Accession | MIMAT0000442 |
Description | hsa-miR-9-3p mature miRNA |
Hairpins | |
Sequence | AUAAAGCUAGAUAACCGAAAGU |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0032410 negative regulation of transporter activity |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:28260112 | has_input UniProtKB:P08183 |
acts_upstream_of | GO:1905700 negative regulation of xenobiotic detoxification by transmembrane export across the plasma membrane |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:28260112 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23530058 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28260112 | has_input UniProtKB:P08183 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23530058 | has_input UniProtKB:P05556 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28260112 | has_input UniProtKB:P08183 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23530058 | has_input UniProtKB:P05556 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28260112 | has_input UniProtKB:P08183 |
located_in | GO:0070062 extracellular exosome |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | produced_by CL:0000540 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|