sort by

231 publications mentioning hsa-mir-195 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-195. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 426
Supported by miRNA target analysis and luciferase reporter assays, we propose that miR-195-5p targets the 3′-UTR of YAP1 mRNA and inhibits YAP expression, leading to proliferative inhibition in CRC cells. [score:10]
Moreover, upregulation of miR-195-5p suppresses proliferation, migration, invasion, and EMT of colon cancer cells through targeting the YAP1 mRNA 3′-UTR. [score:8]
Our results demonstrated that miR-195-5p was a potent suppressor of YAP1, and miR-195-5p -mediated downregulation of YAP1 significantly reduced tumor development in a mouse CRC xenograft mo del. [score:7]
Thirdly, miR-195-5p can directly regulate expression of YAP1 by targeting its 3′-UTR. [score:7]
The presumed targets of integrated-signature miRNAs, especially the most significant has-miR-195, were identified by four different target prediction algorithms: TargetScan v7.1 (http://www. [score:7]
Downregulation of miR-195-5p is concomitant with upregulation of YAP1 in primary human CRC. [score:7]
Additionally, consistent with the proposed regulations of miR-195-5p on the Hippo pathway and EMT, expression patterns of YAP, Ki67, Vimentin, ZEB2, and E-cadherin in miR-195-5p-agomir -treated tumors were similar to the in vitro results, substantiating the tumor suppressor function of miR-195-5p in CRC tumorigenesis (Fig.   7e–g). [score:6]
YAP1 expression was downregulated after miR-195-5p treatment by qRT-PCR analysis and western blot. [score:6]
Additionally, expressions of TAZ, Vimentin, ZEB2, and SMAD3 protein were also negatively regulated by miR-195-5p, while E-cadherin was positively regulated by miR-195-5p, suggesting the negative regulations of miR-195-5p on the Hippo pathway and EMT in CRC cells. [score:6]
Hence, major players in this pathway may be tightly regulated by miR-195-5p in the colorectum, and miR-195-5p restoration could target YAP/TAZ/EMT pathway to suppress CRC progression. [score:6]
The multicenter sequencing of 1893 carcinoma/normal paired samples revealed that miR-195-5p was a tumor-suppressing miRNA and was downregulated in tumor tissues [10]. [score:6]
Furthermore, the present study also shed light on the potential role of miR-195-5p in CRC metastasis, where ectopic expression of miR-195-5p could reduce cell migration and invasion and promote expression of the EMT marker, E-cadherin. [score:5]
Cell culture and transfection of miR-195 mimic, inhibitor, and siRNA of target gene. [score:5]
We transfected DLD1 and HCT116 cells with miR-195-5p mimic or miR mimic NC, and miR-195-5p inhibitor or miR-195-5p inhibitor NC, separately. [score:5]
The results showed that miR-195-5p suppressed luciferase activity whereas miR-195-5p inhibitor could promote luciferase activity for the reporter plasmid carrying wild-type YAP1 3′-UTR (Fig.   6c, P < 0.05), but no significant effects were observed for the reporter plasmid carrying mutant YAP1 3′-UTR (i. e., pmiR-RB-REPORT [TM]-mut-YAP1-3′-UTR). [score:5]
Fig. 4Ectopic expression of miR-195-5p inhibits proliferation and colony formation of DLD1 and HCT116 cells. [score:5]
In contrast, miR-195-5p inhibitor treatment could lift this inhibition (Fig.   4a–b). [score:5]
As miR-195 showed a consistent pattern of downexpression in human CRC, we wondered about the expression pattern of miR-195-5p in the colon cancer cell lines. [score:5]
Since predicted targets of miR-195-5p were enriched for the Hippo/YAP signaling pathway, we hypothesize that miR-195-5p may function by targeting the YAP1 mRNA. [score:5]
The miR-195-5p -expressing cells migrated toward the wound at a much slower rate than the control or the cells treated by miR-195 inhibitors (Fig.   5a–b). [score:5]
Cells were washed by phosphate-buffered saline (PBS, pH 7.4) before transient transfection with 50 nM miR-195-5p mimic or miR mimic NC, 100 nM miR-195-5p inhibitor or miR inhibitor NC. [score:5]
Bold italics indicate statistically significant values (P < 0.05) Significantly, in spite of the presence of biological and technical confounding factors, such as the differences in sample cohorts, treatments, and microarray technologies, in all eight independent CRC expression microarrays, our results indicated the importance of miR-195 expression in human CRC (Fig.   2d). [score:5]
f Kaplan–Meier analysis of OS based on YAP1 mRNA levels in 60 cases of CRC patients Since the Hippo pathway emerged in our previous KEGG analysis for the miR-195 targets, it is conceivable that miR-195 may directly regulate this pathway during CRC tumorigenesis. [score:5]
e Venn diagrams of putative miR-195 targets predicted by TargetScan (v7.1), miRDB, PicTar, and DIANA-TarBase (v7.0). [score:5]
Fig. 7Ectopic expression of miR-195-5p suppresses tumor growth in vivo. [score:5]
These results suggest that miR-195-5p binds directly to the predicted binding site(s) in the YAP1 3′-UTR and negatively regulates YAP1 expression. [score:5]
f Kaplan–Meier analysis of OS based on YAP1 mRNA levels in 60 cases of CRC patients Since the Hippo pathway emerged in our previous KEGG analysis for the miR-195 targets, it is conceivable that miR-195 may directly regulate this pathway during CRC tumorigenesis. [score:5]
Representative photomicrographs (a) and quantifications (b) of BrdU staining in DLD1 and HCT116 cells after transfection with miR-195-5p mimic, miR-195-5p mimic NC, miR-195-5p inhibitor, or miR-195-5p inhibitor NC for 48 h. Bar = 100 μm. [score:5]
We next examined the pathophysiological significance of miR-195-5p downregulation in CRC and its underlying regulatory mechanisms. [score:5]
Hsa-miR-195 mimic and mimic negative control (NC), hsa-miR-195 inhibitor, and inhibitor negative control (NC) were purchased from RiboBio Co. [score:5]
Both qRT-PCR and western blotting revealed that the YAP1 level was reduced in miR-195-5p -expressing cells, while its level was restored in miR-195-5p inhibitor -treated cells (Fig.   6d–f). [score:5]
Four downregulated miRNAs (hsa-let-7a, hsa-miR-125b, hsa-miR-145, and hsa-miR-195) can be potentially useful diagnostic markers in the clinic. [score:4]
Only hsa-let-7a, hsa-miR-125b, hsa-miR-145, and hsa-miR-195 were significantly downregulated in CRC tumors (Fig.   1c), and each of these miRNAs could provide a high accuracy on CRC tissue classification as estimated by ROC curve analysis (Fig.   2a; Additional file 10: Figure S1a). [score:4]
We showed for the first time that the full-length 3′-UTR of the human YAP1 mRNA was a direct target of miR-195-5p. [score:4]
In addition, we validated and obtained 4 downregulated miRNAs (i. e., hsa-let-7a, hsa-miR-125b, hsa-miR-145, and hsa-miR-195) from over 250 tumors from the TCGA-COAD database which granted us the opportunity to systematically analyze the potential molecular mechanisms associated with the pathophysiology of CRC. [score:4]
d Forest plots summarizing the downregulation of hsa-miR-195 from eight datasets in the integrated analysis. [score:4]
Thus, given the results of the integrated analysis and the in vitro experiments, we hypothesize that the decreased expression of miR-195-5p may promote CRC progression and development. [score:4]
The downregulation of miR-195 has been consistently observed in the CRC patients with poor overall survivals, indicating that miR-195 may be functionally important in CRC pathogenesis. [score:4]
Four downregulated miRNAs (hsa-let-7a, hsa-miR-125b, hsa-miR-145, and hsa-miR-195) were demonstrated to be potentially useful diagnostic markers in the clinical setting. [score:4]
We investigated the mechanism of miR-195-5p -mediated regulations on colon cancer cells and found that over -expression of miR-195-5p markedly inhibited cellular proliferation and invasion of CRC cells. [score:4]
The luciferase reporter plasmid pmiR-RB-REPORT [TM]-YAP1-3′-UTR or mutant reporter plasmid carrying point mutations in the putative miR-195-5p binding sites was co -transfected with miR-195-5p mimics or miR mimic NC and inhibitors, separately. [score:4]
Thus, negative values indicate downregulation of miR-195 in CRC. [score:4]
In the transwell invasion and migration assay, we found that invasion and migration of the miR-195-5p -expressing cells was reduced, and this effect could be reversed by the miR-195-5p inhibitor (Fig.   5c–f). [score:4]
In our study, we confirmed that miR-195 was downregulated in CRC tissues, which was significantly correlated with poor survivals of CRC patients. [score:4]
c Kaplan–Meier curves of the overall survivals (OS) reveal that downregulated miR-195-5p is associated with poor prognosis in CRC patients. [score:4]
Taken together, these results indicate that deregulated miR-195 expression plays a critical role in human CRC. [score:4]
MiR-195-5p targets human YAP1 and inhibits YAP1 in colon cancer cells. [score:4]
Representative photomicrographs (c) and quantifications (d) of the colony formation assay after transfection with miR-195-5p mimic, miR-195-5p mimic NC, miR-195-5p inhibitor, or miR-195-5p inhibitor NC for 8 days. [score:4]
We also identified the Hippo signaling pathway as being enriched in the prediction analysis of the miR-195-5p targets. [score:3]
In previous analysis, the Hippo signaling pathway was significantly enriched for the predicted targets of miR-195-5p (P = 6.47E-05) (Additional file 13: Figure S2). [score:3]
Meanwhile, the protein-protein interaction network (PPI) suggested that YAP1 is the hub gene of the miR-195 targets (Additional file 14: Figure S3). [score:3]
c Kaplan–Meier plots for overall survival for a discriminatory median miR-195 expression, from TCGA sequencing data to assess prognostic accuracy. [score:3]
Functional enrichment and target prediction of miR-195. [score:3]
YAP1, which harbors two conserved miR-195-5p cognate sites, namely, 162-168 and 1857–1862 of YAP1 3′-UTR (Fig.   6b), is a predicted target of miR-195-5p. [score:3]
HCT116 treated with miR-195-5p inhibitor showed mesenchymal features. [score:3]
The most significantly enriched by the predicted targets of miR-195 (P = 6.47E-05). [score:3]
The expression of miR-195 was validated in The Cancer Genome Atlas (TCGA) datasets, and an independent validation sample cohort. [score:3]
Additionally, Kaplan–Meier and Cox’s proportional hazards regression mo del survival analysis revealed that patients with low expression levels of miR-195-5p had shorter overall survival (Fig.   3c, Table  2). [score:3]
To our knowledge, this is the first meta-analysis that reveals the detailed mechanism where loss of miR-195-5p leads to malignant progression of CRC via unleashed expression of YAP1. [score:3]
Furthermore, it is likely that other molecules or signaling pathways will be discovered that are also targeted by miR-195-5p in CRC. [score:3]
Protein-protein interaction network of the consensus target gene of miR-195-5p. [score:3]
Overexpression of miR-195-5p in DLD1 and HCT116 cells repressed cell growth, colony formation, invasion, and migration. [score:3]
Aberrant expression of hsa-miRNA-195 (miR-195) which is distinguished as a clinically noteworthy miRNA has previously been observed in multiple cancers, yet its role in CRC remains unclear. [score:3]
Interestingly, the top KEGG pathways enriched for the miR-195 targets were mainly associated with cancer-specific pathways (Additional file 12: Table S9), including the Hippo signaling pathway, proteoglycans in cancer, viral carcinogenesis, pathways in cancer, and prostate cancer (Fig.   2f). [score:3]
Firstly, reduced expression of miR-195-5p in primary CRC was revealed independently by both integrated analysis and TCGA-COAD validation analysis, suggesting miR-195-5p can be an effective diagnostic and prognostic marker in the clinical setting. [score:3]
Ectopic expression of miR-195-5p could significantly reduce proliferation, migration, invasion, and EMT in two colon cancer cell lines, DLD1 and HCT116. [score:3]
Our study may serve as rational for targeting the miR-195-5p/YAP interaction in a novel therapeutic application to medicate CRC patients. [score:3]
Interestingly, we also found that loss of miR-195-5p accelerated YAP expression and promoted nuclear accumulation of YAP and EMT in vitro [19, 55, 56]. [score:3]
Therefore, miR-195-5p significantly inhibits the tumorigenicity of DLD1 cells in vivo. [score:3]
We have demonstrated that miR-195-5p is dramatically downregulated in human CRC tissues compared with normal colorectal tissues. [score:3]
Red frame shows the predicted miR-195 targets. [score:3]
To confirm the tumor suppressor role of miR-195-5p in vivo, we established a BALB/c nude mouse xenograft mo del using DLD1 cells. [score:3]
Secondly, ectopic expression of miR-195-5p in colon cancer cell lines considerably decreased cell growth, migration, and invasion. [score:3]
a Expression of miR-195-5p in two colon cancer cell lines, DLD1 and HCT116, and the normal NCM460 cells. [score:3]
HCT116 cell lines were showed in cell morphology after transfection miR-195-5p inhibitor (10 nM) after 7–10 days. [score:3]
We identified miR-195-5p binding sites within the 3’-untranslated region (3′-UTR) of the human yes -associated protein (YAP) mRNA. [score:3]
These results indicated that the anti-cancer and reverse EMT efficacy of miR-195-5p is partly attributed to its inhibitory role on YAP, which was confirmed by qRT-PCR and western blot of YAP1 (Additional file 16: Figure S5f-g) in DLD1 cells. [score:3]
Inhibition of miR-195-5p function contributed to aberrant cell proliferation, migration, invasion, and epithelial mesenchymal transition (EMT). [score:3]
Collectively, miR-195-5p suppresses tumor cell growth in vitro and tumorigenicity in vivo. [score:3]
a An ROC curve built on a univariate classification mo del based on miR-195 expression across independent TCGA dataset for predicting CRC. [score:3]
Fig. 5Ectopic expression of miR-195-5p in DLD1 and HCT116 cells reduces cell migration and invasion. [score:3]
c Relative luciferase activity of reporter plasmids carrying wild-type or mutant YAP1 3′-UTR in DLD1 and HCT116 cells co -transfected with negative control (NC) or miR-195-5p mimic or miR-195-5p inhibitor. [score:3]
Enrichment analysis of predicted miR-195 targets in KEGG cell signaling pathway database. [score:3]
The results showed that miR-195-5p expression in the tumors was significantly (P < 0.05) reduced in the tumors relative to PANT (Fig.   3b). [score:3]
We conducted target prediction for validated miR-195 with high-stringency. [score:3]
Fig. 3Expressions of miR-195-5p and YAP1 are inversely correlated in primary CRC tumors. [score:3]
For this purpose, we searched different databases for the potential targets of miR-195-5p that exhibited oncogenic properties. [score:3]
Finally, miR-195-5p suppressed tumor growth in vivo. [score:3]
These data offer a plausible mechanism accounting for the tumor-suppressing function of miR-195-5p, further supporting the notion that the miR-195-5p/YAP1/EMT axis can be the therapeutic focus for eliminating CRC tumorigenesis [19]. [score:3]
Soon et al. found aberrant expression of miR-195 could indicate a poorer prognosis in adrenocortical carcinoma [39]. [score:3]
Colon cancer cells were transfected with miR-195 mimic and inhibitor, after which cell proliferation, colony formation, migration, invasion, and dual luciferase reporter were assayed. [score:2]
Only the low level of miR-195 in tumors was substantially correlated with reduced overall survivals of CRC patients, suggesting miR-195 may negatively regulate CRC progression. [score:2]
MiR-195 as a tumor suppressor has been reported in various types of cancer. [score:2]
f Top ten KEGG pathways that are enriched for the miR-195 targets are mainly cancer-specific pathways To further investigate whether the deregulated miRNAs correlate with the survivals of the CRC patients, we performed Kaplan-Meier and Cox’s proportional hazards regression mo del analysis and found that low miR-195 level was significantly correlated with poor overall survivals of CRC patients (Fig.   2c, Table  2), suggesting the prognostic value of miR-195-5p in clinical CRC diagnosis. [score:2]
f Top ten KEGG pathways that are enriched for the miR-195 targets are mainly cancer-specific pathways To further investigate whether the deregulated miRNAs correlate with the survivals of the CRC patients, we performed Kaplan-Meier and Cox’s proportional hazards regression mo del analysis and found that low miR-195 level was significantly correlated with poor overall survivals of CRC patients (Fig.   2c, Table  2), suggesting the prognostic value of miR-195-5p in clinical CRC diagnosis. [score:2]
MiR-195-5p inhibits proliferation and colony formation of colon cancer cells. [score:2]
BrdU incorporation assay revealed that miR-195-5p inhibited DNA synthesis in DLD1 and HCT116 cells (Fig.   4a–b). [score:2]
Significantly, the miR-195-5p level was inversely correlated with the YAP1 level in the tumors as calculated by Pearson’s correlation (R [2] = 0.531, P = 4.02E − 11) (Fig.   3e), suggesting that miR-195-5p may downregulate YAP1 in CRC (Fig.   3e). [score:2]
MiR-195-5p inhibits migration and invasion of colon cancer cells. [score:2]
So far, the results suggest that miR-195-5p negatively regulates YAP1 levels in CRC cells. [score:2]
MiR-195-5p suppresses tumor growth in vivo. [score:2]
These results, taken together, clearly demonstrate that miR-195-5p negatively regulates invasion and migration of colon cancer cells. [score:2]
In addition, clonogenic assay showed that miR-195-5p mimic treatment decreased the clonogenic survivals of DLD1 and HCT116 cells compared with blank controls, while miR-195-5p inhibitor -treated DLD1 and HCT116 cells showed a reversed phenotype (Fig.   4c–d), suggesting miR-195-5p negatively regulates cancer cell proliferation. [score:2]
Similarly, we found a lower expression of miR-195-5p in DLD1 and HCT116 cell lines, compared with the normal intestinal epithelium cell line NCM460 (Fig.   3a). [score:2]
CRC patients with a decreased level of miR-195-5p in tumor tissues had significantly shortened survival as revealed by the TCGA colon adenocarcinoma (COAD) dataset and our CRC cohort. [score:1]
We confirmed that the miR-195-5p level was high in patients with favorable survival in TCGA, and may play a critical role in CRC tumorigenesis. [score:1]
The diamonds represent overall, combined mean difference for miR-195. [score:1]
To assess the prospective functions of the most significant has-miR-195, we discharged the Kyoto Encyclopedia of Genes and Genomes (KEGG) using the Database for Annotation, Visualization and Integrated Discovery (DAVID) [25]. [score:1]
b The 3′-UTR of YAP1 mRNA harbors two miR-195-5p cognate sites. [score:1]
Xenograft mouse mo dels were used to determine the role of miR-195 in CRC tumorigenicity in vivo. [score:1]
Hsa-miRNA-195(miR-195) YAP1 Colorectal cancer (CRC) Epithelial mesenchymal transition (EMT) Prognosis Biomarker Colorectal cancer (CRC) has been the fourth leading cause of cancer death worldwide for several decades [1]. [score:1]
We first examined the effect of miR-195-5p on proliferation of DLD1 and HCT116 cells. [score:1]
e Scatter plots showing the inverse association between miR-195-5p and YAP1 mRNA levels. [score:1]
MiR-195-5p agomir or miR agomir NC (RiboBio Co. [score:1]
We distinguished miR-195-5p as a clinically noteworthy miRNA in CRC as found in lung cancer [18]. [score:1]
In the clinic, miR-195-5p can serve as a prognostic marker to predict the outcome of the CRC patients. [score:1]
Both the volumes and weights of the tumors treated with miR-195-5p agomir were significantly reduced relative to those treated with miR agomir NC (Fig.   7a–d). [score:1]
Future work will focus on revealing additional functions of miR-195-5p in CRC carcinogenesis and progression. [score:1]
For the qRT-PCR detection of mature miR-195-5p expression, we purchased the Bulge-Loop™ miRNA qRT-PCR Primer Set and Control Primer Set (RiboBio, Guangzhou, China). [score:1]
<5 μg/mL) 0.982(0.542–1.780) 0.953  Hsa-miR-195 (≥median vs. [score:1]
Luo et al. found miR-195 might tender a novel tactic for the diagnosis and treatment of breast cancer patients [41]. [score:1]
<5 μg/mL) 0.893(0.506-1.573) 0.695  Hsa-miR-195 (≥median vs. [score:1]
Our integrated microRNA profiling approach identified miR-195-5p independently associated with prognosis in CRC. [score:1]
Li et al. found that extracellular vesicles delivering miR-195 to intrahepatic cholangiocarcinoma could decrease the tumor size and improve survivals in a rat mo del [40]. [score:1]
Starting day 8 post-implantation, we injected miR-195-5p agomir or miR agomir NC intratumorally every 4 days for 7 treatments. [score:1]
The conversion from epithelial cells to mesenchymal cells, characterized by spindle-type cell morphology, was observed in HCT116 cells treated with miR-195-5p inhibitor (Additional file 15: Figure S4). [score:1]
We assessed the role of miR-195-5p on the migration and invasion of DLD1 and HCT116 cells. [score:1]
Among them, only miR-195 is inversely correlated with overall survival in CRC patients. [score:1]
Experimentally, we verified that the Hippo pathway core effector YAP1 mRNA 3′-UTR had two conserved miR-195-5p cognate sites. [score:1]
In addition, we performed KEGG pathway analysis to elucidate the potential biological functions of miR-195 integrated-signature. [score:1]
Supporting this notion, a colorimetric based cellular proliferation assay (i. e., CCK8 assay) showed consistent phenotypes when treating with miR-195-5p mimic or its inhibitor (Fig.   4e–f). [score:1]
g Immunohistochemistry of tumor tissues treated with or without miR-195-5p. [score:1]
[1 to 20 of 132 sentences]
2
[+] score: 405
Other miRNAs from this paper: hsa-mir-17, hsa-mir-20a, hsa-mir-106b, hsa-mir-29c, hsa-mir-520b
Moreover, we demonstrated that upregulation of miR-195 in glioma cells led to the downregulation of phosphorylated pRb and proliferative marker PCNA through downregulation of cyclin D1 and cyclin E1 via directly targeting the 3′-UTR of cyclin D1 and cyclin E1. [score:13]
Moreover, as shown in Supplemental Figure 4, the levels of Cyclin D1 and Cyclin E1 proteins were upregulated in glioma cell lines relative to normal astrocytes, and in tumors relative to adjacent normal tissue, which further confirm the notion that downregulation of miR-195 could lead to upregulation of Cyclin D1 and Cyclin E1 expression in glioma. [score:12]
Similar to our results in glioma, it was previously reported that miR-195 inhibited the hepatocellular carcinoma cells and hepatic stellate cells proliferation, respectively through targeting CyclinD1and CyclinE1 [51]– [52], indicating that the miR-195-downregulation -induced Cyclin D1/Cyclin E1 expression might be Universal among different types of tumors. [score:10]
However, dysregulation of miR-195 did not result in altered expression of another two cell cycle regulators, CDK2 and p21, which are not the predicted targets of miR-195, further demonstrating the specific effect of miR-195 on proliferation through targeting cyclin D1 and cyclin E1 (Figure 4B). [score:9]
miR-195 downregulates cyclin D1 and cyclin E1 by directly targeting their 3. miR-195 Inhibits Glioma Proliferation in vivo. [score:9]
Consistently, flow cytometry analysis showed that enforced expression of miR-195 not only significantly decreased the percentage of cells in the S peak but also increased the percentage of cells in the G1/G0 peak (Figure 2D), suggesting that miR-195 upregulation inhibits proliferation of glioma cells through induction of G1-S arrest. [score:8]
Furthermore, ectopic overexpression of miR-195 did not affect other cell cycle regulators (CDK2 and p21) which were not predicted to be targets of miR-195, further demonstrating that miR-195 affects proliferation by specifically targeting cyclin D1 and cyclin E1. [score:8]
As shown in Figure 2C, overexpression of miR-195 significantly decreased the percentage of BrdUrd-incorporating cells (21.3% vs 36.5% for LN18 cells, and 18.7% vs 34.2% for T98G cells), indicating that upregulation of miR-195 in LN18 and T98G glioma cells inhibits the DNA synthesis. [score:8]
As predicted, upregulation of miR-195 decreased, but inhibition of miR-195 increased, the expression levels of cyclin D1 and cyclin E1 in LN18 and T98G glioma cells (Figure 4B). [score:8]
Western blotting analysis confirmed that overexpression of miR-195 downregulated cyclin D1 and cyclin E1, and luciferase reporter assays demonstrated that miR-195 targeted cyclin D1 and cyclin E1 via the miR-195 binding sites in their 3′-UTRs. [score:7]
On the other hand, miR-195 inhibition -induced glioma cell growth promotion could be antagonized by individually silencing these two targets, and to further extent by co-silencing the two targets (Supplemental Figure 2D). [score:7]
We demonstrated that miR-195 promotes glioma cell proliferation by directly targeting the 3′-UTRs of cyclin D1 and cyclin E1, consequently reducing phosphorylation of pRb and downregulating the proliferative marker PCNA. [score:7]
Importantly, As shown in Figure 4C, ectopically expressing miR-195 only decreased the expression of GFP, which containing the 3′UTR of cyclin D1 or cyclin E1, but did not decreased the expression of GFP-γ-tubulin, indicating that miR-195 specifically affected the 3′UTR of cyclin D1 or cyclin E1 (Figure 4C). [score:7]
Strikingly, we both highlighted the point that one microRNA has multiple targets to perform its biological function, as found that miR-195 exhibited proliferation-inhibiting role by targeting Cyclin D1, Cyclin E1, E2F3 and CCND3. [score:7]
A. miR-195 Downregulates Cyclin D1 and Cyclin E1 by Directly Targeting their-3′UTRs. [score:7]
Importantly, analysis using publicly available algorithms (TargetScan, Pictar, miRANDA) indicates that cyclin D1 and cyclin E1, key regulators of cell cycle, are the predicted targets of miR-195 (Figure 4A). [score:6]
These results suggest that miR-195 upregulation inhibits proliferation of glioma cells. [score:6]
Upregulation of miR-195 suppresses the proliferation of glioma cells. [score:6]
Our findings suggest that miR-195 directly targets the 3′-UTR of the oncogenes cyclin D1 and cyclin E1 to inhibit proliferation by inducing G1-S arrest. [score:6]
Taken together, these results suggest that miR-195 can inhibit proliferation in gliomas, and that downregulation of miR-195 plays an important role in the progression of gliomas. [score:6]
These results indicate that miR-195 may function as a tumor suppressor miRNA and downregulation of miR-195 may correlate with clinical progression in glioma. [score:6]
To determine whether the miR-195 downregulation in glioma cell lines is also clinical relevant, we further examined the miR-195 expression in eight paired glioma tissues and adjacent nontumor tissues from the same patients. [score:6]
As expected, the modified cells displayed upregulated miR-195, reduced Cyclin D1 and Cyclin E1 expression and presented lower growth rate in vitro. [score:6]
Ectopic expression of miR-195 could decreased the proliferation and anchorage-independent growth of glioma cells, while inhibition of miR-195 reversed these effects. [score:5]
Taken together, our results suggest that miR-195 inhibit glioma proliferation both in vitro and in vivo by repressing Cyclin D1 and Cyclin E1 expression. [score:5]
Importantly, consistent with the observed effects of the miR-195 in vitro, miR-195 -overexpressing LN18 glioma cells formed much smaller tumors, about 0.27 fold of the control, indicating a dramatic inhibition of glioma cell proliferation by miR-195 in vivo (Figure 5D–F). [score:5]
Furthermore, we found that overexpression of miR-195 reduced, but inhibition of miR-195 increased, the luciferase activity of cyclin D1-3′UTR or cyclin E1-3′UTR in a consistent and dose -dependent manner (Figure 4D). [score:5]
The average miR-195 expression was normalized to U6 expression. [score:5]
The key finding of the current study is that miR-195 expression is markedly downregulated in glioma cells and clinical glioma tissues as compared to NHA and normal brain tissues. [score:5]
miR-195 expression inversely correlates with Cyclin D1 and Cyclin E1 expression in glioma tissues. [score:5]
Furthermore, overexpression of miR-195 reduced glioma proliferation, tumorigenicity and cell cycle progression, whereas suppression of miR-195 enhanced proliferation, tumorigenicity and cell cycle progression. [score:5]
A. miR-195 Overexpression Inhibits Proliferation of Glioma Cells. [score:5]
Analysis (left) and correlation (right) between miR-195 expression and Cyclin D1 and Cyclin E1 expression levels in 10 freshly collected human glioma samples. [score:5]
Coincidently, Zhang QQ, et al. recently demonstrated that microRNA-195 could play a tumor-suppressor role in human glioblastoma cells by targeting E2F3 and CCND3 [47]. [score:5]
0054932.g006 Figure 6 Analysis (left) and correlation (right) between miR-195 expression and Cyclin D1 and Cyclin E1 expression levels in 10 freshly collected human glioma samples. [score:5]
Collectively, our results indicate that miR-195 is downregulated in gliomas. [score:4]
miR-195 is Downregulated in Glioma Cell Lines and Glioma Tissues. [score:4]
Our results suggest that downregulation of miR-195 plays an important role in enhancing the proliferation of glioma cells. [score:4]
Consistent with these findings, miR-195 has been reported to be downregulated in a variety of different tumor types including hepatocellular carcinoma, gastric cancer and breast cancer [44]– [46]. [score:4]
Finally, we examined whether the low miR-195 -induced Cyclin D1/Cyclin E1 upregulation identified by our study is clinically relevant. [score:4]
Combining Zhang’s work and ours, both two groups demonstrated that miR-195 downregulation promotes glioma cell proliferation. [score:4]
Taken together, our results suggest that downregulation of miR-195 plays an important role in promoting carcinogenesis and progression of gliomas. [score:4]
Taken together, these results suggest that both Cyclin D1 and Cyclin E1 downregulations contribute to miR-195 -induced glioma cell growth arrest. [score:4]
This study demonstrates that miR-195 was significantly downregulated in human glioma cell lines and glioma tissues, compared to the adjacent non-cancerous tissues. [score:3]
A, Predicted miR-195 target sequence in the 3′-UTR of cyclin D1 and cyclin E1 (cyclin D1 3′-UTR and cyclin E1 3′-UTR) and illustration of the three altered nucleotides in miR-195-mut. [score:3]
B. Western blotting analysis of Cyclin D1 and Cyclin E1 expression in vector- or miR-195-transduced cells. [score:3]
C, Representative micrographs (left) and quantification of BrdU incorporating-cells after transfection with NC or miR-195 inhibitor. [score:3]
In the present study, we report that miR-195 was significantly downregulated in glioma cells and clinical glioma tissues, compared to normal human astrocytes (NHA) and non-tumor associated tissues. [score:3]
Western blotting analysis revealed that the phosphorylated pRb (p-pRb) and proliferative marker PCNA were also decreased in the miR-195 -transfected cells and increased in the miR-195 -inhibited cells, further demonstrating that miR-195 plays an important role in the proliferation of glioma cells (Figure 4B). [score:3]
A. Inhibition of miR-195 Promotes Proliferation of Glioma Cells. [score:3]
In this study, cyclin D1 and cyclin E1 were identified as theoretical targets of miR-195 using bioinformatic analysis. [score:3]
, Real-time PCR analysis of miR-195 expression in normal human astrocytes NHA and glioma cell lines, including A172, LN340, U118MG, LN464, SNB19, LN18, T98G, U251MG and LN235. [score:3]
Analysis of the GSE13030 dataset also revealed low expression of miR-195 in glioma tissues. [score:3]
Real-time PCR analysis of miR-195 expression in LN18-Vector and LN18-miR-195 stable cell lines. [score:3]
Meanwhile, western blotting analysis confirmed that the expression levels of Cyclin D1 and Cyclin E1 in the tumors derived from LN18/miR-195 were significantly lower than those in the tumors derived from LN18/Vector (Supplemental Figure 3). [score:3]
Furthermore, we found that ectopic expression of miR-195 dramatically reduced the anchorage-independent growth ability of LN18 and T98G glioma cells (Figure 2B), as indicated by reduced colony numbers and colony sizes. [score:3]
B, Upregulation of miR-195 reduced glioma cell tumorigenicity as determined by anchorage-independent growth assay. [score:3]
Together, these results suggest that inhibition of miR-195 plays an important role in the proliferation and tumorigenic phenotype of glioma cells. [score:3]
0054932.g001 Figure 1, Real-time PCR analysis of miR-195 expression in normal human astrocytes NHA and glioma cell lines, including A172, LN340, U118MG, LN464, SNB19, LN18, T98G, U251MG and LN235. [score:3]
To investigate the biological role of miR-195 in glioma progression, we first examined the effect of overexpressing miR-195 in glioma cells and relative miR-195 expression were analyzed using realtime PCR (Supplemental Figure 1). [score:3]
B, Inhibition of miR-195 promoted the anchorage-independent growth of glioma cells. [score:3]
Analysis of miR-195 expression in glioma cell lines and tissues. [score:3]
The miR-195 mimics, negative control and miR-195 inhibitor were purchased from RiboBio (Guangzhou, Guangdong, China). [score:3]
miR-195 inhibits glioma proliferation in vivo. [score:3]
We were able to demonstrate that cyclin D1 and cyclin E1 are bona fide targets of miR-195 using different methods. [score:3]
B, The expression of miR-195 was examined in paired primary glioma tissues (T) and glioma adjacent nontumor tissues (ANT) from eight individual patients. [score:3]
Figure S3 Western blotting analysis of the expression levels of Cyclin D1 and Cyclin E1 in the tumors derived from LN18/Vector cells, or from LN18/miR-195 cells. [score:3]
D, Flow cytometric analysis of indicated glioma cells after transfection with NC or miR-195 inhibitor. [score:3]
Understanding the precise role played by miR-195 in the progression of glioma will increase our knowledge of tumor biology and explore the potential of miR-195 as a diagnostic/prognostic marker and novel therapeutic target for glioma. [score:3]
Inhibition of miR-195 promotes glioma cell proliferation. [score:3]
Consistent with these results, the anchorage-independent growth ability of LN18 and T98G glioma cells transfected with the miR-195 inhibitor significantly increased, as indicated by increased colony number and size on soft agar (Figure 3B). [score:3]
Figure S1 Real-time PCR analysis of miR-195 expression in LN18-NC, LN18-miR-195, T98G-NC, T98G-miR-195 transfected cells. [score:3]
A. Real-time PCR analysis of miR-195 expression in LN18-Vector and LN18-miR-195 stable cell lines. [score:3]
Collectively, our results suggest that inhibition of miR-195 promotes proliferation and the G1/S cell cycle transition in glioma cells. [score:3]
To further demonstrate the significance of the anti-proliferative function of miR-195 in glioma cells, the growth rate was examined in LN18 and T98G glioma cells transfected with miR-195 inhibitor. [score:3]
As shown in Figure 6, miR-195 levels in 10 freshly collected glioma samples inversely correlated with the expression of Cyclin D1 (r = −0.709, P = 0.022), and Cyclin E1 (r = −0.783, P = 0.002). [score:3]
As shown in Figure 3A, inhibition of miR-195 dramatically increased the growth of LN18 and T98G glioma cells. [score:3]
Taken together, our results demonstrate that cyclin D1 and cyclin E1 are bona fide targets of miR-195. [score:3]
, MTT assays revealed that upregulation of miR-195 reduced cell growth of LN18 and T98G glioma cell lines, compared to negative control (NC) -transfected cells. [score:2]
Moreover, point mutations in the tentative miR-195 -binding seed region in cyclinD1 3′-UTR and cyclinE1 3′-UTR abrogated the aforementioned repressive effect of miR-195 (Supplemental Figure 2A and 2B). [score:2]
Real-time PCR analyses showed that expression of miR-195 was markedly lower in all eight analyzed glioma cell lines, including A172, LN340, U118MG, LN464, SNB19, LN18, T98G, U251MG and LN235, as compared with that in normal human astrocytes (NHA) (Figure 1A). [score:2]
, MTT assays revealed that inhibition of miR-195 promoted cell growth of glioma cell lines of LN18 and T98G. [score:2]
0054932.g003 Figure 3, MTT assays revealed that inhibition of miR-195 promoted cell growth of glioma cell lines of LN18 and T98G. [score:2]
Strikingly, MTT assay showed that miR-195 overexpressing LN18 and T98G glioma cells exhibited significantly lower growth rates (approximately 2-fold lower) than control cells at day 4 after plating (Figure 2A). [score:2]
Figure S2 A. illustration of point mutations in the tentative miR-195 -binding seed region in Cyclin D1 3′-UTR and Cyclin E1 3′-UTR. [score:2]
0054932.g002 Figure 2, MTT assays revealed that upregulation of miR-195 reduced cell growth of LN18 and T98G glioma cell lines, compared to negative control (NC) -transfected cells. [score:2]
However, transfection of the miR-195-mut, containing mutations in the miR-195 seed region, did not decreased the luciferase activity of cyclin D1-3′UTR or cyclin E1-3′UTR (Figure 4D). [score:2]
Moreover, flow cytometry assay displayed that the percentage of cells in the G1/G0 peak significantly decreased in response to miR-195 inhibition (Figure 3D). [score:2]
cDNA was synthesized from 5 ng of total RNA using the TaqMan miRNA reverse transcription kit (Applied Biosystems, Foster City, CA), and the expression levels of miR-195 were quantified using miRNA-specific TaqMan MiRNA Assay Kit (Applied Biosystems) on the Applied Biosystems 7500 Sequence Detection system. [score:2]
As shown in Figure 1B, comparative analysis showed that the expression level of miR-195 was also reduced in all 8 examined tumor tissues as compared to that in paired adjacent nontumor tissues. [score:2]
D, Luciferase assay of indicated cells transfected with the pGL3-cyclin D1-3′UTR reporter (left) or the pGL3-cyclin E1-3′UTR reporter (right) with increasing amounts (10, 50 nM) of miR-195 mimic, or miR-195 inhibitor, or miR-195 mutant. [score:2]
Furthermore, we found that the percentage of S phase glioma cells dramatically increased in the miR-195 inhibited-glioma cells as compared with that in the control cells (Figure 3C). [score:2]
