miRBase entry: hsa-mir-9-3

Stem-loop hsa-mir-9-3


Accession
MI0000468
Symbol
HGNC: MIR9-3
Description
Homo sapiens hsa-mir-9-3 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR9-3 is one of the three main transcripts of the MIR9 gene family, which is associated with the regulation of gene expression post-transcriptionally and is located on chromosome 15 [PMC9220270]. It, along with MIR9-1 and MIR9-2, has been identified as having a promoter region subject to methylation, which can be indicative of its regulatory role in cancer metastasis and progression [PMC8835734]. The methylation status of MIR9-3, as well as its counterparts MIR9-1 and MIR9-2, can be specifically analyzed using Methylation Specific PCR (MSP), a technique that targets the CpG region near the transcription start sites of these genes [PMC5366901]. The methylation patterns observed in these regions have been associated with both metastasis and advanced stages in primary tumors, suggesting that alterations in methylation at these sites may have significant implications for cancer prognosis [PMC8835734].

Literature search
542 open access papers mention hsa-mir-9-3
(3363 sentences)

Sequence

663527 reads, 1289 reads per million, 111 experiments
ggaggcccguuucucUCUUUGGUUAUCUAGCUGUAUGAgugccacagagccgucAUAAAGCUAGAUAACCGAAAGUagaaaugauucuca
.((((..(((((((((.(((((((((((((((.(((((..((......))..))))).))))))))))))))))).)))))))..)))).

Structure
g    cc       -  C               G     gu  ca 
 gagg  cguuucu cU UUUGGUUAUCUAGCU UAUGA  gc  c
 ||||  ||||||| || ||||||||||||||| |||||  ||   
 cucu  guaaaga GA AAGCCAAUAGAUCGA AUAcu  cg  a
a    ua       U  -               A     gc  ag 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr15: 89368017-89368106 [+]

Disease association
hsa-mir-9-3 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-9-5p

Accession MIMAT0000441
Description Homo sapiens hsa-miR-9-5p mature miRNA
Sequence 16 - UCUUUGGUUAUCUAGCUGUAUGA - 38
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-9-3p

Accession MIMAT0000442
Description Homo sapiens hsa-miR-9-3p mature miRNA
Sequence 55 - AUAAAGCUAGAUAACCGAAAGU - 76
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739