sort by

663 publications mentioning mmu-mir-21a (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-21a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 405
If the sustained and increased expression of miR-21 in the experimental glioma cells is caused by an up-regulation of PDGF signaling, we would expect to find a down-regulation of miR-21 upon inhibition of PDGF signaling. [score:11]
Interestingly, in normal fibroblasts the expression of miR-21 was induced by PDGF-BB, and inhibition of PDGF signaling in mouse glioma primary cultures resulted in suppression of miR-21 suggesting that miR-21 is indeed regulated by PDGF signaling. [score:8]
We therefore conclude that miR-21, directly or through an intermediate target, participates in the up-regulation of SOX2 in these cells. [score:7]
When PDGF-BB expression was inhibited by siRNA against PDGF-B we found a significant decrease in miR-21 expression as shown by qPCR (Figure 5C). [score:7]
This pattern of miR-21 expression was sustained in the newborn brain but at P7, the expression was abolished and no expression could be found in the adult brain. [score:7]
We show that miR-21 and SOX2 are co-expressed during mouse brain development and subsequently down-regulated in the adult mouse brain. [score:7]
When studying embryonic stem cells, siRNA against the DNA -binding protein REST resulted in an increased expression of miR-21 accompanied by a reduced expression of SOX2 and thereby a suppression of self-renewal [50, 51]. [score:7]
One might consider that PDGFB -induced tumor development involves activation of single or multiple signaling pathways leading to continuous expression of miR-21, followed by an increased expression of SOX2, thereby keeping the cell in a progenitor/stem cell stage which protects them from undergoing apoptosis. [score:6]
For example, PDGF-B inhibition that causes down-regulation of miR-21 (Figure 5C) is also known to differentiate PDGFB -driven mouse brain tumor cells along the oligodendrocyte lineage [33]. [score:6]
Furthermore, miR-21 and SOX2 showed up-regulation and overlapping expression pattern in RCAS/tv-a generated mouse brain tumor specimens. [score:6]
Knockdown of miR-21 with an LNA -modified siRNA or suppression of miR-21 through PDGF inhibition was accompanied by a decrease in SOX2. [score:6]
Inhibition of PDGF signaling causes down-regulation of miR-21. [score:6]
We hypothesize that the aberrant expression of miR-21 in glioma cells may exist in the normal progenitor and become re-activated when that cell is targeted for tumor development, knowing that some features of embryogenesis are recapitulated in the tumor setting. [score:6]
We identified miR-21 to be highly expressed during embryonic and newborn brain development followed by a gradual decrease until undetectable at postnatal day 7 (P7), this pattern correlated with SOX2 expression. [score:6]
The finding that miR-21 is expressed in the immature brain, but not in the adult tissue, indicates that miR-21 is of developmental importance with a controlled and restricted expression. [score:6]
Expression of SOX2 overlaps with miR-21 expression during embryogenesis. [score:5]
The extent of miR-21 expression varied between different cell lines, U251MG revealed the highest expression and U87MG and LN18 the lowest (Figure 6A). [score:5]
By using a panel of inhibitors of PDGF signaling, we could conclude that PDGF-BB and PDGFR-α signaling drives miR-21 expression in primary mouse glioma cultures. [score:5]
Inhibition of miR-21 causes a decrease in SOX2 expression. [score:5]
The reduction in miR-21 expression could be coupled to a decrease in SOX2 expression, loss of tumor-initiating ability of the cells and induction of oligodendrocyte differentiation [33]. [score:5]
However, one cannot exclude other mechanisms for tumor inhibition upon miR-21 suppression. [score:5]
By using a panel of inhibitors of PDGF-signaling, we could conclude that PDGF-BB and PDGFR-α signaling drives miR-21 expression in primary mouse glioma cultures. [score:5]
org) which suggested SOX2 to be a potential target of miR-21 as opposed to our in vivo finding of an overlapping expression pattern. [score:5]
Thus, miR-21 expression appears to be developmentally regulated and absent in adult brain tissue. [score:5]
miR-21 expression is thus indirectly or directly induced by PDGF signaling. [score:5]
Interestingly, miR-21 was indeed shown to be expressed already at embryonic day E18, displaying a sustained expression also in the newborn brain. [score:5]
Values of miR-21 were normalized to expression of miR-16 (set to 1), and the relative expression was quantified. [score:5]
Growth inhibition and apoptosis were induced by inhibition of miR-21. [score:5]
Figure 5 PDGF-BB stimulation of normal fibroblasts resulted in increased expression of miR-21 whereas inhibition of PDGF signaling in glioma cells caused a decrease of miR-21. [score:5]
However, at postnatal day 7 (P7) and onwards miR-21 expression was strongly reduced and no expression was found in the adult brain (Figure 1C, and data not shown). [score:5]
Our data show that miR-21 is expressed during normal embryogenesis and is tightly regulated in normal mouse development. [score:5]
Upon direct knockdown of miR-21 in tumor cells, addicted to miR-21 expression, apoptosis is induced [9] and Figure 7 in this paper. [score:5]
By using inhibitors for the PDGFR itself and for known targets downstream of the PDGF receptor, we could verify that miR-21 was indeed decreased (Figure 5B). [score:5]
miR-21 knockdown is followed by a decrease in SOX2 expression. [score:4]
miR-21 expression in Gtv a wild type mouse brain at different developmental stages E18 is shown in A), P1 in B) and P7 in C). [score:4]
Likewise, si-PDGF-BB treatment of a primary mouse glioma sphere culture resulted in a down-regulation of miR-21, followed by a decrease in the number of spheres, further strengthening the notion that miR-21 is indeed driven by PDGF-BB signaling in these tumor cells. [score:4]
miR-21 and to a large extent also SOX2 expression were lost in the adult brain, indicating a co-regulation. [score:4]
Knowing that SOX2 is required to maintain cellular pluripotency in the developing embryo [36], we decided to investigate the expression pattern of miR-21 during mouse brain development in relation to SOX2 expression, using Gtv-a wild type mice. [score:4]
Our findings suggest that miR-21 indirectly sustains the SOX2 expression and thereby is involved in the maintenance of the glial progenitor/stem cell phenotype. [score:4]
Figure 1 miR-21 is expressed during embryonic development. [score:4]
The expression of SOX2 as well as miR-21 was substantially decreased at P7 (Figure 2C), also indicating a co-regulation. [score:4]
In addition miR-21 has been demonstrated to be up-regulated in a majority of human cell lines and tumor tissues such as glioblastoma [9], breast cancer [10], and chronic lymphocytic leukemia [11]. [score:4]
miR-21 is expressed during brain development but is absent in adult brain. [score:4]
Coronal tissue sections of paraffin embedded normal brain from embryonic day 18 (E18), were subjected to in situ hybridization, which revealed that miR-21 was highly expressed in the hippocampus and the outer rim of the cortex (containing martinotti, pyramidal, and stellate cells) as shown in Figure 1A. [score:3]
This was further strengthened by in situ hybridization on mouse brains revealing that the expression pattern of miR-21 was specific to tumor areas and strongly overlapped with areas staining positive for SOX2. [score:3]
Suppression of miR-21 resulted in a decrease of SOX2 in glioma cell cultures derived from both Gtv-a and Ntv-a mice (Figure 4B). [score:3]
The recently published data revealing that withdrawal of miR-21 in a mouse mo del leads to complete regression of tumors [13], make miR-21 a promising therapeutic target, particularly in glioblastoma where effective treatment modalities are still lacking. [score:3]
Western blot analysis, demonstrating a decreased expression of the stem cell transcription factor SOX2, after LNA-miR-21 in p19 [Arf−/−] mouse primary glioma cultures is shown in B). [score:3]
PDGF-BB induces miR-21 expression. [score:3]
Western blot analysis showing a decreased expression of SOX2, after LNA-miR-21 in the human glioblastoma cell lines U2987MG and Cl2:6 (B), and in human glioblastoma primary culture, U3001MG (C). [score:3]
Our data propose that the embryonic expression pattern of miR-21 is maintained or re-established during initiation and progression of glioblastoma. [score:3]
A) Serial paraffin coronal sections of a Gtv-a p16 [Ink4a−/−]/p19 [Arf−/−] mouse brain showing overlapping expression of miR-21, SOX2, and OLIG2. [score:3]
We used immunohistochemical (IHC) staining and in situ hybridization to demonstrate that SOX2 and miR-21 showed overlapping expression at E18 and P1 (Figure 2A, 2B). [score:3]
All cell lines expressed miR-21 at considerably higher levels than 1064SK used as control, in accordance with previous publications [9]. [score:3]
Figure 7 Inhibition of miR-21 mediated apoptosis in both mouse and human tumor cells. [score:3]
Based on knockdown studies, it has been proposed that miR-21 acts as an oncogene exerting its effect by down -regulating crucial apoptosis-related genes [9]. [score:3]
Elevated expression of miR-21 in human glioblastoma cell lines. [score:3]
When performing IHC staining of mouse brain tumors, an almost complete overlap between SOX2 and miR-21 expression could be seen. [score:3]
IHC and in situ hybridization showing the expression pattern of SOX2 and miR-21, respectively. [score:3]
Its overlapping expression with SOX2 is further suggestive since SOX2 has been demonstrated to be involved in the proliferation and/or maintenance of neural stem cells in the developing brain [43, 44], indicating miR-21 to share these functions. [score:3]
Likewise, in a transgenic mouse mo del for conditional expression of miR-21, a complete regression of B-cell lymphoma was observed upon withdrawal of miR-21 [13]. [score:3]
miR-21 is highly expressed in mouse glioma cells and tissue. [score:3]
However, mouse gliomas show high expression of miR-21. [score:3]
Figure 6 and down regulation of SOX2 upon miR-21 knock down. [score:3]
In situ hybridization with a digoxigenin-labeled probe, showing differential expression of miR-21 in normal E18 (A), newborn (P1) (B) and P7 (C) Gtv a wild type mouse brain. [score:3]
An elevated expression of miR-21 was found in PDGFB -induced mouse glioma. [score:3]
Figure 4 and IHC, showing similar expression pattern for miR-21, SOX2, and the tumor cell marker OLIG2. [score:3]
We decided to investigate the expression of the oncogenic miR-21 during normal mouse development and glioma, focusing on PDGF signaling as a potential regulator of miR-21. [score:3]
To verify our findings on mouse glioma, we used a panel of human glioblastoma cell lines and analyzed them for miR-21 expression by. [score:3]
We have focused on miR-21 that recently was identified as differentially expressed in a high number of solid tumors when comparing to normal tissue [8]. [score:3]
Upon irreversible depletion of miR-21 the expression of SOX2 was strongly diminished in both mouse primary glioma cultures and human glioma cell lines. [score:3]
Suppression of miR-21 in human cell lines has previously been shown to result in apoptosis [9]. [score:3]
Overlapping expression pattern of miR-21 and SOX2 in mouse glioma. [score:3]
1064SK cells with low basal levels of miR-21 were subjected to PDGF-BB stimulation resulting in a strong increase in miR-21 expression (Figure 5A). [score:3]
Western blot analysis of these cell lines demonstrated a decrease in SOX2 expression upon addition of LNA-miR-21 (Figure 6B), which confirms the data obtained from the mouse glioma cell lines. [score:3]
Inhibition of PDGF signaling causes a decrease of miR-21 in a glioma cell culture and glioma initiating cells cultured as spheres, respectively. [score:3]
Furthermore, inhibition of PDGF signaling using Imatinib (Gleevec), Rapamycin and U0126, significantly reduced miR-21 levels in mouse glioma primary cultures. [score:3]
miR-21 positive cells were restricted to the tumor areas, showing no expression in the adjacent normal cells (Figure 3B and 3C). [score:3]
Figure 2 Overlapping expression of SOX2 and miR-21. [score:3]
Expression of miR-21 in mouse cell cultures and mouse brain were assessed using and in situ hybridization. [score:3]
Furthermore, we believe that miR-21 is a mediator of PDGF -driven brain tumors, which suggests miR-21 as a promising target for treatment of glioma. [score:3]
Encouraged by our previous finding of the overlapping expression pattern of miR-21 and SOX2 in the normal developing mouse brain, we performed IHC staining of mouse glioma. [score:3]
It showed that the previously observed overlap of miR-21 and SOX2 expression was even more pronounced, exhibiting a total overlap in the tumor area (Figure 3C). [score:3]
In mouse brain at E18, miR-21 was highly expressed in areas known to contain a large number of neural/glial progenitor cells, viz. [score:3]
In C) a Gtv-a p16 [Ink4a−/−]/p19 [Arf−/−] mouse brain could be seen, showing miR-21 expression specifically to the tumor area adjacent to the ventricle and the choroid plexus. [score:3]
The expression of miR-21 in PDGFB -induced mouse glioma was confined to the tumor areas as shown by in situ hybridization. [score:3]
Arrow indicates overlapping expression of SOX2 and miR-21. [score:3]
Upon siRNA -mediated knockdown of miR-21, the levels of SOX2 in both mouse glioma cell lines and human glioblastoma cell lines strongly decreased. [score:2]
Furthermore, AnnexinV-staining showed a five-fold increase in the number of apoptotic cells after repression of miR-21 by LNA-miR-21 both in an p16 [Ink4a]/p19 [Arf] double knockout mouse glioma cell culture as well as in the human glioblastoma cell line LN18 (Figure 7A). [score:2]
We decided to investigate the expression of miR-21 during normal brain development in mice. [score:2]
A) Human glioblastoma cell lines revealed a higher expression of miR-21 compared to the normal fibroblast cell line, 1064SK, as shown by. [score:2]
Our data suggest that miR-21 regulates SOX2 and is important in maintaining PDGF -driven brain tumors that constitute the large proneural subgroup of human malignant glioma [56]. [score:2]
In this paper we reveal that siRNA -mediated knockdown of miR-21 led to a significant reduction of SOX2 in both mouse and human glioma cells. [score:2]
Primary mouse glioma cell cultures were established and showed that expression levels of miR-21 varied between these cultures, although they all showed an increased level as compared to normal mouse brain (Figure 3A). [score:2]
Specific mechanisms for miR-21 regulation have been suggested in breast cancer as well as lung cancer [53, 54]. [score:2]
A) AnnexinV staining showing that both mouse and human glioma cells undergo apoptosis upon miR-21 inhibition by using LNA-miR-21 as compared to si-control. [score:2]
Cells cultured in duplicates in two individual experiments were treated with LNA-miR-21 or si-EGFP (previously described) for 48 h counting from addition of the si -RNA. [score:1]
In B) in situ hybridization of miR-21 in the tumor area of a Gtv-a p16 [Ink4a−/−]/p19 [Arf−/−] mouse brain is presented, using a digoxigenin-labeled miR-29b probe as an independent miRNA control. [score:1]
Treatment of p19 [Arf−/−] mouse glioma primary cultures with Gleevec (imatinib mesylate), Rapamycin and U0126, all significantly reduced the miR-21 levels, as shown by qPCR. [score:1]
Twenty-four hours after seeding the cells were transfected with 50 nM LNA-miR-21 and si-EGFP with Lipofectamine RNAiMAX (Invitrogen, San Diego, CA) in serum-free medium. [score:1]
LNA -modified siRNA was used for irreversible depletion of miR-21. [score:1]
Previous studies describing miR-21 as an oncogene [3] prompted us to generate experimental gliomas using the RCAS/tv-a mouse mo del system [28]. [score:1]
We next analyzed the effect of miR-21 on SOX2 in p19 [Arf−/−] mouse glioma primary cultures after repression of miR-21 using locked nucleic acid (LNA) -modified antisense miR-21. [score:1]
To investigate the involvement of miR-21 during embryogenesis we analyzed its expression pattern in the developing mouse brain, using Gtv-a wild type mice. [score:1]
Western blot analysis supported induction of apoptosis by showing that loss of miR-21 through LNA-miR-21 treatment increased the amount of cleaved and activated Caspase-3. In Figure 7B the result for a panel of primary mouse glioma cultures, the low passage human glioma cell culture (U3001MG), and two human glioblastoma cell lines (Cl2:6 and U2987MG) are presented. [score:1]
We went on investigating brain tumors and showed that miR-21 is overexpressed in glioma tissue and primary cultures established from RCAS/PDGFB -induced mouse gliomas, mimicking human high grade gliomas. [score:1]
In order to investigate the mechanism behind miR-21 expression we used a human fibroblast cell line, 1064SK. [score:1]
LNA modified antisense miR-21 (5´-TCAACATCAGTCTGATAAGCTA-3´) and antisense enhanced green fluorescence protein (EGFP) (5´-AAGGCAAGCUGACCCUGAAGU-3´) used as a negative control, were purchased from Integrated DNA Technologies. [score:1]
However, a heterogeneity could be seen with a clear boundary distinguishing cells in the ventral lateral geniculate nucleus (vLG) that are negative for SOX2, as previously described [37], but positive for mir-21. [score:1]
We also investigated the effect on miR-21 expression in glioma-derived cancer initiating cells (GICs) cultured as spheres derived from PDGFB -induced tumors in neonatal Gtv-a mice [33]. [score:1]
miR-21 could be seen in hippocampus as well as areas close to the ventricle. [score:1]
Stem-loop reverse transcription for miR-21 was performed using TaqMan® MicroRNA Reverse Transcription Kit according to manufacturers’ description (Applied Biosystems, Carlsbad, CA). [score:1]
To further investigate the expression pattern of miR-21 in vivo, coronal tissue sections from paraffin embedded tumor-bearing Gtv-a p16 [Ink4a−/−]/p19 [Arf−/−] mouse brains were subjected to in situ hybridization. [score:1]
Figure 3 Increased levels of miR-21 in mouse glioma cell lines and glioma. [score:1]
miR21 or U6 snRNA DNA oligos were labeled in the 5´ end with [γ- [32]P]ATP using T4 Polynucleotide Kinase (New England Biolabs, Ipswich, MA), purified with G-25 MicroSpin Columns (GE Healthcare) and used in the hybridization step (42°C, 16-18 h). [score:1]
miR-21 values were normalized to miR-16 and represent mean values from five independent experiments. [score:1]
Recent data from Bao et al. support such a view of miR-21 as a mediator of the cancer stem cell phenotype [52]. [score:1]
Furthermore, gain of function and loss of function of miR-21 in a transgenic mouse mo del for non-small-cell lung cancer showed that miR-21 behaved as a tumor promoter [12]. [score:1]
To investigate the interplay between miR-21 and SOX2 further we performed a target screen based on bioinformatics (http://www. [score:1]
[1 to 20 of 119 sentences]
2
[+] score: 326
Inhibition of miR-21 Expression by Resveratrol Involves AktPrevious studies have proposed that Akt is a direct regulator of miR-21 expression [36]. [score:9]
For example, increased expression of miR-21 is associated with development of resistance of glioblastoma multiforme cells to the chemotherapeutic agent, tenoposide, by downregulating a nuclear factor (NF)-κB inhibiting protein [25]. [score:9]
Furthermore, resveratrol inhibited the expression of the miR-21 target, PDCD4, in PC-3M-MM2-derived tumors from a SCID-mouse tumor mo del. [score:7]
For example, resveratrol inhibits miR-21 expression in PC-3M-MM2 cells and increase the protein levels of key targets, such as PDCD4 and maspin. [score:7]
It is possible that the direct Akt pathway is essential for regulating PDCD4 levels in DU145 and LNCaP cells, since in these cells resveratrol was unable to inhibit miR-21 expression. [score:7]
Resveratrol Regulates miR-21 Expression in PC-3M-MM2 CellsMicroarray was performed to examine miRNAs that were regulated by resveratrol, which could account for its growth inhibitory effects. [score:7]
These results support the conclusion that inhibition of Akt by resveratrol could contribute to its suppression of miR-21 expression. [score:7]
The inhibition of miR-21 expression was associated with dose -dependent increases in PDCD4 and maspin, two targets of miR-21 (Fig. 3C and D). [score:7]
Resveratrol inhibition of Akt phosphorylation contributes to its regulation of miR-21 expression and function. [score:6]
0051655.g006 Figure 6Resveratrol inhibition of Akt phosphorylation contributes to its regulation of miR-21 expression and function. [score:6]
Like resveratrol, LY294002 inhibited miR-21 expression (Fig. 6C) and increased the levels of PDCD4 (Fig. 6D) and PDCD4 luciferase activity (Fig. 6E). [score:5]
Inhibition of Prostate Cancer Growth and Metastasis by Resveratrol is Associated with Decreased miR-21 ExpressionIn order to determine the in vivo efficacy of resveratrol against prostate cancer, we tested this drug in xenograft mo del of prostate cancer in SCID mice. [score:5]
Inhibition of miR-21 Expression by Resveratrol Involves Akt. [score:5]
We show that inhibition of pAkt by LY294002 decreased miR-21 expression and increased PDCD4 levels. [score:5]
However, resveratrol significantly increased PDCD4 levels in these cells, attesting to its ability to suppress the high basal expression of miR-21. [score:5]
Inhibition of Prostate Cancer Growth and Metastasis by Resveratrol is Associated with Decreased miR-21 Expression. [score:5]
In addition, miR-21 regulates colon cancer intravasation and metastasis of colon cancer by targeting PDCD4 for down regulation [23]. [score:5]
Previous studies have proposed that Akt is a direct regulator of miR-21 expression [36]. [score:5]
Resveratrol reduces miR-21 expression and increases PDCD4 and maspin expression. [score:5]
Several pieces of evidence support the conclusion that resveratrol targets miR-21 for inhibition in PC-3M-MM2 cells. [score:5]
Further evidence supporting miR-21 as a target of resveratrol was obtained in PC-3M-MM2 cells transfected with pre-miR-21 in order to over-express this miR. [score:5]
In summary, we have identified miR-21 and Akt as novel targets of resveratrol for mediating inhibition of prostate cancer growth, survival and invasiveness. [score:5]
As such, we show that over -expression of miR-21 or inhibition of PDCD4, antagonizes the anti-tumor actions of resveratrol. [score:5]
Overall, these studies suggest that inhibition of Akt phosphorylation could serve as a reasonable mechanism for reducing miR-21 levels and increasing the expression of PDCD4. [score:5]
However, experiments performed in LNCaP and DU145 cells did not show inhibition of miR-21 expression following treatment with resveratrol (data not shown). [score:5]
In this study, we show that resveratrol reduces the viability and invasiveness of PC-3M-MM2 cells in culture and tumor growth in xenograft mouse mo del by inhibiting miR-21 expression. [score:5]
0051655.g003 Figure 3Resveratrol reduces miR-21 expression and increases PDCD4 and maspin expression. [score:5]
These assays showed that resveratrol dose -dependently reduced miR-21 expression, with ∼35% and ∼55% inhibition observed at 5 and 100 µM resveratrol, respectively (Fig. 3B). [score:4]
Previous studies have shown that resveratrol can regulate the expression of miR-21 which contributes to its cardioprotective action [34]. [score:4]
This action is mediated by inhibition of Akt, an upstream regulator of miR-21 gene. [score:4]
Resveratrol Regulates miR-21 Expression in PC-3M-MM2 Cells. [score:4]
Another potential regulator of miR-21 expression includes TGF-β. [score:4]
0051655.g008 Figure 8Resveratrol suppresses tumor growth in vivo by regulating miR-21. [score:4]
Interestingly, the resulting high expression of miR-21 is believed to promote androgen resistance, presumably by regulating a number of genes. [score:4]
We therefore examined the potential implications of down-regulation miR-21 on the actions of resveratrol in subsequent studies. [score:4]
Resveratrol suppresses tumor growth in vivo by regulating miR-21. [score:4]
Our data support the contention that Akt plays a major role in the regulation of miR-21 expression in PC-3M-MM2 prostate cancer cells. [score:4]
Up-regulation of miR-21 has been detected in a number of cancers [14], including prostate cancer [17], [18], [19], suggesting that this miRNA could serve as a biomarker for these cancers. [score:4]
High levels of TGF-β are found in prostate cancers [50], suggesting that they could serve as a positive regulator of miR-21 expression. [score:4]
Cells over -expressing miR-21 were also more resistant to the action of resveratrol to suppress invasiveness, as indicated in wound healing and invasion chamber assay (Fig. 5C–E). [score:4]
These data confirm the finding that miR-21 gene is a potential target of resveratrol in PC-3M-MM2 cells. [score:3]
Overall, these data support the contention that inhibition of the Akt/ miR21 axis could contribute the antitumor efficacy of resveratrol in prostate cancer. [score:3]
Overall, these data provide evidence that miR-21 is a viable target of resveratrol for mediating its antitumor actions. [score:3]
Recent reports have also identified bone morphogenetic protein receptor II (BMPRII) [24] and lucine rich repeat (in FLII) interacting protein 1 (LRRFIP1) [25] as targets of miR-21. [score:3]
Over -expression of pre-miR-21 renders these cells partly resistant to the PDCD4 stimulatory action of resveratrol (Fig. 5B). [score:3]
The expression of miR-21 is high in androgen-independent prostate cancer cell lines (such as PC3 and DU145) and low in LNCaP cells which are androgen -dependent prostate cancer cells [37]. [score:3]
These results suggest that pre-miR-21 is effectively processed in PC-3M-MM2 cells to functionally over-express miR-21. [score:3]
These studies link miR-21 to the pathogenesis of prostate cancer and suggest that targeting this factor or its downstream effectors could represent effective therapeutic approaches in the treatment of both androgen-sensitive and hormone refractory prostate cancer. [score:3]
It has also been shown that the transcription factor, signal tranducer and activator of transcription 3 (STAT3), could also induce miR-21 expression in memory T cells obtained from patients with Sezary syndrome [52]. [score:3]
These investigators subsequently showed that miR-21 regulated breast cancer metastasis by down regulating tumor suppressor genes, such as programmed cell death 4 (PDCD4) and maspin [21]. [score:3]
C, Akt inhibition reduced miR-21 levels as determined by microRNA array analysis. [score:3]
Overall, these data support miR-21 as an essential target of resveratrol for mediating the growth and invasiveness of PC-3M-MM2 cells in vitro. [score:3]
It is proposed that the androgen/androgen receptor complex binds to the promoter region of miR-21 and induces its expression [38]. [score:3]
A recent study also indicated that interferon increases the expression of miR-21 and reduces apoptosis of prostate cancer cells through activation of STAT3 [57]. [score:3]
Activation of the ERK1/2 MAP kinase pathway can also promote miR-21 expression, through activation of AP-1 transcription factor. [score:3]
Our data support the hypothesis that resveratrol uncouples a putative growth factor -mediated activation of Akt, leading to the induction of miR-21 expression or reductions in the levels of PDCD4. [score:3]
TGF-β has been shown to increase miR-21 expression by enhancing processing of pri-miR-21 to pre-miR by Drosha [49]. [score:3]
Using TaqMan assay, we confirmed the results of down-regulation of miR-21 by resveratrol from gene array studies. [score:3]
These actions are produced, at least in part, through the phosphorylation of Akt and/or the induction of miR-21 targeted genes, such as PDCD4. [score:3]
Analysis of tumor samples showed that the expression of miR-21 was significantly reduced by resveratrol (Fig. 8E). [score:3]
Of interest, we observed a ∼1.9 fold reduction in the expression of the oncomir, miR-21. [score:3]
The levels of IGF-1 is high in androgen-independent prostate cancer [46], suggesting that this growth factor might serve as an alternate to androgens in mediating Akt activation and high miR-21 expression in this type of prostate cancer. [score:3]
3′-untranslated mRNA sequence of PDCD4 having miR-21 binding site was cloned downstream to the luciferase gene as described previously in Zhu S et al, 2008 [21]. [score:3]
The current data demonstrate that Akt/ miR-21 axis is an important target of resveratrol for mediating survival and invasiveness of PC-3M-MM2 prostate cancer cells. [score:3]
Inhibition of miR-21 increased apopotosis of human glioblastoma cells [26], suggesting an anti-apoptotic role of this miRNA. [score:3]
Mature miR-21 expression was calculated using the 2 [-ddC] [t] method relative to U6-snRNA and expressed as fold change. [score:3]
The miR-21 promoter possesses AP-1 binding sites which could serve as targets for activated AP-1 complex produced through ERK1/2 activation [51]. [score:3]
C, Pre-miR-21 (30 nM) reversed resveratrol -induced inhibition of PC-3M-MM2 cell invasion in modified Boyden invasion chamber assay. [score:2]
For example, miR-21 regulates the growth of breast cancer cells (MCF7) in vitro and in a xenograft mouse mo del [20]. [score:2]
MiR-21 is an oncomir which plays an important role in regulating various cellular processes to enhance cancer cell growth and invasiveness. [score:2]
D, E, Wound healing assay showing reversal of resveratrol -induced inhibition of PC-3M-MM2 cell migration by pre-miR-21 (30 nM). [score:2]
Recent studies have implicated miR-21 in the development of cancer resistance. [score:2]
Overall, these studies support an integral role of miR-21/NF-κB interaction in the development of chemotherapeutic resistance in cancers. [score:2]
While the induction of PDCD4 is consistent with a decrease in miR-21 levels, it is unclear why the levels of maspin were not regulated. [score:2]
Cells transfected with pre-miR-21 (30 nM) showed increased levels of miR-21. [score:1]
Next day, appropriate amount of pre-miR-21 or PDCD4 siRNA and their negative controls were diluted in 100 µl serum-free medium and were incubated at room temperature for 15 to 20 minutes with 5 µl of Lipofectamine™ RNAiMAX transfection reagent to allow the formation of transfection complexes, which were added to the cell cultures by gently swirling the plates. [score:1]
The anti-apoptotic role of miR-21 is also attributed to induction of the antiapoptotic Bcl-2 protein [20] and possibly to the activation of nuclear factor (NF)-κB [27]. [score:1]
Synthetic pre-miR-21 (30 ng) (ID # PM10206, Ambion, Austin, TX), PDCD4 siRNA (10 ng) (siRNA ID # s223740, Ambion) and their respective negative controls were delivered into PC-3M-MM2 cells using Lipofectamine™ RNAiMAX (Life Technologies Corp. [score:1]
Exposure of these cells to IL-21 resulted in activation of STAT3 and induction of miR-21. [score:1]
Several studies have implicated miR-21 in oncogenesis. [score:1]
MiR-21 has also been shown to regulate inflammation [53]. [score:1]
Pre-miR-21 increases the levels of miR-21 and attenuates the responses of resveratrol. [score:1]
The levels of PDCD4 were significantly reduced, as anticipated from previous studies showing that miR-21 binds to the 3′ UTR region of the PDCD4 mRNA and enhances its degradation [20], [21]. [score:1]
The highest change was observed for miR-21 as indicated. [score:1]
Overall, this study highlights that Akt/miR-21 pathway is mediating the anti-tumor actions of resveratrol in prostate cancer. [score:1]
MiR-21 regulated genes include myristoylated alanine-rich protein kinase c substrate (MARCKS), PDCD4, maspin and tropomyosin-1 [14], [39]. [score:1]
Pre-miR-21 oligonucleotide, pre-miR negative control, PDCD4 siRNA and negative control siRNA were purchased from Ambion (Houston, TX). [score:1]
B, Resveratrol decreases miR-21 levels in a dose -dependent manner. [score:1]
Increases in PDCD4 were associated with elevations in PDCD4 luciferase activity (Fig. 3E), suggesting a functional role of resveratrol mediated via miR-21. [score:1]
A, Cells transfected with pre-miR-21 (30 nM) showed increased levels of miR-21. [score:1]
Pre-miR-21 is processed by an RNAse III enzyme, Dicer, to a 22 base pair double stranded RNA with a two nucleotide 3′ overhangs. [score:1]
Asterisks (*), (**) and (***) indicate statistically significant difference (p<0.05) from scramble -treated control, resveratrol+scramble pre-miR and pre-miR-21 transfected PC-3M-MM2 cells, respectively. [score:1]
B, Pre-miR-21 (30 nM) transfection decreased the levels of PDCD4 and attenuated the response of resveratrol (25 µM for 24 h), as determined by Western blotting. [score:1]
To study the effects of the PDCD4 siRNA and pre-miR-21, PC-3M-MM2 cells were transfected with PDCD4 siRNA, pre-miR-21and their respective negative controls for 24 h before seeding them on the top compartment. [score:1]
MiR-21 negatively regulates the levels of MARCKS, which is believed to control cell motility by interacting with actin cytoskeleton [39], [40]. [score:1]
0051655.g005 Figure 5 Pre-miR-21 increases the levels of miR-21 and attenuates the responses of resveratrol. [score:1]
[1 to 20 of 96 sentences]
3
[+] score: 325
Other miRNAs from this paper: mmu-mir-21b, mmu-mir-21c
Moreover, the expressions of E-cadherin and PTEN proteins in the miR-21 inhibitors group increased significantly while the expressions of N-cadherin, β-catenin, Vimentin and Slug proteins decreased remarkably compared with the blank group and the NC group, suggesting that miR-21 inhibitors might inhibit the growth and proliferation of xenograft through up -regulating E-cadherin and PTEN protein expressions and down -regulating N-cadherin, β-catenin, Vimentin, and Slug protein expressions. [score:16]
In a word, this study found that TGF-β1 can induce EMT in GC cells, and up-regulate miR-21 while down-regulate PTEN; and miR-21 expression inhibition can promote the phosophorylation of AKt and inhibit EMT through up -regulating target gene PTEN, which was further verified by an in vivo experiment using a xenograft mo del in nude mice. [score:16]
However, compared with the blank and NC groups, gene and protein expressions of N-cadherin, β-catenin, Vimentin and Slug in SGC-7901 cells in the miR-21 inhibitors group down-regulated, while up-regulations of N-cadherin, β-catenin, Vimentin and Slug expressions were observed in the in the PTEN-siRNA and miR-21 inhibitors + PTEN-siRNA groups (all P < 0.05). [score:14]
Figure 8(A– E) The E-cadherin expression in SGC-7901 cells in the blank group, negative control group, miR-21 inhibitors group, PTEN-siRNA group and miR-21 inhibitors + PTEN-siRNA group; (F– J) the E-cadherin expression in KATO-III cell in the blank group, negative control group, miR-21 inhibitors group, PTEN-siRNA group and miR-21 inhibitors + PTEN-siRNA group). [score:13]
These results suggested that miR-21 inhibitors could inhibit the growth and proliferation of xenograft through up -regulating E-cadherin and PTEN expressions and down -regulating N-cadherin, β-catenin, Vimentin, and Slug expressions (Figure 13). [score:11]
Meng et al. showed that if miR-21 was inhibited, its target gene PTEN expression would up-regulate and the growth, migration and invasion of cancer cells would decrease [14]. [score:10]
The gene and protein of p-Akt in the miR-21 inhibitors group was significantly lower than those in the blank and the NC group (all P < 0.05), while p-Akt expressions in the PTEN-siRNA and the miR-21 inhibitors + PTEN-siRNA groups were up-regulated significantly compared with the blank group and the NC group (all P < 0.05). [score:9]
After transfection of miR-21 inhibitors, the miR-21 expression of SGC-7901 and KATO-III cells in the miR-21 inhibitors group and miR-21 inhibitors + PTEN-siRNA group decreased (all P < 0.05), while no significant change was found in other three groups (all P > 0.05) (Figure 7). [score:9]
The SGC-7901 and KATO-III cells were divided into several groups: the blank group (without transfection sequence), negative control (NC) group (transfected with negative control sequence), miR-21 inhibitor group (transfected with miR-21 inhibitors), PTEN-siRNA group (transfected with PTEN siRNA) and miR-21 inhibitors + siRNA group (transfected both miR-21 inhibitors and PTEN siRNA). [score:9]
After cell transfection and TGF-β1 treatment for 48 h in SGC-7901 and KATO-III cells, gene and protein expressions of PTEN in the miR-21 inhibitors group were significantly higher than that in the blank group and the NC group (both P < 0.05), while PTEN expressions in the PTEN-siRNA and miR-21 inhibitors + PTEN-siRNA groups were lower than that in the blank and the NC groups (all P < 0.05) (Figure 10). [score:9]
The immunofluorescence staining showed that the E-cadherin expression in the miR-21 inhibitors group was apparently higher than that in the blank group and the NC group; the E-cadherin expressions in PTEN-siRNA group and miR-21 inhibitors + PTEN-siRNA group lowered significantly. [score:9]
The results of and showed that gene and protein expressions of E-cadherin in SGC-7901 cells in the miR-21 inhibitors group was higher than those in the blank and NC groups, while E-cadherin expression in the PTEN-siRNA and miR-21 inhibitors + PTEN-siRNA groups reduced significantly compared with the blank and NC groups (all P < 0.05) (Figure 9A–9C). [score:8]
Figure 5(A) The expressions of miR-21 and PTEN detected by; (B) The mRNA expressions of EMT related factors detected by; (C– D) The protein expressions of of EMT related factors detected by). [score:7]
Figure 6(A) The expressions of miR-21 and PTEN detected by; (B) the mRNA expressions of EMT related factors detected by; (C– D) The protein expressions of of EMT related factors detected by). [score:7]
Figure 13 In the present study, our results demonstrated that the expressions of miR-21, Akt and p-Akt were significantly higher in the 83 GC tissues than those in adjacent normal tissues, but the expression of PTEN was significantly lower than that in adjacent normal tissue, which indicated that the expressions of miR-21, Akt, p-Akt and PTEN were related to GC. [score:7]
In addition, tumor weight in the miR-21 inhibitors group (both GC SGC-7901 and KATO-III cell lines) was significantly lower than that in the blank group and the NC group, which indicated that miR-21 inhibitors could inhibit the growth of subcutaneous xeongraft in GC SGC-7901 and KATO-III cell lines. [score:7]