C, Representative micrographs (left) and quantification of BrdU incorporating-cells after transfection with negative control (NC) or miR-195. [score:1]
D, Flow cytometric analysis of indicated glioma cells after transfection with Negative control (NC) or miR-195. [score:1]
In summary, the current study provides the first evidence of an important link between miR-195 and proliferation in human glioma cells. [score:1]
The BALB/c nude mice were inoculated subcutaneously with LN18-Vector (5×10 [6]) in the left dorsal flank and with LN18-miR-195 (5×10 [6]) in the right dorsal flank per mouse. [score:1]
To further investigate the effect of miR-195 reduction on glioma proliferation, the LN18 glioma cell lines, established to stably overexpress miR-195, were implanted into the right dorsal flank and with LN18-Vector cells in the right dorsal flank per mouse. [score:1]
[1 to 20 of 97 sentences]
3
[+] score: 378
We found that miR-195 expression was downregulated in two prostate cancer cell lines, ectopic expression of miR-195 significantly suppressed cell migratory and invasive capacities of PC3 and DU145 cells through inhibition of Fra-1. These findings indicated that miR-195 could be a potential tumor suppressor by directly binding to Fra-1 in prostate cancer. [score:15]
These results indicated that high miR-195 level in normal prostatic epithelium cells might play a tumor-suppressive role through negatively regulating Fra-1 expression suggesting that downregulation of miR-195 might be involved in the prostate tumorigenesis and progression. [score:9]
HEK293T cells were co -transfected with 50 nM of either miR-195 or NC and 200 ng pmirGLO Dual-Luciferase miRNA Target Expression Vector comprising Wt or Mut 3′-UTR of Fra-1. miR-195 significantly suppressed the firefly luciferase activity of construct with Wt 3′-UTR of Fra-1 (*P < 0.05) To verify that miR-195 act as a Fra-1 suppressor, PC-3 and DU145 cells were respectively transfected with 50 nM miR-195 and NC. [score:9]
Here, we found that the specific Fra-1 knock-down with siRNAs phenocopied the migration and invasion inhibitory effects of miR-195 over -expression, and forced Fra-1 expression by transfecting certain constructed plasmids or could partially rescued the migration and invasion capability of miR-195 -transfected cells, which further strengthened our findings that Fra-1 was an important mediator of miR-195 -induced biological function. [score:8]
These results suggest a targeted downregulation of Fra-1 by miR-195 in prostate cancer, and miR-195 functions as an inhibitor of prostate cancer progression. [score:8]
a Inhibitor of miR-195 suppressed the expression of miR-195. [score:7]
Here, 37 miRNAs (miR-16, miR-23a, miR-23b, miR-143, miR-145, miR-195,miR-221, miR-222, miR-497 et al. ) were found to be downregulated in hormone-refractory late-stage prostate carcinomas, whereas 14 miRNAs were upregulated in hormonerefractory carcinomas. [score:7]
Our findings suggest that miR-195 may function as a potential biological molecule for preventing metastasis of prostate cancer, which may lead more new diagnostic and therapeutic approaches for prostate cancer, and provide new insights into the posttranscriptional regulation of Fra-1. Indeed, it is probable that other regulators of Fra-1 may also participate in prostate cancer development and our future studies should pay more attention to examining how Fra-1 is regulated in PCa or other human diseases. [score:7]
We also observed that inhibition of miR-195 or restoration of Fra-1 in miR-195-over-expressed prostate cancer cells partially reversed the suppressive effects of miR-195. [score:7]
miR-195, as a tumor suppressor in bladder cancer cells, could induce G1-phase arrest by targeting the novel target CDK4. [score:7]
In order to identify downstream targets of miR-195, bioinformatics analysis was carried out using online algorithms including TargetScan (http://targetscan. [score:7]
In conclusion, we were able to illustrate for the first time that miR-195 can regulate prostate cancer cell migration and invasion through its direct target gene Fra-1 by targeting it in a classical 3′-UTR binding fashion. [score:7]
c The prostate cancer cells migration and invasion ability was restored after miR-195-Inhi transfection (×100) (*P < 0.05) Fig.  7Forced expression of Fra-1 or miR-195 -inhibitor partially rescued miR-195 -dependent suppression of tumorous behavior. [score:7]
Our previous study showed that overexpression of miR-195 could induce G1-phase arrest by targeting the novel target CDK4 in bladder cancer cells [18]. [score:7]
In the current study, we revealed a decrease in expression of the newly identified tumor suppressive miR-195 in two human prostate cancer cell lines PC3 and DU145 compared with normal prostatic epithelial cells RWPE-1. Our quantification analysis yielded a similar expression pattern with former miRNA signature results. [score:6]
Taken together, these data suggested that the effects of miR-195 on cell migration and invasion were in part mediated by Fra-1. Previous studies demonstrated that miR-195 was downregulated in prostate cancer [7], in this study, we examined the expression levels of miR-195 in one immortalized prostatic epithelial cell line, RWPE-1, and two prostate cancer cell lines, PC3 and DU145, by miR-quantitative RT-PCR analysis. [score:6]
The expression of miR-195 was frequently downregulated in human prostate cancer. [score:6]
Previous studies demonstrated that miR-195 was downregulated in prostate cancer [7], in this study, we examined the expression levels of miR-195 in one immortalized prostatic epithelial cell line, RWPE-1, and two prostate cancer cell lines, PC3 and DU145, by miR-quantitative RT-PCR analysis. [score:6]
miR-195 can repress the migration and invasion of prostate cancer cells via regulating Fra-1. Our results indicate that miR-195 could be a tumor suppressor and may have a potential to be a diagnostics or therapeutic target in prostate cancer. [score:6]
However, in majority of cancers, miR-195 was suggested to function as a tumor suppressor in cancer development and progression, which was consistent with its expression patterns in hepatocellular carcinoma [19], adrenocortical carcinoma [32, 33], colorectal cancer [21], breast cancer [34], bladder cancer [35, 36] and squamous cell cancer of tongue [37]. [score:6]
Furthermore, we demonstrated miR-195 could inhibit prostate cancer cell motility by regulated the expression of c-Met, MMP1, MMP9. [score:6]
miR-195 played a tumor-suppressor role in human glioblastoma cells by targeting E2F3 and CCND3 involved in cellular proliferation and invasion [20]. [score:5]
2′- O-methyl modified miR-195 inhibitor (named as miR-195-Inhi, 5′-GCCAAUAUUUCUGUGCUGCUA-3′) and NC inhibitor (named as Inhi-NC, 5′-CAGUACUUUUGUGUAGUACAA-3′) were used. [score:5]
The cells were co -transfected with either miR-195 mimics or NC oligos with miR-195 inhibitor or NC inhibitor. [score:5]
By transfecting cancer cells with miR-195 mimics, we revealed that miR-195 was a potential metastasis suppressor for PCa as miR-195 expression significantly diminished the cell motility and invasion capability of PCa cells. [score:5]
The Fra-1 expression inhibition by miR-195 in the level of protein could be reversed in both cells (Fig.   6b). [score:5]
miR-195 inhibited Fra-1 expression. [score:5]
b The expression of Fra-1 was determined by western blot analysis after miR-195 inhibitor treatment, western-blot results should be analyzed quantitatively (*P < 0.05). [score:5]
Fig.  6Inhibition of miR-195 partially reversed the over -expression of miR-195 induced effect. [score:5]
Inhibition of miR-195 partially reverses the overexpression of miR-195 induced effects. [score:5]
To further investigate the function of miR-195, the antisense inhibitor (miR-195 inhibitor) experiments were performed to see whether the reverse effects to over -expression could be demonstrated. [score:5]
Our previous work confirmed that miR-195 was frequently down-regulated in bladder cancer. [score:4]
The knock-down of Fra-1 through RNAi approach yielded the anticipated cell physiological function, which phenocopied the effect of miR-195 over -expression. [score:4]
Fig.  2Forced expression of miR-195 suppressed cell motility in wound healing assay without significantly affecting cell viability. [score:4]
But the underlying mechanisms mediating miR-195 deregulation in cancer development are still elusive, particularly in tumor metastasis, and whether the deregulation of miR-195 expression in cancer is mediated by epigenetic alterations remains to be further investigated. [score:4]
Of note, in our study, MMP1, MMP9 and c-Met were also significantly decreased in miR-195 -transfected cells, although they were not direct targets of miR-195. [score:4]
Fra-1 is a novel direct target of miR-195. [score:4]
More importantly, a miRNA signature study had also shown that miR-195 was down-regulated in prostate cancer [7]. [score:4]
miR-195-5p (termed as miR-195 for briefly in the following part) was suggested to function as a tumor suppressor in cancer development and progression. [score:4]
miR-195 was frequently down-regulated in both prostate cancer cell lines, DU145 and PC3. [score:4]
a DU145 and PC3 cells were co -transfected with either miR-195 -inhibitor or Inhibitor-NC oligos with siFra-1. Transwell assays were conducted and quantified (*P < 0.05). [score:4]
In addition, we identified Fra-1, a cell motility regulator, as a novel target of miR-195. [score:4]
As a novel target of miR-195, Fra-1 was reported to regulate cell motility and invasion in various malignant epithelial cells. [score:4]
Moreover, the cell migration and invasion in cell lines with silence of Fra-1 could be partially restored when the miR-195 level was downregulated (Fig.   7a). [score:4]
b, e The Fra-1 expression level was significantly reduced following treatment with miR-195 mimics by RT-PCR and western blot in DU145 and PC3 cells. [score:3]
b Forced expression of Fra-1 abrogated cell motility impairment by miR-195 (representative migration and invasion results at ×100 were shown). [score:3]
The data was shown in additional file 2: Figure S1, which provide evidence to conclude that miR-195 indeed suppresses cell motility. [score:3]
As a result, co-transfection of miR-195-Inhi was applied to attenuate the miR-195 expression promotion in the level of mRNA (Fig.   6a). [score:3]
Overexpression of miR-195 had no apparent effect on prostate cancer cell viability (cell viability of 0 nM was regarded as 1.0, n = 3). [score:3]
Several recent studies have presented a global analysis of miR-195 expression and function in different human cancers. [score:3]
Fig.  1Quantitative analysis of miR-195 and Fra-1 in prostate cancer cell lines, IHC staining of Fra-1 expression pattern in tissue microarray. [score:3]
Thus, we speculated that miR-195 might be a putative tumor suppressor in prostate cancer. [score:3]
As previously described, two algorithm programs were used to predict miRNAs targeting the 3′-UTR of Fra-1. As shown in Fig.   3f, Fra-1 mRNA has one potential complimentary miR-195 binding site within its 3′-UTR region. [score:3]
Western blotting showed that at 72 h post-transfection, the overexpressions of miR-195 contributed to both significant decreases in Fra-1 protein levels in above two cell lines (Fig.   3e). [score:3]
a The ectopic expression of miR-195 was confirmed by qRT-PCR. [score:3]
miR-195 inhibitor experiments. [score:3]
As shown in Fig.   2a, the ectopic expression of miR-195 was confirmed by qRT-PCR, and no significant difference was observed between NC group and miR-195 treated group, miR-195 did not significantly affect cell viability (Fig.   2b). [score:3]
Therefore, the potential function of miR-195, such as suppressing cell migration and invasion in prostate cancer, triggers our initial interest. [score:3]
d An increased protein expression of Fra-1 in DU145 and PC3 cells compared with RWPE-1. e Fra-1 showed in stronger positivity in 20 out of 29 cancer tissues (cancer) compared with the paired non-tumor tissues (NT) (P < 0.05) To elucidate that whether miR-195 could function as a tumor suppressor, the effects of miR-195 over -expression was evaluated in vitro. [score:3]
Introduction of miR-195 inhibited migration and invasion of prostate cancer cells in vitro. [score:3]
These results indicated that miR-195 might reduce cell migration and invasion partially through indirectly regulating MMP1, MMP9 and c-Met. [score:3]
Overexpression of miR-195 significantly repressed the capability of migration and invasion of prostate cancer cells. [score:3]
Forced Fra-1 expression partially rescued the migration and invasion capability of miR-195 -transfected prostate cancer cells. [score:3]
The expression of miR-195 was determined by real-time PCR, snRNA U6 served as an internal control (*P < 0.05). [score:3]
In order to identify miR-195 targeting Fra-1 accurately, we established two groups: siFRA-1 + miR-195-Inhi, siFRA-1 + Inhi -NC, and then the cell migration and invasion should be assessed. [score:3]
It was reported that miR-195 could block the G(1)/S transition in hepatocellular carcinoma cells by repressing Rb-E2F signaling through targeting multiple molecules, including cyclin D1, CDK6, and E2F3 [19]. [score:3]
We found that Fra-1 was a possible target of miR-195. [score:3]
Two human prostate cancer cell lines were analyzed for the expression of miR-195 by quantitative real-time reverse transcription–polymerase chain reaction (RT–PCR). [score:3]
Thus, we confirmed that miR-195-Inhi could reverse the effects to over -expression of miR-195. [score:3]
Moreover, dual luciferase reporter assay confirmed that miR-195 could specifically inhibit Fra-1 by binding to a critical region located on its 3′-UTR. [score:2]
c Expression of motility-related markers were compared by western blot between NC and siFra-1 groups, band intensity quantification was calculated by Image J software, GAPDH was used as a loading control (*P < 0.05) To better verify the function of miR-195, the antisense inhibitor experiments were performed to see whether the reverse effects could be observed. [score:2]
c Western blot analysis was performed to confirm the re -expression of Fra-1 and other related proteins To further investigate whether the effects of miR-195 on cell motility are mediated by Fra-1, we next carried out cell migration and invasion assays in DU145 cells that were co -transfected with miR-195 and the pFra-1 plasmid, which lacked the 3′-UTR of Fra-1 and therefore cannot be inhibited by miR-195. [score:2]
The regulation of motility by miR-195 was analyzed by western blot. [score:2]
We next investigated whether Fra-1 was a direct functional target of miR-195. [score:2]
In the current study, we aimed to determine the role of miR-195 in determining the aggressiveness of prostate cancer cells and studied the correlated regulatory mechanism of miR-195. [score:2]
A series of transwell experiments showed that the migration and invasion were significantly reduced in the selective miR-195 overexpressing PCa cells as compared with the control ones. [score:2]
miR-195 expression was reported to be elevated in chronic lymphocytic leukemia [31] and it was considered to be an oncomiR. [score:2]
The target gene of miR-195 was determined by luciferase assay, quantitative RT–PCR and western blot. [score:2]
As illustrated in Fig.   3d, expression of motility-related markers, including c-Met, MMP1, MMP9, Vimentin and HMGA1 were compared by western blot between NC and miR-195 groups. [score:2]
Besides, expression level of miR-195 was calculated by quantitative PCR. [score:1]
Then HEK293T cells were co -transfected with either miR-195 or NC and reporter vectors containing wildtype (Wt) or mutant (Mut) 3′-UTR. [score:1]
c, d DU145 and PC3 cells were transfected with NC, miR-195 mimics at a concentration of 50 nM and were performed wound healing assays with a 24–48 h recovery period, the wound area was measured by Image J software (*P < 0.05) Fig.  3Transfection with miR-195 impaired the motility of prostate cancer cells and Fra-1 is a direct target of miR-195. [score:1]
d Representative western blotting results of motility-related proteins in miR-195 -transfected DU145 and PC3 cells, band intensity quantification was made by Image J software, while GAPDH used as a loading control (n = 3; *P < 0.05). [score:1]
Furthermore, we validated the functional roles of miR-195 in prostate cancer cell lines by gain of function study. [score:1]
The level of relative luciferase activity in the case of co-transfection with Wt 3′-UTR-reporter and miR-195 mimics was significantly lower than that co -transfected with NC. [score:1]
Furthermore, miR-195-Inhi could partially abrogate the effect of miR-195 on cells migration and invasion ability (Fig.   6c). [score:1]
On the contrary, the level of luciferase activity in the reporter bearing 3′-UTR with mutated binding sites was unaffected by a simultaneous transfection with miR-195. [score:1]
Inhi-NC) and miR-195 (vs. [score:1]
After overnight incubation, cells were respectively transfected with 50 nM miR-195 or miR-NC. [score:1]
Recently, a number of studies have shown that the roles of miR-195 may be controversial in different types of cancers. [score:1]
Transwell assay showed that the motility were significantly reduced in the miR-195 overexpressing PC3 and DU145 cells as compared with the negative control (Fig.   3a, c). [score:1]
The protein levels of these genes were significantly decreased in prostate cancer cells transfected with miR-195, except for vimentin and HMGA1. [score:1]
HEK293T cells were co -transfected with 0.2 µg luciferase reporter vector comprising wildtype or mutant 3′-UTR and 50 nM miR-195 or miR-NC, using Lipofectamine 2000 (Invitrogen) in the 24-well plates. [score:1]
Subsequently, we focused on the correlation between Fra-1 protein and miR-195. [score:1]
Transfection of miR-195 had no impact on motility of normal prostate cells (RWPE-1). [score:1]
Taken together, these results revealed that miR-195 negatively modulate prostate cancer cells migration and invasion. [score:1]
miR-195 mimic(sense 5′-UAGCAGCACAGAAAUAUUGGC-3′) and the negative control(sense 5′-ACUACUGAGUGACAGUAGA-3′) were chemically synthesized by GenePharma (Shanghai, China). [score:1]
After preparation, miR-195 or miR-NC was co -transfected with pFra-1 or the empty control vector (pNull). [score:1]
DU145 and PC3 cells were co -transfected with miR-195-Inhi (vs. [score:1]
However, forced expression of miR-195 in both cells led to retarded wound closing compared to NC groups (Fig.   2c, d) with cell wound healing assay. [score:1]
The relative expression level of miR-195 and Fra-1 was calculated and quantified with the 2 [−ΔΔCt] method after normalization. [score:1]
After an overnight incubation, the cells were transfected with the RNA duplexes (miR-195, siFra-1or control) for 2–3 days. [score:1]
However, the roles of miR-195 in human prostate cancer are still elusive. [score:1]
More importantly, this restoration of Fra-1, partially, but significantly, rescued the migration and invasion capability of miR-195 -transfected cells (Fig.   7b). [score:1]
miR-195 Fra-1 Prostate cancer Migration Invasion Prostate cancer is the most frequently diagnosed male cancer and the second-leading cause of oncological mortality in men living in the United States [1]. [score:1]
For convenience, miR-195 mimic and the negative control are termed miR-195 and NC, respectively. [score:1]
[1 to 20 of 106 sentences]
4
[+] score: 361
Other miRNAs from this paper: hsa-mir-21, hsa-mir-138-2, hsa-mir-138-1, hsa-mir-184
Levels of miR-195 expression were inversely correlated with the expression of Cyclin D1 and Bcl-2. Overexpression of miR-195 inhibited cell cycle progression, promoted apoptosis, and reduced Cyclin D1 and Bcl-2 expression in two TSCC cell lines. [score:11]
Further analysis showed that Cyclin D1 and Bcl-2 expression were both inversely correlated with miR-195 expression and that overexpression of miR-195 inhibits cell cycle progression and promotes apoptosis of TSCC cells, probably by reducing the expression of Cyclin D1 and Bcl-2. These results suggest important roles for miR-195 in TSCC pathogenesis and implicate its potential application in cancer prognosis. [score:11]
Because the Cyclin D1 and Bcl-2 transcripts were shown to be direct targets of miR-195 and their inhibition may account for the antitumor effect of miR-195 [16], [17], we examined the expression of the proteins they encode in paraffin sections of TSCC and nonmalignant samples using immunohistochemistry and Spearman’s rank correlation coefficient analysis. [score:8]
Because Cyclin D1 and Bcl-2 have been shown to be direct targets of miR-195 [16], [17] and their expression in TSCC may account for the effect of miR-195, we examined the expression of these two proteins in paraffin sections of TSCC samples using immunohistochemistry. [score:8]
However, just as other single miRNAs are known to target multiple messenger RNAs to regulate gene expression [30], miR-195 can also regulate multiple coding genes that are related to tumor growth [31]. [score:7]
Overexpression of miR-195 Decreased Expression of Cyclin D1 and Bcl-2 by Targeting the 3′-UTRs of their mRNAs. [score:7]
The mRNA for Cyclin D1 contains one conserved putative miR-195 target site in its 3′-UTR and that for Bcl-2 contains two conserved putative miR-195 target sites in its 3′-UTR, according to TargetScan predictions [16], [17] (Fig. 5A). [score:7]
With the mean fold change (T/N = 0.652) in miR-195 expression chosen as the cut-off point, we divided the patients into a high miR-195 expression group (T/N fold change >0.652) and a low miR-195 expression group (T/N fold change <0.652). [score:7]
org), we cannot exclude the possibility that other potential targets of miR-195 may govern additional cancer pathways that promote TSCC cancer development and that miR-195 may also target different molecules in different types of cancer. [score:6]
0056634.g002 Figure 2Kaplan-Meier curves with log rank tests show that patients with high miR-195 expression (T/N fold change >0.652) survived statistically significantly longer (P = 0.006) than those with low miR-195 expression (T/N fold change <0.652). [score:5]
To further determine whether there was an association between miR-195 expression and tumor prognosis, we looked for a correlation between miR-195 expression and the clinicopathological features of TSCC. [score:5]
0056634.g003 Figure 3 Expression of Cyclin D1 and Bcl-2 was examined by immunohistochemistry (IHC) and miR-195 expression was detected by qRT–PCR and in situ hybridization (ISH). [score:5]
Moreover, Cyclin D1 and Bcl-2 were shown to be direct targets of miR-195 by a dual-luciferase reporter assay and western blots, and their inhibition may account for the antitumor effect of miR-195 in TSCC. [score:5]
Patients with high miR-195 expression survived statistically significantly longer than those with low miR-195 expression (Fig. 2; P = 0.006). [score:5]
Moreover, the anti-tumor effects of miR-195 in TSCC may be partially mediated by its inhibition of Cyclin D1 and Bcl-2 expression. [score:5]
miR-195 is aberrantly expressed in multiple types of disease. [score:5]
The anti-tumor effect of miR-195 in TSCC could be at least partially via inhibition of Cyclin D1 and Bcl-2 expression. [score:5]
However, the relationship between the expression of miR-195 and its target gene Cyclin D1 and Bcl-2 has not been reported in TSCC. [score:5]
In addition, we examined the effects of overexpression of miR-195 on the endogenous expression of Cyclin D1 and Bcl-2 proteins in the two cell lines. [score:5]
By normalizing miR-195 expression levels in the tumor tissues with those in adjacent nonmalignant tissues (Tumor/Nonmalignant, T/N), we found that there were statistically significant relationships between miR-195 expression (T/N) and some clinicopathologic features of TSCC (Table 1), including tumor size (P = 0.005), clinical stage (P = 0.019), and patient mortality (P = 0.010). [score:5]
Overexpression of miR-195 Inhibited Cell Cycle Progression and Promoted Apoptosis in TSCC Cell Lines. [score:5]
Coexpression of pc3-miR-195 significantly suppressed firefly luciferase activity of the reporter with wildtype 3′UTR but not that of the mutant reporter (Fig. 5B). [score:5]
Overexpression of miR-195 inhibited cell viability and cell cycle progression and promoted cell apoptosis. [score:5]
These important observations not only support previous findings that Cyclin D1 and Bcl-2 are target genes silenced by miR-195 but also demonstrate that the expression of miR-195 is potentially a more accurate prognostic tumor marker than Cyclin D1 or Bcl-2 levels alone in TSCC patients. [score:5]
Overexpression of miR-195 inhibited the viability of SCC-15 and CAL27 cells (Fig. 4A), leading to substantial accumulation of the cell population at the G1 stage of the cell cycle (Fig. 4B). [score:5]
SCC-15 and CAL27 cells grown in a 48-well plate were co -transfected with 400 ng of either pcDNA3.0 or pcDNA3.0-miR-195, 40 ng of the firefly luciferase reporter plasmid including the 3′-UTR of the target gene, and 4 ng of pRL-TK, a plasmid expressing rellina luciferase (Promega, Madison, WI)). [score:5]
0056634.g005 Figure 5(A), Sequence alignments of miR-195 and its target sites in 3′-UTRs of Cyclin D1 or Bcl-2. (B), Targeting of 3′-UTRs of Cyclin D1 or Bcl-2 by miR-195. [score:5]
Our results demonstrate that ectopic overexpression of miR-195 reduces cell viability, inhibits cell cycle progression, and promotes cell apoptosis. [score:5]
Expression of the Cyclin D1 and Bcl-2 Proteins were Both Inversely Correlated with miR-195 Expression in TSCC. [score:5]
0056634.g004 Figure 4(A), Inhibition of cell viability by overexpression of miR-195. [score:5]
These data suggest that the antitumor effects of miR-195 may be mediated by inhibition of its target genes, Cyclin D1 and Bcl-2. 10.1371/journal. [score:5]
However, because TargetScan predicts hundreds of potential targets of miR-195 (http://www. [score:5]
The expression of two known miR-195 target genes, Cyclin D1 and Bcl-2, was also examined in the TSCC samples by immunohistochemistry. [score:5]
These data suggest that the antitumor effects of miR-195 may be mediated by inhibition of its target genes, Cyclin D1 and Bcl-2. 10.1371/journal. [score:5]
Expression of Cyclin D1 and Bcl-2 was examined by immunohistochemistry (IHC) and miR-195 expression was detected by qRT–PCR and in situ hybridization (ISH). [score:5]
Cyclin D1 and Bcl-2 expression were significantly decreased in SCC-15 and CAL27 cells in which miR-195 was overexpressed, in comparison with similar cells transfected with pcDNA3.0, a negative control (Fig. 5C). [score:5]
Thus, expression of miR-195 is likely to reflect altered physiology of TSCC more precisely and effectively than any of the target genes alone. [score:5]
Inhibition of Cyclin D1 and Bcl-2 was responsible for the tumor suppressive effects of miR-195. [score:5]
Therefore, based on our observations that decreased miR-195 expression was associated with poor overall survival in TSCC patients, we anticipate that miR-195 could be a useful prognostic factor for TSCC and that its stability should allow the development of practical, economical methods for TSCC detection. [score:4]
These findings further demonstrated that Cyclin D1 and Bcl-2 are direct targets of miR-195 in TSCC cell lines. [score:4]
Cyclin D1 and Bcl-2 are direct targets of miR-195. [score:4]
In this study, we observed that miR-195 expression was reduced in TSCC compared with adjacent nonmalignant tissues, and that decreased expression was correlated with cancer progression and prognosis. [score:4]
Both immunohistochemistry and in situ hybridization analysis in consecutive pathological dissections showed miR-195 expression were inversely correlated with Cyclin D1 and Bcl-2 in all three specimens examined. [score:3]
Decreased miR-195 Expression was Associated with Poor Overall Survival in TSCC Patients. [score:3]
Kaplan–Meier survival analysis indicated that the TSCC patients with reduced expression of miR-195 had poor overall survival and in multivariable analyses low levels of miR-195 emerged as an independent prognostic factor for this clinical outcome. [score:3]
Reduced miR-195 expression was associated with tumor size and the clinical stage of TSCC tumors. [score:3]
The median miR-195 expression level (T/N = 0.652) in the tumor samples was chosen as the cut-off point. [score:3]
Moreover, overexpression of miR-195 also promoted apoptosis in both cell lines (Fig. 4C). [score:3]
Therefore, we constructed luciferase reporter plasmids to contain either the Cyclin D1 or the Bcl-2 3′-UTR sequence, including the wildtype and mutant miR-195 target sites. [score:3]
To ascertain the roles of Cyclin D1 and Bcl-2 in miR-195 regulated cell cycle progression and apoptosis, we determined if knockdown of the endogenous Cyclin D1 or Bcl-2 was able to mimic the effect of miR-195 restoration. [score:3]
Moreover, we determined that decreased miR-195 expression was associated with poor overall survival in TSCC patients, independent of other clinicopathologic factors. [score:3]
SCC-15 and CAL27 cells were co -transfected with firefly luciferase reporter plasmids containing wildtype (Wt) and mutant wildtype and mutant (Mut) 3′-UTRs of Cyclin D1 or Bcl-2, and pRL-TK plasmid (a plasmid expressing rellina luciferase) and pcDNA3.0-miR-195 (miR-195) or pcDNA3.0 as indicated. [score:3]
The human Bcl-2 and Cyclin D1 3′-UTRs, which contained predicted targets of miR-195, were amplified by PCR and cloned into a modified version of pcDNA3.1(+) that contained a firefly luciferase reporter gene (gift from Brigid L. M. Hogan, Duke University, Durham, NC, USA) [26], at a position downstream of the luciferase reporter, between the EcoRI and XhoI cloning sites. [score:3]
We further analyzed the correlation of miR-195 expression and postoperative overall survival of TSCC patients. [score:3]
Correlation between miR-195 expression and Cyclin D1 or Bcl-2 protein levels was analyzed using Spearman’s rank correlation coefficient analysis with r and P values as indicated. [score:3]
The effects of miR-195 overexpression on cell cycle progression and apoptosis and its effects on the expression of Cyclin D1 and Bcl-2 were examined in transfected TSCC cell lines (SCC-15 and Cal27) using fluorescence-activated cell sorting assays, luciferase reporter assays, and Western blots. [score:3]
So far, the expression and role of miR-195 in TSCC remains to be examined. [score:3]
Decreased expression of miR-195 was correlated with poor survival in TSCC patients. [score:3]
miR-195 Expression was Reduced in TSCC and was Correlated with Cancer Progression. [score:3]
However, miR-195 expression has been reported to be increased in adrenocortical adenomas [18] and breast cancer [19]. [score:3]
We hope that this study will provide more accurate and clinically useful information on the prognostic significance of miR-195 expression. [score:3]
The relative expression level of miR-195 was normalized to that of U6 by the 2 [−ΔΔCt] cycle threshold method [23]. [score:3]
Site-directed mutagenesis of the miR-195 binding sites in Cyclin D1 and Bcl-2 3′UTRs were performed using Site-Directed Mutagenesis Kit (SBS Genetech, Beijing, China) and named as mutant 3′UTRs. [score:3]
To understand the biological function of miR-195 in TSCC, miR-195 was overexpressed in TSCC cell lines. [score:3]
Relationship between expression of miR-195, Cyclin D1, and Bcl-2 and clinicopathologic factors in 81 TSCC patients. [score:3]
Recent studies have demonstrated that miR-195 expression is decreased, relative to nonmalignant tissue, in many solid tumors, including bladder cancer [14], gastric cancer [15], colorectal cancer [16], and hepatocellular carcinoma [17]. [score:3]
The empty vector, pcDNA3.0, and an miR-195 expression vector, pcDNA3.0-miR-195, were gifts from Dr. [score:3]
In the final multivariable Cox regression mo del, low levels of miR-195 expression in TSCC were associated with a poor prognosis in terms of overall survival (P = 0.025, relative risk = 0.322), independent of other clinical covariates (Table 2), suggesting that miR-195 might be used as an independent prognostic factor for TSCC. [score:3]
The effects of miR-195 overexpression on SCC-15 and CAL27 cell proliferation were assessed using the Cell Counting Kit-8 (CCK-8, Dojindo, Kumamoto, Japan). [score:3]
Firefly luciferase reporter containing wildtype or mutant 3′UTR of the target gene was cotransfected with renilla luciferase reporter and either pcDNA3.0 or pcDNA3.0-miR-195. [score:3]
Although our data failed to establish evidence for Cyclin D1 and Bcl-2 expression as prognostic markers in TSCC, we did demonstrate for the first time that immunostaining of Cyclin D1 and Bcl-2 is inversely correlated with miR-195 levels in TSCC tissues. [score:3]
More importantly, our data showed that the expression of Cyclin D1 and Bcl-2 in TSCC tissues is inversely correlated with miR-195 levels. [score:3]
miR-195 expression was reduced in human TSCC and cell lines. [score:3]
In confirmation, we examined the expression of miR-195 in paraffin sections of TSCC and nonmalignant samples using in situ hybridization. [score:3]
In this study, we found that the expression of miR-195 was statistically significantly decreased in primary TSCC compared with matched normal tissues and was associated with progression and prognosis of TSCC patients. [score:2]
In conclusion, our study has confirmed in a large and homogeneous patient population that miR-195 expression was decreased in 80.2% of TSCC tumor samples compared with adjacent nonmalignant tissues and has provided evidence that miR-195 may be an independent biomarker of clinical prognosis among TSCC patients. [score:2]
Because miR-195 appears to have an anti-tumor effect in TSCC cell lines and has potential as a prognostic biomarker, it will be interesting in future experiments to further define the role of miR-195 in TSCC development. [score:2]
But little is known about the dysregulation of miR-195 in tongue squamous cell carcinoma (TSCC). [score:2]
Moreover, miR-195 expression was also statistically significantly decreased in the TSCC cell lines SCC-15 and CAL27, compared with TSCC adjacent nonmalignant tissues (Fig. 1C). [score:2]
The average expression level of miR-195 was statistically significantly decreased in tumor tissues compared with matched nonmalignant tissues (Fig. 1B; P<0.01). [score:2]
miR-195 expression was decreased in 65 of 81 (80.2%) tumor samples compared with their nonmalignant counterparts (Fig. 1A). [score:2]
0056634.g001 Figure 1(A), Relative levels of miR-195 in 81 surgical specimens of TSCC and matched adjacent nonmalignant tissues was quantified by qRT-PCR. [score:1]
The Bcl-2 staining in TSCC adjacent nonmalignant tissues was generally of reduced intensity and Cyclin D1 staining was only found in basal cells of normal epithelium, coincident with the relatively high miR-195 signal (Fig. 3B). [score:1]
We evaluated the expression levels of miR-195 in 81 pairs of TSCC and the adjacent histologically normal tissues. [score:1]
Data were presented as 2 [−ΔCt (miR-195-U6)] values (** P<0.01). [score:1]
Previous studies have shown that miR-195 prevents cell proliferation and promotes apoptosis in diverse cancers by binding to the 3′-UTRs of mRNAs of Bcl-2 and Cyclin D1 [16], [17]. [score:1]
Data were presented as 2 [−ΔCt (miR-195-U6)] values (*** P<0.001). [score:1]
SCC-15 and CAL27 cells were transfected with pcDNA3.0, a negative control (NC) or with pcDNA3.0-miR-195 (miR-195), as indicated. [score:1]
Levels of staining of Cyclin D1 and Bcl-2 in TSCC cancer tissues were inversely correlated with miR-195 levels (Fig. 3A). [score:1]
Therefore, miR-195 may display either pro-proliferative or pro-apoptotic roles under specific physiological conditions and in different types of cancers. [score:1]
Transfection with 4 µg of pcDNA3.0 or pcDNA3.0-miR-195 and 100 nm Cyclin D1 and Bcl-2 siRNA or siRNA control were performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) in accordance with the manufacturer’s procedure. [score:1]
To identify whether miR-195 is an independent prognostic covariate for TSCC, we did a multivariable Cox proportional hazards analysis. [score:1]
Using quantitative reverse transcription-polymerase chain reaction (qRT-PCR), we evaluated miR-195 expression in TSCC samples from 81 patients. [score:1]
miR-195 may have potential applications as a prognostic factor for TSCC patients. [score:1]
miR-195 could be a potential biomarker for prognosis prediction in TSCC patients. [score:1]
Inverse correlation between miR-195 and Cyclin D1 or Bcl-2 protein levels in TSCC. [score:1]
Student's t test and one-way ANOVA were used to analyze the relationship between miR-195 expression and clinicopathologic characteristics. [score:1]
Dual-DIG -labelled LNA probes miR-195 detection probe or Scramble-miR were obtained from Exiqon (Exiqon, Vedbaek, Denmark) and the hybridizations were performed at 42°C. [score:1]
miR-195 was first predicted based on homology to a verified miRNA from the mouse [12] and was later shown to exist in humans [13]. [score:1]
[1 to 20 of 99 sentences]
5
[+] score: 298
Other miRNAs from this paper: hsa-mir-15a, hsa-mir-146a, hsa-mir-185, hsa-mir-155
In addition, western blot analysis indicated that the REGγ protein level was downregulated following overexpression of miR-195-5p while upregulated following suppression of miR-195-5p (Figure 5F, 5G). [score:11]
In addition, the qRT-PCR results indicated that the mRNA level of REGγ is down-regulated after transfection with miR-195-5p mimics while up-regulated following transfection with miR-195-5p inhibitors in RCC cells (Figure 5D, 5E). [score:9]
Our results revealed that overexpression of miR-195-5p significantly suppressed Wnt/β-catenin pathway, while suppression of miR-195-5p exhibited an opposite results in RCC cells (Figure 7G, 7H). [score:7]
Moreover, MTT ands indicated that overexpression of miR-195-5p significantly inhibited proliferation in RCC cells (Figure 2C, 2E), while suppression of miR-195-5p markedly enhanced RCC cells proliferation (Figure 2D, 2F). [score:7]
