-9 in OCCC. [score:4]
Prospero homeobox 1 promotes epithelial-mesenchymal transition in colon cancer cells by inhibiting E-cadherin via miR-9. Clin Cancer Res. [score:3]
The precise mechanisms underlying aberrant miR-9 expression in several cancers are not completely understood. [score:3]
Relative expression of miR-9 in ten OCCC cell lines and six non-OCCC cell lines. [score:3]
S1 FigRelative expression of miR-9 in ten OCCC cell lines and six non-OCCC cell lines. [score:3]
A previous study proposed that activated forms of the MYC and MYCN oncoproteins promote miR-9 expression via gene amplification in human cancers [17]. [score:3]
Furthermore, the clinical implications of the association between miR-9 and E-cadherin expressions should be clarified in a large-scale study of patients with OCCC. [score:3]
Accordingly, miR-9 may be a promising therapeutic target strategy for OCCC. [score:3]
In this study, we observed high miR-9 expression in OCCC, similar to previous studies describing many other types of cancer, including esophageal [16], breast [17], and colorectal cancer [18]. [score:3]
In contrast, tumor suppressive and/or chemosensitive effects of miR-9 have been reported in HGSC [36, 37]. [score:3]
Individual Taqman [®] MicroRNA assays for miR-9, miR-132, miR-126, and miR-34a were used to validate the expression signatures that were determined via microRNA PCR plate analysis in the original 27 and additional 23 cases (Table 1). [score:2]
Real-time RT-PCR analysis of 16 ovarian cancer cell lines revealed higher miR-9 expression in OCCC cell lines compared with non-OCCC cell lines despite a lack of significant differences, these results were similar to those observed in clinical specimens (S1 Fig). [score:2]
In addition, miR-132, miR-9, miR-126, and miR-34a expression profiles were analyzed using TaqMan [®] MicroRNA Assays (Applied Biosystems, Foster City, CA, USA). [score:2]
0162584.g002 Fig 2Individual Taqman MicroRNA assays were used to analyze the relative expression of miR-9 (A), miR-132 (B), miR-126 (C), and miR-34a (D) in the original 27 and additional 23 cases. [score:2]
Through in vitro invasion and migration analyses, we observed that in OCCC cells, despite similar proliferative capacities (S2A Fig), miR-9 suppression significantly reduced the invasion and migration abilities compared with that in negative control or parental cells (Fig 3A, S2B Fig). [score:2]
Involvement of miR-9 in OCCC pathogenesisReal-time RT-PCR analysis of 16 ovarian cancer cell lines revealed higher miR-9 expression in OCCC cell lines compared with non-OCCC cell lines despite a lack of significant differences, these results were similar to those observed in clinical specimens (S1 Fig). [score:2]
0162584.g003 Fig 3Effects of miR-9 knockdown on biological responses of OCCC cells. [score:2]
S2 FigEffects of miR-9 knockdown on biological responses of OCCC cells. [score:2]
Effects of miR-9 knockdown on biological responses of OCCC cells. [score:2]
An unsupervised hierarchical clustering analysis of 87 miRNA expression in 27 patients with ovarian cancer, including the calculated centered correlation distances and average linkages, identified two main clusters, A and B. Individual Taqman [®] MicroRNA assays for miR-9, miR-132, miR-126, and miR-34a were used to validate the expression signatures that were determined via microRNA PCR plate analysis in the original 27 and additional 23 cases (Table 1). [score:2]
Individual Taqman MicroRNA assays were used to analyze the relative expression of miR-9 (A), miR-132 (B), miR-126 (C), and miR-34a (D) in the original 27 and additional 23 cases. [score:2]
Of note, only approximately 80 cancer-related miRNAs from among >2500 human miRNAs could significantly differentiate the ovarian histological subtypes of OCCC and HGSC; of these, miR-132, miR-9, miR-126, miR-34a, and miR-21 were the strongest classifiers. [score:1]
Involvement of miR-9 in OCCC pathogenesis. [score:1]
In previous studies, we [39] and another research group [40] frequently observed chromosomal amplification at 1q22, which includes miR-9, in OCCC via comparative genomic hybridization analysis. [score:1]
These findings have led to the hypothesis that miR-9 may exert multiple functions in different cancers and in different histotypes of cancers in the same organ. [score:1]
To assess cell invasion and migration abilities, JHOC-9 and OVISE cells were transfected with either miR-9 inhibitor or anti-miR-NC for 24 h and seeded in the upper chambers of either 24-well Matrigel-coated polyethylene terephthalate membrane inserts (pore size, 8 μm; Corning, Tewksbury, MA, USA) for invasion assay or 24-well Falcon [®] Cell Culture Insert (pore size, 8 μm; Corning) for migration assay. [score:1]
To confirm the direct binding of miR-9 to E-cadherin, pMIR luciferase vectors were transfected in JHOC-9 and OVISE cells, which were then subjected to a luciferase reporter assay. [score:1]
[1 to 20 of 40 sentences]
20
[+] score: 141
Other miRNAs from this paper: hsa-mir-183, hsa-mir-9-1, hsa-mir-9-2
Given significant biomarker and therapeutic potential, noncoding RNAs have been the focus of major research efforts 3, 4. More specifically, micro -RNAs (miRNAs) are small, non-protein-coding nucleotides (18–25 bp) that negatively regulate messenger RNA (mRNA), and thus, posttranscriptional protein expression 5, 6. Recent studies have proven miRNAs to be of fundamental importance throughout embryological development, tissue differentiation, proliferation, and cell death 5. Our laboratory has previously reported significant differential miRNA expression between SMTC and HMTC 7. MiR-9-3p was shown to be underexpressed in sporadic cases and functional work showed that miRNA therapeutics were efficacious in vitro. [score:9]
This implies that miR-9-3p plays a regulatory role in autophagic flux in vitro, by attempting to maintain a basal level of autophagic flux; with expression elevating in circumstances of Rapamycin induced autophagy stimulation and expression being suppressed when autophagy is blocked with Chloroquine. [score:8]
Figure 3 illustrates a suggestion of downregulation of all three gene targets following miR-9-3p transfection in both cell lines when compared to negative control -transfected cells (expressed as log [10] fold change). [score:7]
MiR-9-3p is one member of the miR-9 family and has been shown to be dysregulated in not only MTC but also breast cancer cell lines where it has also been proven to synergize with MEK inhibitors to suppress cell growth 8. Roles in differentiation of pluripotent osteoblastic stem cells have also been published 9 but beyond these present findings, there is a relative paucity of data upon which to reflect regarding the precise role that miR-9-3p plays in biology. [score:6]
Additional validation studies revealed BCL-2 and LAMP-1 to be significantly suppressed following miR-9-3p transfection, reinforcing the suggestion of miRNA -induced autophagy inhibition and also revealing potential key regulators. [score:6]
Figure 5qPCR results displaying TT and MZ-CRC-1 miR-9-3p expression 48 h following treatment with rapamycin or chloroquine (expressed as log [10] fold change relative to control; # P <  0.05). [score:5]
More specifically, the only predicted target of miR-9-3p within the context of autophagy, Atg5, was shown through luciferase reporter experimentation to be a validated target (in the TT cell line). [score:5]
In contrast, the low miR-9-3p expression seen in the TT cell line resulted in a greater relative change in miRNA expression following transfection that was subsequently associated with a larger therapeutic effect. [score:5]
Figure 3qPCR results displaying TT and MZ-CRC-1 expression of selected probes 48 h following miR-9-3p transfection (expressed as log [10] fold change relative to control; # P <  0.05). [score:5]
Relatively elevated miR-9-3p expression was observed following autophagy induction, implying that miR-9-3p does maintain a regulatory influence in vitro. [score:4]
Following prior studies 7, we demonstrated that transfection facilitated upregulation of miR-9-3p, results in therapeutic cell death in vitro. [score:4]
Figure 4 shows a significant reduction in reporter assay signaling, following miR-9-3p transfection of the TT cell line at 48 h (P <  0.01), consistent with targeted Atg5 inhibition. [score:4]
In order to test the hypothesis of miR-9-3p -targeted suppression of Atg5, a luciferase reporter assay was constructed and performed in both cell lines. [score:4]
Pharmacologic autophagy manipulation alters miR-9-3p expression. [score:3]
The present experiments support this hypothesis, in that miR-9-3p transfection led not only to cell death and autophagy inhibition but also evidence of increased apoptotic flux. [score:3]
miR-9-3p transfection inhibits autophagic flux and increases apoptosis. [score:3]
Further to miR-9-3p autophagy inhibition and crosstalk with apoptosis, array studies were confirmatory of this influence throughout a multitude of autophagy-related genes. [score:3]
miR-9-3p transfection inhibits a range of autophagy-related genes. [score:3]
The current work, using a number of autophagy markers, demonstrated global suppression of autophagic flux following miR-9-3p transfection, in association with a therapeutic in vitro effect. [score:3]
In both cell lines, following miR-9-3p transfection, cPARP expression was significantly elevated, providing more specific evidence of cell death via apoptosis. [score:3]
Thirdly, experiments employing miR-9-3p and then also siRNA to Atg5 itself revealed not only autophagy inhibition, but evidence of crosstalk between autophagy and apoptosis pathways. [score:3]
A concurrent and significant increase in cPARP expression was also seen in both cell lines, indicating enhanced apoptosis within the context of miR-9-3p -induced autophagic blockade. [score:3]
Preliminary findings (not shown in) showed that basal miR-9-3p expression was significantly higher in the MZ-CRC-1 cell line. [score:3]
miR-9-3p transfection results in cell-line-specific Atg5 inhibition. [score:3]
Secondly, the targeted influence of miR-9-3p was able to be isolated. [score:3]
Atg5 knockdown also led to reduced cellular proliferation, but not to the same extent as seen following miR-9-3p transfection with an observed reduction in the number of viable cells by 12.6% (TT cells; P =  0.04) and 2% (MZ-CRC-1 cells; P =  0.43), respectively. [score:2]
We aimed to explore the in vitro therapeutic impact of miR-9-3p in MTC with an emphasis on autophagy manipulation and to probe clinical correlations with key autophagy regulators. [score:2]
In order to explore miR-9-3p regulation of autophagy, a posttransfection autophagy gene mRNA array was performed. [score:2]
To further investigate the role of miR-9-3p regulation of autophagy, cell lines were treated with an autophagy inducer (Rapamycin) or a known autophagy blocker (Chloroquine) for 48 h. Using qPCR, significant differences were observed in miR-9-3p expression between treatments in both cell lines. [score:2]
Firstly, these findings are novel in identification of miR-9-3p regulation of autophagic flux in vitro, and in MTC specifically. [score:2]
With regard to “autophagamiRs” 15, or miRNAs that play a role in autophagy regulation, pharmacologic induction and blockade experiments revealed the importance of miR-9-3p. [score:2]
While still engaging a therapeutic effect, it would appear that additional elevation of miR-9-3p in the cell line had a finite influence, and represented a relatively lower level of increased expression (compared to basal levels). [score:2]
More specifically, miR-9-3p expression was significantly higher after treatment with Rapamycin when compared to Chloroquine (Fig. 5; TT: P =  0.013; MZ-CRC-1: P <  0.01). [score:2]
This could be explained as being akin to a negative feedback loop, whereby induction of a physiological process (in this case autophagy) is met with elevation of regulators (i. e., miR-9-3p) that reduce activity back to basal levels. [score:2]
This has assisted in unlocking the precise mechanism of the miR-9-3p effect and identified an additional level of regulation that could be exploited therapeutically. [score:2]
It could be assumed that miR-9-3p was enacting a mechanism based on cell death via apoptosis. [score:1]
miR-9-3p transfection reduces TT and MZ-CRC cell viability. [score:1]
This effect was not seen, however, in the MZ-CRC-1 cell line, where subtle differences between negative control and miR-9-3p transfection were not significant (P =  0.23). [score:1]
When comparing cell lines, the pre-miR-9-3p effect was significantly greater in the TT cell line (P <  0.01). [score:1]
miR-9-3p transfection has a cell-line -dependent effect on cell cycle progression. [score:1]
Post-miR-9-3p transfection autophagy gene array results. [score:1]
Additionally, populations of sub-G1 cells, in either cell line, were not significantly altered by miR-9-3p transfection. [score:1]
Of note was the absence of a significant increase in the sub-G1 population of cells in both cell lines following miR-9-3p transfection. [score:1]
These results served as controls for post-miR-9-3p transfection immunoblots on both cell lines. [score:1]
Figure S1 shows cell cycle analysis results for TT (Fig. S1A) and MZ-CRC-1 (Fig. S1B) cell lines comparing negative control -transfected cells with miR-9-3p. [score:1]
Subsequent miR-9-3p transfected lysates from both cell lines resulted in evidence of a significant reduction in markers of autophagic flux (TT: Figure 2A and B and MZ-CRC-1: C and D). [score:1]
Figure 2(A) Western blot of apoptosis and autophagy markers 48 h post-TT cell transfection with miR-9-3p or negative control; (B) quantified densitometry results of (A); (C) Western blot of apoptosis and autophagy markers 48 h post-MZ-CRC-1 cell transfection with miR-9-3p or negative control; (D) quantified densitometry results of C (# P <  0.05). [score:1]
Global changes in autophagy markers following miR-9-3p transfection were evident for all autophagy markers in both cell lines, with the exception of p62 in the MZ-CRC-1 cell line. [score:1]
[1 to 20 of 48 sentences]
21
[+] score: 116
Moreover, the co-transfection of HEK293 T cells with psiCHECK-UTRwt and both miR-9 and −155 led to a reduction (~65%) in reporter luciferase activity, but this reduction was not greater than that achieved using miR-155 alone, suggesting that either miR-155 or −9 alone could achieve robust downregulation of CTLA-4. Altogether, these results demonstrate the roles of miR-9 and −155 in the regulation of CTLA-4 expression through direct and specific binding to their target sites. [score:10]
Moreover, the co-transfection of HEK293 T cells with psiCHECK-UTRwt and both miR-9 and −155 led to a reduction (~65%) in reporter luciferase activity, but this reduction was not greater than that achieved using miR-155 alone, suggesting that either miR-155 or −9 alone could achieve robust downregulation of CTLA-4. Altogether, these results demonstrate the roles of miR-9 and −155 in the regulation of CTLA-4 expression through direct and specific binding to their target sites. [score:10]
Another observation shows that in a single subtype of human Treg cells, different microRNAs can target the 3′-UTR of the same gene (FoxP3 is targeted by miR-24, −31, −210 and −335, CTLA-4 is targeted by miR-9 and −155, and GARP is targeted by miR-24 and −335). [score:9]
A Treg cell miRNA signature was identified that included 10 significantly differentially expressed miRNAs: miR-9, −24, −31, −155, −210, −335 and −449 were downregulated in CD8 [+] natural Treg cells, whereas miR-214, −205 and −509 were overexpressed. [score:8]
of miR-9 and −155 in Treg cells significantly reduces CTLA-4 expressionTo study the effect of miR-9 and −155 on the mRNA expression levels of CTLA-4, we increased miR-9 and −155 levels by expressing the miR-9 and −155 precursors from a lentiviral vector (lenti-miR-9 and −155). [score:7]
This ‘signature’ included 10 significantly differentially expressed miRs: miR-214, −205 and −509 were overexpressed, whereas miR-9, −24, −31, −155, −335, −210 and −449 were underexpressed in CD8 [+]CD25 [+] natural Treg cells compared with CD8 [+]CD25 [−] T cells. [score:6]
Furthermore, miR-31, −24, −210 and −335 have target sites in the FOXP3 3′-UTR but not in the CTLA-4 3′-UTR, while miR-9 and −155 have target sites in the CTLA-4 3′-UTR but not in the FOXP3 3′-UTR [68, 69]. [score:5]
Scanning the 3′-UTR of CTLA-4 revealed that miR-9 and −155 (both underexpressed in Treg cells) contained a target site. [score:5]
We could show that both miR-9 and −155 negatively regulate CTLA-4 expression in a direct and specific way. [score:5]
A 249-bp fragment of FOXP3 3′-UTR encompassing the miR-335 potential target site and a 300-bp fragment of CTLA-4 encompassing the miR-9 and miR-155 potential target sites were cloned downstream of the Renilla luciferase gene (Eco RI/Xho I sites) in the psiCHECK-1 plasmid (Promega, Mannheim, Germany) and designated as psiCHECK 3′-UTR WT. [score:5]
In parallel, it is also interesting to note that the majority of miRNAs in the CD8 [+]CD25 [+] natural Treg cell signature are also found to be differentially expressed in either the CD4 [+]CD25 [+] natural Treg cell (miR-31) or the circulating peripheral blood CD4 [+]CD25 [+]CD127 [low] Treg cell (miR-9, −24, −210, −335 and −509) signatures, which may suggest that a limited number of miRNAs control the expression of major features of Treg cells. [score:5]
To study the effect of miR-9 and −155 on the mRNA expression levels of CTLA-4, we increased miR-9 and −155 levels by expressing the miR-9 and −155 precursors from a lentiviral vector (lenti-miR-9 and −155). [score:5]
QuikChange site-directed mutagenesis were performed using the following primers (5′ to 3′): FOXP3 (miR-335 site deleted 3′UTR): GCCCCCCAGTGGGTGTCCCGTGCAG (forward) CTGCACGGGACACCCACTGGGGGGC (reverse) CTLA-4 (miR-9 site deleted 3′UTR): GGGAATGGCACAGCAGGAAAAGGG (forward) CCCTGCCTTTTCCTGCTGTGCCATTCCC (reverse) CTLA-4 (miR-155 site deleted 3′UTR), GGGATTAATATGGGGATGCTGATGTGGGTCAAGG (forward) CCTTGACCCACATCAGCATCCCCATATTAATCCC (reverse) GARP 3′UTR 2070-bp encompassing the miR-24 and −335 potential target sites were cloned downstream the Firefly luciferase gene (AsiSI/Xho1 sites) in the pEZX-MT01 plasmid (Labomics, Nivelles, Belgium) and designed as pEZX-MT01 3′-UTR WT. [score:3]
