miRBase entry: hsa-mir-9-1

Stem-loop hsa-mir-9-1


Accession
MI0000466
Symbol
HGNC: MIR9-1
Description
Homo sapiens hsa-mir-9-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR9-1 is a microRNA implicated in various cellular processes, including apoptosis and cell proliferation [PMC9220270]. In the context of lung cancer, MIR9-1 has been identified as having a proapoptotic effect, which suggests that it can promote programmed cell death in cancerous cells [PMC9220270]. Additionally, MIR9-1 is involved in the suppression of cell proliferation, and this function is mediated through its interaction with the UHRF1 protein [PMC9220270]. UHRF1 has been known to play a role in gene expression regulation by interacting with epigenetic marks. The hypermethylation of MIR9-1 gene has been associated with an increased relative risk of death in lung cancer patients [PMC8835734]. This epigenetic alteration can lead to the downregulation of MIR9-1 expression, which may contribute to cancer progression by reducing its proapoptotic and antiproliferative effects. The study highlights the significance of MIR9-1 as a potential biomarker for lung cancer prognosis and as a target for therapeutic interventions [PMC8835734].

Literature search
547 open access papers mention hsa-mir-9-1
(3386 sentences)

Sequence

663527 reads, 1291 reads per million, 111 experiments
cgggguugguuguuaUCUUUGGUUAUCUAGCUGUAUGAgugguguggagucuucAUAAAGCUAGAUAACCGAAAGUaaaaauaacccca
.(((((((....((((.(((((((((((((((.((((((.(.(....).).)))))).))))))))))))))).))))...))))))).

Structure
c       guug    C               G      u g g 
 gggguug    uuaU UUUGGUUAUCUAGCU UAUGAg g u u
 |||||||    |||| ||||||||||||||| |||||| | |  
 ccccaau    aaUG AAGCCAAUAGAUCGA AUAcuu u a g
a       -aaa    A               A      c g g 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr1: 156420341-156420429 [-]

Disease association
hsa-mir-9-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-9-5p

Accession MIMAT0000441
Description Homo sapiens hsa-miR-9-5p mature miRNA
Sequence 16 - UCUUUGGUUAUCUAGCUGUAUGA - 38
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-9-3p

Accession MIMAT0000442
Description Homo sapiens hsa-miR-9-3p mature miRNA
Sequence 55 - AUAAAGCUAGAUAACCGAAAGU - 76
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739