Results of western blot showed that the wnt/β-catenin pathway was suppressed by miR-195-5p overexpression while activated by miR-195-5p inhibition in RCC cells. [score:7]
Our results revealed an obvious increase of cell apoptosis in 786-O and caki-1 cells after overexpression of miR-195-5p, whereas suppression of miR-195-5p significantly inhibited RCC cells apoptosis (Figure 3A, 3B). [score:7]
To the best of our knowledge, miRNA-195-5p was reported to suppress colorectal cancer cell proliferation via regulation of FGF2 and the Wnt/β-catenin pathway [31], indicating that the latter pathway may be involved in the tumor suppressive function of miR-195-5p. [score:6]
Figure 5 (A) REGγ was predicted as a direct target of miR-195-5p by bioinformatic analysis using the TargetScan, PicTar and miRanda databases. [score:6]
miR-195-5p mimics (miR-195-5p), inhibitors (anti-miR-195-5p), siRNA targeting human REGγ (si-REGγ) and non-specific negative control oligos (miR-NC, anti-miR-NC and si-NC) were all purchased from GenePharma (Shanghai, China). [score:5]
Furthermore, overexpression of miR-195-5p significantly suppressed RCC tumorigenesis in a xenograft nude mice mo del. [score:5]
By using Dual-luciferase reporter assay, qRT-PCR, western blot analysis and immunohistochemical staining of the xenograft tumor tissues, we demonstrated that miR-195-5p could directly bind to the 3′-UTR of REGγ and suppress its expression in RCC. [score:5]
A total of 3 bioinformatic databases including TargetScan, PicTar and miRanda were used in combination to predict the putative targets of miR-195-5p (Figure 5A). [score:5]
Our findings indicated that miR-195-5p may act as a tumor suppressor in RCC and may serve as a novel therapeutic target in RCC treatment. [score:5]
To further confirm whether the roles of miR-195-5p in RCC was mediated by REGγ, we transfected pcDNA5-REGγ plasmid to restoring REGγ expression when miR-195-5p was overexpressed in 786-O cells (Figure 7A). [score:5]
Figure 2miR-195-5p suppressed RCC cell growth in vitro and xenograft tumor growth in vivo (A) 786-O and caki-1 cells were transfected with miR-195-5p mimics (miR-195-5p) or inhibitors (anti-miR-195-5p), and their negative controls (miR-NC or anti-miR-NC). [score:5]
Given that REGγ could regulate the Wnt/β-catenin pathway and that REGγ was a direct target of miR-195-5p in RCC, we presumed that miR-195-5p may have effect on wnt/β-catenin pathway in RCC. [score:5]
The results indicated that chemosensitivity to sorafenib was significantly increased by miR-195-5p overexpression, while decreased by miR-195-5p suppression in both 786-O and caki-1 cells (Figure 4A, 4B). [score:5]
786-O cells were infected with a miR-195-5p lentiviral expression vector (LV-miR-195-5p) to overexpress miR-195-5p or the negative control lentivirus (LV-miR-NC). [score:5]
The sequences are 5′-UAGCAGCACAGAAAUAUUGGC-3′ for miR-195-5p mimics, 5′-UUCUCCGAACGUGUCACGUTT-3′ for miR-NC, 5′ –GCCAAUAUUUCUGUGCUGCUA-3′ for miR-195-5p inhibitors and 5′-CAGUACUUUUGU GUAGUACAA-3′ for inhibitor NC. [score:5]
Recently, the aberrant expression of miR-195-5p and its tumor suppressive role were demonstrated in a majority of human cancers namely, breast cancer [10], prostate cancer [11] and hepatocellular carcinoma [12]. [score:5]
The number of Ki-67 -positive cells in tumors from miR-195-5p overexpression group was lower than that in the control group as shown by immunohistochemistry (Figure 2K), indicating a tumor suppressor potential. [score:5]
Furthermore, the immunohistochemical analysis of the xenograft tumor tissues generated from LV-miR-195-5p and LV-miR-NC 786-O cells revealed a marked reduction of REGγ expression when miR-195-5p was overexpressed (Figure 5H). [score:5]
Our findings suggested that miR-195-5p acted as a tumor suppressor in RCC and may serve as a new target for RCC therapy. [score:5]
The overexpression of miR-195-5p significantly inhibited cellular proliferation, in accordance with induction of apoptosis and cell cycle arrest in 786-O and caki-1 RCC cells. [score:5]
miR-195-5p suppressed cell growth, induced apoptosis and enhanced chemosensitivity to sorafenib via REGγ -mediated regulation of the Wnt/β-catenin pathway in renal cell carcinoma, which was summarized by the schematic mo del (Figure 8). [score:4]
In addition, knockdown of REGγ significantly inhibited proliferation, induced apoptosis and increased sorafenib chemosensitivity in RCC cells, and restoration of REGγ markedly abolished the effects of miR-195-5p in RCC. [score:4]
The relative miR-195-5p levels in xenograft tumors were confirmed to be upregulated in LV-miR-195-5p groups (Figure 2J). [score:4]
Figure 8 miR-195-5p suppressed cell growth and enhanced chemosensitivity to sorafenib via REGγ mediated regulation of the Wnt/β-catenin pathway in renal cell carcinoma. [score:4]
Our results indicated that miR-195-5p acted as a tumor suppressor in RCC development. [score:4]
REGγ is a direct downstream target of miR-195-5p in RCC. [score:4]
miR-195-5p suppressed cell growth and enhanced chemosensitivity to sorafenib via REGγ mediated regulation of the Wnt/β-catenin pathway in renal cell carcinoma. [score:4]
In our study, we found that miR-195-5p was significantly downregulated and negatively correlated with advanced clinical stage in RCC. [score:4]
miR-195-5p was downregulated and negatively correlated with advanced clinical stage in RCC. [score:4]
Conversely, the cells transfected with miR-195-5p inhibitors showed significantly higher colony formation rates compared with the NC inhibitor (Figure 2B). [score:4]
miR-195-5p was downregulated in RCC. [score:4]
The expression of miR-195-5p was determined in 67 paired ccRCC tumor tissues and matched normal tissues in order to elucidate the potential role of miR-195-5p in the development of RCC. [score:4]
miR-195-5p suppressed cell growth, induced apoptosis and enhanced chemosensitivity to sorafenib via REGγ -mediated regulation of the Wnt/β-catenin pathway in renal cell carcinoma. [score:4]
These results suggest that miR-195-5p may exert its function by targeting REGγ in RCC. [score:3]
In breast cancer, miR-195-5p can increase the sensitivity of the cells to adriamycin treatment via Raf-1 inhibition [29]. [score:3]
The results showed that miR-195-5p was significantly downregulated in RCC tumor tissues compared with adjacent normal tissues (Figure 1A). [score:3]
In addition, inhibition of miR-195-5p had a converse effect on RCC cellular proliferation, apoptosis and cell cycle distribution. [score:3]
We found that miR-195-5p expression was significantly correlated with clinical stage, histological grade, tumor stage and lymph node metastasis (P<0.05), but was not significant associated with patients’ gender, age and tumor size (Table 1). [score:3]
miR-195-5p suppressed RCC cell growth in vitro and xenograft tumor growth in vivo. [score:3]
Figure 1 (A) Relative miR-195-5p expression levels in 67 paired RCC tumor tissues and matched normal tissues as determined by qRT-PCR. [score:3]
REGγ, which was reported as an oncogene in many human cancers, was selected as a potential target of miR-195-5p among the screened candidate genes (Figure 5B). [score:3]
Figure 3 (A and B) Apoptosis of 786-O and caki-1 cells as measured by flow cytometry following miR-195-5p overexpression (A) or suppression (B). [score:3]
That was consist with a previous study which reported that miR-195-5p expression is deceased in RCC by using TaqMan Low Density Arrays [24]. [score:3]
To explore the mechanism by which miR-195-5p exerts its effect in RCC, the potential target genes of miR-195-5p were predicted by 3 bioinformatic databases and REGγ was selected as a candidate gene. [score:3]
Relationship between miR-195-5p expression level and clinicopathologic factors. [score:3]
In addition, patients with low miR-195-5p expression level had a significantly shorter overall survival time than those with high miR-195-5p level, indicating the potential value of miR-195-5p as a prognosis predictor in RCC patients. [score:3]
These results indicated that miR-195-5p may play a tumor suppressive role in renal cell carcinoma. [score:3]
786-O cells were infected with LV-miR-195-5p or LV-NC and then selected by puromycin (Sigma-Aldrich) in order to generate the stably transfected miR-195-5p overexpressing cell lines. [score:3]
These results suggested that miR-195-5p may suppress cell growth by inducing apoptosis and cell cycle arrest in RCC cells. [score:3]
Moreover, Kaplan–Meier analysis revealed that ccRCC patients with low miR-195-5p expression levels had a significantly shorter overall survival time than those with high miR-195-5p levels (Figure 1D). [score:3]
The recombinant has-miR-195-5p expression lentivirus (LV-miR-195-5p) and the negative control lentivirus (LV- miR-NC; Hanyin Co. [score:3]
It was reported that miRNA-195-5p sensitizes human hepatocellular carcinoma cells to 5-FU by targeting BCL-w [28]. [score:3]
miR-195-5p was reported as a tumor suppressor in various human cancers. [score:3]
Qu et al. also demonstrated that miRNA-195-5p chemosensitizes colon cancer cells to doxorubicin by targeting BCL2L2 [30]. [score:3]
Following overexpression or suppression of miR-195-5p, the RCC cell lines 786-O and caki-1 were treated with various concentrations of sorafenib (0 ∼ 20 μM) for 24 h and the cell viability was evaluated by MTT assay. [score:2]
And, we found that the miR-195-5p expression levels in 4 RCC cell lines (786-O, ACHN, caki-1 and A498) were markedly decreased compared to the immortalized primary human proximal tubular cell line HK-2 (Figure 1B). [score:2]
As miR-195-5p acted as a tumor suppressor in RCC development, the effect of miR-195-5p in the modulation of chemosensitivity to sorafenib in RCC cells was investigated. [score:2]
In addition, TCGA database also indicated a significant lower miR-195-5p expression in RCC compared with non-tumor tissues (Figure 1C). [score:2]
This finding indicated that miR-195-5p could directly bind to the 3′-UTR of REGγ in RCC. [score:2]
Our results suggest that miR-195-5p is critical in REGγ -mediated regulation of wnt/β-catenin pathway in renal cell carcinoma. [score:2]
In addition, cell cycle analysis indicated that the percentage of cells in G0/G1 phase was markedly higher in the miR-195-5p mimics group and lower in the miR-195-5p inhibitors group compared with the control groups (Figure 3C, 3D). [score:2]
Subsequently, the results of colony formation assay indicated that the growth of 786-O cells was significantly suppressed following transfection with miR-195-5p mimics. [score:2]
For colony formation assays, cells were transfected with a miR-195-5p mimic or inhibitors for 48 h and then plated in 6-well plates at a density of 1×10 [3]/well for 10 days. [score:2]
These results collectively suggested that miR-195-5p may exert its roles via REGγ -mediated regulation of Wnt/β-catenin pathway in RCC. [score:2]
A significant decrease in the size and weight of tumors was observed in the miR-195-5p overexpressed group compared with that in the control group (Figure 2H, 2I). [score:2]
A schematic mo del for the effect of miR-195-5p in RCC. [score:1]
The 3′-UTR sequences of human REGγ mRNA, containing the putative miR-195-5p binding site, were amplified by PCR and cloned into the XhoI /BglII site of the pGL3 vector (Promega, Madison, WI, USA) in order to construct the wild-type REGγ 3′-UTR plasmid (wt 3′-UTR). [score:1]
The relationship between miR-195-5p expression level and clinicopathologic factors was evaluated using Pearson's Chi-square test. [score:1]
The images were captured using a fluorescence microscope at a magnification of 100×, and the relative miR-195-5p expression was evaluated by qRT-PCR. [score:1]
microRNA-195-5p (miR-195-5p) is a member of the microRNA-15a/b/16/195/497 family that is located on chromosome 17p13.1 [9]. [score:1]
However, the function of miR-195-5p in RCC is largely unknown. [score:1]
In addition, we determined the effect of miR-195-5p on Wnt/β-catenin pathway. [score:1]
The effects of miR-195-5p on RCC cells apoptosis and cell cycle distribution were determined by flow cytometry. [score:1]
U6 and 18s were used as internal controls for miR-195-5p and REGγ, respectively. [score:1]
Next we investigated the realtionship between miR-195-5p expression level and clinicopathologic factors in the 67 ccRCC patients. [score:1]
In accordance with the aforementioned findings, miR-195-5p was also demonstrated to modulate chemosensitivity in various human cancers. [score:1]
The relative miR-195-5p levels were determined by qRT-PCR following 48 h of culture. [score:1]
The cultured 786-O cells were co -transfected with wt or mut REGγ 3′-UTR plasmid, miR-195-5p mimics (miR-195-5p), negative control miR (miR-NC) and a control Renilla luciferase pRL-TK vector (Promega) using Lipofectamine 2000 reagent (Invitrogen). [score:1]
The hsa-miR-195-5p sequence was cloned into the lentiviral vector PHY-502 carrying a green fluorescent protein (GFP) sequence by Hanyin Co. [score:1]
Data showed that restoration of REGγ significantly abolished the effects of miR-195-5p on RCC cells proliferation, apoptosis and cell cycle distribution (Figure 7B, 7C and 7D). [score:1]
miR-195-5p induced apoptosis and cell cycle arrest in RCC. [score:1]
The infection efficiency was examined by fluorescent microscopy and miR-195-5p expression was evaluated by qRT-PCR (Figure 2G). [score:1]
Consistently, the increase of chemosensitivity to sorafenib by miR-195-5p was also abolished by REGγ restoration in 786-O cells (Figure 7E, 7F). [score:1]
miR-195-5p enhanced RCC cells chemosensitivity to sorafenib. [score:1]
Restoration of REGγ markedly abolished the effects of miR-195-5p in RCC. [score:1]
As miR-195-5p exhibited a tumor suppressive role in RCC progression, we further investigated the effect of miR-195-5p on RCC cells chemosensitivity to sorafenib. [score:1]
[1 to 20 of 90 sentences]
6
[+] score: 294
Second, the regulation of miR-195 on ActRIIA expression is likely direct, because the luciferase report construct containing the 3′UTR region of ActRIIA mRNA with the putative miR-195 binding sequence is specifically responsive to miR-195 overexpression by inhibition on the luciferase activity. [score:9]
The findings in the present study revealed that miR-195 could regulate trophoblast cells invasion via repressing ActRIIA protein expression, and down-regulation of the small molecule may be involved in the aberrant placenta function which contributes to the pathology of preeclampsia. [score:7]
The invasion-promoting effect of miR-195 observed in HTR8/SVneo cells most likely results from interference on Nodal signaling mediated by suppressed expression of ActRIIA, as it has been shown that Nodal inhibits, whereas ActivinA promotes trophoblast cell invasion. [score:7]
When we performed bioinformatic analysis to predict target genes for miR-195 using four different programs, miRanda, TargetScan, miRBase, and PicTar, we found ActRIIA is one of the commonly predicted targets. [score:7]
As shown in Fig. 2A and 2B, transfection of miR-195 mimics in HTR8/SVneo cells resulted in down-regulation of ActRIIA expression at both mRNA and protein levels. [score:6]
As shown in Fig. 1A and 1B, relative expression of pri-miR-195 and miR-195 in PE placentas was significantly down-regulated to about 20% and 50%, respectively, of that in normal placentas. [score:6]
In preeclamptic placenta tissues, pri-miR-195 and mature miR-195 expressions were down-regulated, whereas ActRIIA level appeared to be increased when compared with that in gestational-week-matched normal placentas. [score:5]
Literature reports revealed that miR-195 could inhibit cell invasion by inhibiting CCND1 and CCND3 in breast cancer cells and gliobalstoma cells. [score:5]
Given that a single microRNA can target many genes, we believe that miR-195 also has multiple targets. [score:5]
First, ActRIIA expression is suppressed by miR-195 in HTR8/SVneo cells. [score:5]
As shown in Fig. 3A and D, transfection of mimics or inhibitors for miR-195 could significantly increase or repress the relative expression of miR-195 in HTR8/SVneo cells. [score:5]
The two experimentally proved targets involved in invasion-inhibiting effect of miR-195 in cancer cells, CCND1 and CCND3, are not influenced by miR-195 in human trophoblastic HTR8/SVneo cells. [score:5]
Recently, miR-195 and miR-497 were shown to suppress breast cancer cell proliferation and invasion via targeting Raf-1 and CCND1 [32]. [score:5]
In glioblastoma cells, miR-195 could inhibit cell invasion by inhibiting CCND3 and cause cytoplasmic accumulation of p27 [33]. [score:5]
For instance, miR-195 could control cell cycle through targeting cyclin D1, CDK6, and E2F3, and thus suppress the ability of HCC cells to form colonies in vitro and to develop tumors in nude mice [18]. [score:5]
ActRIIA Protein and miR-195 Exhibit Reversed Expression Pattern in Placentas from Severe PreeclampticWe compared expression levels of pri-miR-195, miR-195 and ActRIIA in placentas from 15 severe preeclamptic patients and 17 normal pregnant women. [score:4]
Third, the inhibitory effect of miR-195 on the luciferase activity is abolished upon mutation in the binding sites paired by the seed sequence of miR-195. [score:4]
Validation of ActRIIA as the Direct Target of miR-195 in Human Trophoblast Cells. [score:4]
From literatures of microarray data, miR-195, miR-15b and miR-424 were the three members in miR-15 gene family that exhibited down-regulation in preeclamptic placenta [12], [31]. [score:4]
Based on the results of target prediction and expression pattern of miR-195 in preeclamptic placentas, we further evaluate whether ActRIIA is functionally involved in trophoblast cell invasion regulated by miR-195. [score:4]
By using Real-time PCR, Western blotting and, we validated that ActRIIA was the direct target of miR-195 in human trophoblast cells. [score:4]
The specifically aberrant regulation on miR-195 expression may contribute to the occurrence of preeclampsia through destroying physiological role of Nodal signaling in trophoblast cells. [score:4]
Our data regarding the expression pattern of miR-195 and ActRIIA in PE placenta as well as their regulation on trophoblast cell invasion are likely indicating the way whereby miR-195 participates in the pathogenesis of PE. [score:4]
MiR-195 could also promote colorectal cancer cell apoptosis and suppress tumorigenicity by targeting BCL-2 [17]. [score:4]
The mechanism of miR-195 down-regulation in preeclamptic placenta remains unknown. [score:4]
Recently, the methylation state of CpG islands upstream of the miR-195/497 gene was found to be responsible for the down-regulation of both miRNAs in breast cancer [32]. [score:4]
Based on above evidences, we hypothesized that miR-195 may participate in the regulation of placental trophoblast cell functions by targeting ActRIIA. [score:4]
0038875.g001 Figure 1A, B and C, Quantitative real time PCR to reveal pri-miR-195 (A), mature miR-195 (B) levels and mRNA expression of ActRIIA (C) in placentas from PE and Control. [score:3]
Data revealed that overexpression of miR-195 in HTR8/SVneo cells evidently promoted cell invasiveness as well as the activation of MMP-9 and MMP-2, which have been shown to be the most important MMPs involved in trophoblast cell invasion (Fig. 3B and C). [score:3]
However, inhibition of miR-195 did not affect cell invasiveness and MMP-9 or MMP-2 activation. [score:3]
Also, it is reported that miR-195 serves as tumor suppressor gene in colorectal cancer [17] and hepatocellular carcinoma [18]. [score:3]
The siRNA duplex against human ActRIIA, mature microRNA mimics for miR-195, miR-195 inhibitor and the scramble control were designed and purchased from Shanghai GenePharma, China. [score:3]
To further demonstrate the influence of miR-195 on trophpoblast cell behaviors, we examined cell proliferation and invasion in HTR8/SVneo cells that were transfected with miR-195 or inhibitor of the small molecule. [score:3]
Several lines of evidence prove that ActRIIA is a target of miR-195 in human trophoblasts. [score:3]
Effect of miR-195 on protein expression of CCND1 and CCND3 in HTR8/SVneo cells. [score:3]
It was shown that overexpression of ActRIIA could completely block the invasion-promotion as well as activation of MMP-9 and MMP-2 caused by miR-195 in HTR8/SVneo cells (Fig. 4A and B). [score:3]
Aberrant expression of miR-195 may contribute to the occurrence of preeclampsia through interfering with Activin/Nodal signaling mediated by ActRIIA in human placenta. [score:3]
In mamanlian, only miR-195, miR-497 and miR-424 are expressed [30]. [score:3]
We then performed a “rescue” experiment by transfecting the cells with miR-195 together with ActRIIA -expressing construct (pcDNA4-ActRIIA). [score:3]
The mutated pMIR-REPORT plasmids, which carry site mutations in the 3′UTR segments of human ActRIIA mRNA being complementary to the seed sequence of miR-195, were generated based on BD1-WT/BD2-WT plasmids using QuikChange Lightning Site-Directed Mutagenesis Kit according the manufacture’s instruction (Stratagene, La Jolla, California, USA). [score:3]
Recently, miR-195 was found to be down-regulated in preeclamptic placentas compared with normal pregnant ones, indicating possible association of this small molecule with placental pathology of preeclampsia. [score:3]
It will greatly help us to better understand the mechanism of miR-195 in human placentation after more functional targets are identified. [score:3]
A, B and C, Quantitative real time PCR to reveal pri-miR-195 (A), mature miR-195 (B) levels and mRNA expression of ActRIIA (C) in placentas from PE and Control. [score:3]
0038875.g003 Figure 3A and D. The expression of miR-195 in HTR8/SVneo cells transfected with miR-195 mimics (miR-195), scramble siRNA (NC), miR-195 antigomir (Anti-miR-195) or scramble antigomir (Inhibitor NC) was measured by real time PCR. [score:3]
The increase of ActRIIA receptor resulting from, at least in part, lowered miR-195 in PE placenta will lead to further augment of Nodal signaling and therefore inhibition on trophoblast cell invasion. [score:3]
A and D. The expression of miR-195 in HTR8/SVneo cells transfected with miR-195 mimics (miR-195), scramble siRNA (NC), miR-195 antigomir (Anti-miR-195) or scramble antigomir (Inhibitor NC) was measured by real time PCR. [score:3]
Overexpression of ActRIIA Attenuates the Invasion-promoting Effect of miR-195 in HTR8/SVneo Cells. [score:3]
ActRIIA Protein and miR-195 Exhibit Reversed Expression Pattern in Placentas from Severe Preeclamptic Patients. [score:3]
The expression pattern of miR-195 and ActRIIA in preeclamptic placenta was further examined. [score:3]
Our data revealed that the expression of miR-195 was in an inverse association with protein level of ActRIIA in severe preeclamptic placentas, indicating that miR-195 may play roles in the excessive activation Nodal/ActivinA signaling observed in preeclamptic placenta. [score:3]
In human, miR-195 and mir-497 were shown potential tumor suppressor gene in primary peritoneal tumorgenesis [13]. [score:3]
The data strongly validated ActRIIA as target gene of miR-195 in human trophoblast cells, and the 502–508 nt of 3′UTR in ActRIIA gene was the real binding site for miR-195. [score:3]
The binding sites in ActRIIA mRNA for miR-15/16 and miR-195 are conserved, further suggesting that ActRIIA may be an essential target for these members of miR-15 family. [score:3]
Twenty-four hours after seeding, miR-195 mimics, inhibitors for miR-195, specific siRNA for ActRIIA, or pcDNA4/pcDNA4-ActRIIA was transfected into the cells using lipofectamine 2000 reagent according to the manufacturer’s instruction (Invitrogen, Carlsbad, CA). [score:3]
These findings indubitably indicated that ActRIIA is one of the critical targets, at least, in mediating the invasion-promoting role of miR-195 in human trophoblast cells. [score:3]
Validation of ActRIIA as target gene of miR-195 in HTR8/SVneo cells. [score:3]
Our finding of lowered expression of pri-miR-195 in PE placenta strongly indicates the aberrant transcription of this small RNA during the pathological process. [score:3]
We therefore examined CCND1 and CCND3 expression in HTR8/SVneo cells transfected with miR-195. [score:3]
Expression of miR-195 and ActRIIA in placentas derived from severe preeclamptic patients (PE) and gestational-week-matched normal pregnant women (Control). [score:3]
Therefore, further detailed studies on the localization and expression patterns of miR-195 in human placenta along the whole gestation are necessary for clarifying its working mechanisms. [score:3]
Transwell insert invasion assay showed that miR-195 could promote cell invasion in trophoblast cell line, HTR8/SVneo cells, and the effect could be abrogated by overexpressed ActRIIA. [score:2]
By far the function of miR-195 in the development of placenta remains unknown. [score:2]
MiR-195 did Not Influence CCND1/3 Expression in HTR8/SVneo Cells. [score:2]
The data demonstrated that ActRIIA was directly involved in the invasion-promoting effect of miR-195 in HTR8/SVneo cells. [score:2]
We compared expression levels of pri-miR-195, miR-195 and ActRIIA in placentas from 15 severe preeclamptic patients and 17 normal pregnant women. [score:2]
There are two putative conserved binding sites in the 3′UTR region of ActRIIA mRNA, but only one of them is proved to be directly responsive for miR-195 in human trophoblast cells. [score:2]
Bioinformatic assay predicted ActRIIA as one of the targets for miR-195. [score:2]
Considering that the differentiation status and properties of trophoblast cells vary along gestation, the roles of miR-195 should be tightly associated with placental developmental stages. [score:2]
B and E. Transwell insert assay to examine cell invasiveness transfected with NC, miR-195, siRNA for ActRIIA (si-ActRIIA), Inhibitor NC or Anti-miR-195. [score:2]
We then tried to figure out whether ActRIIA directly participated in the invasion-promoting effect of miR-195. [score:2]
The constructs containing the region complementary to the seed sequence for miR-195 in 3′UTR segment of human ActRIIA gene are shown as BD1-WT and BD2-WT, and the mutant constructs are shown as BD1-MUT and BD2-MUT with asterisks indicating the mutation sites. [score:2]
As shown in Fig. 2D, miR-195 mimics could evidently reduce the relative luciferase activity of BD2-WT construct by about 45% compared with scramble control, whereas did not show any suppression on that of BD2-MUT construct. [score:2]
The level of miR-195 was adjusted by that of U6, and the relative value was presented as Mean±SEM according to three independent experiments. [score:1]
HTR8/SVneo cells were transfected with miR-195 and ActRIIA alone or in combination, with scramble siRNA (NC) or pcDNA4 vector (pcDNA4) as corresponding negative control. [score:1]
NM_001616) containing the two putative miR-195 binding sequences were amplified and cloned into pMIR-REPORT Luciferase plasmid (Ambion, Austin, Texas, USA) at the Sac I and Hind III sites. [score:1]
According to the bioinformatic analysis, miR-195 has two binding sites in 3′UTR of ActRIIA mRNA. [score:1]
This is the first report on the function of miR-195 in human placental trophoblast cells which reveals an invasion-promoting effect of the small RNA via repressing ActRIIA. [score:1]
This suggests that modulation of ActRIIA by miR-195 may be biologically conserved during evoluation. [score:1]
MiR-195 is one of the differential miRNAs in preeclamptic placentas reported by Zhu et al. [12]. [score:1]
MiR-195 is clustered with miR-497 [13] and belongs to miR-15 family [14]. [score:1]
Effect of miR-195 on cell invasion in HTR8/SVneo cells. [score:1]
To attest the hypothesis, we checked the direct binding of miR-195 to ActRIIA mRNA by using luciferase report assay in human placental trophoblast cell line, HTR8/Svneo cells. [score:1]
More importantly, ActRIIA could substantially abrogate the effect of miR-195 on cell invasion and activation of MMP-2 and MMP-9 in HTR8/SVneo cells. [score:1]
A. Real-time PCR to reveal miR-195 level in HTR8/SVneo cells transfected with scramble siRNA (NC) or miR-195 mimics (miR-195). [score:1]
Effects of miR-195 on Cell Invasion in HTR8/SVneo Cells. [score:1]
In human trophoblast cell line, HTR8/SVneo cells, no change in cell number is observed after miR-195 transfection. [score:1]
C and F. Gelatin zymography to measure MMP-2 and MMP-9 productions in cells transfected with miR-195, NC, Inhibitor NC or Anti-miR-195. [score:1]
Whether allelic loss and promoter hypermethylation can account for the reduced miR-195 expression in PE placentas needs further investigation. [score:1]
High frequency of loss of heterozygosity has been found on chromosome 17p13.1 where miR-195 located, which is implicated to play important roles in the pathogenesis of many types of tumors [39]. [score:1]
B. Western blot analysis to show change of ActRIIA protein level in HTR8/SVneo cells transfected with NC, miR-195 or si-ActRIIA. [score:1]
The seed sequence of miR-195 was complementary to the 47–53 nt or 502–508 nt of 3′UTR in ActRIIA mRNA. [score:1]
We further detected the influence of miR-195 on trophoblast cell invasion, and determined the rescue effect of ActRIIA on miR-195 function. [score:1]
HTR8/SVneo cells were plated into 24-well plates at a density of 5*10 [4] cells/well and transfected using Lipofectamine 2000 with 80 ng of pMIR-REPORT plasmid construct, 8 ng of pRL-TK control vector (encoding Renilla luciferase), and 20 nM of miR-195 in a final volume of 0.25 ml. [score:1]
Meanwhile, miR-195 shows strongly invasion-promoting effect in HTR8/SVneo cells, which is absolutely opposite to the results observed in breast cancer and glioblastoma cells [32], [33]. [score:1]
ActRIIA rescued the effect of miR-195 on cell invasion in HTR8/SVneo cells. [score:1]
However, miR-195 mimics could not affect the relative luciferase activity of BD1-WT/BD1-MUT construct. [score:1]
We assume that the endogenous level of miR-195 in HTR8/SVneo cells is too low to exhibit significant impact on cell invasion (Fig. 3E and F). [score:1]
B. Western blot analysis to show change of CCND1 and CCND3 protein level in HTR8/SVneo cells transfected with NC or miR-195. [score:1]
0038875.g004 Figure 4HTR8/SVneo cells were transfected with miR-195 and ActRIIA alone or in combination, with scramble siRNA (NC) or pcDNA4 vector (pcDNA4) as corresponding negative control. [score:1]
Real-time PCR to reveal miR-195 level in HTR8/SVneo cells transfected with scramble siRNA (NC) or miR-195 mimics (miR-195). [score:1]
By far, functional studies on miR-195 are mainly in cancer, whereas little is known about its role in placenta. [score:1]
MiR-195 belongs to miR-15 gene family which includes miR-15a/b/c, miR-16a/b/c, miR-497 and miR-424. [score:1]
This study extends our knowledge on the functions of miR-195 in human placenta. [score:1]
Therefore, it is most likely that miR-195 works in a unique way in human trophoblast cells which is different from what it does in cancer cells. [score:1]
HTR8/SVneo cells were transfected with BD1-WT/BD2-WT or BD1-MUT/BD2-MUT reporter construct together with miR-195 mimics as well as renilla luciferase vector (pRL-TK) to be used as reference control. [score:1]
A. Real-time PCR to reveal change of ActRIIA mRNA level in HTR8/SVneo cells transfected with scramble siRNA (NC), miR-195 mimics (miR-195) or ActRIIA siRNA (si-ActRIIA). [score:1]
Real-time PCR to reveal change of ActRIIA mRNA level in HTR8/SVneo cells transfected with scramble siRNA (NC), miR-195 mimics (miR-195) or ActRIIA siRNA (si-ActRIIA). [score:1]
As shown in Figure 5, no change in protein levels of CCND1 and CCND3 was observed in HTR8/SVneo cells at 48 h after miR-195 transfection. [score:1]
[1 to 20 of 108 sentences]
7
[+] score: 269
Other miRNAs from this paper: hsa-mir-145, hsa-mir-126, hsa-mir-150, hsa-mir-532, hsa-mir-582
This conclusion is supported by several findings: (1) a complementary sequence of miR-195 was identified in the 3′UTR of GABARAPL1 mRNA suggesting this 3′UTR interacts with miR-195; (2) inhibition of miR-195 led to a significant reduction in GABARAPL1 protein expression; (3) over -expression of miR-195 suppressed the luciferase reporter activity of the GABARAPL1 3′UTR- containing vector; (4) this effect was abolished by mutation of the miR-195 binding site in the GABARAPL1 3′UTR and (5) silencing of GABARAPL1 decreased the suppressive effect of miR-195 on autophagy, cell proliferation, migration and angiogenesis of hEPCs. [score:12]
In the present study, GABARAPL1 was identified as a direct target of miR-195, which regulates its expression by inhibiting mRNA translation through imperfect base-pairing with the 3′UTR in hEPCs. [score:11]
Figure 1The expression of miR-582, miR-195 and miR-532 under normoxic and hypoxic conditions as detected by qRT-PCR (* P<0.05) Knockdown of miR-195 promotes the autophagy of hEPCs under hypoxiaSince the expression level of miR-195 is increased under hypoxia, we transfected a miR-195 inhibitor into hEPCs and the cells were harvested for qRT-PCR. [score:8]
The results indicate that the miR-195 inhibitor could effectively suppress miR-195 expression (Figure 2A). [score:7]
Figure 1The expression of miR-582, miR-195 and miR-532 under normoxic and hypoxic conditions as detected by qRT-PCR (* P<0.05) Since the expression level of miR-195 is increased under hypoxia, we transfected a miR-195 inhibitor into hEPCs and the cells were harvested for qRT-PCR. [score:7]
GABARAPL1 is a direct target of miR-195To elucidate the underlying mechanism by which miR-195 regulates cell proliferation, migration and angiogenesis of hEPCs through autophagy, we explored miR-195 targets using the microRNA. [score:7]
The results showed that conversion of LC3B-I to LC3B-II and beclin1 expression were decreased after si-GABARAPL1 plus miR-195 inhibitor transfection compared with that of the si-NC plus miR-195 inhibitor transfected group under hypoxia (Figure 5C). [score:6]
As shown in Figure 6(A), the transfection of si-GABARAPL1 plus miR-195 inhibitor could obviously suppress the proliferation of hEPCs after transfection for 1, 2 and 3 days compared with that of the si-NC plus miR-195 inhibitor. [score:6]
In the present study, we found that miR-195 knockdown promotes the autophagy of hEPCs under hypoxia and inhibition of the autophagy process through 3-MA treatment could counteract the effect of miR-195 inhibitor on cell proliferation, migration and capillary tube formation. [score:6]
Figure 2Knockdown of miR-195 promotes the autophagy of hEPCs under hypoxia(A) The expression level of miR-195 after miR-195 inhibitor or NC transfection as detected by qRT-PCR. [score:6]
In conclusion, hypoxia could induce the expression of miR-195 and GABARAPL1 is a directed target of miR-195. [score:6]
Figure 3Inhibition of miR-195 promotes cell proliferation, migration and angiogenesis of hEPCs through the autophagy process under hypoxia(A) The effect of the miR-195 inhibitor or miR-195 inhibitor plus 3-MA on cell proliferation under hypoxia as detected by the cell proliferation assay after transfection for 1, 2 and 3 days. [score:6]
Figure 6GABARAPL1 silencing decreased the effect of miR-195 knockdown on cell proliferation, migration and angiogenesis of hEPCs under hypoxia(A) The effect of si-GABARAPL1 plus miR-195 inhibitor or si-NC plus miR-195 inhibitor on cell proliferation under hypoxia detected by cell proliferation assay after transfection for 1, 2 and 3 days. [score:5]
Then, the effect of si-GABARAPL1 plus miR-195 inhibitor on the expression of the autophagy-related genes LC3B and beclin1 was examined using western blotting. [score:5]
Such a significant decrease in reporter activity was not seen when the reporter was in the vector containing the mutant GABARAPL1 3′UTR (Figure 4B), despite the presence of miR-195, indicating that sequences in the 178–184 bp region of the GABARAPL1 3′UTR indeed interact with miR-195, inhibiting expression of GABARAPL1. [score:5]
Our analysis revealed that GABARAPL1 was a potential target of miR-195 based on putative conserved target sequences in the 178–184 bp region of the GABARAPL1 3′UTR (Figure 4A). [score:5]
And the inhibition of miR-195 expression could promote autophagy of EPCs. [score:5]
The inhibition of miR-195 inhibition did not cause degradation of GABARAPL1 mRNA (Figure 4C). [score:5]
The highest increased expression and the known functions [16– 21] of miR-195 indicated that miR-195 might play a role in regulating the function of hEPCs. [score:4]
For transwell migration assays, the number of cells that passed through the membrane into the lower chamber was significantly more for the si-GABARAPL1 plus miR-195 inhibitor transfected cells than for the si-NC plus miR-195 inhibitor transfected cells (Figures 6B and 6C). [score:4]
Figure 4GABARAPL1 is a direct target of miR-195(A) Predicted duplex formation between the wild-type or mutant GABARAPL1 3′UTR and miR-195. [score:4]
As shown in Figure 5(D), the number of intracellular autophagosomes after si-GABARAPL1 plus miR-195 inhibitor transfection decreased compared with that of the si-NC plus miR-195 inhibitor transfected group cultured under hypoxic conditions. [score:4]
Simply put, miR-195 regulates proliferation, migration, angiogenesis and autophagy of hEPCs by targeting GABARAPL1. [score:4]
The results showed that conversion of LC3B-I to LC3B-II and beclin1 expression was increased after miR-195 inhibitor transfection compared with that of the NC transfected group under hypoxia (Figure 2B). [score:4]
To elucidate the underlying mechanism by which miR-195 regulates cell proliferation, migration and angiogenesis of hEPCs through autophagy, we explored miR-195 targets using the microRNA. [score:4]
Figure 5GABARAPL1 silencing decreased the effect of miR-195 knockdown on the autophagy of hEPCs under hypoxia(A) The mRNA expression level of GABARAPL1 was successfully decreased after transfection with si-GABARAPL1. [score:4]
So we predicted that miR-195 might regulate cell proliferation, migration and angiogenesis through cell autophagy by targeting GABARAPL1. [score:4]
GABARAPL1 is a direct target of miR-195. [score:4]
Inhibition of miR-195 promotes cell proliferation, migration and angiogenesis of hEPCs through the autophagy process under hypoxia. [score:3]
