Accession | MIMAT0000441 |
Description | hsa-miR-9-5p mature miRNA |
Hairpins | |
Sequence | UCUUUGGUUAUCUAGCUGUAUGA |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0051055 negative regulation of lipid biosynthetic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25592151 | |
acts_upstream_of | GO:1901202 negative regulation of extracellular matrix assembly |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26315535 | occurs_in CL:0002553 |
acts_upstream_of | GO:1901223 negative regulation of non-canonical NF-kappaB signal transduction |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26354749 | |
acts_upstream_of | GO:1901492 positive regulation of lymphangiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26354749 | occurs_in CL:0002138 |
acts_upstream_of_or_within | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26354749 | has_input UniProtKB:P35916 |
enables | GO:0003727 single-stranded RNA binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23985560 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19289835 | has_input UniProtKB:P19838 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25592151 | has_input UniProtKB:Q07869 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26354749 | has_input UniProtKB:P19838 |
enables | GO:0008035 high-density lipoprotein particle binding |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in UBERON:0000955 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19289835 | has_input UniProtKB:P19838 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25592151 | has_input UniProtKB:Q07869 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25809226 | has_input UniProtKB:P05231 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26315535 | occurs_in CL:0002553 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26315535 | occurs_in CL:0002553 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26354749 | has_input UniProtKB:P19838 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29584810 | has_input UniProtKB:O95477 |
involved_in | GO:0007162 negative regulation of cell adhesion |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:2000058 |
involved_in | GO:0008285 negative regulation of cell population proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25809226 | |
involved_in | GO:0030336 negative regulation of cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25809226 | |
involved_in | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26315535 | occurs_in CL:0002553 |
involved_in | GO:0031047 regulatory ncRNA-mediated gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23985560 | |
involved_in | GO:0033689 negative regulation of osteoblast proliferation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19289835 | has_input UniProtKB:P19838 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25592151 | has_input UniProtKB:Q07869 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|