Target prediction for miR-9, −24, −155 and −335. [score:3]
We could identify putative miRNA target sites in the FOXP3 and CTLA-4 3′-UTRs by both programs—miR-335 in the FOXP3 3′-UTR and both miR-9 and −155 in the CTLA-4 3′-UTR. [score:3]
Lentiviral transduction of miR-9 and −155 in Treg cells significantly reduces CTLA-4 expression. [score:3]
QuikChange site-directed mutagenesis were performed using the following primers (5′ to 3′): FOXP3 (miR-335 site deleted 3′UTR): GCCCCCCAGTGGGTGTCCCGTGCAG (forward) CTGCACGGGACACCCACTGGGGGGC (reverse) CTLA-4 (miR-9 site deleted 3′UTR): GGGAATGGCACAGCAGGAAAAGGG (forward) CCCTGCCTTTTCCTGCTGTGCCATTCCC (reverse) CTLA-4 (miR-155 site deleted 3′UTR), GGGATTAATATGGGGATGCTGATGTGGGTCAAGG (forward) CCTTGACCCACATCAGCATCCCCATATTAATCCC (reverse)GARP 3′UTR 2070-bp encompassing the miR-24 and −335 potential target sites were cloned downstream the Firefly luciferase gene (AsiSI/Xho1 sites) in the pEZX-MT01 plasmid (Labomics, Nivelles, Belgium) and designed as pEZX-MT01 3′-UTR WT. [score:3]
Considering the important role of CTLA-4 in Treg cell biology, we decided to investigate the effect of miR-9 and −155 (underexpressed in CD8 [+] natural Treg cells) on CTLA-4 expression. [score:3]
We engineered luciferase reporter plasmids containing either the wild-type 3′-UTR of this gene (psiCHECK-UTRwt) or a 3′-UTR with deleted miR-9 and −155 target sites (psiCHECK-UTR del). [score:3]
CTLA-4 is directly regulated by miR-9 and miR-155. [score:3]
Relative miR-9, miR-155 and CTLA-4 expression in CD8 [+]CD25 [+] Treg cells transduced by lenti-miR-9 or lenti-miR-155 compared with CD8 [+]CD25 [+] Treg cells transduced by lenti-miR-Ctrl, as determined by relative qRT-PCR. [score:2]
MiR-9, miR-24, miR-155 and miR-335 detection by TaqManTaqMan miRNA assays (Applied Biosystems) used the stem loop method [64, 65] to detect the expression level of mature miR-9, miR-24 miR-155 and miR-335. [score:2]
We next investigated whether CTLA-4 could be directly targeted by miR-9 and −155. [score:2]
TaqMan miRNA assays (Applied Biosystems) used the stem loop method [64, 65] to detect the expression level of mature miR-9, miR-24 miR-155 and miR-335. [score:2]
MiR-9, miR-24, miR-155 and miR-335 detection by TaqMan Real-time PCR. [score:1]
PCR primers used for amplification of the FOXP3 and CTLA-4 3′-UTR were as follows (5′ to 3′): FOXP3 primers: GCGCCTCGAGTCACCTGTGTATCTCACGCATA (forward) GCGCGAATTCGAGCTCGGCTGCAGTTTATT (reverse) CTLA-4 primers: GCGCCTCGAGAGGAGCTCAGGACACTAATA (forward) GCGCGAATTCAATTGGGCCCATCGAACT (reverse) QuikChange site-directed mutagenesis (deletion) of miR-9, miR-24, miR-155 and miR-335 target sites in psiCHECK 3′-UTR WT was performed according to manufacturer's protocols (Stratagene, La Jolla, CA) and designated as psiCHECK-UTR del. [score:1]
Reporter plasmids (psiCHECK, psiCHECK 3′-UTR WT, psiCHECK 3′-UTR deleted, pEZX-MT01, pEZX-MT01 3′-UTR GARP WT, pEZX-MT01 GARP 3′-UTR deleted) (100 ng) were co -transfected in HEK293T and HeLa cells along with miR-9, miR-24, miR-155, and miR-335 -mimic/miR -negative control -mimic at a final concentration of 10 μM (mirVana miRNA mimic, Life Technologies, Gent, Belgium) and control firefly plasmid pGL3-CMV for the psiCHECK vectors only (100 ng) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's gui delines. [score:1]
PCR primers used for amplification of the FOXP3 and CTLA-4 3′-UTR were as follows (5′ to 3′): FOXP3 primers: GCGCCTCGAGTCACCTGTGTATCTCACGCATA (forward) GCGCGAATTCGAGCTCGGCTGCAGTTTATT (reverse) CTLA-4 primers: GCGCCTCGAGAGGAGCTCAGGACACTAATA (forward) GCGCGAATTCAATTGGGCCCATCGAACT (reverse) QuikChange site-directed mutagenesis (deletion) of miR-9, miR-24, miR-155 and miR-335 target sites in psiCHECK 3′-UTR WT was performed according to manufacturer's protocols (Stratagene, La Jolla, CA) and designated as psiCHECK-UTR del. [score:1]
[1 to 20 of 28 sentences]
22
[+] score: 116
We identified 11 downregulated and 20 upregulated genes in NFs overexpressing miR-9 compared with NFs/control based on a minimum log2 fold change of 0.7 and P<0.05 (Figure 5a). [score:8]
Since it has been reported that co-culture with CAFs induces in tumor cells downregulation of E-cadherin, [21] known miR-9 direct target, [17] we therefore hypothesized that the increase in tumor cell motility induced by miR-9 internalization could be explained, at least in MDA-MB-468 cell line, by modulation of this molecule. [score:7]
In line with the genetic heterogeneity between breast CAFs and NFs, 20, 24 our expression profile identified in NFs overexpressing miR-9 a signature of differentially expressed genes correlated with cell motility and ECM organization: specifically members of matrix metalloproteinases, fibulins and collagens. [score:7]
We selected 17 genes (8 downregulated and 9 upregulated) related with cell motility pathways and ECM remo deling to be validated by qRT-PCR in NFs/control versus NFs/miR-9 (Figure 5b). [score:7]
Identification of differentially expressed genes in NFs upon miR-9 transfectionTo clarify the molecular alterations triggered by miR-9 to induce the acquisition of breast NFs to a CAF phenotype, gene expression profile of NFs transiently transfected with miR-9 or control was performed. [score:5]
[20] We demonstrated that this stronger cell capability could be caused, at least in MDA-MB-468, by the reduction of the E-cadherin, calcium -dependent cell–cell adhesion glycoprotein that has been demonstrated to be a direct target of miR-9. [17] In MDA-MB-231, where E-cadherin is epigenetically silenced, other molecules are probably regulated by miR-9 in order to obtain the observed biological effect. [score:5]
Then, in order to clarify if the modulation of miR-9 also affects CAF properties, the reverse experiment was performed inhibiting miRNA with LNA-9. The transient transfection of CAFs with the inhibitor reduced their migration and invasion compared with control (Figure 2c). [score:4]
In conclusion, the involvement of miR-9 in reprogramming the microenvironment, activating tumor-promoting abilities in normal fibroblasts, as migration and invasion, in addition to its tumor-intrinsic pro-metastatic role, confers to this miRNA a relevant potential as a therapeutic target in breast cancer. [score:3]
The additional ‘medium change step' did not affect miR-9 expression in recipient NFs, and led to a similar motility improvement in the presence of miR-9 containing exosomes (Supplementary Figures S4D and E). [score:3]
In conclusion, these data confirm that a higher expression of miR-9 in the TME plays an important role in breast cancer progression. [score:3]
To confirm the capability of miR-9 overexpressing NFs to affect cancer progression, we monitored in vivo tumor growth of MDA-MB-468 cells co -injected with NFs/miR-9 or control in the mammary fat pad of SCID mice (6 mice for group). [score:3]
To identify differentially expressed genes between NFs/miR-9 and NFs/control, a moderate t-test was performed using limma package. [score:3]
MiR-9 expression was determined by qRT-PCR in transfected cells (Figure 3a) and in the isolated exosomes (Figure 3b) to verify the transfection efficiency and the levels of the miRNA released, respectively. [score:3]
NFs overexpressing miR-9 promote in vivo tumor growth. [score:3]
Even more interestingly, we demonstrated the existence of a positive circuitry, where ‘converted' fibroblasts are in turn able to promote tumor growth and aggressiveness: our results revealed that conditioned medium derived from NFs overexpressing miR-9 increased the aggressiveness of triple -negative breast cancer MDA-MB-231 and MDA-MB-468 cell lines, consistent with the well-established role of CAFs in promoting cancer cell progression. [score:3]
To clarify the molecular alterations triggered by miR-9 to induce the acquisition of breast NFs to a CAF phenotype, gene expression profile of NFs transiently transfected with miR-9 or control was performed. [score:3]
NFs overexpressing miR-9 stimulate tumor cell migration by reducing E-cadherin. [score:3]
To define a significantly enrichment of Gene Ontology and pathways of the differentially expressed genes in the miR-9 transitory transfection mo del, the DAVID annotation chart tool (https://david. [score:3]
Our data demonstrated that the modulation of gene expression profile and the acquisition of a CAF-like phenotype in recipient fibroblasts can be induced by tumor cells through exosome -mediated delivery of miR-9. This is not surprising, since circulating miRNAs seem to be mainly associated to exosomes, and exchanged between different cell types as a communication tool. [score:3]
Indeed, we detected by western blot analysis the downmodulation of E-cadherin protein in MDA-MB-468 grown in contact with the supernatant from NFs overexpressing miR-9 (Figure 4b). [score:3]
[34] Even though the mechanisms by which NFs are converted into CAFs are still unclear, here we show that the overexpression of miR-9 in normal fibroblasts was sufficient to increase tumor growth in mouse mo dels, corroborating the capability of this miRNA to reprogram NFs into CAFs, thus promoting tumor initiation and progression. [score:3]
Identification of differentially expressed genes in NFs upon miR-9 transfection. [score:3]
NFs overexpressing miR-9 promote in vivo tumor growthSeveral studies revealed that the conversion of NFs into CAFs may occur at the initiation phase of breast cancer, inducing malignant transformation of adjacent mammary epithelial cells. [score:3]
These results were consistent with the modulation observed in gene expression data of NFs transfected with miR-9 compared with control. [score:2]
This first evidence is consistent with the association of miR-9 with aggressive breast cancer phenotype [19] and with our own data (unpublished). [score:1]
Interestingly, we also observed that the miR-9 released by NFs/miR-9 induced recipient NFs themselves to enhance migration and invasion (Figure 4c), thus establishing a positive feedback loop. [score:1]
Immortalized NFs (5.0 × 10 [6] cells/mouse) were transiently transfected with miR-9 precursor or control for 24 h and co -injected with TNBC MDA-MB-468 (5.0 × 10 [6] cells/mouse) in the mammary fat pad of 8-week-old female SCID mice (Charles River, Wilmington, MA, USA). [score:1]
MiR-9 is overexpressed in triple -negative breast CAFs compared with NFs and contributes to acquisition of NFs to a CAF phenotype. [score:1]
Tumor-secreted miR-9 is transferred to NFs via exosomes and increases cell motilityIn order to elucidate if tumor-secreted miR-9 is delivered to the cellular components of the stroma via exosomes, first TNBC MDA-MB-231 cell line was transiently transfected with miR-9 or control, then the conditioned medium, changed 8 h post-transfection, was collected from transfected cells at 48 h and processed for exosomal purification. [score:1]
In order to elucidate if tumor-secreted miR-9 is delivered to the cellular components of the stroma via exosomes, first TNBC MDA-MB-231 cell line was transiently transfected with miR-9 or control, then the conditioned medium, changed 8 h post-transfection, was collected from transfected cells at 48 h and processed for exosomal purification. [score:1]
Tumor-secreted miR-9 is transferred to NFs via exosomes and increases cell motility. [score:1]
To study the functional role of miR-9, we decided to use immortalized NFs and CAFs. [score:1]
No significant difference was detected in miR-9 transfer to recipient NFs (Supplementary Figures S4A–C). [score:1]
Total RNA derived from three independent biological samples of immortalized NFs transiently transfected with control (NFs/control) or miR-9 (NFs/miR-9) was isolated using QIAzolLysis Reagent according to the manufacturer's instruction. [score:1]
These data demonstrate that miR-9 is involved in the acquisition of a CAF phenotype in breast fibroblasts. [score:1]
MiR-9 precursor and negative control were purchased as Pre-miR precursor molecules (Thermo Fisher Scientific). [score:1]
[32] Moreover, tumor-secreted miR-9 has been demonstrated to affect also endothelial cell proliferation, [18] thus suggesting that this miRNA is probably exploited by tumor cells as a sort of ‘signal' to convert the microenvironment into a pro-tumoral niche. [score:1]
[15] In the present work, we show that miR-9 acts as an important player in the communication between breast cancer cells and the cellular component of the TME and it is able to promote the conversion of NFs toward a CAF-like phenotype. [score:1]
For this reason, co-culture experiments of TNBC MDA-MB-231 and MDA-MB-468 cell lines in conditioned medium derived from NFs transiently transfected with miR-9 or control were performed. [score:1]
The migration ability of cancer cells was assessed and, as shown in Figure 4a, miR-9 internalization resulted in stronger motility. [score:1]
Zhao and colleagues did not report miR-9 as deregulated in breast CAF/NF couples obtained from patients; however, we observed a significantly higher level of this miRNA in primary triple -negative CAFs compared with the normal counterpart. [score:1]
NFs overexpressing miR-9 stimulate tumor cell migration by reducing E-cadherinSince we demonstrated that miR-9 is delivered from breast cancer cells to the microenvironment promoting the neoplastic progression, and considering that the tumor–stroma cross-talk is a two-way communication, we also investigated if the miRNA could be released by fibroblasts to tumor cells. [score:1]
[8] Our results show that the exosome-vehicolated- miR-9 released from transfected fibroblasts promoted tumor cell aggressiveness in vitro, modulating genes involved in cell motility and ECM remo deling. [score:1]
Taken together, these results demonstrated that miR-9 can be delivered from microenvironment to neoplastic cells, where it is able to enhance tumor progression. [score:1]
Taken together, these results show that some of the transcriptional alterations identified in NFs after transient transfection with miR-9 are also detected in stroma of breast cancer patients. [score:1]
Locked nucleic acid (LNA) against miR-9 and the corresponding control were purchased from EXIQON (Vedbaek, Denmark). [score:1]
To confirm that the miR-9 internalized by NFs was specifically delivered from MDA-MB-231 cancer cells, we repeated the experiment in exosome-deprived medium. [score:1]
[1 to 20 of 47 sentences]
23
[+] score: 115
In abdominal fat the expression of both mir-9 and mir-124a was found to be more highly expressed in obese males (mir-124a FC: 119.8; p-value = 0.0108, mir-9 FC: 7.8; p-value = 0.07) and both were significantly more highly expressed in the liver of obese males (mir-124a FC: 12.3; p-value = 0.013, mir-9 FC: 1.6; p. value = 0.036) while no difference in expression could be detected in the females. [score:9]
Mir-9 over -expression in β-cells induces exocytosis and thereby insulin release by targeting the transcription factor Onecut, which negatively regulates granuphilin. [score:5]
Both the 3’ and 5’ mature miRNAs of mir-9 were significantly differentially expressed in the sequencing analysis, but only mir-9-5p was tested in qPCR due to low expression of mir-9-3p. [score:5]
In Fig 2 the expression of mir-9 and mir-124a in lean and obese subcutaneous adipose tissue is illustrated in a Column scatter plot as the relative mean of log2 fold change were the lowest expressed sample of each miRNA assay is set to 1. Mir-9 and mir-124a are both significantly up regulated in obese animals with even higher fold changes than found in the sequencing study. [score:5]
Two of the 6 miRNAs found to be differentially expressed in the sequencing study, mir-9 and mir-124a, were significantly differentially expressed between the two groups (Table 6, Fig 2). [score:5]
qPCR validation of these results in general confirms the expression pattern, however, statistical significant differential expression was only observed for two of the six miRNAs, mir-9 and mir-124a (Table 6, Fig 2). [score:5]
A selection of target genes for mir-9 and mir-124 (list in S7 Dataset) were tested by qPCR but none of them were significantly suppressed in the obese group (S8 Dataset). [score:5]
Mir-9 expression has also been linked to the obesity related diseases diabetes and inflammation. [score:4]
The overexpression of mir-9 and mir-124 in the adipose tissue of obese pigs may also contribute to the lipid accumulation in the adipocytes. [score:3]
Among these the expression profiles of mir-124a-3p and mir-9-3p overlapped with the results for the analysis of the combined dataset. [score:3]
Student’s t-test of mir-9 and mir-124a qPCR Expression in Liver and Abdominal Adipose Tissue. [score:3]
Mir-9 and mir-124a were both significantly differentially expressed in the liver of obese males, while there was no significant difference in the females. [score:3]
In abdominal adipose tissue both mir-9 and mir-124a was expressed at a higher level in the obese male pigs, (p-value = 0.07 and 0.01 respectively). [score:3]
Differential expression in the sequencing data from the lean and obese pigs was calculated using the DESeq2 package in R and revealed six significantly differentially expressed miRNAs between the two groups: mir-9-5p, mir-124a-3p, mir-9-3p, mir-199a-5p, mir-489-3p and mir-34c-3p. [score:3]
Expression of mir-9 and mir-124a in Abdominal Adipose Tissue and Liver. [score:3]
When the qPCR results were analyzed for male pigs only, mir-99a was differentially expressed in addition to mir-124a and mir-9 (Table 6). [score:3]
Both mature arms of mir-9 were significantly differentially expressed in the sequencing data, but only the mir-9-5p was tested in qPCR. [score:3]
qPCR expression of mir-9 and mir-124a in Abdominal Adipose Tissue (Abd AT) (A,B) and Liver (C,D). [score:3]
0131650.g002 Fig 2 qPCR expression of mir-9 (A) and mir-124a (B) in Subcutaneous Adipose Tissue (SC AT). [score:3]
Additionally, only mir-124 is significantly up regulated in abdominal adipose tissue of male obese pigs and both mir-9 and mir-124a are up regulated in the liver of obese male pigs. [score:3]
0131650.g003 Fig 3 qPCR expression of mir-9 and mir-124a in Abdominal Adipose Tissue (Abd AT) (A,B) and Liver (C,D). [score:3]