However, the expression and function of miR-582, miR-195 and miR-532 in EPCs, especially in hypoxic conditions such as that of DVT, remains unknown. [score:3]
Furthermore, to determine the effect of miR-195 suppression on cell autophagy, the formation of autophagosomes was observed using. [score:3]
For the matrigel tube formation assay, hEPCs transfected with si-GABARAPL1 plus miR-195 inhibitor showed a significant improvement in capillary tube formation compared with si-GABARAPL1 plus miR-195 inhibitor (Figures 6D and 6E). [score:3]
Inhibition of miR-195 promotes cell proliferation, migration and angiogenesis of hEPCs under hypoxia. [score:3]
The results showed that 3-MA treatment could counteract the effect of miR-195 inhibitor on cell proliferation (Figure 3A), migration (Figures 3B and 3C) and capillary tube formation (Figures 3D and 3E). [score:3]
Based on these results, we predicated miR-195 might be a target for improving the function of hEPCs, although this predication needs more studies for further confirmation. [score:3]
We then examined the effect of miR-195 inhibitor transfection on GABARAPL1 mRNA and protein levels. [score:3]
To determine the effect of miR-195 on cell autophagy of hEPCs, the expression of the autophagy-related genes LC3B and beclin1 was examined using western blotting. [score:3]
As shown in Figure 3(A), transfection with the miR-195 inhibitor could obviously promote the proliferation of hEPCs after transfection for 1, 2 and 3 days. [score:3]
The miR-195 mimic, miR-195 inhibitor mimics and negative control (NC) mimics were purchased from Ribobio Co. [score:3]
Secondly, miR-195 has been shown to inhibit proliferation of certain cell types including thyroid, myoblast, cancer, mesenchymal stromal/stem and medullary thymic epithelial cells [16, 18, 22– 25]. [score:3]
Expression of miR-195 is increased under hypoxic conditions in hEPCs. [score:3]
Expression of miR-195 is increased under hypoxic conditions in hEPCshEPCs were cultured under normoxic and hypoxic conditions for 24 h. The hEPCs were subsequently harvested for qRT-PCR analysis. [score:3]
do) were used to predict the targets of miR-195. [score:3]
Firstly, miR-195 has been shown to have a significantly increased expression pattern between DVT and control subjects [14]. [score:3]
In addition, GABARAPL1 decreased the suppressive effect of miR-195 on cell proliferation, migration and angiogenesis of hEPCs. [score:3]
GABARAPL1 silencing decreased the effect of miR-195 knockdown on the autophagy of hEPCs under hypoxiaTo further investigate whether miR-195 affected cell autophagy through its target GABARAPL1, GABARAPL1 was knocked-down using si-GABARAPL1 (Figures 5A and 5B). [score:3]
The expression of miR-582, miR-195 and miR-532 under normoxic and hypoxic conditions as detected by qRT-PCR (* P<0.05). [score:3]
Thirdly, miR-195 has also been shown to suppress the migration of cancer cells [24]. [score:3]
Furthermore, we investigated the role of miR-195 on the proliferation, migration and angiogenesis of EPCs under hypoxia, and identified GABA type A receptor associated protein like 1 (GABARAPL1) as a directed target of miR-195. [score:2]
In addition, miR-195 also could regulate cell proliferation, migration and angiogenesis of hEPCs under hypoxic conditions. [score:2]
To analyse miR-582, miR-195 and miR-532 expression, reverse transcription PCR was performed using specific stem-loop reverse transcription primers, miRNA first strand synthesis was performed using a First Strand Synthesis Kit (Takara), and quantitative real-time PCR analysis (qRT-PCR) was performed using a SYBR Green Real time PCR Master Mix (Toyobo) on an Applied Biosystems 7500 system (Applied Biosystems). [score:2]
To further examine whether miR-195 directly targets GABARAPL1, a luciferase reporter assay was carried out and the results showed that a significant decrease in the luciferase activity of the reporter in the wild-type GABARAPL1 3′UTR containing vector was observed in the presence of miR-195 (Figure 4B), compared with that of the NC. [score:2]
Based on our present study, it is sure that miR-195 could regulate autophagy process under hypoxic conditions. [score:2]
For transwell migration assays, the number of cells that passed through the membrane into the lower chamber was significantly more for the miR-195 inhibitor transfected cells than for NC transfected cells (Figures 3B and 3C). [score:2]
All these results showed that miR-195 knockdown could promote the autophagy process of hEPCs under hypoxia. [score:2]
These results showed that GABARAPL1 silencing could decrease the effect of miR-195 knockdown on the autophagy of hEPCs under hypoxia. [score:2]
Inhibition of miR-195 promotes cell proliferation, migration and angiogenesis of hEPCs under hypoxiaTo investigate the effect of miR-195 on cell proliferation, migration and angiogenesis of hEPCs under hypoxia, hEPCs were transfected with the miR-195 inhibitor or NC under hypoxic conditions and cell proliferation, transwell migration and matrigel tube formation assays were carried out. [score:2]
Knockdown of miR-195 promotes the autophagy of hEPCs under hypoxia. [score:2]
As shown in Figure 2(C), the number of intracellular autophagosomes after miR-195 inhibitor transfection was increased compared with that of the NC transfected group when cultured under hypoxic exposure. [score:2]
To further investigate whether miR-195 affected cell autophagy through its target GABARAPL1, GABARAPL1 was knocked-down using si-GABARAPL1 (Figures 5A and 5B). [score:2]
All these results indicated that miR-195 might regulate cell proliferation, migration and angiogenesis of hEPCs through autophay. [score:2]
The results of qRT-PCR showed that the expression of miR-582, miR-195 and miR-532 was all significantly increased under conditions of hypoxia compared with that under normoxia (Figure 1). [score:2]
The knockdown of miR-195 promoted cell proliferation, migration, angiogenesis and autophagy of hEPCs under hypoxic conditions. [score:2]
GABARAPL1 silencing decreased the effect of miR-195 knockdown on cell proliferation, migration and angiogenesis of hEPCs under hypoxiaTo investigate the effect of GABARAPL1 silencing on the effect of miR-195 knockdown on cell proliferation, migration and angiogenesis of hEPCs under hypoxia, hEPCs were transfected with si-GABARAPL1 or si-NC plus miR-195 inhibitor and cell proliferation, transwell migration and matrigel tube formation assays were carried out. [score:2]
GABARAPL1 silencing decreased the effect of miR-195 knockdown on cell proliferation, migration and angiogenesis of hEPCs under hypoxia. [score:2]
GABARAPL1 silencing decreased the effect of miR-195 knockdown on the autophagy of hEPCs under hypoxia. [score:2]
Among these three miRNA, only miR-195 was demonstrated to have functions in regulating cell migration, angiogenesis and autophagy in many kinds of cells [16– 20]. [score:2]
The results showed that miR-195 knockdown promotes the autophagy, cell proliferation, migration and angiogenesis of hEPCs under hypoxia. [score:2]
Based on above reasons, miR-195 was chose for the following study. [score:1]
In the present study, we firstly investigated the expression level of miR-582, miR-195 and miR-532 in hEPCs under hypoxic conditions. [score:1]
To investigate the effect of GABARAPL1 silencing on the effect of miR-195 knockdown on cell proliferation, migration and angiogenesis of hEPCs under hypoxia, hEPCs were transfected with si-GABARAPL1 or si-NC plus miR-195 inhibitor and cell proliferation, transwell migration and matrigel tube formation assays were carried out. [score:1]
Finally, miR-195 was found to play an anti-angiogenic role in endothelial cells, mesenchymal stromal/stem cells and cancer cells [16, 18, 26]. [score:1]
For the matrigel tube formation assay, hEPCs transfected with the miR-195 inhibitor showed a significant improvement in capillary tube formation compared with that of the NC (Figures 3D and 3E). [score:1]
In another previous study, a panel of miRNAs, such as miR-582, miR-195 and miR-532, were identified as new biomarkers for the detection of DVT [14]. [score:1]
293T cells, plated on 24-well plates, were co -transfected with 100 ng plasmid and 200 nM miR-195 mimic or miR-NC. [score:1]
To determine whether miR-195 promotes cell proliferation, migration and angiogenesis of hEPCs through the autophagy process under hypoxia, hEPCs were treated with 3-MA which could block the autophagy process. [score:1]
In addition, only miR-195 was reported to have function under hypoxia condition [21]. [score:1]
Furthermore, the increased fold of miR-195 was highest under hypoxic conditions in hEPCs. [score:1]
In the present study, we found that, the increased fold of miR-195 was highest in human EPCs (hEPCs) under hypoxic conditions among these three miRNAs. [score:1]
[1 to 20 of 79 sentences]
8
[+] score: 239
Consistent with miR-195 transfection, the inhibition of FGF2 expression in PCa cells decreased vimentin and N-cadherin expression and increased E-cadherin expression (Fig 4C). [score:9]
miR-195 overexpression remarkably inhibited FGF2 expression in DU-145 and PC-3 cells (Fig 3C). [score:7]
In this study, our data showed that the knockdown of FGF2 elicited similar effects on PCa cells with overexpressed miR-195 by inhibiting EMT and invasiveness. [score:6]
Bioinformatics analyses were performed using DIANA microT v5.0 and TargetScanHuman 6.2 to identify the target genes of miR-195. [score:5]
B) Forced expression of miR-195 inhibited invasion in PCa cell lines. [score:5]
0144073.g002 Fig 2 A) Forced expression of miR-195 inhibited migration in PCa cell lines. [score:5]
Patients were divided into low and high expression groups by using the number located in 30% of all number, 11.05 as a cut-off of miR-195 expression. [score:5]
Overexpressed miR-195 in PCa cells inhibited EMT and cell metastasis. [score:5]
In conclusion, miR-195 inhibited PCa cell metastasis and EMT by targeting FGF2. [score:5]
Furthermore, the restored FGF2 levels in cells which overexpressed miR-195 likely inhibited the effects of miR-195. [score:5]
The induction of miR-195 expression inhibited EMT and invasiveness of PCa cells. [score:5]
Luciferase reporter assays and were conducted to identify miR-195 targets; results showed that fibroblast growth factor 2 (FGF2) is a direct target. [score:5]
A) Forced expression of miR-195 inhibited migration in PCa cell lines. [score:5]
CARMA3 and Bcl-2 are direct targets of miR-195 in colorectal cancer [18, 28]. [score:4]
However, no significant different was observed between LnCap cells transfected miR-195 inhibitor and control inhibitor in invasion and migration assays (S1 Fig). [score:4]
FGF2 was a direct target of miR-195. [score:4]
IGF1R and HDGF are direct targets of miR-195 in NSCLC [14, 17]. [score:4]
FGF2 was then knocked down in PCa cells and effects similar to those of miR-195 overexpression were observed. [score:4]
These results suggested that FGF2 is a direct target gene of miR-195. [score:4]
Invasion ability was also significantly downregulated in miR-195 -transfected DU-145 and PC-3 cells (Fig 2B). [score:4]
FGF2 knockdown elicited similar effects on PCa cells with overexpressed miR-195. [score:4]
FGF2 was knocked down in PCa cells by introducing siRNA to determine whether the effects of miR-195 can be partly explained by targeting of FGF2. [score:4]
FGF2 knockdown resulted similar effects in PCa cells with overexpress miR-195. [score:4]
Transfected miR-195 inhibitor in LnCap cells didn’t affect the migration and invasion abilities. [score:3]
In this study, data from Memorial Sloan Kettering Cancer Center (MSKCC) prostate cancer database were re-analysed; results revealed that miR-195 was poorly expressed in metastatic PCa. [score:3]
A) Data in the re-analysed MSKCC prostate cancer database showed that miR-195 is expressed poorly metastatic PCa (metastatic PCa vs. [score:3]
miR-195 inhibited EMT in an FGF2 -dependent manner. [score:3]
To investigate whether miR-195 affects PCa cell invasion and migration, we transfected miR-195 inhibitor or control inhibitor in LnCap cells and miR-195 mimics or control miRNA in DU-145 and PC-3 cells and analysed cell migration and invasion ability by using Transwell. [score:3]
miR-195 inhibited EMT in PCa cells. [score:3]
miR-195 expression and clinical patient data were downloaded from the MSKCC database (http://www. [score:3]
However, this study only analyzed miR-195 expression in prostate cancer, the effects of miR-195 on PCa pathobiology, especially in metastasis, are currently undetermined. [score:3]
In this study, FGF2 was confirmed as a direct target gene of miR-195 through luciferase assay and. [score:3]
In this study, re-analysis of the data obtained from MSKCC showed that miR-195 was poorly expressed in metastatic PCa. [score:3]
miR-195 expression between localised PCa and metastatic PCa and the corresponding biochemical relapse-free time after radical prostatectomy was re-analysed in the database. [score:3]
C) Common EMT markers expression after transfecting miR-195. [score:3]
EMT inhibition by miR-195 in PCa cells. [score:3]
These results showed that miR-195 inhibited EMT of PCa cells in an FGF2 -dependent manner. [score:3]
S1 Fig Transfected miR-195 inhibitor in LnCap cells didn’t affect the migration and invasion abilities. [score:3]
miR-195 inhibited EMT in an FGF2 dependent manner. [score:3]
Moreover, miR-195 can also inhibit invasion and migration in NSCLC, colorectal cancer and osteosarcoma [17, 18, 22]. [score:3]
E-cadherin expression increased in cells transfected with miR-195 mimics (Fig 2C). [score:3]
Expression of miR-195 in prostate cancer cell lines were retrieved from database (GSE21032, http://www. [score:3]
B) Dual-luciferase assay results for PC-3 cells showed that miR-195 upregulation decreased luciferase activity. [score:3]
miR-195 expression and impact on diagnosis and outcome of patients with PCa. [score:3]
B) ROC analysis using expression levels of miR-195 in metastatic PCa and localised PCa (AUC = 0.705, P = 0.017). [score:3]
Kaplan–Meier curves of RFS showed that PCa patients with low miR-195 expression showed shorter RFS time (P = 0.047, Fig 1C). [score:3]
Expression of miR-195 in prostate cancer cell lines was retrieved from the NCBI GEO database (GSE21032, http://www. [score:3]
These results suggested that miR-195 may impede cell invasion and migration by inhibiting EMT. [score:3]
0144073.g001 Fig 1 A) Data in the re-analysed MSKCC prostate cancer database showed that miR-195 is expressed poorly metastatic PCa (metastatic PCa vs. [score:3]
miR-195 was also found be low expression in PCa tissues [23]. [score:3]
Patients with lower miR-195 expression exhibited shorter relapse-free survival (RFS) time. [score:3]
miR-195 expression and its effect on the diagnosis and outcome of patients with PCa. [score:3]
Aberrant miR-195 expression has been observed in many types of malignant cancers, such as breast, gastric, colon, adrenocortical, bladder and ovarian cancers, hepatocellular carcinoma and non-small cell lung cancer (NSCLC) [14– 21]. [score:3]
ROC analysis demonstrated that miR-195 can discriminate metastatic cancer from primary PCa; low miR-195 expression exhibited shorter RFS time. [score:3]
The effect of miR-195 inhibitor in LnCap. [score:3]
However, the regulatory procedure of miR-195 in PCa remains unclear. [score:2]
As such, genes were regulated by miR-195. [score:2]
A decreased expression of vimentin and N-cadherin proteins was observed in cells transfected with miR-195 mimics compared with that in cells transfected with control miRNA. [score:2]
These results showed that miR-195 may be implicated in PCa metastasis; miR-195 can be used as a biomarker for diagnosis and prognosis analysis. [score:1]
3′-UTRs of FGF2 were predicted to contain five binding sites for miR-195. [score:1]
To further confirm whether FGF2 was required for miR-195 mediated EMT, we treated the cells with recombinant human FGF2 protein (Sino Biological Inc. [score:1]
A great numbers of miRNAs are found play integral roles in modulating EMT [10], miR-195 is also correlated with lymph node metastasis and poor prognosis in colorectal cancer [27]. [score:1]
The results showed that the miR-195 mimics group contained fewer numbers of cells, which migrated into the lower chamber of the Transwell filter, than the miR-NC group in Du-145 and PC-3 cells (Fig 2A). [score:1]
Moreover, ROC analysis demonstrated that miR-195 could discriminate between metastatic cancer and primary PCa (AUC = 0.705, P = 0.017, Fig 1B). [score:1]
miR-195 belongs to the miR-15/16/195 family; this miRNA is localised inn chromosome 17p13.1. [score:1]
The expression of miR-195 between localised and metastatic PCas was calculated by t-tests. [score:1]
0144073.g005 Fig 5 PCa cell lines were treated with recombinant human FGF2 protein after transfection with miR-195 was performed. [score:1]
The result showed that miR-195 in metastatic PCa was significantly lower than that in localised PCa (9.92 ± 0.56 vs. [score:1]
Patients with low miR-195 levels exhibited shorter RFS than those with high levels (P < 0.05) *P < 0.05. [score:1]
Therefore, we investigated the effect of low miR-195 expression on RFS in localised PCa. [score:1]
Luciferase activity assay showed that miR-195 mimics significantly suppressed the luciferase activity of the reporter plasmid containing binding sites compared with the NC of the wild-type reporter but not of the mutant one (Fig 3B). [score:1]
0144073.g003 Fig 3 A) Sequence alignment of human miR-195 with 3’ UTR of FGF2 predicted by DIANA LAB. [score:1]
Hence, miR-195 may play important functions in PCa metastasis. [score:1]
Predicted binding sites of miR-195 for FGF2. [score:1]
miR-195 restoration may provide new therapeutic methods to treat metastatic PCa. [score:1]
C) Kaplan–Meier curves of RFS of patients with PCa stratified by the tissues of miR-195 levels. [score:1]
The reporter plasmids were co -transfected with miR-195 mimics or NC in PC-3 cells. [score:1]
The sequence of miR-195 siRNA was 5′-GCCAAUAUUUCUGUGCUGCUA-3′ and the control sequence was 5′- CAGUACUUUUGUGUAGUACAA -3′. [score:1]
The sense and anti-sense sequences of the hsa-miR-195 mimics were: 5′-UAGCAGCACAGAAAUAUUGGC-3′ and 5′- CAAUAUUUCUGUGCUGCUAUU-3′, respectively. [score:1]
These findings suggested that miR-195 plays an important role in PCa metastasis. [score:1]
After miR-195 was transfected, the treated cells with recombinant human FGF2 protein abrogated the effects of miR-195. [score:1]
Cells were cultured in 24-well plates and each well was transfected with 250 ng of vectors with 50 nM miR-195 or NC. [score:1]
PCa cell lines were treated with recombinant human FGF2 protein after transfection with miR-195 was performed. [score:1]
[1 to 20 of 83 sentences]
9
[+] score: 207
Bioinformatics analysis of the expression levels of the 92 genes significantly downregulated (fold change<-1.5, P-value<0.05) by miR-195 in THP-1 macrophages revealed that atherosclerosis signaling (P-value = 0.0147) is one of the top canonical pathways, as a result of F3, S100A8 and ALOX5 downregulation (fold change: -1.93, -6.87 and -1.65, respectively), three genes known to be involved in important mechanisms that contribute to disease pathophysiology (Fig 5A) [30, 31]. [score:11]
In silico miR-195 targets prediction In silico predictions of miR-195-5p targets were performed by screening the databases TargetScan (http://www. [score:7]
Moreover, important processes in atherosclerosis such as inflammatory response, cell-to-cell signaling and interaction, and immune cell trafficking are comprised among the most prominent biologic functions predicted to be affected by the most downregulated mRNAs in THP-1 macrophages overexpressing miR-195 (Fig 5C). [score:6]
are illustrated in Fig 3A, and show that phosphorylation levels of p54 and p46 JNK and p38 MAPK are all significantly downregulated in miR-195 -overexpressing cells, which indicates an active repression of TLR2 downstream effectors. [score:6]
Regarding ALOX5, although not statistically significant, its expression levels tend to be downregulated by miR-195 as well (Fig 5B). [score:6]
To further identify relevant genes and pathways targeted by miR-195, the expression profile of THP-1 macrophages overexpressing miR-195 was compared with SCR -transfected cells. [score:6]
Following these results, we hypothesized that miR-195 could influence TLR2 expression by directly targeting its mRNA. [score:6]
However, the results obtained show no direct interaction between miR-195 and TLR2 for the predicted binding site (Fig 2D), suggesting TLR2 expression is regulated by miR-195 through an indirect mechanism. [score:6]
Importantly, RT-qPCR results confirmed that F3 and S100A8 were significantly downregulated in macrophages overexpressing miR-195 compared with SCR -transfected macrophages (p<0.05). [score:5]
Expression of miR-195 in macrophages inhibits smooth muscle cells recruitment and migration profile. [score:5]
In silico predictions of miR-195-5p targets were performed by screening the databases TargetScan (http://www. [score:5]
Our results show, for the first time, that the expression of TLR2 is regulated by miR-195, as its levels are significantly reduced in miR-195 -transfected THP-1 macrophages polarized towards M1 phenotype. [score:4]
miR-195 downregulated genes are associated with inflammatory and cell recruitment mechanisms. [score:4]
com/products/ingenuitypathway-analysis) was performed to identify the pathways and biological functions associated to miR-195 downregulated genes. [score:4]
C) List of the 10 most prominent biological functions of genes downregulated by miR-195, determined by IPA. [score:4]
In conclusion, miR-195 impacts inflammatory pathways through downregulation of active phosphorylated forms of p54 JNK, p46 JNK and p38 MAPK proteins downstream of TLR2. [score:4]
Remarkably, levels of IL-1β, IL-6 and TNF-α were reduced, which indicates that miR-195 efficiently inhibits the pro-inflammatory TLR2 signalling pathway, specifically p38 MAPK and JNK pathways, reinforcing the hypothesis that this specific miRNA acts as an anti-inflammatory regulator in macrophages. [score:4]
Nonetheless, differences in levels of total forms of p54 JNK, p46 JNK and p38 MAPK were not observed (S4B Fig), indicating that these proteins are not miR-195 direct targets. [score:4]
miR-195 inhibits the TLR2 signaling pathway. [score:3]
B) Relative miR-195 expression levels in non -treated, LPS and IL-10 treated macrophages, determined by RT-qPCR (n = 9); Cq: quantification cycle. [score:3]
Then, from the list of mRNAs predicted to be targeted by miR-195, the interaction with TLR2 was specifically analyzed. [score:3]
Therefore, we explored the impact of miR-195 in the expression of TLRs known to be involved in human atherosclerotic plaques formation, namely TLR2 and TLR4. [score:3]
Increased expression of miR-195 in macrophages decreases production of pro-inflammatory cytokines. [score:3]
Importantly, miR-195 overexpression in macrophages under pro-inflammatory conditions is able to decrease HUASMC recruitment to similar levels of macrophages in a non-pro-inflammatory environment (Fig 6D). [score:3]
This suggests miR-195 as a potential tool to prevent and potentially treat atherosclerotic lesions and other cardiovascular diseases. [score:3]
miR-195 is overexpressed in IL-10 -treated macrophages. [score:3]
TLR2 was predicted to be a target of miR-195 by RNA22 and miRWalk algorithms (Fig 2D). [score:3]
D) In silico target prediction for hsa-miR-195-5p interaction with TLR2 mRNA; graphic shows normalized levels of luciferase activity of a representative experiment performed in triplicates (mean ± SD); Control: Non -transfected, non-stimulated THP-1 macrophages; Mutated (Mut): vector with a deletion in the predicted binding site. [score:3]
Interestingly, miR-195 inhibits VSMC proliferation and migration, and reduces neointimal formation in a balloon-injured carotid artery [19], which shows that miR-195 plays a role in the cardiovascular system. [score:3]
Levels of IL-1β, IL-6 and TNF-α secreted by macrophages after miR-195 overexpression upon pro-inflammatory stimulation. [score:3]
Specifically, high expression levels of miR-195 in THP-1 macrophages reduce cell capability to recruit HUASMC by 40% (versus M1 non -transfected) and 50% (versus M1 SCR-macrophages) (Fig 6D). [score:3]
Specifically, 30 min after M1 stimulation, phospho-p54 and phospho-p38 levels show a reduction of 25% (p<0.05) and 41% (p<0.05), respectively, in miR-195 -overexpressing THP-1 macrophages (Fig 3B). [score:3]
Moreover, phospho-p46 was found to be significantly downregulated by 41% (p<0.05) in macrophages transfected with miR-195 compared with the respective SCR controls, after M1 stimulation for 15 and 30 minutes (Fig 3B). [score:3]
miR-195 expression impacts inflammatory and atherosclerosis associated pathways. [score:3]
In silico miR-195 targets prediction. [score:3]
Moreover, the effect could be indirect through miR-195 binding to TLR2 regulators and transcription factors. [score:3]
For gene expression array data validation, RNA from SCR and miR-195 transfected THP-1 macrophages was treated with TURBO DNA-free Kit (Invitrogen) and complementary DNA (cDNA) was synthesized using Random Hexamers (Invitrogen), dNTPs (Bioline) and SuperScript [®] III Reverse Transcriptase (Invitrogen). [score:3]
However, macrophages overexpressing miR-195 do not significantly change their surface or intracellular TLR4 levels compared with SCR -transfected macrophages. [score:2]
Interestingly, both assays showed that macrophages overexpressing miR-195 drastically lose their ability to promote VSMC recruitment in a pro-inflammatory environment. [score:2]
A) Volcano plot of statistical significance against fold change representing most deregulated genes between miR-195 and SCR -transfected THP-1 macrophages. [score:2]
0188530.g005 Fig 5 A) Volcano plot of statistical significance against fold change representing most deregulated genes between miR-195 and SCR -transfected THP-1 macrophages. [score:2]
Although a TLR2 mRNA::miRNA-195 direct interaction for the predicted binding site was not found, we do not exclude the hypothesis of an interaction in other region of the TLR2 mRNA. [score:2]
In the cardiovascular system, miR-195 regulates VSMC proliferation, migration and cytokine secretion profile, and prevents neointimal formation [19]. [score:2]
Importantly, under pro-inflammatory conditions, cells overexpressing miR-195 show a significant reduction in TLR2 at the cell surface and intracellularly compared with M1 macrophages transfected with SCR (p<0.01) (Fig 2A). [score:2]
Similarly, TLR2 intracellular levels are decreased by miR-195 -overexpressing cells compared with SCR in a pro-inflammatory environment (p = 0.0552). [score:2]
Transfection efficiency of miR-195 mimics in THP-1 macrophages. [score:1]
Therefore, miR-195 can be used as a tool to counterbalance and reverse the effect of the induced M1 pro-inflammatory profile in macrophages. [score:1]
0188530.g004 Fig 4 miR-195 mimic was transfected into THP-1 macrophages before stimulation with LPS and IFN-γ. [score:1]
miR-195 reduces the capability of macrophages to recruit human umbilical artery smooth muscle cells and impair their migratory profile. [score:1]
miR-195 is increased in human M2 macrophages. [score:1]
qPCR reactions were prepared using cDNA, miR-195 or small nuclear RNA U6 TaqMan probe (Applied Biosystems) and SsoAdvanced [™] Universal Probes Supermix (Bio-Rad). [score:1]
Differentiated THP-1 macrophages were transfected with miRNA mimics (Pre-miR miRNA Precursor miR-195-5p) or Pre-miR miRNA Precursor Negative Control (Scrambled—SCR) (Life Technologies), using Lipofectamine 2000 transfection reagent (Invitrogen), as recommended by the manufacturer. [score:1]
To address this hypothesis, we followed an unbiased bioinformatics approach whereby prediction databases for miRNA-mRNA interaction were screened and tested for complementary base pair interaction between miR-195 and TLR2 mRNA. [score:1]
Thus, the impact of miR-195 overexpression in THP-1 macrophages, under pro-inflammatory stimuli, on HUASMC recruitment was evaluated using an in vitro recruitment mo del. [score:1]
Herein, we describe for the first time that miR-195 levels are increased in IL-10 -treated human primary macrophages and further investigated miR-195 as a potential tool to inhibit mechanisms that promote M1 macrophage polarization. [score:1]
Although JNK isoforms (p54, p46) and p38 MAPK total protein levels were not altered, the activated/phosphorylated p54 JNK, p46 JNK and p38 MAPK forms were significantly decreased by miR-195. [score:1]
THP-1-derived macrophages were transfected with miR-195 mimics or SCR and then stimulated with 100 ng/mL LPS and 20 ng/mL IFN-γ. [score:1]
miR-195 reduces TLR2 levels in macrophages. [score:1]
Supernatants of THP-1 macrophages transfected with miR-195 in pro-inflammatory conditions were collected 24 hours after stimulation, and analyzed by ELISA. [score:1]
A) shows protein levels of p54 JNK, p46 JNK and p38 MAPK phosphorylated forms in THP-1 macrophages after transfection with SCR control or miR-195 and M1 stimulation during 15 or 30 minutes. [score:1]
Although further experiments are needed to understand which mediators are changed by miR-195 and how do they affect VSMC-macrophages crosstalk, this is the first evidence that modulation of macrophage phenotype through miR-195 has a paracrine effect on VSMC. [score:1]
Firstly, THP-1 cells were differentiated to macrophages, transfected with either miR-195 or SCR, and stimulated with 100 ng/mL LPS and 20 ng/mL IFN-γ for six hours, in 24-well plates (bottom compartment of the transwell system—BC). [score:1]
Knowing that miR-195 influenced TLR2 expression, we further investigated the impact of miR-195 on TLR2 signaling pathway. [score:1]
Cells were cotransfected with 50 nM of SCR or miR-195, and 0.4 μg of pGL3-putative binding site plasmids or pGL3-mutated putative binding site plasmids, together with Renilla luciferase construct that was used as a normalization reference. [score:1]
Finally, miR-195 expression levels were evaluated by RT-qPCR in M1 and M2c macrophage phenotypes. [score:1]
hsa-miR-195-5p sequence annotation was obtained from the miRBase database (http://www. [score:1]
0188530.g003 Fig 3 A) shows protein levels of p54 JNK, p46 JNK and p38 MAPK phosphorylated forms in THP-1 macrophages after transfection with SCR control or miR-195 and M1 stimulation during 15 or 30 minutes. [score:1]
miR-195 has been shown to control major cellular processes, including cell cycle progression, proliferation, migration and invasion, and cell differentiation [34, 35]. [score:1]
Column 1—non-stimulated THP-1 macrophages; Column 2 –No THP-1 macrophages, only M1 stimuli (LPS + IFN-γ); Column 3—M1 stimulated THP-1 macrophages; Column 4—M1 stimulated THP-1 macrophages transfected with SCR; and Column 5—M1 stimulated THP-1 macrophages transfected with miR-195. [score:1]
0188530.g002 Fig 2A) analysis of TLR2 surface (n = 5) and B) intracellular (n = 4) levels on THP-1 macrophages after transfection with either SCR or miR-195 and after induction of M1-like macrophages with LPS and IFN-γ. [score:1]
In conclusion, miR-195 specifically impacts TLR2 but not TLR4 levels in a pro-inflammatory environment. [score:1]
Next, levels of total and phosphorylated proteins were measured in non -transfected, SCR and miR-195 overexpressing cells. [score:1]
A) analysis of TLR2 surface (n = 5) and B) intracellular (n = 4) levels on THP-1 macrophages after transfection with either SCR or miR-195 and after induction of M1-like macrophages with LPS and IFN-γ. [score:1]
miR-195 decreases levels of p54 JNK, p46 JNK and p38 MAPK phosphorylated forms. [score:1]
miR-195 impacts TLR2 surface and intracellular levels upon pro-inflammatory stimuli. [score:1]
miR-195 mimic was transfected into THP-1 macrophages before stimulation with LPS and IFN-γ. [score:1]
RNA from miR-195-THP1 macrophages and SCR-THP-1 macrophages was isolated as described above and RNA quality was assessed using Bioanalyzer RNA 6000 Nano Kit (Agilent). [score:1]
of miR-195 mimics were successfully performed, as shown by RT-qPCR results (p<0.0001) (S2 Fig). [score:1]
For this reason, we hypothesized and evaluated if the anti-atherogenic miR-195 could act through macrophages by inhibiting their pro-inflammatory action and conditioning the communication with VSMCs. [score:1]
In conclusion, miR-195 impacts macrophage polarization status, favoring an anti-inflammatory phenotype even in pro-inflammatory conditions, which leads to a reduction in the recruitment of VSMC. [score:1]
Interestingly, HUASMC cultured in the presence of conditioned media from miR-195-M1-macrophages migrated significantly less than those cultured with conditioned media from M1 macrophages (p<0.01, 36 hours) or SCR-M1-macrophages (p<0.05, 36 hours) (Fig 6E). [score:1]
Therefore, miR-195 is involved in the response of macrophages to M2c stimuli. [score:1]
[1 to 20 of 82 sentences]
10
[+] score: 186
Here, we demonstrate that miR-195, a classical tumor suppressor in many types of cancer, is down-regulated in melanoma and directly regulates PHB1 expression. [score:10]
To establish PHB1 as a relevant target of miR-195, we conducted rescue experiments in which we showed that PHB1 transgenic expression could antagonize the suppressive effect miR-195 on the proliferation of melanoma cells. [score:7]
Moreover, RT-qPCR data showed that miR-195 is down-regulated while PHB1 is up-regulated in a collection of melanoma cells. [score:7]
miR-195 is described as a classical tumor suppressor in many tumors and down-regulation of the miR-195/497 cluster could be explained by a hypermethylated promoter region in hepatocellular carcinoma, breast cancer, gastric cancer, and glioblastoma [39– 42]. [score:6]
Taken together, these data indicate that PHB1 up-regulation in melanoma could be due in part to a decrease in miR-195 expression. [score:6]
Lacking of miR-195 expression in melanoma patients seems to be one of the main mechanisms of PHB1 accumulation in melanomas which could decrease the efficacy of chemotherapy and even target therapies like vemurafenib used in melanoma patients harboring BRAF V600E mutation. [score:6]
To determine if this suppressive effect of miR-195 takes place primarily via PHB1 inhibition, we conducted rescue experiments. [score:5]
Previous studies have shown that ectopic expression of miR-195 also sensitized glioblastoma, hepatocellular carcinoma, breast cancer, and colon tumor cells to temozolomide, 5-fluorouracil, adriamycin, and doxorubicin treatment by targeting BCL2L-2, BCL-W, and RAF-1 genes, respectively [23, 43– 45]. [score:5]
MicroRNA-195 is down-regulated in melanoma cells according to the TCGA database and shows a significant negative expression correlation with PHB1. [score:5]
To check if miR-195 also sensitizes melanoma cells to BRAF inhibitor (vemurafenib, PLX4032), we transfected UACC-62 melanoma cells with miR-195 (25 nM) and treated with 1 μM and 10 μM PLX-4032 for 48 h. The results confirmed the sensitizing role of miR-195 also to target therapy against melanoma (Additional file  6: Figure S5). [score:5]
PHB1 expression is negatively correlated with miRNA-195 expression. [score:5]
Here, we determined that transgenic expression of PHB1 neutralizes the anti-proliferative effect of miR-195, establishing PHB1 as relevant target gene. [score:5]
In addition, miR-195 is still up-regulated even 48 and 72hs after transfection (Fig.   2c and d and Additional file  2: Figure S1C and D, respectively. [score:4]
To confirm that PHB1 is a direct target of miR-195, an 852 bp fragment of the 3′-UTR of PHB1 containing the putative miR-195 binding site was cloned (pmiR-GLO-PHB1–3’UTR-WT) and a miR-195 binding site deletion clone was prepared (pmiR-GLO-PHB1–3’UTR- del195) (Fig.   2e, upper panel). [score:4]
Transfection of miRNA-195 mimics down-regulates PHB1 mRNA and protein levels in UACC-62 and SK-MEL-5. miR-195 has a slightly sensitize effect in human melanoma cells to different doses of cisplatin and temozolomide. [score:4]
miR-195 acts as a classical tumor suppressor miRNA in many tumor types and regulates anti-apoptotic molecules in drug resistance pathways [28]. [score:4]
Interestingly, most of melanoma patients have down-regulation of microRNA-195. [score:4]
When miR-CTRL was transfected in ORF-PHB1 expressing cells, the proliferation index reached its maximum in 99 h (Fig.   3b), while miR-195 mimics transfection produced a much less dramatic impact on the proliferation index, which reached the maximum of 80% in 100 h (Fig.   3b). [score:3]
In cells transfected with the open reading frame (ORF) of PHB1, and therefore not susceptible to miR-195 inhibition, a different scenario was observed. [score:3]
This study support the role of miR-195 as anti-proliferative miRNA via targeting of PHB1 in melanoma cells. [score:3]
Analysis of the TCGA -RNAseq revealed a significant negative correlation (Pearson) between miR-195 and PHB1 expression. [score:3]
The red line indicates an inverse correlation of expression between the samples for miR-195 and PHB1 genes (Pearson’s r = −0.23; P ≤ 0.001). [score:3]
PHB1 expression is modulated by miRNA-195. [score:3]
TCGA data are reported as means ± SD of relative quantification Log [2] base values To investigate whether miR-195 regulates directly PHB1 expression, UACC-62 and SK-MEL-5 melanoma cells were transfected with miR-195 mimics or a miR-control. [score:3]
A co-transfection experiment showed that miR-195 decreased the expression of pmiR-GLO-PHB-3’UTR-WT by approximately 40%, based on luciferase/renilla activity (P ≤ 0.0001). [score:3]
For miR-195-PHB1 antagonism studies, two clones of the UACC-62 cell line overexpressing either ORF-PHB1 or pcDNA3.1-EV were used. [score:3]
PHB1 antagonizes the suppressive effect of miRNA-195 on cell proliferation. [score:3]
b MicroRNA-195 is down-regulated (open columns down) and PHB1 up-regulated (full columns up) in 12/12 melanoma cell lines evaluated by RT-qPCR compared to melanocytes (NGM cells) using 2 [(− ∆∆ Ct)] method. [score:3]
Site-directed mutation was performed in order to delete miR-195 binding-site region (PHB1–3’UTR- del195–5′-…agaTGCTGCTgaa…3′) using Pfu Turbo DNA polymerase (2.5 U/μL) following the manufacturer’s instructions (Stratagene, La Jolla, CA, USA). [score:3]