To further explore the mechanisms of PTEN involved in GC, the study used miR-21 targeted molecular technique and identified PTEN as the target gene of miR-21 through online prediction and transfection with miR-21 inhibitors. [score:7]
Furthermore, the correlation analysis demonstrated a negative correlation between miR-21 and PTEN expression level, while a positive correlation between miR-21 and Akt expression level, and between miR-21 and p-Akt expression level. [score:7]
Immunofluorescence results demonstrated that the expressions of E-cadherin and PTEN proteins in the miR-21 inhibitors group increased significantly, while the expressions of N-cadherin, β-catenin, Vimentin and Slug decreased remarkably compared with the blank group and the NC group (all P < 0.05). [score:6]
After TGF-β1 treatment, the miR-21 expression was remarkably higher than that in the BSA control group, while PTEN mRNA expression was significantly reduced in both SGC-7901 and KATO-III cells (all P < 0.05) (Figures 5A and 6A). [score:5]
The mRNA and protein expressions level of EMT related factors in SGC-7901 and KATO-III cells after induced by TGF-β1 for 48 h (BL, blank group; NC, negative control group; IN, miR-21 inhibitors group. [score:5]
The scratch test showed that miR-21 inhibitors significantly inhibit cell migration and invasion in GC cell lines Figure 11(A) scratch test of SGC-7901 cells in each group; (B) scratch test of KATO-III cells in each group). [score:5]
Target Scan was used to ensure the target site of PTEN combining with miR-21 and the 3′-UTR sequence of PTEN mRNA combining with miR-21, which were shown in Figure 3A. [score:5]
Previous studies have demonstrated that the target genes of miR-21 including phosphatase and tensin homolog detected on chromosome 10 (PTEN), Bcl-2, TPM1 and PDCD4 which are cancer suppressed genes [10– 13]. [score:5]
Previous studies have shown that miR-21 regulates PTEN by interacting with its target gene 3′-UTR and participates in the process of cancer occurrence and development [14– 15]. [score:5]
The scratch test showed that miR-21 inhibitors significantly inhibit cell migration and invasion in GC cell lines Figure 11(A) scratch test of SGC-7901 cells in each group; (B) scratch test of KATO-III cells in each group). [score:5]
Therefore, we may conclude that miR-21 could promote TGF-β1 -induced EMT in GC cells through up -regulating PTEN expression. [score:4]
After TGF-β1 treatment, both SGC-7901 and KATO-III cells in the miR-21 inhibitors group had cobblestone-like morphology and were conjunct with each other closely (Figure 8); the cells in the PTEN-siRNA group and miR-21 inhibitors + PTEN-siRNA group had long ectomesenchymal spindle shape, were dispersed and had migration synapse which were more obvious compared with the blank group and the NC group. [score:4]
The results demonstrated that compared with the blank group and the NC group, wound healing rate in the miR-21 inhibitors group decreased significantly, while in the PTEN-siRNA group and the miR-21 inhibitors + PTEN-siRNA group increased evidently. [score:4]
Targeting regulatory relation between miR-21 and PTEN. [score:4]
After cell transfection and TGF-β1 treatment for 48 h in SGC-7901 and KATO-III cells, compared with the blank group and the NC group, cell migration and invasion in the miR-21 inhibitors group decreased significantly (all P < 0.05), while in the PTEN-siRNA and miR-21 inhibitors + PTEN-siRNA group increased evidently (all P < 0.05). [score:4]
The results showed that tumor weight of mice in the miR-21 inhibitors group was significantly lower than that in the blank group and the NC group (all P < 0.05) (Figure 12B). [score:3]
Expressions of miR-21, PTEN, Akt and p-Akt in gastric cancer and adjacent normal tissues. [score:3]
As shown in Table 3, the expressions of miR-21 and PTEN showed significant associations with lymph node metastasis, differentiation grade and TNM stage of GC patients (all P < 0.05). [score:3]
After tumorigenesis, tumors in the blank group and the NC group grew rapidly and tumor volume was obviously larger than that in the miR-21 inhibitors group (P < 0.05) (Figure 12A). [score:3]
However, both miR-21 and PTEN expressions exhibited no associations with age and gender of GC patients (both P > 0.05). [score:3]
Effects of miR-21 on the expressions of EMT related factors and PTEN of xenograft in nude mice. [score:3]
miR-21 and PTEN expressions in gastric cancer patients. [score:3]
miR-21 inhibited TGF-β1 -induced EMT in GC. [score:3]
The influences of TGF-β1 treatment on the expressions of miR-21, PTEN and EMT related factors in SGC-7901 cells. [score:3]
All these indicated that miR-21 could regulate the occurrence of GC though down -regulating PTEN. [score:3]
Figure 1(A) The expression of miR-21 in GC tissue and adjacent normal tissue detected by. [score:3]
In current study, we aim to investigate the role of miR-21 and its target gene PTEN in TGF-β1 -induced EMT in GC and to search for new molecular therapy targets for GC. [score:3]
Nude mice in the blank and NC groups inoculated with SGC-7901 cells presented tumorigenesis after about 10 days, while mice in the miR-21 inhibitors group showed tumorigenesis 12 days after inoculation or even later, with tumors growing slowly. [score:3]
The expressions of miR-21 and PTEN in GC tissue were higher than those in adjacent normal tissue (4.25 ± 1.09 vs. [score:3]
The internal reference of miR-21 was U6 and that of other target genes was β-actin. [score:3]
The expressions of miR-21, PTEN, Akt and p-Akt in GC tissue and adjacent normal tissue. [score:3]
PTEN is the target gene of miR-21. [score:3]
The miR-21 expression in SGC-7901 and KATO-III cells after cell transfection. [score:3]
After PTEN-3′-UTR-MT group was transfected with miR-21 inhibitors, the comparison of relative activity of luciferase between PTEN-3′-UTR-MT and PTEN-3′-UTR-MT+NC groups showed no statistical difference (P > 0.05) (Figure 3B). [score:3]
The 36 nude mice were divided into three groups with 6 mice in each group: the blank group, NC group, and miR-21 inhibitors group. [score:3]
The influences of TGF-β1 treatment on the expressions of miR-21, PTEN and EMT related factors in KATO-III cells. [score:3]
Figure 13 The expressions of miR-21 and PTEN in GC tissue were higher than those in adjacent normal tissue (4.25 ± 1.09 vs. [score:3]
TGF-β1 induced EMT in GC and altered the expressions of miR-21 and PTEN. [score:3]
These results demonstrated that PTEN was the target gene of miR-21. [score:3]
Figure 3(A) miR-21 combined with PTEN 3′UTR; (B) the activity assay of dual luciferase reporter gene, activity assay of luciferase correlated with miR-21 inhibitors and PTEN 3′UTR WT/MT in gastric cancer cells, miR-21inhibited the luciferase activity of WT plasmid but it had no influence on that of MT plasmid). [score:3]
MiR-21 is highly expressed in multiple cancers, such as epithelial cell cancer, connective tissue cancer, hematopoietic cell cancer, reproductive cell cancer and nerve cell cancer [9]. [score:2]
In PTEN-3′-UTR-WT transfection group, after transfected with miR-21 inhibitors, the relative activity of luciferase significantly increased compared with the NC groups (PTEN-3′-UTR-WT+NC group and PTEN-3′-UTR-MT group) (all P < 0.05) (Figure 3B). [score:2]
The quantitative real-time polymerase chain reaction (qTR-PCR) assay was performed to detect the expression of miR-21 in tissues. [score:2]
The natural PTEN 3′UTR sequence was PTEN-3′-UTR-WT, and the mutation sequence of PTEN 3′UTR without miR-21 binding site was PTEN-3′-UTR-MT (as shown in Table 2). [score:2]
The seed sequence of miR-21 matched the 3′UTR of PTEN gene. [score:1]
The correlation analysis demonstrated that there was a negative correlation between miR-21 and PTEN in GC (r = −0.865, P < 0.01), while positive correlations were found between miR-21 and Akt/ p-Akt in GC (Akt: r = 0.747, P < 0.001; pAkt: r = 0.804, P < 0.01). [score:1]
After miR-21 in keratinocytes was cleaned away, PTEN would rise [18]. [score:1]
Moreover, we conducted a xenograft tumor experiment in nude mice, with cell migration detected by scratch test, tumorigenesis and growth of xenograft observed, and effect of miR-21 on EMT related transcription factors in subcutaneous xenograft in nude mice analyzed. [score:1]
Half of the specimens were used for measurement of miR-21 expression and the other half were fixed by 10% formalin and embedded in paraffin for immunohistochemistry. [score:1]
In the mo del of TGF-β1 -mediated EMT in GC, the study found that miR-21 promoted phosphorylation of Akt through dropping PTEN which promote the EMT in GC induced by TGF-β1. [score:1]
[1 to 20 of 66 sentences]
4
[+] score: 325
However, enforced expression of miR-30c, and not of miR-21, decreased target mRNA levels (Supplementary Figures  S4a-c) indicating that miR-30c regulates BID, NF1, RASA1, and RASSF8 at the transcriptional level while miR-21 halts RASA1 and RASSF8 protein expression. [score:8]
Fig. 7 KRAS, through the transcription factor ELK1, activates miR-30c and miR-21, which in turn, by downregulating NF1, RASA1, RASSF8, and BID, regulates KRAS, NF-kB, and the intrinsic apoptotic pathways, inducing lung tumorigenesis and inhibiting apoptosis in NSCLC. [score:7]
MiR-30c and miR-21 are released into the bloodstream and could be potential biomarkers for early NSCLC detection KRAS, through the transcription factor ELK1, activates miR-30c and miR-21, which in turn, by downregulating NF1, RASA1, RASSF8, and BID, regulates KRAS, NF-kB, and the intrinsic apoptotic pathways, inducing lung tumorigenesis and inhibiting apoptosis in NSCLC. [score:7]
MiR-30c and miR-21 enhanced cell proliferation and migration/invasion and inhibited apoptosis by targeting important tumor suppressor genes, inducing the activation of KRAS downstream pathways. [score:7]
Overexpression of miR-30c and miR-21 led to a significant downregulation of BID, NF1, RASSF8, and RASA1 endogenous levels as assessed by western blot and immunofluorescence (Fig.   2d–f). [score:6]
Importantly, silencing of RASA1, NF1, and RASSF8 increased the expression of two mesenchymal markers, AP4 and SNAIL, confirming that miR-30c and miR-21 regulate EMT through these target genes (Supplementary Figures  S7g, h). [score:6]
Overexpression of KRAS [WT] or KRAS [G12D] induced a significant upregulation of miR-30c and miR-21. [score:6]
e, f (IF) showing downregulation of miR-30c and miR-21 target genes in H1299 cells. [score:6]
This work defines that miR-30c and miR-21 are specifically activated by KRAS and play an important role in lung cancer development and chemoresistance by targeting crucial tumor suppressor genes (Fig.   7). [score:6]
miR-30c and miR-21 fostered proliferation and reduced response to cisplatin by targeting BID and RASA1 41, 42 while promoted invasive capabilities and EMT of NSCLC cells through RASA1, NF1, and RASSF8 downregulation. [score:6]
Overexpression of miR-30c and miR-21 resulted in the upregulation of RAS endogenous levels and augmented ERK1/2 and AKT phosphorylation in H1299 cells (Fig.   3a). [score:6]
We focused on the top modulated and highly expressed microRNAs and found that miR-30c directly silenced NF1, BID, RASSF8, and RASA1, whereas miR-21 inhibited RASSF8 and RASA1. [score:6]
Taken together, our findings suggest that miR-30c and miR-21 are upregulated in NSCLC in the early stage of NSCLC development and released into the bloodstream. [score:5]
Kaplan–Meier Plotter software was used to analyze and generate survival time data relative to high or low expression of miR-30c and miR-21 target genes [30]. [score:5]
Downregulation of SNAIL and several other mesenchymal markers was identified after miR-30c and miR-21 knockdown (Supplementary Figure  S7e, f), therefore miR-21 and miR-30c are involved in the control of the epithelial–mesenchymal transition (EMT) in lung cancer. [score:5]
Bars indicate mean ± SD (n = 3) and the P values were addressed by two-tailed Student’s t test (* P < 0.05, ** P < 0.001) Kaplan–Meier analysis based on the average expression of miR-30c and miR-21 target genes was performed to predict the risk for NSCLC patients using Kmplot database [30]. [score:5]
Subsequently, we analyzed the expression of miR-30c and miR-21 in vivo in a mouse mo del of lung cancer (Kras [LSL-G12D]) that involves activation of an oncogenic Kras allele (Kras [G12D]) following intranasal administration of plaque-forming units of a recombinant adenovirus -expressing Cre recombinase (AdenoCre) [31]. [score:5]
Furthermore, NRAS knockdown alone did not have any effect on miR-30c and miR-21 levels in H1299 cells whereas simultaneous silencing of NRAS and overexpression of KRAS [G12D] did increase their levels, suggesting that the regulation of these microRNAs is exclusively KRAS dependent (Supplementary Figure  S1i). [score:5]
ELK1 silencing (Fig.   5b) or treatment with the MEK inhibitor Trametinib decreased miR-30c and miR-21 expression levels in two different NSCLC cell lines (Fig.   5c; Supplementary Figure  7i). [score:5]
Next, we determined the effect of miR-30c and miR-21 overexpression or corresponding target genes silencing on migratory and invasive capabilities of NSCLC cells. [score:5]
In addition, we showed that ELK1, a transcription factor downstream of KRAS, directly regulated the expression of miR-30c and miR-21 by binding to the miRNA proximal promoter regions. [score:5]
e MiR-30c and miR-21 knockdown increases RASSF8 and IKB-α endogenous level f– g NF-kBp65 nuclear localization after miR-30c and miR-21 enforced expression. [score:4]
Accordingly, same results were obtained after miR-30c and miR-21 enforced expression, as a consequence of RASSF8 knockdown (Fig.   3d) whereas anti-miR-30c and anti-miR-21 increased RASSF8 and IκB-α protein levels (Fig.   3e). [score:4]
We previously reported that miR-30c and miR-21 are regulated by the epidermal growth factor receptor and induce resistance to tyrosine kinase inhibitors [33]. [score:4]
MiR-30c and miR-21 directly silence several tumor suppressor genes. [score:4]
d MiR-30c and miR-21 activate NF-κB p65 by silencing IKB-α through RASSF8 downregulation. [score:4]
Upregulation of miR-30c and miR-21 was also detected in a normal immortalized KRAS [G12V] inducible human cell line derived from alveolar epithelia 18, 19 and in a pancreatic KRAS inducible mouse cell line after treatment with doxycycline (Fig.   1f; Supplementary Figure  S1e) [20]. [score:4]
miR-30c and miR-21 expression was analyzed in plasma from a peripheral vein (P) (taken before the operation) and in plasma from the pulmonary vein directly draining a cancer-bearing lobe (C) (taken during surgery) (Supplementary Figure  9Se). [score:4]
In summary, these findings indicate that miR-30c and miR-21 not only activate KRAS signaling through the silencing of NF1 and RASA1 but also activate NF-κB signaling via RASSF8 downregulation. [score:4]
b, c ELK1 knockdown reduced miR-30c and miR-21 expression in A549 and Calu-1 cells. [score:4]
e, f MiR-30c (44 normal samples, 150 lung adenocarcinoma KRAS [WT], and 5 lung adenocarcinoma KRAS [G12D]) and miR-21 (46 normal samples, 155 lung adenocarcinoma KRAS [WT], and 5 lung adenocarcinoma KRAS [G12D]) expression in tumors expressing KRAS [WT] and KRAS [G12D] compared to normal samples from the TCGA data set LUAD. [score:4]
MiR-30c and miR-21 expression and modulation in vivo. [score:3]
In NSCLC specimens, miR-30c and miR-21 positively correlated with KRAS [WT] or KRAS [G12D] and ELK1 expression. [score:3]
Importantly, miR-30c and miR-21 were upregulated in a large cohort of NSCLC samples compared to the normal counterparts and in the lungs from a KRAS mouse mo del, therefore these two miRNAs are KRAS-modulated oncogenes also in vivo. [score:3]
Further, we checked the expression of miR-30c and miR-21 in 21 adenocarcinomas and corresponding normal counterpart. [score:3]
Notably, miR-30c and miR-21 were found highly expressed in matched normal/tumor samples and in the blood of patients that underwent surgical resection of early NSCLC, indicating that they may be useful biomarkers for lung cancer early detection. [score:3]
d Enforced miR-30c and miR-21 expression decreased BID, NF1, RASSF8 and RASA1 endogenous levels in H1299 cells. [score:3]
Seven weeks after infection with AdenoCre, mice were killed and expression of miR-30c and miR-21 was analyzed in the lungs of these mice and in the lungs of mice that were infected with GFP adenovirus as control. [score:3]
Scale bar 200 μm a Activation of AKT and ERKs pathways after miR-30c and miR-21 enforced expression in H1299 cells. [score:3]
g MiR-30c and miR-21 are significantly upregulated in tumors from KRAS [G12D] mice compared to control mice. [score:3]
Scale bar 200 μm It is known that KRAS plays an important role in cell proliferation, apoptosis, and drug resistance [2] Ectopic expression of miR-30c and miR-21 significantly promoted cell growth of KRAS wild-type H1299 cells and reduced the response to cisplatin of H292 cisplatin-sensitive cells (Fig.   4a; Supplementary Figure  S5a). [score:3]
Therefore, we checked whether enforced expression of miR-30c and miR-21 could affect NF-κB signaling. [score:3]
Fig. 6 a MiR-30c and miR-21 upregulation in tumor samples compared to normal lung (tumor samples n = 21; normal lung n = 21). [score:3]
f Overexpression of miR-30c or miR-21 in H1299 cells induced an increase in the S phase of the cell cycle. [score:3]
Fig. 3 a Activation of AKT and ERKs pathways after miR-30c and miR-21 enforced expression in H1299 cells. [score:3]
In line with these findings, transient transfection of both BID and RASA1 sensitized A549 cells to cisplatin (Fig.   4d), suggesting that miR-30c and miR-21 exert their proliferative and oncogenic role by repressing these tumor suppressor genes. [score:3]
Furthermore, miR-30c and miR-21 were found upregulated in KRAS [WT] (miR-30c, sample n = 150; miR-21, sample n = 155) and KRAS [G12D] mutant lung adenocarcinoma (miR-30c, sample n = 5; miR-21, sample n = 5) compared to normal lung (miR-30c, sample n = 44; miR-21 sample n = 46) (Fig.   6e,f). [score:3]
l MiR-30c and miR-21 expression levels in plasma from KRAS [G12D] mice treated with anti-miR-ctr or anti-miR-21. [score:3]
ELK1 knockdown reduced miR-30c and miR-21 promoter activity (Fig.   5e,f) whereas deletion of the binding sites by site direct mutagenesis rescued this effect (Fig.   5d–f). [score:3]
Forced expression of mutant NRAS in different cell lines revealed that NRAS does not increase ERKs phosphorylation, fundamental for ELK1 and accordingly miR-30c and miR-21 activation. [score:3]
MiR-30c and miR-21 enforced expression promoted migration and invasion in H1299 cells (Supplementary Figure  S7a). [score:3]
Bars indicate mean ± SD (n = 3) and the P values were addressed by two-tailed Student’s t test (* P < 0.05, ** P < 0.001) a MiR-30c and miR-21 upregulation in tumor samples compared to normal lung (tumor samples n = 21; normal lung n = 21). [score:3]
Analysis was performed on the available samples expressing miR-30c (normal lung samples n = 44, lung adenocarcinoma KRAS WT samples n = 150 and lung adenocarcinoma KRAS G12D samples n = 5) or miR-21 (normal lung samples n = 46, lung adenocarcinoma KRAS WT samples n = 155 and lung adenocarcinoma KRAS G12D samples n = 5) using GraphPad Prism package (GraphPad Software Inc). [score:3]
From a therapeutic perspective, our findings indicate that miR-30c and miR-21 inhibition halts lung tumorigenesis in vitro and in vivo by switching off simultaneously KRAS effector signalings such as PI3K/AKT, ERKs, and the NF-κB pathways and that these microRNAs could be potential biomarkers for NSCLC early detection and to stratify KRAS -driven NSCLC. [score:3]
Overexpression of KRAS [G12C] also increased miR-30c and miR-21 in H1299 and A549 cells (Supplementary Figure  S1f). [score:3]
H1299 cells harbor a mutation in NRAS, therefore to exclude a role for NRAS in miR-30c and miR-21 regulation, Calu-6 and A549 (NRAS wild type) cells were transfected with a mutant NRAS plasmid (NRAS Q61K). [score:3]
MiR-30c and miR-21 target genes. [score:3]
Further, we conducted an in silico study using four different algorithms to predict miR-30c and miR-21 putative mRNA targets (Fig.   2a). [score:3]
Conversely, miR-30c or miR-21 silencing (Supplementary Figure  S5b) inhibited cell proliferation in KRAS mutant A549 cells and reduced cisplatin resistance (Supplementary Figure  S5c-d). [score:3]
DIANA miRPath v3.0 software was employed to analyze miR-30c and miR-21-related signaling pathways and number of target genes based on TarBase v7.0 data set [57]. [score:3]
MiR-30c and miR-21 levels were also upregulated in the blood from KRAS [LSL-G12D] mice treated with anti-miR-ctrl compared to mice treated with anti-miR-21 (Fig.   6l). [score:3]
Finally, we analyzed miR-30c and miR-21 expression in a unique set of plasma samples obtained from patients undergoing surgical resection of early stage NSCLC. [score:3]
ELK1 directly binds to miR-30c and miR-21 proximal promoter regions. [score:2]
Furthermore, miR-30c and miR-21 knockdown induced apoptosis and this effect was significantly higher after cisplatin treatment (Fig.   4e). [score:2]
MiR-30c and miR-21, as well KRAS and ELK1 expression, was significantly elevated in tumors compared to normal lung samples (Fig.   6a and Supplementary Figure  S9a). [score:2]
Consequently, we selected the top most upregulated microRNAs (miR-30 family and miR-21) for further characterization. [score:2]
As shown in Fig.   6j,k, miR-30c and miR-21 expression levels were significantly higher in C compared to P and in the matched tumor/normal tissue of the same patients (Fig.   6j,k; Supplementary Figures  S9f, g). [score:2]
We also examined the response to pemetrexed alone or as platinum doublet, frequently used as first line chemotherapy in patients with advanced NSCLC [27] after miR-30c and/or miR-21 knockdown. [score:2]
g ChIP showing a direct interaction between ELK1 and miR-30c and miR-21 promoter regions. [score:2]
Fig. 4 a Enforced expression of miR-30c and miR-21 promoted cell growth compared to control cells. [score:2]
Co-transfection of these constructs along with miR-30c or miR-21 induced a significant reduction of the luciferase activity that was rescued when the miRNA -binding site was deleted by site direct mutagenesis (Fig.   2b,c and Supplementary Figure  S3b). [score:2]
e MiR-30c and miR-21 expression in KRAS [WT] and KRAS [G12D] compared to control cells. [score:2]
miR-30c and miR-21 regulate KRAS and NF-κB signaling. [score:2]
Bars indicate mean ± SD (n = 3) and the P values were addressed by two-tailed Student’s t test (* P < 0.05, ** P < 0.001) a Enforced expression of miR-30c and miR-21 promoted cell growth compared to control cells. [score:2]
In summary, miR-30c and miR-21 induce cisplatin resistance by silencing BID and RASA1 and increase the proliferation rate of NSCLC cells by regulating cell cycle progression. [score:2]
Bars indicate mean ± SD (n = 3) and the P values were addressed by two-tailed Student’s t test (* P < 0.05, ** P < 0.001) Since miR-30c and miR-21 silenced important KRAS regulators we tested whether these miRNAs had an effect on KRAS activation. [score:2]
MiR-30c and miR-21 were predicted to be involved in the regulation of oncogenic signaling downstream of KRAS such as PI3K/AKT and MAPK. [score:2]
Lungs from mice treated with anti-miR-21 presented a normal alveolar texture with normal bronchiolar structures and no or minimal signs of fibrosis/flogosis (a). [score:1]
MiR-30c and not miR-21 silencing increased the response to pemetrexed. [score:1]
H1299 cells were transfected with miR-30c, miR-21, or NF1, RASSF8 and RASA1 siRNAs for 48 h using Lipofectamine 2000 (Invitrogen). [score:1]
Using PROMO 8.3 algorithm we found three different putative ELK1 -binding sites in miR-30c and two ELK1 -binding sites in miR-21 promoter (Fig.   5a) [29]. [score:1]
Furthermore, forced increase of miR-30c and miR-21 resulted in the accumulation of NF-κB p65 in the nucleus, as assessed by immunofluorescence and immunoblot (Fig.   3f,g). [score:1]
Kras [LSL-G12D] mice received systemically LNA-anti-miR-21 once per week for 7 weeks and two doses of cisplatin intraperitoneally for all the length of the experiment. [score:1]
MiR-30c and miR-21 are released into the bloodstream and could be potential biomarkers for early NSCLC detection All cell lines used in this study were purchased from ATCC or identification was performed on established lines using PowerPlex® 21 System (Promega). [score:1]
Since we have previously shown the therapeutic potential of miR-30c [33], we tested whether modulation of miR-21 could have an effect on lung tumorigenesis in vivo. [score:1]
Computational tools identified potential binding sites for miR-30c and miR-21 in the 3′UTRs of neurofibromin 1 (NF1), BH3-interacting domain death agonist (BID), Ras association domain-containing protein 8 (RASSF8), Ras p21 GTPase-activating protein 1 (RASA1) mRNAs (Supplementary Figure  S3a). [score:1]
j, k qPCR showing miR-30c and miR-21 levels in plasma samples obtained from patients undergoing surgical resection of NSCLC. [score:1]
MiR-30c and miR-21 activate AKT, ERKs, and NF-κB signaling. [score:1]
MiR-30c and miR-21 promote tumorigenesis in vivo. [score:1]
Combination of anti-miR-30c and anti-miR-21 had a synergic effect in the response to cisplatin in both KRAS mutant and wild-type cells (Fig.   4b,c). [score:1]
Five weeks after adenoCRE administration mice in group 2 were treated with anti-miR-ctrl and mice in group 3 with anti-miR-21 once per week for 7 weeks plus two doses of cisplatin intraperitoneally (i. p. ). [score:1]
Bars indicate mean ± SD (n = 3) and the P values were addressed by two-tailed Student’s t test (* P < 0.05, ** P < 0.001) a Schematic representation of ELK1 -binding sites in miR-30c and miR-21 promoters. [score:1]
d Pearson correlation between Elk1 and miR-21 in 160 (155 KRAS [WT] and 5 KRAS [G12D]) adenocarcinoma samples. [score:1]
Cells cultured on coverslips were transfected with miR-30c, miR-21 or control miR for 48 h and then fixed with 4% paraformaldehyde for 15 min, permeabilized in 0.2% Triton X-100 /PBS for 20 min, and incubated in primary antibodies for 1 h. Cells were stained with DAPI (ThermoFisher Scientific) and imaged using confocal microscope (Leica). [score:1]
Therefore, the combination miR-21/30c could be exploited as potential biomarker for early detection of lung cancer. [score:1]
h Representative pictures of the effect of LNA-anti-miR-21 (a– c) and LNA-anti-miRNA control (d– f) treatment 12 weeks post adenoCRE inhalation in KRAS [G12D] transgenic mice. [score:1]
b after cisplatin, pemetrexed or combination cisplatin/pemetrexed, and miR-30c and/or miR-21 silencing in KRAS mutant A549 cells. [score:1]
These results indicate that KRAS transactivates miR-30c and miR-21 through the downstream activation and recruitment of ELK1 to the miRNAs’ proximal promoters. [score:1]
i KI67 in lungs from mice treated with anti-miR-ctr and anti-miR-21. [score:1]
Fig. 5 a Schematic representation of ELK1 -binding sites in miR-30c and miR-21 promoters. [score:1]
Our experiments also pointed out that miR-30c and miR-21 are exclusively modulated by KRAS and not NRAS as they might perform distinct functions during transformation [45]. [score:1]
A total of 8.4 × 10 [4] cells were seeded in 12-well plate and transfected with miRNA control or miR-30c and miR-21 for 12, 24 or 48 h. Cells were counted using Count II FL (Life Technologies) at different time points. [score:1]
MiR-30c and miR-21 increase proliferation, invasion, and chemoresistance in NSCLC cell lines. [score:1]
A significant positive correlation between miR-30c and KRAS or ELK1 was observed in the 21 lung tumor samples (P = 0.0229 and P = 0.0011, respectively) (Fig.   6b,c) and between miR-21 and ELK1 in 160 adenocarcinoma samples from the TCGA (LUAD data set) (Fig.   6d). [score:1]
Primers used to amplify 3′ UTRs of miR-30c and miR-21 target genes or delete the microRNA -binding sites and primers used to amplify miR-30c and miR-21 promoter regions are reported in Supplementary Tables  S2 and S3, respectively. [score:1]
To determine whether an alteration in cell cycle progression was responsible for the promotion of cell proliferation by miR-30c and miR-21, we performed flow cytometry analysis. [score:1]
Cells were grown on coverslips in six-well plates and transfected with anti-miR-ctrl, anti-miR-30c, or anti-miR-21. [score:1]
Systemic delivery of LNA-anti-miR-21 combined with only two doses of cisplatin over 7 weeks in these mice completely abolished the onset of lung adenomas and hyperplasia, denoting that miR-21 plays a major role in KRAS -mediated lung tumorigenesis. [score:1]
3′UTRs of NF1, RASA1, BID, and RASSF8 containing miR-30c- or miR-21 -binding sites were PCR amplified and inserted into the pGL3 control vector (Promega). [score:1]
f Increased levels of miR-30c and miR-21 in Type II pneumocytes after KRAS [G12V] induction. [score:1]
To verify whether ELK1 was the transcription factor involved in miR-21 and miR-30c activation, two miR-30c promoter regions containing one and two ELK1 -binding sites, respectively, and one region containing two ELK1 -binding sites spanning miR-21 promoter, were cloned in a promoterless reporter vector (Fig.   5d). [score:1]
MiR-30c and miR-21 promote cell proliferation and increase drug resistance. [score:1]
c Effect of miR-30c and miR-21 silencing on cell proliferation in H1299 cells. [score:1]
Promoter regions of miR-30c and miR-21 containing ELK1 putative -binding sites were PCR amplified and inserted into the promoterless pGL3 basic vector (Promega). [score:1]
Highlighted with different colors are miR-30c family members and miR-21. [score:1]
ELK1 transcriptionally activates miR-30c and miR-21. [score:1]
Bars indicate mean ± SD (n = 3) and the P values were addressed by two-tailed Student’s t test (* P < 0.05, ** P < 0.001) We used the online tool DIANA miRPath to identify miR-30c-modulated and miR-21-modulated pathways (Supplementary Figures  S2a, b and Supplementary Table  S1). [score:1]
[1 to 20 of 117 sentences]
5
[+] score: 323
In this study, we found that miR-21a-5p expression in N2a cells was up-regulated after PHEV infection and increased up to 2.5-fold at 60 h. The expression of miR-21a-5p was also up-regulated in PHEV-infected mice and increased to 3.35-fold at 5 days. [score:11]
To test whether miR-21a-5p directly regulates the expression of Caskin1 in the process of the PHEV infection, we prepared a Dual-Luciferase miRNA Target Expression Vector by binding the 3′-UTR of mouse Caskin1 which containing an exact match to miR-21a-5p target sequence (Caskin1-WT-UTR) (Figure 2G). [score:11]
In addition, the up-regulation of miR-21a-5p expression promotes viral proliferation, and the knock-down of the expression of miR-21a-5p reduces viral proliferation, suggesting that miR-21a-5p affects PHEV proliferation. [score:9]
We also created a Dual-luciferase miRNA Target Expression Vector by binding the 3′-UTR of mouse Caskin1 which containing a mismatched version of miR-21a-5p target side (Caskin1-MUT-UTR) (Figure 2G) as control. [score:7]
The results were similar to those in vitro, it has a negative relationship between the expression patterns of miR-21a-5p and its target Caskin1 in the brain tissues from the PHEV-infected mice, and the higher expression of miR-21a-5p was associated with a low-level of Caskin1 (Figures 4C–E). [score:7]
Further study showed that miR-21 protects against myocardial apoptosis by specifically inhibiting the expression of its target programmed cell death 4 (PDCD4). [score:7]
Time dynamics research to the expression of miR-21a-5p and its target gene Caskin1 showed that an inverse relationship with respect to each other’s expression until the 24 h time point. [score:7]
miR-21a-5p Directly Regulates Caskin1 Expression by Targeting the 3′-UTR of Caskin1. [score:7]
Inhibition the expression of miR-21a-5p caused the enhanced expression of Caskin1 mRNA and protein (Figures 2E,F). [score:7]
FIGURE 2 miR-21a-5p directly regulates Caskin1 expression by targeting the 3′-UTR of Caskin1. [score:7]
To figure out the efficacy of the miR-21a-5p mimics and the inhibitor, the N2a cells were transfected with the miR-21a-5p inhibitor or the miR-21a-5p mimics for 24 h, and the expression level of miR-21a-5p was analyzed. [score:7]
The regulatory role of miR-21 in process of viral infection was confirmed by a number of studies and can be used as a target for the treatment of viral diseases. [score:6]
The expression of viral RNA and protein was down-regulated after injecting the miR-21a-5p antagomir (Figures 4F,G). [score:6]
Co-transfection of the Dual-luciferase miRNA Target Expression Vector containing the Caskin1-WT-UTR (Caskin1-WT) with the miR-21a-5p mimics in the Hela cells resulted in an approximate 90% loss of Dual-luciferase reporter expression compared with the control (Figure 2H). [score:6]
For example, in traumatic brain injury, the expression of miR-21 was up-regulated 1.5-fold in the brain cortex and hippocampus and might affect the pathophysiology of traumatic brain injury (Re dell et al., 2011). [score:6]
miR-21 is a multifaceted microRNA regulating the expression of target genes involved in several cellular programs, such as cell proliferation, migration, invasion, and metastasis (Krichevsky and Gabriely, 2009; Zhang et al., 2013). [score:6]
In the miR-21a-5p antagomir group, the miR-21a-5p expression levels were significantly down-regulated 24 h after injection compared with the control (Figure 4A). [score:5]
It is possible that miR-21a-5p reduces the expression of its target mRNA and protein (Caskin1). [score:5]
Among the RT-PCR, Western blotting, IFA and TCID50 results, the overexpression of miR-21a-5p significantly increased the progeny of PHEV production, and conversely, the transfection of the miR-21a-5p inhibitor demonstrated the opposite effects (Figures 1D–G). [score:5]
Similarly, luciferase activity was significantly increased when the Hela cells were transfected with the miR-21a-5p inhibitor to inhibit the endogenous miR-21 levels (Figure 2H). [score:5]
The mRNA and protein expression of Caskin1 also were determined after transfecting with the miR-21a-5p mimics which could be over-expressed miR-21a-5p. [score:5]
Furthermore, the expression of Caskin1 in N2a cells following transfection with the miR-21a-5p inhibitor was analyzed. [score:5]
These data proved miR-21 might be a novel target for the treatment of CVB3 infection and other apoptosis -mediated cardiovascular diseases (He et al., 2013). [score:5]
The miR-21a-5p targets were predicted by TargetScan, Microcosm and Miranda. [score:5]
X-tremeGENE HP DNA Transfection Reagent (Roche, Sweden) was used to co -transfected Hela cells with 50 nM miR-21a-5p mimic or 100 nM inhibitor or their respective non -targeting negative control oligonucleotides (RiboBio) and 2 μg of Caskin1-WT or Caskin1-MUT. [score:5]
Altered expression of miRNA-21 and its targets in the hippocampus after traumatic brain injury. [score:5]
MiR-21a-5p exhibited a negative regulation expression profile with Caskin1 in the brain of PHEV-infected mouse, which further supports a functional interaction between the miRNA and mRNA in vivo. [score:4]
miR-21a-5p Up-Regulation during the PHEV Infection Process. [score:4]
Taken together, our findings demonstrate that miR-21a-5p positively regulates PHEV replication by targeting Caskin1. [score:4]
miR-21a-5p Promotes PHEV Replication In vitroTo determine whether mir-21a-5p has effects on PHEV replication, we tested the effect of upregulating or blocking miR-21a-5p on PHEV replication in N2a cells. [score:4]
Taken together, these results indicate that miR-21a-5p negatively regulates Caskin1 expression in the PHEV infection process by straightly binding the 3′-UTR of the Caskin1 gene. [score:4]
To determine whether mir-21a-5p has effects on PHEV replication, we tested the effect of upregulating or blocking miR-21a-5p on PHEV replication in N2a cells. [score:4]
These findings affirm that the miR-21a-5p antagomir inhibits viral proliferation by up -regulating Caskin1 and has a therapeutic effect on animals. [score:4]
It was evident from the luciferase reporter assay that miR-21a-5p binds to this region of Caskin1 and suppresses its expression. [score:4]
FIGURE 1 miR-21a-5p was up-regulated during the porcine hemagglutinating encephalomyelitis virus (PHEV) replication process and promoted PHEV replication. [score:4]
FIGURE 3 miR-21a-5p promotes PHEV replication by targeting Caskin1 in N2a cells. [score:3]
miR-21a-5p Promotes PHEV Replication by Targeting Caskin1 in the N2a Cells. [score:3]
miR-21a-5p and Caskin1 expressions were determined by RT-PCR using SYBR Green Master Mix kit as described previously (Shen et al., 2016). [score:3]
The results revealed that the relatively expression level of miR-21a-5p was significantly higher after infection than in the control (Figures 1A,B). [score:3]
miR-21a-5p Modulates Caskin1 Expression in PHEV-Infected N2a Cells. [score:3]
U6 and GAPDH were used for normalization of miR-21a-5p and Caskin1 expression, respectively (Shen et al., 2016). [score:3]
The up-regulation of miR21a-5p after PHEV infection showed a sustained changes at 24, 48, and 60 h; however, Caskin1 mRNA and protein levels decreased 60 h post-infection compared to the 24 and 48 h time points. [score:3]
The N2a cells were transfected with the mimics or the miR-21a-5p inhibitor (50 or 100 nM), followed by infection with PHEV. [score:3]
However, the Dual-luciferase expression was not affected by the co-transfection with the miR-21a-5p mimics when the Caskin1-WT-UTR was replaced with the Caskin1-MUT-UTR in the Dual-luciferase reporter system (Figure 2H). [score:3]
Apoptosis and the target genes of microRNA-21. [score:3]
However, further studies are required to resolve this issue of the differential kinetics of miR-21a-5p and its target. [score:3]
The brain tissues were analyzed 5 days after the inoculation with PHEV to analyze the expression of miR-21a-5p and Caskin1 and viral RNA by qRT-PCR or Western blotting. [score:3]
mir base Matuacc mirna_name Gene symbol Gene description Score mmu-miR-21a-5p MIMAT0000530 mmu-miR-21 Fnip1 Folliculin interacting protein 1 -0.25 mmu-miR-21a-5p MIMAT0000530 mmu-miR-21 Pcbp1 Poly(rC) binding protein 1 -0.25 mmu-miR-21a-5p MIMAT0000530 mmu-miR-21 Tmem170 Transmembrane protein 170 -0.24 mmu-miR-21a-5p MIMAT0000530 mmu-miR-21 Caskin1 CASK interacting protein 1 -0.23 mmu-miR-21a-5p MIMAT0000530 mmu-miR-21 Spg20 Spastic paraplegia 20, spartin (Troyer syndrome) homolog (human) -0.23 mmu-miR-21a-5p MIMAT0000530 mmu-miR-21 Chd7 Chromodomain helicase DNA binding protein 7 -0.23 mmu-miR-21a-5p MIMAT0000530 mmu-miR-21 Rpa2 Replication protein A2 -0.23 mmu-miR-21a-5p MIMAT0000530 mmu-miR-21 Klhdc5 Kelch domain containing 5 -0.23 mmu-miR-21a-5p MIMAT0000530 mmu-miR-21 Chic1 Cysteine-rich hydrophobic domain 1 -0.23 mmu-miR-21a-5p MIMAT0000530 mmu-miR-21 Jag1 Jagged 1 -0.22 The time -dependent expression pattern of Caskin1 mRNA and protein in the N2a cells and mouse brain tissue following PHEV infection was studied. [score:3]