Fold changes and p-values for qPCR in subcutaneous adipose tissue can be found in Table 6. To further study the expression of mir-9 and mir-124a, the two miRNAs with the largest fold changes between the lean and obese group in the subcutaneous adipose tissue, qPCR was also performed on cDNA from abdominal adipose tissue, liver and muscle from the same animals as in the study of subcutaneous adipose tissue. [score:3]
Expression of mir-9 and mir-124a in Subcutaneous Adipose Tissue. [score:3]
Inactivated lipid carrying HSCs have higher mir-9 and mir-124 expression than activated HSCs that carry no lipids [63]. [score:3]
MiRTarbase Verified mir-9 and mir-124 Target Genes. [score:3]
qPCR expression of mir-9 (A) and mir-124a (B) in Subcutaneous Adipose Tissue (SC AT). [score:3]
In the female pigs mir-9, mir-124a, mir-103, mir-10b and mir-99a were differentially expressed (Table 6). [score:3]
The data is presented as column scatter plots in Fig 3. Mir-9 and mir-124a were expressed in all three tissues. [score:3]
Analysis of mir-9 and mir-124a target genes has not previously been performed in adipose tissue. [score:3]
QPCR studies confirm some of these differences, in particular for mir-9 and mir-124a which are significantly differentially expressed with large fold changes. [score:3]
Mir-9 expression is also induced in monocytes and neutrophils upon activation of the immune receptors TLR4, TLR2 and TLR7/8 and by the pro-inflammatory cytokines TNF-a and IL-1B. [score:2]
Mir-9 and mir-124a are significantly up regulated in subcutaneous adipose tissue of obese pigs, independently of gender. [score:2]
An example is that mir-9 and mir-124 are slightly up regulated in the blood of diabetic patients compared to non-diabetic controls [52]. [score:1]
This is, to our knowledge, the first study of subcutaneous adipose tissue of lean versus obese subjects where mir-9 and mir-124a have been shown to be significantly up regulated in the obese subjects with large fold changes compared to the lean subjects. [score:1]
[1 to 20 of 34 sentences]
24
[+] score: 112
In this study, majority of the differentially expressive miRNAs have not been reported in other tumors, especially miR-433 and miR-9. Both of them were down-regulated significantly in gastric carcinoma tissue and SGC7901 cell line, suggesting they might be the special markers for gastric carcinoma. [score:6]
In this study, we found the expressive levels of miR-433 and miR-9 was significantly down-regulated in gastric cancer tissues and SGC7901. [score:6]
To confirm whether the predicted targets of miR-9 and miR-433 were responsible for their regulation, the presumed target sites were cloned and inserted at the downstream of the luciferase gene of pGL3. [score:6]
To explain the potential roles of miR-9 and miR-433 in carcinogenesis, we predicted the targets of miR-9 and miR-433 via the algorithms: TargetScan, PicTar, and miRanda. [score:5]
B, miR-9 was down-regulated 75% in carcinoma tissues compared with normal gastric tissues and down-regulated 76.2% (P < 0.05) in SGC7901 compared with GES-1 cell lines. [score:5]
In addition, we also found miR-433 and miR-9 targeted GRB2 and RAB34, which was favorable for explaining carcinogenesis pathway mediated by miRNAs and screening the therapeutic targets. [score:5]
Meanwhile, we also found that miR-433 and miR-9 regulated the expression levels of GRB2 and RAB34 respectively. [score:4]
Figure 5 miR-9 and miR-433 down regulated RAB34 and GRB2 expression in SGC7901 cell line. [score:4]
The down-regulation of miR-433 and miR-9 attenuated the gene silencing, which activated GRB2 and RAB34. [score:4]
Our data show miR-9 and miR-433 was down-regulated in gastric carcinoma. [score:4]
MiR-9 and miR-433 were found down-regulated significantly in gastric carcinoma samples, suggesting they might play important roles in the cancerigenic process. [score:4]
Our results showed miR-433 and miR-9 was significantly down-regulated and might be used as a marker for the advanced gastric carcinoma. [score:4]
Figure 2 Cloning of miR-9 target gene. [score:3]
GRB2 and RAB34, targets of miR-433 and miR-9 respectively, were detected by Western blot. [score:3]
Then, the expressions of miR-9 and miR-433 in gastric carcinoma tissue and SGC7901 cell line were validated by qRT-PCR. [score:3]
Figure 1 MiR-433 and miR-9 expression in normal gastric tissues, 24 malignant tissues, SGC7901 and GES-1 cell lines. [score:3]
In this way, we found that RAB34 and GRB2 were the predicted targets of miR-9 and miR-433 respectively. [score:3]
Identification of miR-9 and miR-433 targets. [score:3]
Detection of miR-433 and miR-9 expression by Quantitative Real-time PCR. [score:3]
Compared with normal gaster samples, our data showed that miR-9 and miR-433 were down-regulated in gastric carcinoma. [score:3]
Furthermore, our data suggested significantly down-regulated miR-433 and miR-9, which were considered as the modulator of GRB2 and RAB34 respectively. [score:3]
qRT-PCR was used to detect the expressive level of miR-433 and miR-9 in 3 normal gastric tissues, 24 malignant tissues, SGC7901 and GES-1 cell lines. [score:3]
The targets of miR-433 and miR-9 were tumor -associated proteins GRB2 and RAB34 respectively. [score:3]
Amplification primers of Plasmid containing miR-9 target (about 430 bp products): forward (5'-TGGACGAAGTACCGAAAGGT-3') and reverse (5'-GGCACAGTGAGAGGCTGGAATCATTAAGCATCCTCAAAC); The Amplification primers of Plasmid containing miR-433 target (about 580 bp products): forward (5'-TGGGAGTCTCCCTCCGACTCCAGATATGAA-3') and reverse (5'-CACTGCATTCTAGTTGTGGT-3'). [score:3]
MiR-9 was down-regulated 75% in carcinoma tissues compared with normal gastric tissues. [score:2]
Meanwhile, we confirmed that RAB34, GRB2 were down regulated by miR-9 and miR-433 respectively, which revealed the potential mechanism for gastric carcinoma genesis. [score:2]
A, miR-9 regulated luciferase activity by integrating the binding site in the 3'-UTR of RAB34. [score:2]
MiR-9 was down-regulated 76.2% (P < 0.05) in SGC7901 compared with GES-1 cell lines (Figure 1B). [score:2]
Figure 4 miR-9 and miR-433 down regulated luciferase activity of RAB34 and GRB2. [score:2]
Respectively, ①SGC7901 (blank control), ②pGL3, ③pGL3-miR-9, ④hsa-miR-9 (Takara Co. [score:1]
The sequenced plasmids were named pGL3-miR-9 and pGL3-miR-433 and used for SGC7901 cell transfection. [score:1]
To examine the luciferase activity, 4 groups were set up for miR-9 and miR433. [score:1]
MiR-9 and miR-433 level were mesured by qRT-PCR respectively. [score:1]
A, miR-9 level increased 1.3-fold and 2.8-fold respectively after 50 pmol (group 1) and 100 pmol (group 2) hsa-miR-9 transfection. [score:1]
For both miR-9 and miR-433, there were three groups including ①control group; ②group 1: 50 pmol of miR-9 or miR-433 was transfected; ③group 2: 100 pmol of miR-9 or miR-433 was transfected. [score:1]
Danian, China)+ pGL3-miR-9 for miR-9 and ①SGC7901 (blank control), ②pGL3, ③pGL3-miR-433, ④hsa-miR-433 (Takara Co. [score:1]
The expression level of RAB34 and GRB2 were measured after miR-9 or miR-433 were transfected into SGC7901. [score:1]
Figure 6 MiR-9 and miR-433 increased after hsa-miR-9 and hsa-miR-433 transfection. [score:1]
[1 to 20 of 38 sentences]
25
[+] score: 109
Other miRNAs from this paper: hsa-mir-9-1, hsa-mir-9-2
Based on two studies miR-9 is down-regulated in gastric carcinoma and has tumor suppressor activity by NF-κB1 expression regulation [18- 19], but recently it has been reported that miR-9 is up-regulated in gastric cancer tissues and down-regulated CDX2 expression but methylation status of these three miR-9 regions did not correspond to the expression levels of precursor miR-9 or maturemiR-9 [34]. [score:19]
It has been reported that miR-9 is downregulated in gastric carcinoma and it has tumor suppressor activity by NF-κB1 expression regulation [10, 19], we reasoned that hypermethylation of CpG islands located in the promoter of one or more miR-9 genomic loci in cancerous tissue might be responsible. [score:9]
Wan et al showed miR-9 is down-regulated in gastric adenocarcinoma and inhibits the growth of human gastric adenocarcinoma cell line MGC803 through NF-κB1 gene regulation [20]. [score:7]
Deregulation of miR-9 genes expression are involved in pathogenesis of some important human diseases such as cancer in colorectal, gastric, breast, non-small cell lung and even cardiac hypertrophy [20- 23]. [score:6]
Taken together, it seems that the exact function and regulatory mechanisms of miR-9 expressions remain to be elucidated in gastric cancer and further studies on miR-9 expression and methylation of their promoters in normal gastric and other cancer are needed. [score:6]
The up-regulation of miR-9 expression level in breast cancer cells lead to increase cell motility, invasiveness and tumor angiogenesis through activation of β-catenin signaling pathway. [score:6]
MiR-9 acts as a putative tumor suppressor gene on recurrent ovarian cancer and inhibits ovarian cancer cells growth through NF-κB1 regulation [28, 29]. [score:5]
The overexpression of miR-9 in non- metastatic breast tumor cells causes these cells to make pulmonary micrometastasis in mice and its inhibition in highly malignant cells prohibit metastasis formation. [score:5]
In early breast cancer and colorectal cancer miR-9 was transcriptionally down-regulated in a methylation dependent way [16, 18]. [score:4]
Luo et al reported miR-9 down-regulation in gastric carcinoma [19]. [score:4]
In early breast cancer and colorectal cancer miR-9 was transcriptionally downregulated in a methylation dependent way [17- 18]. [score:4]
miR-9 is overexpressed in several cancer forms, such as brain tumors, hepatocellular carcinomas and Hodgkin lymphoma (HL). [score:3]
Butour data revealed that methylation status of miR-9 family CpG islands are not different between tumor and non-tumor tissues of gastric, and cannot account for alteration of miR-9 expression in this type of gastric cancer [34]. [score:3]
Therefore the exact function of miR-9 as a tumor suppressor, oncogene or both of them, remains to be elucidated in gastric cancer. [score:3]
To figure out the cause of reduction reduction in miR-9 expression of human gastric cancer, we examined the methylation status of the CpG islands of miR-9 loci in human gastric primary tumors with normal margin gastric tissue and AGS cell line. [score:3]
MiR-9 expression level increases during embryonic stem (ES) cell differentiation to neural precursors [27]. [score:2]
The observed heterozygous methylation status of miR9-3may be an allele-specific methylation (ASM) phenomenon. [score:1]
Aberrant hypermethylation of miR-9 family genes (miR-9-1, miR-9-2 and miR-9-3) was reported in some primary tumors with lymph node metastasis such as colon, lung and breast cancers, and melanoma [15]. [score:1]
The miR-9-2 promoter was unmethylated in both normal samples and tumors (Fig. 1B); but miR-9-3 showed methylation of one allele and unmethylation of the other one in all of specimens (Fig. 1C). [score:1]
For analysis of CpG island methylation status of mir-9 family, EpiTect Control DNA (human), universal methylated DNA (Chamicon International, Inc), and normal lymphocytes DNA were used as controls for discriminating of methylated and unmethylated alleles, respectively. [score:1]
Gastric cancer Epigenetic DNA methylation miR-9 MS-PCR Gastric cancer is the forth-commonest malignancy in the world. [score:1]
miR9-3 CpG island showed methylation in one allele and unmethylation status in the other one in all of patient samples and AGS cell line too. [score:1]
On the contrary, recently it is reported that miR-9 levels were significantly up regulated in primary breast tumors from patients with metastases compared to those from metastasis-absent patients. [score:1]
Since ASM usually is due to cis-effects of existed genetic polymorphisms it is possible that a CpG SNP variation may be near to the miR-9-3 CpG island locus. [score:1]
M and U are indicating methylated and unmethylated status of loci in promoter regions of mir-9 family, respectively. [score:1]
Summary of miR-9- 1, miR-9-2 and miR-9-3 promoter analyses result by MSP in primary gastric adenocarcinoma and normal samples are presented in Table 1. Figure 1Methylation-specific PCR analyses of promoters in miR-9 loci family in tumors (T) and their normal (N) tissues. [score:1]
In human, Hsa- miR-9 is transcribed from three genomic loci including 1q22 (miR-9-1), 5q14.3 (miR-9-2) and 15q26.1 (miR-9-3). [score:1]
However, miR-9-1showed methylation of at least one allele in73.3% of normal samples and 76.6% in tumor samples, respectively (Fig. 1A). [score:1]
In the other hand Tsai et al reported that DNA methylation tightly repressed miR-9 through the simultaneous methylation of the CpG- rich regions of these three independent genes [35]. [score:1]
In some of cancers the promoter hyper-methylation of miR-9 had correlation with metastasis formation [15, 24]. [score:1]
However one of the alleles of miR9-3 may be specifically methylated in gastric tissue. [score:1]
Figure 2 Methylation-specific PCR analyses of miR-9 in AGS cell line. [score:1]
Part (A) represent the MSP analyses of miR-9-1, part (B) MSP analyses of miR-9-2 and part (C) MSP analyses of miR-9-3 loci, respectively. [score:1]
However miR-9-3 locus was methylated in one allele and unmethylated in the other one in AGS cell line (Fig. 2). [score:1]
The methylation status of the CpG islands of miR-9 loci by MSP in samples of gastric cancer patients were analyzed in comparison to their normal margins. [score:1]
miR-9 is one of the conserved microRNAs among different organisms found in insects to mammals. [score:1]
[1 to 20 of 36 sentences]
26
[+] score: 87
Among miRNA-correlated genes involved in apoptosis, we identified PDCD4 (proapoptotic, 1.4-fold upregulated) and found out that it is correlated with seven miRNAs, including miR-155-5p and miR-150-3p; BNIP3L (proapoptotic, 1.5-fold downregulated) also correlated with seven miRNAs, including miR-155-5p and miR-9-3p; APAF1 (proapoptotic, 1.3-fold downregulated) correlated with four miRNAs including miR-155-5p and miR-9-3p; and PTEN (proapoptotic) correlated with seven miRNAs including miR-155-5p. [score:10]
Among genes involved in cell proliferation, the transcription factor NKX3-1 (2.4-fold upregulated), which mediates non-cell autonomous regulation of gene expression and inhibits cell proliferation, is correlated with miR-9-3p, miR-155-5p, miR-378a-3p, and miR-378-5p (Figure 5). [score:9]
The most dysregulated miRNAs identified in the present work are the upregulated miR-9-5p, miR-9-3p, and miR-155-5p, and the downregulated ones are miR-150-3p and miR-378a-3p. [score:8]
miR-9-5p and miR-155-5p, together with IFNG, IL17F, and BCL6 transcripts, were upregulated in MMG, whereas miR-378a and miR-150-3p together with HLA-DRB1 and TLR4 transcripts were downregulated in MMG. [score:7]
By using Cytoscape [60], we visualized the functional interactions between miRNAs whose expression levels changed the most in PBLs incubated in MMG, such as miR-9-5p, miR-9-3p, miR-155-5p, miR-150-3p, and miR-378a-3p, and correlated target genes involved in GO categories of immune/inflammatory response, regulation of programmed cell death, and regulation of cell proliferation (Figure 5). [score:7]
The microarray data from miRNA and gene expression profiling were validated by real-time qPCR experiments for four miRNAs (miR-9-5p, miR-155-5p, miR-378a, and miR-150-3p) and five mRNAs (IFNG, IL17F, BCL6, HLA-DRB1, and TLR4) whose expression level was significantly altered by MMG incubation (Figure 6). [score:5]
Moreover, Gao et al. [90] have shown that miR-9 disturbs the display of antigens at the cell surface by suppressing the expression of MHC class I gene transcription. [score:5]
GADD45A (1.5-fold upregulated), regulating cell cycle arrest, DNA repair, cell survival, senescence, and apoptosis, is also correlated with miR-9-3p. [score:5]
Our results show that miR-155-5p correlates with IFNG, IL17F, BCL6, and RELA involved in immune/inflammatory response, with PTEN, BNIP3L, APAF1, and PDCD4 involved in regulation of programmed cell death, and with NKX3-1 involved in regulation of cell proliferation; miR-150-3p correlates with immune-related genes (IFNG, IL1A, and HLA-DRB1) and with proapoptotic gene PDCD4; miR-9-3p correlates with genes regulating cell proliferation (NKX3-1, GADD45A, and TP53BP1), apoptosis (APAF1, BNIP3L), and immunity (CCL7, CXCL5, and BCL6). [score:4]
miR-9-5p, miR-9-3p, and miR-155-5p were the most upregulated (4.6-, 3.5-, and 2.4-fold, resp. [score:4]
TP53BP1 (1.4-fold upregulated), encoding for a chromatin -associated factor involved in cell cycle checkpoint and growth, is correlated with miR-9-3p. [score:4]
Moreover, miRNAs mostly dysregulated in MMG, such as miR-9, miR-155, and miR-150, are oncogenic, suggesting that their abnormal expression can influence the carcinogenic process. [score:4]
Its overexpression in MMG, mediated by miR-9-3p and miR-155-5p, could thus mediate the antiproliferative effect and the apoptosis induction. [score:3]
Recent evidences show that miR-9 is highly involved in immunity and inflammatory diseases [90– 92] by enhancing IFN- γ production in activated human CD4(+) T-cells [91]. [score:3]
Such miRNAs have been found altered in human tumors; in particular, miR-9 is an oncogenic miRNA overexpressed in mixed lineage leukemia- (MLL-) rearranged acute myeloid leukemia [62], in muscle-invasive bladder cancer [63], and in osteosarcoma cell lines [64]. [score:3]
” Notably, the most dysregulated miRNAs detected in the present study, miR-378a-3p, miR-150-3p, miR-155-5p, miR-9-3p, and miR-9-5p, are significantly correlated with immune-related genes. [score:2]
Among genes enriched within the three functional categories, miR-9-5p correlates with BCL6. [score:1]
Besides miR-155-5p, BCL6 is correlated with four miRNAs including miR-9 (3p and 5p); in addition, miR-9-3p is positively correlated with CCL7 and CXCL5 (Figure 5). [score:1]
The following miRNAs were subjected to the RT-qPCR validation: miR-9-5p, miR-378a, miR-155-5p, and miR-150-3p. [score:1]
In addition, the correlation between miR-9-3p and TP53BP1 could explain the clonogenicity decrease and apoptosis increase in PBLs incubated in MMG. [score:1]