MicroRNA-195 modulates PHB1 expression in melanoma cells. [score:2]
We demonstrated that miR-195 regulates PHB1 directly by RT-qPCR and western blot in melanoma cells and luciferase assays. [score:2]
Deletion of miR-195 binding site in PHB1 3′ UTR decreased the regulation (P ≤ 0.05) (Fig.   2e, lower panel). [score:2]
To corroborate the observed negative correlation, we analyzed the gene expression levels of PHB1 and miR-195 in 12 melanoma cell lines compared to melanocytes (NGM) (Fig.   1b). [score:2]
In summary, our results established miR-195-PHB1 as important regulatory node. [score:2]
It is possible that this site is weakly recognized by miR-195 and contributes to the regulation. [score:2]
These results indicate that the anti-proliferative effect of miR-195 observed in melanoma cells was in great part due to PHB1 regulation. [score:2]
SK-MEL-5 melanoma cells were transfected with either miR-control/mir-195. [score:1]
Effect of miRNA-195 and drugs in melanoma cells. [score:1]
We checked the sequence of PHB 3’UTR and identified another sequence that partially matches miR-195 seed sequence. [score:1]
This panel shows the cell cycle profile of UACC-62 melanoma cells transfected with either miRNA-control/miR-195 (10 nM) (24 h) and treated with cisplatin (CIS-2.5 and 5 μM) or temozolomide (TMZ-50 and 250 μM) for 48 h (total time 72 h). [score:1]
miR-195 is located at 17p13.1 and belongs to the microRNA-15/16/195/424/497 family [38]. [score:1]
Interestingly, in the presence of miR-195, the cytotoxic effects of cisplatin and temozolomide were even higher and, in this scenario, cell death was not preceded by a cell cycle arrest at the G2/M phase (Fig.   5, and Additional file  7: Figure S6). [score:1]
However, when these cells were transfected with miR-195, the proliferation index decreased to 18–30%. [score:1]
Interestingly, hypodiploid cells were observed after miR-195 transfection in both UACC-62 (25%) and SK-MEL-5 (40%) cells; however, in the presence of either cisplatin and temozolomide, we did observe a significant increase in cell death index in both cell lines transfected with miR-195, suggesting an effect of miR-195 in melanoma sensitivity to chemotherapy (Fig.   4c, d; Additional file  5: Figure S4C, D, respectively). [score:1]
SK-MEL-5 melanoma cells were transfected with either miR-control or miR-195 (10 nM) and observed for five days after transfection Representative examples of at least three independent experiments are reported. [score:1]
Among the top three negatively correlated miRNAs, miRNA-195 caught our attention (Pearson’s r = −0.23; P < 0.001, Fig.   1a). [score:1]
In fact, the deletion of miR-195 binding site in PHB 3′ UTR reduced drastically the effect of miR-195 but did not completely abolished it. [score:1]
This panel shows the cell cycle profile of SK-MEL-5 melanoma cells transfected with either miRNA-control/miR-195 (10 nM) (24 h) and treated with cisplatin (CIS-2.5 and 5 μM) or temozolomide (TMZ-50 and 250 μM) for 48 h (total time 72 h). [score:1]
UACC-62 melanoma cells were transfected with either miR-control/mir-195. [score:1]
HeLa cells were transiently co -transfected with either pmiR-GLO-PHB1–3’UTR-WT/pmiR-GLO-PHB1–3’UTR- del195 in the presence of miRNA-control/miR-195 mimics. [score:1]
UACC-62 cells were transfected with either miR-control/miR-195 (25 nM). [score:1]
In (c) and (d) miR-195 levels 48 and 72 h after transfection, respectively. [score:1]
Drug -induced cell death is accentuated by miR-195. [score:1]
Representative examples of at least three independent experiments are reported We tested if miRNA-195 mimics could potentially sensitize melanoma cells to chemotherapy treatments. [score:1]
Cells were then transfected with either miRNA -mimics control or miR-195 mimics. [score:1]
When cells were treated with increasing doses of cisplatin or temozolomide, cell viability decreased in a dose -dependent manner for both cell lines and miR-195 seems to exert an slightly additive effect combined with drugs on cell viability (Fig.   4a, b and Additional file  5: Figure S4A, B, respectively). [score:1]
We used miRNA mimic Syn-has-miR-195 (5′-TCCTTCATTCCACCGGAGTCTG-3′) (GE Dharmacon, Lafayette, CO USA) and ALL STARS Negative control siRNA (QIAGEN, Hilden, Germany). [score:1]
Here, we investigate the role of miR-195, its impact on PHB1 expression, and on chemosensitivity in melanoma cells. [score:1]
Cells were reverse transfected (RNAiMax) with miRNA-195/miRNA-control mimics (10 nM). [score:1]
All results showed that miR-195 exerts a small effect in UACC-62 melanoma cells sensitization to cisplatin and temozolomide treatments. [score:1]
Data from The Cancer Genome Atlas (TCGA) were used to evaluate the expression of miR-195 and PHB1. [score:1]
UACC-62 melanoma cells were transfected with either miR-control or miR-195 (25 nM) and observed for five days after transfection. [score:1]
To confirm that miR-195 induces cell death, we quantified caspase 3/7 activation. [score:1]
MicroRNA-195 or miRNA-control was transfected into stable each cell line. [score:1]
PHB1 mRNA decreased by approximately 50% in UACC-62 and by 20% in SK-MEL-5 cells upon miR-195 transfection (Fig.   2a and Additional file  2: Figure S1A, P ≤ 0.0001 and P ≤ 0.01, respectively). [score:1]
miRNA-195 act as anti-proliferative microRNA in melanoma cell. [score:1]
As observed in Fig.   4e, f and Additional file  5: Figure S4E, F, miR-195 alone is sufficient to trigger apoptosis and when cells were treated with cisplatin or temozolomide, activation of apoptosis was induced. [score:1]
Fig. 3PHB1 overcomes the anti-proliferative effect of miRNA-195. [score:1]
UACC-62 and SK-MEL-5 cells were seeded in 96 well plates and reverse transfected with either miR-195 or miRNA-control (10 nM). [score:1]
Melanoma microRNA-195 Prohibitin 1 Cisplatin Temozolomide Vemurafenib Melanoma is the most aggressive and lethal type of skin cancer. [score:1]
Representative examples of at least three independent experiments are reported We investigated the regulation of PHB1 by miR-195 and its possible impact on chemoresistance of metastatic melanoma cell lines harboring a BRAF-V600E mutation. [score:1]
10 ng of each pmiR-GLO-3′-UTR-PHB1 or pmiR-GLO-PHB1–3’UTR- del195 reporter vector were mixed with 500 nM of each miRNA-195 or miRNA-control in 25 μL OptiMEM (Invitrogen/Thermo Fisher Scientific, Waltham, MA USA). [score:1]
Then, we transfected both cell lines with either miR-control or miR-195 mimics, expose them to cisplatin and temozolomide and checked the impact on cell death. [score:1]
Moreover, miR-195 mimics impact cancer related phenotypes and modulate drug response in melanoma cells. [score:1]
Finally, transfection experiments combined with drug treatments performed in the UACC-62 and SK-MEL-5 melanoma cells corroborated miR-195 as potential anti-proliferative agent, with potential impact in sensitization of melanoma cell death. [score:1]
All experimental data were obtained 24 h after miRNA-control/miR-195 (10 nM) transfection plus 48 h of drug exposure (total time 72 h). [score:1]
In (c) and (d), miR-195 levels 48 and 72 h after transfection, respectively. [score:1]
shown that miR-195 decreased luciferase activity by about 40% (P ≤ 0.0001). [score:1]
NS: non-significant; ** P ≤ 0.01;*** P ≤ 0.001; **** P ≤ 0.0001 Fig. 5Drug -induced cell death is accentuated by miR-195. [score:1]
Figure  3a shows the proliferation curve for cells transfected with miR-CTRL, reaching a 90% proliferation rate at 120 h, while cells with miR-195 reached a 10% proliferation rate at the same time point. [score:1]
[1 to 20 of 80 sentences]
11
[+] score: 181
In silico target prediction In silico predictions of miR-195 targets were performed by screening the databases TargetScan (http://www. [score:7]
Moreover, other proteins in the supernatants, which could be miR-195 direct or indirect targets, may have a synergistic effect on angiogenesis inhibition. [score:7]
Results obtained show that miR-29b-3p, miR-29c-3p and miR-20a-5p were upregulated upon osteogenic differentiation, while miR-143-3p, miR-195-5p and miR-497-5p were downregulated (Figure 2B). [score:7]
In silico predictions of miR-195 targets were performed by screening the databases TargetScan (http://www. [score:5]
All together, these results indicate miR-195 as a potential target for enhancing regeneration of human bone defects (or bone-degenerative diseases, such as osteoporosis). [score:5]
Considering that this miRNA has multiple targets, some with potential effects on cell proliferation, it is reasonable to expect that this effect may be mediated by other miR-195 targets acting intracellularly (e. g. SMAD5 or HOXA10 related pathways). [score:5]
Among the analyzed miRNAs, miR-195-5p (and the genomic closely located miR-497-5p - Supplementary Figure 3) were selected for further analysis since 1) this is the first report showing downregulation of miR-195-5p in human primary MSCs under osteogenic differentiation conditions versus basal control, 2) the profile is consistent for all MSC donors during 28 days, and 3) other biological mechanisms for this miRNA in primary human MSC are still unexplored. [score:4]
miR-195 directly targets VEGF. [score:4]
Figure 6 A. VEGF expression levels are decreased in miR-195 -overexpressing MSC compared with scrambled when analyzed by quantitative real-time PCR (** P < 0.01, Student t test). [score:4]
Notably, downregulation of miR-195-5p was consistent and significant along all differentiation time points (Figure 2B). [score:4]
A. VEGF expression levels are decreased in miR-195 -overexpressing MSC compared with scrambled when analyzed by quantitative real-time PCR (** P < 0.01, Student t test). [score:4]
In conclusion, expression of miR-195 in MSC regulates the angiogenic activity of endothelial cells. [score:4]
On the other hand, mRNA levels of SMAD5 and HOX10A were decreased after miR-195 MSC electroporation, while increased after anti-miR-195 MSC tranfection (Figure 6F, 6G), indicating that miR-195 controls SMAD5 and HOXA10 expression but it does not directly interact with SMAD5 and HOXA10. [score:4]
In conclusion, the present study demonstrates that miR-195 (and the clustered miR-497 gene) acts as a negative regulator of osteogenesis in human primary bone marrow MSC, an inhibitor of MSC proliferative capacity and an anti-angiogenic player. [score:4]
Within the analyzed miRNAs, miR-195 was the only one consistently and significantly downregulated in human MSC under osteogenic stimuli compared with non-stimulated cells in all time points and, for this reason, was further explored. [score:3]
For miR-195 antagonist experiments, 100nM anti-miR-195 (mirVana [®] miRNA inhibitor, ThermoFisher Scientific) or SCR Negative Control (Anti-miR Negative Control #1, ThermoFisher Scientific) were used to transfect MSC using Lipofectamine 2000 reagent (Invitrogen), according to manufacturer's instructions. [score:3]
Cell viability was significantly decreased in miR-195 and miR-497 -overexpressing MSC (P < 0.001) in comparison with the SCR control (Figure 4A). [score:3]
VEGF expression levels were significantly decreased in miR-195 MSC versus SCR control (P < 0.01) (Figure 6A). [score:3]
In fact, in silico predictions using different algorithms indicate miR-195 targets VEGF 3′UTR (Supplementary Figure 8). [score:3]
miR-195 expression impairs MSC proliferation. [score:3]
miR-195 decreased VEGF expression and MSC-secreted VEGF levels. [score:3]
Angiogenesis is decreased by miR-195 and miR-497 expression in primary human MSC. [score:3]
This biological effect is crucial for bone formation and may be partially explained by the ability of miR-195 to target VEGF. [score:3]
Both genes were predicted to be targeted by miR-195 (Supplementary Figure 8). [score:3]
D. ALP expression levels 48h after MSC transfection with SCR negative control or anti-miR-195; ALP staining quantification in MSC transfected with SCR negative control or anti-miR-195 after 5 days of incubation with osteogenic supplements. [score:3]
C. ALP and RUNX2 expression levels in human MSC electroporated with either SCR, miR-195, miR-497. [score:3]
miR-195 and miR-497- overexpressing cells did not show ALP activity (negative for ALP staining) while SCR control MSC showed positive ALP staining in 9% of the well surface (Figure 3B). [score:3]
Considering the biological effect and targets of miR-195, future studies should address in vivo delivery of anti-miR-195 oligonucleotides into bone injury scenarios. [score:3]
Conditioned medium from miR-195, miR-497 or SCR expressing MSC, were placed on top of E10 growing CAM into a 3mm silicone ring under sterile conditions. [score:3]
Conversely, MSC transfected with anti-miR-195 expressed higher levels of VEGF than control (P < 0,05) (Figure 6A). [score:3]
Growth-suppressive properties of miR-195 have been mainly described for tumor cells, particularly for hepatocellular carcinoma [29, 30], esophageal squamous cell carcinoma [31], non-small cell lung cancer [32, 33, 34] and colorectal cancer [35]. [score:3]
VEGF regulation by miR-195. [score:2]
On the other hand, VEGF was found to be increased in cell culture supernatants of MSC after miR-195 knockdown (P < 0,05) (Figure 6B). [score:2]
G. Expression levels of HOXA10 were decreased 48hours after MSC miR-195-electroporation, while increased 48hours after MSC anti-miR-195-transfection compared with control. [score:2]
However, this difference was abolished when the binding site was mutated suggesting a specific VEGF::miR-195 direct interaction (Figure 6C). [score:2]
However, we cannot exclude the hypothesis of a direct SMAD5::miR-195 and HOXA10::miR-195 interaction in other mRNA sites or cells lines. [score:2]
Results showed a significant increase of 1.9-fold in ALP expression level (P < 0.05) and enhanced ALP activity in anti-miR-195-MSC when compared with control, 5 days after stimulation with osteogenic differentiation supplements (Figure 3D). [score:2]
F. Expression levels of SMAD5 were decreased 48hours after MSC miR-195-electroporation, while increased 48hours after MSC anti-miR-195-transfection compared with control. [score:2]
Thus, in general terms, the miR-195 and miR-497 regulation of osteogenic differentiation are likely conserved from mouse to human. [score:2]
Moreover, expression levels of the key osteogenic differentiation marker RUNX2 was diminished in miR-195 and miR-497-electropotared cells compared with SCR control (P < 0.05) (Figure 3C). [score:2]
VEGF expression levels are increased in anti-miR-195 MSC compared with scrambled negative control when analyzed by quantitative real-time PCR (* P < 0.05, Student t test). [score:2]
As expected, miR-195 knockdown increased MSC proliferation. [score:2]
This result is in agreement with the significant reduction in ALP mRNA expression level in miR-195 and in miR-497-electroporated cells compared with SCR control (P < 0.05) (Figure 3C). [score:2]
This result further strengthens the impact of miR-195 on osteogenic differentiation. [score:1]
Gain-of-function studies revealed miR-195 (and the clustered miR-497) decreased cell proliferation, as determined by significant decreases in the number of positive cells for the cellular proliferation marker Ki-67, which is present during all active phases of the cell cycle, and in the overall number of cells. [score:1]
To further test the specific effect of miR-195 on osteogenesis, we successfully transfected cells with anti-miR-195 (Supplementary Figure 4) and analyzed its effect on the early osteogenic marker ALP. [score:1]
Therefore, miR-195 and miR-497 impaired MSC proliferation. [score:1]
miR-195 and miR-497 decrease osteogenesis in human primary MSC. [score:1]
To test if miR-195 directly binds VEGF in bone cells luciferase assays were performed in U-2 OS cells. [score:1]
miR-195 and miR-497 affects cell proliferation of primary human MSC. [score:1]
Cells were transfected with either SCR, miR-143 (used as a positive control), miR-195 or miR-497. [score:1]
To the best of our knowledge our study is the first to describe the role of miR-195 in the proliferation of human primary non-malignant and non-transformed cells. [score:1]
We concluded that miR-195 decreased significantly the number of vessels formed in response to MSC conditioned medium. [score:1]
A. miR-195 and miR-497 levels after electroporation of human MSC with miR-195 and miR-497 were determined by quantitative real time PCR. [score:1]
Human primary MSC (Lonza) (0.5×10 [6]) were mixed with Pre-miR miRNA Precursors miR-195, Pre-miR miRNA Precursors miR-497 or Pre-miR miRNA Precursor Negative Control (Scrambled - SCR) (Life Technologies) in an electroporation cuvette and electroporated using OPTI-MEM I (Invitrogen, Life Technologies) in a Gene Pulser Xcell Electroporation Systems (Bio-Rad) with the following conditions: voltage - 250 V, capacitance - 950 μF, resistance - 200 Ω [46]. [score:1]
Concentration of secreted VEGF was significantly decreased in miR-195 electroporated MSC versus control (P < 0.05) (Figure 6B). [score:1]
A recent study by Grünhagen et al. showed that miR-195-miR-497 cluster impaired osteoblast differentiation in mouse cells [27]. [score:1]
miR-195 and miR-497 modulates osteogenic differentiation in primary human MSC and mouse MC3T3 cell line. [score:1]
To determine the effect of miRNAs on proliferation, MSC (Passage 7) electroporated with Pre-miR miRNA Precursors miR-195, Pre-miR miRNA Precursors miR-497 or Pre-miR miRNA Precursor Negative Control (Scrambled - SCR) were plated in 96-well plates in sextuplicates. [score:1]
Human primary MSCs were electroporated with either miR-195 or SCR control. [score:1]
miR-146b-5p, miR-29b-3p, miR-29c-3p, miR-20a-5p, miR-143-3p, miR-195-5p and miR-497-5p expression levels were measured by quantitative real-time PCR. [score:1]
To further confirm if cell proliferation was indeed affected by miR-195 and miR-497, staining with the proliferation marker Ki-67 was quantified. [score:1]
Figure 3 A. miR-195 and miR-497 levels after electroporation of human MSC with miR-195 and miR-497 were determined by quantitative real time PCR. [score:1]
To further elucidate the impact of miR-195 and miR-497 during osteogenic differentiation of human primary MSC, these were successfully electroporated with SCR control, miR-195 or miR-497 (P < 0.05) (Figure 3A) and allowed to differentiate with osteogenic supplements up to 7 days. [score:1]
Therefore, we concluded that miR-195 and miR-497 play an anti-osteogenic differentiation role in human primary MSC cells. [score:1]
A. Number of vessels in the CAM after 72 hours incubation with SCR-electroporated MSC condition media or miR-195-electroporated MSC condition media (mean±SD, ** P < 0.01, Student t test). [score:1]
B. ALP staining 7 days after electroporation of human MSC with scrambled negative control (SCR), miR-195 or miR-497 (5X; microscope scale: 50 μm; photography scale: 2 mm). [score:1]
miR-195 and miR-497 sequence annotations were obtained from the miRBase database (http://www. [score:1]
Interestingly, miR-195 is located within less than 10kb distance from miR-497, in chromosome 17 (sequence details are shown in Supplementary Table 2). [score:1]
In conclusion, our data shows that both miR-195 and miR-497 decrease cell proliferation in human primary MSC. [score:1]
C. Differences in the percentage of proliferative MSC (Ki-67+/DAPI+) 96h after transfection of SCR negative control or anti-miR-195 (* P < 0.05, one-way ANOVA). [score:1]
MC3T3 cells (3×10 [6]) plated in a 10-cm culture dish were transfected with 50 nM Pre-miR miRNA Precursors miR-143, Pre-miR miRNA Precursors miR-195, Pre-miR miRNA Precursors miR-497 or Pre-miR miRNA Precursor Negative Control (Scrambled - SCR) (Life Technologies) using Lipofectamine 2000 transfection reagent (Invitrogen, Life Technologies). [score:1]
To test if VEGF levels were altered by miR-195, RNA was isolated from MSC 48h after miR-195 electroporation. [score:1]
VEGF protein levels in supernatants of miR-195 or SCR electroporated MSC and of anti-miR-195 or SCR negative control transfected MSC were quantified using Raybiotech Human VEGF ELISA kit (Tebu-Bio), following the manufacturer protocol (Supplementary Methods). [score:1]
Interestingly, VEGF was able to dose -dependently revert the decrease in the number of new blood vessels caused by miR-195-MSC conditioned media. [score:1]
B. Confocal imaging of MSC cells 48 hours after electroporation of SCR, miR-195 or miR-497. [score:1]
miR-195, miR-497 or SCR-electroporated MSC, and anti-miR-195 or SCR negative control -transfected MSC, were grown on top of cover-slips. [score:1]
Figure 4 A. A representative experiment on cell viability of miR-195 and miR-497 in human MSC. [score:1]
C. Number of vessels in the CAM after 72 hours incubation with SCR-electroporated MSC conditioned media or miR-195-electroporataed MSC conditioned media with or without human recombinant VEGF supplementation (mean±SD, * P < 0.05, one way ANOVA), in a total of 34 analyzed eggs. [score:1]
A. A representative experiment on cell viability of miR-195 and miR-497 in human MSC. [score:1]
We next investigated VEGF as a potential target for miR-195. [score:1]
[1 to 20 of 81 sentences]
12
[+] score: 161
Meanwhile, upregulation of miR-195 expression has been shown to suppress cell proliferation and invasion by targeting the Raf-1 and Ccnd1 genes in both ZR-75-30 and MCF7 human breast cancer cells (10). [score:10]
In summary, overexpression of miR-195-5p inhibited the proliferation and colony formation ability, suppressed migration and caused G1 phase arrest by targeting CCNE1 in MDA-MB-231 breast cancer cells. [score:9]
Cell functional studies further showed that overexpression of miR-195-5p inhibited proliferation and colony formation ability, suppressed cell migration and caused G1 phase arrest by targeting CCNE1 in MDA-MB-231 breast cancer cells. [score:9]
To validate the possibility that miR-195-5p may target CCNE1, we initially searched for putative targets within its mRNA sequence using three bioinformatic algorithms: miRanda, TargetScan and miRBase. [score:7]
This suggests that the expression of miR-195-5p is associated with the development of breast cancer, and that it may function as a tumor suppressor. [score:6]
miR-195-5p regulates CCNE1 expression by targeting its mRNA in MDA-MB-231 cells. [score:6]
We demonstrated that overexpression of miR-195-5p significantly decreased CCNE1 expression at both the mRNA and protein levels (Fig. 7). [score:5]
Overexpression of miR-195-5p in MDA-MB-231 cells inhibits cell migratory ability. [score:5]
Additionally, we found that the mRNA and protein levels of CCNE1 were significantly reduced in miR-195-5p -overexpressing cells when compared with those transfected with either mock or NC, thus further indicating that CCNE1 is a direct target of miR-195-5p. [score:5]
All of the data suggest that miR-195-5p is a tumor suppressor that may inhibit carcinogenesis in human breast cancer. [score:5]
These results suggest that transient overexpression of miR-195-5p suppresses the proliferation and colony formation ability of MDA-MB-231 cells. [score:5]
Overexpression of miR-195-5p in MDA-MB-231 cells inhibits cell proliferation and colony formation ability. [score:5]
Therefore, our study suggests that miR-195-5p may act as a tumor suppressor, and thus may be considered a potential therapeutic and diagnostic target of breast cancer. [score:4]
A recent study showed that miR-195 is significantly downregulated in breast cancer (10). [score:4]
First, through qPCR, we found that the expression level of miR-195-5p in breast cancer specimens was significantly lower than that in adjacent normal tissues. [score:3]
Moreover, cell migration ability was also significantly reduced by overexpression of miR-195-5p in the MDA-MB-231 cells. [score:3]
Furthermore, by flow cytometry we found that overexpression of miR-195-5p prevented cells from entering the S phase and instead caused an accumulation of cells in the G1 phase. [score:3]
To test whether CCNE1 was a real target of miR-195-5p, we constructed a psiCHECK-2 plasmid containing the 3′-UTR of CCNE1 (psiCHECK-2/CCNE1 3′-UTR). [score:3]
These data further indicate that CCNE1 is a target of miR-195-5p. [score:3]
Indeed, the expression of miRNA-195, which is closely related to miRNA-195-5p, has been previously reported to be decreased in human breast cancer. [score:3]
In the present study, we initially demonstrated that the expression level of miR-195-5p in breast cancer specimens was significantly lower than that in adjacent normal tissues. [score:3]
These results indicate that the overexpression of miR-195-5p prevents cells from entering the S phase through initiation of G1 phase arrest in MDA-MB-231 cells. [score:3]
Through dual-luciferase assays, we confirmed that CCNE1 was a direct target of miR-195-5p. [score:3]
The expression level of miR-195-5p was detected by the One-Step qRT-PCR method (EzOmics SYBR qPCR kit). [score:3]
In the present study, we transfected miR-195-5p mimics into MDA-MB-231 cells to generate its overexpression. [score:3]
Overexpression of miR-195-5p initiates G1 phase arrest of MDA-MB-231 cells. [score:3]
These data suggest that the migratory ability of MDA-MB-231 cells may be inhibited by miR-195-5p (Fig. 4). [score:3]
miR-195-5p expression is decreased in breast cancer specimens. [score:3]
Therefore, miR-195-5p may be a potential diagnostic and therapeutic target for breast cancer. [score:3]
In the present study, we examined the expression of miR-195-5p in human breast cancer and its potential role in carcinogenesis. [score:3]
Finally, we performed qPCR and western blot analysis of CCNE1 expression in MDA-MB-231 cells with and without transfection of miR-195-5p mimics, or controls. [score:3]
These results suggest that miR-195-5p directly interacts with the CCNE1 3′-UTR in the psiCHECK-2 reporter plasmid and leads to the degradation of RL mRNA. [score:2]
As shown in Fig. 1, compared with the adjacent normal tissues, miR-195-5p expression was significantly decreased in the breast cancer specimens (P<0.05). [score:2]
This exogenous overexpression of miR-195-5p significantly inhibited proliferation and colony formation ability of MDA-MB-231 cells as measured by MTT and colony formation assays, respectively. [score:2]
As shown in Fig. 5, the percentage of cells remaining in the G1 phase in the miR-195-5p overexpression group (57.62±0.53%) was significantly greater than that of the mock (47.32±0.96%) and NC groups (47.33±0.17%, P<0.05); while the proportion of G2 and S phase cells decreased in the miR-195-5p group compared with those of the mock and NC groups (P<0.05). [score:2]
We measured the mRNA expression levels of miR-195-5p in breast cancer specimens and the adjacent normal tissues by real-time PCR. [score:1]
We found that the viability of both miR-195-5p mimic groups was consistently significantly lower than the mock and NC groups in a time- and dose -dependent manner (Fig. 2). [score:1]
miRNA-195 includes miRNA-195-5p and miRNA-195-3p, and together they belong to the miRNA-15 family. [score:1]
The cell cycle distribution of the MDA-MB-231 cells with and without transfection of miR-195-5p mimics was analyzed by flow cytometry. [score:1]
To ascertain why miR-195-5p exhibited these effects on the cell function, we investigated putative targets of miR-195-5p and identified CCNE1, which drives cells from the G1 to the S phase. [score:1]
When the cells reached 30–40% confluence, they were transfected with either 50 or 100 nM miR-195-5p mimics or NC mimics. [score:1]
We found two potential binding sites for miR-195-5p which were located 247–254 and 485–492 bp downstream from the 5′ end of the CCNE1 3′-UTR (Fig. 6A). [score:1]
CCNE1 3′-UTR were cloned into the psiCHECK-2 vector, and co -transfected with miR-195-5p mimics (100 nM) or NC mimics when cells reached 80–90% confluence. [score:1]
The sequence of the miR-195-5p mimic was 5′-UAGCA GCACAGAAAUAUUGGC-3′ and the sequence of the NC mimic was 5′-UCACAACCUCCUAGAAAGAGUAGA-3′. [score:1]
Three hundred cells of each group (miR-195-5p, mock and NC) were plated in a 6-well plate in complete medium. [score:1]
However, the role that miR-195-5p plays in the carcinogenesis of breast cancer is still largely unknown. [score:1]
This construct was transfected into 293T cells together with either miR-195-5p or NC mimics, and the luciferase activity was analyzed. [score:1]
Notably, the interaction between miR-195-5p and CCNE1 mRNA has not been previously reported. [score:1]
Our results showed that 20 h after transfection, the number of migrating cells in the miR-195-5p group was significantly less than that in either the mock or NC groups (P<0.05). [score:1]
Based on three databases, we found that the CCNE1 3′-UTR contains two miR-195-5p matching sites. [score:1]
miR-195-5p mimics and non-specific negative control (NC) oligos were purchased from GenePharma (Shanghai, China). [score:1]
miR-195-5p (100 nM), mock and NC cells were harvested at 48 h after transfection, centrifuged at 1,200 rpm for 10 min and washed three times with cold PBS. [score:1]
[1 to 20 of 52 sentences]
13
[+] score: 149
The level of expression of oncogenic miR-21, miR-221, miR-210 including the tumor suppressor miR Let-7a were found to be consistently up-regulated in TNBC tissues as well as in their corresponding sera and cancer cell lines, MDA-MB-231, MCF-7, whereas miR-145 and miR-195 were regularly downregulated (p<0.001) (Table 2a and 2b, Figs 1A, 2A and 2D). [score:11]
Of six miRNAs, the expression of four miRNAs, miR-21, miR-221, miR-210 and Let-7a were found to be significantly upregulated while the other two miRNAs, miR-195 and miR-145 were downregulated in both paired tumor tissue and sera of triple negative breast cancer patients. [score:9]
The expression of two miRNAs (miR-195 and miR-145) was found to be significantly downregulated and when we correlated the expression of these two miRs with the above clinicopathological and demographic variables, we also found a good negative correlation. [score:8]
A screening approach employing any of these four significantly overexpressed miRNAs individually can still reveal a good but lower diagnostic accuracy when compared to the three upregulated miRNAs (miR-21; miR-221; miR-210) and/or two downregulated miRNAs (miR-195 and miR-145) combined together (Fig 4G–4I). [score:8]
The level of miR-195 expression is inversely correlated with tumorigenesis and Raf-1 (rapidly accelerated fibrosarcoma) is a direct target of miR-195 and Raf-1 is overexpressed in many cancers including breast cancer [32]. [score:8]
In contrast, the expression of miR-195 and miR-145 in all subtypes of breast cancer showed a consistent and significant downregulated expression which changed inversely as a function of the severity of breast cancer (Table 2a). [score:8]
Out of six microRNAs screened, four of them, miR-21; miR-221; miR-210 including the tumor suppressor miR Let-7a were consistently upregulated whereas two miR-145 and miR-195 were regularly downregulated in TNBC tissue as compared to that of adjacent normal tissue (Table 2a). [score:8]
In contrast, the two downregulated miRs (miR-195 and miR-145) showed inverse correlation, (r = −0.464 and r = −0.438, p < 0.0001) for tissue and (r = −0.451 and r = −0.379, p<0.0001) for sera as their expression decreased with the severity of the disease (Fig 3E and 3F). [score:8]
We find that three oncogenic miRNAs, miR-21, miR-221 and miR-210 were consistently overexpressed while two tumor suppressor miRNAs, miR-195 and miR-145 were always downregulated in paired tumor tissue and sera as well as cell lines of TNBC compared to TPBC or other subtypes of breast cancer. [score:7]
The results showed a significant correlation of the panel of five miRNAs, three over expressed miR-21, miR-221, miR210 and two downregulated miR-195 and miR-145 in the tissues (Pearson’s r = 0.881, r = 0.858, r = 0.748, r = −0.464 and r = −0.438 respectively, p<0.0001) and in their corresponding sera (r = 0.758, r = 0.647, r = 0.767, r = −0.451 and r = −0.379 respectively, p<0.0001). [score:6]
The expression of miR-195 and miR-145 was found to be down-regulated in paired serum samples of TNBC patients and the difference was found to be statistically significant (Table 2b; Fig 2B). [score:6]
The expression of miR-195 and miR-145 also showed significant decreased expression in these two breast cancer cell lines. [score:5]
Despite being a tumor suppressor and in contrast to miR-195 and miR-145, miR Let-7a showed increased expression in TNBC tissue and sera and also showed a good correlation with tumor grades (r = 0.629 for tissue and r = 0.668 for sera, p<0.0001). [score:5]
The AUC value, sensitivity and specificity of the two downregulated microRNAs, miR-195 and miR-145 are presented in Table 4a and 4b; Fig 4D and 4E. [score:4]
We observed that while miR-21, miR-221, miR-210 and Let-7a were overexpressed as a function of severity of lesion or tumor grade and stage of tissue and paired sera, miR-145 and miR-195 showed down regulation. [score:4]
The combination of two downregulated miRNAs (miR-195 and miR-145) also revealed a good AUC of 0.899 (95% CI: 0.8082 to 0.9873) with an optimal sensitivity of 78% and specificity of 87% (Fig 4I). [score:4]
A (miR-21); B (miR-221); C (miR-210); D (miR-195); E (miR-145); F (Let-7a); (G) comparative ROC of all six miRNAs (miR-21; miR-221; miR-210; miR-195, miR-145 and Let-7a); (H) combined ROC of three miRs (miR-21; miR-221 and miR-210); (I) combined ROC of two downregulated miRNAs (miR-195 and miR-145). [score:4]
However, the downregulated miRNA showed lower AUC of 0.5078 (95% CI: 0.4201–0.5955, p < 0.0001) with a low sensitivity and specificity of 51% and 45% for tissue and for sera AUC was found to be 0.8043 (95% CI: 0.7369–0.8717, p < 0.0001) with sensitivity and specificity of 77% and 71% for miR-195 for all subtypes of breast cancer (Table 5a and 5b). [score:4]
Even scoring with the two downregulated miRNAs (miR-195 and miR-145), the accuracy was improved with an AUC of 0.899, and 78% sensitivity and 87% specificity. [score:4]
Systemic miRNA-195 differentiates breast cancer from other malignancies and is a potential biomarker for detecting noninvasive and early stage disease. [score:3]
Although several reports indicate an alteration in expression of miR-21, miR-145, miR-221, miR-195 and Let-7a in a variety of breast cancer types [16, 50– 54] but none is specific to TNBC. [score:3]
The fold change expression level of miR-195 and miR-145 is presented in Fig 1A which showed a significant decrease as a function of hormone receptor negativity/severity of TNBC (Table 2a; Fig 1B). [score:3]
0158946.g001 Fig 1 (A) The expression level of miR-21, miR-221, miR-210, miR-195, miR-145 and Let-7a in total breast tumour and adjacent normal tissues. [score:3]
Since an altered expression level of six selected microRNAs, miR-21, miR-221, miR-210, miR-145, miR-195 and Let-7a is known to be frequently involved in breast carcinogenesis, these have been examined in paired TNBC tissue and serum samples in comparison to that of adjacent normal tissue margins and normal serum. [score:3]
0158946.g002 Fig 2(A) Expression level of selected miRNAs (miR-21, miR-221, miR-210, miR-195, miR-145 and Let-7a) in total serum samples from breast cancer patients and healthy individuals. [score:3]
The expression of miR-195 and miR-145 also decreased with increasing histopathological grade and clinical stage and all other risk factor associated with TNBC (Fig 1C and S1 Table). [score:3]
We analyzed the expression pattern of a set of six selected microRNAs- miR-21, miR-221, miR-210, miR-145, miR-195 and Let-7a in four subtypes of breast cancer tissues including adjacent normal tissues. [score:3]
Reverse transcription as well as Real-Time PCR for miRNA expression analysis was carried out using primers for hsa-miR-21, hsa-miR-221, hsa-miR-210, hsa-miR-195, hsa-miR-145 and hsa-miR-Let-7a and SnRNA U6 was used as a reference control. [score:2]
9570)p = 0.0004 * miR-210 100% 100% 0.9979 (0.9911–1.000)p < 0.0001 * miR-195 78% 65% 0.6767 (0.5098–0.8437)p = 0.0400 * miR-145 78% 91% 0.8837 (0.7862–0.9812)p < 0.0001 * Let-7a 91% 86% 0.9660 (0.9237–1.008)p < 0.0001 * AUC: Area Under the Curve; CI: Confidence Interval; * Significant. [score:1]
86 up0.0001 * 27.82±4.52 up0.001 * miR-195 0.78±0.08 down0.007 * 0.41±0.07 down0.001 * 0.27±0.06 down0.001 * 0.14±0.04 down0.001 * miR-145 0.76±0.09 down0.008 * 0.52±0.15 down0.001 * 0.41±0.12 down0.001 * 0.27±0.08 down0.001 * Let-7a 0.67±0.13 down0.001 * 8. 25±1.07 up0.001 * 15.61±1.76 up0.001 * 17.90±2.93 up0.001 * (b) In breast cancer sera (n = 85) miRNA Types TPBC (n = 21) SNBC (n = 20) DNBC (n = 21) TNBC (n = 23) FC±S. [score:1]
[1 to 20 of 30 sentences]
14
[+] score: 128
372 inhibition -dependent reduction in ACC and FAS expression and impaired intracellular triglyceride contents could be largely restored by miR-195 suppression (Fig.   5c, Supplementary Fig.   6b, Supplementary Fig.   7a, b), suggesting that reduced miR-195 suppression of ACC and FAS expression plays a key role in uc. [score:11]
372 specifically suppresses miR-195/miR-4668 expression by binding to pri-miR-195/pri-miR-4668 to relieve miR-195/miR-4668 -mediated suppression of functional target genes such as ACC, FAS, SCD1, and CD36, leading to lipid accumulation in hepatocytes. [score:9]
372 drives hepatic steatosis through inhibition of miR-195/miR-4668 maturation to relieve miR-195/miR-4668 -mediated suppression of functional target gene related to lipid synthesis, including acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), stearoyl-CoA desaturase 1 (SCD1), and genes related to lipid uptake such as CD36, leading to hepatic lipid accumulation. [score:7]
372 inhibits the maturation of miR-195/miR-4668 to regulate expression of ACC, FAS, SCD1, and CD36. [score:6]
b Expression levels of ACC and FAS in the HepG2 cells transfected with miR-195 mimic and inhibitor for 24 h in the presence with Ad-uc. [score:5]
372 was overexpressed, no changes in pri-miR-195/pri-miR-4668, pre-miR-195/pre-miR-4668, and mature miR-195/miR-4668 expression were identified (Supplementary Fig.   5b). [score:5]
a Expression levels of ACC and FAS in the HepG2 cells transfected with miR-195 mimic and inhibitor at a final concentration of 20 nM for 48 h (n = 3). [score:5]