N2a cells (3 × 10 [5] cells per well) were seeded into six-well culture plates, incubated overnight and transfected with 50 nM of the miR-21a-5p mimics or 100 nM of the miR-21a-5p inhibitor or the Caskin1 siRNAs or the siRNA NC using X-tremeGENE HP DNA Transfection Reagent (Roche). [score:3]
To determine the mechanism of miR-21a-5p affecting virus proliferation, we predicted its target genes. [score:3]
The miR-21a-5p antagomir used in this study contains chemically modified single-stranded RNA molecules which could prevent the complementary pairing of miRNA and its target gene mRNA through the combination of strong competitive with the mature miRNA in vivo were purchased from RiboBio. [score:3]
The brain tissues were analyzed 24 h after an intracerebral injection to study the expression of miR-21a-5p and Caskin1 by RT-PCR or Western blotting. [score:3]
The recovery of miR-21 expression significantly relieved CVB3 -induced myocarditis as shown by an increased body weight, a reduced myocardial injury, a lowered myocarditis score and an increased survival rate. [score:3]
The Prediction of miR-21 Target Genes. [score:3]
To determine the differentiated expression of miR-21a-5p during the PHEV infection process, we collected the N2a cells after infection for 24, 48, and 60 h, and the mouse brain tissue was infected for 3 and 5 days prior to the RT-PCR. [score:3]
We detected miR-21a-5p expression in the brain tissue of the different groups of mice. [score:3]
In the PHEV-infected mice, the treatment with the miR-21a-5p antagomir caused a significant reduction in the miR-21a-5p expression and rescued the alterations in the Caskin1 levels (Figures 4C–E). [score:3]
The expression of Caskin1 was significantly decreased after transfection with miR-21a-5p mimics (Figures 2E,F). [score:3]
The previous research from our lab demonstrated that the change in the miR-21a-5p expression was obvious in the PHEV infection process, suggesting that miR-21a-5p might play a very important role in the process of virus infection. [score:3]
There were many target genes of miR-21, such as PTEN, PDCD4, RECK, TPM1, TIMP-3, Maspin, and Sprouty (Spry-2, Spry-1) (Buscaglia and Li, 2011). [score:3]
For example, in the murine coxsackievirus B3 (CVB3) -induced myocarditis mo del, the expression of miR-21 was significantly reduced. [score:3]
This indicates that the expression level of miR-21a-5p is significantly increased during PHEV-infected host, suggesting that miR-21a-5p may play a role in PHEV -induced neurotoxicity. [score:3]
Whether there are other targets of miR-21a-5p affect viral replication is unclear during PHEV infection. [score:3]
It was thus evident from the results that miR-21a-5p modulates Caskin1 expression. [score:3]
To determine whether miR-21a-5p inhibition was possible in normal mice in vivo, the miR-21a-5p antagomir was injected intracerebrally three times, at 3-day intervals (at days 0, 3, and 6). [score:3]
In this study, we identified a new mechanism regulating the proliferation of PHEV mediated by interaction between miR-21 and Caskin1, which may be exploited to reduce the proliferation of PHEV for therapeutic applications. [score:2]
MiR-21 confers resistance against CVB3 -induced myocarditis by inhibiting PDCD4 -mediated apoptosis. [score:2]
A significant increase or decrease was observed in the miR-21a-5p level in the N2a cells transfected with the miR-21a-5p mimics or the miR-21a-5p inhibitor, respectively, compared to the cells transfected with the negative control (Figure 1C). [score:2]
miR-21: a small multi-faceted RNA. [score:1]
The mice were randomly divided into four groups, six mice in each group, as follows: group 1 was the control group; group 2 was the PHEV-infected and PBS group (PBS); group 3 was the PHEV-infected and antagomir control group (NC); and group 4 was the PHEV-infected and miR-21a-5p antagomir treated group (antagomir). [score:1]
FIGURE 4 miR-21a-5p antagomir treatment reduces symptoms in PHEV-infected mice. [score:1]
In conclusion, these results indicate that Caskin1 is a conditioning factor of PHEV replication and that PHEV makes use of miR-21a-5p induction to decrease Caskin1 levels and conducive to its replication. [score:1]
Caskin1-WT-UTR, sequence of the putative miR-21 binding site; Caskin1-MUT-UTR, sequence of the mutant miR-21 binding site. [score:1]
These data suggest that miR-21a-5p induction contributes to PHEV replication. [score:1]
To characterize the molecular components of miR-21a-5p activity in facilitating PHEV replication, we next predicted miR-21a-5p targets using bioinformatics prediction software. [score:1]
After the miR-21a-5p antagomir treatment, the virus multiplication decreased in the PHEV-infected mouse brain tissues. [score:1]
PHEV mainly causes obvious nerve injury, whereas miR-21 also plays an important role in nerve injury. [score:1]
The expression of miR-21a-5p was measured by RT-PCR. [score:1]
miR-21a-5p Antagomir Treatment Reduces Symptoms in PHEV-Infected Mice. [score:1]
The result indicated that the miR-21a-5p antagomir efficiently entered into the mouse brain tissue, resulting in the deletion of miR-21a-5p in the mouse brain tissue. [score:1]
Our previous research revealed that miR-21a-5p, which is highly homologous with miR-21, was significantly increased in the process of PHEV infection by a DNA microarray analysis (Data are not published). [score:1]
Therefore, we speculated that miR-21a-5p might play an important role in PHEV pathogenesis. [score:1]
The 3′-UTR of mouse Caskin1 gene, containing a mutant miR-21 binding side (Caskin1-MUT-UTR), was created by overlap extension of PCR. [score:1]
We used RT-PCR, IFA, and Western blotting to determine the effects of the miR-21a-5p antagomir on the viral proliferation after injection. [score:1]
The results of the IFA indicated that the miR-21a-5p antagomir had a certain effect on the proliferation of the virus (Figure 4H). [score:1]
The 3′-UTR of mouse Caskin1 gene, containing the putative miR-21a-5p binding site (Caskin1-WT-UTR), was amplified from mouse genomic DNA by PCR. [score:1]
In this study, we sought to investigate the regulatory role of miR-21 in PHEV proliferation and provide theoretical basis for the development of a new therapeutic regimen for PHEV infection. [score:1]
PHEV Infection and miR-21a-5p Antagomir Administration. [score:1]
miR-21a-5p Promotes PHEV Replication In vitro. [score:1]
In this study, miR-21a-5p antagomir treatment delayed the onset of mice and delayed their weight loss, and the lifespan of the mice was extended for about 2 days. [score:1]
Thus, we speculate that miR-21 might play a role in the process of viral infection. [score:1]
These findings indicate that the miR-21a-5p antagomir treatment reduces the symptoms in the PHEV-infected mice. [score:1]
[1 to 20 of 92 sentences]
6
[+] score: 317
miR-21 inhibition brought an improvement of HSV -induced BD-like inflammatory symptoms and down-regulated pro-inflammatory cytokine IL-17 and IL-6. A conventional medication to BD mice resulted in improvement accompanied with down-regulation of miR-21. [score:9]
Figure 4miR-21 inhibition by antagomir up-regulated several genes in BD mice by time qPCR in BD mice (A); Regulated genes by miR21-I was reconfirmed by protein expression with FACS analysis in PBMC isolated from BD mice (B). [score:9]
The mRNA expression of RhoB is consistently up-regulated after miR21 inhibition in BD mice. [score:8]
The expression of RhoB in PBMC of normal and BD mice was also up-regulated after miR-21 inhibition in our experiment. [score:8]
Figure 2Cutaneous manifestation of mice was improved after pentoxifylline medication (arrows: skin lesion) (A); Expression of miR-21 was down-regulated by medication with either colchicine or pentoxifylline (B); miR-150 expression was not affected after medication (C). [score:8]
Figure 3miR-21 antagomir (miR-21 inhibitor, miR21-I) inhibited miR-21 expression (A); improved BD-like symptoms (B); and decreased BD severity score (C) as well as serum levels of IL-17 and IL-6 (D). [score:7]
Conti A. Aguennouz M. La Torre D. Tomasello C. Cardali S. Angileri F. F. Maio F. Cama A. Germano A. Vita G. miR-21 and 221 upregulation and miR-181b downregulation in human grade II-IV astrocytic tumors J. Neurooncol. [score:7]
This miR-21 antagomir injection brought an improvement of BD-like symptoms accompanied by decreased serum level of IL-17 and IL-6. In the miR-21 inhibited group, mRNA expressions of PDCD4, RhoB, PD-1, and IL-12p35 were up-regulated compared to the control injected group in normal and BD mice. [score:7]
Connolly E. C. van Doorslaer K. Rogler L. E. Rogler C. E. Overexpression of miR-21 promotes an in vitro metastatic phenotype by targeting the tumor suppressor Rhob Mol. [score:7]
Figure 5 The frequencies of toll-like receptor (TLR)-4 positive cells were down-regulated after miR-21 inhibition by treatment of miR-21 antagomir in mice. [score:6]
Up-Regulated Genes after miR-21 Inhibition. [score:6]
miR-21 expression was significantly (p < 0.05) down-regulated after treatment with either colchicine or pentoxifylline. [score:6]
The frequencies of TLR4+ cells were also down-regulated after miR-21 inhibition in BD mice. [score:6]
miR-21 inhibition up-regulated PDCD4, PD-1, RhoB, and IL-12p35. [score:6]
In normal mice, serum level of IL-6 was also significantly (p = 0.0006) down-regulated after inhibition of miR-21 (Figure 3D). [score:6]
2.5. miR-21 Inhibition Down-Regulated TLR4 in Normal Healthy Mice. [score:6]
Programmed cell death 4 (PDCD4) is known to be up-regulated during apoptosis [38] as a functionally important target of miR-21 [39]. [score:6]
Feng Y. H. Wu C. L. Tsao C. J. Chang J. G. Lu P. J. Yeh K. T. Uen Y. H. Lee J. C. Shiau A. L. Deregulated expression of sprouty2 and microRNA-21 in human colon cancer: Correlation with the clinical stage of the disease Cancer Biol. [score:6]
Similarly, PDCD4 was up-regulated after miR-21 inhibition in the present study. [score:6]
Lu T. X. Munitz A. Rothenberg M. E. MicroRNA-21 is up-regulated in allergic airway inflammation and regulates IL-12p35 expression J. Immunol. [score:6]
miR-21 inhibition correlated to the improvement of inflammatory BD-like symptoms through regulating cytokine expression and toll-like receptor 4 (TLR4). [score:6]
miR-21 inhibition also resulted in down-regulation of the frequencies of TLR4+ cells. [score:6]
miR-21 inhibition by intraperitoneally injection of miR-21 antagomir showed down-regulation of miR-21 in normal healthy mice. [score:6]
Our study showed that colchicine or pentoxifylline treatment ameliorated BD-like symptoms accompanied by down-regulation of miR-21 expression in PBMC of mice. [score:6]
To determine whether miR-21 inhibitions was possible in normal mice in vivo, miR-21 antagomir (miR-21 inhibitor, miR21-I) was injected intraperitoneally (ip) with transfection reagent three times, with 2 days intervals (days 0, 2, and 4). [score:5]
In order to confirm the changes of target molecules after inhibition of miR-21, real time-qPCR was applied to BD mice (Figure 4A). [score:5]
In order to inhibit miR-21 expression, miR-21 antagomir was injected intraperitoneally three times to normal and BD mice with 2 days intervals. [score:5]
miR-21 exhibits an anti-angiogenic function by targeting RhoB expression in endothelial cells through the repression of RhoB [55]. [score:5]
For the confirmation of protein expression after miR-21 inhibition, flow cytometric analysis was applied in isolated PBMC of BD mice. [score:5]
miR-21 was also over-expressed in the inflamed colonic mucosa of patients with ulcerative colitis (UC) [23] and colonic Crohn’s disease (CD) [24]. [score:5]
In normal healthy mice, miR21-I also inhibited serum IL-17 expression. [score:5]
miR-21 was over-expressed in atopic eczema and psoriasis compared to its expression in healthy controls [25]. [score:4]
miR21-I injection significantly (p < 0.05) inhibited miR-21 expression compared to the transfection reagent injected control group in normal healthy mice (Figure 3A). [score:4]
Merline et al. [57] described that the down-regulated miR-21 increased the abundance of PDCD4. [score:4]
It has been shown that RhoB is a direct target of miR-21 in angiogenesis [55]. [score:4]
According to recent reports, miR-21 also contributes to the development of inflammatory bowel disease (IBD) [22] and allergic airway inflammation [51]. [score:4]
The frequencies of RhoB, PD-1, and IL-12p35 positive cells were also up-regulated in miR21-I group as you can see in Figure 4B. [score:4]
The expression of miR-21 and miR-150 were significantly (p < 0.05) different between BDN and BD. [score:3]
In PBMC after miR21-I injection, PDCD4 expression was increased in BD mice. [score:3]
Therefore, miR-21 antagomir could be useful to control BD, ulceration caused by HSV infection, and other systemic inflammatory diseases as immune modulators. [score:3]
According to Lu et al. [41], the main function of miR-21 is to regulate the IL-12/IFNγ axis and act as a central regulator of Th1 and Th2 responses to allergens in delayed type hypersensitivity and allergic inflammation. [score:3]
These findings suggest that the expression level of miR-21 is correlated with BD-like symptoms in a HSV induced mouse mo del. [score:3]
RhoB is known as a target of miR-21 [40]. [score:3]
In mice, the expression of miR-21 and miR-150 was higher in BD than BDN. [score:3]
The experimental group was composed of control, transfection reagent treatment without antagomir, and antagomir for miR-21 inhibition (miR21-I) (1 μM). [score:3]
In PBMC of human patients with BD (n = 9), the expression of miR-21 was also higher than that in healthy normal (n = 5) (p = 0.12). [score:3]
Correlation of miR-21 Inhibition with BD Symptoms. [score:3]
The expression levels of miR-21 and miR-150 were then analyzed by real-time PCR. [score:3]
Frankel L. B. Christoffersen N. R. Jacobsen A. Lindow M. Krogh A. Lund A. H. Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells J. Biol. [score:3]
Figure 1 Expressions of miR-21 and miR-150 in BD mice and miR-21 in BD patients. [score:3]
In this study, antagomir -mediated inhibition of miR-21 was first demonstrated in a mouse mo del for therapeutic application. [score:3]
Flow cytometry analysis revealed that the frequencies of TLR4+ cells were significantly (p = 0.01) down-regulated in miR21-I injected mice (3.44% ± 0.35%) compared to TR injected control mice (6.03% ± 1.76%, Figure 5). [score:3]
PD-1 (programmed cell death 1) was also increased in miR-21 inhibited mice. [score:3]
Liu C. Yu J. Yu S. Lavker R. M. Cai L. Liu W. Yang K. He X. Chen S. MicroRNA-21 acts as an oncomir through multiple targets in human hepatocellular carcinoma J. Hepatol. [score:3]
In our result, PD-1 was also negatively correlated with miR-21 expression. [score:3]
According to Svrcek et al. [22] miR-21 was increased in inflammatory bowel disease (IBD) with or without colorectal cancer. [score:3]
IL-6 was also significantly (p = 0.01) down-regulated to 103.56 ± 25.44 pg/mL after miR21-I injection compared to TR injection (222.83 ± 40.62 pg/mL) in BD mice. [score:3]
Over -expression of miR-21 in cancer cells promotes cell survival by decreasing apoptosis [8]. [score:3]
The lymph nodes (LN) were isolated one day after the last injection (day 5) and subjected to real time PCR analysis to detect miR-21 expression level. [score:3]
Our data also showed increased IL-12p35 mRNA levels in miR-21 inhibited mice. [score:3]
miR-21 and miR-150 in BD were highly expressed compared to those in BDN (Figure 1). [score:2]
Dillhoff M. Liu J. Frankel W. Croce C. Bloomston M. MicroRNA-21 is overexpressed in pancreatic cancer and a potential predictor of survival J. Gastrointest. [score:2]
According to Lu et al. [41] IL-12p70 was higher in dendritic cell culture conditioned media in miR-21 knockout (miR [−/−]) mice than in miR-21 [+/+] mice. [score:2]
In the immune system, deregulation of miR-21 has recently been reported to be related to malignancies such as B cell lymphoma and Hodgkin’s lymphoma [19, 20]. [score:2]
There was no report related to miR-21 in BD patients or HSV -induced inflammation. [score:1]
To determine the correlation between miR-21 and TLR4, the frequencies of TLR4+ cells were analyzed among CD14+ cells in PBMC of miR21-I injected normal healthy mice (n = 6). [score:1]
Iliopoulos D. Kavousanaki M. Ioannou M. Boumpas D. Verginis P. The negative costimulatory molecule PD-1 modulates the balance between immunity and tolerance via miR-21 Eur. [score:1]
PD-1 deficient mice developed severe arthritis accompanied by increased miR-21 [56]. [score:1]
Further studies are needed to delineate the exact role of miR-21 in the chronic inflammation in vivo. [score:1]
miR-21 is one of the most abundant miRNAs in T cells, specifically in effector T cells, indicating that miRNA profile changes dynamically during T-cell differentiation [21]. [score:1]
Kurashige J. Kamohara H. Watanabe M. Tanaka Y. Kinoshita K. Saito S. Hiyoshi Y. Iwatsuki M. Baba Y. Baba H. Serum microRNA-21 is a novel biomarker in patients with esophageal squamous cell carcinoma J. Surg. [score:1]
miR21-I or TR was ip injected three times with two-day intervals. [score:1]
We confirmed that the level of miR-21 was correlated with BD in mice mo del and BD patients. [score:1]
For mRNA analysis, total RNA was isolated from lymph nodes treated with either miR21-I or transfection reagent using TRIZOL (Life Technologies, Helgerman, CT, USA) according to the manufacturer’s recommendations. [score:1]
In addition, miR-21 injected BD mice showed improvement of BD-like symptoms (Figure 3B). [score:1]
Taken together, our data support the previously reported results that miR-21 increases cell proliferation and decreases cell apoptosis [58]. [score:1]
In our experiment, cytokine IL-17 was lower in miR-21 antagomir treated mice. [score:1]
These reports showed that miR-21 extendeds to the non-neoplastic mucosa. [score:1]
Patrick et al. [54] showed that miR-21 antagomir might be therapeutically useful in preventing heart failure in mice. [score:1]
In addition, miR-21 was involved in inflammatory responses during the innate immune response to aerosolized lipopolysaccharide (LPS) in mouse lung [26]. [score:1]
In human, miR-21 was also higher in BD patients than healthy control. [score:1]
miR-21 has been reported in gastric [9], renal [10], esophageal [11], colon [12], lung [13], pancreas [14], tongue [15], prostate [16], breast [17], and brain [18] cancers. [score:1]
miRNA-21 (miR-21) is one of the first microRNAs identified [4]. [score:1]
Our present study showed that the level of miR-21 was correlated to HSV -induced inflammation in a BD mouse mo del and BD patients. [score:1]
Merline R. Moreth K. Beckmann J. Nastase M. V. Zeng-Brouwers J. Tralhao J. G. Lemarchand P. Pfeilschifter J. Schaefer R. M. Iozzo R. V. Signaling by the matrix proteoglycan decorin controls inflammation and cancer through PDCD4 and microRNA-21 Sci. [score:1]
[1 to 20 of 85 sentences]
7
[+] score: 308
Other miRNAs from this paper: hsa-mir-21, mmu-mir-21b, mmu-mir-21c
Identification of potential miR-21 targetsIt is known that animal miRNAs regulate gene expression by inhibiting translation and/or by inducing degradation of target. [score:12]
Because miR-21 targets are expected to up-regulated for the LNA-antimiR-21 samples, ANKRD46 and EIF4A2, the two up-regulated genes upon miR-21 knockdown in the two cell lines and predicted by target prediction programs, were selected for further investigation. [score:10]
To further screen potential direct targets, we compared the 27 candidate mRNAs with miR-21 targets predicted by TargetScan 5.1, miRBase Targets V. 5, miRNAMap 2.0, PicTar and miRanda 3.0. [score:9]
Recently, estradiol was shown to down-regulate miR-21 expression in MCF-7 cells [32], although another study found estradiol -mediated up-regulation of miR-21 in MCF-7 cells [33]. [score:9]
Computational prediction of miR-21 target genesPredicted miR-21 targets were identified using the algorithms of TargetScan 5.1 [22], miRBase Targets V5 [23], miRNAMap 2.0 [24], PicTar [25] and miRanda 3.0 [26]. [score:9]
Luciferase assays using a reporter carrying a putative target site in the 3' untranslated region of ANKRD46 revealed that miR-21 directly targeted ANKRD46. [score:7]
Using LNA silencing combined to microarray technology and target prediction, we screened for potential targets of miR-21 and validated direct targets by using luciferase reporter assay and Western blot. [score:7]
Predicted miR-21 targets were identified using the algorithms of TargetScan 5.1 [22], miRBase Targets V5 [23], miRNAMap 2.0 [24], PicTar [25] and miRanda 3.0 [26]. [score:7]
LNA-antimiR-21 inhibits BC cell growth, proliferation and migration in vitroMCF-7 and MDA-MB-231 cell lines were selected to investigate miR-21 functions and targets by using sequence-specific functional inhibition of miR-21, because both cell lines express higher levels of miR-21 compared with MCF-10A cells. [score:6]
Our data showed that miR-21 directly interacted with the ANKRD46 3' UTR and inhibited ANKRD46 expression, though there was no significant association between miR-21 and ANKRD46 in resected patient tumors. [score:6]
We show here that knockdown of miR-21 suppresses cell growth and proliferation of MCF-7 cells in vitro, and suppresses MCF-7 xenograft growth. [score:6]
To determine whether miR-21 affects the expression of the potential endogenous target genes, we transfected MCF-7 and MDA-MB-231 cells with LNA-antimiR-21 or LNA-control. [score:5]
All tests were two-tailed, and the significance level was set at P < 0.05. miR-21 is overexpressed in BC tissues and cell linesExpression of miR-21 was detected in the cytoplasm in cancerous and luminal epithelial cells, and occasionally in fibroblasts. [score:5]
In vivo results suggested that the PNA -based miR-21 inhibitor had a subtle yet reproducible inhibitory effect on tumor growth. [score:5]
These results suggest that miR-21 directly targets ANKRD46 in BC cells. [score:4]
We further tested whether miR-21 could directly repress the identified mRNA targets through 3' UTR interactions (Figure 5a). [score:4]
A key oncomir in carcinogenesis is miR-21, which is consistently up-regulated in a wide range of cancers. [score:4]
In addition, ANKRD46 is newly identified as a direct target of miR-21 in BC. [score:4]
In particular, miR-21 [miRBase: MIMAT0000076] has emerged as a key oncomir, since it is the most consistently up-regulated miRNA in a wide range of cancers [4- 7]. [score:4]
MCF-7 and MDA-MB-231 cell lines were selected to investigate miR-21 functions and targets by using sequence-specific functional inhibition of miR-21, because both cell lines express higher levels of miR-21 compared with MCF-10A cells. [score:4]
Knockdown of miR-21 in MCF-7 and MDA-MB-231 cells inhibits in vitro and in vivo growth as well as in vitro migration. [score:4]
miR-21 directly targets ANKRD46 in BC cells. [score:4]
IHC may not be sensitive enough to observe the down-regulation of ANKRD46 by miR-21. [score:4]
Given that miRNAs usually target multiple genes post-transcriptionally, miR-21 is likely to exert its effects by regulating many genes involved in BC. [score:4]
Figure 5 ANKRD46 is a direct target of miR-21 in BC cell lines. [score:4]
Knockdown of miR-21 significantly increased the expression of ANKRD46 at both mRNA and protein levels. [score:4]
ANKRD46 is newly identified as a direct target of miR-21 in BC. [score:4]
PDF file comprising a figure showing the expression of miR-21 in human BC tissues and FA tissues by FISH. [score:3]
miR-21 directly targets ANKRD46 in BC cellsThe microarrays were validated by qRT-PCR assay. [score:3]
However, few functional studies are available for miR-21, and few targets have been identified. [score:3]
For validation of mRNA array and quantitative analysis of miR-21 as well as potential target genes, qRT-PCR was used as previously described [20]. [score:3]
In this study, we explored the role of miR-21 in human breast cancer cells and tissues, and searched for miR-21 targets. [score:3]
miR-21 and EIF4A2 proteins are inversely expressed in resected patient tumors in vivo. [score:3]
Identification of potential miR-21 targets. [score:3]
Expression of miR-21 was detected in the cytoplasm in cancerous and luminal epithelial cells, and occasionally in fibroblasts. [score:3]
In this study, we found that miR-21 and EIF4A2 protein were inversely expressed in resected BC patient tumors. [score:3]
Click here for file PDF file comprising a figure showing the expression of miR-21 in human BC tissues and FA tissues by FISH. [score:3]
We also searched for miR-21 targets using gene prediction -based and systematic screening approaches. [score:3]
Anti-miR-21 inhibited growth and migration of MCF-7 and MDA-MB-231 cells in vitro, and tumor growth in nude mice. [score:3]
Knockdown of miR-21 suppressed MCF-7 cell migration by up to 69% (P = 0.013), and MDA-MB-231 migration by 51% (P = 0.001), compared with the LNA-control at 24 h after wound scratch (Figure 2d). [score:3]
miR-21 and EIF4A2 protein were inversely expressed in breast cancers (r [s ]= -0.283, P = 0.005, Spearman's correlation analysis). [score:3]
These results suggest that miR-21 inhibitory strategies using PNA-antimiR-21 may have potential for therapeutic applications in BC treatment. [score:3]
Interestingly, our study suggests that LNA-antimiR-21 also suppresses the growth and proliferation of MDA-MB-231 in vitro, in contrast to a recent report that found no effect of LNA-antimiR-21 on the growth of MDA-MB-231 in vitro or in vivo, although anti-miR-21 -treated tumors were slightly smaller than control tumors [10]. [score:3]
Computational prediction of miR-21 target genes. [score:3]
In 99 successfully tested cases out of 113, endogenous miR-21 and EIF4A2 protein levels were inversely expressed in resected patient tumors (r [s ]= -0.283, n = 99, P = 0.005, Spearman's correlation analysis). [score:3]
Mutation of ANKRD46 was introduced in the predicted miR-21 binding site by a QuikChange site-directed mutagenesis kit (Stratagene, Foster City, CA, USA). [score:3]
miR-21 expression in xenograft tumors of PNA-antimiR-21 group was 0.96 log [2]-scale higher than that of the control group (P < 0.05; Figure 3e). [score:3]
These data clearly implicate miR-21 as a key molecule in carcinogenesis, but functional studies that demonstrate cause and effect relationships between miR-21 and target genes are lacking. [score:3]
miR-21 expression levels in BC tissues are much higher than that in corresponding NATs. [score:3]
These results suggest that inhibitory strategies against miR-21 using peptide nucleic acids (PNAs)-antimiR-21 may provide potential therapeutic applications in breast cancer treatment. [score:3]
Functional study of ANKRD46 is required in the future to determine weather ANKRD46 is a functional target of miR-21 in BC progression as demonstrated in this study. [score:3]
MCF-7 xenograft tumor sections demonstrated that miR-21 inhibition induced apoptosis of MCF-7 cells, confirming a previous study [9]. [score:3]
We demonstrate that MCF-7 and MDA-MB-231 cells transfected with anti-miR-21 show growth inhibition in vitro and in vivo, as well as cell migration in vitro. [score:3]
miR-21 and EIF4A2 proteins are inversely expressed in resected patient tumors in vivoWe examined ANKRD46 [NCBI: NP940683] and EIF4A2 [NCBI: NP001958] protein levels by IHC on TMAs constructed by the BC cases described in Materials and. [score:3]
miR-21 is overexpressed in BC tissues and cell lines. [score:3]
Total RNAs were isolated to quantify miR-21 expression by relative qRT-PCR, normalizing on U6 RNA levels. [score:3]
The 3' untranslated region (3' UTR) of mRNA sequence of ANKRD46 containing predicted miR-21 binding site was amplified by PCR. [score:3]
Figure 1Altered expression of miR-21 in different breast tumor types and breast cell lines. [score:3]
Consistent with the microarray results, qRT-PCR showed increased ANKRD46 and EIF4A2 mRNA levels in MCF-7 and MDA-MB-231 cell lines upon miR-21 inhibition, although the increase of EIF4A2 in MDA/LNA-antimiR-21 cells was relatively modest (Figure 4c). [score:3]
For IHC staining of miR-21 predicted target genes, formalin-fixed paraffin-embedded tissues were obtained from 99 randomly selected BC patients without neoadjuvant therapy at SYSUCC from January 2000 to November 2004, from whom informed consent and agreement, and clinicopathological information was available. [score:3]
miR-21 is a key molecule in a wide range of cancers, and identifying its functional role in BC has direct clinical implications. [score:2]
l (H2A/l) -1.47 -1.67 PRKCI NM_002740 L33881, BC042405, BC022016 Protein kinase C, iota type -1.43 -1.32 SLC25A3 NM_002635, NM_213611, NM_213612, NM_005888 BX647062, AK057575 Phosphate carrier protein, mitochondrial precursor (PTP) -1.39 -1.39 CCNE1 NM_057182, NM_001238 M74093, BC035498 G1/S-specific cyclin E1 -1.37 -1.39 DCAMKL1 NM_004734 AB002367 Serine/threonine-protein kinase DCAMKL1 -1.34 -1.46 GNG12 NM_018841 AL832431 Guanine nucleotide -binding protein G(I)/G(S)/G(O) gamma-12 subunit -1.32 -1.40 Miranda Q8TAY7 NM_024869 BC025658 hypothetical protein FLJ14050 -1.32 -1.31 NP_653284 NM_144683 BC015582 hypothetical protein MGC23280 -1.31 -1.35 NP_055182 NM_014367 - growth and transformation -dependent protein -1.30 -1.34Fold-regulation of mRNAs affected by miR-21 knockdown compared with control -transfected cells (MCF-7 and MDA-MB-231) at indicated time points. [score:2]
Knockdown of miR-21 in MDA-MB-231 cells significantly reduced invasion and lung metastasis [10]. [score:2]
But we did not find miR-21 binding sites in the EIF4A2 3' UTR and found no significant increase of EIF4A2 protein upon miR-21 knockdown in MCF-7 and MDA-MB-231 cells, although EIF4A2 mRNA increased after anti-miR-21 transfection. [score:2]
Figure 3Effect of miR-21-knockdown on MCF-7 cells growth in nude mice: in vivo functional studies. [score:2]
Excel file containing a table listing RT and PCR primers for miR-21 and putative target genes. [score:2]
Consistent with previous findings [8, 10, 30], miR-21 overexpressed in MCF-7, MDA-MB-231 and MDA-MB-453 cell lines from 6.48- to 4.04-fold compared with MCF-10A cell line (P < 0.01, Figure 1d). [score:2]
These data demonstrate the tumorigenic properties of miR-21 in regulating cell growth, proliferation and migration. [score:2]
For the first time, we identify miR-21 as an important regulator of ANKRD46 mRNA and protein levels in BC cells. [score:2]
Taken together, the data reported here suggest that there maybe unknown indirect interactions between miR-21 and EIF4A2 in BC progression. [score:2]
Parallel detection by FISH is shown in Additional file 3. Consistent with the CISH results, quantitative analysis indicated that miR-21 expression was significantly increased by 4.44- to 2.02-fold in BC tissues compared with NATs (P = 0.019, n = 4), and increased in FA tissues by 3.03- to 1.89-fold (P = 0.008, n = 4, Figure 1b). [score:2]
In our study, the miR-21 knockdown effect was reduced from 5.72 log [2]-scale reduction before cell injection to 0.96 log [2]-scale reduction after mice sacrifice. [score:2]
Functional studies showed that knockdown of miR-21 in MCF7 cells led to reduced proliferation and tumor growth [8, 9]. [score:2]
PNA-antimiR-21 reduced miR-21 expression by 5.72 log [2]-scale in MCF-7 cells 48 h post-treatment compared with that in the control (P < 0.01). [score:2]
Figure 4 mRNA profiling of miR-21-knockdown BC cell lines. [score:2]
Knockdown of miR-21 reduced miR-21 levels by 98% in MCF-7 cells, and 77% in MDA-MB-231 cells (P < 0.01) (Figure 2a). [score:2]
Click here for file Excel file containing a table listing RT and PCR primers for miR-21 and putative target genes. [score:2]
However, no significant association between miR-21 and ANKRD46 (P = 0.181, Spearman's correlation analysis) was observed. [score:1]
Spearman's rank correlation test was used for correlation analysis between predicted target gene protein levels and endogenous miR-21 levels measured previously by qRT-PCR [20]. [score:1]
The graph shows a log [2]-scale RQ calculated by normalizing the miR-21 expression values in the tumors on those in the NATs. [score:1]
Validation of tumor growth-promoting activity of miR-21 in an animal mo del. [score:1]
PDF file comprising a figure showing relative miR-21 induction by LNA-antimiR in BC cells. [score:1]
The graph shows a log [2]-scale RQ calculated by normalizing the miR-21 expression values in the LNA-antimiR-21 transfected cells on that in the LNA-control independently for each time point and dose. [score:1]
The graph shows the percentage of remaining luciferase activity calculated by normalizing the miR-21 expression values on the miR-control values. [score:1]
Relative miR-21 induction in LNA-antimiR-21 transfected MCF-7 (a) and MDA-MB-231 cells (b). [score:1]
In this study, we explored the role of miR-21 in the malignant progression of human BC by assaying in vitro and in vivo function after miR-21 knockdown. [score:1]
These vectors were then cotransfected with synthetic miR-21 (pre-miR-21) or miR-control in 293T cells, and luciferase activity was quantified. [score:1]
We used in vitro and in vivo assays to explore the role of miR-21 in the malignant progression of human breast cancer, using miR-21 knockdown. [score:1]
Our results suggest that, as an oncomir, miR-21 also affects cell migration. [score:1]
Based on our results, we propose that estradiol reduced differences in miR-21 level between MCF/PNA-antimiR-21 and MCF/PNA-control cells, which would explain, in part, why differences in tumor weight between the two groups were not significance (P = 0.065). [score:1]
Therefore, we used a PNA miR-21 inhibitor for in vivo investigation. [score:1]
The graph shows RQ calculated by normalizing the miR-21 expression values in LNA-antimiR-21 treated cells on those in the LNA-control treated cells. [score:1]
Note the seed matches at the 5' end of miR-21 (grey boxes) and the mutated nucleotides (underlined). [score:1]
These vectors were then used to assess whether miR-21 could repress luciferase activity in 293T cells. [score:1]
Nonetheless, treatment with anti-miR-21 reduced MCF-7 xenograft growth by approximately 68% for up to nine days. [score:1]
Click here for file PDF file comprising a figure showing relative miR-21 induction by LNA-antimiR in BC cells. [score:1]
Validation of tumor growth-promoting activity of miR-21 in an animal mo delFive- to six-week-old female BALB/c-nude mice (Slaccas Shanghai Laboratory Animal Co. [score:1]
[1 to 20 of 97 sentences]
8
[+] score: 307
Macrophage incubation with miR-21 -overexpressing neuron EVs was associated with upregulation of Nos2 (Fig.   5d), whereas in the presence of the antagomir, incubation of miR-21 -overexpressing neuron EVs resulted in higher expression of Mrc1 and Spry2 (Fig.   5e). [score:10]
The intrathecal delivery of a miR-21-5p antagomir resulted in (i) downregulation of miR-21-5p expression and upregulation of Spry2 in DRG; (ii) prevention of the development of ipsilateral mechanical hypersensitivity; and (iii) reduction of inflammatory macrophage number in DRG. [score:10]
miR-21 has been shown to play a significant intracellular role in promoting neurite outgrowth through downregulation of the Spry2 protein [24] and it is conceivable that miR-21 regulates targets in sensory neurons that can influence nociceptors' function directly or indirectly at peripheral and central terminals. [score:9]
Consistent with possible miR-21 transfer in macrophages, the expression of Sprouty2 mRNA (Spry2) a known miR-21 target [24] was downregulated (Fig.   4d). [score:8]
d Expression of Nos2 mRNA in macrophages incubated with GFP -overexpressing or miR-21 -overexpressing neuronal EVs. [score:7]
We confirmed that peripheral nerve injury induces upregulation of miR-21 expression in the lumbar DRG. [score:6]
Finally, inhibition of miR-21-5p prevented the effect of neuron-derived exosomes on cell phenotype as treatment of macrophages with a specific miR-21-5p antagomir resulted in lower expression of Nos2 concomitant to higher expression of Spry2, compared to treatment with scrambled oligomer (Fig.   4e). [score:6]
Specifically, we observed relatively low expression of miR-21 in the cell bodies of sensory neurons under sham conditions (Figs.   1a, c, e) as well as contralateral to nerve injury (Figs.   1d, e) and significant upregulation of miR-21 in ipsilateral sensory neurons 7 days after SNI (Figs.   1b, e). [score:6]
b Transfection efficacy expressed as percentage of cells double -positive for F4/80 and FAM-labeled miR-21-5p mimic or N4; miR-21-5p expression in transfected macrophages revealed by qPCR. [score:5]
Consistent with a neuronal origin of miR-21, the deletion of miR-21 expression in sensory neurons was associated with antinociceptive behavior, polarization of macrophages toward an anti-inflammatory phenotype, and alteration in macrophages of known miR-21-5p target genes that are responsible for cytoskeleton remo deling and cell survival. [score:5]
To gain further insight from these pathways, we examined the cohort of regulated genes and found that three known target genes of miR-21 were significantly regulated in the macrophages (Supplementary Fig.   10d). [score:5]
e Mrc1 and Spry2 mRNA expression levels in macrophages transfected with miR-21-5p antagomir or scrambled oligomer and incubated with miR-21 -overexpressing EVs derived from CAPS -treated DRG neurons. [score:5]
The expression of Spry2 was downregulated in miR-21-5p mimic -transfected macrophages compared to control transfection and N4 -transfected cells (Fig.   6c). [score:5]
c miR-21-5p expression in macrophages transfected with miR-21-5p antagomir or scrambled oligomer and incubated with or without miR-21 -overexpressing EVs derived from CAPS -treated DRG neurons. [score:5]
a– d Upregulation of miR-21 expression detected by fluorescence in situ hybridization (FISH) in ipsilateral L5 DRG neurons 7 days after SNI compared to sham injury and contralateral DRG neurons. [score:5]
Fig. 6Transfection of peritoneal macrophages with miR-21-5p “mimic” induces upregulation of pro-inflammatory markers. [score:4]
Exosomal cargo can vary depending on cell type and stimulus, and we observed that sensory neuron-derived exosomes contain several miRs including miR-21, which is upregulated in the DRG following peripheral nerve injury. [score:4]
