MIR9-3 is one of the three main transcripts of the MIR9 gene family, which is associated with the regulation of gene expression post-transcriptionally and is located on chromosome 15 [PMC9220270]. It, along with MIR9-1 and MIR9-2, has been identified as having a promoter region subject to methylation, which can be indicative of its regulatory role in cancer metastasis and progression [PMC8835734]. The methylation status of MIR9-3, as well as its counterparts MIR9-1 and MIR9-2, can be specifically analyzed using Methylation Specific PCR (MSP), a technique that targets the CpG region near the transcription start sites of these genes [PMC5366901]. The methylation patterns observed in these regions have been associated with both metastasis and advanced stages in primary tumors, suggesting that alterations in methylation at these sites may have significant implications for cancer prognosis [PMC8835734].
g cc - C G gu ca gagg cguuucu cU UUUGGUUAUCUAGCU UAUGA gc c |||| ||||||| || ||||||||||||||| ||||| || cucu guaaaga GA AAGCCAAUAGAUCGA AUAcu cg a a ua U - A gc ag
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000441 |
| Description | Homo sapiens hsa-miR-9-5p mature miRNA |
| Sequence | 16 - UCUUUGGUUAUCUAGCUGUAUGA - 38 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000442 |
| Description | Homo sapiens hsa-miR-9-3p mature miRNA |
| Sequence | 55 - AUAAAGCUAGAUAACCGAAAGU - 76 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|