372 drives hepatic steatosis by repressing the maturation of miR-195/miR-4668, thus relieving the suppression of target genes, including ACC, FAS, SCD1, and CD36. [score:5]
Additionally, miR-195 suppresses cell proliferation, invasion, and metastasis in breast cancer cells by targeting FAS, HMGCR, ACC, and CYP27B1 [26]. [score:5]
Based on the previous studies and our observations, we consider that FAS and ACC/SCD1 and CD36 are direct targets of miR-195/miR-4668 mediated by Ago2. [score:4]
Singh R Yadav V Kumar S Saini N Microrna-195 inhibits proliferation, invasion and metastasis in breast cancer cells by targeting fasn, hmgcr, acaca and cyp27b1Sci. [score:4]
Intriguingly, we observed an increase of pri-miR-195/pri-miR-4668 and a reduction of miR-195/miR-4668 expression in the liver of NAFLD patients (Fig.   8f, g). [score:3]
372 affected lipid metabolism through miR-195/miR-4668 -mediated target genes. [score:3]
Previous studies have shown that ACC and FAS are target genes of miR-195 [26] (Supplementary Fig.   6a). [score:3]
372 inhibits the maturation of miR-195/miR-4668. [score:3]
Abnormal expression of miR-195 has been wi dely reported in diverse biological systems 51, 52. [score:3]
For instance, miR-195 can bind the 3′UTRs of cyclin D1, CDK6, and E2F3, thereby suppressing cell proliferation in human hepatocellular carcinoma cells [52]. [score:3]
372, we determined expression levels of pri-miR-195/pri-miR-4668, pre-miR-195/pre-miR-4668, and miR-195/miR-4668 upon uc. [score:3]
372i-infected and miR-195 inhibitor -transfected HepG2 cells in the presence with with 300 μM O/P mixture for 48 h (representative blots from three similar experiments) (n = 3). [score:3]
As shown by real-time PCR analysis, miR-195 markedly suppressed mRNA levels of FAS and ACC, even when uc. [score:3]
Consistently, we found that miR-195 markedly suppresses mRNA levels of FAS and ACC, even when uc. [score:3]
In the present study, the sequence alignment results in Supplementary Fig.   6a, b showed canonical complementarity between miR-195/miR-4668 and their respective targets, which is necessary for the formation of the miRNA–mRNA duplex [56]. [score:3]
372 on abnormal lipid accumulation is subjected to regulation of miR-195/ miR-4668 in the liver of NAFLD patients. [score:2]
372 was functionally involved in the abnormal hepatic lipid accumulation of NAFLD patients by regulation of pri-miR-195/pri-miR-4668 processing. [score:2]
Liu L Chen L Xu Y Li R Du X Microrna-195 promotes apoptosis and suppresses tumorigenicity of human colorectal cancer cellsBiochem. [score:2]
372 regulates pri-to-pre-miRNA cleavage of miR-195 and 4668 by binding pri-miR-195/pri-miR-4668. [score:2]
372 is subject to regulation by miR-195/miR-4668 in the steatotic liver of NAFLD patients. [score:2]
372 binds to pri-miR-195/pri-miR-4668. [score:1]
372 and the terminal loop region of pri-miR-195/pri-miR-4668. [score:1]
How miR-195/miR-4668 link to the metabolic genes such as FAS, ACC, SCD1, and CD36? [score:1]
f The levels of pri-miR-195, pre-miR-195, and mature miR-195 in the liver samples of NAFLD patients or healthy control (n = 11). [score:1]
283 + A impairs microprocessor recognition and efficient pri-miR-195 cropping [22]. [score:1]
TRIzol reagent (Invitrogen) was used to isolate the precipitated RNA and the level of pri-miR-195 or pri-miR-4668 was further analyzed using real-time PCR. [score:1]
372. e The levels of pri-miR-195/pri-miR-4668, pre-miR-195/pre-miR-4668, and mature miR-195/miR-4668 in the HepG2 cells transfected with Ad-uc. [score:1]
Subsequently, we analyzed the hepatic levels of pri-miR-195/pri-miR-4668 and mature miR-195/miR-4668 in these patients. [score:1]
372 significantly increased the level of pri-miR-195/pri-miR-4668 in the immunoprecipitated RNA with antibody against Drosha, indicating a binding between uc. [score:1]
Of note, pri-miR-195 and pri-miR-4668 displayed a complementarity with the ultraconserved region of uc. [score:1]
To further assess that pri-miR-195/pri-miR-4668 interacts with uc. [score:1]
This complementarity involved nucleotides located at the terminal loop region site within the miR-195 and miR-4668 primary transcripts (Fig.   4d). [score:1]
To explore the interaction between miR-195/miR-4668 and uc. [score:1]
372 could bind pri-miR-195/pri-miR-4668 in HepG2 cells transfected with Ad-uc. [score:1]
372 at the terminal loop region site within the miR-195 and miR-4668 primary transcript. [score:1]
Based on the reduced levels of miR-195 in HepG2 cells treated with an O/P mixture (Supplementary Fig.   6a), we investigated the effects of miR-195 on expression of ACC and FAS. [score:1]
d The stem-loop sequence of pri-miR-195 (left panel) and pri-miR-4668 (right panel), and their partial complementarity with uc. [score:1]
372 in the HepG2 increased the levels of pri-miR-195/pri-miR-4668 and repressed the maturation of miR-195/miR-4668 (Fig.   4e). [score:1]
Of note, significantly reduced pri-miR-195/pri-miR-4668 and elevated pre-miR-195/pre-miR-4668 and mature miR-195/miR-4668 were observed in the HepG2 cells transfected with Ad-372i (Supplementary Fig.   5a). [score:1]
[1 to 20 of 46 sentences]
15
[+] score: 122
Other miRNAs from this paper: hsa-mir-30c-2, hsa-mir-34a, hsa-mir-155, hsa-mir-30c-1, hsa-mir-130b
For example, miR-34a-5p regulated Cdk4, and miR-195-5p regulated CDC42; both miR-34a-5p and miR-195-5p were up-regulated by DHA and co-regulated Cdk6, VEGF, E2F3, and Cdk4; the up-regulated microRNA miR-30c-5p regulated Rac1, and co-regulated MEK1 with miR-34a-5p and E2F3 with miR-34a-5p and miR-195-5p; the up-regulated microRNA miR-130b-3p co-regulated E2F1 with miR-34a-5p; and the down-regulated microRNA miR-155-5p regulated p16. [score:20]
Here, we found that DHA treatment up-regulated miR-34a-5p, miR-195-5p, miR-130b-3p, and miR-30c-5p expression and down-regulated the expression of the target mRNAs Cdk4, Cdk6, E2F3, and E2F1, respectively; DHA treatment also decreased protein levels translated from these mRNAs. [score:15]
To analyze the mechanism by which DHA suppresses growth, inhibits angiogenesis, and promotes apoptosis in tumor tissues, expression of the microRNAs (miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p) that were up-regulated by DHA and their target mRNAs (Cdk4, Cdk6, VEGF, IKKα, MEK1, E2F3, Rac1, E2F1, and CDC42) were analyzed using qRT-PCR. [score:12]
Here, the DHA -induced increase in miR-195-5p down-regulated CDC42 expression, likely contributing to the ability of DHA to inhibit proliferation and suppress metastasis. [score:10]
Here, we found that DHA treatment down-regulated VEGF mRNA expression and protein levels by up -regulating the expression of miR-34a-5p and miR-195-5p. [score:9]
miR-34a-5p, miR-195-5p, miR-30c-5p, miR-130b-3p, mir-34a-5p specific inhibitor (miR-34a-5p antisense oligodeoxyribonucleotide, AMO-34a-5p), mir-195-5p specific inhibitor (miR-195-5p antisense oligodeoxyribonucleotide, AMO-195-5p), mir-30c-5p specific inhibitor (miR-30c-5p antisense oligodeoxyribonucleotide, AMO-30c-5p), mir-130b-3p specific inhibitor (miR-130b-3p antisense oligodeoxyribonucleotide, AMO-130b-3p), and negative control miRNA (NC) were obtained from RiboBio (Guangzhou, China). [score:9]
Surprisingly, in the present study, DHA treatment up-regulated miR-195-5p, which down-regulated IKKα mRNA expression. [score:9]
To confirm the results of microarray experiments and mRNA data obtained from the experimentally validated databases, all of the microRNAs (miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p) that were up-regulated by DHA, suppressed growth and angiogenesis, and promoted apoptosis in pancreatic cancer cells, and their target mRNAs (Cdk4, Cdk6, VEGF, IKKα, MEK1, E2F3, Rac1, E2F1, and CDC42), were analyzed with qRT-PCR. [score:8]
To assess the regulatory relationships between the microRNAs and target mRNAs identified via microarray and systematic analysis, we next transfected PANC-1 and BxPC-3 cells with miR-34a-5p, miR-195-5p, miR-30c-5p, or miR-130b-3p or their inhibitors and examined the protein levels of their target mRNAs, including Cdk4, Cdk6, VEGF, IKKα, MEK1, E2F3, Rac1, E2F1, and CDC42 in western blots. [score:8]
Our results provide mechanistic evidence that the anti-proliferative, pro-apoptotic, and anti-angiogenesis effects of DHA were associated with the up-regulation of miR-34a-5p, miR-195-5p, miR-30c-5, and miR-130b-3p. [score:4]
Surprisingly, we found that four crucial microRNAs (miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p) regulated the expression of many mRNAs (Cdk4, Cdk6, VEGF, IKKα, MEK1, E2F3, Rac1, E2F1, ERK1, and CDC42) and their proteins, and thus were crucial to the anti-pancreatic cancer effects of DHA. [score:4]
Similarly, miR-195-5p overexpression reduced, and inhibition of endogenous miR-195-5p increased, IKKα, CDC42, VEGF, Cdk4, Cdk6, and E2F3 levels in both PANC-1 and BxPC-3 cells compared to the control group. [score:4]
As shown in Figure 8A, miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p were up-regulated in the DHA -treated group compared to the vehicle -treated group, confirming the microarray results in vivo. [score:3]
As shown in Figure 5, miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p were up-regulated in DHA -treated PANC-1 and BxPC-3 cells compared to vehicle -treated controls, confirming the microarray results. [score:3]
A. PANC-1 and BxPC-3 cells were transfected with miR-34a-5p, miR-195-5p, miR-30c-5p, miR-130b-3p, AMO-34a-5p, AMO-195-5p, AMO-30c-5p, AMO-130b-3p, or negative control miRNA. [score:1]
These results indicate that the anti-pancreatic cancer effects of DHA were mediated at least partly by miR-195-5p, mir-34a-5p, and mir-30c-5p. [score:1]
Figure 4 A. PANC-1 and BxPC-3 cells were transfected with miR-34a-5p, miR-195-5p, miR-30c-5p, miR-130b-3p, AMO-34a-5p, AMO-195-5p, AMO-30c-5p, AMO-130b-3p, or negative control miRNA. [score:1]
All of the microRNAs (miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p) were also analyzed with qRT-PCR in HPDE6-C7 cell line (Supplementary Figure S2). [score:1]
[1 to 20 of 18 sentences]
16
[+] score: 104
Other miRNAs from this paper: hsa-mir-15a, hsa-mir-15b
Overexpression of miR-195 increased PCSK9 expression and decreased LDLR, HMGCR, and SREBF2 expression, while knockdown of miR-195 decreased PCSK9 expression and increased LDLR, HMGCR, and SREBF2 expression (Figs.   5b–d). [score:12]
We observed that overexpression of miR-195 significantly inhibited the phosphorylation status of p65 and the expression levels of TAB3 and IKKα, while knockdown of miR-195 increased the phosphorylation status of p65 and the expression levels of TAB3 and IKKα (Fig.   7), supporting our findings that NF-κB pathway played an important role in HCC intracellular cholesterol accumulation. [score:10]
a validation of miR-195 mimic and inhibitor by qRT-PCR at 24 h after transfection (b- d) After transfection with miR-195 mimic or inhibitor for 24 h, cells were exposed to LPS (1000 ng/mL) for 24 h. The expression levels of PCSK9, LDLR, HMGCR and SREBF2 in HCC cells were detected by qRT-PCR (b, c) and western blot (d). [score:7]
It has been reported that miR-195 suppresses cancer development and is downregulated in multiple types of cancer, such as prostate [25, 26], lung [27], osteosarcoma [28], HCCs [29], and so forth. [score:7]
Genome-wide screening suggests that miR-195 mediates NF-κB activity by directly targeting the expression of IKKα TAB3 in HCCs [19]. [score:6]
Additionally, miR-195, a regulator directly targeting IKKα and TAB3, blocked the effects of cholesterol accumulation, further supporting the critical role of pro-inflammation NF-κB signaling in regulating cholesterol accumulation. [score:6]
Data represent the mean ± SD of triplicate samples; ** P < 0.01 Previous findings have shown that miR-195 decreases the activity of NF-κB signaling and the expression of NF-κB downstream effectors by directly targeting TAB3 and IKKα [19]. [score:6]
Here, we demonstrated that not only miR-195 but also its targeted genes TAB3 and IKKα mediate LPS/NF-κB -induced cholesterol accumulation and cholesterol-related gene expression, providing further evidence that NF-κB pathway play an important role in HCC intracellular cholesterol accumulation. [score:5]
In addition, overexpression of miR-195 inhibited the total intracellular cholesterol level (Fig.   6a and b) and (Fig.   6c). [score:5]
Twenty-four hours after transfection with miR-195 mimic, miR-195 inhibitor, or negative control, HCC cells were treated with 1000 ng/mL LPS for another 24 h and then analyzed for intracellular cholesterol levels and related gene expression. [score:5]
MiR-195, as a regulator of NF-κB pathway, inhibited cholesterol accumulation by decreasing the expression of TAB3 and IKKα. [score:5]
To further investigate the involvement of NF-κB signaling in cholesterol metabolism, the cells overexpressing or knocking down miR-195 were established by transfecting with miR-195 mimic, mir-195 inhibitor. [score:4]
Data represent the mean ± SD of triplicate samples; ** P < 0.01 Next, we investigated the phosphorylation status of p65 and the expression levels of TAB3 and IKKα, which were the direct gene targets of miR-195. [score:4]
Data represent the mean ± SD of triplicate samples; ** P < 0.01 Next, we investigated the phosphorylation status of p65 and the expression levels of TAB3 and IKKα, which were the direct gene targets of miR-195. [score:4]
These data indicate that miR-195 negatively regulates LPS -induced cholesterol accumulation and expression of cholesterol-related genes. [score:4]
For transfections in 12-well plates, the HCC cells were seeded at a density of 1 × 10 [5] cells/well and incubated overnight and then transfected with 50 nM miR-195 mimic or 100 nM miR-195 inhibitor (GenePharma, Shanghai, China) using lipo2000 Transfection Agent (Invitrogen, USA) according to the manufacturer’s instructions. [score:3]
a, b, c After transfection with miR-195 mimic for 24 h, cells treated with 1000 ng/ml LPS for 24 h, then the phosphorylation status of P65 and the expression levels of TAB3 and IKKα were detected by western blot. [score:3]
MiR-195 regulates cholesterol accumulation and cholesterol-related gene expression induced by LPS. [score:3]
DIL-LDL Low density lipoprotein labeled with 1,1′-Dioctadecyl-3,3,3′,3′-tetramethyl-indocarbocyanideperchlorate HCC Hepatocellular carcinoma HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase IKKα Nuclear factor kappa-B kinase subunit alpha LDLR LDL receptor LPS Lipopolysaccharide miR-195 microRNA-195 NF-κB Nuclear factor-kappa B PCSK9 Proprotein convertase subtilisin/kexin 9 SREBF2 Sterol regulatory element -binding transcription factor 2 TAB3 TGF-beta-activated kinase 1 and MAP3K7 -binding protein 3 Not applicable. [score:2]
MiR-195 is a member of the miR-15/16/195/424/497 family [24]. [score:1]
Lipopolysaccharide Nuclear factor-kappa B Cholesterol accumulation microRNA-195 Hepatocellular carcinoma Metabolic reprogramming in the uncontrolled proliferation of cancer cells has been thought to play important roles in cancer biology [1]. [score:1]
c, d After transfection with miR-195 mimic for 24 h, cells were exposed to LPS (1000 ng/mL) for 24 h. was detected. [score:1]
[1 to 20 of 22 sentences]
17
[+] score: 93
Other miRNAs from this paper: hsa-mir-107, hsa-mir-196b
d Western-blot analysis of cyclin A, cyclin E and p21 protein expression levels in U87MG cells upon miR-195-5p over -expression. [score:5]
f Western-blot analysis of cyclin A, cyclin E and p21 protein expression levels in U87MG cells upon miR-195-5p depletion with miR-195-5p inhibitor (inh miR-195-5p). [score:5]
h Western-blot analysis of cyclin A, cyclin E and p21 protein expression levels in U87MG cells upon miR-195-5p depletion with miR-195-5p inhibitor (inh miR-195-5p) and treatments wit BRV or LCM at IC20. [score:5]
Although we could not completely clarify the mechanism of action, our data suggest that, even at low doses (IC20), the two drugs exert a role in blocking cell cycle progression of glioma cells possibly trough up-regulation of miR-195-5p. [score:4]
Brivaracetam and lacosamide treatments induce miR-107 and miR-195-5p expression in glioma cells by determining epigenetic modification on their regulatory regions. [score:4]
These results are in line with the observed increase in p21 and cyclin E protein levels and decrease in cyclin A levels upon miR-195-5p over -expression or upon treatment with BRV or LCM (Figs.   5d and 2b-d). [score:3]
d- e- f qRT-PCR validation of miR-107 and miR-195-5p in U87MG, SW1783 and T98G upon IC20 LCM or BRV treatments at the indicated time points By performing pathway analysis of the putative target of both miRNAs signatures, we observed an almost complete overlapping between BRV and LCM treatments, possibly indicating a similar mechanism of action of the two AEDs (Table  1). [score:3]
In agreement with these data, our results confirm the role of miR-195-5p in the suppression of cell proliferation in human glioma cells. [score:3]
To confirm these results, we analysed the expression levels of miR-107 and miR-195-5p by qRT-PCR (Fig.   3d). [score:3]
Zhang et al. reported that overexpression of miR-195-5p was able to induce the arrest of cell cycle progression in G1/S transition in U87 [31] and similar results have been described by Hui et al. in other cellular mo dels of human glioma [29]. [score:3]
The exposure of glioma cells to brivaracetam and lacosamide resulted in the modulation of several microRNAs; particularly, the effect of miR-195-5p modulation seemed to affect cell cycle, while miR-107 seemed to be implicated in the inhibition of cells migration. [score:3]
For mature miR-195-5p or miR-107 expression, we used Pre-miRNA Precursor-Negative Control (Ambion) and Pre-miRNA195-5p (Ambion) or Pre-miRNA107 at final concentration of 5nM. [score:3]
Altogether these findings indicated a BRV- and LCM -mediated chromatin remo deling effect on miR-107 and miR-195 genes, in particular a reduction in the methylation status, determining miRNAs expression. [score:3]
For miR-195-5p and miR-107 depletion we used miRCURY LNA microRNA inhibitor control (Exiqon) and hsa-miR-195-5p miRCURY LNA (Exiqon) or hsa-miR-107 miRCURY LNA (Exiqon) at final concentration of 10nM. [score:3]
d) U87MG cells morphology upon miR-195-5p exogenous expression. [score:3]
Ectopic expression of miR-195-5p induces accumulation of cells in G0/G1. [score:3]
d- e- f qRT-PCR validation of miR-107 and miR-195-5p in U87MG, SW1783 and T98G upon IC20 LCM or BRV treatments at the indicated time points By performing pathway analysis of the putative target of both miRNAs signatures, we observed an almost complete overlapping between BRV and LCM treatments, possibly indicating a similar mechanism of action of the two AEDs (Table  1). [score:3]
Overexpression of miR-195-5p induced a significant increase in the percentage of cells in G0/G1 phase of the cell cycle after 48 h from transfection and a concomitant decrease in G2/M (Fig.   5c and Additional file 7: Figure S7c). [score:3]
Although at a minor extent, the increase in miR-195-5p expression was detected also in SW1783 and in T98G cell line upon treatments with both drugs, while in the latter cell line miR-107 was not inducible by LCM (Fig.   3e-f). [score:3]
MiR-195-5p expression determined a significant reduction in U87MG growth and viability (Fig.   5a-b). [score:2]
As shown in Fig.   4a-b, both two AEDs increase pre-miRNAs levels, suggesting a transcriptional regulation of miR-107 and miR-195-5p. [score:2]
MiR-195-5p inhibits U87MG cells proliferation. [score:2]
a) Transwell migration assay in U87MG cells upon miR-195-5p exogenous expression. [score:2]
e Viability assay in U87MG cells transfected with miR-195-5p inhibitor or control and treated with BRV or LCM at IC20. [score:2]
Fig. 4 Brivaracetam and lacosamide treatments induce epigenetic modification on miR-107 and miR-195 regulatory regions. [score:2]
On the contrary, mir-195-5p depletion had no effect on U87MG cells viability and did not determine any change in cyclin A, cyclin E and p21 protein levels (Fig.   5e-f Additional file 7: Figure S7e). [score:1]
Moreover, as shown in Fig.   5g-h, mir-195-5p silencing in U87MG cells abolished the anti-proliferative effects of BRV or LCM treatments. [score:1]
The tumor-suppressor activity of miR-195-5p in glioma cells and other tumor mo dels has been previously characterized [29– 31]. [score:1]
Cells were transfected with Pre-miRNA Precursor-Negative Control or the Pre-miRNA107, or the Pre-miRNA195-5p (Ambion), or treated with BRV or LCM at IC20. [score:1]
Fig. 5 Brivaracetam and lacosamide treatments exert their anti-proliferative effect in part trough miR-195-5p. [score:1]
Similar results were obtained for miR-195-5p, localized in the first intron of MIR495HG gene, by analysing two regions of MIR495HG promoter (Fig.   4f-h). [score:1]
U87MG were transfected with control (left) or with mimic miR-195-5p mimic (right) and cultured for the following 48 h. Cell were then harvested, fixed in 80% ethanol, stained with PI and analysed by flow cytometry for DNA content (see methods). [score:1]
MiR-107 significantly impinged on cell migration, while miR-195-5p had no effect (Fig.   6a and Additional file 8: Figure S8a). [score:1]
In particular miR-195-5p depletion blocked the BRV- or LCM- induced arrest in G1 phase of cell cycle and prevented cyclin A protein reduction and accumulation of cyclin E and p21 proteins (Fig.   5g-h). [score:1]
c Supervised statistical test of the significance level of the difference between signal distributions of miR-107 and miR-195-5p in U87MG cells treated with LCM or BRV versus the control (untreated cells). [score:1]
a- b qRT-PCR of miR-107 a and miR-195-5p b precursors (pre-miRNAs) in U87MG cells upon IC20 LCM or BRV treatments. [score:1]
To evaluate if BRV- and LCM -mediated modulation of miR-107 and miR-195-5p expression occurred at the transcriptional level, we analysed the levels of their precursors (pre-miRNAs) upon BRV and LCM treatments in U87MG cells. [score:1]
e) qRT-PCR of miR-195-5p in U87MG cells depleted for miR-195-5p (inh miR-195-5p) and treated with BRV or LCM (IC20). [score:1]
To test if the cytotoxic effect of BRV and LCM was in part mediated by the induction of miR-195-5p or miR-107, we ectopically expressed miR-195-5p or miR-107 in U87MG and we evaluated cell proliferation rate. [score:1]
The anti-proliferative effect exerted by miR-195-5p was confirmed by cell morphology which presented the typical features of growth-arrested cells (Additional file 7: Figure S7d). [score:1]
g Distribution of U87MG cells in the different phases of the cell cycle upon miR-195 depletion and treatments wit BRV or LCM at IC20. [score:1]
[1 to 20 of 41 sentences]
18
[+] score: 68
Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a -targeted mRNAs and two miR-195 -targeted mRNAs were downregulated while one miR-195 -targeted mRNA was upregulated. [score:14]
MiR-195 was shown to play a fundamental role in cell cycle regulation and tumorigenesis where overexpression repressed phosphorylation of rentioblastoma (Rb)-E2F signalling downregulated mRNA targets such as cyclin D1, CDK6 and E2F3, thus suggesting miR-195 as a potential target for cancer therapy [57]. [score:11]
Increased miR-195 expression in U-87 astrocytoma RISC correlated with the significantly (p<0.01) decreased levels of miR-195 predicted targets: Fraser syndrome 1 (FRAS1*, −2.270) and thyrotropin-releasing hormone degrading enzyme (TRHDE, −2.170), which are involved in in cell communication and signalling (Figure 10, Table 6). [score:5]
Perhaps as in other cells, miR-195 function may have switched from repression to activation of target translation depending on the cell cycle status of astrocytoma cells [31], [80], [81]. [score:5]
Beyond the 6 mRNAs targeted by miR-34a and miR-195, there were many mRNAs that were increased and decreased in U-87 astrocytoma RISC that were directly (solid black arrows) or indirectly (dashed black arrows) connected through another molecule within the same pathway (Figure 10). [score:5]
MiR-195 is also predicted to silence reticulon 1 (RTN1*) which has a role in apoptosis, however the mRNA microarray results of our study show that RTN1* levels were increased by a log2 fold change of 2.470 in U-87 astrocytoma RISC, suggesting that miR-195 upregulation may have activated RTN1* (Figure 10, Table 6). [score:4]
In contrast to our observation of miR-195 levels being increased in U-87 astrocytoma RISC, miR-195 has been shown to be downregulated in various cancer cells including hepatocellular carcinoma [36], [37], [56]. [score:4]
Our results show miR-195 is in U-87 astrocytoma cell RISC as contrasted to primary astrocyte RISC, suggesting that U-87 astrocytoma RISC may be enriched in tumor suppressive miR-195 in an attempt to regulate the cell cycle and cell proliferation. [score:4]
Thus, it is possible that miR-195 may have a dual function depending on the status of the mRNA target or where the mRNA is localized within the cell. [score:3]
Global miR-195 was increased with a log2 fold of 4.491, a difference of −0.977 from RISC expression. [score:3]
Alternatively, RTN1* may not be a bona fide target of miR-195. [score:3]
MiR-195 expression has not been specifically reported in brain cancers to date. [score:2]
Since U-87 astrocytoma cells rapidly proliferate in culture, it is unlikely that these cells had arrested and moved into quiescence (G [o]) thereby questioning the potential activation role of miR-195. [score:1]
Indeed, rather than being activated, RTN1* may be stabilized by another binding protein that would prevent miR-195 from binding to RTN1* to exert a repressive effect. [score:1]
Specific messenger RNA fold change linked to increased levels of miR-195 in U-87 astrocytoma RISC. [score:1]
MiR-195 expression was also increased in U-87 astrocytoma GW/P bodies compared to primary astrocyte GW/P bodies with a log2 fold change of 5.468 (Figure 3D, Table 1, p-value 7.00×10 [−7]). [score:1]
The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. [score:1]
[1 to 20 of 17 sentences]
19
[+] score: 64
miR-195 and miR-497 regulate TARBP2 and DICER expression in adrenocortical tumorsTo explore a possible involvement of miRNAs in TARBP2 regulation, we first searched for the published under-expressed miRNAs in ACCs, thus showing an inverse expression pattern compared with TARBP2. [score:8]
In line with the expression pattern, we previously showed that over -expression of miR-195 and miR-497 can inhibit cell growth with concomitant increase of apoptosis in NCI-H295R ACC cells (Özata et al. 2011). [score:7]
Together, it is intriguing to speculate that the phenotypic effect observed in ACC cell line upon alteration of miR-195 and miR-497 expression may be mediated through TARBP2 and DICER downregulation. [score:6]
Here, we demonstrate that mature miR-195 and miR-497 can directly regulate TARBP2 and DICER expression in ACC. [score:5]
Noteworthy, the four carcinomas with TARBP2 copy number gain and low TARBP2 expression exhibited high expression of miR-195 and miR-497. [score:5]
Next, we adopted the Ago2-immunoprecipitation approach to determine whether TARBP2 and DICER are direct targets of miR-195 and/or miR-497. [score:4]
Downregulation of miR-195 and/or miR-497 has been observed in several tumor types, including ACC (Soon et al. 2009, Özata et al. 2011, Patterson et al. 2011, Schmitz et al. 2011), liver (Xu et al. 2009), bladder (Han et al. 2011), breast (Li et al. 2011), and peritoneal carcinoma (Flavin et al. 2009). [score:4]
miR-195 and miR-497 regulate TARBP2 and DICER expression in adrenocortical tumors. [score:4]
We observed a significant reduction of TARBP2 and DICER mRNA and protein expression levels in the cells over -expressing miR-195 or miR-497 compared with the cells transfected with pre-miR -negative control. [score:4]
To confirm whether TARBP2 and DICER were biological targets of miR-195 and miR-497 in adrenocortical tumors, we transfected NCI-H295R cells with miRNA mimics (pre-miR-195 and/or pre-miR-497). [score:3]
TARBP2 mRNA was also strongly enriched in the immunoprecipitates of miR-195 over -expressing cells (P<0.05) while for DICER mRNA the enrichment did not show any statistical significance (Fig. 5E). [score:3]
Reduced expression of miR-195 is also correlated with lymph node metastasis and poor prognosis in colorectal cancer (Wang et al. 2011). [score:3]
The analysis identified let-7 family members, miR-195 and miR-497, as possible regulators of TARBP2. [score:2]
Thus, we immunoprecipitated Ago2 complexes in NCI-H295R cells after induced over -expression of miR-195 or miR-497 and measured the abundance of the co-immunoprecipitated TARBP2 and DICER mRNAs by RT-qPCR. [score:1]
Here, we analyzed the levels of miR-195 and miR-497 in additional five ACC cases included in this study. [score:1]
NCI-H295R cells were transfected using Amaxa Nucleofector technology (Lonza, Basel, Switzerland) with pre-miR-195, pre-miR-497 (PM10827 and PM10490 respectively; Applied Biosystems/Ambion), or siTARBP2 (sc-106846; Santa Cruz Biotechnology, Inc. [score:1]
Expression levels of miR-497 (ID_001043) and miR-195 (ID_000494) were quantified in the NCI-H295R cells after transfection experiments to evaluate transfection efficiency. [score:1]
Cells (2×10 [6] cells/dish) were transfected with pre-miR Negative control#1, pre-miR-195 or pre-miR-497, and seeded in six tissue culture plates (10 cm). [score:1]
As let-7 family members were not significantly deregulated in ACCs compared with adenomas in our cohort (Özata et al. 2011), we focused on miR-195 and miR-497. [score:1]
[1 to 20 of 19 sentences]
20
[+] score: 49
MicroRNA-195 suppresses angiogenesis and metastasis of hepatocellular carcinoma by inhibiting the expression of VEGF, VAV2, and CDC42. [score:6]
MicroRNA-195-5p suppresses glucose uptake and proliferation of human bladder cancer T24 cells by regulating GLUT3 expression. [score:5]
MicroRNA-195 inhibits the proliferation of human glioma cells by directly targeting cyclin D1 and cyclin E1. [score:5]
MicroRNA-195 and microRNA-378 mediate tumor growth suppression by epigenetical regulation in gastric cancer. [score:4]
MicroRNA-195 inhibits non-small cell lung cancer cell proliferation, migration and invasion by targeting MYB. [score:4]
Involvement of miR-195 in cardiovascular diseases. [score:3]
miRNA-195 sensitizes human hepatocellular carcinoma cells to 5-FU by targeting BCL-w. Oncol. [score:3]
Targets of miR-195. [score:3]
microRNA-195 promotes apoptosis and suppresses tumorigenicity of human colorectal cancer cells. [score:3]
MicroRNA-195 suppresses tumorigenicity and regulates G1/S transition of human hepatocellular carcinoma cells. [score:3]
MicroRNA-195 targets ADP-ribosylation factor-like protein 2 to induce apoptosis in human embryonic stem cell-derived neural progenitor cells. [score:2]
miR-195. [score:1]
is repressed in breast cancer (Li et al., 2011) and gastric cancer (Deng et al., 2013) owing to hypermethylation of CpG islands upstream of the miR-497/miR-195 locus. [score:1]
Human chromosomal locus of miR-195 gene. [score:1]
is repressed in colorectal cancer owing to deletion of the miR-497/miR-195 locus (Guo et al., 2013), while is repressed in colorectal adenoma mainly owing to epigenetic silencing and in part owing to deletion (Menigatti et al., 2013). [score:1]
Circulating miR-24, miR-125b, miR-195, and miR-214. [score:1]
Human chromosomal locus of gene is derived from the miR-497/miR-195 locus at human chromosome 17p13.1 (Figure 2). [score:1]
is derived from the miR-497/miR-195 locus at human chromosome 17p13.1 (Figure 2). [score:1]
Involvement of miR-195 in cancers. [score:1]
[1 to 20 of 19 sentences]
21
[+] score: 46
In particular, previous studies showed that miR-26a sensitized gastric cancer to cisplatin targeting NRAS and E [2]F [2] [22], miR-149 increased chemosensitivity of glioblastoma to Temozolomide treatment through a RAP1B -mediated remo deling of cellular cytoskeleton [23], miR-181a enhanced Adryamicin -induced apoptosis targeting Bcl-2 [24], miR-193b sensitized cancer cells to Doxorubicin targeting myeloid cell leukemia-1 (MCL-1) [25], miR-195 increased Adriamycin sensibility by downregulating RAF [26], and, finally, miR-324-3p induced drug sensitivity reducing its SMAD7 target mRNA that is associated with lung, pancreas and skin cancer [27]. [score:12]
Since miR-26a, miR-149, miR-181a, miR-193b, miR-195 and miR-324-3p are resulted to be upregulated (Figure 5) and data in literature showed their involvement in increasing drug sensitivity, we assessed also the expression levels of miR-26a and its potential target E2F2 (Hs00918090_m1) (Supplementary Figure 5). [score:8]
Conversely, miR-23a, miR-149, miR-193b, and miR-324-3p were upregulated, whereas miR-15b, miR-29a, miR-181a, miR-195, and miR-494 were downregulated (Figure 6). [score:7]
Figure 6 MiRNAs deregulation was confirmed by TaqMan miRNA expression assays that specifically allowed to detect the expression levels of following miRNAs: miR-23a (Hs03659093_s1), miR-149 (Hs04231523_s1), miR-193b (Hs04231607_s1), miR-324-3p (Hs04273262_s1), miR-15b (Hs04231486_s1), miR-29a (Hs03849009_s1), miR-181a (Hs04231460_s1), and miR-195 (Hs03656088_s1) (Supplementary Figure 6). [score:5]
Figure 6MiRNAs deregulation was confirmed by TaqMan miRNA expression assays that specifically allowed to detect the expression levels of following miRNAs: miR-23a (Hs03659093_s1), miR-149 (Hs04231523_s1), miR-193b (Hs04231607_s1), miR-324-3p (Hs04273262_s1), miR-15b (Hs04231486_s1), miR-29a (Hs03849009_s1), miR-181a (Hs04231460_s1), and miR-195 (Hs03656088_s1) (Supplementary Figure 6). [score:5]
The upregulation of other miRNAs, such as miR-149 (Hs04231523_s1), miR-181a (Hs04231460_s1), miR-193b (Hs04231607_s1), miR-195 (Hs03656088_s1) and miR-324-3p (Hs04273262_s1), was confirmed by TaqMan microRNA expression assays (Supplementary Figure 4). [score:5]
In MDA-MB-231 cells, among upregulated miRNAs there are miR-26a, miR-149, miR-181a, miR-193b, miR-195 and miR-324-3p that increase drug responsiveness. [score:4]
[1 to 20 of 7 sentences]
22
[+] score: 45
Bioinformatics analyses indicated that the 3′ untranslated region of MACF1 has a sequence (5′ GGACAAUAGCUGCUA 3′) which is complementary to the seed sequence for the mature hsa-miR-195 (5′ UAGCAGCACAGAAAU 3′), indicating a strong binding affinity to this protein. [score:3]
It has also been predicted computationally that the cellular hsa-miR-195 may interact with the HIV-1 Nef in the3’ LTR region based on a perfect complementarity of a 7 nucleotide seed sequence with its viral target [31]. [score:3]
Further, it appears unlikely that the newly discovered miR-195-like sequence in the HIV genomes could be incorporated into RISC complexes that guide the miRNA to the mRNA target site. [score:3]
While this region corresponds to the published location of the 21 nt hsa-miR-195 sequence [30], our HIV-env -associated miR-195-like sequence is not that of a typical miRNA because: 1) this sequence encodes a functional protein; 2) it is not a part of a stem-loop structure necessary for the processing of miRNAs; 3) there is no evidence that the miR-195-like sequence is processed from a long precursor transcript (pre-miRNA) by Drosha; and 4) there is no evidence that this sequence is cleaved into mature miRNA by Dicer enzyme. [score:1]
The finding of several viral sequences homologous to cellular miR-30d, miR-30e, miR-374a, miR-424 and miRNA-195 in different regions of the HIV-1 genome but primarily in the envelope regions of several HIV-1 strains indicate that the phenomenon of cellular miRNA-like sequences in the HIV-1 genome may be widespread. [score:1]
These sequences were distinct from those aligned with miR-195 and were located in different regions of the HIV-1 envelope than hsa-miR-195. [score:1]
The miR-195-like sequence we have identified in #GU216763 contains both the seed region and positions 13–16 of hsa-miR-195 and is 100% conserved in these regions. [score:1]
However, while miR-195-like sequences were shared by all representative strains among the 6 clades that we examined, these sequences were highly divergent among the different clades (Table 5). [score:1]
These analyses resulted in the discovery of a perfect match (100%) from nucleotide positions 1 through 18 of the mature hsa-miR-195 sequence, including the seed region at nucleotide positions 2–7, within the envelope (env) protein-coding sequences of an HIV-1 isolate from South Africa (accession #GU216763) (Table 2). [score:1]
Herein, we report the discovery of a sequence homologue of hsa-miR-195 within the HIV-1 protein-coding regions of several HIV-1 strains from Africa (Table 2). [score:1]
Phylogenetic Tree of miR-195-like sequences in different HIV clades. [score:1]
The hsa-miR-195-like region is shown in blue. [score:1]
The miR-424-like, miR-374a-like, miR-30d-like, and miR-195-like sequences are embedded in the hypervariable regions corresponding to V1, V2, V4 and V5 respectively and are depicted in blue. [score:1]
These 8 miRNA sequences are listed in Table 1. These analyses also revealed that hsa-miR-195 was one of the most frequently detected cellular miRNAs among the 8 miRNAs identified to be associated with mRNAs of the proteins modulated in our experimentally HIV-1 infected T-cells. [score:1]
The alignment given in Table 5 can be cross-referenced with the nucleotide-specific map of the HXB2 strain and indicates that the ‘hsa-miRNA-195-like’ sequence maps to the segment from position 7611 through 7628 within the env gene of the HXB2 genome (Figure 2). [score:1]
As can be seen in Figure 1, all viral genomes that shared miR-195-like sequences are clustered together in Clade C. 10.1371/journal. [score:1]
Any functional similarity of this sequence to the cellular hsa-miR-195 may be speculative. [score:1]
This figure shows the envelope region of the HIV HXB2 genome to which the hsa-miR-195-like seqeunce maps. [score:1]
Discovery of miRNA-195 Homologues in the HIV-ENV Gene. [score:1]
We used the five most homologous HIV-1 sequences to hsa-miR-195 as identified by our BLAST searches and shown in Table 2, as well as the sequences of 17 other representative HIV-1 strains from 6 clades to generate alignments using the Clustal algorithm. [score:1]