However, these data are indicative of neuronal miR-21 being a critical regulator, either directly or indirectly, of large number of cellular processes that underpin the macrophage phenotypes. [score:4]
The administration of the miR-21-5p antagomir to naive mice significantly enhanced expression of Spry2 compared to the scrambled oligomer (Supplementary Fig.   6a) and reduced miR-21-5p expression in the lumbar DRG (Supplementary Fig.   6b), confirming efficient delivery of the construct. [score:4]
Several miRs are dysregulated in sensory neurons after spared nerve injury (SNI) and in particular the expression of miR-21 increases after sciatic nerve axotomy [24]. [score:4]
Consistent with the intrathecal antagomir data, deletion of miR-21 expression in sensory neurons resulted in development of a less severe mechanical hypersensitivity and a marked reduction of inflammatory macrophage infiltration in the DRG. [score:4]
To identify possible gene targets that are regulated by neuron-derived miR-21 to drive the macrophage response, we performed a genome-wide microarray analysis of macrophages (F4/80 [+]CD11b [+] cells) isolated from L4 and L5 DRG of WT and c KO at 7 days after SNI (Supplementary Fig.   10a). [score:4]
We acknowledge evidence that miR-21 may upregulate IL-10 in macrophages after 24 h-TLR4 stimulation, which mimics an infective status [35]. [score:4]
Specifically, peripheral nerve injury induced upregulation of miR-21 in ipsilateral DRG neurons, which was associated with ipsilateral mechanical hypersensitivity. [score:4]
Furthermore, we show in vitro that capsaicin stimulation of sensory neurons causes the release of exosomes containing miR-21-5p, that when phagocytosed by macrophages, promotes an increase in the expression of pro-inflammatory genes and proteins. [score:3]
Data are means ± S. E. M., n = 3; * P < 0.05 and ** P < 0.01 Student’s t-test Altogether, these in vitro observations indicate that sensory neurons can transfer miR-containing exosomes to macrophages and this transfer results in changes of cell phenotype as well as intracellular levels of miR-21-5p and known miR-21 gene targets. [score:3]
e Nos2 and Spry2 mRNA expression levels in macrophages transfected with miR-21-5p antagomir or scrambled oligomer and incubated with EVs derived from CAPS -treated pure DRG neurons. [score:3]
Fig. 1Expression of miR-21 is increased in DRG neurons following spared nerve injury. [score:3]
Data are means ± S. E. M., n = 3; * P < 0.05 and ** P < 0.01 Student’s t-test Altogether, these in vitro observations indicate that sensory neurons can transfer miR-containing exosomes to macrophages and this transfer results in changes of cell phenotype as well as intracellular levels of miR-21-5p and known miR-21 gene targets. [score:3]
a Downregulation of miR-21-5p levels in DRG of miR-21 c KO compared to WT littermate mice. [score:3]
No miR-21 expression in DRG was detected with a control scrambled probe (Supplementary Figs.   1a–d). [score:3]
Once released, exosomes can be phagocytosed by infiltrating macrophages where elevated miR-21-5p expression is accompanied by an increase in pro-inflammatory and decrease in anti-inflammatory phenotype. [score:3]
c Overexpression of miR-21-5p in macrophages induces a significant reduction of Spry2 protein revealed by western blot. [score:3]
Transfection with N4 displayed the same efficacy as miR-21-5p mimic, but, as expected, did not result in increased expression of miR-21-5p (Fig.   6b). [score:3]
Moreover, selective deletion of neuronal miR-21 was associated with a significant presence of anti-inflammatory macrophages that displayed significant alteration in known miR-21-5p target genes. [score:3]
Such macrophages may phagocytose miR-21-containing exosomes, especially those expressing the adhesion molecule MFG-E8, which we have identified in our EV preparations. [score:3]
Released upon DRG neuron soma activity in exosomes, when phagocytosed and overexpressed by macrophages, miR-21 would polarize macrophages toward a pro-inflammatory over an anti-inflammatory phenotype as evident by several validated markers. [score:3]
An LNA -based miR-21-5p inhibitor and scrambled control oligomer were custom-made as fluorescein amidite (FAM)-labeled compounds by Exiqon (Denmark). [score:3]
i Expression of miRs 21-5p, Let7b-5p, 124-3p and 134-5p in the exosomal fraction of DRG neurons media treated with buffer control or CAPS for 3 h. Data are means ± S. E. M., n = 4 cultures; * P < 0.05, ** P < 0.01 and *** P < 0.001 compared to control, Student’s t test Expression analysis of miRs in the exosome fraction of cultured DRG media indicated that capsaicin significantly increased levels of miR-21-5p, let7b, miR-124, and miR-134 compared to control conditions (Fig.   2i). [score:3]
Cultures (10,000–22,500 cells/well) were incubated at 37 °C for 24 h. In the experiments where miR-21 was overexpressed, cultured neurons were transduced with a green fluorescent protein (control) or miR-21 lentiviral vector [24] and were incubated at 37 °C for 72 h. Non-neuronal cells were separated from neurons using anti-biotin microbeads and MACS technology (Miltenyi Biotech) [41]. [score:3]
Following traumatic nerve injury we could demonstrate a functional link between overexpression/ deletion of miR-21 with pro-/anti-inflammatory macrophages both in vitro and in vivo. [score:3]
Sequences of the oligomers are reported in Supplementary Table  1. Antagomir -transfected cells were cultured for 48 h at 37 °C and then exposed to EVs derived from either non-viral transfected or miR-21 -overexpressing sensory neurons stimulated with capsaicin. [score:3]
Macrophage transfection with miR-21-5p mimic produced more than a 90% yield efficiency in F4/80 [+] cells and resulted in a significant increase in miR-21-5p expression relative to controls (Figs.   6a, b). [score:3]
Expression of miR-21-5p was comparable to miR-let7b, miR-124, and miR-134, which were selected as positive-control miRs (Fig.   2a). [score:3]
k Quantification of CGRP [+] neurons that also express miR-21 in L4/5 DRG. [score:3]
Data are means ± S. E. M., n = 3; * P < 0.05 and ** P < 0.01 Student’s t-test Fig. 5Expression of miR-21-5p is increased in antagomir -transfected macrophages exposed to capsaicin-released exosomes. [score:3]
Having observed that (i) macrophages that had infiltrated into the DRG after injury displayed a pro-inflammatory M1 phenotype; (ii) DRG sensory neurons were able to release exosomes containing miR-21-5p in an activity -dependent manner; (iii) miR-21-5p overexpression in macrophages was associated with M1 phenotype, we hypothesized that in vivo the ongoing nociceptive neuron activity contributes to M1 polarization of macrophages through exosome release, which serves as a neuron–macrophage communication mediator. [score:3]
It would be worthwhile to test whether higher systemic doses of the antagomir display antihyperalgesic efficacy and target miR-21 at sites additional to the DRG. [score:3]
Secondly, specific elements of the exosome cargo could be targeted and we provide here an example of such approach centered on miR-21-5p. [score:3]
h Quantification of large cell bodies NF-200 [+] neurons that also express miR-21 in L4/5 DRG. [score:3]
Overexpression of miR-21-5p promotes M1 macrophage phenotype. [score:3]
d Representative western blot and quantification of iNOS and P-NF-κB protein levels induced by overexpression of miR-21-5p in macrophages. [score:3]
i Expression of miRs 21-5p, Let7b-5p, 124-3p and 134-5p in the exosomal fraction of DRG neurons media treated with buffer control or CAPS for 3 h. Data are means ± S. E. M., n = 4 cultures; * P < 0.05, ** P < 0.01 and *** P < 0.001 compared to control, Student’s t test Expression analysis of miRs in the exosome fraction of cultured DRG media indicated that capsaicin significantly increased levels of miR-21-5p, let7b, miR-124, and miR-134 compared to control conditions (Fig.   2i). [score:3]
e mRNA expression levels for pro-inflammatory (Nos2, Rela) and anti-inflammatory (Mrc1, Arg1) mediators following macrophage transfection with miR-21-5p mimic and N4. [score:3]
b miR-21-5p expression in macrophages transfected with miR-21-5p antagomir or scrambled oligomer and incubated with or without EVs derived from CAPS -treated pure DRG neurons. [score:3]
Under both conditions, we observed that in antagomir -transfected macrophages incubation of neuron-derived EVs produced a significant increase in miR-21-5p expression (Figs.   5b, c). [score:3]
We have observed that macrophages expressed basal constitutive levels of miR-21-5p, although to a much lesser extent than other miRs, such as miR-155-5p (Fig.   5a). [score:3]
We found that 2207 genes were statistically and significantly regulated in the sorted macrophage population (Supplementary Fig.   10b) and a number of pathways were significantly perturbed by neuronal miR-21 absence (Supplementary Fig.   10c). [score:2]
Data are means ± S. E. M., n = 6; * P < 0.05 and ** P < 0.01 compared to CON, one-way ANOVA, post hoc Bonferroni Subsequent analysis of polarization markers in miR-21-5p -transfected macrophages revealed upregulation of several pro-inflammatory markers compared to N4 transfection and control transfection. [score:2]
We observed that intrathecal delivery of the miR-21-5p antagomir, but neither the scrambled oligomer nor transfecting agent (vehicle), significantly prevented the development of nerve injury -associated nociceptive hypersensitivity from day 2 to 7 by ~50% (Fig.   8a). [score:2]
As the macrophage phenotype is associated with change in their shape that depends on contractility within the actin cytoskeleton [36], future studies will determine potential direct association between cytoskeletal changes and downstream effects of miR-21-5p on macrophage polarization and function. [score:2]
In addition, some macrophages expressed miR-21 fluorescence in SNI DRG (Fig.   1o) and miR-21 -positive macrophages were more abundant in DRG ipsilateral compared to contralateral SNI and ipsilateral sham injury (Supplementary Fig.   1e). [score:2]
Data are means ± S. E. M., n = 6; * P < 0.05 and ** P < 0.01 compared to CON, one-way ANOVA, post hoc Bonferroni Subsequent analysis of polarization markers in miR-21-5p -transfected macrophages revealed upregulation of several pro-inflammatory markers compared to N4 transfection and control transfection. [score:2]
Data are means ± S. E. M., n = 4. * P < 0.05 compared to control WT, one-way ANOVA, post hoc Bonferroni test These in vitro data indicate that exosomes containing miRs, such as miR-21-5p, are released from the cell bodies of TRPV1 -expressing sensory neurons. [score:2]
a Effect of continuous intrathecal delivery of the miR-21-5p antagomir (12 pmol/day) for 7 days on the development of mechanical hypersensitivity. [score:2]
Expression of miR-21 was ele-vated 7 days after SNI in both large-diameter neurons (NF200 [+]; Figs.   1f–h) and small-diameter peptidergic neurons (CGRP [+]; Figs.   1i–k) compared to either contralateral or ipsilateral sham neurons. [score:2]
Inflammatory macrophages infiltrate the DRG after peripheral axon injury and release cyto/chemokines that contribute to neuronal sensitization 3, 9. We suggest that in vivo neuron–macrophage transfer of exosomes containing miR-21 may serve as a regulator of macrophage phenotype and consequentially promotes a pro-nociceptive environment. [score:2]
Data are means ± S. E. M., n = 4. * P < 0.05 compared to control WT, one-way ANOVA, post hoc Bonferroni test These in vitro data indicate that exosomes containing miRs, such as miR-21-5p, are released from the cell bodies of TRPV1 -expressing sensory neurons. [score:2]
Intrathecally delivered miR-21-5p antagomir in vivo, which significantly prevented the development of neuropathic hypersensitivity and showed preferential tropism toward neuronal cells over satellite cells and macrophages. [score:2]
Fig. 10Conditional deletion of miR-21 in sensory neurons prevents the development of mechanical hypersensitivity and is associated with polarization of macrophages toward an anti-inflammatory phenotype. [score:2]
b Effect of miR-21 deletion in DRG sensory neurons on the development of mechanical hypersensitivity following SNI. [score:2]
Furthermore, immunohistochemical analysis revealed that miR-21-5p antagomir treatment significantly reduced the number of macrophages (F4/80 [+] expressing cells) in DRG ipsilateral to injury compared to treatment with the scrambled oligomer (Figs.   8j, k). [score:2]
For mimic transfection, cells (500,000/well) were transfected with FAM-labeled miR-21-5p mimic or scrambled control N4 (500 ng; Exiqon), using a Lipofectamine [®] 3000 Transfection Reagent (Invitrogen), as an alternative to a DNA plasmid. [score:1]
Generation of sensory neuron-specific miR-21 null mice. [score:1]
Furthermore, miR-21-5p transfection, more significantly than N4 and control transfection, reduced the transcriptional levels of Mrc1 and Arginase-1 (Arg1; Fig.   6e). [score:1]
a Representative scatterplots of peritoneal macrophages transfected with N4 or miR-21-5p mimc for 48 h. Cells were immunolabeled with antibody–fluorophore conjugates against CD45, CD11b, F4/80, CD206, and CD11c. [score:1]
It is conceivable that the modulatory roles of miR-21 on macrophage polarization are plastic as well as dependent on time, stimulus, and specific microenvironments. [score:1]
Probe sequences: miR-21: TCAACATCAGTCTGATAAGCTA; scrambled: GTGTAACACGTCTATACGCCCA. [score:1]
e Quantification of miR-21 [+] neurons in L4/5 DRG. [score:1]
miR-21 deletion in sensory neuron prevents hypersensitivity. [score:1]
Representative scatterplots of immune cells sorted from pools of contralateral and ipsilateral L4 and L5 DRG obtained from SNI mice intrathecally treated with scrambled oligomer (a) or miR-21-5p antagomir (b) as in Fig.   8. Cells were gated on CD45 [+], F4/80 [+], and CD11b [+]. [score:1]
k Quantification of F4/80 [+] cells in L4 and L5 DRG ipsilateral and contralateral to injury following intrathecal delivery of either the scrambled oligomer or miR-21-5p antagomir. [score:1]
i, j Immunostaining of small-diameter DRG neurons (CGRP, red) and FISH for miR-21 (green) in sham and SNI ipsilateral L5 DRG. [score:1]
As both the miR-21-5p antagomir and scrambled oligomer were fluorescently tagged, we examined their distribution. [score:1]
In order to substantiate our finding, we performed flow cytometry analyses of miR-21-5p -transfected macrophages and observed a significant shift in favor of the M1 population. [score:1]
Cell bodies of sensory neurons in the DRG release exosomes and selected miRs, including miR-21-5p, following specific activation of nociceptive neurons by capsaicin. [score:1]
In order to test this hypothesis, we took a dual approach by (i) performing prolonged intrathecal delivery of the miR-21-5p antagomir and (ii) generating sensory neuron conditional miR-21 null mice. [score:1]
Fig. 9Intrathecal delivery of miR-21-5p antagomir reduces immune cell recruitment and number of M1 macrophages in DRG following SNI injury. [score:1]
Specifically, we postulated that neuronal miR-21 could contribute to the nociceptive hypersensitivity and influence the nature of the inflammatory infiltrate in the DRG after peripheral nerve injury. [score:1]
These in vitro transfection data support evidence for a pro-inflammatory role of miR-21 [32] by showing that an increase in intracellular miR-21-5p induces macrophage polarization toward a pro-inflammatory M1 phenotype. [score:1]
f, g Immunostaining for large-diameter DRG neurons (NF-200, red) and FISH for miR-21 (green) in sham and SNI ipsilateral L5 DRG. [score:1]
miR- 21-5p levels in DRG tissue and in macrophages incubated with neuron-derived EVs: Small RNAs were purifed as above and PCR for miR-21-5p performed in L4-L5 DRG obtained from WT and conditional miR-21 KO, DRG after intrathecal oligomers treatment as well as in macrophages after incubation with neuron-derived EVs. [score:1]
Fig. 8Intrathecal delivery of miR-21 antagomir prevents mechanical hypersensitivity and reduces macrophage numbers in the DRG following SNI injury. [score:1]
Our data provide evidence for an extracellular role of neuron-derived miR-21, which is released as part of exosomal cargo. [score:1]
Notably, the numbers of CD45 [+], F4/80 [+] CD11b [+], and CD206 [+] CD11c [+] cell populations were comparable after control, N4 and miR-21-5p transfection (Figs.   7a–d). [score:1]
miR-21 antagomir prevents nociceptive hypersensitivity. [score:1]
To assess whether macrophages phagocytosed neuron-derived exosomes, resulting in functional transfer of miR-21-5p, we incubated peritoneal macrophages with exosome-enriched media derived from pure sensory neurons in culture and made the following three observations. [score:1]
For antagomir transfection, cells (1 × 10 [6]/well) were allowed to adhere for 6 h at 37 °C and transfected with either miR-21-5p antagomir or scrambled control oligomer (1 μg; Exiqon). [score:1]
miR-21 antagomir modulates macrophage phenotype in DRG. [score:1]
Thus, to further investigate possible transfer of miR-21, we silenced miR-21-5p (Figs.   5b, c) and incubated macrophages with exosomes isolated from either non-viral transfected or miR-21 -overexpressing sensory neurons [24]. [score:1]
However, delivery of the miR-21-5p antagomir altered the macrophage profile in DRG ipsilateral to injury. [score:1]
The sections were acetylated with 1.35% triethanolamine/0.25% acetic anhydride/0.18% HCl and pre-hybridized in 50% formamide, 5× saline sodium citrate, 0.5 mg/ml yeast tRNA, 1× Denhardt’s solution prior to hybridization with a digoxigenin (DIG)-labeled probe complementary to mouse miR-21 (0.5 pmol, LNA miRCURY probe; Exiqon). [score:1]
To define the effect of increased intracellular miR-21-5p on macrophage polarization, we transfected primary peritoneal macrophages with either fluorescence-labeled miR-21-5p (miR-21-5p mimic) or the scrambled sequence termed N4. [score:1]
Macrophages (F4/80 [+] CD11b [+] 2–5000 cells) were sorted from a pool of ipsilateral L4/L5 DRG of SNI WT and miR-21 c KO using a FACS Aria II sorter (BD Bioscience). [score:1]
Scrambled oligomer and miR-21-5p antagomir (green) distribution in L5 DRG and co-localization with the neuronal marker β-tubulin (red; c, d, i) macrophage marker F4/80 (red; e, f, i), or the satellite cell marker GFAP (red; g– i). [score:1]
Thus, 7-day-intrathecal administration of a miR-21-5p antagomir, which accumulated predominantly in the cell bodies of sensory neurons in the DRG, resulted in a reduction in pro-inflammatory macrophage infiltration in the DRG and a significant behavioral antinociceptive effect. [score:1]
d Representative scatterplots of immune cells sorted from pools of ipsilateral L4 and L5 DRG obtained from WT mice or miR-21 c KO mice, on day-7 post SNI injury. [score:1]
Herein, we make two observations that demonstrate that DRG neurons are a critical cellular source of exosomes containing miR-21. [score:1]
Specifically, stimulation of sensory neurons in vitro with capsaicin induced release of miR-21-5p in a TRPV1 -mediated manner, suggesting that nociceptive neurons are a likely source of miR-21. [score:1]
Predictably, while very few F4/80 [+] cells were found in sham injury DRG (Figs.   1l, m), in the DRG ipsilateral to injury, infiltrating macrophages (F4/80 [+] cells) were observed in the vicinity of sensory neuron cell bodies containing miR-21 (Fig.   1n). [score:1]
Whether EVs transfer pre-miR-21 and/or induce transcription of miR-21 in macrophages remain interesting possibilities. [score:1]
l– o Immunostaining of macrophages (F4/80 [+] cells, red), FISH for miR-21 (green), and nuclei (4',6-diamidino-2-phenylindole (DAPI), blue) in sham and SNI DRG. [score:1]
Critically, delivery of the miR-21-5p antagomir did not have an effect on mechanical thresholds contralateral to injury (Fig.   8b). [score:1]
Fig. 7Transfection of peritoneal macrophages with miR-21-5p mimic reduces M2 and favors M1 phenotype. [score:1]
a Peritoneal macrophage transfection for 48 h with FAM-labeled miR-21-5p mimic or scrambled control N4, and co-localization of miR-21-5p and N4 (FAM-labeled, green) with F4/80 (macrophage marker, red); nuclear stain DAPI (blue). [score:1]
The mouse line miR-21, with a KO first conditional allele, was sourced from the Jackson Laboratory (accession number 36060). [score:1]
b No effect on contralateral nociceptive thresholds of miR-21-5p, scrambled oligomers, or vehicle. [score:1]
[1 to 20 of 117 sentences]
9
[+] score: 304
Other miRNAs from this paper: hsa-mir-21, mmu-mir-21b, mmu-mir-21c
In this study we first examined whether acute treatment with Cr(VI) can increase miR-21 expression and downregulate its target tumor suppressor protein PDCD4. [score:10]
It has been established that miR-21 directly targets the 3′ UTR region of PDCD4 and down-regulates its expression [18– 20]. [score:9]
BEAS-2B cells with miR-21 knock down also blocked the suppression of its target tumor suppressor, PDCD4 that normally occurs with chronic Cr(VI) treatment (Figure 7B). [score:8]
There was a significant decrease in the PDCD4 3′-UTR reporter activity when cells were treated with 5 μM Cr(VI) for 6 h, whereas reporter activity was upregulated when miR-21 gene expression was inhibited (Figure 1D). [score:8]
Interestingly, catalase overexpression in BEAS-2B cells significantly inhibited Cr(VI) -induced miR-21 elevation, PDCD4 suppression and malignant cell transformation. [score:7]
Exogenous addition of ROS inhibitors catalase or NAC inhibited the acute Cr(VI)- induced (L) miR-21 increase and (M) PDCD4 suppression. [score:7]
miR-21 binds to the 3′-UTR of the tumor suppressor PDCD4 to suppress its translation [4]. [score:7]
Stable knockdown of miR-21 and overexpression of PDCD4 inhibit Cr(VI) -induced malignant cell transformation and invasion. [score:6]
Down-regulation of PDCD4 expression by miR-21 leads to tumor cell growth, survival, chemoresistance, invasion and metastasis [4, 50]. [score:6]
Studies suggest that hydrogen peroxide (H [2]O [2]) can up-regulate miR-21 levels and decrease PDCD4 expression in vascular smooth muscle cells [53]. [score:6]
Stable knockdown of miR-21 and overexpression of PDCD4 or catalase inhibit Cr(VI) -induced malignant cell transformation and invasion. [score:6]
To substantiate a role for antioxidants in the Cr(VI) -induced malignant cell transformation mediated by increased miR-21 levels and PDCD4 suppression, we chronically treated BEAS-2B cells overexpressing catalase with Cr(VI) for six months. [score:5]
The expression levels of miR-21 and its downstream target protein PDCD4 were determined by real time PCR and florescence immunohistochemistry respectively in lung tissues from lung adenocarcinoma patients. [score:5]
Increased miR-21 and suppressed PDCD4 expression in Cr(VI)-exposed animals and xenograft tumors. [score:5]
In summary, we found that chronic Cr(VI) exposure increases miR-21 levels with an associated inhibition of PDCD4 expression, and cause malignant transformation in BEAS-2B cells. [score:5]
Inhibition of miR-21 or overexpression of PDCD4 results in decreased tumor formation and growth [51]. [score:5]
However, the Cr(VI) -induced miR-21 elevation and PDCD4 suppression were markedly reversed by treatment with the ROS inhibitors, NAC or Catalase (Figure 2L–2M). [score:5]
Our study shows that overexpression of catalase noticeably decreased the miR-21 elevation induced by chronic Cr(VI) treatment (Figure 7H) and suppressed the PDCD4 reduction (Figure 7I) in BEAS-2B cells with chronic Cr(VI) treatment. [score:5]
We found that chronic Cr(VI) exposure increased miR-21 levels and was associated with inhibition of PDCD4 expression and malignant cell transformation. [score:5]
Earlier studies showed that PDCD4, a novel tumor suppressor is an important functional target of the oncogenic microRNA miR-21 [33]. [score:5]
Antioxidants inhibit chronic Cr(VI) -induced miR-21 elevation and PDCD4 suppression. [score:5]
Furthermore, stable shut down of miR-21 and overexpression of PDCD4 in BEAS-2B cells significantly inhibited the chronic Cr(VI) -induced malignant transformation. [score:5]
These results demonstrated that the increased levels of oncomiR miR-21 and suppression of tumor suppressor PDCD4 are critically important for Cr(VI) -induced malignant cell transformation and invasion. [score:5]
Elevated miR-21 and suppressed PDCD4 expression in Cr(VI)-exposed animals and xenograft tumors. [score:5]
In addition we confirmed that stable knockdown of miR-21 or overexpression of PDCD4 reduce the tumorigenicity of chronic Cr(VI) exposed BEAS-2B cells in nude mice. [score:4]
In addition we also demonstrated that stable knockdown of miR-21 or overexpression of PDCD4 in BEAS-2B cells chronically exposed to Cr(VI) reduced tumorogenicity in nude mice. [score:4]
Tumors developed from BEAS-2B cells with stable knockdown of miR-21 and exposed to Cr(VI) (Figure 8H), and tumors formed from Cr(VI)-exposed BEAS-2B cells overexpressing PDCD4 (Figure 8I) were smaller than those of Cr(VI)-exposed-vector cells. [score:4]
As shown in Figure 3F, miR-21 promoter activity was significantly (p < 0.05) elevated by Cr(VI) or IL-6, while STAT3 knock down (siSTAT3) inhibited miR-21 promoter activity. [score:4]
Stable knockdown of miR-21 or overexpression of PDCD4 reduces the tumorogenicity of chronic Cr(VI) exposed BEAS-2B cells in nude mice (Figure 9D). [score:4]
Importantly, miR-21 knock down significantly inhibited the chronic Cr(VI) -induced malignant cell transformation (Figure 7C) and invasion (Figure 7D). [score:4]
BEAS-2B cells or BEAS-2B cells with stable overexpression of catalase or PDCD4 or BEAS-2B cells with stable knockdown of miR-21 were treated with 0.5 μM Cr(VI). [score:4]
BEAS-2B cells with (H) miR-21 knockdown, (I) PDCD4 overexpression and respective vector controls were exposed to Cr(VI) (0 or 0.5 μM) for 6 months, xenograft growth of tumors in nude mice was performed as described previously. [score:4]
miR-21 elevation and PDCD4 suppression contribute to Cr(VI) -induced malignant cell transformation. [score:3]
BEAS-2B cells were transfected with renilla reporter construct (pGL3-PDCD4_3′-UTR), miR-21 inhibitor (100 nM), negative control (100 nM), and pGL3-promoters and treated with 5 μM Cr(VI) for 6 h. Cellular lysates were subjected to a luciferase reporter analysis as described in Materials and Methods. [score:3]
To explore whether Cr(VI) exposure causes miR-21 elevation and PDCD4 suppression in vivo, BALB/c mice were nasally exposed to insoluble Cr(VI) particles for 3 months. [score:3]
Moreover, we found an significantly increased miR-21 levels associated with decreased PDCD4 expression in xenograft tumors generated with chronic Cr(VI) exposed BEAS-2B cells. [score:3]
Human miR-21 hairpin inhibitor was purchased from Thermo Fisher Scientific Dharmacon (Chicago, IL, USA). [score:3]
Moreover, high miR-21 levels were found to be inversely correlated with PDCD4 expression in a variety of tumors [18– 24]. [score:3]
For these studies, BEAS-2B cells stably expressing miR-21 shRNA, PDCD4, or vector, with or without Cr(VI) exposure for 6-month, were injected to nude mice. [score:3]
Cr(VI) increases miR-21 and targets PDCD4. [score:3]
Therefore, miR-21 and PDCD4 are potential targets for novel cancer prevention and therapeutics. [score:3]
As outlined above, we demonstrated that ROS plays an essential role in Cr(VI) -induced miR-21 elevation and PDCD4 suppression. [score:3]
Notably miR-21, a key oncogene, plays an important role in the initiation and progression of cancer [47] and is highly overexpressed in most cancers [48, 49]. [score:3]
We found a dose -dependent and significant (p < 0.05) increase in the miR-21 levels (Figure 4E) associated with a dose -dependent and drastic decrease in the PDCD4 expression (Figure 4F) with chronic Cr(VI) exposure. [score:3]
A recent study suggests that NADPH oxidase-derived ROS is essential for the expression and function of miR-21 [15]. [score:3]
Increased expression of miR-21 has been associated with a variety of processes including in carcinogenesis, apoptosis resistance, cell proliferation, tumor progression and chemoresistance [11– 14]. [score:3]
Consistent with our in vitro findings above, we found significantly increased miR-21 levels (Figure 8F) associated with decreased PDCD4 expression (Figure 8G) in xenograft tumors generated with chronic Cr(VI) exposed BEAS-2B cells. [score:3]
To explore whether Cr(VI) exposure causes miR-21 elevation and PDCD4 suppression in vivo, BALB/c mice were nasally exposed to insoluble Cr(VI) particles (1.2 mg/ml) for up to 3 months. [score:3]
Moreover, exogenous treatment of cells with catalase or NAC significantly inhibited the Cr(VI) -induced a rise in miR-21 and decreased PDCD4 levels. [score:3]
Cr(VI) -induced miR-21 increase and PDCD4 suppression contribute to malignant cell transformation. [score:3]
To investigate the role of antioxidants on chronic Cr(VI) -induced miR-21 elevation and PDCD4 suppression, we treated BEAS-2B cells overexpressing catalase with Cr(VI) (0.5 μM) for six months. [score:3]
We observed a dose -dependent and significant (p < 0.05) elevation in the miR-21 levels associated with a dose -dependent decrease in PDCD4 expression by RT-PCR and Western blot analysis respectively in human bronchial epithelial BEAS-2B cells treated with Cr(VI) (Figure 1A and 1B). [score:3]
We found an increase in miR-21 levels associated with PDCD4 suppression in the lungs of mice exposed to Cr(VI). [score:3]
Human embryonic kidney 293T cells (ATCC, Manassas, VA) were transfected with lentiviral packaging vectors (ABM, Richmond, BC, CA) and lentiviral vectors expressing miR-Off-has-miR-21-puro-GFP or miR-Off- puro-GFP by Lipofectamine™2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol [56]. [score:3]
Among them, miR-21 has emerged as a key onco-miR [6], since it is consistently overexpressed in a number of human malignancies [7– 10]. [score:3]
These results support the assumption that acute Cr(VI) treatment increases the miR-21 levels with an associated decrease in PDCD4 expression. [score:3]
The pLenti-III-miR-Off-has-miR-21-puro-GFP expression vector and the negative control vector pLenti-III-miR-Off- puro-GFP were purchased from Applied Biological Materials, Inc. [score:3]
As shown in Figure 7A, miR-21 knock down cells showed no increase in miR-21 levels even after chronic Cr(VI) treatment. [score:2]
The results show that chronic Cr(VI) exposure at 1.2 mg/ml induced an increase in miR-21 levels (Figure 8A) and decreased PDCD4 expression (Figure 8B–8C) in mouse lung tissue compared to control. [score:2]
For generating stable miR-21 knockdown cell lines, two days after transfection, supernatants containing viral particles were harvested and used to infect BEAS-2B cells at approximately 70% confluence in DMEM supplemented with 8 μg/ml of polybrene using lentifectin reagent (ABM technologies) following the manufacture's protocol. [score:2]
To determine the oncogenic role of miR-21 in Cr(VI) -induced malignant transformation and invasion, BEAS-2B cells with stable knocked down of miR-21 were treated with Cr(VI) (0.5 μM) for six months. [score:2]
In our preliminary analysis, we found increased miR-21 levels and decreased PDCD4 expressions in lung cancer cell lines (H2030, H460, H23, and A549) compared to those found in normal lung epithelial cells (BEAS-2B and NL-20). [score:2]
Our results showed increased miR-21 levels (Figure 8J) and decreased PDCD4 expression (Figure 8K) in the lung cancer cells (H2030, H460, H23, and A549) compared to normal lung epithelial cells (BEAS-2B and NL-20). [score:2]
These observations clearly demonstrate the indispensable role of ROS in regulating miR-21-PDCD4 signaling during chronic Cr(VI) -induced malignant cell transformation and invasion. [score:2]
Expression of miR-21-microRNA was determined by the TaqMan miRNA-assay (Applied Biosystems, Foster City, CA, USA), and normalized using the 2 [−ΔΔCT] -method relative to U6-snRNA. [score:2]
STAT3, known to be important for cancer initiation and tumor progression, was reported to bind directly to the miR-21 promoter upon IL-6 induction [28, 30, 52]. [score:2]
There are two phylogenetically conserved STAT3 binding sites in miR-21 that regulate its oncogenic activity [30]. [score:2]
Figure 7(A– D) BEAS-2B cells were stably knockeddown with miR-21 shRNA or their corresponding vehicle vector and exposed to Cr(VI) (0 or 0.5 μM) for 6 months. [score:2]
In short, our findings demonstrate an indispensable role for an miR-21-PDCD4 signaling axis in Cr(VI) -induced malignant cell transformation and lung carcinogenesis. [score:1]
The STAT3-miR-21 reporter was constructed as described previously [30]. [score:1]
STAT3 binding to the miR-21 promoter upon IL-6 induction has been reported previously [30]. [score:1]
To confirm these results, we examined the basal levels of miR-21 and PDCD4 in a variety of lung cancer cell lines. [score:1]
In this study we detail a mechanism for Cr(VI) -induced malignant transformation and the involvement of a miR-21-PDCD4 signaling process. [score:1]
It has been reported that transcriptional activation of miR-21 by STAT3 leads to the induction of a stable transformed state in cancer cell lines [28]. [score:1]
These data clearly suggest that Cr(VI) -induced IL-6 secretion mediates STAT3 activation, which is crucial for the rise in miR-21. [score:1]
However, the role of Cr(VI) -induced ROS in miR-21-PDCD4 signaling and malignant transformation is currently unclear. [score:1]
Importantly, Cr(VI) -induced ROS was essential for the miR-21 elevation and PDCD4 reduction. [score:1]
Cr(VI) also increased the binding of miR-21 to the 3′-UTR of PDCD4. [score:1]
ROS generation is critical to effect an acute Cr(VI) -induced miR-21 –PDCD4 signaling cascade. [score:1]
These results strongly demonstrate that this interactive miR-21-PDCD4 signaling plays an important role in Cr(VI) -induced malignant transformation. [score:1]
STAT3 binding to the miR-21 promoter upon IL-6 induction by Cr(VI). [score:1]
Moreover, the increased miR-21 and reduced PDCD4 levels brought about by chronic Cr(VI) treatments in BEAS-2B cells also induced malignant transformation. [score:1]
Figure 1BEAS-2B cells were exposed to increasing concentrations (0–5 μm) of Cr(VI) for 24 h. (A) The relative miR-21 level was determined by Taqman real-time PCR. [score:1]
In addition, Cr(VI) treatment also increased the binding of STAT3 on miR-21 promoter (Figure 3D–3E). [score:1]
Next we sought the role of Cr(VI) -induced ROS generation in miR-21- PDCD4 signaling. [score:1]
These results suggest that miR-21 and PDCD4 are critical components of Cr(VI) -induced malignant transformation. [score:1]
The levels of miR-21 increase and PDCD4 decrease in human lung adenocarcinoma tissue. [score:1]
Cr(VI) triggers the miR-21 increase via the IL-6/STAT3 pathway. [score:1]
In addition, STAT3 transcriptional activation by IL-6 was crucial for the Cr(VI) -induced miR-21 elevation. [score:1]
We investigated the effect of Cr(VI) on the interaction of miR-21-PDCD4 signaling and subsequent malignant cell transformation; both acute and chronic treatments of Cr(VI) induce miR-21 increases with an associated suppression of PDCD4. [score:1]
Furthermore, the binding of STAT3 on the miR-21 promoter was also increased with Cr(VI) treatment. [score:1]
We also explored the mechanisms by which Cr(VI) activates miR-21. [score:1]
BEAS-2B cells were exposed to increasing concentrations (0–5 μm) of Cr(VI) for 24 h. (A) The relative miR-21 level was determined by Taqman real-time PCR. [score:1]
These results provide solid evidence that ROS plays a key role in Cr(VI) -induced miR-21 elevation and PDCD4 reduction. [score:1]
These observations clearly emphasize a role for miR-21-PDCD4 signaling in Cr(VI) -induced transformation. [score:1]
The levels of miR-21 and PDCD4 in lung adenocarcinoma. [score:1]
We treated BEAS-2B cells with various concentrations (0.125, 0.25 and 0.5 μM) of Cr(VI) and measured the miR-21 levels and PDCD4 expression at two, four and six months. [score:1]
These results demonstrate the indispensable role of the miR-21-PDCD4 signaling axis in lung carcinogenesis. [score:1]
[1 to 20 of 98 sentences]
10
[+] score: 302
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-155, mmu-mir-21b, mmu-mir-21c
In miR-21 -deficient cells, miR-21 deficiency suppresses phosphorylation of Akt through promoting expression of PTEN, a direct target of miR-21 that functions as a negative regulator of Akt activation, thereby inhibits activation of mTOR and subsequent IRF7 expression and nuclear translocation to reduce IFNs production by pDCs. [score:13]
Instead, deficiency of miR-21 resulted in upregulation of its target PTEN, which suppressed phosphorylation of Akt, leading to defective activation of mTOR and its downstream targets p70S6K and 4E-BP1, thereby decreased the expression of IRF7 at post transcriptional level. [score:12]
As an example, miR-21 promotes TLR9 -induced Akt phosphorylation and the subsequent expression of type I and III IFNs by targeting PTEN in pDCs, whereas it negatively regulates TLR4 -induced IL-10 expression through targeting PDCD4 in macrophages. [score:10]
CpG stimulation led to decreased Pten expression in wild-type pDCs that is inversely correlated with CpG -mediated induction of miR-21 expression (Figure 1A), but did not affect the PTEN mRNA level in miR-21 -deficient pDCs (Figure 5A), indicating that miR-21 may directly regulate Pten gene expression in pDCs. [score:9]
Collectively, these data provide evidence that miR-21 modulates IFN-α and IFN-λ responses in pDCs through targeting PI3K-Akt-mTOR signaling to regulate IRF7 expression at translational level. [score:8]
The tumor suppressor gene PTEN is a validated target of miR-21, which displays an inverse correlation with miR-21 expression at the protein level in cancer cells (43). [score:7]
These data demonstrate that miR-21 facilitates Akt activation by inhibiting expression of PTEN, one canonical target of miR-21. [score:7]
Therefore, our study demonstrate that miR-21 regulates IRF7 expression and subsequent type I and III IFNs production via targeting PI(3)K-Akt-mTOR pathway in pDCs. [score:6]
Previous studies showed that miR-21 negatively regulated TLR -induced pro-inflammatory cytokine expression by targeting PDCD4 in macrophages (21, 22). [score:6]
To determine whether miR-21 regulates IRF7 expression through targeting mTOR pathway, we assessed TLR -induced mTOR activation by detecting its phosphorylation form in wild-type and miR-21 -deficient pDCs. [score:6]
In line with this view, miR-21 induction by TLR9 did not affect PDCD4 expression in pDCs (Figure S6B in), another established target of miR-21, which was previously identified as a regulator of type I IFN in macrophages (47). [score:6]