[1 to 20 of 20 sentences]
27
[+] score: 81
Figure 4B and C analyses two genes CDH1, which is a known target of miR-9 (27) but is not a predicted target of isomiR-9 and DNMT3B, which is a predicted target of isomiR-9 but not of mir-9 (Table 2). [score:7]
By contrast, Figure 5C shows that the isomiR-9 but not the miR-9 sponge can relieve the inhibition of the DNMT3B luciferase expression vector by isomiR-9. Similarly, we identified NCAM2 as a target of isomiR-9 but not miR-9 and also showed that repression by isomiR-9 could be rescued by an isomiR-9 sponge (Supplementary Figure S2). [score:7]
We chose these two genes because they are expressed in hESCs and are downregulated upon differentiation, which also corresponds with the appearance of miR-9 and isomiR-9 (Figure 1B and D). [score:6]
We chose these miRNAs because they are among the most abundant miRNAs expressed in hESCs (miR-302 and 367) or NSCs (miR-9–1) and because their isomiRs are co-expressed at levels that are comparable to most of the canonical miRNAs in our libraries (Supplementary Table S2). [score:5]
The first two column pairs of Figure 5B doubly repeat the observation that 12 nM miR-9 can inhibit the expression of luciferase mRNA when it is fused to the 3′UTR of CDH1. [score:5]
In order to strengthen these results, we constructed two expression vectors that contain six repeated binding sites for either miR-9 or isomiR-9. These binding sites have the same sequence as the target sites within the 3′UTRs of CDH1 or DNMT3B (Figure 5A, Supplementary Table S4). [score:5]
For example, isomiR-9 has 398 novel predicted targets compared to miR-9 (Figure 2) and of these 18 are not predicted targets of any other human miRNA. [score:4]
In order to further test whether isomiRs are functional, we constructed luciferase reporter vectors with the 3′UTR mRNA of potential targets of miR-9, miR-302a, miR367 and their corresponding isomiRs (Supplementary Table S4). [score:3]
The next two column pairs show that inhibition by 12 nM miR-9 can be relieved by sufficient amounts of a miR-9 sponge (100 ng) but not by an isomiR-9 sponge (Figure 5B). [score:3]
Figure 5. Sponge inhibitors of miR-9 and isomiR-9. (A) Outline of sponge constructs pcDNA-miR-9 amd pcDNA-isomiR-9 (see Materials and Methods). [score:3]
Our titrations indicate that isomiR-9 is an equally good inhibitor of DNMT3B as miR-9 is of CDH1. [score:3]
Target sites of miR-9 within the 3′UTR of CDH1 and of isomiR-9 within the 3′ UTR of DMN3TB DNA were used to make sponges. [score:3]
5′ and 3′ isomiRs are functional in vitroIn order to further test whether isomiRs are functional, we constructed luciferase reporter vectors with the 3′UTR mRNA of potential targets of miR-9, miR-302a, miR367 and their corresponding isomiRs (Supplementary Table S4). [score:3]
We were able to use these differences in targeting to construct sponges that were specific for miR-9 or its 5′isomiR. [score:3]
By contrast, a similar titration experiment shows that the 3′UTR of DNMT3B was a target of isomiR-9 but not miR-9 (Figure 4C). [score:3]
DNA fragments consisting of 6 target site repeats of miR-9 or isomiR-9 were synthesized by Eurogentec and were separately ligated into pcDNA3.1(+) under the control of the cytomegalovirus promoter (see Supplementary Table S4 for sequence details). [score:3]
In addition, the 3′UTRs of BTG1 and HMGA2 were confirmed as predicted targets of both miRNAs and 5′isomiRs of miR-302a and miR-9, respectively. [score:3]
As a control we mutated two small regions within the 3′UTRs of CDH1 and DNMT3B that are the predicted binding sites for the seed regions of miR-9 and isomiR-9, respectively, this markedly reduced luciferase inhibition in both cases (Figure 4B and C, middle and bottom panels). [score:3]
Luciferase assays confirmed that the 3′UTR of CDH1 is a target of miR-9, but our titration clearly shows that isomiR-9 was not able to repress luciferase activity as efficiently (Figure 4B). [score:2]
Ma L. Young J. Prabhala H. Pan E. Mestdagh P. Muth D. Teruya-Feldstein J. Reinhardt F. Onder T. T. Valastyan S. miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasisNat. [score:2]
Membranes were washed twice at room temperature with 2 × SSC and 0.1% SDS for 5 min and exposed on x-ray film with an intensifying screen at −80°C for a minimum of 48 h. Digoxigenin labelled locked nucleic acid probe (Exiqon) specific to miR-9, miR-302a and let-7d were used in some of the hybridization experiments. [score:1]
Bottom panel: illustration of the sequences and expected alignments of miR-9 and 5′isomiR-9 against the 3′UTRs of CDH1 and DNMT3B. [score:1]
Figure 1E illustrates that the ratios of the isomiR bands for miR-9 and miR-302a that we detected by northern blotting correspond well with the sequencing results. [score:1]
HEK293 cells were transfected with the indicated concentrations of each sponge vector with either (B) pGL3-CDH1–3′UTR (400 ng) and miR-9 (12 nM) or (C) pGL3-DNMT3B-3′UTR (400 ng) and isomiR-9 (12 nM). [score:1]
n = 3. Note for top panels B and C the statistical difference is between single columns for miR-9 and isomiR-9, whereas for A the statistical difference is between the treatments and the control column pairs. [score:1]
[1 to 20 of 25 sentences]
28
[+] score: 70
The expression of let-7a, miR-9, and miR-129-5p in the human fetal cerebellum is consistent with their roles in regulating FOXP2 expression during early cerebellum development in humans. [score:7]
Our results, together with recent reports that miR-9, miR-132, and miR-140-5p regulate Foxp2/ FoxP2 expression (Foxp2 and FoxP2 denote respective rodent and avian genes) in animal mo dels [21, 22], highlight the importance of the FOXP2 3′ UTR sequence and the roles for miRNAs in regulating FOXP2 expression. [score:7]
The expression of let-7a, miR-9, and miR-129-5p in the human fetal cerebellum is consistent with their roles in regulating FOXP2 expression during early cerebellum development. [score:7]
We selected 12 miRNAs: miR-9, miR-19b, miR-27b, miR-92a, miR-140-5p, miR-190, miR-200a, let-7a, miR-129-5p, miR-582-5p, miR-892a, and miR-1237 (Figure  1) and tested whether they downregulate FOXP2 expression in cell culture systems. [score:6]
Focusing on let-7a, miR-9, and miR-129-5p, three brain-enriched miRNAs, we show that these miRNAs regulate human FOXP2 expression in a dosage -dependent manner and target specific sequences in the FOXP2 3′ UTR. [score:6]
The dose -dependent downregulation was significant for each miRNA (p < 0.0018 for let-7a and miR-9; p < 0.0006 for miR-129-5p, Jonckheere-Terpstra test). [score:4]
Figure 3 The downregulatory effects of let-7a, miR-9, and miR-129-5p are mediated via specific sequences in the human FOXP2 3′ UTR. [score:4]
Of these miRNAs, let-7a, miR-9, and miR-129-5p were among the most effective regulators, reducing FOXP2 protein by 70-90%; they are also known to be abundantly expressed in vertebrate brains [17, 18]. [score:4]
Using quantitative real time PCR (qRT-PCR), we also found that FOXP2 mRNA level was downregulated by let-7a, miR-9, and miR-129-5p in similar transfection experiments (Figure  2D). [score:4]
let-7a, miR-9, and miR-129-5p target specific sequences in the human FOXP2 3′ UTR. [score:3]
We found that all these three miRNAs, let-7a, miR-9, and miR-129-5p, were expressed in the cerebellum of the human fetal brain (Figure  4). [score:3]
We examined the expression of let-7a, miR-9, and miR-129-5p in human fetal brain tissue by in situ hybridization using Locked Nucleic Acid (LNA) modified miRNA detection probes. [score:3]
Figure 4 Expression of let-7a, miR-9, and miR-129-5p in the cerebellum of the human fetal brain. [score:3]
Let-7a, miR-9, and miR-129-5p are expressed in the cerebellum of the human fetal brain. [score:3]
We focused on let-7a, miR-9, and miR-129-5p and further tested whether their regulatory effects were sequence-specific. [score:2]
We found that miR-9, miR-19b, miR-140-5p, miR-200a, let-7a, miR-129-5p, miR-582-5p, and miR-892a reduced FOXP2 protein levels significantly (Figure  2A). [score:1]
LNA modified miRNA detection probes were purchased from Exiqon: let-7a probe (18000–01); miR-9 probe (88078–05); a customer designed mutant miR-9 probe (miR-9m: 5′-TCATA GAGCTA CATAACCA TA CA-3′, underlined are mutated nucleotides); miR-129-5p probe (38482–15); negative control probe (99004–01). [score:1]
At 2 nM, comparing to the control, let-7a and miR-9 each decreased FOXP2 protein levels by about 50%, while miR-129-5p decreased FOXP2 protein by less than 10% (p < 0.01 for all). [score:1]
At 20 nM, let-7a and miR-9 decreased FOXP2 protein levels by 90%, and miR-129-5p decreased FOXP2 protein by 70% (p < 0.001 for all, Figure  2B and C). [score:1]
[1 to 20 of 19 sentences]
29
[+] score: 69
Other miRNAs from this paper: hsa-mir-9-1, hsa-mir-9-2, hsa-mir-375, hsa-mir-758
When dichotomized using the median expression level in cases without recurrence, Kaplan-Meier analysis revealed that patients with low expression levels of miR-9 had better 10-year LR-free survival than those with high levels. [score:5]
When only ER positive cases were analyzed, the 10-year LR-free survival between patients with low and high miR-9 levels showed substantial and statistically significant differences, with 67.9% 10-year LR-free survival rate in patients with low miR-9 expression compared to 30.8% 10-year LR-free survival rate in patients with high miR-9 expression (p = 0.02, Figure 2B). [score:4]
Methylation and down-regulation of miR-9 was frequently observed in colorectal cancer cell lines and primary CRC tumors and associated with lymph node metastasis [33]. [score:4]
Solid lines represent LR-free survival curves of breast cancer patients who had miR-9 low expression tumors in validation sample set, all cases (panel A) and ER positive cases (panel B). [score:3]
The previous findings are consistent with our observations that miR-9 expression is higher in breast cancer patients with LR. [score:3]
miR-9 was the only miR candidate that showed significantly different expression levels between cases with and without LR (Table 2). [score:3]
In summary, this study revealed that high expression of miR-9 was significantly associated with an increased risk of breast cancer LR in patients who were diagnosed with ER positive cancer. [score:3]
Thus, in general miR-9 is associated with cancer progression while miR-375 is thought to be a cancer suppressor. [score:3]
Under physiologic conditions, miR-9 has been described as having a role in the development of the nervous system [28] and hepatocytes [29], and in the negative regulation of the acute responses of innate immunity [30]. [score:3]
The higher expression of miR-9 in cancer cells may indicate a more aggressive tumor, also suggested by the association with higher stage in our study. [score:3]
In cell line studies, miR-9 has been observed to target junction protein E-cadherin, facilitating metastases and stimulating angiogenesis in breast cancer and HCC cells [31], [32]. [score:3]
Association of miR-9 expression levels with breast cancer LR. [score:3]
miR-9 expression level was significantly associated with ER status (p<0.001) and clinical stage (p = 0.03, Table 3). [score:3]
Association of miR-9 and miR-375 expression levels with tumor estrogen receptor (ER) status. [score:3]
0039011.g002 Figure 2 Solid lines represent LR-free survival curves of breast cancer patients who had miR-9 low expression tumors in validation sample set, all cases (panel A) and ER positive cases (panel B). [score:3]
The expression of miR-9 was significantly higher in tumors from patients with LR compared to tumors from patients without LR (average fold change  = 1.26, p = 0.0495, table 2). [score:2]
The median delta Ct values of miR-9 were 10.24 (range: 3.38 to 15.02) in cases without LR and 9.60 (range: 4.45 to 11.29, p = 0.02) in cases with LR (Figure 1A). [score:1]
Association of miR-9 and miR-375 with Tumor ER Status. [score:1]
These promising data warrant further investigation to verify if the expression level of miR-9 in breast cancer cells can be a useful biomarker, in combination with other known risk factors, to identify patients at high risk of breast cancer local recurrence. [score:1]
We also found that miR-9 and miR-375 were strongly associated with ER status of breast tumors. [score:1]
Association of miR-9 with Breast Cancer LR. [score:1]
No statistically significant associations between miR-9 and age at diagnosis, tumor size and histological type, year and type of surgery, and systemic therapy were found (Table 3). [score:1]
In ER positive cases, the median delta Ct values of miR-9 were 11.11 (range: 3.38 to 15.02) in cases without LR, and 10.04 (range: 5.96 to 11.29) in cases with LR (p = 0.02, Figure 1C). [score:1]
Regarding the potential of miR-9 to discriminate cases with and without LR, the AUC of ROC curve of miR-9 was computed to be 0.68 (p = 0.02), validating its value in predicting LR (Figure 1B). [score:1]
Although this is the first report associating these miRs with estrogen receptor and LR in breast cancer, miR-9 and miR-375 have been shown to play important roles in many biological processes including carcinogenesis at different biological sites. [score:1]
ROC curves are drawn to show the capability of miR-9 to discriminate LR in all tumors (panel B), ER positive tumors (panel D) and ER negative tumors (panel F). [score:1]
Kaplan-Meier survival curves for miR-9.. [score:1]
In addition, miR-9 is involved in the carcinogenesis of biliary tract carcinoma [34], glioblastoma [35], colorectal cancer [36], Burkitt lymphoma [37], clear cell renal cell carcinoma [38] and gastric cancers [39]. [score:1]
The mean delta Ct values of miR-9 were 7.83 (range: 4.45 to 10.52) in ER negative samples and 10.44 (range: 3.38 to 15.02) in ER positive samples (Figure 3A). [score:1]
The capabilities of miR-9 and miR-375 to discriminate ER status are shown in ROC curves (panel C and D, respectively). [score:1]
Consistent with these results, miR-9 and −375 showed significant capability of predicting ER status of patients, with AUCs of 0.78 and 0.81, respectively (p<0.001, Figure 3C, D). [score:1]
We report herein the discovery of two micro RNAs in breast tumor tissue, miR-9 and miR-375, which were associated with estrogen receptor status, one of them (miR-9) was significantly associated with local recurrence in ER positive tumors. [score:1]
There has been no report on any possible link between miR-9 and ER status. [score:1]
In ER negative cases, the mean delta Ct values of miR-9 were 7.67 (range: 5.98 to 10.52) in cases without LR, and 8.00 (range: 4.45 to 10.27) in cases with LR (p = 0.93, Figure 1E). [score:1]
[1 to 20 of 34 sentences]
30
[+] score: 64
Additionally, miR-9 overexpression causes a strong reduction in the MHB and cerebellum, as well as blurred somatic boundaries and altered cell fates, through downregulation of fgfr1 in the Fgf signaling pathway (91). [score:6]
Many conserved miRNAs are expressed at the same developmental timepoints as other vertebrates, for example, miR-9 and let-7 are expressed in both proliferating and differentiating cells (88). [score:6]
miR-9 inhibits proliferation at the MHB and hindbrain ventricular zone through targeting of proproliferation genes her5, her6/ Hes1, and zic5 and then later also influences neuronal maturation by regulating elav3/ HuC (91– 93). [score:6]
Ectopic expression of Foxp2 in the developing cortex was counteracted by increased endogenous expression of miR-9 and miR-132 (127). [score:5]
When Yoo and colleagues (121) added miR-9 and miR-124 precursors to cultured neonatal foreskin fibroblasts, they were able to directly convert them to neurons expressing the mature marker MAP2, albeit at a conversion rate of <5%. [score:4]
Interestingly, increased apoptosis was also observed, and this was correlated with reduced expression of miR-9 and miR-124 (107), two miRNA families that have been wi dely implicated in brain development. [score:4]
For example, overexpression of the highly conserved miR-9 promotes proliferation of neural progenitor cells in human embryonic stem cells (115). [score:3]
Confirming its proproliferative role, loss of miR-9 suppresses neural stem cell proliferation, through stathmin (115). [score:3]
The highly conserved miR-9 is also required for neurogenesis along the anterior–posterior axis by targeting the transcription factor, hairy1, although its function varies from the hindbrain to the forebrain. [score:3]
The miR-9 family is one of the most highly conserved and abundantly expressed miRNA families in the vertebrate brain and is also involved in balancing neural progenitor proliferation and controlling progenitor state (93). [score:3]
Therefore, the above-mentioned in vivo studies suggest that miR-9 and miR-124 are major players in the regulation of cerebral cortex development, but in vitro studies have shown that miR-9 and miR-124 can drive the neurogenic program. [score:3]
In zebrafish hindbrain development, miR-107 stabilizes dicer levels, which maintains a specific level of miR-9 biogenesis to regulate optimal proliferation of neural progenitors (90). [score:3]
In the forebrain, regulation of hairy1 by miR-9 influences proliferation of neural progenitor cells through Fgf8 signaling, but via Wnt signaling in the hindbrain (83). [score:2]
miR-9 regulates early progenitor proliferation in the mammalian brain through the transcription factors Hes1 (113), Foxg1, Elav2, Pax-6, as well as Gsh2 (114). [score:2]
It was demonstrated that a regulatory pathway essential for normal neuron migration and axon guidance involves mir-79 (an ortholog of mammalian miR-9) (42). [score:2]
In addition to being crucial for neuronal progenitor proliferation, miR-9 and miR-124 are emerging as key regulators of neuron migration. [score:2]
Although described previously in Drosophila and in the mouse, miR-9 is a good example of an evolutionary conserved miRNA that contributes to various aspects of neuronal development. [score:2]
miR-9, along with miR-132, represses Foxp2 to regulate radial migration in the developing mouse cortex. [score:2]
This suggests positional specificity regarding miR-9 function. [score:1]
miR-9 along with miR-124 and miR-125b has also been associated with inducing human pluripotent stem cells to differentiate into neurons (142). [score:1]