Thus, out of the 8 miRNAs that we identified for further analysis, 5 (hsa-miR-195, hsa-miR-424, hsa-miR-30d, hsa-miR-30e and hsa-miR-374a) showed homology domains in the HIV-1 genomes of several strains, and 3 (hsa-mir-15b, hsa-miR-16-1 and hsa-miR-16-2) did not. [score:1]
Phylogenetic tree was constructed using the hsa-miR-195 sequence TAGCAGCACAGAAATATT for alignment similar to that used in Table 5. This tree was constructed using the treedyn program. [score:1]
Using the ClustalW2 algorithm, as well as the Los Alamos compendium of all HIV-1 alignments, we were able to show the exact regions of these sequences in each of the 6 clades that corresponded to the position of the hsa-miR-195-like sequence we have identified from the African HIV-1 strains (Table 5). [score:1]
Two other isolates, #GU216768 and #GU216773, from the same individual also showed homology with hsa-miRNA-195 in the same region of the Env gene and again matched miR-195 at positions 1–18, with 17 of 18 (94%) nucleotides matching perfectly (Table 2). [score:1]
The hsa-miR-195 sequence. [score:1]
We have conducted a thorough literature search for the possible biological functions of cellular hsa-miR-195, miR-30d, miR-424 and miR-374a as it relates to HIV infection. [score:1]
As can be seen from Figure 2, the miRNA-195-like sequence is embedded entirely within the V5 region of the HIV-1 genome. [score:1]
A total of 17 papers were found to report on a wide range of functionalities of miR-195, 6 citations were associated with miR-30d function, 8 papers discussed miR-424 gene function and only 1 citation described miR-374a function. [score:1]
The hsa-miR-195-like sequence corresponds to the first 18 nucleotides of the mature hsa-miR-195, which has a length of 21 nucleotides. [score:1]
0058586.g001 Figure 1 This figure shows the envelope region of the HIV HXB2 genome to which the hsa-miR-195-like seqeunce maps. [score:1]
HIV-1 strains containing the hsa-miR-195-like sequence. [score:1]
In addition to the sequence homology in the South African HIV-1 isolates (#GU216763), we have identified two other strains from Tanzania, #HM215313 and #DQ199139, whose Env gene sequences also matched with the same region of hsa-miR-195 at 17 of 18 nucleotide positions, as in the GU216763 isolate (Table 2). [score:1]
In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence), matched perfectly (100%), or with one nucleotide mismatch, within the envelope (env) genes of five HIV-1 genomes from Africa. [score:1]
As can be seen in Figure 1, all viral genomes that shared miR-195-like sequences are clustered together in Clade C. 10.1371/journal. [score:1]
These analyses indicated that in addition to hsa-miR-195, there are three other cellular mature miRNAs (hsa-miR-424, hsa-miR-374a, hsa-miR-30d) that displayed 13–18 nucleotide length homologous regions within the Env genes of four different HIV-1 strains (Table 3). [score:1]
Location of hsa-miR-195-like Sequence in HXB2 Env Gene. [score:1]
Sequence Similarity Between Human miR-195 and HIV Envelope Genes. [score:1]
Using the BLAST algorithm and the 18-nucleotide miR-195-like sequence as the query, only one significant match was localized to nucleotides 6524363 through 6524380 (18/18 matches) on the human chromosome 17 (Table 6). [score:1]
These analyses revealed that the hsa-miR-195-like region that we have identified aligns best to a specific region in the Env gene of African strains (Table 5, shaded area). [score:1]
[1 to 20 of 39 sentences]
23
[+] score: 42
Overexpression of miR-195-5p inhibited cell proliferation, reduced cell colony formation, suppressed cell migration and caused an accumulation of cells in the G1 phase of the cell cycle by directly targeting cyclin E1 (CCNE1)[22]. [score:10]
In support of the hypothesis that miR-195-5p acts as a tumor suppressor in breast cancer, we found that miR-195-5p expression is downregulated in aggressive subtypes of breast cancers, especially in HER2 -positive and basal types of breast cancers. [score:8]
miR-195-5p has been found to be down-regulated [21] and also been suggested as a possible diagnostic target for breast cancer [22]. [score:6]
As predicted, low expression of miR-195-5p and 181d shows an association with poor patient survival (Figure 2b and 2d) whereas high expression of miR-146a-5p shows an association with poor patient survival (Figure 2f). [score:5]
Among these differentially expressed miRNAs, miR-146a-5p, miR-195-5p, and miR-181d are potentially involved in breast cancer development based on previous research and therefore they were selected for further statistical analysis. [score:4]
Both miRNAs miR-195-5p and 181d are down-regulated in HER2 -positive breast epithelial cells compared to control cells (Figure 1b). [score:3]
Expression and prognostic values of miR-181d, miR-195-5p and miR-146a-5p in clinical breast cancer samples. [score:3]
Figure 2(a, c, e) Relative expression levels of miR-181d, miR-195-5p and miR-146a-5p in breast cancer subtypes. [score:3]
[1 to 20 of 8 sentences]
24
[+] score: 38
Other miRNAs from this paper: hsa-mir-145, hsa-mir-135b
In particular, miR-195 upregulated after RA treatment targeted CCNE1 that was accordingly downregulated after RA-treatment. [score:9]
In our mo del, miR-195 was significantly upregulated after hMB-SLCs differentiation, in contrast to its direct target CCNE1, whose expression was significantly reduced. [score:9]
However, despite its role as an oncogene, only recently it has been proposed in human glioma cells a mechanism for the regulation of CCNE1 activity that involves the miR-195 and leads to the reduction of pRb phosphorylation and to the downregulation of the proliferative marker PCNA [16]. [score:5]
In addition also miR-145, which belongs to the same family of miR-195, was upregulated in RA -treated cells. [score:4]
Thus, our results point out that the mechanism of CCNE1 modulation by miR-195 and the subsequent reduction of PCNA may be also involved in the regulation of hMB-SLCs proliferation, suggesting that the inhibition and/or activation of one or more players of this network could be of strong interest in the clinical management of hMB-SLCs. [score:4]
In Figure 6(a) a network including miR-195 and its proliferative target CCNE1 is shown. [score:3]
In addition to CCNE1 also PCNA, another known target of miR-195 [16] is included in the network. [score:3]
As shown in Figure 6(a), miR-195, CCNE1, and PCNA are involved in the first subnetwork. [score:1]
[1 to 20 of 8 sentences]
25
[+] score: 36
For example, the up-regulation of miR-34a and miR-195 was associated with a down-regulation of BCL2 and SGK1 protein levels, respectively; whereas the down-regulation of miR-193b, miR-221, miR-222 and miR-7 was associated with an up-regulation of MCL1, BCL2L11 (Bim), CDN1B (p 27) and VDAC1 protein levels, respectively (Figure 9A). [score:13]
MiR-34a and miR-195, both up-regulated by Par-4 overexpression, were predicted to target the pro-survival genes BCL2 and SGK1, respectively (Figure 8B and 8C; see Additional file 8). [score:8]
Our qRT-PCR results showed that miR-18a, miR-193, miR-221, miR-222 and miR-7 were down-regulated, whereas miR-195, miR-30d and miR-34a were up-regulated in Par-4 -transfected cells when compared with empty vector -transfected cells (Figure 8C). [score:6]
To the best of our knowledge, the predicted target mRNAs of miR-193b, miR-195 and miR-7 have yet to be functionally validated; whereas BCL2, BCL2L11 (Bim) and CDN1B (p 27) have been functionally validated (by Western blot or qRT-PCR analysis) as target mRNAs of miR-34a, miR-221 and miR-222 in human neuroblastoma, prostate cancer and rat PC12 cell lines [40- 42]. [score:5]
Eleven (miR-30d, miR-10b, miR-34a, miR-195, miR-222, miR-221, miR-31, miR-7, miR-663, miR-193b and miR-18a) out of 22 deregulated microRNAs accounted for the 283 predicted target mRNAs linked to cell death (e. g. pro- or anti-apoptotic genes) (see Additional file 8). [score:4]
[1 to 20 of 5 sentences]
26
[+] score: 34
Focusing on the conserved miRNAs presented in Table 1, we found that of the 14 miRNAs downregulated in our study relative to normal bone, six were published as upregulated in osteosarcoma relative to osteoblasts, namely the miRNAs miR-126, miR-142-3p, miR-195, miR-223, miR-451 and miR-497, while miR-31/miR-31* was upregulated compared to bone and downregulated compared to osteoblasts. [score:11]
The inverse deregulation of miRNAs compared to bone or osteoblasts is consistent with previous publications, Jones et al. [10] identified miR-126, miR-142-5p, miR-195, miR-223 and miR-451 to be downregulated in osteosarcoma versus bone while Lulla et al. [11] reported a subset of these, miR-126, miR-142-3p, miR-223 and miR-451, to be upregulated when compared to osteoblasts. [score:6]
All of the miRNAs that were confirmed downregulated in clinical samples compared to bone are known to act as tumor suppressors in other types of cancers, that is miR-1, miR-126/miR-126*, miR-133b, miR-144, miR-195, miR-223 and miR-497 [38], [39], [40], [41], [42], [43]. [score:5]
The highly downregulated miRNAs presented in Table 1 were miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-363, miR-486-5p and members of the miR-1/miR-133a, miR-206/miR-133b, miR-451/miR-144 and miR-497/miR-195 clusters. [score:4]
Among these, miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-486-5p and members of the miR-1/miR-133a, miR-144/miR-451, miR-195/miR-497 and miR-206/miR-133b clusters were found to be downregulated in osteosarcoma cell lines. [score:4]
A set of miRNAs, miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-142-3p, miR-133b, miR-144, miR-195, miR-223, miR-451 and miR-497 was identified with an intermediate expression level in osteosarcoma clinical samples compared to osteoblasts and bone, which may reflect the differentiation level of osteosarcoma relative to the undifferentiated osteoblast and fully differentiated normal bone. [score:2]
As predicted, the 13 miRNAs miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-133b, miR-142-3p, miR-144, miR-195, miR-223, miR-451 and miR-497 showed opposite regulation when the osteosarcoma clinical samples were compared against bone or osteoblasts. [score:1]
The level of change was significant for nine of these miRNAs; miR-1, miR-9, miR-18a, miR-18b, miR-126, miR-133b, miR-144, miR-195 and miR-223. [score:1]
[1 to 20 of 8 sentences]
27
[+] score: 34
down-regulation of miR-195 elevated CARMA3 protein expression, whereas miR-195 up-regulation abolished the Caspase recruitment domain (CARMA3 also known as CARD10) protein expression in CRC cells through NF-kB activity. [score:11]
Research based on mouse mo dels indicated that induced expression of miR-195 dramatically reduced tumor microvessel densities and inhibited both pulmonary and intrahepatic metastasis. [score:5]
We have revealed common small non-coding RNA molecules (miR-26a, miR-195, miR- miR-126, miR-122, miR-21, miR-155, miR-9, miR-135b, miR-29b, miR-142-3p, miR-210, miR-181, miR- 224) in HCC and CRC, which suppress the expression of multiple genes involved in tumor- stromal interactions, immune invasion and tumor angiogenesis. [score:5]
Another promising HCC biomarker with a considerable therapeutic potential is inflamma-miR-195, which suppresses HCC angiogenesis and metastasis if overexpressed in tumor tissues. [score:5]
Both loss-of-function and gain-of-function research of in vitro mo dels showed that miR-195 not only suppresses the ability of HCC cells to develop the migration and capillary formation of endothelial cells but also directly decrease the ability of HCC cells to migrate and invade the ECM gel [24]. [score:4]
Thereafter, miR-195 directly decreases the expression of the proangiogenic VEGF and the prometastatic factors VAV2 and CDC42 from the Rho -family GTP-ases, which activates cellular actin dynamics in manycellular functions [24, 25] (Figure 1). [score:4]
[1 to 20 of 6 sentences]
28
[+] score: 33
Taken together with our later observations that targeting of the liver-specific miR-122-5p or poorly abundant miR-195-5p, miR-25-3p, miR-200a/b/c-3p, miR182-5p and the mutant miR-224-5p mut2 by 2′OMe AMOs (but not their LNA/DNA AMO counterparts) also resulted in significant inhibition of immunostimulatory ssRNA sensing, our work establishes sequence -dependent and miRNA-independent off-target inhibitory activity of 2′OMe AMOs on the immune sensing of pathogenic RNA by human and mouse phagocytes. [score:9]
The sequence-specific and miRNA-independent significant inhibition of immunostimulatory ssRNA sensing by 2′OMe AMOs targeting miR-195-5p, miR-25-3p, miR-122-5p, miR-200a/b/c-3p and miR182-5p (Figure 2B) was supported by the lack of inhibitory activity with LNA/DNA AMOs (Figure 2C), and the low abundance of these miRNAs (less than 100-fold the level of the most abundant miRNA in BMMs) (Figure 2A). [score:7]
The inhibitory effect was dose dependent, with a maximum IC [50] around 2 nM for miR-195-5p 2′OMe AMO (Supplementary Figure S1), while other 2′OMe AMOs (for example, miR-224-5p, not shown) showed only minor inhibitory activity when used at concentrations as high as 80 nM. [score:5]
Next, dose-response studies comparing the activity of highly inhibitory AMOs (miR-182-5p 2′OMe and miR-331-3p LNA/DNA) and that of poorly inhibitory AMOs (miR-224-5p 2′OMe and miR-195-5p LNA/DNA) on both TLR7 and TLR8 sensing were conducted in human PBMCs (Figure 3C and D). [score:5]
Critically, this core sequence overlapped with a significantly enriched motif found in all the inhibitory sequences of Class 2 AMOs previously identified, in 5′-3′ orientation (for miR-200a/b-3p, and miR-25-3p) or 3′-5′ orientation (for AMO-NC1, miR-182-5p, miR-122-5p and miR-195-5p) (Figure 4C and Supplementary Table S2). [score:3]
In line with a predominant TLR7 inhibitory effect of LNA/DNA AMOs, the miR-331-5p LNA/DNA AMO significantly decreased IFN-α levels compared to the miR-195-5p LNA/DNA AMO, while having a smaller impact on TLR8 -driven TNF-α production (Figure 3D). [score:2]
Ordinary one-way (A and B) or two-way (C and D) ANOVA with Dunnett's multiple comparison tests to the RD+B-406AS-1 (A and B), the miR-224-5p+B-406AS-1 (C) or the miR-195-5p+B-406AS-1 (D) conditions are shown. [score:1]
Similar results were seen with miR-195-5p 2′OMe AMO dose-response studies (Supplementary Figure S1). [score:1]
[1 to 20 of 8 sentences]
29
[+] score: 33
Furthermore, the methylation state of CpG islands in the promoter region upstream of the miR497-195 cluster was responsible for the down-regulation of those two miRNAs in breast cancer, and direct targets of miR-195-5p included CCND1 and RAF1 [26]. [score:7]
Moreover, introduction of miR-195-5p was shown to inhibit cancer cell colony formation in vitro [26] and tumor development in nude mice [27], suggesting that ectopic expression of miR-195-5p may be involved in the tumorigenesis of breast cancer. [score:6]
Furthermore, miR-195-5p in the same cluster was down-regulated (Figure  3G; mean fold change 0.4) in triple -negative breast cancers in the quantitative RT-PCR validations. [score:4]
In addition, miR-497-5p and miR-195-5p, in the miR-497-195 cluster located in the intronic region of MIR497HG at 17p13.1, were both significantly down-regulated (p <0.05; fold change 3.0-3.3) in triple -negative breast cancer. [score:4]
Li et al. described that miR-497-5p and miR-195-5p in this cluster were both down-regulated in human breast cancer tissues and cell lines [26]. [score:4]
Our results provide evidence showing in vivo that both miR-497-5p and miR-195-5p are down-regulated in triple -negative breast cancer tissues. [score:4]
Relative expression levels of (F) miR-497-5p and (G) miR-195-5p in 23 samples are shown. [score:3]
Two 5p miRNA forms, miR497-5p and miR-195-5p, located at two different loci in the miR-497-195 cluster are shown in Figure  3E. [score:1]
[1 to 20 of 8 sentences]
30
[+] score: 33
On the contrary, miRNA-195-5p, elevated in AD and sCJD, downregulates Aβ production by targeting APP and BACE1, and protects against chronic brain hypoperfusion -mediated dementia [89]. [score:6]
Only miRNA-195-5p showed common expression profiles in sCJD and FFI, with increased expression in both brain regions compared to age-matched control (Fig 6D) indicating a lack of complete specificity of miRNA patterns between neurodegenerative diseases from same etiology. [score:6]
Although the precise role of miRNA-195-5p in prion diseases is unknown, we also detected increased levels in the FC of fatal familial insomnia (FFI), a genetic prion disease with moderate cortical involvement [91]. [score:5]
In AD samples, we detected coincident gene expression regulations with sCJD for miRNA-195-5p (increased) and for miRNA-877-5p and 323a-5p (decreased) (Fig 6B). [score:4]
Six miRNAs were selected: i) miRNA-195-5p, 877-5p and 323a-5p, commonly regulated in the FC of sCJD and in the PFC of AD, ii) miRNA-146a-5p and miRNA-342-3p, reported to be altered in AD and prion disease mo dels [22, 23, 53, 54] and iii) miRNA-5701. [score:4]
Among these, the deregulated expression levels of miRNA-195-5p, miRNA-877-5p and miRNA-323a-5p (marked in red) were previously validated by qPCR in the FC of sCJD cases (Fig 2). [score:4]
RNA extraction from immunoprecipitates and further qPCR analysis allowed us to detect miRNA enrichment for a subset of miRNAs with increased expression in sCJD MM1 brain tissue according to qPCR analysis (miRNA-146a-5p, miRNA-26a-5p, miRNA-195-5p and miRNA-154-5p). [score:3]
Among these, miRNA-195-5p, 877-5p and 323a-5p were previously validated in sCJD from our small RNA-Seq dataset and miRNA-195-5p and 877-5p were validated by qPCR (Fig 2A). [score:1]
[1 to 20 of 8 sentences]
31
[+] score: 32
MiR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572, and miR-663a were downregulated, while miR-101-3p, miR-106b-5p, miR-130a-3p, miR-195-5p, and miR-19b-3p were upregulated. [score:7]
miR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
MiR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated, while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
miR-151a-3p (ΔΔCt = -2.01, P = 8.29E-06), MiR-181b-5p (ΔΔCt = -3.39, P = 1.04E-10), miR-320a (ΔΔCt = -2.47, P = 5.02E-12), miR-328 (ΔΔCt = -2.28, P = 4.33E-06), miR-433 (ΔΔCt = -2.33, P = 0.0001), miR-489 (ΔΔCt = -2.10, P = 1.25E-06), miR-572 (ΔΔCt = -2.47, P = 2.66E-08) and miR-663a (ΔΔCt = -2.06, P = 0.00002) were downregulated, while miR-101-3p (ΔΔCt = 1.43, P = 0.003), miR-106b-5p (ΔΔCt = 1.30, P = 0.008), miR-130a-3p (ΔΔCt = 2.35, P = 1.89E-09), miR-195-5p (ΔΔCt = 1.43, P = 0.0016) and miR-19b-3p (ΔΔCt = 1.87, P = 6.88E-09) were upregulated in the ASD individuals. [score:7]
The results of the present and previous studies are summarized in Table  2, in which hsa-miR-181b-5p, hsa-miR-195-5p, hsa-miR-320a and hsa-miR-328 showed the same direction of regulation as in the brain [13] and lymphoblasts [14- 16], while hsa-miR-106b-5p, hsa-miR-19b-30 and hsa-miR-663a did not. [score:3]
The Ct values of nine miRNAs (miR-101-3p, miR-106b-5p, miR-151a-3p, miR-195-5p, miR-19b-3p, miR-27a-3p, miR-320a, miR-328, and miR-489) were in the range of 25–30, while the remaining five miRNAs (miR-130a-3p, miR-181b-5p, miR-433, miR-572, and miR-663a) had Ct values in the range of 30 to 35. [score:1]
[1 to 20 of 6 sentences]
32
[+] score: 29
A comparison was performed between the miRNAs upregulated in both MMTBI and STBI group which identified a signature of 10 miRNAs viz miR-151-5p, miR-195, miR-20a, miR-328, miR-362-3p, miR-30d, miR-451, miR-486, miR-505* and miR-92a, with increased expression in both MMTBI and STBI groups (Fig. 2, Common miRNAs in MMTBI and STBI are highlighted in bold in Tables 1 and 2). [score:6]
MiR-505* and miR-195 were upregulated however due to sample outliers in a small group it was not statistically significant. [score:4]
This analysis identified 30 genes as direct targets for the 8 miRNA candidate miR-151-5p, miR-195, miR-328-3p, miR-362-3p, miR-30d, miR-20a, miR-486 and miR-92a. [score:4]
For miR-505* and miR-195, although the mean fold upregulation was more than 10 fold, however it was only observed in 50–60% of the samples whereas in the remaining samples it was not detected, hence these failed the statistical test. [score:4]
MiR-486, miR-27a and miR-195 targeted molecules involved in glutamate receptor signaling and GABA receptor signaling. [score:3]
We randomly selected five miRNAs miR-195, miR-328, miR-362-3p, miR-486 and miR-505* and performed specific miRNA assays to validate their expression. [score:2]
There were significant differences between the two groups for all but two of the selected miRNA: miR-195 (p < 0.001); miR-30d (p < 0.001); miR-451 (p < 0.011); miR-328 (p < 0.101); miR-92a (p < 0.001); miR-486 (p < 0.006); miR-505 (p < 0.008); and miR-362 (p < 0.035); miR-151 (p < 0.065); and miR-20a (p < 0.012) (Fig. 5). [score:1]
There were significant differences between the two groups for all but two of the selected miRNA (see asterisks): miR-195 (p < 0.001); miR-30d (p < 0.001); miR-451 (p < 0.011); miR-328 (p = 0.101); miR-92a (p < 0.001); miR-486 (p = 0.006); miR-505 (p = 0.008); and miR-362 (p = 0.035); miR-151 (p = 0.065); and miR-20a (p = 0.012). [score:1]
Comparison of miRNAs modulated in this study with that of serum miRNA from blast induced MMTBI in rats show common miRNAs such as miR-20a, miR-362-3p, miR-195, miR-451 and miR-92a. [score:1]
The analysis identified the AUC values as miR-195 (0.81, p value < 0.003), miR-30d (0.75, p value < 0.016), miR-451 (0.82, p value < 0.002), miR-328 (0.73, p value < 0.030), miR-92a (0.86, p value < 0.001), miR-486 (0.81, p value < 0.003), miR-505 (0.82, p value < 0.002), miR-362 (0.79, p value < 0.006), miR-151 (0.66, p value < 0.123), miR-20a (0.78, 0.007). [score:1]
The AUC’s were: miR-195 (0.81), miR-30d (0.75), miR-451 (0.82), miR-328 (0.73), miR-92a (0.86), miR-486 (0.81), miR-505 (0.82), miR-362 (0.79), miR-151 (0.66), miR-20a (0.78). [score:1]
The real time data for miR-151-5p, miR-195, miR-20a, miR-30d, miR-328, miR-362-3p, miR-451, miR-486, miR-505* and miR-92a was normalized using miR-202. [score:1]
[1 to 20 of 12 sentences]
33
[+] score: 27
These miRNAs showed downregulation in our sequencing analysis and hsa-miR-195 downregulation was comfirmed by Real-Time qPCR in this study. [score:7]
hsa-miR-133a, hsa-miR-133b and hsa-miR-195 are downregulated in bladder cancers [28]. [score:4]
hsa-miR-182, hsa-miR-183 and hsa-miR-200a were overexpressed hsa-miR-143 and hsa-miR-195 were underexpressed in bladder urothelial carcinoma compared to matched histologically normal urothelium. [score:4]
hsa-miR-182, hsa-miR-183 and hsa-miR-200a were overexpressed hsa-miR-143 and hsa-miR-195 were underexpressed in bladder urothelial carcinoma compared to matched histologically normal urothelium (p<0.001 for each miRNA) (Table S3). [score:4]
Three overexpressed (hsa-miR-182, hsa-miR-183 and hsa-miR-200a) and two underexpressed miRNAs (hsa-miR-143 and hsa-miR-195) were evaluated in all of the patients included in this study. [score:3]
For the comparison between deep sequencing data and Real-Time qPCR results, hsa-miR-182, hsa-miR-183, hsa-miR-200a, hsa-miR-143 and hsa-miR-195 determined to be differentially expressed in bladder urothelial carcinoma compared to matched histologically normal urothelium in nine patients by deep sequencing were validated using Real-Time qPCR. [score:2]
0018286.g001 Figure 1For the comparison between deep sequencing data and Real-Time qPCR results, hsa-miR-182, hsa-miR-183, hsa-miR-200a, hsa-miR-143 and hsa-miR-195 determined to be differentially expressed in bladder urothelial carcinoma compared to matched histologically normal urothelium in nine patients by deep sequencing were validated using Real-Time qPCR. [score:2]
In this study, Real-Time qPCR was performed to evaluate the expression patterns of hsa-miR-182, hsa-miR-183, hsa-miR-200a, hsa-miR-143 and hsa-miR-195 in a total of fifty-one bladder urothelial carcinoma patients. [score:1]
[1 to 20 of 8 sentences]
34
[+] score: 26
Along these lines, our results show a significant downregulation of miR-195 and miR-503 expression in MKN45 radioresistant cells. [score:6]
Accordingly, NSCLC (non small cell lung carcinoma) shows lower miR-195 expression in the tumor than in adjacent tissues, and this lower expression has been associated with poorer overall survival 57. [score:5]
Taken together, these data suggest an involvement of miR-195 and -503 in the upregulation of CHK1 mRNA in MKN45 cells. [score:4]
Chk1 protein levels could be modified by pRB-E2F1, p53 or miRNAs that seem to regulate its expression Thus, the miR-195/Chk1 axis may be used as a new biomarker tool to predict individual response to adjuvant radiotherapy. [score:4]
We then used real-time to detect the expression of miR-195/503 in AGS and MKN45 cell lines. [score:3]
From the predicted miRNAs that target CHK1, we investigated the potential role of miR-195 and miR-503 in the regulation of the stability of CHK1 mRNA. [score:2]
miR-195 belongs to the big miR-15 microRNA family. [score:1]
Our results showed that miR-195 and -503 levels were significantly lower (P ≤ 0.05) in MKN45 cells than in AGS cells (Supplementary Fig. 4B). [score:1]
[1 to 20 of 8 sentences]
35
[+] score: 26
Interestingly, from these 17 significant pairs (adjusted p-value ≤ 0.05) several downregulated tumour-suppressor miRNAs (e. g., miR-let-7c, miR-139, miR-145 or miR-195) appeared to regulate oncogenic genes related to the cell cycle and DDR pathways (BUB1B, AURKA, BIRC5, CENPK, BRCA1 and CHEK1). [score:7]
Conversely, tumour suppressor miRNAs (miR-145, miR-139 and miR-195) are the most strongly down-regulated miRNAs in our dataset. [score:6]
Most of these interactions involved cell cycle related genes, like SPC24 and CDC20 (regulated by the anti-oncomiR miR-139), and PKMYT1 (regulated by the tumour suppressor miR-195). [score:5]
Conversely, the anti-oncomiRs miR-145, miR-139 and miR-195 were the most strongly down-regulated miRNAs in our dataset. [score:4]
Moreover, miR-195 and miR-139 are also well-known tumour suppressor miRNAs 28. [score:3]
The senescence pathway was also represented and while most of the associations identified were known, novel ones were found like HMGA2/miR-139 and EZH2/miR-195. [score:1]
[1 to 20 of 6 sentences]
36
[+] score: 26
mir-200a, mir-34, mir-195, and mir-381-3p are usually downregulated in presence of SIRT1 expression, and vice versa low expression of SIRT1 relates to miRNAs upregulation [9, 11, 17, 18, 26– 28]. [score:11]
Comparing the miRNAs expression of LPS -treated rats with LPS + RvD1, a significant downregulation of the levels of miR-195-5p, miR-200a-3p (related to SIRT1 expression and activity), miR-145-5p (related to both SIRT1 and p53 regulation), and miR-34a-5p (candidate for p53 regulation) in ocular tissues of LPS + RvD1 1000 ng/kg treated rats compared to the LPS -treated group (P < 0.01 versus LPS group; Figure 6) was noted. [score:9]
Interestingly, the protective action of intravitreal RvD1 was associated with an increased level of endogenous SIRT1 within the eye and a downregulated expression of miR-195-5p, miR-200a-3p, miR-34a-5p, and miR-145-5p. [score:6]
[1 to 20 of 3 sentences]
37
[+] score: 24
Up-regulation of CHEK1 by reduced expression of miR-195 promotes cell proliferation, migration, and invasion, and is associated with a higher overall mortality in lung cancer [73]. [score:6]
CHEK1 is a direct target of miR-195, which results in decreased CHEK1 expression in lung cancer. [score:6]
MiR-195 expression is lower in NSCLC than in non-cancerous normal tissues and low miR-195 expression has been associated with unfavorable overall survival of patients with NSCLC. [score:5]
MiR-195 MiR-195 expression is lower in NSCLC than in non-cancerous normal tissues and low miR-195 expression has been associated with unfavorable overall survival of patients with NSCLC. [score:5]
MiR-195 suppresses cancer growth and is associated with lower mortality in several cancers, including NSCLC. [score:2]
[1 to 20 of 5 sentences]
38
[+] score: 23
The last number shows the potential diseases that related to this co-function pair The 5th-ranked pair, miR-15b and miR-195, both belong to the miR-15 family, and both of them can target gene BCL2, an important apoptosis inhibitor. [score:7]
The last number shows the potential diseases that related to this co-function pair The 5th-ranked pair, miR-15b and miR-195, both belong to the miR-15 family, and both of them can target gene BCL2, an important apoptosis inhibitor. [score:7]
A co-functional pair miR-195-5p-miR-15b-5p is highlighted Figure 6 a shows the percentages of the predicted disease-miRNA associations that can be verified when the number of top-ranked miRNAs varies from 10 to 150. [score:3]
Based on these analysis and evidences, it is suggested that the pair of miR-15b and miR-195 may contribute to the development of all the 38 different types of cancers via a similar regulation mechanism. [score:3]
A co-functional pair miR-195-5p-miR-15b-5p is highlighted Figure 6 a shows the percentages of the predicted disease-miRNA associations that can be verified when the number of top-ranked miRNAs varies from 10 to 150. [score:3]
[1 to 20 of 5 sentences]
39
[+] score: 23
At 40 weeks of age, the expression of miR-216, miR-217, miR-223, miR-141, miR-483-3p (p-value = 0.031), miR-195, Let-7b (p-value = 0.063) and miR-96 were significantly downregulated; on the other hand, the expression of miR-21, miR-205, miR-146b (p-value = 0.031), and miR-34c (p-value = 0.063) were upregulated in KC mice compared to the control animals (Figure 2C). [score:10]
At 30 weeks of age, the expression of miR-216 (p-value = 0.016), miR-217 (p-value = 0.0078), miR-150 (p-value =0.023), Let-7b (p-value = 0.031,) and miR-96 were significantly downregulated, whereas the expression of miR-146b (p-value = 0.0078), miR-205, (p-value - 0.0078), miR-21, miR-195 (p-value = 0.031), and miR-34c (p-value = 0.063) were significantly upregulated in KC animals compared to control animals (Figure 2B). [score:10]
On the other hand, miR-146b, miR-34c, miR-223, miR-195 (p-value = 0.031) and miR-216 (p-value = 0.063) were downregulated in KC mice compared to control littermates. [score:3]
[1 to 20 of 3 sentences]
40
[+] score: 23
In summary, our study revealed four down-regulated miRNAs, miR-148a, miR-142-3p, miR-26a, and miR-195, in GC patients. [score:4]
Ultimately, four down-regulated plasma miRNAs (i. e., miR-26a, miR-142-3p, miR-148a and miR-195) were selected as the candidates for the fist-stage validation (Table 2). [score:4]
0151345.g002 Fig 2(A-D) Relative expression levels of miR-26a, miR-142-3p, miR-148a, miR-195, in 50 paired gastric cancer tissues and corresponding noncancerous tissues (log [10] scale on Y -axis). [score:3]
The plot showed that the expression levels of four miRNAs were statistically significant in the GC tissues (P = 0.001, P = 0.002, P < 0.001 and P = 0.003 for miR-26a, miR-142-3p, miR-148a and miR-195, respectively, Figs 2A–2D). [score:3]
S2 Fig The combination of miR-26a, miR-142-3p and miR-148a (A), the combination of miR-26a, miR-142-3p and miR-195 (B), the combination of miR-26a, miR-148a and miR-195 (C) and the combination of miR-142-3p, miR-148a and miR-195 (D) yielded the largest AUCs. [score:1]
Comparing TLDA analysis and the result of tissue microarray, four miRNAs(miR-26a, miR-142-3p, miR-148a and miR-195) reduced in GC were selected. [score:1]
S1 Fig The combination of miR-26a and miR-142-3p (A), the combination of miR-26a and miR-148a (B), the combination of miR-26a and miR-195 (C), and the combination of miR-142-3p and miR-148a (D), the combination of miR-142-3p and miR-195(E) and the combination of miR-148a and miR-195 (F) yielded the largest AUCs. [score:1]
ROC curves were constructed to show AUCs of miR-26a (A), miR-142-3p (B), miR-148a (C), miR-195 (D) and the combination of four miRNAs (E). [score:1]
The sensitivity and specificity were 75.4% and 83.1% for miR-148a, 69.2% and 75.4% for miR-195, respectively (Fig 4C and 4D). [score:1]
0151345.g004 Fig 4 ROC curves were constructed to show AUCs of miR-26a (A), miR-142-3p (B), miR-148a (C), miR-195 (D) and the combination of four miRNAs (E). [score:1]
0151345.g003 Fig 3Box plots showed the plasma levels of miR-26a (A), miR-142-3p (B), miR-148a (C) and miR-195 (D) in 200 gastric cancer patients and 200 age- and gender-matched healthy controls. [score:1]
The AUCs were 0.842 (95% CI = 0.803–0.882) and 0.765 (95% CI = 0.717–0.812) for miR-148a and miR-195, respectively. [score:1]
Box plots showed the plasma levels of miR-26a (A), miR-142-3p (B), miR-148a (C) and miR-195 (D) in 200 gastric cancer patients and 200 age- and gender-matched healthy controls. [score:1]
[1 to 20 of 13 sentences]
41
[+] score: 21
It has been reported that miR-195–5p could inhibit osteosarcoma cell migration and invasion through targeting FASN (fatty acid synthase) [20]. [score:5]
The 4 miRNAs, including miR-195–5p, miR-199a-3p, miR-320a, and miR-374a-5p, were shown to be upregulated by a factor greater than two-fold. [score:4]
S1 Fig (A) The expression levels of miR-195–5p in patients without metastasis before and after surgery. [score:3]
0121499.g005 Fig 5 (A) The correlation between the expression levels of miR-195–5p and metastasis status. [score:3]
As shown in S1 Fig., both miR-195–5p and miR-199a-3p were significantly decreased in the patients without and with metastasis after tumor removal. [score:1]
In addition, circulating miR-195-5p and miR-199a-3p were correlated with metastasis status, while miR-199a-3p and miR-320a were correlated with histological subtype. [score:1]
In this study, miR-195–5p and miR-199a-3p were correlated with metastatic status, and miR-320a and miR-199a-3p were correlated with osteoblastic subtype. [score:1]
Four plasma miRNAs including miR-195-5p, miR-199a-3p, miR-320a, and miR-374a-5p were significantly increased in the osteosarcoma patients. [score:1]
Furthermore, the plasma levels of miR-195–5p and miR-199a-3p were analyzed in the 50 patients without or with metastasis who underwent surgical removal of the tumors. [score:1]
The AUC was 0.9029 for miR-195–5p (95% confidence interval [CI], 0.8602–0.9456) (Fig. 3A), 0.9025 for miR-199a-3p (95% confidence interval [CI], 0.8658–0.9392) (Fig. 3B), 0.9188 for miR-320a (95% confidence interval [CI], 0.8857–0.9519) (Fig. 3C), and 0.9173 for miR-374a-5p (95% confidence interval [CI], 0.8855–0.9492) (Fig. 3D). [score:1]
[1 to 20 of 10 sentences]
42
[+] score: 19
FAS has target sites for miR-195, miR-181d and miR-16 that were all downregulated in the liver of the obese minipigs. [score:6]
MiR-181d (FC 2.27; p value 0.03) was the most downregulated while miR-195 and miR-16 were down regulated with fold changes < -1.5 and p values < 0.05. [score:5]
MiR-208b-3p, miR-1, miR-16 and miR-195 were upregulated with a fold change of > 1.5 and p value < 0.05. [score:4]
In contrast, miR-195 is upregulated in the liver of type 2 diabetic rats [56]. [score:4]
[1 to 20 of 4 sentences]
43
[+] score: 19
Additionally, miR-195-5p has been shown to directly target the 3′;-UTR of GLUT3 and regulate its expression in order to suppress glucose uptake, inhibit tumor cell growth and proliferation, and promote apoptosis of tumor cells. [score:11]
Therefore, the decreased expression of miR-195-5p will lead to the up-regulation of GLUT3 expression, which may contribute to tumorigenesis [82]. [score:8]
[1 to 20 of 2 sentences]
44
[+] score: 19
Further analysis showed that miRNA-195 (a member of miRNA-15 family) regulates expression of a number of cell cycle genes, including checkpoint kinase 1 (Chek1), which was identified as a highly conserved direct target of miRNA-195 [102]. [score:7]
Therefore, forced expression of individual miRNAs for example miRNA-195 was sufficient to exacerbate pathological cardiac hypertrophy when over expressed in transgenic mice [16]. [score:5]
miR-195 targets mouse protein-25 (MO25), a central component of the MO25/Ste20 Related Adaptor (STRAD)/liver kinase B1 (LKB1) complex that acts as an upstream kinase for adenosine monophosphate-activated kinase (AMPK), a prominent player in the development of cardiac hypertrophy and heart failure [63]. [score:4]
These studies indicate that miRNAs, miRNA-208, miRNA-23a, miRNA-24, miRNA-125, miRNA-21, miRNA-129, miRNA-195, miRNA-199, and miRNA-212 are frequently increased in response to cardiac hypertrophy, whereas, miRNA-29, miRNA-1, miRNA-30, miRNA-133, and miRNA-150 expression are often found to be decreased. [score:3]
[1 to 20 of 4 sentences]
45
[+] score: 18
Let-7b also had lower expression in circulating blood from the breast cancer cohort, an observation that was not statistically supported by sequencing results, and no evidence of differential expression was observed using either method for miR-195 or miR-16. [score:5]
No differences in expression levels were found for the miR-195 or miR-16 (Table 5, Fig 3B). [score:3]
The standard curve for the miRNA target miR-195 and miR-16 ranged from 10 [8] to 10 [3] copies. [score:3]
Similarly, miR-195 expression was assessed using RT-qPCR because it was dysregulated in breast cancer patients from the same geographical location as evaluated in this study [19]. [score:2]
As such, for the purposes of this study miR-320a, let-7b, miR-16 and miR-195 were examined by RT-qPCR using both total RNA and also by developing a pre-RT-qPCR enrichment process for RNA <30 bases. [score:1]
Log 10 box-plots indicating changes in expression of miR-195, miR-16 and Let-7b from healthy to cancer state measured in total RNA using RT-qPCR. [score:1]
MiR-195 and miR-16 showed no notable differences between groups (Table 5, Fig 3A). [score:1]
MiR-320a, let-7b, miR-195 and miR-16 were analysed and quantified using RT-qPCR in samples from both the healthy controls and breast cancer patients using both total RNA and enriched small RNA. [score:1]
Log 10 box-plots indicating changes in expression of miR-195, miR-16 and Let-7b from healthy to cancer state measured in enriched small RNA using RT-qPCR. [score:1]
[1 to 20 of 9 sentences]
46
[+] score: 18
Ovine cardiac expression of miR-15a expression was lowest at 140 days gestation and highest at 21 days of age (P < 0.05), the expression of miR-15b was lowest at 173 days of age and highest at 5 days of age (P < 0.05) and miR-195 expression was lowest at 140 days gestation and highest at 91 days gestation, 5 and 21 days of age (P < 0.05). [score:9]