We thus tested whether miR-21 regulated Akt activation in pDCs through inhibition of PTEN expression. [score:6]
The subsequent nuclear translocation of IRF7 was also reduced in miR-21 null cells (Figures 3B,C), suggesting that miR-21 regulates expression of IFN-α and IFN-λ through modulating IRF7 expression at posttranscriptional level in pDCs. [score:6]
qPCR analysis showed that expression of Ifnl2/3 and Ifna was robustly induced in wild-type pDCs in response to CpG ODN stimulation, while expression of these two genes was much lower in miR-21 -deficient pDCs (Figure 1B), suggesting that miR-21 is required for efficient induction of Ifnl and Ifna in pDCs. [score:5]
Multiple validated targets of miR-21 have been identified, among which tumor suppressor phosphatase and tensin homolog (PTEN) and programmed cell death 4 (PDCD4) are the best described (20). [score:5]
In addition, we found that miR-21 deficiency did not alter the expression of Tlr9 in pDCs (Figure S4B in), indicating that the defective production of these IFNs by miR-21 -deficient pDCs is not due to a lower level of Tlr9 expression. [score:5]
We found that pharmacological inhibition of both PI3K and mTOR significantly suppressed TLR -induced IFN-λ production in wild-type and miR-21 -deficient pDCs (Figures 4C,D), suggesting that PI3K-Akt-mTOR activation is crucial for robust induction of IFN-λ in pDCs. [score:5]
We found that miR-21 deficiency did not affect Irf7 mRNA expression by pDCs on CpG stimulation (Figure 3A), but expression of IRF7 protein was significantly lower than that of wild-type pDCs after CpG stimulation. [score:5]
Hence, deficiency of PTEN further enhances IRF7 -mediated expression of IFN, which is consistent with our observation that induction of miR-21 by TLR stimulation decreased PTEN expression in pDCs. [score:5]
The results showed that deficiency of miR-21 significantly suppressed TLR -mediated phosphorylation of Akt without altering expression of total Akt (Figure 4B), indicating that miR-21 promotes mTOR activation through enhancing activation of the upstream kinase Akt in pDCs. [score:5]
Notably, CpG induced similar levels of IFN-λ in wild-type and miR-21 -deficient pDCs after pretreatment of PI3K inhibitor LY294002 or mTOR inhibitor rapamycin (Figures 4C–E), demonstrating that miR-21 promotes IFN-λ production by acting on PI3K-Akt-mTOR signaling. [score:5]
Figure S6Immunoblot analysis of nuclear factor-κB phosphorylation, IκBα expression (A), and programmed cell death 4 (PDCD4) expression (B) in wild-type and miR-21 -deficient Fms-like tyrosine kinase 3 ligand-plasmacytoid dendritic cells stimulated with CpG ODN (1 µM) for the indicated periods. [score:5]
In contrast, we found PTEN, as the target of miR-21, negatively regulated TLR -mediated production of IFN-α and IFN-λ in pDCs. [score:4]
Together, these data suggest that miR-21 is a critical positive regulator that promotes PI3K-Akt-mTOR signaling cascades during pDCs activation, which contributes to the maintenance of IRF7 protein expression. [score:4]
Here, we demonstrated that miR-21 positively regulated TLR -mediated production of IFN-α and IFN-λ by pDCs through targeting PTEN and mTOR signaling. [score:4]
Collectively, these data suggest that PTEN functions as a negative regulator of TLR -mediated IFN-λ production and is responsible for impaired IFN-λ expression in miR-21 -deficient pDCs. [score:4]
Having identified that miR-21 regulates TLR -mediated IFN-λ production through modulating PI3K-Akt-mTOR pathway, we next sought to investigate the direct target by which miR-21 regulates PI3K-Akt-mTOR signaling. [score:4]
In addition, induction of miR-21 in macrophages negatively regulated production of pro-inflammatory cytokines through targeting PTEN (22). [score:4]
Interestingly, PTEN has been identified as one of the direct targets of miR-21 (38). [score:4]
Interestingly, miR-21 expression can also be induced by type I IFNs, indicating that an amplification loop for induction of miR-21 takes place during viral infection (53). [score:3]
Interestingly, PTEN knockdown in miR-21 -deficient pDCs indeed restored TLR9 -induced IFN-λ production to a similar level compared to that in wild-type cells (Figure 5D), suggesting that PTEN is the key upstream molecule that suppresses IFN-λ response in miR-21 -deficient pDCs. [score:3]
In the present study, we demonstrated that the expression of miR-21 increased markedly in pDCs in response to TLR stimulation and miR-21 was required for optimal production of IFN-α and IFN-λ by pDCs. [score:3]
miR-21 Promotes IRF7 Expression and Nuclear Translocation in pDCs. [score:3]
Interestingly, miR-21 deficiency did not affect TLR -induced activation of canonical NF-κB signaling, a key transcription factor responsible for IFNs expression in pDCs. [score:3]
miR-21 Suppresses PTEN to Promote Akt Phosphorylation in pDCs. [score:3]
Mechanistic studies provided further evidence showing that miR-21 promoted production of type I and III IFNs through targeting PI3K-Akt-mTOR signaling pathway. [score:3]
It has been shown that PTEN is a validated target of miR-21 in other cell types (39). [score:3]
MicroRNA-21 is an abundantly expressed miR in multiple types of mammalian cells including immune cells. [score:3]
In summary, our findings demonstrate that miR-21 functions as a positive regulator for optimal production of type I and III IFNs by pDCs and provide clear evidence that the PI(3)K-Akt-mTOR pathway is involved in the regulation of IFN-λ production in pDCs. [score:3]
As a consequence, miR-21 expression enhanced host antiviral immune responses. [score:3]
Although miR-21 is expressed in many types of cells, we have verified that miR-21 exerts its antiviral effects primarily in immune cells using the bone marrow transfer approach. [score:3]
Taken together, these data reveal that miR-21 promotes expression of IFN-α and IFN-λ via modulating transcription factor IRF7 without altering activation of canonical NF-κB signaling. [score:3]
The expression of miR-21 can be significantly induced by various stimuli in many cell types. [score:3]
In contrast to high levels of IFN-λ and IFN-α induced by CpG stimulation, IFN-β is present at a negligible level in pDCs, and IFN-β expression did not differ significantly between wild-type and miR-21 -deficient pDCs (Figure S3B in). [score:3]
In contrast to the effects on IFN-α and IFN-λ production, lack of miR-21 did not affect expression of the prototypical pro-inflammatory cytokines IL-6 and TNF-α at mRNA and protein levels (Figure S5A in). [score:3]
Given that mTOR, p70S6K, and 4E-BP1 are all downstream targets of the kinase Akt (32), we next tested whether miR-21 deficiency also affected TLR -induced Akt activation. [score:3]
For example, studies have shown that elevation of miR-21 could orchestrate PI(3)K-Akt-mTOR signaling via targeting PTEN in various cell types including human colorectal cancer cells (43), bladder cancer cells (44), and glomerular mesangial cells (45). [score:3]
To investigate the mechanisms by which miR-21 modulates the expression of these IFNs, expression and nuclear translocation of IRF7 were examined. [score:3]
miR-21 mimic markedly decreased PTEN 3′UTR -driven luciferase activities in pDCs, but did not affect mutant PTEN 3′UTR -induced luciferase activities (Figure 5F), confirming that PTEN is also a validated target of miR-21 in pDCs (Figure 5G). [score:3]
Hence, miR-21 may serve as a potential target for modulating antiviral immune responses. [score:3]
Moreover, PTEN protein level was higher both at basal level and in CpG-stimulated condition in miR-21 -deficient pDCs than that in wild-type pDCs (Figure 5B), suggesting that the lack of miR-21 increases PTEN expression. [score:3]
miR-21 is expressed in many types of mammalian cells. [score:3]
Toll-like receptor stimulation can lead to apoptosis of pDCs, and it has been reported that miR-21 is involved in regulation of cell death (22). [score:2]
MicroRNA-21 expression is inducible by multiple stimuli in many types of mammalian cells (20). [score:2]
We found that deficiency of miR-21 does not affect development of bone marrow, splenic, or thymus DCs in vivo (Figures S1 and S2A–C in) and differentiation of DCs in vitro (Figure S3A in). [score:2]
Collectively, these data demonstrate that miR-21 contributes to host defense against viral infection likely via regulating the production of type I and III IFNs by pDCs. [score:2]
Of those, miR-146a, miR-155, and miR-21 induced by TLR activation serve as negative feedback regulators in inflammatory responses (17). [score:2]
However, whether miR-21 is also involved in regulation of TLR -mediated IFNs production remains unclear. [score:2]
These results prompted us to address whether miR-21 plays roles in regulation of DCs function. [score:2]
Overall, our study identifies miR-21 as a novel positive regulator of type I and III IFN in pDCs and suggests that miR-21 is crucial for modulation of pDCs activation and for promoting host antiviral immunity. [score:2]
Taken together, these results suggest that miR-21 functions as a selective regulator of IFN production in pDCs. [score:2]
miR-21 Facilitates Activation of PI3K-Akt-mTOR Signaling to Regulate IRF7 Protein Synthesis. [score:2]
These results demonstrate that miR-21 selectively promotes TLR -induced IFN-α and IFN-λ production by pDCs through regulating PI3K-Akt-mTOR activation both in vitro and in vivo. [score:2]
Therefore, FL-pDCs or splenic pDCs from wild-type and miR-21 -deficient mice were infected with HSV-1, a dsDNA virus that can be recognized by TLR9 to induce type I and III IFN production. [score:1]
In addition, similar results were also observed in miR-21 -deficient FL-pDCs when stimulated with a TLR7 agonist resiquimod (R848) (Figure 1E), indicating that defective production of IFN-λ and IFN-α by miR-21 -deficient pDCs is not restricted to TLR9 activation. [score:1]
To rule out the possibility that miR-21 deficiency in non-hematopoietic cells may impair IFNs production in vivo, we generated chimeric mice by transferring bone marrow cells from wild-type and miR-21 -deficient mice to C57BL/6 mice. [score:1]
Similarly, serum IFN-λ and IFN-α levels in miR-21 -deficient mice were also lower than those in wild-type mice infected with HSV-1 (Figure 2C). [score:1]
Here, we show that miR-21 is crucial for sufficient IFN-α and IFN-λ production in antiviral immune responses both in vitro and in vivo. [score:1]
Consistent with our observation with CpG stimulation, we found that miR-21 deficiency markedly impaired production of IFN-λ and IFN-α in response to HSV-1 infection in both FL-pDCs and splenic pDCs (Figures 2A,B). [score:1]
To rule out the possibility that the impaired production of IFN-λ and IFN-α was due to increased cell death of pDCs by miR-21 deficiency -induced apoptosis, we determined the apoptotic sensitivity of wild-type and miR-21 -deficient pDCs. [score:1]
We found that phosphorylation of p65 and IκBα exhibited a similar pattern between wild-type and miR-21 -deficient pDCs in response to CpG stimulation (Figure S6A in), suggesting that miR-21 deficiency does not affect canonical NF-κB activation in pDCs. [score:1]
miR-21 Is Required for Robust Production of IFN-λ and IFN-α by pDCs. [score:1]
Mutations within the putative miR-21 binding sites were generated by the following primers: forward, 5′-AACCGCGGTAAGAGAAATAAGCACCGTTTTCCAAG-3′ and reverse, 5′-AAAACGGTGCTTATTTCTCTTACCGCGGTTCAGATGTCTGAAGAT-3′. [score:1]
On CpG stimulation, wild-type and miR-21 -deficient FL-pDCs showed comparable viability (Figure S4A in), demonstrating that the impaired production of IFN-λ and IFN-α by miR-21 -deficient pDCs is not due to the poor cell viability. [score:1]
These findings suggest that induction of miR-21 appears to exert different effects in different cell types. [score:1]
qPCR analysis of Ifnl2/3 and Ifna mRNA in wild-type and miR-21 -deficient FL-pDCs stimulated with CpG ODN (1 µM) at indicated period. [score:1]
In addition, levels of HSV-1 DNA in the brain of miR-21 -deficient mice were higher than those of wild-type mice (Figure 2F). [score:1]
Therefore, the impaired production of IFN-α and IFN-λ caused by miR-21 deficiency in vivo is more likely due to defective pDCs function. [score:1]
miR-21 Promotes IFN-λ and IFN-α Production by pDCs during Viral Infection. [score:1]
Turning 21: induction of miR-21 as a key switch in the inflammatory response. [score:1]
To assess the role of miR-21 in pDC activation, FL-pDCs from wild-type and miR-21 -deficient mice were stimulated with CpG ODN for different periods. [score:1]
The type I IFN -induced miRNA, miR-21. [score:1]
ELISA of IFN-α (A) and IFN-λ (B) in serum from wild-type and miR-21 -deficient chimeras infected with HSV-1 (5 × 10 [6] pfu) via iv for 7 h. Data shown are mean ± SEM pooled from two independent experiments (n = 8). [score:1]
Transfection was performed in triplicate with Lipofectamine 2000 and 400 ng of the plasmids mixture (360 ng of the miR-21 mimic plasmid and 40 ng of the reporter vector). [score:1]
However, the exact functional outcome of such increase of miR-21 in pDCs is unclear. [score:1]
In addition, rapamycin pretreatment resulted in comparable levels of serum IFN-λ in wild-type and miR-21 -deficient mice in response to CpG stimulation in vivo (Figure 4F). [score:1]
In this study, we identified miR-21 as a key modulator required for TLR9 -induced robust production of IFN-α and IFN-λ by pDCs. [score:1]
To investigate whether PTEN is also a direct target of miR-21 in pDCs, we performed luciferase assay by co-transfection of miR-21 mimic with a PTEN 3′UTR or PTEN 3′UTR mutant reporter construct in FL-pDCs. [score:1]
Figure S4MicroRNA (miR-21) deficiency does not affect plasmacytoid dendritic cells (pDCs) viability and Tlr9 transcript level in toll-like receptor (TLR)-activated pDCs. [score:1]
ELISA of IFN-λ production in XCR1 [+] cDCs from wild-type and miR-21 -deficient mice stimulated with CpG (1 µM) for 20 h. Data shown are mean ± SEM of one representative (n = 8) from two independent experiments. [score:1]
Figure S2Flow cytometry analysis of cell population of bone marrow dendritic cells (DCs) (A), splenic DCs (B), and thymus DCs (C) from wild-type and microRNA-21 -deficient mice. [score:1]
Consistent with the pattern of mTOR activation, phosphorylation of p70S6K and 4E-BP1 induced by CpG stimulation was also decreased in miR-21 -deficient pDCs (Figure 4A). [score:1]
Littermates with genotypes of miR-21 [+/+] and miR-21 [−/−] mice were used for experiments. [score:1]
Consistently, protein levels of IFN-λ and IFN-α were also lower in the supernatants of miR-21 -deficient pDCs than those of wild-type cells (Figures 1C,D). [score:1]
Interestingly, we found that miR-21 was also highly induced in pDCs in response to TLR stimulation, and such induction might be an indicator of activation of pDCs. [score:1]
Similarly, viral loads in the TG of miR-21 -deficient mice were also higher than those in wild-type animals infected by HSV-1 via cornea (Figure 2G). [score:1]
Together, these results demonstrate that miR-21 deficiency impairs IFN-λ and IFN-α production during viral infection both in vitro and in vivo. [score:1]
Interestingly, we found that miR-21 was strongly induced in FL-pDCs in response to CpG ODN stimulation (Figure 1A), indicating that high level of miR-21 may be correlated with pDCs activation. [score:1]
On CpG stimulation, mTOR phosphorylation was strongly induced within 15 min and sustained for at least 1 h in wild-type pDCs, while phosphorylation of mTOR in miR-21 -deficient pDCs showed only a minimal increase (Figure 4A), suggesting that miR-21 is necessary for sufficient activation of mTOR. [score:1]
[1 to 20 of 99 sentences]
11
[+] score: 298
Other miRNAs from this paper: mmu-mir-155, mmu-mir-21b, mmu-mir-21c
When we combined the berberine and inhibitor treatments (inhibitor-Ber group), we found that the miRNA-21 expression levels of the 2- and 4-cell embryos and blastocysts in the inhibitor-Ber group were significantly higher than those in the inhibitor group (p < 0.05 for 2- and 4-cell embryos, p < 0.01 for blastocysts; Fig 2). [score:11]
Because we found higher levels of miRNA-21 expression in the 2- and 4-cell embryos and blastocytes cultured with berberine, we wanted to further explore the effect of berberine by comparing the levels of miRNA-21 in the 2- and 4-cell embryos and blastocysts treated with a miRNA-21 inhibitor alone (inhibitor group) to the levels of miRNA-21 in those treated with both berberine and a miRNA-21 inhibitor. [score:9]
The levels of miRNA-21 expression in the 2- and 4-cell embryos and blastocysts in the inhibitor group were all significantly lower than those in the control and NC groups (p < 0.01), indicating that a miRNA-21 inhibitor can be used to specifically reduce the miRNA-21 expression in embryos. [score:9]
In this study, by detecting the expression levels of miRNA-21 target genes in 2- and 4-cell and blastocyst stage embryos, we found that berberine reduced the expression of caspase-3 and PTEN, and increased the level of Bcl-2 expression in pre-implantation embryos. [score:9]
Berberine exerts pro-developmental and anti-apoptotic effects by increasing miRNA-21 expression, down -regulating PTEN and caspase-3, and up -regulating Bcl-2 expression. [score:8]
Wickramasinghe et al. found that estrogen up-regulates miRNA-21 and increases Bcl-2 expression, thereby inhibiting apoptosis [44]. [score:8]
Berberine treatment in embryos treated with the miRNA-21 inhibitor increased the Bcl-2 expression and decreased the expression of caspase-3 and PTEN compared to embryos treated with the miRNA-21 inhibitor alone. [score:8]
Effects of berberine on the in vitro development and apoptosis of pre-implantation embryos with inhibited miRNA-21 expression levelsTo further investigate the effects of berberine on embryos with inhibited expression of miRNA-21, we measured the rates of in vitro development and apoptosis. [score:7]
The tumor suppressor gene PTEN is directly regulated by miRNA-21, which mediates its expression in many tumor cell types [40– 41]. [score:7]
In conclusion, we found that miRNA-21 is necessary for pre-implantation embryonic development and the quality of pre-implantation embryonic development is closely related to the expression of apoptotic proteins that are regulated by miRNA-21, especially during blastocyst development in vitro. [score:7]
These results indicate that berberine promotes miRNA-21 expression in pre-implantation embryos, and is capable of increasing the miRNA-21 expression levels in embryos treated with a miRNA-21 inhibitor. [score:7]
Embryos microinjected with the miRNA-21 inhibitor (inhibitor group) or a negative control fragment of the miRNA inhibitor (negative control (NC) group) were cultured with mCZB basic medium. [score:7]
Expression of caspase-3 is inhibited by miRNA-21 that has also been shown to inhibit tumor cell apoptosis and increase cell proliferation [48]. [score:7]
In pronuclear embryos microinjected with a miRNA-21 inhibitor, there were significantly lower expression levels of miRNA-21 in 2- and 4-cell embryos and blastocysts than in control embryos, leading to lower development rates and cell numbers of blastocysts and to higher numbers of apoptotic cells and rates of apoptosis. [score:6]
In summary, miRNA-21 inhibitor treatment decreased the Bcl-2 transcript level and increased the caspase-3 and PTEN transcript levels in embryos, and berberine can partially nullify the effect of the inhibitor to improve pre-implantation embryo development in vitro. [score:6]
Effects of berberine on the in vitro development and apoptosis of pre-implantation embryos with inhibited miRNA-21 expression levels. [score:6]
This observation suggests that the development of many mouse embryos proceeds past the 2-cell stage, but these embryos cannot successfully develop into the blastocyst stage in vitro, and this block of development is closely related to the regulation of apoptotic protein expression by miRNA-21. [score:6]
These observations are in contrast to the findings in blastocysts treated with berberine, which showed relatively higher levels of miRNA-21 expression than blastocysts treated with a miRNA-21 inhibitor alone, as well as significantly higher developmental rates and cell numbers of blastocysts, and lower numbers of apoptotic cells and rates of apoptosis. [score:6]
Overall, berberine increased the expression of the miRNA-21-regulated anti-apoptotic gene Bcl-2 in the embryo and reduced the expression of the apoptotic genes caspase-3 and PTEN, combining to exert an anti-apoptotic effect in the embryo. [score:6]
Transcription levels of miRNA-21 target genes in different groups of pre-implantation embryos with inhibited miRNA-21. [score:5]
Additionally, we found in a previous study that icariin, which is a component from another TCM monomer, up-regulates miRNA-21 in pre-implantation embryos and exerts anti-apoptotic effects to improve development in vitro [27]. [score:5]
The levels of miRNA-21 expression in the 2- and 4-cell embryos and blastocysts in the berberine group were all significantly higher than those in the control and vivo groups (p < 0.01), and no differences were seen between the levels of miRNA-21 expression in the control and vivo groups (p > 0.05; Fig 2). [score:5]
Similarly treated embryos in the experimental group (inhibitor-Ber group) were microinjected with the miRNA-21 inhibitor and cultured in mCZB medium supplemented with berberine. [score:5]
Together, these results suggest that miRNA-21 is important for pre-implantation embryonic development, and that berberine increases miRNA-21 expression in pre-implantation embryos, which has an anti-apoptotic effect that enhances the quality of embryonic development in vitro. [score:5]
To further explore the effect of berberine on the promotion of embryonic development and reduction of apoptosis, we microinjected a miRNA-21 inhibitor into the pronuclear embryonic cytoplasm and then observed the development of pre-implantation embryos with reduced levels of miRNA-21. [score:5]
Through miRNA-21 up-regulation, Shen et al. found that interleukin-6 (IL-6) stimulates the anti-apoptotic IL-6/Stat3 pathway, increases cellular proliferation, reduces apoptosis, and promotes pre-implantation embryonic development [26]. [score:5]
The 50 nmol/L miRNA-21 inhibitor (AUC GAA UAC UCU GAC UAC AAC U, GenePharma, Shanghai, China) or a negative control fragment of the miRNA inhibitor was microinjected into the cytoplasm of pronuclear embryos in a volume of approximately 10 pL using a micromanipulator. [score:5]
MiRNA-21 directly regulates PTEN, PDCD4, TPM1, maspin, and many other genes, as well as affecting the expression of members of caspases and the Bcl protein family, which are associated with apoptosis and cell proliferation. [score:4]
There is a close relationship between miRNA-21 expression levels and pre-implantation embryonic development. [score:4]
In this study, by measuring miRNA-21 expression levels in 2- and 4-cell embryos and blastocysts, we found that berberine significantly increased miRNA-21 expression, which correlated with an improvement in embryonic development. [score:4]
0129527.g003 Fig 3Effect of berberine on embryonic in vitro development and apoptosis when miRNA-21 is inhibited. [score:4]
Effect of berberine on embryonic in vitro development and apoptosis when miRNA-21 is inhibited. [score:4]
Rates of development in embryos from the control group were set as the benchmark at a value of 1. (B) Cell numbers and rates of apoptosis in blastocysts treated with a miRNA-21 inhibitor. [score:4]
These data indicate that low levels of miRNA-21 may cause reduced blastocyst cell numbers, increased apoptotic cell numbers and apoptosis rates, and a reduced embryonic in vitro development rate, whereas berberine treatment could significantly improve embryonic development quality in embryos with low levels of miRNA-21. [score:3]
Transcription levels in embryos from the control group were set as the benchmark at a value of 1. Significance levels are indicated as in Fig 2. Transcription levels of Bcl-2, caspase-3, and PTEN in (A) 2-cell embryos, (B) 4-cell embryos, and (C) blastocysts, all treated with a miRNA-21 inhibitor (n = 3). [score:3]
Although caspase-3, PTEN, and Bcl-2 transcription levels were affected by berberine and the miRNA-21 inhibitor at all three stages, their protein levels were unchanged in 2- and 4-cell embryos. [score:3]
The effect of berberine on miRNA-21 expression in pre-implantation embryos. [score:3]
Additional experiments with embryo transfers are needed to verify the detrimental effects of miRNA-21 regulation and the rescue effect of berberine treatment on embryo implantation and postimplantation development. [score:3]
Microinjection of a miRNA-21 inhibitor. [score:3]
0129527.g005 Fig 5Transcription levels of Bcl-2, caspase-3, and PTEN in (A) 2-cell embryos, (B) 4-cell embryos, and (C) blastocysts, all treated with a miRNA-21 inhibitor (n = 3). [score:3]
The transcription levels of miRNA-21 target genes in different groups of pre-implantation embryos. [score:3]
Our results illustrate that the anti-apoptotic effects of berberine in pre-implantation embryonic development in vitro occur though the regulation of miRNA-21, and they provide new data to improve the pre-implantation embryonic culture microenvironment. [score:3]
However, the regulatory role and mechanisms of miRNA-21 in pre-implantation embryonic development are not yet clear. [score:3]
Transcription levels in embryos from the control group were set as the benchmark at a value of 1. Significance levels are indicated as in Fig 2. Given our above findings, we expanded our experiment to compare the transcript levels of Bcl-2, caspase-3, and PTEN in embryos and blastocysts treated with the miRNA-21 inhibitor. [score:3]
First, we confirmed that our negative control fragment (NC group) did not affect the baseline levels of miRNA-21 expression. [score:3]
The protein levels of miRNA-21 target genes in different groups of pre-implantation embryos. [score:3]
This approach allowed us to explore the regulation of miRNA-21 and berberine in an environment with very little miRNA-21 during pre-implantation embryonic development. [score:3]
Studies have suggested that miRNA-21 might be a diagnostic marker and/or treatment target for cancer [24– 25]. [score:3]
Transcription levels in embryos from the control group were set as the benchmark at a value of 1. Significance levels are indicated as in Fig 2. Given our above findings, we expanded our experiment to compare the transcript levels of Bcl-2, caspase-3, and PTEN in embryos and blastocysts treated with the miRNA-21 inhibitor. [score:3]
The effect of berberine on miRNA-21 target gene protein levels in pre-implantation embryos. [score:3]
It is likely that berberine acts via regulation of miRNA-21 at the blastocyst stage to exert an anti-apoptotic effect and promote embryonic development in vitro. [score:3]
In this study, we found that mouse embryos cultured in vitro from pronuclear embryos to blastocysts in medium supplemented with berberine exhibited an increase in miRNA-21 expression and a decrease in apoptosis rates. [score:3]
The effect of berberine on miRNA-21 target gene transcription in pre-implantation embryos. [score:3]
Using qPCR assays, we assessed mRNA expression levels of miRNA-21 with U6 as an internal reference, and of caspase-3 (5′-GGG CCT GTT GAA CTG AAA AA-3′ and 5′-CCG TCC TTT GAA TTT CTC CA-3′; 242 bp), PTEN (5′-CCC AGT CAG AGG CGC TAT GT-3′ and 5′-GAT ATC ACC ACA CAC AGG CAA TG-3′; 255 bp) and Bcl-2 (5′-TAC CGT CGT GAC TTC GCA GAG-3′ and 5′-GGC AGG CTG AGC AGG GTC TT-3′; 350 bp) with β-actin (5′-TGA CAG GAT GCA GAA GGA-3′ and 5′-CAG GAT AGA GCC ACC AAT C-3′; 110 bp) as the internal reference. [score:2]
When they knocked out miRNA-21, Chan et al. found an activation of caspases in glioma cells along with an increase in apoptosis [49]. [score:2]
The anti-apoptotic effects of berberine regulated through miRNA-21 appear to occur mainly during the blastocyst stage. [score:2]
Bcl-2 is an anti-apoptotic gene that is also regulated by miRNA-21. [score:2]
Many miRNAs have an important regulatory role in cell proliferation, apoptosis, and differentiation [22– 23], and miRNA-21 in particular has been found to exhibit anti-apoptotic effects in many cell and tissue types. [score:2]
Specifically, miRNA-21 plays an important role in regulating numerous biological and cellular processes and is a major anti-apoptotic factor [39]. [score:2]
To examine the effects of berberine on the transcription of miRNA-21 target genes that are involved in regulating apoptosis, we measured the levels of Bcl-2, caspase-3, and PTEN in 2- and 4-cell embryos and blastocysts cultured with (Ber) or without (control) berberine or isolated from mice as described in the methods (vivo). [score:2]
Significance levels are indicated as in Fig 2. To examine the effects of berberine on the transcription of miRNA-21 target genes that are involved in regulating apoptosis, we measured the levels of Bcl-2, caspase-3, and PTEN in 2- and 4-cell embryos and blastocysts cultured with (Ber) or without (control) berberine or isolated from mice as described in the methods (vivo). [score:2]
Using gene chip technology, Lee et al. found that regulation of miRNA-21 by DNA methylation plays a very important role in the transition from the morula to the blastocyst in mice [51], which supports our findings. [score:2]
Studies have shown that miRNA-21 regulates the anti-apoptotic capacity of pre-implantation mouse embryos [26]. [score:2]
These results are consistent with the regulation of miRNA-21 by berberine in pre-implantation embryos. [score:2]
To further investigate the effects of berberine on embryos with inhibited expression of miRNA-21, we measured the rates of in vitro development and apoptosis. [score:2]
Anti-apoptotic effect of microRNA-21 after contusion spinalcord injury in rats. [score:1]
To test if berberine treatment affects the levels of miRNA-21 expression, qPCR was used to measure the levels of miRNA-21 in the 2- and 4-cell embryos and blastocysts cultured with (Ber) or without (control) berberine or isolated from mice as described in the methods (vivo). [score:1]
Effect of berberine in blastocysts with reduced levels of miRNA-21 on total blastocyst cell numbers and apoptosis. [score:1]
The miRNA-21 transcription levels in 2- and 4-cell embryos and blastocysts various groups are shown (n = 3). [score:1]
Berberine alters miRNA-21 transcription levels in pre-implantation embryos. [score:1]
0129527.g002 Fig 2The miRNA-21 transcription levels in 2- and 4-cell embryos and blastocysts various groups are shown (n = 3). [score:1]
Next, we evaluated the effectiveness of the miRNA-21 inhibitor. [score:1]
The miRNA-21 level in embryos of the control group was set to 1. Different uppercase letters represent significant differences of p < 0.01, and different lowercase letters represent significant differences of p < 0.05. [score:1]
A link between the Interleukin-6/Stat3 anti-apoptotic pathway and microRNA-21 in preimplantation mouse embryos. [score:1]
There was no significant difference between the levels of miRNA-21 in the control and NC groups (p > 0.05). [score:1]
[1 to 20 of 75 sentences]
12
[+] score: 290
Other miRNAs from this paper: mmu-mir-21b, mmu-mir-21c
Software analysis and PCR array analysis showed an increase in the expression of p21 and p38 MAP kinases after the inhibition of miR-21 and decreased expression of cyclins and cyclin dependent kinases. [score:7]
We also looked at mRNA expression of cyclin dependent kinases, CDK2, CDK4, CDKE1 and CDKE2 and found their expression to be significantly reduced after inhibition of miR-21 (data not shown). [score:7]
To elucidate the functional role of miR-21 in renal cancer we inhibited the expression of miR-21 in A-498 renal cancer cells with a commercially available miR-21 inhibitor. [score:7]
Genistein inhibited the expression of miR-21 in A-498 cells and in the tumors formed after injecting genistein treated A-498 cells in nude mice besides inhibiting tumor formation. [score:7]
In groups of patients having low miR-21 expression (T/N<1.2), high expression (T/N = 1.2–10) and very high expression (T/N>10), the percent of those in early stage (Stage I) decreased by 80%, 51.5% and 37.5%, respectively. [score:7]
One of the genes up regulated in the PCR array after the inhibition of miR-21 was the cyclin dependent kinase inhibitor, CDKN1A also known as Cip1 or p21. [score:6]
Thus we believe that miR-21 can be used as a tumor marker and its inhibition may prove to be useful in controlling cancers with up-regulated miR-21. [score:6]
miR-21 increases the expression of cyclin dependent kinase inhibitor CDKN1A (p21). [score:5]
All patients with low miR-21 expression survived 5 years, while with high miR-21 expression, only 50% survived. [score:5]
Our analysis showed that very high expression of miR-21 in patient samples led to an increase in stage of the disease. [score:5]
The cell cycle showed a significant increase (9.1%) in the G0/G1 phase, with a concomitant reduction (6.8%) in the G2/M phase, indicating that the reduction of miR-21 expression in A-498 cells inhibited the cell growth and caused G0/G1 arrest (Figure 2a). [score:5]
Moreover, we show the chemo preventive role of genistein in inhibiting tumor formation in vivo by decreasing miR-21 expression in mouse tumors. [score:5]
0031060.g002 Figure 2 (a) Effect on cell cycle: Flow cytometry analysis of the cell cycle showed a significant increase in G0/G1 phase (9.1%), with a concomitant reduction in the G2/M phase (6.8%), indicating that the forced reduction of miR-21 expression in A-498 cells could inhibit the cell growth and cause G0/G1 arrest (p value 0.010). [score:5]
For patients with low miR-21 expression (Figure S1), all survived 5 years after surgery, while for those with high miR-21 expression (Figure S2), only 50% survived (Figure 1). [score:5]
Thus we tried to see if p21 was a direct target of miR-21 using the 3′ luciferase assay but we could not find a direct interaction. [score:4]
Cell cycle PCR array experiments showed that cDKN1A (p21) was up regulated after inhibition of miR-21 in A-498 cells. [score:4]
0031060.g004 Figure 4 Expression of p21, p38MAP kinase and cyclin E2 after the inhibition of miR-21 in A-498 cells, as compared to negative control. [score:4]
In conclusion, up-regulated miR-21 in kidney cancer may be a good tumor marker for kidney cancer diagnosis. [score:4]
Inhibition of miR-21 expression had a more pronounced effect on invasion as compared to migration, (reduction of 50% vs 25%). [score:4]
Expression of p21, p38MAP kinase and cyclin E2 after the inhibition of miR-21 in A-498 cells, as compared to negative control. [score:4]
The expression level of miR-21 was correlated with 5 year survival and the pathological stage. [score:3]
Functional studies after inhibiting miRNA-21 in RCC cell lines show cell cycle arrest, induction of apoptosis and reduced invasive and migratory capabilities. [score:3]
Following PCR, relative miR-21 expression levels in cancerous regions were normalised to their adjacent normal counterparts. [score:3]
In the case of anti-miR-21 transfection into Caki-2 cells the same level of reduction of miR-21 expression was observed (Figure S4). [score:3]
Firstly A-498 renal cancer cells were treated with 25 µM genistein for 4 days and subsequent to RNA extraction miR-21 expression was checked. [score:3]
In order to determine the role of miR-21 in renal cell carcinoma (RCC) functional assays such as cell cycle, apoptosis, invasion, and migration, were done after knocking down miR-21 expression in A-498 cells. [score:3]
Functional studies were done after inhibiting miR-21 in RCC cell lines. [score:3]
The different forms of cancers in which the expression of miR-21 was analyzed were clear cell carcinoma, papillary carcinoma and tubular carcinoma. [score:3]
As mentioned earlier we checked the effect of a chemoprevention agent, genistein (a soy product), on the expression of miR-21 in nude mouse tumors. [score:3]
MicroRNA-21 is up-regulated in a variety of cancers like, breast, colorectal, lung, head and neck etc. [score:3]
To see the effect of miR-21 expression on different genes involved in the cell cycle and apoptosis we used PCR arrays. [score:3]
The single tubular renal cell carcinoma sample had very high miR-21 expression. [score:3]
Figure S4 Expression levels of miR-21 after knockdown in Caki-2 cells: The miR-21 level was reduced by more than 99% (1.0 to 0.011), as compared to the negative control. [score:3]
The effects of miR-21 inhibition on the cell cycle and apoptosis were analyzed by flow cytometry. [score:3]
Also, lower expression of miR-21 leads to a higher survival rate. [score:3]
We studied in vitro and in vivo effects of the chemo preventive agent genistein on miR-21 expression. [score:3]
MicroRNA-21 is up-regulated in a variety of cancers, such as breast, colorectal, lung, head and neck, etc. [score:3]
0031060.g001 Figure 1 The expression of miR-21 was graded as either low (T/N<1.2), high (T/N = 1.2–10) and very high (T/N>10). [score:3]
Our study shows for the first time that patients with a higher expression of miR-21 in renal cancer have a lower probability of survival. [score:3]
However to date there is no data which relates clinical correlation of miR-21 expression with the stage and survival of renal cancer patients. [score:3]
Figure S1 miR-21 levels in patients having low expression (<1.2): Low levels of miR-21 in patients with 100% survival. [score:3]
A498 and Caki-2 cells were transiently transfected with either an inhibitor of miRNA-21 or anti-miR negative control #1 (from Ambion, Austin, TX, USA), using X-tremeGENE siRNA transfection reagent (Roche Diagnostics Indianapolis, IN, USA) according to the manufacturer's protocol. [score:3]
Genistein reduces the expression of miR-21 in mouse tumors. [score:3]
We also correlated the expression of miR-21 with the stage of the cancer for those patients that we had complete information regarding the stage (34/39). [score:3]
Figure S3 Expression levels of miR-21 after knockdown in A-498 cells: The miR-21 level was reduced by more than 99% (1.0 to 0.030), as compared to the negative control. [score:3]
This led us to search for potential cell cycle genes affected by inhibition of miR-21 in A-498 cells. [score:3]
The expression level of miR-21 correlated with 5 year survival and stage of the patients. [score:3]
Furthermore, we also assessed the effect of a dietary chemoprevention agent, genistein (a soy product), on the expression of miR-21 in mice tumors. [score:3]
miR-21 expression in A-498 cells was about 7.3× that of HK-2 cells while that of Caki-1 was 1.6×, and Caki-2, 3×. [score:3]