Secondly, miR-9a (mammalian miR-9 homolog) acts from epithelial cells to fine-tune dendrite growth. [score:1]
[1 to 20 of 21 sentences]
31
[+] score: 63
Interestingly, one study (PMID: 22761433) reported that miR-9 targeting of the mitochondrial enzyme, MTHFD2, mediated a tumor suppressive effect in breast cancer, and in contrast to other studies, found that miR-9 inhibited invasion. [score:7]
For convenience, we will refer to a miR or its aspects as a miR entity (e. g. mir-9, overexpressed mir-9, hypermethylation of mir-9) and likewise refer to a disease or its aspects as a disease entity (e. g. gastric cancer, biomarker for gastric cancer). [score:7]
Variations in miR-9 expression related to miR-9 promoter hypermethylation have also been observed in the disease. [score:5]
For example we first extract the tuple [miR-9, is involved in, regulation of apoptosis] and resolve it to [miR-9, regulates, apoptosis], categorizing it as a “regulation” relation. [score:4]
In the sentence “expression of mir-9 regulates proliferation of U87 cells. [score:4]
For example, in the sentence “ apoptosis is regulated by miR- 9”, “miR-9” is the agent performing the action “regulates” and “apoptosis” is the theme being regulated. [score:4]
As a consequence of these findings, miR-9 has been suggested as both a potential biomarker and therapeutic target. [score:3]
Consider the sentence “mir-9 is known to directly regulate cell proliferation”. [score:3]
miR-9 targeting of E-cadherin (CDH1) has been implicated in promotion of cell motility and invasiveness. [score:3]
d Text evidence view with miR and disease mentions highlighted and miRiaD positive sentences underlinedBrowsing the highlighted sentences in the 13 PMIDs shown in Fig.   3c reveals that miR-9 has been associated with a number of breast cancer phenotypes including metastasis, invasiveness, aggressiveness, cell motility, and poor prognosis. [score:3]
d Text evidence view with miR and disease mentions highlighted and miRiaD positive sentences underlined Browsing the highlighted sentences in the 13 PMIDs shown in Fig.   3c reveals that miR-9 has been associated with a number of breast cancer phenotypes including metastasis, invasiveness, aggressiveness, cell motility, and poor prognosis. [score:3]
c Filtering of search results to show those where the miR is mir-9 and the disease is breast cancer. [score:3]
can be filtered to include only those where mir-9 is the miR and breast cancer is the disease using the drop-down menus above each column as shown in Fig.   3c. [score:3]
Here the “regulation” relation is represented by the verb “regulate” and the agent (mir-9) and theme (cell proliferation) are the subject and object of this verb. [score:3]
For example in the sentence fragment “miR-9 is involved in the regulation of apoptosis…”, the two triggers “involved in” and “regulation” connect the (mir-9) and the linking entity (apoptosis). [score:3]
The predicate verb (“regulate”) is the head verb of the second of the two consecutive verb groups and thus the noun phrase before this predicate is still “miR-9”. [score:2]
For example, a user interested in “miR-9” and “breast cancer” can submit a query such as “ mir- 9” AND “ breast cancer”. [score:1]
In this case the head modifier relation indicates the state of entity “miR-9”. [score:1]
b of searching for “mir-9 AND breast cancer”. [score:1]
[1 to 20 of 19 sentences]
32
[+] score: 57
This deviant DNA methylation causes damping of miRNA tumour suppressors such as let-7, miR-101, and miR-202 that target MYCN; miR-9 that targets tyrosine kinase (Trk) C, RE-1 silencing transcription factor (REST), DNA -binding protein inhibitor (ID2), and Matrix metalloproteinase-14 (MMP-14); miR-34a that targets E2F transcription factor 3 (E2F3), B-cell lymphoma 2 (Bcl-2) and MYCN; miR-340 that targets SRY (sex determining region Y)-box 2 (SOX2); miR-184 that targets v-akt murine thymoma viral oncogene homolog 2 (Akt2); and miR-335 that targets Mitogen-Activated Protein Kinase 1 (MAPK1), leucine-rich repeat 1 (LRG1), and Ser/Thr Rho kinase 1 (ROCK1) [101] (Figure 1). [score:17]
This is exemplified by the cell cycle exit and differentiation promoted by overexpression of let-7 [114] or cell proliferation stimulated by the loss of miR-9 via an increase in expression of its target HES1 and consequently downregulation of its target p27, a cell cycle inhibitor [177]. [score:14]
Packer A. N. Xing Y. Harper S. Q. Jones L. Davidson B. L. The bifunctional microRNA miR-9/miR-9* regulates REST and CoREST and is downregulated in Huntington’s diseaseJ. [score:7]
Conversely, miRNA-9 encourages the proliferation and migration of NSPCs [183], and is also responsible for the regulation of the FoxO1 expression generated during neurogenesis of NSPCs that per se is downregulated during these early stages. [score:7]
Conversely, neuronal differentiation can be brought about by miR-125a/b and miR-135b blocking BMP signalling [223], miR-124, and miR-9 via the targeting of several components of the Notch signalling pathway, which in turn regulates neuronal development and expansion of neural progenitors [195, 224, 225], or the activation of PAX6 by miR-135b, promoting neural lineage entry [226]. [score:5]
Zhao C. Sun G. Ye P. Li S. Shi Y. MicroRNA let-7d regulates the TLX/microRNA-9 cascade to control neural cell fate and neurogenesisSci. [score:2]
Coolen M. Katz S. Bally-Cuif L. miR-9: A versatile regulator of neurogenesisFront. [score:2]
Ma L. Young J. Prabhala H. Pan E. Mestdagh P. Muth D. Teruya-Feldstein J. Reinhardt F. Onder T. T. Valastyan S. miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasisNat. [score:2]
NSCs will differentiate into neurones when modulation of Hes1 occurs via miR-9 [57]. [score:1]
[1 to 20 of 9 sentences]
33
[+] score: 57
Moreover, impairment in HD protein regulation of REST results in the repression of miRNA expression in HD brains, in particular the down-regulation of miR-132 affecting neurite outgrowth [101] and the down regulation of miR-124a and miR-9/9* affecting a double negative feedback loop regulation of REST with miR-9 [100]. [score:9]
The up-regulation of miR-125b and down-regulation of miR-9 and miR-210 have been consistently reported in different studies on miRNA expression profiling of AD-affected brain (Table 2). [score:9]
In an initial expression profiling of the 13 most abundant brain miRNAs mentioned above [124], Lukiw [98] reported the up-regulation of miR-9, miR-125b and miR-128 in AD affected hippocampus (Table 1B). [score:6]
Interestingly, miR-9 is predicted to target PSEN1, suggesting that the up-regulation of PSEN1 could be associated with the decline in miR-9 levels in AD. [score:6]
The deregulation of miR-125b and miR-9 in AD is particularly interesting because, as described above, these key miRNAs are involved in brain development and function as well as in neurological diseases such as DS and HD. [score:5]
In PSEN1 knock-out mice, Notch signaling and transcriptional networks associated with miR-9 expression decrease and reflect to some extent the loss-of-function PSEN1 mutations associated with FAD pathology [72]. [score:5]
The down-regulation of miR-9 and miR-29 is, however, not specific to AD (Table 1B) as these miRNA species are also diminished in the brains of individuals with schizophrenia [105] and HD [100]. [score:4]
The probable decline of miR-9 in AD suggests that its target REST may induce the repression of other neuronal genes and miRNAs (i. e. miR-29a/b, -124, and -132) as reported in the hereditary neurodegenerative disorder, HD [100]. [score:3]
In Drosophila, miR-9 regulates the transcription factor Senseless in the development of the peripheral nervous system [76]. [score:3]
Of note, BACE1 and APP appear to be targeted by similar sets of miRNAs, including miR-9, -15, -27, -29, and miR-101. [score:3]
Another key miRNA under the regulation of REST is miR-9 [134]. [score:2]
AD -associated miRNAs activated by stress-inducing agents, such as aluminum and iron sulfates, include miR-9, miR-125b and miR-128 [98, 107]. [score:1]
MicroRNA miR-9 is also required for brain functions, as suggested in PSEN1 null mice, where its decrease is associated with severe brain defects [72]. [score:1]
[1 to 20 of 13 sentences]
34
[+] score: 56
Other miRNAs from this paper: hsa-mir-9-1, hsa-mir-9-2
DJ-1 parkinson protein 7 As an upstream regulator of KLF17, miR-9 inhibits KLF17 expression via directly targeting its 3′ untranslated region (3′ UTR), resulting in migration and invasion in HCC (Fig.   1). [score:11]
As an upstream regulator of KLF17, miR-9 inhibits KLF17 expression via directly targeting its 3′ untranslated region (3′ UTR), resulting in migration and invasion in HCC (Fig.   1). [score:11]
KLF17, Krüppel-like factor 17; 3′UTR, 3′ untranslated region; miR-9, microRNA-9 ID1 is one member of the vertebrate inhibitors of differentiation family and a negative regulator of bHLH transcription factors. [score:6]
miR-9 downregulates KLF17 expression through binding to 3’ UTR of KLF17 gene, increases cell migration and invasion. [score:6]
miR-9 upregulation facilitates tumor progression in diverse human cancer, including HCC [42], Hodgkin lymphoma (HL) [43], breast cancer [44], cervical cancer [45], colon cancer [46], acute myeloid leukemia (AML) [47], and gastric cancer (GC) [48]. [score:4]
miR-9 is regulated by prospero homeobox 1 (PROX1), a tumor suppressor. [score:4]
Fig. 1Schematic illustration of miR-9 -mediated KLF17 low expression. [score:3]
Repressed KLF17 is also found in metastatic HCC [18]; KLF17 is post-transcriptionally inhibited by microRNA-9 (miR-9) in HCC and implicated in miR-9 -mediated HCC metastasis [25]. [score:3]
Lu and colleagues [46] further confirmed that PROX1 promotes EMT by inhibiting E-cadherin via binding to miR-9 promoter in colon cancer cells. [score:3]
miR-9 mediates KLF17 low expression. [score:3]
In contrast, miR-9 undergone hypermethylation -associated silencing is correlated with metastasis in various cancers, including colorectal cancer (CRC) [49], clear cell renal cell carcinoma (ccRCC) [50], lung cancer [51], neuroblastoma [52], and nasopharyngeal carcinoma (NPC) [53]. [score:1]
Taken together, these studies show that miR-9 could act as an oncogene and promote the progression of HCC via KLF17. [score:1]
[1 to 20 of 12 sentences]
35
[+] score: 56
Interestingly, miR-9 maintained its down-regulation in older mice and miR-409-3p was the only miRNA to be consistently down-regulated in APP23 from a very young age right through to older animals. [score:7]
The down-regulated miRNAs miR-9, miR-30 and miR-20 were all strongly predicted to affect target genes involved in axonal guidance. [score:6]
Over -expression of miR-9 accelerates neuronal differentiation, while its inhibition in the medial pallium of E11.5 mouse embryos results in defective differentiation of Cajal-Retzius cells, the first neurons to populate the embryonic cortex. [score:5]
The overlap between human AD and our in vitro and in vivo AD mo dels indicates that amongst the complex pathology in human AD brain, down-regulation of miR-9, miR-181c, miR-30c, miR-20b, miR-148b and Let-7i could be attributed at least in part to the presence of Aβ. [score:4]
In contrast to the above studies including ours, miR-9 was found to be up-regulated in human AD CA1 [34] and temporal cortex [35]. [score:4]
Our in vivo analysis of APP23 hippocampus showed down-regulation of miR-9, 181c, 30c, 20b, 148b and Let-7i, all of which were altered in human AD brain. [score:4]
miR-9 has also been reported to be down-regulated in an independent human profiling study of various brain regions including hippocampus [25]. [score:4]
Importantly, this human study showed that miR-9, 181c and Let-7i were down-regulated in AD brain. [score:4]
Axon guidance was among the most significant pathways to be affected by the predicted target genes and was the top prediction for miR-9, miR-30 and miR-20. [score:3]
It is encouraging to see that most of the pathways predicted to be affected by miR-9 target genes are related to brain function. [score:3]
Decreased expression of miR-9 may therefore impact adult brain function. [score:3]
Individual TaqMan assays (Applied Biosystems) were used to analyse the expression of the following mature mouse miRNAs: miR-181c, miR-9, miR-20b, miR-21, miR-30c, miR-148b, miR-361, miR-409-3p and Let-7i. [score:2]
In addition, an interesting overlap between human studies and ours was observed (miR-9, 181c, 30c, 148b, 20b and Let-7i) (Table 1) and therefore it was of great interest to validate and analyze these miRNAs in particular [13], [25]. [score:1]
Studies performed in zebrafish and mice revealed that miR-9 is essential in patterning, neurogenesis and differentiation and thus ideally placed to impact various aspects of brain function. [score:1]
miR-9, the most abundant human brain miRNA [53], is a recurring candidate from several AD profiling studies. [score:1]
Similarly, loss of miR-9 in zebrafish embryos decreases the relative numbers of differentiated neurons in the anterior hindbrain [54], [55], [56]. [score:1]
Interestingly, Aβ caused an extremely rapid neuronal response of distinct mature miRNA sequences with miR-9, 181c, 409-3p and 361 responding even after a one hour Aβ treatment. [score:1]
The decay rates for miR-9 are comparable in human brain tissue (T [1/2] = 48 min) and neuronal cells in culture (T [1/2] = 42 min), highlighting the validity of the in vitro mo del used by us. [score:1]
That the stability of mature miRNAs varies considerably was shown for the highly abundant, hepatocyte-specific microRNA miR-122 (T [1/2]>24 hrs) [48], while several brain-enriched miRNAs, such as miR-9, 125b, 146a, 132 and 183 exhibit short half-lives ranging from 1 to 3.5 hrs [35]. [score:1]
[1 to 20 of 19 sentences]
36
[+] score: 49
The bifunctional microRNA miR-9/miR-9 [*] regulates REST and CoREST and is downregulated in Huntington's disease. [score:7]
The control of these biological events by miR-9 may be mediated by controlling expression levels of the downstream targets such as Forkhead box G1 (Foxg1/ Bf1) (Shibata et al., 2008, 2011), embryonic lethal, abnormal vision, Drosophila like 2 (Elavl2/ HuB) (Sathyan et al., 2007), Fibroblast growth factor receptor 1 (Fgfr1) (Pappalardo-Carter et al., 2013), Forkhead box P2 (Foxp2) (Pappalardo-Carter et al., 2013), Stathmin 1 (Stmn1) (Delaloy et al., 2010), Nuclear receptor subfamily 2, group E, member 1 (Nr2e1/ Tlx) (Zhao et al., 2009; Shibata et al., 2011), Inhibitor of DNA binding 4 (Id4) (Shibata et al., 2008), Paired box 6 (Pax6) (Shibata et al., 2011), Meis homeobox 2 (Meis2) (Shibata et al., 2011), GS homeobox 2 (Gsh2) (Shibata et al., 2011), Islet1 (Isl1) (Shibata et al., 2011), RE1-silencing transcription factor (Rest) (Packer et al., 2008), and Actin-like 6A (Actl6a/ BAF53a) (Yoo et al., 2009). [score:7]
Reduction of miR-9 expression and the target gene expressions in the zebrafish whole-embryo (Tal et al., 2012) and the embryonic forebrain (Pappalardo-Carter et al., 2013) exposed to alcohol also supports this hypothesis. [score:7]
Thus, reduced expression of miR-9 by alcohol exposure is also likely to inhibit those events by the similar mechanism. [score:5]
MicroRNA-9 modulates Cajal-Retzius cell differentiation by suppressing Foxg1 expression in mouse medial pallium. [score:4]
Consistent with this in vivo observation, miR-9 knockdown inhibited the proliferation and promoted the migration of the neural progenitor cells in vitro (Delaloy et al., 2010). [score:4]
However, in the conditions of exposure to different contexts of maternal stress induced by such as restraint of the body and forced swimming, expression of miR-9 was increased in the brain of offspring (Zucchi et al., 2013). [score:3]
In a comprehensive miRNA profiling study using a neurosphere mo del of alcohol exposure, Miranda and his colleagues found a reduction in expressions of miR-21, miR-335, miR-9, and miR-153 24 h after exposure (Sathyan et al., 2007). [score:3]
MicroRNA-9 regulates neurogenesis in mouse telencephalon by targeting multiple transcription factors. [score:3]
Suppression and epigenetic regulation of MiR-9 contributes to ethanol teratology: evidence from zebrafish and murine fetal neural stem cell mo dels. [score:3]
A feedback regulatory loop involving microRNA-9 and nuclear receptor TLX in neural stem cell fate determination. [score:2]
MiR-9 knockout mouse displays smaller brain size (Shibata et al., 2011). [score:1]
[1 to 20 of 12 sentences]
37
[+] score: 44
In humans, CXCR4 is a verified target gene of miR-9 [64] and there is extensive support for a human target site in Table 1, but no support for a porcine target site. [score:7]
MiR-9-5p, miR-148a and miR-125a also have target sites in SCD, which is upregulated in the adipose tissue of the obese minipigs. [score:6]
In contrast, MiR-9-5p is upregulated in serum of human diabetic patients and, in another study, upregulated in porcine adipose tissue from a mixed breed population [10, 40]. [score:6]
LEP has target sites for three miRNAs: MiR-30a, miR-148a and miR-9-5p which were all downregulated in obese adipose tissue and muscle. [score:6]
LEP was the gene containing the most miRNA target sites, i. e. is targeted by miR-148a-3p, miR-125a-5p, miR-30a, miR-9-5p and miR-17-5p. [score:5]
However, miR-9 was highly downregulated (FC 7.6; p value 0.046). [score:4]
MiR-9 (FC -8.5; p value 0.02) was the most downregulated miRNA. [score:4]
CXCL14 has a target site for miR-9-5p. [score:3]
SCD is also targeted by many of the same miRNAs, namely miR-148a-3p, miR-125a-5 and miR-9-5p. [score:3]
[1 to 20 of 9 sentences]
38
[+] score: 43
Several mRNAs targeted by neuronal miRNAs (i. e., miR-124, miR-9 and miR-96) were downregulated upon increased miRNA expression, consistent with expectations of the role of miRNAs in repressing downstream targets, whereas for the decreasing miR-302 cluster and miR-103, similar proportions of the targets were up- and downregulated. [score:15]
We initially analyzed the correlations between the expression levels of miR-302a-d, miR-124, miR-96, miR-9 and miR-103 and their experimentally validated (miRTarBase 4.4 (Hsu et al, 2011)) mRNA targets that are expressed in iNGN cells (Supplementary Fig S8). [score:7]