Comparisons of across this period identified miR-195, a member of the, as the most up-regulated miRNA and therefore possibly implicated in the inhibition of cardiomyocyte proliferation [27]. [score:6]
members miR-15b, miR-16, miR-195 and miR-497 were identified in Clusters 5, 2, 1 and 4, respectively. [score:1]
Consistent with this view, miRNA implicated in rodent cardiomyocyte quiescence,, miR-497 and miR-195, were identified in Clusters 4, 4 and 1, respectively, from the. [score:1]
The relative expression of (MS00031423, QIAGEN Pty Ltd, Doncaster, Australia), the (miR-15a, MS00008785; miR-15b, MS00008799; miR-16, MS00031493; miR-195, MS00008953; miR-497, MS00031906; QIAGEN Pty Ltd, Doncaster, Australia), miR-199a (MS00007602; QIAGEN Pty Ltd, Doncaster, Australia) and miR-590 (MS00010269; QIAGEN Pty Ltd, Doncaster, Australia) were measured using quantitative real-time reverse transcription PCR (qRT-PCR) on an ABI ViiA7 (PE Applied Biosystems, Foster City, CA). [score:1]
[1 to 20 of 5 sentences]
47
[+] score: 17
miR-195, one of the miR-16/15/195/424/497 family members, is down-regulated in a wide variety of tumors including colorectal cancer; moreover, it seems to negatively regulate lymph-node metastasis by targeting cyclins D1 and E1, CDK6, E2F3, suppressing tumorigenesis and blocking G1-S transition. [score:9]
miR195 down-regulation during HCC process suggested that miR-195 could have an important role in the control of processes that are deregulated in HCC carcinogenesis [171]. [score:5]
More recently, Brenner and collaborators analyzed and compared miRNAs profiles between primary tumor of patients with recurrent and non-recurrent GC and reported that three miRNAs (miR-451, miR-199a-3p and miR195) were differentially expressed in tumors from patients with good prognosis in comparison with patients with bad prognosis [107]. [score:2]
Particularly, the authors concluded that miR-212 and miR-195 could be independent biomarkers to predict gastric cancer metastasis to lymph node. [score:1]
[1 to 20 of 4 sentences]
48
[+] score: 17
For the detection of differentially expressed microRNAs we analyzed 240 target miRNAs with four different normalization methods: Recommendation of (i) geNormPlus (geometric mean of miR-26b-5p and miR-195-5p (Pool A) as well as of miR-720, miR-1274a, miR-1260a and miR-30a-5p (Pool B)), (ii) NormFinder (geometric mean of miR-28-5p, miR-127-3p and miR-181a-5p (Pool A) as well as miR-10b-3p, miR-181a-2-3p and miR-720 (Pool B)), (iii) global mean normalization method, (iv) two most stable snoRNAs (geometric mean of RNU44 and RNU48 (Pool A) as well as RNU48 and snRNU6 (Pool B)) or (v) geometric mean of all three snoRNAs provided by the manufacturer. [score:5]
Furthermore, miR-195-5p was identified as an inhibitor of sirtuin 1 (Sirt1) in diabetic nephropathy 44. [score:3]
Under in vitro high-glucose conditions inhibition of miRNA-195-5p protected mesangial cells from apoptosis and induces mesangial cellular proliferation 42, in contrast, miR-195-5p mediated podocyte apoptosis 43. [score:3]
Several miRNAs like miR-181a-5p, miRNA-195-5p, miR-720, and miR-26b-5p have been described in other studies. [score:1]
In order to provide a set of reference miRNAs one could suggest the intersection of the best 15 reference genes from both algorithms geNormPlus and NormFinder (miR-10b-3p, miR-1260a, miR-127-3p, miR-1274a, miR-181a-5p, miR-181a-2-3p, miR-195-5p, miR-26b-5p, miR-28-5p, miR-30a-3p, miR-30a-5p, miR-30d-5p, miR-361-5p, miR-720, miR-92a-3p). [score:1]
GeNormPlus recommended miR-26b-5p and miR-195-5p (Pool A) as well as miR-720, miR-1274a, miR-1260a and miR-30a-5p (Pool B) as the best combinations (Fig. 2). [score:1]
miRNA-195-5p and miR-720 seem to be relevant in diabetic glomerulopathy. [score:1]
Therefore miRNA-195-5p, miR-26b-5p and miR-720 should be used with caution or completely avoided as reference transcripts in diabetic subjects. [score:1]
Relative expression levels were calculated using the following normalization methods: geNormPlus (miR-26b, miR-195-5p) NormFinder (miR-28-5p, miR-127-3p, miR-181a-5p), global Mean, best two snRNAs (RNU44, RNU48) and all 3 snRNAs (RNU44, RNU48, snRNU6). [score:1]
[1 to 20 of 9 sentences]
49
[+] score: 16
van Rooij and colleagues described cardiac hypertrophy and failure in a mouse mo del overexpressing mir-195, which is generally upregulated in hypertrophic human hearts [70]. [score:6]
Thus, the cardiac remo delling induced in the miR-195 Tg animals was specifically caused by the functional effects of this miRNA rather than a general nonspecific effect resulting from miRNA overexpression, suggesting that increased expression of miR-195 induced hypertrophic signalling, leading to cardiac failure. [score:5]
Overexpression of miR-195 under the control of the α- myosin heavy chain (Mhc) promoter initially induced cardiac growth with disorganization of cardiomyocytes, which progressed to a dilated heart phenotype by 6 weeks of age. [score:3]
Furthermore, ratios of heart weight to body weight were also dramatically increased in miR-195 transgenic (Tg) animals as compared to wild-type littermates, indicating that overexpression of miR-195 was sufficient to stimulate cardiac growth. [score:2]
[1 to 20 of 4 sentences]
50
[+] score: 16
Such filtering allowed the selection of four miRNAs: miR-181a-5p (liver expression  = 1233 au; 6 prediction algorithms), miR-23a-3p (liver expression  = 6052 au; 5 prediction algorithms), miR-16-5p (liver expression  = 3513 au; 4 prediction algorithms), and miR-195-5p (liver expression  = 3046 au; 4 prediction algorithms) (see Table 1 and Table S1). [score:9]
Commercial assays for miR-181a-5p, miR-23a-3p, miR-16-5p, miR-195-5p, miR-494, and U6 snRNA (endogenous reference control) (Life Technologies, Madrid, Spain) were used to quantify expression levels of miRNAs in human cell lines and/or hepatocytes. [score:2]
The predicted binding sites of miR-181a-5p, miR-23a-3p, miR-16-5p, and miR-195-5p are indicated in the F11 3′UTR (1,060 bp). [score:1]
Putative binding sites for miRNAs are shown in Figure 1. Whereas miR-181a-5p and miR-23a-3p bind to two closely located sites, miR-16-5p and miR-195-5p share the same binding site located ∼200 bp downstream of the miR-23a-3p seed (Figure 1). [score:1]
0111713.g002 Figure 2HepG2 cells were transfected with 100 nM mimic precursors miR-181a-5p (181a), miR-23a-3p (23a), miR-16-5p (16), miR-195-5p (195), miR-494 (494) or SCR. [score:1]
MiR-16-5p and miR-195-5p share the same binding site. [score:1]
HepG2 cells were transfected with 100 nM mimic precursors miR-181a-5p (181a), miR-23a-3p (23a), miR-16-5p (16), miR-195-5p (195), miR-494 (494) or SCR. [score:1]
[1 to 20 of 7 sentences]
51
[+] score: 16
b The short peptide, ERAP, and the natural product derived from medical plants, xanthohumol, could disrupt the PHB2/BIG3 interaction directly and lead to the translocation of PHB2 from cytoplasm to nucleus, thereby, induce cell growth arrest in some estrogen -dependent cancers a PHB1 can be down-regulated by miR-26a, miR-27a, and miR-195; the lncRNA named PHBP1 directly binds to and maintain the stabilization of PHB1 mRNA; the acetylation of histone H3 can also increase the expression of PHB1; phosphorylation of PHB1 at different amino acids determines the activation and function of PHB1. [score:8]
Fig. 4 a PHB1 can be down-regulated by miR-26a, miR-27a, and miR-195; the lncRNA named PHBP1 directly binds to and maintain the stabilization of PHB1 mRNA; the acetylation of histone H3 can also increase the expression of PHB1; phosphorylation of PHB1 at different amino acids determines the activation and function of PHB1. [score:7]
In human melanoma cells, studies showed that miR-195 binds to the 3′-UTR of PHB1 as well [119]. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 16
Therefore, Deng et al (66) inferred that CDK6 may be the potential target gene of miR-195 in GC and that VEGF may be a candidate target gene of miR-378. [score:5]
CDK6 as a direct target of miR-195 in hepatocellular carcinoma cells has been reported and the 3′UTR of vascular endothelial growth factor (VEGF) has been demonstrated to contain a potential binding site for miR-378 (67, 68). [score:4]
Furthermore, according to the results of analyses conducted using two software packages and luciferase reporter assays, the authors identified CDK6 as a potential direct target of miR-195. [score:3]
The G0/G1 phase arrest caused by miR-195 may be due to the suppression of CDK6, but the mechanism of G2/M phase arrest caused by miR-378 is not clear. [score:3]
miR-195 and miR-378. [score:1]
[1 to 20 of 5 sentences]
53
[+] score: 16
MiR-195 functions as a tumor suppressor miRNA by targeting several genes involved in cell cycle acceleration and anti-apoptotic factors including BCL-2. Another BCL-2 targeting miRNA is miR-497 demonstrated to directly hybridize to the predicted 3′-UTR target sites of this gene. [score:10]
MiR-195 is up-regulated in different types of cancer (metastatic melanoma, gastric cancer, prostate cancer, lung cancer, colorectal cancer and hepatocellular carcinoma) and this result is in agreement with our findings [34]. [score:3]
As shown in Figure 4, we identified the BCL-2 gene as being a specific target of miR-21, miR-181a, miR-181b, miR-29a, miR-29b, miR-497, miR-195, let-7a, miR-34a and miR-1915 (Figure 4 and Table 4). [score:3]
[1 to 20 of 3 sentences]
54
[+] score: 16
Another miRNA, miR-195, was down-regulated and its target MAP7, which is predominantly expressed in cells of epithelial origin and is able to stabilize microtubules, was observed to be up-regulated in TCC (r = −0.48, P = 0.031) [28]. [score:11]
miRNAs solely deregulated in the other two cancers included miR-143 and miR-195, which were down-regulated in TCC. [score:5]
[1 to 20 of 2 sentences]
55
[+] score: 15
Downregulation of miR-195 correlates with lymph node metastasis and poor prognosis in colorectal cancer. [score:4]
MicroRNA-195 inhibits colorectal cancer cell proliferation, colony-formation and invasion through targeting CARMA3. [score:4]
microRNA-195 promotes apoptosis and suppresses tumorigenicity of human colorectal cancer cells. [score:3]
MiR-16 and miR-195 are depleted in CRC tumors relative to normal tissue (Wang et al., 2012; Qian et al., 2013; Xiao et al., 2014). [score:1]
The miR-15 family (miR-15, miR-16, miR-195) can also include miR-424 and miR-497. [score:1]
Study on the molecular regulatory mechanism of MicroRNA-195 in the invasion and metastasis of colorectal carcinoma. [score:1]
IGF2BP2 promotes colorectal cancer cell proliferation and survival through interfering with RAF-1 degradation by miR-195. [score:1]
[1 to 20 of 7 sentences]
56
[+] score: 14
Using microarray analysis, miRNA expression pattern in hearts revealed that miR-1, miR-29, miR-30, miR-133, and miR-150 have often been found to be down-regulated while miR-21, miR-125, miR-195, miR-199, and miR-214 are up-regulated with hypertrophy. [score:9]
Forced expression of miRNA-195 in transgenic mice is sufficient to induce hypertrophic growth and also results in dilated cardiomyopathy and heart failure [19]. [score:3]
Another miRNA that is consistently up regulated in rodent and human hypertrophic hearts is miR-195. [score:2]
[1 to 20 of 3 sentences]
57
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
P53 signaling pathway was regulated by ssc-miR-20b, ssc-miR-497 and ssc-miR-195 through targeting CCNG2, CDKN1A, CASP8, GADD45G, CHEK1, SESN1 and CCNE1. [score:4]
Cell cycle and Neurotrophin signaling pathway were regulated by ssc-miR-20b, ssc-miR-128, ssc-miR-497, ssc-miR-195 and ssc-miR-371-5p through corresponding putative target genes. [score:4]
Ssc-miR-195 and ssc-miR-497 were highly expressed in hpiPSCs and they were also located in the same genome loci in chromosome 12. [score:3]
Ssc-miR-106a, ssc-miR-363, ssc-miR-195, ssc-miR-497, ssc-miR-146b, ssc-miR-92b-5p, ssc-miR-20b and ssc-miR-935 were highly expressed in hpiPSCs than that in mpiPSCs (Fig 3A). [score:3]
[1 to 20 of 4 sentences]
58
[+] score: 14
In cardiovascular diseases and cancers, E2F3 was also testified as a representative target of miR-125b and miR-195 [71]. [score:5]
In human glioblastoma cells, miR-195 was testified to function as a tumor suppressor by targeting E2F3 [39]. [score:5]
E2F3 was also identified as a functional downstream target of miR-195 via robust arrested cell cycle progression in glioblastoma cells [39]. [score:3]
The miR-15 family members, including miR-15a, miR-15b, miR-16-1, miR-16-2, miR-195 and miR-497, are clustered on three separate chromosomes [38]. [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 14
Of these 16 miRNAs, 9 were downregulated (let-7d, miR-106b, miR-122a, miR-141, miR-183, miR-195, miR-200a, miR-335, mir424) and 7 were upregulated (miR-100, miR-199a, miR-296, miR-29a, miR-29c, miR-99a, mir-494). [score:7]
There was little overlap between the targets identified with the two different databases and only 7 targets (FAM44B, BACH1, BCL6, HMGA2, CALU, FGF2, and TNKS2) for 7 miRNAs (let-7 family, miR-98, miR-155, miR-195, miR-346, miR-206, miR-335) were shared between these two databases when the top 3 targets were examined. [score:7]
[1 to 20 of 2 sentences]
60
[+] score: 14
According to previous studies in cancer (MCF-7) cells EGCG up-regulates the expression of miR-16, a member of the miR-15b family (family of miR-16/miR-15a/miR-497/miR-322/miR-195) and consequently, EGCG down-regulates Bcl-2 expression level and thus counteracts cancer progression [25]. [score:11]
A. Cartoon showing the murine mmu-miR-15b (family of miR-16/miR-15a/miR-497/miR-322/miR-195) with STIM2 3’-untranslated region (3’-UTR) with seed sequence. [score:3]
[1 to 20 of 2 sentences]
61
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Zhang and Pan (2009) have evaluated the effects of Hexahydro-1, 3, 5-trinitro-1, 3, 5-triazine (also known as hexogen or cyclonite) (RDX) on miRNA expression in mouse brain and liver, most of the miRNAs that showed altered expression, including let-7, miR-17-92, miR-10b, miR-15, miR-16, miR-26, and miR-181, were related to toxicant-metabolizing enzymes, and genes related to carcinogenesis, and neurotoxicity, in addition, consistent with the known neurotoxic effects of RDX, the authors documented significant changes in miRNA expression in the brains of RDX -treated animals, such as miR-206, miR-30a, miR-30c, miR-30d, and miR-195. [score:5]
Xu et al. (2009) show that miR-195 may block the G(1)/S transition by repressing Rb-E2F signaling through targeting multiple molecules, including cyclin D1, CDK6, and E2F3. [score:3]
MicroRNA-195 suppresses tumorigenicity and regulates G1/S transition of human hepatocellular carcinoma cells. [score:3]
Enhanced MMP2 and MMP9Gramantieri et al., 2007; Meng et al., 2007; Li et al., 2008; Garofalo et al., 2009; Ji et al., 2009a; Pogribny et al., 2009; Wang et al., 2010; Song et al., 2013 miR-182 MetastasisWang et al., 2008, 2012b; Wong et al., 2008, 2010 miR-183 Onset and progression, ApoptosisWang et al., 2008; Wong et al., 2008, 2010; Liang et al., 2013 miR-185 MetastasisBudhu et al., 2008; Wong et al., 2008, 2010; Huang et al., 2009; Zhi et al., 2013 miR-192 Inhibition of DNA excision repairXie et al., 2011 miR-194 MetastasisBudhu et al., 2008; Huang et al., 2009; Meng et al., 2010; Xu et al., 2013 miR-195 Proliferation, colony formation. [score:3]
[1 to 20 of 4 sentences]
62
[+] score: 14
The miRNAs that appear to directly target BIRC5 are miR-145-5p, miR-150-5p, miR-195-5p, and miR-650; both miR-145-5p and miR-150-5p were associated with better survival after diagnosed with CRC overall or with rectal cancer specifically when upregulated in CRC tumor tissue. [score:7]
The miRNAs identified in our study, miR-145-5p, miR-150-5p, miR-195-5p, miR-650, and miR-29b-3p, may serve as reasonable therapeutic targets given their likely role in influencing activity of BIRC5 and CASP7, two important elements in the apoptosis pathway. [score:3]
Several miRNAs, including miR-124 [2], miR-195 [3], miR-148a [4], miR-365 [5], miR-125b [6], miR-129 [7], miR-143 [8], and miR-203 [9], have been linked to apoptosis through regulation of genes such as BCL2 and PUMA, a member of the Bcl-2 family, involved in pro-apoptosis [1, 4, 6, 8, 9]. [score:2]
Ten of the 14 miRNAs associated with BIRC5 has a seed-region match, and four of these matches, miR-145-5p, miR-150-5p, miR-195-5p, and miR-650, had a negative beta coefficient. [score:1]
Several miRNAs were associated with multiple genes, including miR-150-5p with six genes (BIRC5, CSF2RF, TUBA1B, IRPR1, PIK3CD, and BCL2), miR-650 with five genes (BIRC5, CSF2RB, ITPR1, PIK3CD, and BCL2), miR-195-5p with three genes (BIRC5, TUB1B, and BCL2), and miR-20b-5p and miR-3124-5p each with two genes (miR-20b-5p with BIRC5 and CTSS and miR-3124-5p with TNFRSF10B and CSF2RB). [score:1]
[1 to 20 of 5 sentences]
63
[+] score: 13
MicroRNA-195 which was significantly decreased with simulated microgravity (p = 0.0083) is predicted to inhibit RAD50 expression (using miRanda, miRDB, miRWalk, and Targetscan databases), and microRNA-185 which was also decreased with simulated microgravity (p = 0.028) is predicted to inhibit RAD23A expression (using miRanda, miRWalk, TargetScan databases). [score:13]
[1 to 20 of 1 sentences]
64
[+] score: 13
MiR-195 overexpression inhibits ACHN cell viability, migration, and invasion, and also induces cell apoptosis by targeting VEGFR2 via the PI3K/AKT and Raf/MEK/ERK signaling pathways, which indicates that miR-195 plays a tumor suppressive role [56]. [score:9]
The down-regulation of miR-451a, miR-144, miR-195, miR-218, miR-145, miR-30a, miR-126 and miR-139 has been found in both the training and validation set. [score:4]
[1 to 20 of 2 sentences]
65
[+] score: 13
For example, the expression level of miR-195 is lowered in Alzheimer’s disease (AD) patients and the AD amyloid-β production could be downregulated by over -expressing this miRNA [20]. [score:10]
An example is the elevated expression level of miR-195 which occurred exclusively in BN patients and could be used to differentiate BN from other Malignancies [99]. [score:3]
[1 to 20 of 2 sentences]
66
[+] score: 13
Twelve of them (miR-10b, miR-15a, miR-19a, miR-26b, miR-30a, miR-30c, miR-125a, miR-125b, miR-148a, miR-148b, miR-195 and miR-320) are down-regulated both in dogs and in humans whereas one (miR-494) is up-regulated in both species and four (miR-29a, miR-181a, miR-196a and miR-374a) are down-regulated in dogs but up-regulated in humans. [score:13]
[1 to 20 of 1 sentences]
67
[+] score: 12
On the other hand, a number of down-regulated miRNAs, such as miR-378a-5p [19], miR-376c [16], and miR-195 [20], promote trophoblast cell proliferation, survival, and/or invasion. [score:4]
MicroRNA-195 was found to be significantly up-regulated in placenta from women with severe PE by microarray analysis followed by qRT-PCR [25]. [score:3]
For example, miR-195 increased trophoblast cell invasion in part via modulating the expression of ActRIIA [20], a type II receptor for several members of the TGF-β superfamily, including Nodal [130]. [score:3]
However, other studies showed a decrease of miR-195 [20, 26] in preeclamptic pregnancies. [score:1]
Some miRNAs, such as miR-195 [20], miR-376c [16], and miR-378a-5p [19], have been reported to enhance trophoblast migration/invasion. [score:1]
[1 to 20 of 5 sentences]
68
[+] score: 12
Tijsen et al. (2014[155]) also demonstrated that when mice were injected subcutaneously with locked nucleic acid (LNA) -based antimiR-15b, the loss of the miR-15 family members (miR-15-5p, miR-16-5p, miR-195-5p, miR-322 (mouse homolog to human miR-424-5p), and miR-497-5p resulted in a significant up-regulation of TGFβR1 and SMAD3 mRNA, and a trend towards up-regulation of p38, TGFβR2, TGFβR3, SMAD4, SMAD7, and endoglin mRNA. [score:7]
The miR-15/107 family includes miR-15a-5p, miR-15b-5p, miR-16-5p, miR-103-3p, miR-107 (which are expressed in all vertebrates), miR-195-5p, miR-424-5p, miR-497-5p, miR-503-5p (which are expressed in mammals), and miR-646 (human specific) (Finnerty et al., 2010[53]). [score:5]
[1 to 20 of 2 sentences]
69
[+] score: 12
Notably, a group of miRNAs including miR-16 and miR-195, which belong to the miR-15/16 family involving miR-15a/b, miR-16, miR-195, miR-424 and miR-497, are downregulated in human glioblastoma cells, and their abnormal expression patterns are associated with the survival rate of GBM patients compared to non-tumorous cells (7– 9). [score:5]
For example, downregulation of miR-195 and miR-497 may strongly affect cell cycle progression and lead to an aberrant cell proliferation in hepatocellular carcinoma cell lines (25). [score:4]
Given that miR-16-1 and miR-195 played tumor-suppressor roles in human glioblastoma cells, we hypothesized that miR-503 may have a similar antitumor effect as other members of the miR-15/16 family in human glioblastoma cells (7, 8). [score:3]
[1 to 20 of 3 sentences]
70
[+] score: 12
In detail, the expression of miR-186, miR-215 and miR-223 resulted upregulated in ATRA differentiated cells, while the expression of miR-17-5p, miR-25, miR-193, miR-195, and let-7a resulted downregulated (the miRNAs bolded were already reported as deregulated by ATRA in differentiated NB4 cells in refs. [score:12]
[1 to 20 of 1 sentences]
71
[+] score: 12
miR-195 is underexpressed in integrated HPV-16 cervical cell lines compared to the normal cervix; however, its regulation mechanisms and its targets are still not known. [score:5]
miRNAs expression profiles by microarray analysis have shown that the miRNAs most highly expressed in normal cervix were miR-145, miR-26a, miR-99a, let-7a, miR-143, let-7b, let-7c, miR-125b, miR-126, and miR-195, in that order [11, 18, 30, 31]. [score:5]
In contrast, miR-1, miR-126, miR-133b, miR-143, miR-145, miR-195, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in these cell lines as compared with normal cervical tissue. [score:2]
[1 to 20 of 3 sentences]
72
[+] score: 11
Previous studies reported that miR-140 [15], miR-145 [17], miR-195 [16] and miR-9500 [2] are downregulated in NSCLC-related biospecimens. [score:4]
Wang X Wang Y Lan H Li J MiR-195 inhibits the growth and metastasis of NSCLC cells by targeting IGF1RTumour Biol. [score:4]
In particular, miR-140 [15] and miR-195 [16] decrease tumour growth and metastasis through proliferative delay or arrest by targeting IGF-1R in NSCLC. [score:3]
[1 to 20 of 3 sentences]
73
[+] score: 11
MiR-195 exerts its suppressive function by decreasing the expression of multiple NF-kappaB downstream effectors by directly targeting IKK alpha and TAB3 [57]. [score:7]
CCNE1, CDC25A, CCND3, CDK4, and BTRC have been identified as direct targets of miR-497 and miR-195, which leads to aberrant cell proliferation in hepatocarcinogenesis [24]. [score:4]
[1 to 20 of 2 sentences]
74
[+] score: 11
miR-195 inhibits glioma cell proliferation by downregulating expression of Cyclin D1 and cyclin E1, through directly targeting the 3′-UTR of Cyclin D1 and cyclin E1 [29]. [score:11]
[1 to 20 of 1 sentences]
75
[+] score: 10
In the present study, CyclinD1 was targeted by six deregulated miRNAs that regulated pathways in cancer and were reduced in expression–that is, let-7g and -7i, and miR-195, -424, -503, and -93–suggesting that this could underlie the increased levels of CyclinD1. [score:7]
In addition, all five pathways in this core module were associated with glioma [60]– [63] as well as some regulatory associations, e. g., the regulation of miR-195 to cell cycle [60]. [score:3]
[1 to 20 of 2 sentences]
76
[+] score: 10
Consistent with those data, in our study, curcumin upregulated miR-103, miR-22, and miR-23b and downregulated miR-195, miR-15b, miR-196, and miR-92. [score:7]
Based on statistical significance (p<0.05) and 2 -FC, curcumin pretreatment attenuated the H [2]O [2] -induced expression of 17 miRNAs (miR-15b, miR-17, miR-21, miR-26b, miR-27b, miR-28–3p, miR-30b, miR-30d, miR-92a, miR-125a-5p, miR-141, miR-196b,, miR-195, miR-302a, miR-302c, miR-320a, and miR-9), which were also significantly reduced by the curcumin treatment alone (Figure 4, Table 2). [score:3]
[1 to 20 of 2 sentences]
77
[+] score: 10
In our study, we did not observe differential expression for miR-195 (P = 0.169) or let-7a (P = 0.106) between cases and controls. [score:3]
They found the expression of miR-195 was significantly higher in breast cancer patients than healthy controls (P<0.001). [score:3]
They found the expression of miR-195 was significantly elevated in breast cancer patients. [score:3]
Hopefully, this will give us an opportunity to validate our findings in this study as well as test the predictive value of miR-195 and let-7a. [score:1]
[1 to 20 of 4 sentences]
78
[+] score: 10
Specifically, miR-195 regulated glioblastoma cell invasion by modulating the CCND3/p27Kip1 pathway [35] and miR-503 inhibited the G1/S transition by targeting CCND3 and E2F3 in hepatocellular carcinomas [36]. [score:6]
Zhang QQ MicroRNA-195 plays a tumor-suppressor role in human glioblastoma cells by targeting signaling pathways involved in cellular proliferation and invasionNeuro. [score:4]
[1 to 20 of 2 sentences]
79
[+] score: 10
They found that upregulation of miR-499a-5p is a common feature of all placental insufficiencies such as preeclampsia (n = 80), gestational hypertension (n = 35), and FGR (n = 35); in addition, they demonstrated an upregulation of miR-1-3p in FGR pregnancies with abnormal umbilical fetal flows (n = 19); finally, they found downregulation of a series of miRNAs (miR-16-5p, miR-26a-5p, miR-100-5p, miR-103a-3p, miR-122-5p, miR-125b-5p, miR-126-3p, miR-143-3p, miR-145-5p, miR-195-5p, miR-199a-5p, miR-221-3p, miR-342-3p, and miR-574-3p) in FGR requiring the delivery before 34 weeks of gestation. [score:10]
[1 to 20 of 1 sentences]
80
[+] score: 10
In HCC, aberrant expression of miRNAs, including miR-195, miR-214, and miR-302b suppresses tumor cell proliferation, apoptosis, and invasion by targeting downstream proteins [9– 11]. [score:7]
miR-15b, a member of the miR-16 family(miR15a/b, miR-16, miR-195, miR-424 and miR-497), which targets genes important for the G1 - S transition, is reported increased in HCC [12]. [score:3]
[1 to 20 of 2 sentences]
81
[+] score: 9
Ujifuku et al. (2010) also identified three miRNAs (miR-195, miR-455-3p, and miR-10a*) overexpressed in the induced TMZ-resistant cell line, and demonstrated that miR-195 inhibition enhanced TMZ -induced cell death. [score:5]
In fact, recent miRNA studies have revealed that aberrant miRNA expression could affect chemosensitivity, and have also identified several miRNAs (i. e., miR-21, miR-125b-2, miR-195, miR-455-3p, miR-10a) associated with TMZ resistance (Shi et al., 2010; Ujifuku et al., 2010; Zhang et al., 2012). [score:3]
miR-195, miR-455-3p and miR-10a(*) are implicated in acquired temozolomide resistance in glioblastoma multiforme cells. [score:1]
[1 to 20 of 3 sentences]
82
[+] score: 9
In this way, it may directly regulate CDKN2B (a CDK inhibitor controlling G1 progression, down-modulated) and collaborate with down- regulated miRNAs such as miR-145 and miR-195, in modulating key genes such as CDC25B, MYC and PRKDC, involved in cell cycle progression checkpoints and DNA damage response (Figure  3 and Additional file 1: Table S4). [score:6]
The other component comprises several circuits involving miR-17, miR-195 and miR-497 together with NF1 (a hypoxia-activated gene), TFAP4 (another cancer gene with prognostic importance in gastric carcinoma), MYC and HNF1A, and common target genes, which can mainly be classified as cancer genes. [score:3]
[1 to 20 of 2 sentences]
83
[+] score: 9
It is also the common candidate target of other ten significantly differentially expressed miRNAs, i. e. miR-203, miR-195-5p, miR-497-5p, miR-424-5p, miR-16, miR-15b-5p, miR-27a, miR-27b, miR-101 and miR-590-3p. [score:5]
They found that miRNA-195 might improve 5-FU sensitivity by targeting Bcl-w protein to increase cell apoptosis. [score:3]
Another group recently identified the role of miRNA-195 in developing drug resistance in HCC cell line using qRT-PCR [22]. [score:1]
[1 to 20 of 3 sentences]
84
[+] score: 9
miR-145 and miR-195 were commonly downregulated in colorectal and liver cancers whereas let-7a is commonly downregulated in gastric and colorectal cancers. [score:7]
In this regard, the direct targeting of brain-derived neurotrophic factor (BDNF) 3′UTR by miR-195, a miRNA predicted to regulate neurotrophin/NGF signaling, has been validated by other investigators by luciferase assay [49]. [score:2]
[1 to 20 of 2 sentences]
85
[+] score: 9
Although, our investigation was limited to determine the expression level of miR-497 and its predicted target, CCND1 mRNA and protein level according to several functional analyses - such as luciferase assay -based methods - carried out in different types of cancers revealed that miR-497 (and miR-195) directly targets the 3’-UTR region of cyclin D1 [67– 69]. [score:5]
“Previous studies reported that the highly conserved miR-195/497 cluster was significantly downregulated in gastric, breast, bladder, liver, and also in colorectal cancer [61– 66]. [score:4]
[1 to 20 of 2 sentences]
86
[+] score: 9
In addition to miR-15b human dermal fibroblasts also express miR-15a and miR-16-1 at high and comparable copy numbers, whereas the expression levels of miR-16-2, miR-195, and miR-497 were clearly lower (suppl. [score:5]
In this regard, miR-195 levels are elevated rather than downregulated upon replicative senescence [64]. [score:4]
[1 to 20 of 2 sentences]
87
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
MiR-206, miR-133, miR-199, miR-100 and miR-195 were implicated in the autophagy pathway targeting BCL2, MTOR and SQSTM1 as possible autophagy gene targets (Table 6). [score:5]
The analysis showed miRNAs that were related to ER stress pathway (let-7f, miR-351, miR-127, miR-133a, miR-195, miR-214 and miR-503), suggesting CASP3, CASP7, XBP1, ATF6 and ATF4 as possible target genes for these miRNAs (Table 4). [score:3]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
[1 to 20 of 3 sentences]
88
[+] score: 9
Figure 3 A. Real-time PCR showed that the expression of human miR-133b, miR-204-5p, miR-30e-5p, miR-4270, miR-129-2-3p, miR-202-3p, miR-195-5p, miR-664b-3p, miR-497-5p, miR-34b-5p, miR-513a-5p, and miR-101-3p was statistically higher in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
Real-time PCR revealed that hsa-miR-133b, hsa-miR-204-5p, hsa-miR-30e-5p, hsa-miR-4270, hsa-miR-129-2-3p, hsa-miR-202-3p, hsa-miR-195-5p, hsa-miR-664b-3p, hsa-miR-497-5p, hsa-miR-34b-5p, hsa-miR-513a-5p, and hsa-miR-101-3p were statistically upregulated in human Sertoli cells of SCOS patients compared to OA patients (Figure 3A). [score:3]
A. Real-time PCR showed that the expression of human miR-133b, miR-204-5p, miR-30e-5p, miR-4270, miR-129-2-3p, miR-202-3p, miR-195-5p, miR-664b-3p, miR-497-5p, miR-34b-5p, miR-513a-5p, and miR-101-3p was statistically higher in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
[1 to 20 of 3 sentences]
89
[+] score: 9
So we paid more attention to miR-15a, miR-15b, miR-16, miR-195, miR-424 and miR-497, which are the targeted results for CX3CL1 in the Targetscan Database. [score:5]
In order to investigate whether some micro -RNA contained in the MVs played a role, we searched CX3CL1 in the TargetScan database (version 6.2) and identified six putative micro -RNA (miR-15a, miR-15b, miR-16, miR-195, miR-424 and miR-497) targets to CX3CL1 mRNA by matching the seed regions of each. [score:3]
The real-time quantitative PCR analysis indicated that there were relatively high levels of miR-15a, miR-15b and miR-16 contained in hWJMSC-MVs, but none or low levels of miR-195, miR-424 and miR-497 (Figure  7B). [score:1]
[1 to 20 of 3 sentences]
90
[+] score: 9
In brain tissue, hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX), a common environmental contaminant, induced the over -expression of miR-206, miR-30 and miR-195, which then inhibited the expression of the target BDNF gene and contributed to neuro-toxicity and CNS disorders. [score:9]
[1 to 20 of 1 sentences]
91
[+] score: 9
SNP ID small RNA ID Type Chr P-value eQTL P-value GWAS GWAS phenotype rs8033963 hsa-miR-184 mature-miRNA 15 1.98E-06 1.01E-02 BMI rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 4.93E-02 BMI rs2440129 hsa-miR-195-3p mature-miRNA 17 2.44E-05 3.58E-02 BMI rs2053005 SNORD18A snoRNA 15 6.83E-09 4.57E-02 BMI rs16868443 hsa-miR-653 mature-miRNA 7 1.38E-04 3.70E-02 WHR(adjBMI) rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 7.89E-04 LDL rs2986039 hsa-miR-1307-3p mature-miRNA 10 6.31E-06 1.84E-02 HDL rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 1.14E-03 TC While on the whole, none of the cis-SNPs were genome-wide significant in the GWAS data, they were significantly enriched for nominally significant (p<0.05) SNPs in the BMI GWAS results ([65], binomial p = 0.007), indicating either their pleiotropic effect, or metabolic trait regulation through small RNA expression levels. [score:4]
SNP ID small RNA ID Type Chr P-value eQTL P-value GWAS GWAS phenotype rs8033963 hsa-miR-184 mature-miRNA 15 1.98E-06 1.01E-02 BMI rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 4.93E-02 BMI rs2440129 hsa-miR-195-3p mature-miRNA 17 2.44E-05 3.58E-02 BMI rs2053005 SNORD18A snoRNA 15 6.83E-09 4.57E-02 BMI rs16868443 hsa-miR-653 mature-miRNA 7 1.38E-04 3.70E-02 WHR(adjBMI) rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 7.89E-04 LDL rs2986039 hsa-miR-1307-3p mature-miRNA 10 6.31E-06 1.84E-02 HDL rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 1.14E-03 TCWhile on the whole, none of the cis-SNPs were genome-wide significant in the GWAS data, they were significantly enriched for nominally significant (p<0.05) SNPs in the BMI GWAS results ([65], binomial p = 0.007), indicating either their pleiotropic effect, or metabolic trait regulation through small RNA expression levels. [score:4]
rs2440129 was nominally significant in the BMI GWAS lookup [65], while mir-195-3p was significantly associated with both rs2440129 in cis (FDR<5%, p<2.4×10 [−5]), as well as BMI (FDR<5%, p<3.9×10 [−3]) and PTFM (FDR<5%, p<4.1×10 [−3]), suggesting a mechanism for the rs2440129 association. [score:1]
[1 to 20 of 3 sentences]
92
[+] score: 9
Both oncogenic miRNAs and tumor suppressive miRNAs have been demonstrated and described in colon carcinogenesis and progression, such as upregulated miR-135, miR-21, miR-17-92, and miR-196a, and downregulated miR-34, miR-195, and miR-365 [9]– [13]. [score:9]
[1 to 20 of 1 sentences]
93
[+] score: 9
Two miRNA (miR-195-5p and miR-16-5p) strongly upregulated GBA1 expression, while three miRNA (miR-127-5p, miR-19a-5p, and miR-1262) downregulated SCARB2, an important membrane receptor involved in Gba availability. [score:9]
[1 to 20 of 1 sentences]
94
[+] score: 8
In an in-vitro study using H-69 lung cancer cell line, Pak et al. (2014) reported upregulation of miR-16-2, miR-93, miR-95, mir-153, mir-195, miR-199a-3p, and down-regulation of miR let7a, let7i, miR-124a in the presence of excretory secretory protein of C. sinensis. [score:7]
Among the miRNAs, seven of them (miR-16-2, miR-93, miR-95, miR-136, miR-153, miR-195, and miR-199a-3p) were mainly associated with esophageal adenocarcinoma, breast cancer and colorectal carcinoma, suggesting the role of these miRs in cell-proliferation and cell-signaling. [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 8
For examples, miR-195 with higher expression level was found to reduce breast tumor cell survival and increase apoptosis by downregulating the expression of Raf-1, Bcl-2, and P-glycoprotein [22]. [score:8]
[1 to 20 of 1 sentences]
96
[+] score: 8
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
[1 to 20 of 1 sentences]
97
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
In GC, high expression of miR-195 [58], miR-199a [39, 58, 62, 63, 64, 65], miR-1952 [58], miR-335 [82, 83], miR-375 [39, 74, 86, 87, 88], miR-451 [58, 94, 95, 96] and miR-4512 [39], and low expression of miR-142-5p [39] are more likely to indicate relapse or recurrence of GC patients. [score:5]
Conversely, several tumor-suppressor miRNAs circulating in the blood of GC patients can also be used as diagnostic biomarkers to distinguish GC patients from healthy individuals, including miR-122, miR-195-5p, miR-203, miR-218, and miR-375 [155, 189, 198, 209, 210, 211]. [score:3]
[1 to 20 of 2 sentences]
98
[+] score: 8
Upregulation of miR-195-5p seems to have equivocal effects. [score:4]
Based on inspection of the volcano plots and an in silico analysis of regulated pathways with DIANA miRPath v. 2.0 [10] we chose a set of 16 miRNAs for confirmation in microdissected glomeruli from patients with only HLA-class I DSAs: miR-let-7c, miR-28-3p, miR-29b, miR-30d, miR-99b, miR-125a-5p, miR-133a, miR-138, miR-146b, miR-195, miR-374b-3p, miR-484, miR-501-3p, miR-520e, miR-625-3p, miR-885-5p (Table  1). [score:2]
0.12; 0.09; 0.16; p < 0.001), miR-195-5p (5.59; 2.48; 14.14 vs. [score:1]
Glomerular miR-let-7c-5p (a), miR-28-3p (b), miR-30d-5p (d), miR-99b-5p (e), miR-125a-5p (f) and miR-195-5p (j), miR-374b-3p (k), miR-484 (l), miR-501-3p (m), miR-520e (n) and miR-885-5p (p) were higher in DSA+ than to controls. [score:1]
[1 to 20 of 4 sentences]
99
[+] score: 8
Two further studies on circulating microRNAs in unfractionated serum samples from adrenocortical tumor patients have been reported to date 8, 9. Overexpressed circulating hsa-miR-483-5p in ACC has been confirmed in both, along with overexpressed hsa-miR-34a [9] and underexpressed hsa-miR-195 [8]. [score:7]
Soon PSH miR-195 and miR-483-5p Identified as Predictors of Poor Prognosis in Adrenocortical CancerClin. [score:1]
[1 to 20 of 2 sentences]
100
[+] score: 8
For example, miR-122 can only be detected in liver tissues and is undetectable in all other tissues [15]; the expression of miR-122 in hepatocellular carcinoma is relatively lower than it in healthy liver [16]; miR-1 and miR-143 are preferentially expressed in heart and colon tissues, respectively [15], [17]; miR-126 is an endothelial-specific miRNA that regulates vascular integrity and angiogenesis [18]; miR-195 and miR-200c are specifically expressed in lung tissues [19]. [score:8]
[1 to 20 of 1 sentences]