A-498 cells were transfected with anti-miR-21 inhibitor and anti-miR-Negative control. [score:3]
0031060.g005 Figure 5 In vitro and In vivo effect of genistein on the expression of miR-21. [score:3]
miR-21 was one of the first miRNAs detected in the human genome [37] and has been found to be overexpressed in a variety of cancer types [38]. [score:3]
Since we saw a significant effect on the cell cycle by inhibition of miR-21 in A-498 cells, we first decided to use PCR arrays related to cell cycle genes. [score:3]
Western blotting experiments clearly show up regulation of both p21 and p38 MAP kinase genes with miR-21 inhibition as compared to the negative control. [score:3]
In vitro and In vivo effect of genistein on the expression of miR-21. [score:3]
Expression of miR-21 in different forms of renal cell cancer. [score:3]
Higher expression of miR-21 is associated with an increase in the stage of renal cancer. [score:3]
To see the effect of genistein treatment on mice tumors and miR-21 expression A-498 cells were again treated with genistein (25 µM) and after 96 hours of treatment were injected subcutaneously into nude mice. [score:3]
Correlation of miR-21 expression with stage and survival in renal cancer. [score:3]
Figure S2 miR-21 levels in patients having high expression (>1.2): High levels of miR-21 in patients with 50% survival. [score:3]
In vitro and In vivo effects of genistein on renal cancer cellsAs mentioned earlier we checked the effect of a chemoprevention agent, genistein (a soy product), on the expression of miR-21 in nude mouse tumors. [score:3]
Effect on cell invasion and migration on A-498 cells after miR-21 inhibition. [score:3]
This is the first study which shows the correlation of miR-21 expression with clinical parameters and it's functional role in RCC. [score:3]
A recent report on the role of miR-21 in renal cancer shows that it modulates apoptosis through targeting several genes by Zhang et. [score:3]
The expression level of miR-21 was correlated with 5 year survival and stage of the patients. [score:3]
Correlation of miR-21 expression with 5 year survival of renal cell carcinoma patients. [score:3]
In both clear cell (71.1%) and papillary carcinoma (75%) the majority of samples had high expression of miR-21 (T/N = 1.2–10). [score:3]
This implies that increased expression of miR-21 correlates with an increased stage of renal cancer. [score:3]
In case of Caki-2 cells inhibition of miR-21 resulted in a significant increase in apoptosis with no change in cell cycle (data not shown). [score:3]
Effect on cell cycle and apoptosis after knocking down miR-21 in A-498 cells. [score:2]
after the knock down of miR-21 in A-498 cells. [score:2]
The expression of miR-21 in both kidney cancer cell lines and human kidney cancer tissue samples was found to be higher as compared to normal, which is in accordance with previous studies on renal cell carcinoma and also other types of cancer [15]. [score:2]
In the present study we provide evidence that up regulation of miR-21 in renal cell carcinoma is related to lower survival of kidney cancer patients. [score:2]
miR-21 is up regulated in renal carcinoma tissue samples and renal cancer cell lines. [score:2]
Genistein reduced the expression of miR-21 in mice injected with genistein treated cells as compared to vehicle controls. [score:2]
However, the regulation and functional role of miR-21 in kidney cancer has not yet been systematically studied. [score:2]
Cell viability assays showed an anti proliferative effect on A-498 cells after the inhibition of miR-21. [score:2]
This may account for the not so dramatic increase in the number of cells undergoing apoptosis after the inhibition of miR-21 in A-498 cells as compared to changes in cell cycle progression Figure 2b. [score:2]
However, the regulation of miR-21 in renal cell carcinoma (RCC) has not yet been studied systematically. [score:2]
The expression of miR-21 was found to be reduced by ∼40% in genistein treated samples as compared to untreated ones (data not shown). [score:2]
using flow cytometry showed a marginal increase in the number of total apoptotic cells (early apoptotic plus apoptotic) (5.17%) in the miR-21 anti-miRNA inhibitor transfected cells as compared to the negative control (1.79%) and mock (2.49%) (Figure 2b). [score:2]
0031060.g003 Figure 3 (a) Effect on cell invasion: Invasive properties of A-498 cells were decreased after the inhibition of miR-21 as compared to the negative control, Stained A-498 cells (Magnification-40×); Absorbance at 560 nm (p value 0.026). [score:2]
In conclusion this is the first report to correlate miR-21 levels with survival and stage of renal cancer patients and documents the oncogenic role of miR-21 through various cellular pathways. [score:1]
To determine whether miR-21 affects renal cancer cell migration and invasion a cytoselect 24-well cell migration and invasion kit was used. [score:1]
Functional role of miR-21 in A-498 cells. [score:1]
Expression of miR-21 was measured by real-time PCR. [score:1]
The current study shows a clear correlation between miR-21 expression and clinical characteristics of renal cancer. [score:1]
No correlation between tumor grade and miRNA-21 levels was observed. [score:1]
In 48 cases (89%), miR-21 was found to be increased (T/N [Tumor/Normal] was greater than 1.2). [score:1]
Expression of miR-21 was also measured in renal cancer cell lines, A-498, Caki-1, Caki-2 and normal HK-2 cells. [score:1]
In 48 cases (90%), miR-21 was increased. [score:1]
After the formation of palpable tumors with control cells, we excised the tumors and measured the expression of miR-21 subsequent to the tumor homogenization with Qiazol and RNA extraction. [score:1]
There are a few studies documenting the functional relevance of miR-21 by showing the cause and effect relationship between miR-21 and neoplastic transformation. [score:1]
[1 to 20 of 93 sentences]
13
[+] score: 289
Target analysis of miRNA expression revealed that Curcumin down-regulates the expression of pro-oncogenic miR-17-5p, miR-20a, miR-21, and miR-27a in human colo-rectal carcinoma cell lines. [score:10]
Moreover the downregulation of miR-21 expression restrains non-small cell lung cancer cell proliferation and migration through upregulation of programmed cell death 4 protein [36]. [score:9]
AMO-miR-21 down-regulated mature miR-21 expression level and partially induced up-regulation of PDCD4 level [37]. [score:9]
Mudduluru et al [15] showed that Curcumin suppresses tumor growth and metastasis in colorectal cancer through downregulation of miR-21, a microRNA often found overexpressed in several cancers. [score:8]
On the contrary in K562 and LAMA84 cells transfected with miR-21 inhibitor and treated with Curcumin, we observed a higher increase of PTEN mRNA expression than CML cells transfected with miR-21 inhibitor alone (Figure 4d, white bars). [score:7]
On the contrary in K562 and LAMA84 cells transfected with miR-21 inhibitor and treated with Curcumin, we observed a higher decrease of VEGF mRNA expression than CML cells transfected with miR-21 inhibitor alone (Figure 6b, white bars with black dots). [score:7]
To test whether Curcumin treatment induces a modulation of miR-21 expression, thus inhibiting its target PTEN, K562 and LAMA84 cells were incubated with 20 and 40 μM of Curcumin after the transfection of pEZXMT01 vectors. [score:7]
Zhang et al showed that the inhibition of miR-21 and concomitant upregulation of PTEN mediates the anticancer activities of Curcumin in NSCLC cells [29]. [score:6]
We found that the decrease of cellular miR-21, significantly up-regulated the expression of PTEN (Figure 4) modulating the phosphorylation of AKT (Figure 5). [score:6]
Reduced levels of miR-21 in CML cells induce PTEN expression and consequently a decrease of AKT phosphorylation and a down regulation of VEGF expression and release. [score:6]
MiR-21 regulates tumor growth, invasion and metastasis by targeting multiple tumor suppressor genes such as PTEN [17]. [score:5]
It was demonstrated that decreased expression of miR-21 in human lung cancer cells by inhibition of NOX (NADPH oxidase) reduces metastasis [35]. [score:5]
MiR-21 expression was knocked down in CML cells using the miR-21 inhibitor (2′-OMe-miR-21), as demonstrated with real time PCR assay (Figure 1Sb). [score:5]
On the contrary in K562 and LAMA84 cells transfected with miR-21 inhibitor and treated with Curcumin, we observed a higher decrease of VEGF release than CML cells transfected with miR-21 inhibitor alone (Figure 6c, white bars with black dots). [score:5]
b. VEGF expression in K562 and LAMA84 cells transfected with miR-21 mimic, miR-21 inhibitor or scramble, was determined by quantitative real time PCR analysis. [score:5]
Inhibition of miR-21 in K562 and LAMA84 cells increased PTEN mRNA expression (Figure 4d). [score:5]
The transfection of miR-21 mimic, antagonizing the induction of PTEN expression, increased VEGF mRNA expression (Figure 6b). [score:5]
d. PTEN expression in K562 and LAMA84 cells transfected with miR-21 mimic, miR-21 inhibitor, treated or not with 20 μM Curcumin, or scramble was determined by quantitative real time PCR analysis. [score:5]
It was demonstrated that Difluorinated Curcumin (CDF) [40], a nontoxic analog of Curcumin modulated the expression of miR-21 and PTEN in pancreatic cancer and inhibited the growth of colon cancer cells [40]. [score:5]
Figure 6 b. VEGF expression in K562 and LAMA84 cells transfected with miR-21 mimic, miR-21 inhibitor or scramble, was determined by quantitative real time PCR analysis. [score:5]
In order to investigate if Curcumin modulated the miR-21 expression or induced a selective packaging of miR-21 in exosomes, K562 and LAMA84 cells were cotreated with 20–40 μM Curcumin and 1 μM of GW4869, a specific neutral sphingomyelinase (nSMase) 2 inhibitor, also known as an inhibitor of exosomes release [25, 28]. [score:5]
MiRNA target prediction algorithm indicates that PTEN is a predictive target of miR-21. [score:5]
Transfection of miR-21 inhibitor (2′-OMe-miR-21) in CML cells, caused a decrease of VEGF mRNA expression, similar to Curcumin treatment (Figure 6b), as demonstrated with real time PCR assay. [score:4]
In order to evaluate, in K562 and LAMA84 cells, if downregulation of PTEN expression in miR-21 mimic transfected cells was reverted after the addition of Curcumin, we treated the miR-21 mimic transfected CML cells with 20 μM Curcumin. [score:4]
Our results are in line with other studies that demonstrated the effects of Curcumin on cancer cell survival through down-regulation of miR-21 and increase of PTEN. [score:4]
These data indicate that Curcumin caused a decrease of miR-21, in K562 and LAMA84 cells, and consequently an increase of PTEN, its direct target. [score:4]
To further demonstrate the role of miR-21 in the modulation of PTEN levels we knocked down miR-21 in CML cells using the miR-21 inhibitor (2′-OMe-miR-21). [score:4]
Down regulation of miR-21, by transfection of miR-21 inhibitor into K562 cells containing PTEN-pEZX, increased the activity of firefly luciferase respect to untransfected K562 cells, similarly to Curcumin treatment. [score:4]
As shown in Figure 6b (white bars), Curcumin counteracted the effect of the transfection with miR-21 mimic, causing a decreased expression of VEGF mRNA. [score:3]
A number of miR-21 target genes have been identified, including PTEN, PDCD4, and BTG2, which play important roles in the oncogenic process [34]. [score:3]
c. VEGF protein level, assessed by ELISA, in conditioned medium of K562 and LAMA84 cells transfected with miR-21 mimic, miR-21 inhibitor treated or not with 20 μM Curcumin, or scramble or treated with 20 and 40 μM of Curcumin, for 24 hours. [score:3]
The expression of miR-21 was tested by miScript PCR System (QIAGEN, Hilden, Germany). [score:3]
The transfection with miR-21 inhibitor caused a reduction of the colonies size respect to control cells, similarly to Curcumin treatment. [score:3]
Transfection of K562 and LAMA84 cells with miR-21 mimic or inhibitor. [score:3]
Figure 3K562 (a) and LAMA84 (b) cells transfected with PTEN-pEZX were also contrasfected with miR-21 inhibitor or miR-21 mimic. [score:3]
was also performed with K562 and LAMA84 cells transfected with miR-21 mimic and inhibitor. [score:3]
As shown in Figure 2, we found no statistically significant difference of pre-miR-21 expression level in K562 (Figure 2e) and LAMA84 cells (Figure 2f) in the different experimental conditions. [score:3]
Transfection of miScript miR-21 inhibitor (QIAGEN, Hilden, Germany) or miScript miR-21 mimic in CML cells (QIAGEN, Hilden, Germany) was performed according Fast-Forward Transfection protocol (QIAGEN, Hilden, Germany). [score:3]
Figure 7 a. shows that Curcumin treatment caused a decrease of K562 and LAMA84 colonies area with respect to control cells b. Quantitative analysis of colonies area of K562 and LAMA84 cells treated with 20 and 40 μM of Curcumin and/or transfected with miR-21 mimic and miR-21 inhibitor. [score:3]
Inhibition of miR-21 in CML cells decreased the AKT phosphorylation similar to Curcumin treatment. [score:3]
Difluorinated Curcumin (CDF), a nontoxic analog of the dietary ingredient Curcumin has been shown to modulate the expression of miR-21 and PTEN in pancreatic cancer [16]. [score:3]
Real time PCR analysis shows the overexpression efficiency of miR-21, in CML cells transfected with miR-21 mimic (Figure S1b). [score:3]
K562 and LAMA84 cells were cotransfected with 6 pmol miR-21 mimic or miR-21 inhibitor using Attractene Transfection Reagent (QIAGEN, Hilden, Germany) according to manufacturer's protocol. [score:3]
As shown in Figure 4d (black bars with white dots), Curcumin counteracted the effect of the transfection with miR-21 mimic, decreasing the expression of PTEN mRNA. [score:3]
Other groups demonstrated that antisense oligonucleotide against miR-21 inhibits migration and induces apoptosis in leukemic K562 cells [38]. [score:3]
K562 (a) and LAMA84 (b) cells transfected with PTEN-pEZX were also contrasfected with miR-21 inhibitor or miR-21 mimic. [score:3]
Our data indicate that the Curcumin treatment induces an exosomes -mediated decrease of miR-21 that in turn causes the modulation of PTEN expression in CML cells, confirmed by the study of gain and loss of function for miR-21. [score:3]
Previous results showed that also in our mo del, miR-21 targets the 3′ UTR of PTEN mRNA. [score:3]
AKT phosphorylation, assessed by ELISA, in K562 c. and LAMA84 d. cells transfected with miR-21 mimic, miR-21 inhibitor or scramble and/or treated with 20 μM of Curcumin. [score:3]
Conditioned medium (CM) of K562 and LAMA84 cells, treated with (10, 20, 40 μM) Curcumin, transfected or not with miR-21 mimic or inhibitor, was collected from cells after 24 hours of incubation. [score:3]
K562 and LAMA84 cells, treated with (20, 40 μM) Curcumin, transfected or not with miR-21 mimic or inhibitor, were collected and lysated. [score:3]
On the contrary, the addition of miR-21 mimic caused, as expected, a decrease of PTEN expression (Figure 4d). [score:3]
Our current data show an inverse relationship between miR-21 and PTEN and support the role of Curcumin on modulation of the PTEN expression, via a selective packaging of miR-21 in CML exosomes (Figure 10). [score:3]
Values are the mean ± SD of 3 independent experiments * p ≤ 0.05, ** p ≤ 0.01. b. Quantitative analysis of colonies area of K562 and LAMA84 cells treated with 20 and 40 μM of Curcumin and/or transfected with miR-21 mimic and miR-21 inhibitor. [score:3]
Figure 5AKT phosphorylation, assessed by ELISA, in K562 c. and LAMA84 d. cells transfected with miR-21 mimic, miR-21 inhibitor or scramble and/or treated with 20 μM of Curcumin. [score:3]
The miRNA-21 has been indicated as a miRNA overexpressed in several solid tumors; miR-21 is involved in a number of steps of tumor progression, such as proliferation, angiogenesis, antiapoptotic and response to chemotherapy. [score:3]
In this study, we show in in vitro and in vivo mo dels that treatment of CML cells with Curcumin caused a miR-21 -mediated modulation of PTEN/AKT pathway leading to the inhibition of leukemic cell growth. [score:3]
MiR-21 targets PTEN 3′-UTR mRNA. [score:2]
e. pre-MiR-21 expression in K562 cells treated with 20 and 40 μM of Curcumin, for 24 hours, was determined by quantitative real time PCR analysis. [score:2]
In order to exclude the possibility that Curcumin treatment of K562 and LAMA84 cells could directly affect miR-21 expression, we measured, by Real Time PCR, the levels of miR-21 precursor (pre-miR-21) in K562 and LAMA84 cells. [score:2]
In order to confirm the effects of Curcumin on VEGF protein release, we performed an ELISA assay on conditioned medium of K562 and LAMA84 cells treated with 20 and 40 μM Curcumin, for 24 h. As shown in Figure 6 addition of Curcumin caused a dose -dependent decrease of VEGF released from CML cells (Figure 6c), we observed similar effects after transfection of miR-21 inhibitor both in K562 and LAMA84 cells (Figure 6c). [score:2]
The role of miR-21 was further demonstrated by performing an ELISA assay of CML cells lysates, after transfection with an inhibitor or mimic of miR-21 (Figure 5c and 5d). [score:2]
f. pre-MiR-21 expression in exosomes released by LAMA84 cells treated with 20 and 40 μM of Curcumin and/or GW4869 1 μM, for 24 hours, was determined by quantitative real time PCR analysis. [score:2]
Our data indicate that the Curcumin treatment induces in CML cells, a dose -dependent regulation of AKT phosphorylation, confirmed by the study of gain and loss of function for miR-21. [score:2]
On the contrary, the ELISA assay indicated that the overexpression of miR-21 in CML cells increased AKT phosphorylation (Figure 5c and 5d). [score:2]
Now we hypothesized a novel role for exosome release as a route to cellular disposal of an oncogenic miRNAs, such as miR-21, as a consequence of Curcumin treatment. [score:1]
The constructs were designed based on the sequence of miR-21 binding sites. [score:1]
miScript miR-21 (2′-O-Me-miR-21) or miScript miR-21 mimic (2 μM) were diluted in 100 μl culture medium without serum to obtain a final 5 nM miRNA concentration. [score:1]
Few studies have focused on the role of miR-21 in CML progression. [score:1]
Overall, these data confirmed our hypothesis that the anticancer effects of Curcumin may occur through the miR-21 selective packaging in exosomes. [score:1]
On the contrary, miR-21 was enriched in exosomes released by K562 and LAMA84 cells, after treatment with 20 and 40 μM of Curcumin (Figure 2a and b). [score:1]
Our results indicate that Curcumin might exert anticancer effects through elimination of miR-21, via exosomes. [score:1]
Figure 10 Curcumin caused a decrease of cellular levels of miR-21 and a concomitant increase of its amount in exosomes. [score:1]
In order to support our hypothesis that the decrease of miR-21 was determined by a selective enrichment of this miRNA in CML exosomes, we cotreated CML cells with GW4869 1 μM and Curcumin 20–40 μM. [score:1]
Real time PCR analysis indicated that exosomes released in the plasma of the treated mice were enriched in miR-21 with respect control mice (Figure 9c). [score:1]
In this study, we provide evidence that the effects of Curcumin may affect in vitro and in vivo malignant properties of CML cells and we suggest that these effects are mediated by a disposal of miR-21 in exosomes released by CML cells. [score:1]
We showed that Curcumin caused a decrease of miR-21, but not pre-miR-21, in CML cells after Curcumin treatment. [score:1]
The miR-21 levels were tested by miScript PCR System (QIAGEN, Hilden, Germany) following extraction of RNA from 500 μl of plasma collected from mice treated with Curcumin and control mice, treated with vehicle (corn oil). [score:1]
In order to confirm the effect of Curcumin on the sorting of miR-21 in exosomes, we cotreated CML cells with 1 μM GW4869 and 20 μM Curcumin. [score:1]
Overall, these data indicated an antineoplastic role of Curcumin in CML cells, by a selective packaging of miR-21 in exosomes and an increase of miR-196b in CML cells suggesting that Curcumin could be a potential therapeutic agent for CML. [score:1]
Real time PCR analysis showed the transfection efficiency of miR-21 mimic, in K562 and LAMA84 cells (Figure S1c). [score:1]
Li et al demonstrated that anti-miR-21 oligonucleotides (AMO-miR-21) sensitized K562 cells, to arsenic trioxide by inducing apoptosis. [score:1]
We confirmed that miR-21 binds to PTEN 3′UTR mRNA using a Firefly/Renilla Duo-Luciferase reporter vector (pEZX-MT01) where the 3′ UTR of PTEN was cloned downstream of the firefly luciferase gene (PTEN-pEZX). [score:1]
The effects of the transfection with miR-21 mimic reverted after the treatment with Curcumin (Figure 6c, white bars), causing a decrease of VEGF release. [score:1]
In order to support our hypothesis that the decrease of miR-21 was determined by a selective enrichment of this miRNA in CML exosomes, we treated leukemia cells with GW4869 1 μM, (Figure 5a and b) and this treatment caused an increase of AKT phosphorylation. [score:1]
On the contrary, as shown in Figure 6c, the transfection of miR-21 mimic in K562 and LAMA84 cells, induces an increase of secreted VEGF. [score:1]
Curcumin decreases miR-21 levels in CML cells. [score:1]
On the contrary, we observed an increase of miR-21 in the exosomes released by CML cells after addition of Curcumin (Figure 2). [score:1]
We suggest that in CML, Curcumin probably acts through an enhanced disposal of miR-21 in exosomes and that this mechanism may contribute to the antileukemic effect. [score:1]
In order to confirm the effect of Curcumin on decrease of miR-21 through its sorting in exosomes, we cotreated K562 cells with 1 μM GW4869 and 20 and 40 μM Curcumin. [score:1]
Curcumin caused a decrease of cellular levels of miR-21 and a concomitant increase of its amount in exosomes. [score:1]
In contrast, luciferase activity decreased when K562 cells containing PTEN-pEZX were transfected with miR-21 mimic. [score:1]
[1 to 20 of 92 sentences]
14
[+] score: 274
This targeted regulation of miR-21 on PDCD4 lead to down-regulation of both mRNA expression of c-FOS and its protein phosphorylation (p-c-fos) level (Fig. 5g, Supplementary Fig. S3d), which is a critical transcription factor for osteoclastogenesis 5. In addition, we showed up-regulation of PDCD4 and down-regulation of p-c-fos in bone marrow of miR-21 [−/−] mice (Supplementary Fig. S3e,f). [score:15]
We further revealed up-regulation of the miR-21 target PDCD4 protein level, which suppressed c-FOS and p-c-fos expression in osteoclasts from ovariectomized miR-21 [−/−] mice, compared to those derived from ovariectomized WT mice (Fig. 6j, Supplementary Fig. S4f,g). [score:9]
In multiple myeloma-derived BMMSCs, it has recently been reported that miR-21 directly targeted to reduce OPG and indirectly promoted RANKL by targeting the signal transducer and activator of transcription 3 (STAT3) pathway, suggesting inhibition of osteoclastogenesis by miR-21 10. [score:9]
PDCD4 was previously demonstrated to regulate osteoclast differentiation 5 and was revealed as a direct target of miR-21 6. We next uncovered that the effects in miR-21 [−/−] osteoclasts were indeed attributed to an increase of PDCD4 protein level (Fig. 5g), while the mRNA level of PDCD4 remained unchanged (Supplementary Fig. S3c), confirming miR-21 regulation of PDCD4 expression in osteoclasts at the posttranscriptional level. [score:8]
However, age-related elevation of bone resorption was prevented by miR-21 deficiency (Fig. 7d–f), which may be attributed to targeted regulation of PDCD4 that lead to p-c-fos up-regulation (Supplementary Fig. S5d,e). [score:7]
Using a pharmacological ERK inhibitor, PD98059, we further revealed that ERK inhibition could oppose effects of siSPRY1 on RANKL and OPG expression and moreover, the secretion, in miR-21 -deficient osteoblasts (Fig. 4h,i). [score:7]
Extracellular signal-regulated kinase (ERK) signaling has been reported to inhibit RANKL and promote OPG under mechanical force in fibroblasts 21, and it has been proved to be regulated by miR-21 targeting Spry1 22 23. [score:7]
miR-21 deficiency inhibited OVX -induced osteoclastogenesis through promoting the PDCD4 protein level, a functional target of miR-21, which suppressed the phosphorylation level of c-fos. [score:7]
During bone mass accrual physiologically, we discovered in osteoblasts that miR-21 targeted Spry1 to regulate ERK signaling, thus suppressing RANKL and elevating OPG, indicating promotion of osteoclastogenesis by miR-21. [score:6]
Furthermore, siSPRY1 reduced RANKL and rescued OPG expression in miR-21 -deficient osteoblasts (Fig. 4f), suggesting Spry1 is a functional target of miR-21 in regulating osteoclastogenesis. [score:6]
These findings suggested PDCD4 is a functional target of miR-21 in supporting osteoclast function, collectively indicating that miR-21 promotes bone resorption in vivo through direct control of osteoclast function by targeting PDCD4. [score:6]
miR-21 deficiency blocks ovariectomy (OVX) -induced osteopenia by inhibiting osteoclastogenesis through targeting programmed cell death 4 (PDCD4). [score:5]
To dissect the mechanism underlying miR-21 regulating RANKL and OPG in osteoblastic lineage cells, we tested if our previously established miR-21 target in BMMSCs, Spry1 3, is a regulator of both RANKL and OPG. [score:5]
miR-21 deficiency promoted the PDCD4 protein level, a functional target of miR-21, which suppressed the phosphorylation level of c-fos. [score:5]
Therefore, considering that the dynamic regulation of an individual microRNA (miR-21) on its potential targets may vary depending on the experimental conditions/microenvironments, direct in vivo elucidation of its functional importance based on gene-manipulated animals is of necessity. [score:5]
We additionally demonstrated that serological miR-21 up-regulation was directly correlated with reduced BMD in human samples. [score:5]
miR-21 regulates receptor activator of nuclear factor κB ligand (RANKL) and osteoprotegerin (OPG) by targeting Sprouty 1 (Spry1) to modulate extracellular signal-regulated kinase (ERK) signaling in osteoblasts (OBs). [score:5]
Data demonstrated that miR-21 regulated RANKL and OPG by targeting Spry1 to regulate ERK signaling. [score:5]
We confirmed reduction of osteogenic differentiation of ex vivo miR-21 [−/−] BMMSCs that may be attributed to SPRY1 up-regulation (Supplementary Fig. S2). [score:4]
Given that SPRY1 was up-regulated in miR-21 -deficient osteoblastic lineage cells (Supplementary Fig. S2c,d), we applied small interfering RNA (siRNA) for SPRY1 (siSPRY1) in miR-21 -deficient osteoblasts. [score:4]
These findings collectively indicated that miR-21 regulates RANKL and OPG by targeting Spry1 to modulate ERK signaling in osteoblasts. [score:4]
As expected, depicted by tartrate resistant acid phosphotase (TRAP) staining, miR-21 [−/−] mice showed inhibited bone resorption at 3-month old (Fig. 5a), which was attributed to declined parameters of the number and surface of osteoclasts in miR-21 [−/−] mice (Fig. 5b,c). [score:3]
We also confirmed that miR-21 targeted PDCD4 to modulate p-c-fos in vivo after OVX (Supplementary Fig. S4h,i). [score:3]
For now, the source of serological miR-21 and its links with bone cells are still unknown, although we have detected the highest expression level of miR-21 in bone marrow among various tissues (data not shown). [score:3]
Our findings clarified skeletal function of miR-21 and provided first in vivo evidence of a pro-osteoclastic microRNA that regulates bone mass accrual and contributes to the development of osteoporosis. [score:3]
These findings suggested that miR-21 functioned to suppress trabecular bone mass accrual postnatally. [score:3]
miR-21 deficiency inhibited the bone resorption rate. [score:3]
Seeliger et al. also documented that expression of circulating and bone tissue miR-21 elevated in patients with osteoporotic fractures 27. [score:3]
Left tibiae were also used for in situ detection of miR-21 targets in bone marrow, according to published methods 13. [score:3]
In summary, we discovered in vivo the prevention of bone loss in miR-21 [−/−] mice that was attributed to an inhibition of osteoclast function. [score:3]
Pearson’s test was used to determine the correlation between BMD and miR-21 expression. [score:3]
The discrepancy of miR-21 effects on RANKL and OPG might be attributed to the distinguished physiological or pathological states, mature or progenitor cells, and in vivo or in vitro differences that leads to activation of different functional targets and signaling pathways. [score:3]
Interestingly, in the present study, we discovered ex vivo that miR-21 inhibited colony formation and proliferation of BMMSCs, while we confirmed its promotion on osteogenesis. [score:3]
These findings highlighted potential values of miR-21 as both a therapeutic target and a biomarker for osteoporosis. [score:3]
These results suggested that miR-21 inhibited colony formation and proliferation of BMMSCs despite promotion on osteogenesis. [score:3]
Our findings pave an avenue for further mechanistic researches on osteoclast-specific loss-of-function of miR-21 and miR-21 overexpression in skeletal disorders. [score:3]
We revealed that despite the existence of RANKL, miR-21 deficiency inhibited osteoclast differentiation, as shown by declined formation of TRAP [+] multinucleated cells (Supplementary Fig. S3a,b). [score:3]
miR-21 promotes bone resorption in vivo and controls osteoclastogenesis by targeting programmed cell death 4 (PDCD4). [score:3]
How to cite this article: Hu, C. -H. et al. miR-21 deficiency inhibits osteoclast function and prevents bone loss in mice. [score:3]
miR-21 deficiency blocks OVX -induced osteopenia by inhibiting osteoclast function. [score:3]
miR-21 [−/−] mice demonstrate normal skeletal phenotype in developmentmiR-21 [−/−] mice were sourced directly from the Jackson Laboratory, and the deficiency of miR-21 was further confirmed systemically (Supplementary Fig. S1a) and in bone (Supplementary Fig. S1b) without affecting the neighborhood of miR-21 gene loci, the gene Vacuole membrane protein-1 (VMP1) (Supplementary Fig. S1c,d) 16 17. [score:3]
Here, we clarified that the function of miR-21 in promoting osteoclast function predominated in vivo, despite that it maintained osteoblastogenesis, inhibited RANKL and promoted OPG physiologically. [score:3]
To further determine whether miR-21 contributed to the development of osteoporosis, we examined effects of miR-21 deficiency in age-related osteopenia. [score:2]
miR-21 [−/−] mice were sourced directly from the Jackson Laboratory, and the deficiency of miR-21 was further confirmed systemically (Supplementary Fig. S1a) and in bone (Supplementary Fig. S1b) without affecting the neighborhood of miR-21 gene loci, the gene Vacuole membrane protein-1 (VMP1) (Supplementary Fig. S1c,d) 16 17. [score:2]
Unexpectedly, enzyme-linked immunosorbent assay (ELISA) of serological levels demonstrated promoted RANKL and suppressed OPG by miR-21 deficiency (Fig. 4a,b), indicating stimulation of osteoclastogenesis. [score:2]
These results suggested that miR-21 contributed to the development of osteopenia during aging. [score:2]
We next examined whether miR-21 regulates osteoclastogenesis to promote trabecular bone mass. [score:2]
These results indicated normal skeletal phenotype in development of miR-21 [−/−] mice. [score:2]
miR-21 controls osteoclastogenesis by regulating RANKL and OPG. [score:2]
Further analysis identified correlation of serological relative miR-21 levels with BMD of human lumbar spine in the development of osteoporosis (Pearson’s correlation: −0.5679; p = 0.0140) (Fig. 7j). [score:2]
In our previous research, we found that miR-21 in BMMSCs was regulated by tumor necrosis factor-alpha (TNF-α) in estrogen deficiency -induced bone loss ex vivo 3. In this study, we further uncovered that lack of miR-21 in mice blocked osteopenia induced by OVX and during aging, suggesting protection of bone mass by miR-21 deficiency in pathological states. [score:2]
WT C57BL/6 mice and miR-21 [−/−] mice were sourced directly from the Jackson Laboratory. [score:2]
miR-21 regulates osteoblastogenesis and maintains bone formation in vivo. [score:2]
For example, the miR-21-Spry1-ERK axis was documented pivotal under stress 22, and ERK signaling has been reported to regulate RANKL and OPG under mechanical force 21, which is of great significance to maintain bone homeostasis in vivo 33 34. [score:2]
miR-21 [−/−] mice demonstrate normal skeletal phenotype in development. [score:2]
Therefore, although we discovered modulatory effects of miR-21 on RANKL and OPG, these findings suggested that the increased postnatal trabecular bone mass in miR-21 [−/−] mice was not attributed to changes of osteoclastogenesis. [score:1]
miR-21 deficiency promotes trabecular bone mass accrual postnatally. [score:1]
Also, WT and miR-21 [−/−] embryos showed paralleled mineralized area in radius, ulna, carpus and digits (Fig. 1f,g). [score:1]
To further prove the role of PDCD4 in mediating effects of miR-21 on RANKL -induced osteoclast function, we applied siRNA for PDCD4 (siPDCD4) during miR-21 -deficient osteoclast differentiation. [score:1]
Quantifications on the trabecular bone volume (Fig. 3b) and bone mineral density (BMD) (Fig. 3c) confirmed that miR-21 deficiency promotes trabecular bone mass accrual. [score:1]
miR-21 contributes to age-related osteopenia and bone loss in human. [score:1]
No significant difference was detected between ovariectomized WT and miR-21 [−/−] mice. [score:1]
However, we did not detect differences in cortical bone mass between WT and miR-21 [−/−] mice (Fig. 3g), provided the thickness and area of the cortical bone were comparable (Fig. 3h,i). [score:1]
miR-21 [−/−] mice show increased trabecular bone mass accrual postnatally. [score:1]
Instead, OVX -induced bone resorption was prevented by miR-21 deficiency (Fig. 6d–f). [score:1]
Increased RANKL and decreased OPG were detected in miR-21 [−/−] mice, suggest that the increased bone mass in miR-21 [−/−] mice was not attributed to RANKL or OPG changes. [score:1]
miR-21 promotes bone resorption in vivo and supports osteoclast function. [score:1]
We further discovered that miR-21 deficiency reduced resorption activity of osteoclasts, as demonstrated by declined resorption pits on dentine slices (Fig. 5e,f). [score:1]
To confirm effects of miR-21 in RANKL -induced osteoclast differentiation and activity, TRAP staining and resorption examination were respectively performed. [score:1]
In addition, the RANKL/OPG ratio was comparable between aged WT and miR-21 [−/−] mice (Fig. 7g). [score:1]
This skeletal functional diversity of microRNAs from one family was further supported by findings of miR-21. [score:1]
Impairments were still detected in osteoblastogenesis and bone formation of aged miR-21 [−/−] mice (Supplementary Fig. S5a–c). [score:1]
Furthermore, under the existence of RANKL, siPDCD4 rescued both differentiation and resorption activity of miR-21 -deficient osteoclasts, as shown by recovered formation of TRAP [+] multinucleated cells (Supplementary Fig. S3g,h) and resorption pits on dentine slices (Fig. 5i,j). [score:1]
Histological analyses illustrated comparable cartilaginous remnants, hypertrophic chondrocytes (Fig. 1h) and mineralization in tibia (Fig. 1i,j) of WT and miR-21 [−/−] embryos at E18. [score:1]
To our surprise, miR-21 [−/−] embryos at E18 appeared morphologically normal (Fig. 1a), with comparable body length to those of WT (Fig. 1b). [score:1]
miR-21 [−/−] OBs showed increased RANKL secretion and decreased OPG secretion. [score:1]
However, both differentiation (Supplementary Fig. S4d,e) and resorption activity (Fig. 6h,i) of osteoclasts from ovariectomized miR-21 [−/−] mice were impaired. [score:1]
These findings highlighted that miR-21 maintained bone formation and osteoblastogenesis in vivo. [score:1]
Our results also indicate the potential therapeutic effects of miR-21 inhibition on osteoporosis, which may be of clinical significance to investigate in future studies. [score:1]
The RANKL/OPG ratio was not significantly different between ovariectomized WT and miR-21 [−/−] mice (Fig. 6g). [score:1]
These effects were not attributed to a rescue in osteoblastogenesis or bone formation in miR-21 [−/−] mice (Supplementary Fig. S4a–c). [score:1]
showed that miR-21 deficiency blocked OVX -induced osteopenia (Fig. 6a), and that both trabecular and cortical bone loss were prevented (Fig. 6b,c). [score:1]
However, we further discovered that primary miR-21 [−/−] BMMSCs showed increased colony forming efficiency (Fig. 2a,b), and that miR-21 [−/−] BMMSCs continued to show increased proliferation rate during passages (Fig. 2c). [score:1]
Further observations showed that mineralized area in ribs, thoracic spines and lumbar spines of miR-21 [−/−] embryos were as much as those of WT embryos (Fig. 1d). [score:1]
showed that miR-21 [−/−] mice did not develop age-related osteopenia (Fig. 7a), and that both trabecular and cortical bone mass were maintained (Fig. 7b,c). [score:1]
These findings highlighted skeletal effects of miR-21 in correlation with bone homeostasis. [score:1]
For skeletal phenotype analysis during bone mass accrual, WT (n = 6, 3 female and 3 male) and miR-21 [−/−] (n = 6, 3 female and 3 male) mice were sacrificed at 3-month old 15. [score:1]
1 [st] passaged BMMSCs isolated from 3-month WT and miR-21 [−/−] mice were seeded at 2 × 10 [3] cells/well in 96-well plates. [score:1]
We also revealed that bone formation parameters were comparable in WT and miR-21 [−/−] mice (Fig. 2g,h). [score:1]
Another important finding of the present study is that miR-21 reduced RANKL and induced OPG secretion physiologically, but these effects were not observed in pathological states. [score:1]
Surprisingly, we revealed that number and surface of osteoblasts per bone surface were not significantly different between 3-month WT and miR-21 [−/−] mice (Fig. 2e,f). [score:1]
Moreover, alizarin red staining at E18 demonstrated similar overall skeletal mineralization in WT and miR-21 [−/−] embryos (Fig. 1c). [score:1]
To further dissect the skeletal function of miR-21 in embryos, we analyzed the cartilage remnants and the ossification that are key to bone mass accrual, as previously reported 15 20. [score:1]
No significant difference was detected between 16-month WT and miR-21 [−/−] mice. [score:1]
Primary bone marrow cells were isolated from 3-month WT and miR-21 [−/−] mice, seeded at 1 × 10 [5] cells/cm [2], cultured for 14 days, and stained with crystal violet. [score:1]
Besides, WT and miR-21 [−/−] mice showed similar body composition (Supplementary Table S1). [score:1]