Validated targets for active transcription factors (having positive activation score: NEUROG2, NEUROG3, NEUROD1, NEUROD2, SPARC, SNAI1, SNAI2, ZEB1, and ZEB2) and upregulated miRNAs (miR9, miR96, miR124) were combined, respectively. [score:6]
Consistent with this view, fold changes of validated miR-124, miR-96 and miR-9 targets were often smaller than the targets of the proneural transcription factors in our network (Fig 6D). [score:5]
For example, REST, a validated miR-9 target (Packer et al, 2008), decreased in expression after day 0, consistent with the increase in miR-9 levels (Fig 6A; Supplementary Fig S8). [score:5]
Validated miRNA targets (Hsu et al, 2011) were used for correlation analysis with miR-302a-d, miR-9, miR-96, and miR-103. [score:3]
In our cells, miR-124 accounted for 12.8% of total miRNAs at day 0 and increased to 79% by day 4. We also observed increases in the abundance of the neuronal miR-96 (10-fold) and miR-9 (57-fold) (Fig 4B and E; Supplementary Fig S5) among others (Fig 4C). [score:1]
Thus, miRNA profiles rapidly changed in the course of iNGN differentiation, consistent with the loss of pluripotency (miR-302 cluster) and the establishment of neuronal miRNA signatures (miR-124, miR-96 and miR-9). [score:1]
[1 to 20 of 8 sentences]
39
[+] score: 43
miRNA Protein target(s) Regulatory Action Clinical Implications miR-1 LXRα*Directly suppresses LXR in vitro May promote an increase in cellular cholesterol[38] miR-9 ACAT1* Directly suppresses ACAT1 and esterification of cholesterol in macrophages Overexpression may promote macrophage cholesterol efflux and reduce foam cell formation[47] miR-10b ABCA1* ABCG1* Directly represses ABCA1 and ABCG1 expression and decreases macrophage cholesterol efflux Can be suppressed by dietary anthocyanins, leading to increased macrophage cholesterol efflux and lesion regression[63] miR-19b ABCA1* Directly suppresses ABCA1 and decreases cholesterol efflux to ApoA1; increases atherosclerotic lesion area and severity Inhibition may increase macrophage ABCA1, promoting cholesterol efflux and lesion regression[53] miR-26 ABCA1* ARL7 Activated by LXR to suppress both proteins, decreasing macrophage cholesterol efflux Inhibition may increase macrophage ABCA1, promoting cholesterol efflux and lesion regression[58] miR-27a/b ABCA1* ABCG1 ACAT1* CD36 LPL* Directly suppresses ABCA1, indirectly suppresses ABCG1, and reduces cholesterol efflux. [score:32]
Indeed, transfection of macrophages with miR-9 suppressed ACAT1 protein, but not mRNA, expression. [score:5]
MiR-9 is a recently identified regulator of ACAT1 expression [47]. [score:3]
This suggests the possibility of miR-9 -mediated ACAT1 suppression as a therapeutic strategy to reduce foam cell formation. [score:3]
[1 to 20 of 4 sentences]
40
[+] score: 43
The expression of the miR-9 family of genes is dynamically regulated [42] during differentiation and development, and the human miR-9 family has three members: hsa-mir-9-1, -2, and -3. In the human genome, hsa-mir-9-2 and hsa-mir-9-3 are intergenic miRNAs, and hsa-mir-9-1 is found in the second intron of C1orf61. [score:5]
Since there is no other putative GRB target gene within the region of hsa-mir-9-3, we conclude that hsa-mir-9-3 is most likely the only target of long-range enhancers in that region. [score:5]
Our predictions included 29 ST miRNA genes/miRNA gene clusters, 19 of which have known functions in development (Additional file 5 and Table S3) as well as the miR-9 family, which are the validated GRB target miRNAs. [score:4]
The miR-9 family of miRNAs is a known, experimentally verified GRB target [17] and therefore a prime example for illustrating how the genomic features we analyzed could serve to annotate miRNAs under long-range regulation. [score:4]
The analysis of the mir-9 miRNA family members (dre-mir-9-5 and ) dre-mir-9-1) in zebrafish has shown that they are regulated by the same type of enhancers as protein-coding GRB target genes [17]. [score:4]
In summary, the genomic features of regions around members of the miR-9 family display characteristics equivalent to those of protein-coding GRB target genes, lending further support to the use of these features for predicting novel miRNA targets of long-range regulation. [score:4]
Furthermore these predictions include miRNAs of the miR-9 family, which are the only experimentally verified GRB target miRNA genes. [score:3]
However, it was shown that two regions with enhancer activity located ~10 kb downstream of dre-mir-9-1, the zebrafish ortholog of hsa-mir-9-1, and ~100 kb downstream of dre-mir-9-5, the zebrafish ortholog of hsa-mir-9-2, gave the reporter gene an expression pattern similar to that of zebrafish miR-9, but not the zebrafish myocyte enhancer factors [17]. [score:3]
The mir-9 family of miRNAs is highlighted since it contains know examples of GRB target miRNAs that were captured using our two prediction features: 1) localization in regions of high HCNE density and 2) association with a bivalent promoter. [score:3]
Furthermore these predictions include miRNAs of the miR-9 family, which are the only experimentally verified GRB target miRNAs. [score:3]
Given this functional similarity as well as recent zebrafish transgenesis assays showing that the miR-9 family is indeed regulated by with enhancer activity, we hypothesized that this type of miRNA regulation is prevalent. [score:2]
UCSC Genome Browser screen shots of the miRNAs, hsa-mir-9-1 (A), hsa-mir-9-2 (B) and hsa-mir-9-3 (C) as well as their orthologs in the mouse genome. [score:1]
Therefore, all miR-9 family members can be classified as ST miRNAs and are likely to have their own promoters. [score:1]
Figure 4 Case study of the miR-9 family. [score:1]
[1 to 20 of 14 sentences]
41
[+] score: 42
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
OsmoticUptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
Uptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
miRNAs have brain-organizing activity; for instance, miR-9 is expressed selectively in late embryonic neural tube by sparing the midhind brain to define the boundary (Leucht et al. 2008). [score:3]
In mammals, miR-7, miR-9, miR-29b, miR-30d, miR-124a, and miR-375 regulate the secretion and islet development (Poy et al. 2004; Baroukh and Van Obberghen 2009; Tang et al. 2009; Pullen et al. 2011). [score:3]
miR-9 was expressed in mature amacrine cells of the inner nuclear layer and in maturing cells of ciliary marginal zone of the retina. [score:3]
For instance, MALAT1, a long ncRNA, is a target of miR-9 in the nucleus (Leucci et al. 2013). [score:3]
Similarly, Plaisance et al. (2006) have reported the control of the secretory function of insulin-producing cells by miR-9. In their electrophoretic mobility shift assay, chromatine immunoprecipitation, and gene reporter experiments, the transcriptional factor onecut-2, which targets granuphilin, is implicated in insulin secretion, and its level is kept at an appropriate level by miR-9. Given a persistent hyperglycemia in some aquaculture species fed carbohydrate-rich diets (Moon 2001), studies on carbohydrate metabolism in the context of gene regulation may help in understanding the consequences of fish meal replacement with plant products in aquaculture feeds. [score:3]
In contrast, miR-9 and miR-135c are expressed in both cell types (Kapsimali et al. 2007). [score:3]
Soares et al. (2009) let-7a,b,c,f,i, miR-7b, miR-9-5p, miR-9-3p, miR-34b, miR-103, miR-107, miR-124a, miR-125a,b, miR-128, miR-129-3p, miR-132, miR-138, miR-181a,b, miR-216, miR-217, miR-219, and miR-375 Zebrafish Microarray, ISH ? [score:1]
Wienholds et al. (2005) let-7a,b,c, miR-9, miR-34, miR-92b, miR-124, miR-128, miR-135c, miR-137,miR-138, miR-153a, miR-219, miR-222 Zebrafish ISH ? [score:1]
Ason et al. (2006) miR-7, miR-9, miR-34b, miR-96, miR-124a, miR-125b, miR-132, miR-181b, miR-182, miR-183, miR-184, and miR-204, miR-215, miR-216, miR-217 Zebrafish Microarray, ISH ? [score:1]
Soares et al. (2009) let-7b, miR-9, miR-30a, miR-92b,miR-96 miR-124, miR-181a,b, miR-182, miR-183, miR-184, and mir-204 Zebrafish ISH ? [score:1]
Xia et al. (2011) let-7a, b, c, and d, miR-9, miR-21, miR-124, miR-135c Zebrafish NGS, qRT–PCR ? [score:1]
Kapsimali et al. (2007) miR-7 and miR-9 Zebrafish Gain- and loss-of-function boundary organization Leucht et al. (2008) and Memczak et al. (2013) Eye miR-124 Zebrafish NGS, qRT–PCR ? [score:1]
[1 to 20 of 14 sentences]
42
[+] score: 41
In addition, miR-9 has been shown to be downregulated in response to treatment in primary neurons, suggesting that miR-9 downregulation could be a consequence of the disease pathogenesis that results in neurofilament-H upregulation [2]. [score:12]
miRNA-9 expression levels change across Braak stages and neurofibrillary tangle advancement in CSF, decreasing with Alzheimer's disease progression. [score:5]
However, miR-9 also targets Sirtuin (SIRT1), a de-acetylase with reduced expression in AD brains [62], [63]. [score:5]
We found miRNA-9 to be downregulated in CSF from AD patients when compared to levels in CSF from control subjects. [score:3]
The gene coding for neurofilament H is among the miR-9 targets potentially involved in AD [58]. [score:3]
To date, several studies demonstrate the altered expression of miR-9 in AD brains [22], [23], [55], [57]. [score:3]
In contrast to neurofilament H, decreased SIRT1 levels would indicate a potential increase in miR-9, or the increase of another miRNA targeting SIRT1. [score:3]
4 (miR-9-3p and miR-708-3p) that are detected in CSF and change with increasing Braak stage. [score:1]
i)CSF Braak stages: 18 miRNAs, including miR-9-3p and miR-708-3p (Table 4, Figure 2A ). [score:1]
The ordinal logistic regression analysis resulted in 18 reported miRNAs including miR-9-3p and the miR-181 family (Table 5, Figure 3A ). [score:1]
We plotted two miRNAs selected from Table 4 (miR-9-3p and miR-708-3p) that are detected in CSF and change with increasing Braak stage. [score:1]
We plotted four miRNAs (miR-181b-5p, miR-181d, miR-181a-5p and miR-9-3p) detected in CSF from Table 5 with delta AIC <10. [score:1]
These observations correlate with the decrease in miR-9 levels we observed with tangle severity. [score:1]
0094839.g003 Figure 3(A) We plotted four miRNAs (miR-181b-5p, miR-181d, miR-181a-5p and miR-9-3p) detected in CSF from Table? [score:1]
[1 to 20 of 14 sentences]
43
[+] score: 41
a Over -expression of miR-31 restores chemo-response by reducing stathmin expression; miR-101/stathmin pathway contributes to radioresistance in human NPC; down-regulation of miR-193b promotes migration and proliferation of tumor cells by targets stathmin; miR-223 regulates stathmin by JNK signaling pathway to regulate MPM cell motility; b up-regulation of miR193b reduces proliferation and migration by inhibiting stathmin and uPA; silencing of miR-210 promotes proliferation of cancerous cells; transfection of miR-142 and miR-223 decreases expression of stathmin and IGF-1R to inhibit proliferation of cancerous cells; c microrna-9 inhibits cell proliferation, vasculogenic mimicry and tumor growth through controlling stathmin expression; miR-101 suppresses autophagy via targets stathmin and down-regulation of miR-101 is linked to the increase of cellular proliferation and invasiveness. [score:32]
Stathmin has been identified as a functional target of microRNA-9. Up-regulation of microRNA-9 reduces glioma cell proliferation, migration and vasculogenic mimicry by up -regulating the expression of stathmin [75]. [score:9]
[1 to 20 of 2 sentences]
44
[+] score: 38
Our results also indicate that miR-9 is specifically dysregulated in stressed patient neurons with the TARDBP A90V mutation, likely as a direct result of the reduced TDP-43 level observed in these neurons, as shRNA -mediated knockdown of TDP-43 in mouse primary cortical neurons also reduced miR-9 expression (Fig. 6). [score:7]
Moreover, miR-9 expression is significantly reduced in patient neurons with the TARDBP M337V mutation or in neurons with A90V mutation after STS treatment, revealing another stress-related molecular defect in patient neurons. [score:5]
Among these, we identified reduced miR-9 expression as a molecular defect that is downstream of TDP-43 and common to human neurons with TARDBP A90V or M337V mutations. [score:4]
0076055.g006 Figure 6(A) Relative expression levels of mature miR-9 in neurons derived from two control and three patient iPSC lines containing the A90V mutation with or without STS treatment (left panel). [score:4]
In human neurons containing the more pathogenic M337V mutation, miR-9 expression is also reduced even without STS treatment (Fig. 6). [score:4]
To what extent miR-9 and specific miR-9 targets contribute to TDP-43 mediated neurodegeneration remains to be determined. [score:3]
Among them, miR-9, a brain-specific miRNA whose nucleotide sequence is highly conserved through evolution, is implicated in several neurodegenerative diseases and of great interest [49]. [score:3]
Expression of miR-9 and its precursors is reduced in patient neurons under stress. [score:3]
Thus, misregulation of miRNAs and miR-9 in particular may be a common downstream molecular event of both disorders. [score:2]
Indeed, the level of miR-9 (Fig. 6A) was significantly lower in patient neurons with the TARDBP A90V mutation than control neurons only after STS treatment. [score:2]
Pri-miR-9-2 and pri-miR-124-1 were analyzed here because they are the most abundant among three miR-9 or miR-124 alleles, separately [50], [51]. [score:1]
[1 to 20 of 11 sentences]
45
[+] score: 36
MiR-9*, which is upregulated in 2102Ep (Figure  2A), and miR-145 and miR-126, which are upregulated and downregulated in NTera-2 respectively (Figure  2B), all have been validated to repress SOX2 [18, 96– 98]. [score:10]
The differential expression of three miRNAs, miR-9*, miR-145 and miR-126, which have previously been validated to target SOX2, suggests the possible existence of novel autoregulatory loops between SOX2 and miRNAs it directly or indirectly regulates. [score:9]
While the downregulation of miR-126 points towards a negative feedback mechanism, the upregulation of miR-9*, which has a proximal SOX2 binding site in its promoter region (Table  3), and miR-145 indicates the existence of positive feedback loops. [score:7]
In 2102Ep cells, inhibitors of EMT, miR-9 and miR-424, and an activator of MET, miR-182, are all upregulated. [score:6]
Furthermore, independent from the statistical target analysis, miR-9/9*, a highly characterised promoter of EMT and upregulated in 2102Ep cells, has a SOX2 -binding site in its promoter region (Table  3), further revealing a SOX2-linked miRNA EMT network [80]. [score:4]
[1 to 20 of 5 sentences]
46
[+] score: 35
On the other hand, expression of miR-9 seems to be up-regulated in breast cancer, where it reduces E-cadherin expression leading to increased expression of VEGFA and promotion of angiogenesis [10]. [score:10]
The aim of this study was to examine the degree of vascularization determined by microvessel density as well as expression of selected miRNAs (specifically, let-7b, miR-126, miR-9, and miR-19a) in lung tumor tissue, surrounding tissue, and corresponding non-tumor tissue in patients with squamous cell lung cancer (SCC) and lung adenocarcinoma (ADC) as well as in lung tissue from control individuals without clinical evidence of a malignant disease. [score:5]
Using microarray analysis, down-regulation of miR-9 in lung tumor tissue in comparison to corresponding non-tumor tissue was reported [15]. [score:4]
On the other side, no significant changes in miR-9 expression levels among all examined tissue samples were observed (Figure 5A). [score:3]
This study found no significant differences in miR-9 expression levels among all examined tissue samples and no association with MVD. [score:3]
Nevertheless, larger studies are warranted to determine the exact role of miR-9 expression in tumor angiogenesis, since only a limited number of studies in lung cancer have been published so far [15], [38]. [score:3]
Comparative analysis of miR-9 (A) and miR-19a (B) expression in lung cancer patients' tumor tissue, surrounding tissue, and non-tumor lung tissue as well as in lung tissue from control group. [score:3]
The information about the role of miR-9 in lung cancer development and angiogenesis is still lacking. [score:2]
Based on these findings, four miRNAs (specifically, let-7b, miR-9, miR-19a, and miR-126) were selected. [score:1]
Since expression levels of miR-9 and miR-19a did not vary significantly between tumor tissue and corresponding non-tumor tissue, further correlations with MVD were not evaluated. [score:1]
[1 to 20 of 10 sentences]
47
[+] score: 34
In primary breast tumors of patients with metastatic disease, miR-9 expression is much higher than that in metastasis-free patients, implying that miR-9 is a potential regulator of the metastatic process. [score:6]
The consequence of the E-cadherin downregulation by miR-9 is the activation of β-catenin signaling to trigger the expression of downstream oncogenic genes, which leads to increased cell motility and invasiveness. [score:6]
Ma et al. identified that miR-9 reduces the expression of E-cadherin in breast cancer cells via directly binding to its 3′-untranslate region. [score:6]
The function of miR-9 is further confirmed by the fact that inhibition of miR-9 using a miRNA ‘sponge’ suppresses metastasis formation in animal mo del, implying that miR-9 silencing may represent a new therapeutic approach in advanced breast cancers to prevent metastasis formation. [score:5]
MiR-9 expression is activated by c-Myc and n-Myc, both of which directly bind to the miR-9-3 locus. [score:4]
The expression level of miR-9 closely correlates with MYCN amplification, tumor grade and metastatic status in neuroblastoma tumors. [score:3]
105, 106 Other important miRNAs involved in regulating metastasis include miR-9 and miR-212. [score:2]
105, 106 Other important miRNAs involved in regulating metastasis include miR-9 and miR-212. [score:2]
[1 to 20 of 8 sentences]
48
[+] score: 34