For embryonic experiments, WT (n = 6) and miR-21 [−/−] (n = 6) embryos were separated at E18. [score:1]
We confirmed in this study that siSPRY1 induced both ERK1/2 and p-ERK1/2 in miR-21 -deficient osteoblasts (Fig. 4g). [score:1]
To further study the skeletal phenotype of miR-21 [−/−] mice, we separately analyzed trabecular and cortical bone mass of WT and miR-21 [−/−] mice using the micro-CT system. [score:1]
Our results clarified skeletal function of miR-21 and provided first in vivo evidence of a pro-osteoclastic microRNA. [score:1]
For age-related skeletal phenotype analysis, WT (n = 6, 3 female and 3 male) and miR-21 [−/−] (n = 6, 3 female and 3 male) mice were sacrificed at 16-month old 13. [score:1]
The discrepancy of miR-21 effects in different functional aspects of BMMSCs lead to maintained bone formation and osteoblastogenesis in miR-21 [−/−] mice, as shown by our findings. [score:1]
Analyses on the level of serological marker confirmed that miR-21 deficiency reduced the bone resorption rate, as shown by the cross linked C-telopeptide of type 1 collagen (CTX-1) (Fig. 5d) concentration. [score:1]
For skeletal phenotype analysis post estrogen deficiency, 2-month female WT and miR-21 [−/−] mice underwent either a bilateral OVX (n = 6/genotype) or a Sham (n = 6/genotype) operation by the dorsal approach under general anesthesia 3. Mice were mo deled for 1 month and sacrificed at 3-month old. [score:1]
To identify the correlation of miR-21 changes with bone loss, we detected serological miR-21 levels in normal and osteoporotic mice and individuals. [score:1]
Furthermore, the level of a bone formation marker in serum, procollagen 1 N-terminal peptide (P1NP), in miR-21 [−/−] mice was paralleled with that in WT mice. [score:1]
[1 to 20 of 106 sentences]
15
[+] score: 270
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-143, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c
The latter is supported by the following observations: (a) miR-21 is up-regulated, whereas miR-145 is down-regulated in colon cancer CR-HCT-116 cells, highly enriched in CSCs/CSLCs; (b) forced expression of miR-21 through transfection of mature miR-21 in colon cancer HCT-116 cells decreases the expression of miR-145; (c) knock-down of miR-21 by anti-miR-21 increases miR-145 in CR colon cancer cells. [score:12]
The growth inhibition was associated with decreased proliferation of CSCs and induction of their differentiation, as evidenced by reduction in expression of CD44 and induction of CK20 following upregulation of miR-145 or down-regulation of miR-21. [score:11]
In support of this, we found that whereas forced expression of miR-145 in colon cancer cells greatly inhibits CSCs and tumor growth, up-regulation of miR-21 causes an opposite phenomenon. [score:8]
In the miR-21 positive feedback loop, miR-21 is auto -upregulated via indirect upregulation of AP1. [score:8]
Figure 1Over -expression of miR-145 in colon cancer HCT-116 cells by stably transfected pCMV/miR-145 downregulates miR-21 and induces differentiation, inhibits stemness and produces no visible tumors in SCID mice. [score:8]
In contrast to miR-21, miR-145 is a p53 regulated tumor suppressor, whose down-regulation has been found in colorectal and other cancers [14, 15]. [score:7]
Figure 2Chemo-resistance, overexpression of miR-21 and colonosphere formation in colon cancer HCT-116 cells, all of which are associated with increased miR-21 levels, lead to down-regulation of miR-145, and miR-145 and miR-21 negatively regulate each other in chemo-resistant (CR) colon cancer cells. [score:7]
Although the underlying mechanisms for regulation of miR-21 in CRC remain to be defined, we reported EGFR inhibitor Cetuximab (mAb to EGFR) to decrease its expression suggesting a role for EGFR in regulating miR-21[13]. [score:7]
We have reported that chemo-resistant (CR) colon cancer cells, highly enriched in CSCs, exhibit a marked up-regulation of miR-21 and that down-regulation of this miR renders the CR cells more susceptible to therapeutic regimens. [score:7]
Our current data show that miR-21 also regulates the expression of the tumor suppressor miR-145. [score:6]
To further determine whether and to what extent forced expression of miR145 or down-regulation of miR-21 by anti-miR21 would affect the tumorigenic potential of colon cancer cells, SCID mice were subcutaneously injected either with ~ 2.5 × 10 [5] CR HCT-116 or CR HT-29 cells suspended in 100 μl Matrigel. [score:6]
k-Ras appears to play critical role in the regulation of this process, as evidenced by the fact that the absence of k-Ras in CR colon cancer cells increases miR-145 expression, suppresses miR-21, and interrupts the cooperation between miR-21 and miR-145. [score:6]
These observations are in contrast to those depicted in Figure  2D, where are show that in cell with intact k-Ras, downregulation of miR-21 produced 6-fold augmentation of miR-145, forced expression of miR-145 resulted in 70% reduction in miR-21. [score:6]
We observed that the expression of tumor suppressive miR-145 in CR HCT-116 cells was decreased by 62% and in miR-21 -overexpressing HCT-116 cells by 90%, when compared with their corresponding parental or empty vector control cells (Figure  2A and B). [score:6]
Forced expression of miR-21 in k-Ras downregulated CR-HT-29 cells resulted in 1-fold increase in miR-145 (Figure  5D). [score:6]
We have reported that the expression of miR-21 is greatly increased in chemo-resistant (CR) colon cancer cells that are highly enriched in CSC, and forced expression of miR-21 in colon cancer cells greatly increases CSC population accompanied by induction of tumor growth, indicating miR-21 regulates stemness of colon cancer cells [8, 17]. [score:6]
Herein, it is suggested that miR-21 represses miR-145 transcription by stimulating Ras activity that causes RREB1 to repress miR-145 transcription, and that miR-145 inhibits miR-21 transcription through knockdown target Ras (K-RAS) and decreased AP1, the main transcription factor of miR-21. [score:6]
In addition, we observed downregulation of pluripotency factors Oct4, Sox2, Nanog as well as miR-21 following overexpression of miR-145 in colon cancer cells. [score:6]
k-Ras appears to play critical role in regulation of this process, as evidenced by the fact that the absence of k-Ras in CR colon cancer cells increases miR-145 expression, suppresses miR-21, and interrupts the negative cooperation between miR-21 and miR-145. [score:6]
This inference is further supported by our in vivo experiments which demonstrate that increase of miR-145 or inhibition of miR-21 by injecting PEI mediated chemically engineered modified single-stranded RNA or analogues complementary to miRNA which are efficient, specific and long-lasting replacements or silencers of endogenous miRNAs in mice [24, 31] leads to suppression of xenograft growth in SCID mice. [score:5]
We also demonstrated that miR-21 regulates CSC function as well as its growth and differentiation by modulating its direct targets such as TGFβR2, PDCD4 and PTEN, as reported earlier [8, 17, 19]. [score:5]
In addition, we reported miR-21 to induce stemness of colon cancer cells by down -regulating TGFβR2 and that down-regulation of miR-21 induces differentiation of CR colon cancer cells and enhances susceptibility to therapeutic regimens [8, 17]. [score:5]
These results indicate that overespression of miR-21 is associated with downregulation of miR-145 and vice versa in colon cancer cells and that both miR-21 and miR-145 are involved in regulating the growth of colonospheres, enriched in CSCs. [score:5]
Earlier, we reported that exposure of colon cancer HCT-116 or HT-29 cells to the combination of 5-Fluorouracil (5-FU) and Oxaliplatin (Ox), the backbone of colorectal cancer chemotherapy, inhibited their growth and led to enrichment of CSC/CSLC phenotype, where the levels of miR-21 were greatly increased indicating a potential role for this miR in regulating CSCs/CSLCs [7, 8]. [score:4]
These results indicate that miR-21 negatively regulates the expression of miR-145 in colon cancer cells. [score:4]
These reports support our data and further demonstrate the mechanism by which miR-21 negatively regulates tumor suppressor miR-145. [score:4]
They have also demonstrated that PDCD4, a pro-apoptotic gene and the target of miR-21, is a negative regulator of AP1. [score:4]
We found the expression of miR-21 to be greatly increased and miR-145 decreased in CR colon cancer cells that are highly enriched in CSC, indicating a role for these miRNAs in regulating CSCs. [score:4]
To determine the putative functional properties of miR-145 in the development of colorectal tumor and its relation to miR21 expression, pCMV/miR145 plasmid (Origene, Rockville, MD) was stably transfected in HCT-116 cells. [score:4]
Our current data further suggest that the tumor suppressor miR-145, oncomiR miR-21 and their networks are critically involved in regulating these events. [score:4]
miR-21 expression is regulated at multiple levels, including transcription and post-transcriptional processing. [score:4]
The miR-21 -mediated down-regulation of PDCD4 is essential for the maximal induction of AP1 activity in response to Ras. [score:4]
A similar phenomenon occurs following down-regulation of miR-21 in CR colon cancer cells. [score:4]
The levels of miR-145 and miR-21 were manipulated by transfection of mature, antago-miRs or pCMV/miR-145 expression plasmid. [score:3]
miR-145 and, anti-miR-21 inhibit tumorigenic potential of chemo-resistant (CR) colon cancer HT-29 cells in SCID mice. [score:3]
In addition, administration of mature miR-145 or antagomir-21 (anti-sense miR-21) greatly suppresses the growth of colon cancer cell xenografts in SCID mice. [score:3]
Collectively, the current data suggest a negative feedback between the tumor suppressor miR-145 and oncomiR miR-21 in CR colon cancer cells. [score:3]
Zhang Z, Zha Y, Hu W, Huang Z, Gao Z, Zang Y, et al. The auto-regulatory feedback loop of microRNA-21/Programmed cell death protein 4/Activation Protein-1 (miR-21/PDCD4/AP-1) as a driving force for hepatic fibrosis development. [score:3]
Restoration of miRs level by increasing miR-145 or decreasing miR-21 can dislodge Ras mediated feedback between miR-145 and miR-21 and inhibit tumor growth. [score:3]
These observations suggest that k-Ras mediates the negative feedback between the tumor suppressor miR-145 and oncomiR miR-21 in CR colon cancer cells. [score:3]
Down-regulation of k-Ras in CR HT-29 cells, that caused a 45% increase in miR-145, produced a 35% reduction in miR-21, when compared with the corresponding controls (Figure  5C). [score:3]
But, increasing the levels of miR-145 in k-ras downregulated CR-HT-29 cells resulted in no significant reduction in miR-21, compared with corresponding control (Figure  5D). [score:3]
The tumorigenic potential of parental and CR-HT-29 cells in SCID mice was inhibited by administration of miR-145 or anti-miR-21. [score:3]
After 2 days of transfection, the cells were collected and analyzed for protein expression of k-Ras using western blot and for quantitation of miRNA-21 and miR-145 by qRT-PCR according to our standard protocol. [score:3]
Our current observations suggest that dysregulation of miR-21 and miR-145 plays a central role in the growth of CSCs in chemo-resistant colon tumors by regulating a network of genes that are critically involved in tumor progression, metastasis, and relapse of colorectal cancer. [score:3]
Furthermore, overexpression of miR-21 has been shown to dramatically reduce the therapeutic efficacy of 5-FU [12]. [score:3]
Kern et al. [30] also showed that EGF/Ras efficiently induced the miR-21 primary transcript, but this does not rapidly and simply translate into higher mature miR-21 levels. [score:3]
In contrast, miR-21 was decreased by 50% in miR-145 overexpressing cells, compared to the vector -transfected control cells (Figure  1A). [score:2]
miR-145 and miR-21 cooperation plays a role in regulating cancer stem cell proliferation and differentiation. [score:2]
In vitro studies further demonstrate that miR-21 negatively regulates miR-145 and vice versa. [score:2]
In the next set of experiments we tested whether there is a cooperation between miR-145 and miR-21 and how this cooperation may regulate cancer stem cell proliferation and differentiation. [score:2]
Our current observations suggest that miR-21, miR-145, and their networks play critical roles in regulating CSCs growth and/or differentiation in the colon cancer and progression of chemo-resistance. [score:2]
In addition, we observed that while the levels of miR-145 were decreased by ~70% in colonospheres formed by the parental HCT-116 cells, the expression of miR-21 was increased by ~180% in these colonospheres, when compared with the corresponding parental HCT-116 cells (Figure  2C). [score:2]
We also report that miR-21 negatively regulates miR-145 and vice versa. [score:2]
Valeri N, Gasparini P, Braconi C, Paone A, Lovat F, Fabbri M, et al. MicroRNA-21 induces resistance to 5-fluorouracil by down -regulating human DNA MutS homolog 2 (hMSH2). [score:1]
To conduct this experiment, we utilized CR colon cancer cells that are enriched in CSCs and exhibit a 3–5 fold increase in the precursor and mature miR-21 as shown in Figure  2A, an observation similar to what we reported earlier [8, 17]. [score:1]
Once palpable tumors were formed, SCID mice bearing xenografts were treated with PEI/miRNA-145, PEI/anti-miRNA-21 complexes or PEI/control once a week by i. p. injection of 0.45 nmol (6 μg) for 3 weeks [24]. [score:1]
Transfection of miR-145, miR-21, anti-miR-21 or k-Ras siRNA in colon cancer cells. [score:1]
On the other hand, miR-21 can be decreased by elevating the levels of miR-145 through transfection of mature miR-145 in parental and CR colon cancer cells. [score:1]
Quantitation of miRNA-21 and miR-145. [score:1]
These data further suggest that a negative feedback exists between miR-21 and miR-145. [score:1]
In view of these reports together with our current observations prompted us to hypothesize that the negative feedback between miR-21 and miR-145 mediated by Ras signaling pathway plays a crucial role in the induction of CSC proliferation or/and differentiation in CR colon cancer cells, as depicted in Figure  5A. [score:1]
We found miR-21 to induce stemness of colon cancer cells [8]. [score:1]
For transfection of miR-21/145, anti-miR-21 or/and siRNA in the CR-HCT-116 or CR-HT-29 cells, Lipofectamine 2000 transfection reagent (Invitrogen Corp. ) [score:1]
To determine whether and to what extent miR-145 or anti-miR-21 would affect the tumorigenic potential, xenografts in SCID mice formed by colon cancer parental HT-29 or CR-HT-29 cells were first analyzed for the presence of markers of CSCs/CSLCs and their growth and differentiation. [score:1]
Hatley and colleagues have reported that miR-21 increases RAS signaling activity and therefore leads to repression of the miR-143/145 cluster [23]. [score:1]
We have reported that 5-Fluorouracil and Oxaliplatin (FU-Ox) resistant [chemo-resistant (CR)] colon cancer HCT116 and HT29 cells exhibit enrichment of CSCs/CSLCs, elevated levels of mature miR-21 and that miR-21 induces stemness in colon cancer cells [7, 8]. [score:1]
Following transfection of anti-miR21 in CR-HT-29 cells, there was a marked 6-fold increase of miR-145 (Figure  2D). [score:1]
medium prior to adding the complexes containing 100 pmol of scrambled (control), k-Ras siRNA (Integrated DNA Technologies, Coralville, IA) or/and pre-miR-145, pre-miR-21. [score:1]
Talotta et al. [28] have reported that the miR-21 is induced by AP1 in response to Ras. [score:1]
In colorectal cancer, miR-21 has been reported to function as an oncomiR (a miRNA with oncogenic properties) due to its key role in several processes of tumor promotion, invasion and metastasis [10, 11]. [score:1]
Figure 5The feedback circuits between miR-21 and miR-145. [score:1]
OncomiR addiction in an in vivo mo del of microRNA-21 -induced pre-B-cell lymphoma. [score:1]
[1 to 20 of 73 sentences]
16
[+] score: 268
Putative targets of nine differentially expressed miRNAs that were validated by RT-qPCR (upregulated: mmu-miR-151-3p, mmu-miR-155-5p, mmu-miR-181a-5p, and mmu-miR-328-3p; and downregulated: mmu-miR-21a-5p, mmu-miR-98-5p, mmu-miR-145a-5p, mmu-miR-146b-5p, and mmu-miR-374b-5p) were obtained from the miRWalk database. [score:11]
On the other hand, BMDMs were transfected with small, chemically modified single-stranded RNA molecules designed to specifically bind to and inhibit endogenous mmu-miR181a-5p or mmu-miR-21a-5p (inhibitors) and enable miRNA functional analysis by downregulation of miRNA activity (mirVana™ miRNA mimics or inhibitors—Thermo Fischer Scientific, MA, USA). [score:10]
MyD88 Plays an Important Role in Regulating the Expression of miRNAs During B. abortus InfectionSince innate immunity is the first line of host immune defense against bacterial pathogens and our group has previously demonstrated the important role of MyD88 adaptor molecule during B. abortus infection (25), we evaluated the influence of MyD88 during differential expression of miRNAs upregulated (mmu-miR-181a-5p and mmu-miR-328-3p) or downregulated (mmu-miR-21a-5p, mmu-miR-98-5p, and mmu-miR-146b-5p) by infection. [score:10]
According to the expression levels and fold-change comparing Brucella-infected versus NI libraries, we selected four miRNAs that were upregulated (mmu-miR-151-3p, mmu-miR-155-5p, mmu-miR-181a-5p, and mmu-miR-328-3p) and five miRNAs that were downregulated (mmu-miR-21a-5p, mmu-miR-98-5p, mmu-miR-145a-5p, mmu-miR-146b-5p, and mmu-miR-374b-5p) for validation and further analysis. [score:9]
Differential expression of validated upregulated miRNAs (A) mmu-miR-181a-5p and (B) mmu-miR-328-3p or validated downregulated miRNAs (C) mmu-miR-21a-5p, (D) mmu-miR-98-5p, and (E) mmu-miR-146b-5p were assessed by real-time PCR and normalized to SNORD61 in bone marrow-derived macrophages from C57BL/6 and MyD88 KO mice. [score:9]
Herein, we hypothesize that in initial phase of infection host cells can downregulate miR-21a-5p expression to reduce IL-10 and increase GBP5 expression thus resulting in improved control of Brucella replication. [score:8]
Validated upregulated miRNAs (F) mmu-miR-181a-5p and (G) mmu-miR-328-3p or validated downregulated miRNAs (H) mmu-miR-21a-5p, (I) mmu-miR-98-5p, and (J) mmu-miR-146b-5p were also assessed by real-time PCR in spleens from C57BL/6 and MyD88 KO mice. [score:7]
Finally, we show that one of the miRNAs downregulated during infection, miR-21a-5p, affects host control of B. abortus infection by negatively regulating guanylate -binding protein (GBP) 5 and inducing IL-10 expression. [score:7]
For further validation, we chose four upregulated (mmu-miR-151-3p, mmu-miR-155-5p, mmu-miR-181a-5p, and mmu-miR-328-3p) and five downregulated (mmu-miR-21a-5p, mmu-miR-98-5p, mmu-miR-145a-5p, mmu-miR-146b-5p, and mmu-miR-374b-5p) miRNAs (Table S6 in) in infected samples by real-time PCR in macrophages. [score:7]
The intracellular bacteria B. abortus enters the host cell and upregulates miR-181a-5p and downregulates miR-21-5p. [score:7]
One well defined target of miR-21a-5p is programmed cell death protein 4 (PDCD4), which is a pro-inflammatory protein that suppresses IL-10 expression (30). [score:7]
Since innate immunity is the first line of host immune defense against bacterial pathogens and our group has previously demonstrated the important role of MyD88 adaptor molecule during B. abortus infection (25), we evaluated the influence of MyD88 during differential expression of miRNAs upregulated (mmu-miR-181a-5p and mmu-miR-328-3p) or downregulated (mmu-miR-21a-5p, mmu-miR-98-5p, and mmu-miR-146b-5p) by infection. [score:7]
To better understand if the downregulation of miR-21a-5p observed during B. abortus infection could modulate IL-10 mRNA in BMDMs, we used specific miRNA mimics or inhibitors. [score:6]
Figure 6TNF-α expression is modulated by mmu-miR-181a-5p, while IL-10 gene expression is regulated by mmu-miR-21a-5p during Brucella abortus infection. [score:6]
Cohen and Prince (41) showed that during bacterial pneumonia type III IFNλ promotes inflammation by inhibiting miR-21, upregulating PDCD4, and consequently diminishing IL-10 production. [score:6]
Bone marrow-derived macrophages transfected with mmu-miR-21a-5p mimic or inhibitor were lysed with M-PER™ Mammalian Protein Extraction Reagent (Thermo Fisher Scientific) supplemented with phosphatase and protease inhibitors (Roche). [score:5]
Second, mimics and inhibitors transfection for mmu-miR-181a-5p (C) or mmu-miR-21a-5p (D) showed increase or inhibition of specific miRNAs in BMDMs. [score:5]
As for mmu-miR-21a-5p, one defined target is PDCD4, which is a suppressor of the anti-inflammatory cytokine IL-10. [score:5]
Therefore, we decided to test the effect of miR-21a-5p mimic or inhibitor in IL-10 expression on Brucella-infected macrophages. [score:5]
miR-181a-5p regulates TNF-α and miR-21a-5p influences IL-10 expression during bacterial infection. [score:4]
In Vitro Evaluation of TNF-α, IL-10, and GBP5 Targets for Selected miRNAsTo evaluate putative targets of selected miRNAs, BMDMs were transfected for 24 h with small, chemically modified double-stranded RNAs that mimic endogenous mmu-miR-181a-5p or mmu-miR-21a-5p (mimics) to enable miRNAs functional analysis by upregulation of their activities. [score:4]
We also observed that mmu-miR-21a-5p was downregulated during the first 6 h post-infection (Figure 6B). [score:4]
Each of these miRNAs, mmu-miR-181a-5p and mmu-miR-21a-5p, could regulate several mRNA targets that could affect the host immune responses to B. abortus (Table S3 in). [score:4]
miR-21a-5p Regulates GBP5 Expression and Partially Influences Intracellular B. abortus Growth. [score:4]
On the other hand, we observed a dependence of MyD88 for the downregulation of mmu-miR-21a-5p, mmu-miR-98-5p, and mmu-miR-146b-5p during B. abortus infection in macrophages. [score:4]
By contrast, five miRNAs were validated as downregulated: (E) mmu-miR-21a-5p, (F) mmu-miR-98-5p, (G) mmu-miR-145a-3p, (H) mmu-miR-146b-5p, and (I) mmu-miR-374b-5p. [score:4]
miR-21a-5p Regulates GBP5 Expression and Partially Influences Intracellular B. abortus GrowthIn addition to these previously characterized targets, we also observed that the mRNA for several GBPs including GBP2, 4, 5, and 8 had binding sites for mmu-miR-21a-5p (Table S3 in). [score:4]
Since GBPs are putative targets of miR-21a-5p, we decided to evaluate whether this miRNA could also regulate GBP5 expression in macrophages infected with B. abortus. [score:4]
Therefore, we decided to search for GBP genes as potential targets for miR-181a-5p or miR-21a-5p regulation. [score:4]
In summary, the findings present here provide evidences that miR-181a-5p regulates TNF-α and miR-21a-5p influences IL-10 expression during B. abortus infection (Figure 8). [score:4]
These results show that GBP5 expression is regulated by miR-21a-5p. [score:4]
To evaluate putative targets of selected miRNAs, BMDMs were transfected for 24 h with small, chemically modified double-stranded RNAs that mimic endogenous mmu-miR-181a-5p or mmu-miR-21a-5p (mimics) to enable miRNAs functional analysis by upregulation of their activities. [score:4]
miR-181a-5p and miR-21a-5p Regulate Important Immune Pathways During B. abortus Infectionmmu-miR-181a-5p and mmu-miR-21a-5p showed differential expression during B. abortus infection in vivo and in vitro in a MyD88 -dependent manner. [score:4]
By contrast, cells transfected with miR-21a-5p inhibitor showed increased levels of GBP5 transcripts (Figure 7A). [score:3]
Figure 7mmu-miR-21a-5p modulates GPB5 expression and Brucella abortus infection in macrophages. [score:3]
Taken together, these results suggest that miR-21a-5p modulates GBP5 expression, thus affecting the ability of the host to control B. abortus infection. [score:3]
We found that GBP2, GBP4, GBP5, and GBP8 are putative targets for miR-21a-5p but not for miR-181a-5p. [score:3]
In addition, pretreatment of BMDMs with miR-21a-5p inhibitor significantly decreased the intracellular Brucella numbers upon bacterial infection. [score:3]
First, we determined time dependent of mmu-miR-181a-5p (A) or mmu-miR-21a-5p (B) expression during B. abortus infection in bone marrow-derived macrophages (BMDMs). [score:3]
mmu-miR-181a-5p and mmu-miR-21a-5p showed differential expression during B. abortus infection in vivo and in vitro in a MyD88 -dependent manner. [score:3]
By contrast, when the cells were transfected with miR-21a-5p inhibitor, we observed a strong reduction in IL-10 levels. [score:3]
BMDMs were transfected with mimic (MIMIC21) or inhibitors (INH21) for mmu-miR-21a-5p in C57BL/6 cells. [score:3]
This result suggests the role of miR-21a-5p in controlling IL-10 expression via PDCD4 during B. abortus infection. [score:3]
By contrast, the miR-21a-5p inhibitor increased GBP5 transcripts. [score:3]
We also assessed GBP5 protein levels in BMDMs treated with miR-21a-5p mimic or inhibitor. [score:3]
First, we analyzed the kinetics of expression for mmu-miR-181a-5p or mmu-miR-21a-5p during B. abortus infection in macrophages. [score:3]
These results suggest that the reduction of mmu-miR-21a-5p during B. abortus infection helps increase IL-10 mRNA levels by inhibiting PDCD4 in macrophages. [score:3]
When miR-21a-5p mimic was transfected in macrophages, we observed reduced GBP5 expression. [score:3]
CFU analysis demonstrated that the miR-21a-5p mimic increased numbers of intracellular bacteria while the inhibitor had the opposite effect (Figure 7C). [score:3]
miR-181a-5p and miR-21a-5p Regulate Important Immune Pathways During B. abortus Infection. [score:2]
As shown in Figure 7B, it was possible to observe that B. abortus-infected cells transfected with the inhibitor for mmu-miR-21a-5p showed an enhanced amount of GBP5 when compared with untreated cells. [score:2]
We then selected GBP5 as a target to evaluate the potential regulatory role of miR-21a-5p. [score:2]
We observed that the miR-21a-5p mimic induced higher levels of IL-10 mRNA in infected macrophages while its inhibitor reduced IL-10 transcripts compared with controls (Figure 6E). [score:2]
In addition, miR-21a-5p also regulates guanylate -binding protein (GBP) 5 transcription and protein production in macrophages thus affecting Brucella intracellular growth. [score:2]
In addition, miR-21a-5p also regulates GBP5 transcription and protein production in macrophages thus affecting Brucella intracellular growth. [score:2]
Surprisingly, we also detected an increased in GBP5 in cells treated with the mimic for mmu-miR-21a-5p but in much lower levels compared with macrophages transfected with the inhibitor. [score:2]
As for GBP5 protein, miR-21a-5p inhibitor enhanced GBP5 levels in infected and uninfected macrophages compared with miR-21a-5p mimic treated cells. [score:2]
In addition to these previously characterized targets, we also observed that the mRNA for several GBPs including GBP2, 4, 5, and 8 had binding sites for mmu-miR-21a-5p (Table S3 in). [score:1]
Transfection of the miR-21a-5p mimic decreased levels of the GBP5 mRNA in macrophages (Figure 7A). [score:1]
By contrast, miR-21a-5p mimic pretreatment increased bacterial load in macrophages. [score:1]
C57BL/6 mice were infected intraperitoneally at 1, 3, or 6 days post-infection, and the relative expression of miRNAs: (A) mmu-miR-151-3p, (B) mmu-miR-155-5p, (C) mmu-miR-181a-5p, (D) mmu-miR-328-3p, (E) mmu-miR-21a-5p, (F) mmu-miR-98-5p, (G) mmu-miR-145a-3p, (H) mmu-miR-146b-5p, and (I) mmu-miR-374b-5p were evaluated in mouse spleens. [score:1]
To evaluate the influence of miR-21a-5p in intracellular B. abortus growth in macrophages, BMDMs were transfected with mimic or inhibitor and infected with B. abortus for 24 hrs. [score:1]
Finally, BMDMs transfected with mimic or inhibitor for mmu-miR-21a-5p was infected with B. abortus and the level of IL-10 mRNA was measured by real-time PCR (E). [score:1]
We carried out further functional analysis using mmu-miR-181a-5p and mmu-miR-21a-5p. [score:1]
Unexpectedly, we observed a small increase in GBP5 in the Western blot when cells were transfected with miR-21a-5p mimic. [score:1]
To characterize the role of these miRNAs during B. abortus infection, we transfected macrophages with miRNA mimics or inhibitors for mmu-miR-181a-5p or mmu-miR-21a-5p. [score:1]
Bone marrow-derived macrophages (BMDMs) transfected with mimic or inhibitor for mmu-miR-21a-5p were infected with B. abortus and the level of guanylate -binding protein (GBP)5 mRNA was measured by real-time PCR (A). [score:1]
Figure 8Schematic mo del of the role of miR-181a-5p and miR-21a-5p during Brucella abortus infection. [score:1]
[1 to 20 of 68 sentences]
17
[+] score: 267
Other miRNAs from this paper: mmu-mir-21b, mmu-mir-21c
The findings that miR‑21 expression is elevated in primary melanoma tumors [18] and that miR-21 over -expression down-regulates TIMP3 protein expression implicates a role for miR-21 silencing of TIMP3 in the progression of melanoma. [score:10]
Because miRs can achieve a decrease in protein expression by causing the degradation of target mRNAs and by inhibiting translation of mRNA, Real-Time PCR was performed to evaluate changes in TIMP3 mRNA expression in response to increased miR-21. [score:9]
Over -expression of miR‑21 resulted in a decrease in TIMP3 protein expression but did not alter that of several other recognized targets of miR-21. [score:7]
Notably, the murine experiments confirmed that inhibition of miR-21 expression led to increased TIMP3 protein expression. [score:7]
Selaru et al. elegantly demonstrated that miR-21 is elevated in cholangiocarcinoma tissue samples and miR-21 inhibition increases TIMP3 protein expression in cholangiocarcinoma cell lines, but they did not explore the effects of miR‑21 over -expression on cell line behavior, and results were not confirmed in a murine mo del [20]. [score:7]
Co-transfection of an anti-miR-21 oligonucleotide, a renilla luciferase vector, and a pGL3-TIMP3 vector led to an increase in luciferase activity in breast cancer cell lines, indicating direct interaction of miR-21 on TIMP3 expression at the translational level [21]. [score:6]
The effects of miR-21 over -expression on melanoma invasion therefore appear to be mediated by down-regulation of TIMP3. [score:6]
Cell lines derived from different stages of melanoma development exhibited increased invasion and decreased TIMP3 protein expression when miR-21 was over-expressed. [score:6]
This study is the first to identify TIMP3 as a potential target of miR-21 in the context of melanoma and demonstrates that down-regulation of TIMP3 may lead to increased melanoma invasion. [score:6]
Changes in TIMP3 protein expression are associated with miR-21 expression. [score:5]
Changes in TIMP3 protein expression relate to miR-21 expression. [score:5]
Additionally, flow cytometric analysis of TIMP3 protein expression in the Mel 39 cell line following transfection with a pre-miR-21 construct showed a decrease in TIMP3 expression from 63.45% to 30.75% (Fig. 3C). [score:5]
The data obtained demonstrating that miR-21 over -expression enhances invasion indicates that miR-21 may represent a treatment target. [score:5]
Likewise, the change in TIMP3 protein expression was not as definitive when miR-21 expression was modulated via intra-tumoral injections of LNAs. [score:5]
siRNA silencing of TIMP3 expression recapitulated the results obtained with miR-21 over -expression. [score:5]
Additionally, tissue inhibitor of metalloproteinases-3 (TIMP3) has been identified as a putative target and has been shown to be decreased in response to miR-21 [19, 20]. [score:5]
TIMP3 has been identified as a putative target and has been shown to be decreased in response to miR-21 over -expression in cholangiocarcinoma and glioma [19, 20]. [score:5]
In vitro depletion of miR-21 in melanoma cells leads to decreased tumor size in vivo The data obtained demonstrating that miR-21 over -expression enhances invasion indicates that miR-21 may represent a treatment target. [score:5]
miR-21 expression has been previously associated with an invasive phenotype in several malignancies due to its ability to target multiple pathways affecting this process. [score:5]
miR-21 has numerous targets involved in a myriad of cellular processes and while our efforts focused on commonly regulated genes, it is plausible that unstudied genes may have also contributed to the differences in cellular invasion. [score:4]
Murine studies demonstrated that pre-treatment of melanoma cells with an anti-miR-21 reagent led to decreased tumor growth in vivo, but direct injection of tumors in vivo with an anti-miR-21 LNA only modestly inhibited tumor growth. [score:4]
Mature miR-21 expression was significantly and consistently over-expressed in each cell line transfected with pre-miR-21 as compared to control pre-miR -transfected cell lines (WM1552c: 60.5 ± 32.6 fold increase; WM793b: 12.8 ± 4.5 fold increase; A375: 40.0 ± 13.2 fold increase; MEL 39: 100.2 ± 46.2 fold increase; all p < 0.001) (Fig. 1A). [score:4]
After 24 hours from transfection, cells were collected, and miR-21 expression was analyzed by Real-Time PCR to verify effective miR knockdown. [score:4]
A role for miR-21 -associated down-regulation of PDCD4 in colon cancer and TM1 and PDCD4 in breast cancer has also been confirmed [27, 28]. [score:4]
Meng et al. found miR-21 -mediated increases in hepatocellular carcinoma invasion were due to the direct targeting of PTEN mRNA [26]. [score:4]
The observation that miR-21 expression is increased in primary malignant melanoma tumors led us to explore the function of miR-21 in human melanoma cell lines (WM1552c, WM793b, A375, and MEL 39). [score:3]
In the current study, however, increased miR-21 expression was not found to decrease PTEN, TM1, or PDCD4 protein 24 hours post-transfection, suggesting that these pathways may not play a major role in miR-21-initiated invasion of melanoma. [score:3]
To test this hypothesis, A375 cells were transfected with an LNA oligonucleotide targeting miR-21 or a control LNA oligonucleotide. [score:3]
A375 cells were transfected in vitro with an LNA oligonucleotide targeting miR-21 or a control LNA oligonucleotide. [score:3]
The observation of a greater invasive potential without a concomitant increase in migration in miR-21-over -expressing cells suggests that miR-21 may be acting on one or more factors affecting the cell’s ability to degrade the extracellular matrix after they have already acquired increased mobility. [score:3]
Real-Time PCR was performed on the cells 24 hours post-transfection and demonstrated reduced miR-21 expression in the cells transfected with anti-miR‑21 LNA (Fig. 5A). [score:3]
Several mRNA targets for miR-21 have been recently verified, including phosphatase and tensin homolog (PTEN), tropomyosin-1 (TM1), and programmed cell death protein 4 (PCDC4) [20, 26– 29]. [score:3]
The sequences for each oligo are as follows: Ambion Control miR: AGUACUGCUUACGAUACGGTT Ambion Pre-miR miRNA Precursor: hsa-miR-21–5p: (UAGCUUAUCAGACUGA UGUUGA) Ambion Anti-miR miRNA Inhibitor: hsa-miR-21–5p (UAGCUUAUCAGACUGAU GUUGA) Santa Cruz Control siRNA (UUCUCCGAACGUGUCACGU)Santa Cruz TIMP3 siRNA (h2) sc-44331 consists of a pool of three siRNAs with sequences: GGUAUCACCUGGGUUGUAAtt GAACCUGUAUUCCUCUUCUtt GAGAGUAGGUGAUAAUGUAtt Transfection efficiency was assessed using a FAM labeled miR construct (Ambion, Austin, TX) with the same transfection method above. [score:3]
LNAs were used to achieve reduced expression of miR-21 within tumors in vivo. [score:3]
These results demonstrate that increased miR-21 expression may enhance invasion and tumor growth, but not proliferation or migration, in multiple melanoma cell lines. [score:3]
Finally, murine mo dels revealed that a miR-21 antagonist could inhibit melanoma tumor growth. [score:3]
The RNA was converted to cDNA, and Real-Time PCR for miR-21 confirmed reduced miR-21 expression (B). [score:3]
In order to examine the contribution of increased miR-21 expression to an aggressive melanoma phenotype, four melanoma cell lines were transfected with a non-specific control pre-miR or pre-miR-21. [score:3]
Twenty micrograms of protein were loaded and subjected to immunoblotting for the miR-21 putative target proteins TM1, TIMP3, PDCD4, and PTEN (A). [score:3]
In the current study, the effects of miR-21 over -expression were documented in multiple cell lines. [score:3]
While miR-21 has been identified as a microRNA commonly over-expressed in several solid tumors [39], the current study represents the first time a function has been ascribed to miR‑21 in the context of melanoma. [score:3]
However, intra‑tumoral injections of anti-miR-21 into established tumors only modestly inhibited tumor growth, but did appear to have some effect on tumor necrosis. [score:3]
The finding that TIMP3 expression was decreased in melanoma cells with elevated miR-21 and increased invasiveness prompted an exploration into the influence of TIMP3 on invasion. [score:3]
These results indicate that miR-21 may have a role in melanoma tumor formation; however, the down-stream effects of miR-21 over -expression may not be easily reversible via intra-tumoral injections of currently available LNA constructs. [score:3]
The RNA was converted to cDNA, and Real‑Time PCR for miR-21 confirmed reduced miR-21 expression (A). [score:3]
The sequences for each oligo are as follows: Ambion Control miR: AGUACUGCUUACGAUACGGTT Ambion Pre-miR miRNA Precursor: hsa-miR-21–5p: (UAGCUUAUCAGACUGA UGUUGA) Ambion Anti-miR miRNA Inhibitor: hsa-miR-21–5p (UAGCUUAUCAGACUGAU GUUGA) Santa Cruz Control siRNA (UUCUCCGAACGUGUCACGU)Santa Cruz TIMP3 siRNA (h2) sc-44331 consists of a pool of three siRNAs with sequences: GGUAUCACCUGGGUUGUAAtt GAACCUGUAUUCCUCUUCUtt GAGAGUAGGUGAUAAUGUAtt Transfection efficiency was assessed using a FAM labeled miR construct (Ambion, Austin, TX) with the same transfection method above. [score:3]
Western blot analysis of TIMP3 expression following transfection with a pre-miR-21 construct. [score:3]
0115919.g001 Figure 1Real-Time PCR was used to determine the expression of mature miR-21 in four human melanoma cell lines 24 hours post-transfection with control pre-miR or pre‑miR-21 (A). [score:3]
This increase was significant in WM1552c and WM793b (p < 0.05) and approached significance in MEL 39, mimicking the effects of miR-21 over -expression in cell lines. [score:3]
Mature miR-21 is overexpressed in cell lines transfected with pre-miR-21. [score:3]
Tumors of cells transfected pre-implantation with the anti-miR-21 LNA had significantly decreased tumor growth and increased TIMP3 protein expression. [score:3]