Thus, CpG islands of 9 disease-related miR genes, including 5 extragenic miR genes or gene clusters (miR-9-3, miR-137, miR-200b/200a/429, miR-203, and miR-375) and 4 intragenic genes or gene clusters (miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210), were selected as the representative genes in the present study (Additional file 1: Table S1). [score:3]
The expression levels of miRNA-9 and miRNA-34b were similar between SMs and GCs. [score:3]
Most importantly, an inverse relationship between miR methylation and the corresponding expression level was observed for miR-9-1, miR-9-3, miR-137, and miR-200b in these gastric tissue samples (Spearman’s Rank Correlation analysis, miR-9-1, r [s] = −0.533, P = 0.001; miR-9-3, r [s] = −0.464, P = 0.004; miR-137, r [s] = −0.378, P = 0.019; miR-200b, r [s] = −0.409, P = 0.010; Figure 3H-K). [score:3]
However, a solid relationship between miR methylation and expression has not been thoroughly established as only weak supporting evidence has been provided in many of the previous studies, as we have summarized for 9 tested miR genes/clusters (extragenic miR-9-3, miR-137, miR-200b/200a/429, miR-203, miR-375; intragenic miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210) in this present study (Additional file 1: Table S2) [19- 27]. [score:3]
The miRNA levels were then analyzed using a TaqMan Gene Expression Master Mix kit (Life Technologies) with the corresponding probe and primers (Life Technologies, miR-375 #TM000564, miR-34b #TM000427, miR-137 #TM000593, and miR-9 #TM000583). [score:2]
Inversed relationship between miR methylation of CpG islands and their corresponding expression levelsTo investigate the relationship between the above aberrant miR methylation and the transcription of the corresponding miR gene, we quantified the mature miRNA levels of miR-9-1, miR-9-3, miR-34b, miR-137, miR-210, miR-200b, (and miR-375), whose methylation status is related to the development of GC (and GC host adaptation) as described above, in a set of human cell lines with different methylation status of miR CpG islands. [score:2]
These findings strongly suggest that methylation of these miR CpG islands is related to the development of GCs (trend-test, miR-9-1, P < 0.001; miR-9-3, P < 0.001; miR-34b, P = 0.008; miR-137, P < 0.001; miR-210, P = 0.001; Table 1). [score:2]
The miR-9-1, miR-9-2, and miR-9-3 genes all encode the same mature miRNA-9 that affects cell migration and proliferation in a tumor type-specific pattern through the NF-κB1 Snail E-cadherin[45, 46]. [score:1]
As is consistent with others’ reports [14, 15, 19, 25, 27, 36- 40], miR-9-1, miR-9-3, miR-34b, miR-137, and miR-375 methylation was observed in gastric carcinogenesis in the present study. [score:1]
DHPLC chromatogram of methylated and unmethylated miR-9-3 in various cell lines. [score:1]
Except for miR-9-1 and miR-137, the methylation positive rates or proportions of methylated miR-9-3, miR-34b, miR-210, and miR-200b in GCs were similar to those in SMs (Table 1). [score:1]
As expected a significant difference in the positive rate or the proportion of methylated miR-9-3, miR-34b, miR-210, and miR-200b was not observed between GC and SM samples. [score:1]
Such an inverse relationships could also be observed for the miR-9-1, miR-9-3, miR-137, and miR-200b CpG islands in gastric tissue samples in vivo. [score:1]
The inverse relationship was also observed for miR-9-1, miR-9-3, miR-137, and miR-200b in gastric samples. [score:1]
These results confirmed that miR-9-1 and miR-137 methylation was a tumor-specific event and that miR-9-3, miR-34b, and miR-210 methylation, as well as miR-200b demethylation, was a field-effect that occurred during gastric carcinogenesis. [score:1]
Abnormal miR-9-1 and miR-9-3 methylation is frequently reported in many cancers including GCs [15, 19, 40]. [score:1]
Elution profiles of miR-9-3, miR-200b, and miR-203 methylation was analyzed with an ultraviolet detector; other miR gene methylation was detected with the post column HSX-3500 Accessory (Transgenomic, Inc. [score:1]
In contrast, a significant higher of the positive rate and proportion of methylated miR-9-1, but not methylated miR-9-3, was observed in GCs than SMs. [score:1]
This data indicates that miR-9-1 methylation may be a late cancer-specific event, while miR-9-3 methylation may be an early field effect during gastric carcinogenesis. [score:1]
In the present study, we found that methylation or demethylation of all 7 tested miR CpG islands (GC-related miR-9-1, miR-34b, miR-9-3, miR-137, miR-210, miR-200b and host-related miR-375) was consistently, inversely correlated to a statistically significant level with their corresponding miRNA levels in a number of human cell lines in vitro. [score:1]
In the present study, we found that the positive rate of miR-9-1 and miR-9-3 methylation for all 112 GCs was significantly higher than that in 50 non-malignant tissues collected from 37 gastritis patients and 13 healthy controls. [score:1]
In all the tested samples, the prevalence of miR-9-3 methylation is significantly higher than that of miR-9-1. It has been reported that miR-9-3 methylation correlates with poor clinical outcomes for GC patients [40]. [score:1]
Methylation frequency of 5 miR CpG islands (miR-9-1, miR-9-3, miR-137, miR-34b, and miR-210) gradually increased while the proportion of methylated miR-200b gradually decreased during gastric carcinogenesis (Ps < 0.01). [score:1]
[1 to 20 of 23 sentences]
49
[+] score: 34
miR-33b overexpression results in down-regulation of miR-9. miR-33b reduces cell migration. [score:6]
Lovastatin treatment led to miR-33b upregulation and lowered expression of miR-9, c-Myc and cyclin E in tumours of Daoy cells, but not in tumours of D283 cells (Fig 5B–D; Supporting Information Fig S11B). [score:6]
We found that miR-33b reintroduction down-regulated the expression of miR-9 (Fig 2D) and resulted in a reduction in cell migration (Fig 2E). [score:6]
B. miR-33b expression was elevated and miR-9 was down-regulated in tumours with Daoy cells upon lovastatin treatment. [score:6]
In addition, miR-33b overexpression led to a larger percentage of Daoy cells arrested at the G1 phase (Supporting Information Fig S7C), decreased cell proliferation (Supporting Information Fig S7D), and lowered miR-9 expression (Supporting Information Fig S7E) along with reduced cell migration (Supporting Information Fig S7F). [score:5]
miR-9 is a transactivational target of c-Myc and regulates cell migration and tumour metastasis (Ma et al, 2010). [score:4]
Over a dozen miRNAs such as the miR-17–92 cluster (He et al, 2005; O'Donnell et al, 2005) and miR-9 (Ma et al, 2010) have been found to be induced by c-Myc to manifest its function in cell cycle, survival, metabolism, apoptosis and metastasis (Bui & Men dell, 2010). [score:1]
[1 to 20 of 7 sentences]
50
[+] score: 32
By comparing miRNA expression profiles between the wildtype HIV-1 infected human CEMx174 lymphocytes and Tat RNA silencing suppressor in HIV-1 infected human CEMx174 lymphocytes [92], Tat RNA silencing suppressor contributed to the expression change of MIR9 (p-value < 0.035). [score:9]
Dysregulation of MIR101, MIR141, and MIR152 to the HIV-1 Gag protein contributes to HIV-1 budding and release via DNA hypermethylation, ubiquitin transfer, and endoplasmic reticulum -associated degradation at the late infection stage Briefly, dysregulation of; dysregulation of MIR9 contributes to HIV-1 infection to hijack CD4+ T cells through dysfunction of the immune and hormone pathways; dysregulation of MIR139-5p, MIRLET7i, and MIR10a contributes to the HIV-1 integration/replication stage through DNA hypermethylation and immune system dysfunction; dysregulation of MIR101, MIR141, and MIR152 contributes to the HIV-1 virus assembly/budding stage through DNA hypermethylation, ubiquitin transfer, and endoplasmic reticulum -associated degradation; dysregulation of MIR302a contributes to not only microvesicle -mediated transfer of miRNAs but also dysfunction of NF-κB signaling pathway in hepatocarcinogenesis. [score:7]
At early infection stage (Fig.   5), we identified that the expression changes of MIR9 (p-value < 0.448) and general transcription factor IIi (GTF2I) (p-value < 0.96) contribute to the expression change of small ubiquitin-like modifier 3 (SUMO3) (p-value < 0.016) via respectively regulating zinc finger protein 131 (ZNF131) (p-value < 9.3☓10 [-14]) and DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked (DDX3X) (p-value < 1☓10 [-16]). [score:6]
We found that dysregulation of; dysregulation of MIR9 contributes to HIV-1 infection to hijack CD4+ T cells through dysfunction of the immune and hormone pathways; dysregulation of MIR139-5p, MIRLET7i, and MIR10a contributes to the HIV-1 integration/replication stage; dysregulation of MIR101, MIR141, and MIR152 contributes to the HIV-1 virus assembly and budding mechanisms; dysregulation of MIR302a contributes to not only microvesicle -mediated transfer of miRNAs but also dysfunction of NF-κB signaling pathway in hepatocarcinogenesis. [score:6]
It has been also proposed that Tat can induce MIR9 to control inflammatory responses [93], and Tat can also control GTF2I expression during HIV infection [94]. [score:3]
The signaling cascade from MIR9 to SUMO3 contributes to HIV-1 infection to hijack CD4+ T cells through dysfunction of the immune and hormone pathways at early stage. [score:1]
[1 to 20 of 6 sentences]
51
[+] score: 32
The miR-9 family is upregulated [32], [33] or downregulated [31], [35] in various human cancers. [score:7]
The difference in miR-9 expression seen here may be similar to the stage-specific regulation that was demonstrated for miR-200 in liver cancer [36]. [score:4]
As shown in Fig. 4, we confirmed that the endogenous bile miRNAs miR-21, let-7c, and miR-9 were stable in bile and that their expression levels remained high, especially within 4 hours of 24 hours incubation. [score:3]
Of these, we highlighted 10 miRNAs (miR-9, miR-145*, miR-105, miR-147b, let-7f-2*, let-7i*, miR-302c*, miR-199a-3p, miR-222* and miR-942) whose expression was significantly higher at P<0.0005 (Fig. 3A ). [score:3]
In the context of cancer biology, aberrant expression of miR-9 has been associated with metastasis [31], [32], [33], [34]. [score:3]
The mechanism of miR-9 dysregulation in our study remains unknown but may involve aberrant methylation of is promoter region [31], [34], [37] or f activation of the transcription factor MYC/MYCN [32]. [score:2]
Setting the specificity threshold to 100% [17], [30] showed that miR-9, miR-302c*, miR-199a-3p, and miR-222* had a sensitivity level of 88.9%, indicating that these miRNAs can serve as biological markers for biliary tract cancer (Fig. 3B ). [score:1]
Notably, miR-9 showed reliable diagnostic specificity and sensitivity. [score:1]
Furthermore, the fractionation analyses showed that, for all three samples tested, all miRNAs, including miR-9, were detected in the component containing biliary epithelial cells, nuclei, and cytoskeletons, indicating that bile miRNAs reside primarily inside cells and nuclei. [score:1]
Notably, bile miR-9 has strong potential for use as a clinical marker of biliary tract cancers. [score:1]
Additionally, the area under the ROC-curve analysis showed that miR-9 and miR-145* could be excellent diagnostic markers for BTC (Fig. 3C ). [score:1]
Further functional studies of miR-9 in BTC are needed. [score:1]
Setting the specificity threshold to 100% showed the sensitivity level to be 88.9% for miR-9, miR-302c*, miR-199a-3p, and miR-222*; 77.8% in miR-145*, miR-105, and miR-942; and 66.7% in miR-147b, let-7f-2*, and let-7i*. [score:1]
Taken together, our data show that bile miRNAs, notably miR-9, have the potential to be used as diagnostic indicators for biliary tract cancers. [score:1]
The endogenous human bile miRNAs hsa-miR-21, hsa-let-7c, and hsa-miR-9 are relatively stable. [score:1]
0023584.g004 Figure 4The endogenous human bile miRNAs hsa-miR-21, hsa-let-7c, and hsa-miR-9 are relatively stable. [score:1]
[1 to 20 of 16 sentences]
52
[+] score: 32
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Inhibition of miR-9 leads to derepression of Dicer (Leucci et al., 2012); it suppresses matrix metalloproteinase (MMP)-14 expression via binding to a site in the 3′-UTR, thus inhibiting the invasion, metastasis, and angiogenesis of neuroblastoma (Zhang et al., 2012a). [score:9]
The bifunctional microRNA miR-9/MIR-9* regulates REST and co-REST and is downregulated in Huntington’s disease. [score:7]
Downregulation of the miR-9 gene changes the stoichiometry of axonal neurofilaments (upregulates a gene coding for a heavy neurofilament subunit) in a mouse mo del of human spinal muscular atrophy characterized by anterior horn sclerosis, aberrant end plate architecture, and myofiber atrophy with signs of denervation (Haramati et al., 2010), while it is overexpressed in several cancer forms, including brain tumors, hepatocellular carcinomas (HCC), breast cancer, and Hodgkin lymphoma. [score:7]
microRNA-9 targets matrix metalloproteinase 14 to inhibit invasion, metastasis, and angiogenesis of neuroblastoma cells. [score:5]
Inhibition of miR-9 de-represses HuR and DICER and impairs Hodgkin lymphoma tumor outgrowth in vivo. [score:3]
MicroRNA-9 directs late-organizer activity of the midbrain-hindbrain boundary. [score:1]
[1 to 20 of 6 sentences]
53
[+] score: 32
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
These candidate miRNAs included representatives that exhibited regulated patterns of expression from each of the two primary classes detected, namely: those with highest expression in the caput (let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p), or highest expression in the cauda (miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:8]
0135605.g008 Fig 8In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
It also highlighted the caput-specific expression of miR-9-5p, and confirmed a significant up-regulation of miR-486-5p and miR470c-5p between the caput and corpus epididymis. [score:6]
Similarly, within the differentially expressed pool of miRNAs, 10 were identified that are intimately involved in regulating intracellular trafficking pathways, including: miR-7b-5p, miR-9-5p, miR-31-5p, miR-92a-3p, miR-106-5p, miR-126-3p, miR-150-5p, miR-204-5p, miR-222-3p, and miR-322-5p (S2 Fig). [score:4]
[1 to 20 of 5 sentences]
54
[+] score: 31
Although the exact effect of miR-9 expression during neuronal conversion remains elusive, its expression might be affected by induction or culture conditions (e. g., defined factors, medium, or feeder cells). [score:5]
In contrast to miR-124, we did not observe miR-9 expression over time during neuronal conversion (Fig.   2d,e), even though miR-9 reportedly exhibits strong expression in the brain and promotes neural differentiation [44]. [score:5]
Interestingly, overexpression of miR-9 and its opposite strand (miR-9*) in combination with miR-124 facilitates the reprogramming of human fibroblasts into neurons [45], suggesting a positive role for miR-9 in direct neuronal conversion. [score:4]
Notably, qRT-PCR analysis indicated that miR-124 levels were significantly upregulated at 7 days post-SeVdp(ABMN) infection, whereas miR-9 levels remained comparable to levels observed in uninfected MEFs (Fig.   2e). [score:4]
Subsequent qRT-PCR analysis indicated that expression levels of let-7a in NHDFs and WJSCs were considerably higher than those in hiPSCs and H9-NSCs, but H9-NSCs had relatively high levels of miR-9 and miR-124 compared to other cells (Supplementary Fig.   S2b,c), suggesting that the extent of the reduction in EGFP synthesis should be affected by levels of target miRNAs in the infected cells. [score:4]
Expression levels of miR-9 and miR-124 were examined by qRT-PCR at 7 days post-infection of MEFs with SeVdp(ABMN). [score:3]
Alternatively, miR-9 might be preferentially expressed in specific neuronal subtypes. [score:3]
Coolen M Katz S Bally-Cuif L miR-9: a versatile regulator of neurogenesisFront. [score:2]
To investigate the potency of SeVdp-miR-Sensor, we constructed vectors containing target sequences for let-7a (SeVdp-let-7aT), miR-302a (SeVdp-302aT), miR-9 (SeVdp-9T), or miR-124 (SeVdp-124T), as well as a vector containing complementary sequences for a portion of the firefly luciferase gene (SeVdp-FlucT) as a control. [score:1]
[1 to 20 of 9 sentences]
55
[+] score: 30
Knockdown of miR-9 in a mouse leukemia mo del suppressed AML cell proliferation, decreased leukemic cell counts in blood and bone marrow, reduced splenomegaly, and increased survival times, indicating that miR-9 is a potential target for treatment of AML [90]. [score:6]
Ectopic expression of miR-9 or miR-9* blocked neutrophil development in the myeloid 32D cell line and in mouse primary lineage -negative bone marrow cells by inhibiting ETS-related gene (ERG) [32]. [score:6]
Similarly, reduced expression of the miR-9 target Hes1 has been to be an indicator of poor prognosis for AML [89]. [score:5]
Coincidentally, high expression of miRNA-9 was identified in the leukemic progenitor cells (LPs) from CD34 [+] adult CN-AMLs [90]. [score:3]
Overexpression of miR-9 has been shown to enhance transformation of murine hematopoietic progenitor cells by MLL-AF9 [30]. [score:3]
Also, miR-9 targeting of the LIN28B/Let-7/HMGA2 axis induces monocytic differentiation in KASUMI-1 cells [31]. [score:3]
High expressions of both miR-9 and 9* (miR-9/9*) were detected in most cases from a cohort of 647 primary AML patients. [score:3]
For example, miR-9 (miR-9-5p) and miR-9* (miR-9-3p) are highly conserved miRNAs produced from a single precursor. [score:1]
[1 to 20 of 8 sentences]
56
[+] score: 30
Expression of miR-204 is associated with an insulin functional phenotype in PETsExpression of miR-204 and of the closely related miR-211, miR-375, and miR-9 was analyzed by real-time qRT-PCR in functional pancreatic neuroendocrine tumors (PET) of which 7 expressed insulin (Ins-F-PET), 4 glucagon or somatostatin (Gluc/Som-F-PET, 3 glucagonomas, 1 somatostatinoma), and in 7 non-functional tumors (NF-PET) (Supplementary Table  S1). [score:7]
Expression of miR-204 and of the closely related miR-211, miR-375, and miR-9 was analyzed by real-time qRT-PCR in functional pancreatic neuroendocrine tumors (PET) of which 7 expressed insulin (Ins-F-PET), 4 glucagon or somatostatin (Gluc/Som-F-PET, 3 glucagonomas, 1 somatostatinoma), and in 7 non-functional tumors (NF-PET) (Supplementary Table  S1). [score:5]
A consistent trend for higher expression of miR-375 and miR-9 in Gluc/Som-F-PET was also evident. [score:3]
Logistic regression analysis, based on negative or positive immunohistochemical staining, showed that in PETs the expression of insulin at the protein level was predicted by both miR-204 (OR: 16.8, 1.49–189 p = 0.022) and miR-211 (OR: 9.65, 1.09–85 p = 0.041) but not by miR-375 (OR: 0.35, 0.09–1.34) or miR-9 (OR: 0.73; 0.23–2.26). [score:3]
Box and whisker plot (min to max) of miR-204, miR-211, miR-375, and miR-9 levels expressed as fold change relative to median levels in human islets (HI) in Ins-F-PET (dark grey boxes), Gluc/Som-F-PET (light grey boxes), and NF-PET (clear boxes); the significance of differences was analyzed using the Mann Whitney test. [score:3]
In pancreatic islets expression of miR-9, another miRNA implicated in the regulation of insulin secretion, was markedly lower compared to both miR-204 and miR-375, with median levels 87 and 3857 fold lower, respectively. [score:3]
2010.04.116 20417623 6. Plaisance V MicroRNA-9 controls the expression of Granuphilin/Slp4 and the secretory response of insulin-producing cellsJ. [score:2]
Moreover, several miRNAs, like miR-375, miR-124a, miR-96, and miR-9, are implicated in the regulation of insulin secretion 5, 6, 21, 22. [score:2]
Box and whisker plot (min to max) of miR-204 (grey boxes), miR-211 (clear boxes), miR-375 (dark striped boxes), and miR-9 (dotted boxes) levels in human islets (HI), acinar, ductal, and pMSC cells. [score:1]
Neither the expression of miR-204 or miR-211 nor that of miR-375 and miR-9 correlated with any of the other evaluated genes (Supplementary Table  S2). [score:1]
[1 to 20 of 10 sentences]
57
[+] score: 30
Two miRNAs (miR-9-5p and miR-183-5p) were regulated by O [3], and these were shown to target the NF-kB protein and mRNA experimentally (Western blot and qRT-PCR) [46] and by in silico analysis (TargetScan). [score:6]
miR-9-5p expression levels were downregulated. [score:6]
miR-9-5p expression levels were downregulated significantly compared to control, and this may increase NF-kB mRNA levels that in turn may induce anti-proliferative effects [72]. [score:5]
This mRNA is targeted by miR-9-5p [47], miR-21-5p, miR-16-5p (TargetScan), miR-183-5p [47], miR-486b-5p [82], and miR-153-3p [47]. [score:5]
Two miRNAs (miR-9-5p and miR-183-5p) were significantly changed by O [3], and these were shown to target the NF-kB mRNA experimentally [46] and by in silico analysis (TargetScan), respectively. [score:5]
FOXO1 is targeted by a multitude of miRNAs that are changed in our study miR-9-5p, miR-21-5p, miR-16-5p, miR-183-5p [47], miR-486b-5p, and miR-153-3p. [score:3]
[1 to 20 of 6 sentences]
58
[+] score: 29
In a study, Shi and his colleagues provided evidence that miR-9 and miR-140-5p downregulate FOXP2 expression by targeting FOXP2 3’-UTR [140]. [score:8]
Similarly, other miRNAs (let-7a, miR-9, and miR-129-5p) are also found to inhibit FOXP2 expression in a dosage -dependent manner and target specific sequences in the 3’-UTR of FOXP2 during early cerebellum development [141]. [score:8]
Interestingly, substantial miRNAs (miR-9, miR-132, let-7a and miR-140-5p) are found to be lost in the striatum of mammals which is a region important for speech and language, where FOXP2 is expressed [142, 143]. [score:3]
Recently, Clovis et al reported that miR-9 and miR-132 repress FOXP2 expression in mouse embryonic brain [139]. [score:3]
Meanwhile, FOXO3 and FOXO1 are found to be critical targets of miR-9 in hematopoietic cells [76]. [score:3]
FOXO1 is also a target of many cancer-related miRNAs, including miR-96, miR-183-96-182 cluster, miR-196a, miR-9, miR-705, miR-137. [score:3]
miR-9 and miR-33 are the most possible candidate miRNAs due to their conservation and their location in flanking regions of low secondary structure stability [160]. [score:1]
[1 to 20 of 7 sentences]
59
[+] score: 29
With exception of miRNA-155, down-regulated in serum of AMD patients and in serum of Aβ injected rats, six miRNAs (miR-9, miR-23a, miR-27a, miR-34a, miR-146a, miR-126) showed an up-regulation in serum of AMD patients. [score:7]
MicroRNA expression in human retinal pigment epithelial (ARPE-19) cells: increased expression of microRNA-9 by N-(4-hydroxyphenyl)retinamide. [score:5]
Analysis of these 13 miRNAs revealed that 7 miRNAs showed a significant up-regulation in serum of AMD patients in comparison to control group (miR-9, miR-23a, miR-27a, miR-34a, miR-146a, miR-155, and miR-126). [score:4]
In particular, up-regulation of miR-9, miR-23a, miR-27a, miR-34a, miR-126, and miR-146a was found in serum of AMD patients. [score:4]
In conclusion, the modified miRNA levels we found in rat retina (miR-27a, miR-146a, miR-155) and serum of AMD patients (miR-9, miR-23a, miR-34a, miR-126, miR-27a, miR-146a, miR-155) suggest that, among others, miR-27a, miR-146a, and miR-155 have an important role in AMD and could represent suitable biomarkers and appealing pharmacological targets. [score:3]
The following groups of miRNAs were analyzed: miR-27a, miR-146a, miR-155 miR-9, miR-23a, miR-27a, miR-34a, miR-126,miR-146a, miR-155 miR-155 GraphPad Prism (version 4.0; GraphPad Software, San Diego, CA, USA) was used for statistical analysis and graphical representation of miRNA differential expression data. [score:3]
Incidentally, we showed that changes in circulating levels of some miRNAs (miR-9, miR-23a, miR-27a, miR-34a, miR-126, miR-146a, miR-155) as found in AMD patients are associated to Alzheimer's disease and modulate genes involved in neurodegenerative and inflammatory pathways. [score:3]
[1 to 20 of 7 sentences]
60
[+] score: 29
We observe large increases in expression over time for miR-375 [24], [25], miR-7 [26] and miR-503 [15], though for the insulin secretion regulating miRNA miR-9 [27] expression rises and then falls (data not shown). [score:6]
Figure 4(A) shows the expression profile of CD47 and one of its predicted regulating miRNAs – miR-9. A clear anti-correlation is observed, as expected if miR-9 is regulating CD47 levels. [score:5]
ITGB1 gene expression levels anti-correlate with miR-9 levels, but in this case the change in gene expression, particularly at later time points, cannot be well explained by changes in H3K4me [3] which generally stays below the background threshold. [score:5]
A counter-argument to the importance of miR-9 on the regulation of CD47 expression is the H3K4me [3] levels around the CD47 TSS. [score:4]
The miR-9 target, Integrin Beta1 (ITGB1), has recently been shown to play a role in pancreatic development [42], but again the functional link between miR-9 and ITGB1 has not been reported previously. [score:4]
These levels correlate strongly with the gene expression implying that miR-9′s effect, if present, may only be small. [score:3]
An example of this, again involving miR-9, is shown in Figure 4(B). [score:1]
miR-9 is known to be involved in insulin secretion [27], [40] as is CD47 and its receptor SHPS-1 [41]. [score:1]
[1 to 20 of 8 sentences]
61
[+] score: 29
The bifunctional microRNA miR-9/miR-9 [*] regulates REST and CoREST and is downregulated in Huntington's disease. [score:7]
In other studies it has been shown that certain like miR-9 (Dajas-Bailador et al., 2012) and miR-138 (Liu et al., 2013) inhibit axonal extension by targeting Map1b and SIRT1, respectively. [score:5]
microRNA-9 regulates axon extension and branching by targeting map1b in mouse cortical neurons. [score:4]
The products of the miR-9 precursor—miR-9-3p and miR-9-5p—target the transcription factors REST and CoREST, respectively (Packer et al., 2008). [score:3]
miR-124 and miR-9 are classical examples of associated with developmental functions. [score:2]
Figure 4 Regulation of neurogenesis by miR-9 and- RMST. [score:2]
A feedback regulatory loop involving microRNA-9 and nuclear receptor TLX in neural stem cell fate determination. [score:2]
miR-9 is also involved in a PFBL with TLX (Figure 4); a factor that regulates proliferation of neural progenitors (Zhao et al., 2009). [score:2]
This mutual repression between miR-9 and REST-CoREST gives rise to a positive FBL (PFBL). [score:1]
In the proliferating progenitors, REST-CoREST, transcriptionally repress all the miR-9 genes, miR-9-1/2/3, and other neuronal genes. [score:1]
[1 to 20 of 10 sentences]
62
[+] score: 29
We demonstrated that miR-9, which targets ELAVL1, decreased its expression in the transition from naïve to GC and mature B cells, suggesting that miRNA could control HuR expression levels. [score:7]
We validated our microrray results by quantitative RT-PCR on CD5 [+], GC and CD5 [−] activated and resting B cell mRNA samples as shown in Supplementary Figure 3. In fact, we validated 10 different miRNAs: mir-150, mir-20b, mir-23a, mir-211, mir-15b, mir-21, mir-106a, mir-146a, mir-9* and mir-155 whose expression trends by quantitative RT-PCR highlighted the same expression trend shown by microarray analysis. [score:5]
Our study identified 8 new differentially expressed miRNAs: mir-323, mir-138, mir-9*, mir-211, mir-149, mir-373, mir-135a and mir-184; that have not been reported in literature so far. [score:3]
Other miRNAs such as mir-155, mir-181b, mir-15a, mir-16, mir-15b, mir-34a, mir-9, mir-30, let-7a, mir-125b, mir-217 and mir-185 modulate the expression of pivotal genes and functions which contribute to the final B-cell maturation [6]. [score:3]
By contrast, specific alterations of Mir-9* expression were never reported in normal B cell populations, even if this miRNA is a selective marker of follicular lymphomas [28]. [score:3]
MiR-9* was significantly overexpressed in germinal centers (GC), mantle zone (MZ), and subepithelial marginal zone (MaZ) in comparison to squamous epithelium (Sq). [score:2]
Locked nucleic acid (LNA) probes with complementarity to miR-9*, miR-29b, and miR-150 were labelled with 5′-biotin and synthesised using Exiqon (Vedbaek, Denmark). [score:1]
Validation of miR-9*, miR-29b and miR-150 on normal tonsils by in situ hybridizationWe validated by in situ hybridization miR-9*, miR-29b and miR-150, selected from microrray results. [score:1]
MiR-9*, miR-29b and miR-150 distribution in normal tonsillar tissue. [score:1]
Validation of miR-9*, miR-29b and miR-150 on normal tonsils by in situ hybridization. [score:1]
MiRNA in situ hybridization analysisLocked nucleic acid (LNA) probes with complementarity to miR-9*, miR-29b, and miR-150 were labelled with 5′-biotin and synthesised using Exiqon (Vedbaek, Denmark). [score:1]
We validated by in situ hybridization miR-9*, miR-29b and miR-150, selected from microrray results. [score:1]
[1 to 20 of 12 sentences]
63
[+] score: 29
Each data point stands for one gene Of the four miRNAs that were significant, three miRNAs, miR-124, miR-9, and miR-128, show highly specific expression in the brain, based on a dataset of miRNA expression profiles across 40 human tissue samples [21] (Fig.   3b), which is consistent with the observed brain-specific destabilization of their targets. [score:7]
Each data point stands for one gene Of the four miRNAs that were significant, three miRNAs, miR-124, miR-9, and miR-128, show highly specific expression in the brain, based on a dataset of miRNA expression profiles across 40 human tissue samples [21] (Fig.   3b), which is consistent with the observed brain-specific destabilization of their targets. [score:7]
For validation of miRNA targets, we obtained experimentally validated targets of hsa-miR-124-3p, hsa-miR-128-3p, hsa-miR-29(a/b/c)-3p, and hsa-miR-9-5p from miRTarBase [35] release 6.1, which is a database of miRNA-target interactions collected from literature. [score:7]
Of these miRNAs, miR-124 and miR-9 are involved in development and function of the nervous system 22, 23, and de-regulation of miR-128 is associated with tumors of the nervous system 24, 25. [score:3]
Zhao C Sun G Li S Shi Y A feedback regulatory loop involving microRNA-9 and nuclear receptor TLX in neural stem cell fate determinationNat. [score:2]
Specifically, presence of 3′ UTR binding sites for miR-124, miR-29, miR-9 and miR-128 was significantly associated with reduced mRNA stability, whereas binding sites of RBFOX and ZFP36 families of RBPs were significantly associated with increased stability. [score:1]
We show that a substantial portion of the brain mRNA stability profile can be explained by the functions of two RNA -binding protein families (the RBFOX and ZFP36 families) and four miRNAs (miR-124, miR-29, miR-9, and miR-128). [score:1]
Furthermore, our high-confidence network is significantly enriched for experimentally validated interactions that are collected from the literature for each of the four miRNAs miR-124, miR-128, miR-29, and miR-9 [35] (Fig.   4e). [score:1]
[1 to 20 of 8 sentences]
64
[+] score: 29
We observed a large increase in the number of miRNAs expressed at 12 days RA and many of these miRNAs were significantly up-regulated between 8 and 12 days including the REST regulated miRNAs miR-9 and miR-124, which play important roles in neurogenesis [9], [10], [14], [16] and miR-21, which has been proposed as a suppressor of pluripotency in embryonic stem cells [41] (Fig. 8). [score:9]
There are also reports linking non-coding RNAs with neurological disorders such as Parkinson's disease (miR-133b) [17], Huntington's disease (miR-132, miR-9) [18], [19], Alzheimer's disease (miR-29 and miR-107) [20], [21], and Tourette's syndrome (miR-189) [22]. [score:7]
Since, in our NT2-RA time-course, the decrease in REST expression preceded the increase in expression of miR-9 we investigated whether other miRNAs, which increased in the first 8 days, may target REST (Fig. 5). [score:5]
Although miR-9 has been shown to down-regulate REST via MREs in the REST 3′-UTR it is also repressed by REST [16], [19]. [score:4]
In these cells, this phase follows the down-regulation of REST, which has been shown to repress transcription of a number of neural miRNAs including miR-124, miR-9, miR-21, miR-106b and miR-93 [16], [41]. [score:4]
[1 to 20 of 5 sentences]
65
[+] score: 28
Other miRNAs from this paper: hsa-mir-9-1, hsa-mir-9-2
Specifically, by first identifying the p38 transcription network as critical in disease outcome, by following this identification to uncover a possible regulatory mechanism involving the miRNA hsa-mir-9, and to finally match drug response to this network behavior, we reveal the clinical relevance of the p38-miR9 network and call for continued clinical scrutiny of it. [score:4]
Possible binding between hsa-miR-9 and genes within the p38 pathway strengthen the hypothesis that miR-9 may indeed be a key regulator over pathway behavior and may serve as a potential therapeutic target for GBM patients. [score:4]
Combined, these results call for attention to p38 network targeted treatment and present the p38 network-hsa-miR-9 control mechanism as critical in GBM progression. [score:3]
Interestingly, we were able to find significant negative correlation (P-value < 0.0001) between the p38 network and the miRNA hsa-miR-9. Further, gene sequences revealed that 4 out of the 13 genes in the pathway have a possible binding site for hsa-miR-9 (this analysis was performed using PITA [28], a prediction algorithm for potential miRNA targets). [score:3]
Interestingly, the same phenomenon is evident when considering drug control over the network; patients that receive drugs that target and inactivate the network have better prognosis, perhaps in a similar manner to that confered by hsa-miR-9. To support pathway behavior and to demonstrate its robustness as a clinical biomarker, we demonstrate that the same network behavior associates patients with outcome, regardless of specific batches of experimental procedures. [score:3]
Genes highlighted in blue are in the p38 signaling pathway, and the genes in red boxes are those found by PITA to be possibly targeted by hsa-miR-9. (c) Correlation between hsa-miR-9 and p38 pathway levels. [score:3]
Specifically, the regulation of the p38 pathway by hsa-miR-9 may be mimicked by different pharmaceutical components already in use. [score:2]
Figure 2 hsa-miR-9 regulation of the p38 pathway. [score:2]
The microRNA hsa-miR-9 correlated with network behavior and presents binding affinities with network members in a manner that suggests control over network behavior. [score:1]
This network, the p38 network, and an associated microRNA, hsa-miR-9, facilitate prognostic stratification. [score:1]
As we see here, patients in which hsa-miR-9 controls the p38 network in an efficient manner have better prognosis, and patients in which this hsa-miR-9 control fails have poorer prognosis. [score:1]
To investigate if drug regimen does control this pathway's behavior, we identified drugs that target genes in the p38 pathway and may lead to a phenotype similar to the one induced by hsa-miR-9 activity. [score:1]
[1 to 20 of 12 sentences]
66
[+] score: 26
Yet, another pathway regulating VEGF expression was presented by Ma et al (57) who described that the up-regulation of VEGF-A mRNA by miR-9 depends on its ability to down-regulate E-cadherin expression and to activate β-catenin -mediated transcription. [score:12]
E-cadherin has been identified as the direct target of miR-9 and VEGF-A has been described as a transcriptional target gene of β-catenin. [score:6]
miR-9 directly targets CDH1, which is the E-cadherin coding gene, leading to increased cell motility and invasiveness of SUM149 human breast cancer cells (57). [score:4]
The data illustrates a novel mechanism by which miR-9 promotes angiogenesis through stimulation of VEGF-A expression in breast cancer. [score:3]
Other miRNAs, such as miR-30, miR-17-5p, miR-9, are phase-specific. [score:1]
[1 to 20 of 5 sentences]
67
[+] score: 26
In parallel, we observed upregulation of miR-9 in all MDM + TMVs in comparison to control MDM, however expression of miR-9 in MDM + TMV0d was much higher than in MDM + TMV6d. [score:6]
Fig.  5Expression of selected (involved in the MDM differentiation process) microRNAs in MDM + TMV0d and MDM + TMV6d vs control MDM (black line at level 1) presented as relative expression normalized to U6 (2 [−ΔΔCT]): miR-155 (a), miR-378 (b), miR-9 (c), miR-21 (d), miR-511 (e). [score:5]