Decreased expression of TIMP3 in response to increased miR-21 was first described in cholangiocarcinoma and glioma [19, 20]. [score:3]
Real-Time PCR was used to determine the expression of mature miR-21 in four human melanoma cell lines 24 hours post-transfection with control pre-miR or pre‑miR-21 (A). [score:3]
Importantly, the increased invasion of miR-21 over -expressing cells was reproduced in TIMP3 siRNA‑transfected cells. [score:3]
There is always the possibility that other genes regulated by miR-21 could mediate an effect on invasion. [score:2]
In order to assess the effects of elevated miR-21 expression on melanoma cell movement, each of the four cell lines was transfected with pre-miR-21 or the control and plated onto Radius Migration Assay ECM-coated plates that have uniform wounds in the cell monolayers. [score:2]
After the tumors had reached an average volume of 100 mm [3], the tumors were directly injected with 50 μL of PBS alone, or 50 μL of PBS and diluted TransIT T KO transfection reagent containing 500 nM control LNA or 500 nM anti-miR-21 LNA (n = 5 per group). [score:2]
This migration assay examined the cells’ ability to migrate through individual ECM proteins (e. g. collagen and fibronectin), but it may be that additional factors within the native ECM are required for miR-21 over‑expressing melanoma cells to exhibit increased migration. [score:2]
Our group previously identified miR-21 as being over-expressed in primary cutaneous melanomas as compared to benign nevi, suggesting that miR-21 may play a role in melanoma pathogenesis [18]. [score:2]
Furthermore, miR-21 might be a regulator of tumor growth and this effect may be dependent on TIMP3. [score:2]
The effects of i n vivo depletion of miR-21 on tumor size. [score:1]
Interestingly, an increase in PTEN protein was observed in the WM1552c and A375 cell lines in response to pre-miR-21 transfection. [score:1]
Wang et al. showed that miR-21 alters cellular invasion in a TIMP3 dependent manner in the setting of esophageal carcinoma while Zhang et al. showed a similar effect in renal cell carcinoma [44, 45]. [score:1]
Increased miR-21 activity does not affect melanoma proliferation. [score:1]
Mice injected with the anti-miR-21 LNA‑transfected cells developed significantly smaller tumors than those that received the control LNA -transfected cells. [score:1]
These findings differ from previous findings which suggest an involvement of miR-21 in mitotic rate [18]. [score:1]
The anti‑miR-21 LNA -treated tumors appeared to have increased levels of TIMP3 with 1+ staining in 2/5 tumors and 1 to 2+ staining in 3/5 tumors. [score:1]
Immunoblots of cell lysates obtained 24 hours post‑transfection revealed a decrease in the TIMP3 protein in all four melanoma cell lines transfected with pre-miR-21 (Fig. 3A and S3 Fig. ). [score:1]
Potential changes in the proliferative capacity of cells expressing elevated amounts of miR-21 were evaluated through mitochondrial reduction of yellow MTT to purple formazan forty-eight hours following the plating of transfected cells. [score:1]
S3 Fig WM793, Mel 39, A375, and WM 1552 melanoma cells were transfected with pre-miR-21 or a control miR (25 nM) and incubated overnight prior to harvesting. [score:1]
When the cells were 70–80% confluent, they were transfected with pre-miR-21 or control miR-21. [score:1]
In vivo StudiesLNA oligonucleotides against miR-21 and a negative control oligonucleotide were obtained from Exiqon, Inc. [score:1]
At the same time point, 2 × 10 [6] cells were resuspended in PBS and subcutaneously injected into the right flank of 6 week old female 01B74 Athymic NCr-nu/nu mice (n = 4 for the control LNA group and n = 6 for the anti-miR-21 LNA group) (Frederick National Library—NCI, Frederick, MD). [score:1]
Notably, there appeared to be an effect of miR-21 at lower doses of oligonucleotide in A375 cells (Fig. 2E). [score:1]
Notably, one must consider the potential off-target effects of miR-21 when evaluating the role of TIMP3 reductions on the invasion capacity of melanoma cells. [score:1]
Increased miR-21 activity leads to increased invasion but not migration in vitro For metastasis to occur, primary melanoma cells must degrade the basement membrane and extracellular matrix and migrate through the stroma. [score:1]
In vitro depletion of miR-21 in melanoma cells leads to decreased tumor size in vivo. [score:1]
LNA oligonucleotides against miR-21 and a negative control oligonucleotide were obtained from Exiqon, Inc. [score:1]
When the cells were 70–80% confluent, they were transfected with pre-miR-21 or control pre-miR (Ambion, Austin, TX) using TransIT T KO transfection reagent (Mirus Bio, Madison, WI). [score:1]
0115919.g005 Figure 5Decreased tumor size in vivo is achieved by depletion of miR-21 in vitro. [score:1]
There was a small decrease in tumor size for the group receiving anti-miR-21 treatments at days 5–10 but this difference was not appreciable by day 12 (Fig. 6A). [score:1]
Decreased tumor size in vivo is achieved by depletion of miR-21 in vitro. [score:1]
Increased miR-21 activity leads to increased invasion but not migration in vitro. [score:1]
While they carefully examined the effects of miR-21 antagonism on MMP activity and cellular invasion, they did not explore the effect of TIMP3 siRNA on invasion, as was done in this study [19]. [score:1]
Importantly, miR-21 transfection of A375 melanoma cells did enhance invasion at lower doses of oligonucleotide thereby, supporting the use of A375 cells within our in vivo mouse studies. [score:1]
Therefore, interpretation of the effects of miR-21 on TIMP3 protein levels must be tempered by the realization that the miR control constructs could exert some effect on TIMP3 levels. [score:1]
In this report, the effect of increased miR-21 expression on melanoma cell line behavior was evaluated. [score:1]
The tumors were then injected with PBS, the control LNA, or the anti-miR-21 LNA. [score:1]
Each tumor was treated with four 50 µL injections of PBS, control LNA, or anti-miR-21 LNA at 500 nM at days 0, 4, 7, 11 (arrows). [score:1]
Finally, this study evaluated the ability of miR-21 inhibition to exert anti-melanoma effects in vivo. [score:1]
[1 to 20 of 90 sentences]
18
[+] score: 265
Other miRNAs from this paper: mmu-mir-200c, mmu-mir-375, mmu-mir-21b, mmu-mir-21c
Inhibition of miR-21 increased the expression of Sec23A protein in SW-480 cells while over -expression of miR-21 significantly suppressed the expression of Sec23A protein and Sec23A mRNA in DLD-1 cells. [score:11]
After analyzing the expression of miR-21 and Sec23A in CRC cell lines, we transfected the highest miR-21 expressing cell line, SW-480, with a plasmid containing an miR-21 inhibitor and the lowest miR-21 expressing cell line, DLD-1, with a plasmid containing an miR-21 mimic and measured the effects on the expression of Sec23A and on cell proliferation, migration, and invasion. [score:9]
Our data show that miR-21 was over expressed in HT-29 and SW-480 human CRC cells and that this over expression suppressed Sec23A expression in these cells. [score:9]
MiR-21 is overexpressed in CRC cell lines and promotes proliferation, migration, and invasion in these cells in vitro associated with downregulation of Sec23A expression. [score:7]
a Inhibition of miR-21 expression promoted the expression of Sec23A protein in SW-480 cells relative to negative control (NC) and mock -treated cells (MOCK). [score:7]
Up-regulation of miR-21 promoted CRC cell proliferation, migration, and invasion while down-regulation of miR-21 resulted in decreased proliferation, migration, and invasion of these cells. [score:7]
Over -expression of miR-21 promoted tumor growth in BALB/c nude mice and suppressed tumor expression of Sec23A. [score:7]
The expression of miR-21 was significantly suppressed in SW-480 cells transfected with miR-21 inhibitor compared with negative controls (p < 0.01; Fig.   1b). [score:6]
These findings are consistent with earlier reports that miR-21 induced invasion and metastasis [29] and that miR-21 over -expression enhanced CRC cell proliferation, migration, and invasion while miR-21 down regulation inhibited these cells’ proliferation, migration, and invasion [30– 32]. [score:6]
To identify the regulatory relationship between miR-21 and Sec23A, potential targets of miR-21 were analyzed by bioinformatics software, commonly used as targetscan for microRNA. [score:6]
In contrast, miR-21 over -expression significantly suppressed the expression of Sec23A protein and mRNA in DLD-1 cells compared with controls (p < 0.01, p < 0.05, respectively; Fig.   3c- d). [score:6]
Moreover, recent studies have shown that miR-21 is up-regulated in CRC [15, 16] and that high levels of tumoral miR-21 expression are associated with poor prognosis as well as poor response to chemotherapy in patients with CRC [17, 18]. [score:6]
In our study, downregulation of Sec23A stimulated the migration and invasion of SW-480 and DLD-1 cells and the proliferation of DLD-1, which is similar to the effects of miR-21 over -expression. [score:6]
The expression of miR-21 was significantly higher in the tumors from the mice inoculated with miR-21 over expressing DLD-1 cells than in those from the control or mock treatment groups (p < 0.05; Fig.   7a). [score:5]
a Tumors from mice inoculated with miR-21 over -expressing DLD-1 cells expressed higher levels of miR-21 than tumors from mice inoculated with negative controls (NC) or mock -treated cells (MOCK). [score:5]
b Tumors from mice inoculated with miR-21 over -expressing DLD-1 cells expressed lower levels of Sec23A than tumors from mice inoculated with negative controls or mock -treated cells. [score:5]
Genetic deletion of miR-21 suppressed the proliferation, migration, and invasion of SW-480 cells, while over -expression of miR-21 promoted proliferation, migration, and invasion of DLD-1 cells. [score:5]
b The expression of miR-21 in SW-480 cells after transfection with miR-21 inhibitor, negative control (NC) or cells without treatment (MOCK). [score:5]
There was no significant difference in expression of Sec23A mRNA between the SW-480 cells transfected with miR-21 inhibitor and controls (Fig.   3b). [score:5]
c- d Over -expression of miR-21 by miR-21 mimic decreased the expression of Sec23A protein and mRNA in DLD-1 cells relative to negative control and mock -treated cells. [score:5]
On the other hand, expression of Sec23A protein was significantly lower in tumors from the mice inoculated with miR-21 over expressing DLD-1 cells than in the tumors from the control or mock treatment groups (p < 0.01; Fig.   7b). [score:5]
a- c Inhibition of miR-21 in SW-480 by miR-21 inhibitor reduced cell proliferation, migration, and invasion relative to negative control (NC) and mock -treated cells (MOCK). [score:5]
Moreover, our finding that miR-21 over -expression promoted the growth of xenograft DLD-1 tumors in BALB/c nude mice is in line with a previous report that over -expression of miR-21 in colon cancer cells increased their tumorigenic potential in SCID mice [13]. [score:5]
This result was confirmed by immunohistochemical analysis showing lower Sec23A expression in the tumors from mice inoculated with miR-21 over expressing DLD-1 cells (Fig.   7c). [score:5]
These findings suggest that miR-21 might be a potential interesting target in CRC and may have therapeutic implications for patients with this disease. [score:5]
Knockdown of Sec23A increased the expression of miR-21 in SW480 and DLD-1 cells and their proliferation (DLD-1 only), migration, and invasion. [score:4]
MicroRNA-21 (miR-21) is up-regulated in many cancers, including colorectal cancer (CRC). [score:4]
We also observed that knocking down the Sec23A significantly increases the expression of miR-21 in SW-480 and DLD-1 cells. [score:4]
For the cell proliferation assays, SW-480 cells stably expressing miR-21 inhibitor, sh-Sec23A, or empty vector or control shRNA were seeded at a density of 2 × 10 [3] cells in 96-well plates and incubated for various periods of time (0 to 5 days). [score:4]
Also, this may be attributed to indirect regulation of miR-21 and involvement of other regulators of the process of protein formation. [score:4]
Fig. 4Sec23A knockdown increases expression of miR-21 in CRC cell lines. [score:4]
d- f Up-regulation of miR-21 in DLD-1 by miR-21 mimic increased proliferation, migration, and invasion relative to negative control and mock -treated cells. [score:4]
MiR-21 inhibits expression of Sec23A in CRC cell lines. [score:4]
This suggests a novel mechanism by which miR-21 contributes to tumorigenesis through downregulation of Sec23A. [score:4]
f- g MiR-21 expression was increased in Sec23A knockdown SW-480 and DLD-1 cells. [score:3]
a Expression of miR-21 in untreated HT-29, SW-480, and DLD-1 cell lines. [score:3]
These findings provide novel insight into the molecular functions of miR-21 in CRC, which may serve as a potential interesting target. [score:3]
The weights of tumors dissected on day 21 from the mice inoculated with miR-21 over expressing DLD-1 cells were greater than those of the tumors from the control or mock group (p < 0.01; Fig.   6b-d). [score:3]
Also it would be interesting to determine the survival rate in each group in animal mo del and even to conduct clinical study to determine the association of miR-21 expression with clinic-pathological parameters in future study. [score:3]
Expression of Sec23A and miR-21 in CRC cells. [score:3]
Moreover, over -expression of miR-21 promoted tumor growth in BALB/c nude mice. [score:3]
c The expression of miR-21 in DLD-1 cells after transfection with miR-21 mimic, negative control (NC) or cells without treatment (MOCK). [score:3]
The expression of miR-21 in SW-480 was higher than that in DLD-1 cells. [score:3]
DLD-1 cells stably expressing miR-21 mimic, sh-Sec23A, or empty vector or control shRNA were seeded at a density of 1 × 10 [3] cells per well in 96-well plates and incubated for the same periods of time. [score:3]
d Tumors dissected from mice inoculated with miR-21 over -expressing DLD-1 cells weighed significantly more than tumors from mice inoculated with negative control or mock -treated cells. [score:3]
Thus, we couldn’t demonstrate that Sec23A is the direct target of miR-21, as verified by luciferase reporter assay [33, 34] of miR-21. [score:3]
Over -expression of miR-21 also promotes the growth of DLD-1 CRC tumors in BALB/c nude mice in vivo. [score:3]
Accumulating evidence indicates that miR-21 is involved in the pathogenesis and progression of cancer, including cell proliferation, migration, invasion, metastasis, and apoptosis, by targeting PTEN, PDCD4, TIMP3, and RHOB [9– 12] or by playing important roles in signaling pathways such as, RAS/MEK/ERK, PTEN/PI-3 K/AKT, and Wnt/β-catenin [13, 14]. [score:3]
Fig. 6Over -expression of miR-21 enhances DLD-1 tumor growth in BALB/c nude mice. [score:3]
a Mice inoculated with miR-21 over -expressing DLD-1 cells grew larger tumors than mice inoculated with negative controls (NC) or mock -treated cells (MOCK). [score:3]
Cells were transfected with pGCMV/EGFP plasmids containing hsa-miR-21 inhibitor or hsa-miR-21 mimic, or empty vector (negative control [NC]), or with pGPU6 plasmids containing Sec23A shRNA (sh-Sec23A), or control shRNA (sh-NC). [score:3]
MiR-21 overexpression stimulates proliferation, migration, and invasion of CRC cells. [score:2]
In contrast, cell proliferation, migration, and invasion were markedly increased in miR-21 over -expressing DLD-1 cells compared with the controls (all panels, p < 0.01; Fig.   2d- f). [score:2]
We also evaluated the effect of knocking down Sec23A on miR-21 expression and its effects on cell proliferation, migration, and invasion. [score:2]
An experiment with double knock-in of miR-21 and Sec23A will be conducted in our future study to further demonstrate this. [score:2]
MiR-21 overexpression promotes tumor growth in BALB/c nude mice. [score:2]
In contrast, transfection of miR-21 mimic into DLD-1 cells significantly increased the expression of miR-21 compared with negative controls (p < 0.01; Fig.   1c). [score:2]
MiR-21 expression in CRC cells. [score:2]
On the other hand, transfection with sh-Sec23A significantly increased the expression of miR-21 in SW-480 or DLD-1 cells compared with cells transfected with sh-NC (all p < 0.01; Fig.   4f- g). [score:2]
FBS, fetal bovine serum; CRC, colorectal cancer; miR-21, microRNA-21; PBS, phosphate-buffered saline solution; RT-PCR, real-time quantitative polymerase chain reaction The authors would like to thank Dr. [score:1]
In light of previous studies indicating that miR-21 level is increased in CRC tissues and CRC cell lines [27, 28], we determined the effect of miR-21 on the tumorigentic activities of representative CRC cells as well as its relationship with Sec23A. [score:1]
There is probably a across talk between miR-21 and Sec23A but we cannot confirm for now how it works. [score:1]
Unfortunately, analysis showed that there were no binding sites between miR-21 and Sec23A. [score:1]
Finally, we assessed the effect of miR-21 in a xenograft tumor mo del in mice. [score:1]
Despite these findings of the biological roles of miR-21 and Sec23A, respectively in cancer, their relationship has not been established in CRC. [score:1]
Colorectal cancer miR-21 Sec23A Proliferation Tumor growth Colorectal cancer (CRC) is the third most common cancer and the fourth most common cause of cancer-related death worldwide [1]. [score:1]
Nevertheless, the function of miR-21 in CRC and the mechanism underlying that function is still unclear. [score:1]
Levels of miR-21 mRNA were significantly higher in HT-29 (colorectal adenocarcinoma) and SW-480 (Dukes’ type B) cells than in DLD-1 (Dukes’ type C) cells (p < 0.05, p < 0.001, respectively; Fig.   1a). [score:1]
[1 to 20 of 68 sentences]
19
[+] score: 260
miRNAs with fold change <0.8 and >1.2 are represented for each atrophic condition (blue is for down-regulation and yellow is for up-regulation)Quantitative RT-PCR confirmed the up-regulation of miRNA-206 and miRNA-21 after denervation even if their pattern of expression was slightly different (Fig. 1, D and E). [score:12]
miRNAs with fold change <0.8 and >1.2 are represented for each atrophic condition (blue is for down-regulation and yellow is for up-regulation) Quantitative RT-PCR confirmed the up-regulation of miRNA-206 and miRNA-21 after denervation even if their pattern of expression was slightly different (Fig. 1, D and E). [score:12]
The comparison of the down-regulated genes with the in silico predicted targets of miRNA-206 and miRNA-21 significantly reduced the list of the potential targets (Fig. 5 A). [score:8]
Consistently, transfection of C2C12 muscle cells with miRNA-206 led to a significant down-regulation of eIF4E3 transcript (Fig. 7 A), whereas over -expression of miRNA-21 led to a significant decrease of YY1 and eIF4E3 mRNAs (Fig. 7 A). [score:6]
Importantly, over -expression of miRNA-21 led to down-regulation of the YY1 protein (Fig. 7 B). [score:6]
B, Venn diagram shows the number of down-regulated genes (blue circle) in the denervated condition (after 7 and 14 days) that are targets of miR-21 (green circle) and miR-206 (yellow circle). [score:6]
The kinetic of miRNA-21 and -206 induction in denervated muscles suggests that miRNA-206 is one of the miRNA-21 partners and that the simultaneous induction of both microRNAs is critical for an optimal down-regulation of important targets controlling muscle mass. [score:6]
To discriminate whether up-regulation of these miRNAs was sufficient to induce atrophy, we over-expressed miRNA-206 and miRNA-21 either in normal or denervated adult muscle. [score:6]
However, when we overexpressed miRNA-21 in innervated muscle we did not induce muscle atrophy suggesting that miRNA-21 requires the co -expression of other microRNAs to fully elicit an atrophic action. [score:5]
FIGURE 7. A, over -expression of miRNA-206 or miRNA-21 directly regulates the mRNA of YY1 and eIF4E3. [score:5]
Consistent with the data of miRNA over -expression, inhibition of miRNA-21 under basal conditions did not show any effect on muscle fiber size (Fig. 4 D). [score:5]
This was confirmed by experiments in which miRNA-206 and miRNA-21 were co-expressed leading to an exacerbation of muscle atrophy induced by just miRNA-206 expression. [score:5]
This concept is also sustained by the minor changes that miRNA-206 and miRNA-21 over -expression and inhibition elicited on myofiber size. [score:5]
E and F, qRT-PCR of miRNA-206 and miRNA-21 expression levels on C2C12 myoblasts transfected for 48 h with miRNA overexpressing vectors. [score:5]
A and B, transfection of C2C12 cells with constructs expressing miRNA sponges efficiently inhibits miRNA-206 or miRNA-21. [score:5]
Kumarswamy R. Volkmann I. Thum T. (2011) Regulation and function of miRNA-21 in health and disease. [score:4]
In fact miRNA-21 is already up-regulated at 3 days of denervation, a time in which muscles are not atrophic and miRNA-206 is not significantly induced. [score:4]
miRNA-21 is also important in the cardiovascular system because it is highly up-regulated during cardiac stress, but its actual role is still controversial. [score:4]
The microarray analyses identified 4,346 transcripts down-regulated between 3 days of denervation and 7 or 14 days (Fig. 5 B), an opposite profile of that of miRNA-21 and -206. [score:4]
To demonstrate that miRNA-206 and miRNA-21 were involved in this regulation, we transfected adult TA muscle with the 3′UTR-luciferase sensors together with the miRNA expressing vectors. [score:4]
E, mutation of the miRNA-21 binding sites on the 3′UTR of YY1 and eIF4E3 partially prevent miRNA -dependent inhibition. [score:4]
We further focused on atrophy induced by denervation and identified the two most up-regulated miRNAs, miRNA-206 and miRNA-21. [score:4]
Among the up-regulated microRNAs, miRNA-21 and miRNA-206 were strongly induced. [score:4]
FIGURE 1. miRNA expression is deregulated in different mo dels of skeletal muscle atrophy, miRNA-21 and miRNA-206 being the two most induced miRNAs in denervation. [score:4]
Inhibition of miRNA-206 and miRNA-21 Partially Protects from Denervation -induced Atrophy. [score:3]
F, inhibition of miRNA-21 in denervated muscles partially protects from atrophy. [score:3]
Adult tibialis anterior muscles were transfected with DNA vector over -expressing the mature miRNA-21. [score:3]
Fasted and diabetic muscles also showed an induction of miRNA-206 and miRNA-21 expression (Table 4). [score:3]
This finding opens the possibility that miRNA-21, through the regulation of YY1, participates in the regulation of mitochondria biogenesis/functioning. [score:3]
Next we monitored whether inhibition of miRNA-206 and miRNA-21 could reduce atrophy in denervated muscles and promote muscle growth of normal muscles. [score:3]
D, expression level of Tmem49, the host gene of miRNA-21, during 24 h fasting and 7 days of denervation. [score:3]
C and D, qRT-PCR of miRNA-206 and miRNA-21 expression levels on transfected TA muscles, respectively. [score:3]
MicroRNA-206 was also induced by fasting but not by diabetes (Fig. 1, F and H), whereas miRNA-21 was suppressed by fasting and unchanged in diabetes (Fig. 1, G and I). [score:3]
B, densitometric quantification of the Western blot for YY1 in C2C12 myoblasts over -expressing negative control or miRNA-21. [score:3]
FIGURE 5. Approach used to identify biologically relevant targets of miRNA-206 and miRNA-21. [score:3]
Moreover, our finding that two miRNAs control eIF4E3 expression is consistent with the concept that miRNA-206 and miRNA-21 synergistically act to slow down the rate of protein synthesis. [score:3]
G, 48 h of fasting decreases the miRNA-21 expression level. [score:3]
A, miRNA-206, and B, miRNA-21 expression levels are increased after 15 days of denervation in both fast and slow muscles. [score:3]
The mature sequences of miRNA-206 and miRNA-21 were cloned into the BLOCK-iT Pol II miR RNAi Expression Vector Kit with EmGFP (Invitrogen number K4936-00). [score:3]
B, eIF4E3 is a target of both miRNA-206 and miRNA-21. [score:3]
The expression of miRNA-21 reduced the activity of all the 3′UTR-luciferase sensors (Fig. 6, A–C). [score:3]
Identification of miRNA-206 and miRNA-21 Target Genes. [score:3]
Quantitative RT-PCR confirmed that mature miRNA-206 and miRNA-21 were expressed both in vitro (Fig. 3, E and F) and in vivo (Fig. 3, C and D). [score:3]
H and I, diabetes does not alter the expression levels of miRNA-206 and miRNA-21. [score:3]
Adult TA muscles were co -transfected with expression plasmid for miRNA-206 or miRNA-21 and the construct encoding for the luciferase sensor of YY1–3′UTR. [score:3]
However, after denervation, overexpression of miRNA-21 enhanced muscle atrophy by 11% (Fig. 3 L). [score:3]
Interestingly miRNA-21 was induced in 8 of 10 inherited muscular diseases (22) suggesting that it can be part of the complex mechanisms of muscle wasting. [score:3]
A and B, in vivo transfection of co-cistronic vectors expressing (A) miRNA-206 or (B) miRNA-21 together and GFP. [score:3]
L, over -expression of miRNA-21 in denervated muscles aggravates the atrophic phenotype. [score:3]
E, miRNA-21 expression levels are increased at different time points of denervation. [score:3]
The mutated sensors were transfected into adult muscles together with the expression vectors for miRNA-206 and miRNA-21. [score:3]
To address the biological role of miRNA-206 and miRNA-21, in vivo, in adult skeletal muscle we cloned the mature sequence of these miRNAs into a co-cistronic vector that co-express both the miRNA and mRNA for GFP. [score:3]
C2C12 myoblasts were co -transfected with the control or mutated version of the 3′UTR of YY1 or eIF4E3 together with scramble or miRNA-21 expressing vector. [score:3]
FIGURE 3. Over -expression of miRNA-206 and miRNA-21 in vivo alters adult muscle fiber size. [score:3]
These results confirm that the 3′UTR of YY1 is regulated by miRNA-21, whereas the 3′UTR of eIF4E3 is regulated by both miRNA-206 and miRNA-21. [score:3]
C, Pdcd10 is a target of both miRNA-206 and miRNA-21. [score:3]
A, YY1 is a target of miRNA-21. [score:3]
G and H, in vivo transfection of miRNA-206 or miRNA-21 expressing vectors produces functional mature miRNAs. [score:3]
D, in vivo inhibition of miRNA-21 does not affect skeletal muscle fiber size. [score:3]
C2C12 myoblasts were transfected with miRNA-206 or miRNA-21 expressing vector. [score:3]
In fact, this analysis defined 840 and 286 potential targets of miRNA-206 and miRNA-21, respectively. [score:3]
Over -expression of miRNA-206 or miRNA-21 dramatically reduced the luciferase activity confirming that these vectors were able to produce functional miRNAs (Fig. 3, G and H). [score:3]
When miRNA-21 was expressed in innervated muscles, no major differences were observed when compared with controls (Fig. 3 J). [score:2]
J, in vivo transfection of miRNA-21 does not affect skeletal muscle fiber size. [score:1]
miRNA-206 and miRNA-21 were induced in both TA, a glycolytic mitochondrial poor muscle, and soleus, an oxidative mitochondrial rich muscle (Fig. 2, A and B) suggesting that miRNA response is a common feature of atrophying muscles. [score:1]
In conclusion, miRNA-206 and miRNA-21 are important for fine-tuning the denervation atrophy program and their modulation could be a novel potential therapeutic approach to counteract muscle loss and weakness in catabolic conditions. [score:1]
On the other hand, miRNA-21 is located on the 10th intron of the vacuole membrane protein 1 (VMP1/TMEM49) gene (38). [score:1]
The luciferase sensor of miRNA-206 or miRNA-21 was co -transfected with an empty miRZIP (Zip Null) vector or with the specific miRZIP-206 or miRZIP-21 plasmids. [score:1]
Altogether, these in vivo results demonstrate that YY1 is modulated by miRNA-21, whereas eIF4E3 and Pdcd10 are modulated by both miRNA-206 and miRNA-21. [score:1]
Luciferase activity of miRNA-206 and miRNA-21 sensors was significantly reduced after 7 days of denervation (Fig. 1 J) confirming the increased activity of these miRNAs after denervation. [score:1]
This approach allows us to identify miRNA-206 and miRNA-21 as important modulators of muscle loss. [score:1]
Induction of miRNA-206 and miRNA-21 Contributes to Muscle Atrophy. [score:1]
pmiRZIP lentivector (ZIP NULL), pmiRZIP lentivector anti-miRNA-206 (ZIP-206), and pmiRZIP lentivector anti-miRNA-21(ZIP-21) were acquired from System Bioscience. [score:1]
Also in this case the mRNA level of VMP1 remained unchanged in the atrophic conditions indicating that miRNA-21 is transcribed independently from its host gene (Fig. 2 D). [score:1]
[1 to 20 of 74 sentences]
20
[+] score: 256
Our data presented in current study indicated that IPost inhibited the expression of PTEN during I/R injury, accompanied by parallel up-regulation of miR-21 expression. [score:10]
In addition, PTEN expression was up-regulated by knockdown of endogenous miR-21 expression in vivo using its antagomir during I/R injury. [score:9]
Moreover, overexpression of miR-21 could further increase expression of p-Akt and Bcl-2 (Figure 6B-6C), while decrease the expression of Bax and Caspase-3. However, PI3K inhibitor LY294002 could abrogate the cardioprotection of miR-21 against I/R injury in vivo (Figure 6B-6E). [score:9]
Among these abnormally expressed miRNAs, we were excited to find that miR-21 was remarkably up-regulated in hearts by IPost and its expression was increased more than fivefold relative to sham group (Figure 1). [score:8]
It should be noted that IPost -mediated cardiac protection against myocardial I/R injury was partially inhibited by knockdown of cardiac miR-21, indicating that miR-21 may be an important target for the development of novel therapeutic strategies for protection against ischemic insults. [score:7]
The data in Figure 7 showed that overexpression of miR-21 could further decrease apoptosis relative to IPost group (from 14.08% to 11.80%, P<0.05; Figure 7B), while the PI3K inhibitor LY294002 could knockdown the anti-apoptotic role of miR-21 against I/R injury in vivo (from 11.80% to 39.90%, P<0.01; Figure 7B). [score:6]
Moreover, IPost -induced upregulation of cardiac miR-21 expression was successfully silenced by antagomir-21 as determined by qRT–PCR (Figure 2C). [score:6]
IPost up-regulated miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499, while down-regulated miR-23a and miR-9 as compared with Sham group. [score:6]
Cheng et al. [20] demonstrated that miR-21 was up-regulated by IPC, which protected heart against I/R injury via anti-apoptosis through its target programmed cell death 4 (PDCD4). [score:6]
Moreover, IPC -mediated cardiac protection in rat heart was inhibited by knockdown of endogenous miR-21 expression [20]. [score:6]
In order to demonstrate the direct link between PTEN/Akt signaling pathway and miR-21 induced by IPost, we inhibited PI3K using the PI3K inhibitor LY294002, which was given for the first 15 minutes of reperfusion. [score:6]
After 3 h of reperfusion, the expression of miR-21 in infarcted areas in IPost-pretreated mouse hearts was up-regulated relative to I/R group. [score:6]
Modulation of total Akt and p-Akt protein expression in mouse cardiomyocyte by miR-21 and PI3K inhibitor LY294002. [score:5]
Compared with sham group, the expressions of miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499 were increased in IPost hearts, while miR-9 and miR-23a were down-regulated in IPost mo dels. [score:5]
As shown in Figure 5, IPost induced mild decrease in apoptosis-related proteins PTEN (Figure 5A), Bax (Figure 5E) and Caspase-3 (Figure 5F) levels compared with I/R group, accompanied by parallel up-regulation of miR-21 expression. [score:5]
As shown in Figure 2B, miR-21 could be down-regulated with antagomir-21 in vivo at the onset of I/R injury, while the scramble had not the same function. [score:4]
Knockdown of cardiac miR-21 expression using antagomir-21 and gene transfer of miR-21 mimic in vivo. [score:4]
We found that miR-21 was up-regulated by IPost in mouse cardiac I/R injury mo del. [score:4]
Knockdown of cardiac miR-21 expression abolishes IPost -mediated cardioprotection against I/R injury in vivo. [score:4]
In this study we unexpectedly found that miR-21 was remarkably up-regulated in myocardium by IPost in vivo. [score:4]
The effect of IPost -induced miR-21 up-regulation on left ventricular function. [score:4]
Findings of this study firstly present evidence demonstrating that in cardiocytes, IPost -mediated miR-21 negatively regulates PTEN expression during I/R injury. [score:4]
A recent study has shown that miR-21 was upregulated after IPC and miR-21 was thought to be involved in miRNA -induced cardioprotection [36]. [score:4]
To determine the protective role of IPost -induced miR-21 up-regulation, the mice were divided into the following four groups: I/R group; I/R+IPost group (I/R mice treated with IPost); Antagomir-21+IPost+I/R group (I/R mice treated with anagomir-21 and IPost); Scramble+IPost+I/R group (I/R mice treated with scramble and IPost). [score:4]
To further confirm the mechanism of IPost -upregulated miR-21 -mediated cardiac protection in vivo, TUNEL staining was performed. [score:4]
Knockdown of cardiac miR-21 expression restrains IPost -mediated cardioprotection against I/R injury in vivo. [score:4]
This study indicates that IPost-regulated miR-21 may be a promising intervention in the management of ischemic heart diseases. [score:4]
We found that miR-21 was remarkably up-regulated in mouse hearts after IPost. [score:4]
More exciting, we observed that knockdown of endogenous miR-21 expression with antagomir-21 increased sensitivity to I/R-triggered cell death. [score:4]
To further explore the biological involvement of miR-21 in IPost -mediated cardiac protection, miR-21 expression was blocked by its antagomir. [score:3]
The aberrant expression of miR-21 indicated that miR-21 was involved in the protective effect of cardiac IPost. [score:3]
So we selected PTEN as the potential target protein of miR-21 to see whether miR-21 was involved in the IPost -mediated anti-apoptotic effects on cardiomyocyte apoptosis. [score:3]
Computational analysis indicates that PTEN is a potential target gene of miR-21 as described in recent study [30]. [score:3]
Furthermore, we confirmed that miR-21 plays a protective role in myocardial apoptosis through PTEN/Akt signaling pathway, which was abrogated by the PI3K inhibitor LY294002. [score:3]
Then real-time quantitative PCR was performed to quantify the expression level of miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 with SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions. [score:3]
This study indicated that manipulating the expression of miR-21 was involved in the protective effect of myocardial IPost. [score:3]
MiR-21 expression is blocked by its antagomir before and after 3 h of reperfusion in IPost -mediated cardiac protection. [score:3]
But administration of anagomir-21 could silence the cardiac endogenous miR-21 expression in vivo. [score:3]
In our current study, antagomir-21 was used to silence the cardiac endogenous miR-21 expression in vivo. [score:3]
The results presented here indicated that the potential signal pathway of miR-21 protection might be achieved by targeting PTEN/Akt signaling pathway. [score:3]
In addition, the TUNEL staining also demonstrated that inhibiting PI3K at time of reperfusion abrogated the protection of miR-21 induced by IPost (Figure 7). [score:3]
PTEN is the current identified target genes of miR-21 which is involved in miR-21 -mediated cardiovascular effects [35]. [score:3]
Furthermore, inhibiting PI3K at time of reperfusion abrogated cardiac protection of miR-21 induced by IPost. [score:3]
In summary, the results imply that IPost -mediated miR-21 can signal through a PTEN/Akt axis in the cardiomyocytes, which inhibits cardiac myocytes apoptosis during I/R injury. [score:3]
To our best knowledge, this is the first proof to demonstrate that miR-21 expression can be mediated by IPost, which plays an important role in protecting against cardiac I/R injury in mice mo dels. [score:3]
As previously reported, a collection of miRNAs were abnormally expressed in ischemic mouse hearts in response to I/R injury, such as miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 [20, 21, 28]. [score:3]
Moreover, Cheng et al. demonstrated that IPC -mediated miR-21 had a protective role against I/R injury by reducing cardiac cell apoptosis via its target gene programmed cell death 4 (PDCD4) [20]. [score:3]
In different animal mo del, miR-21 expression induced by IPost is perhaps different, which possibly plays the role in ischemic cardioprotection via diverse pathways and causes various phenotypes, providing potential explanations for the currently divergent observations in our field. [score:3]
Up -regulating of endogenous miR-21 induced by IPost is able to alleviate I/R -induced cardiomyocyte apoptosis of the infarct area in mouse heart and the potential mechanism is involved in regulation of PTEN/Akt signaling pathway. [score:3]
Inhibiting PI3K at time of reperfusion abrogated the anti-apoptotic role of miR-21 induced by IPost. [score:3]
Inhibiting PI3K at time of reperfusion abrogates protection of miR-21 induced by IPost. [score:3]
More recently, the roles of miR-21 in cardiovascular disease have come into notice [34, 35]. [score:3]
MiR-21 is a highly expressed miRNA in cardiovascular system, which has also been implicated in cardiomyocyte apoptosis [34, 36]. [score:3]
Taken together, these data suggest that IPost -mediated miR-21 might protect mouse heart against I/R injury, probably through regulation of the cardiac cell apoptosis. [score:2]
By using quantitative real-time RT-PCR analysis, we found that a collection of miRNAs were regulated by IPost (Figure 1), such as miR-21, miR-15b, and miR-199b. [score:2]
IPost -mediated anti-apoptotic effect on cardiac cells in vivo is attenuated by knockdown of cardiac miR-21 with its antagomir. [score:2]
Hence, we sought to examine the significance of miR-21 in regulating PTEN/Akt signaling pathway in IPost mouse hearts. [score:2]
Knockdown of miR-21 with antagomir-21 could reverse the protective effects of IPost. [score:2]
In a recent study, Duan et al. found that there was no statistical significance in the expression of miR-21 in the remote ischemic preconditioning groups and IPost groups compared with the control group in the isolated rat heart mo del [32]. [score:2]
The results showed IPost could reduce I/R injury -induced infarct size of the left ventricle, improve cardiac function, and prevent myocardial apoptosis, while knockdown of miR-21 with antagomir-21 could reverse these protective effects of IPost against mouse I/R injury. [score:2]
Taken together, these results suggest that miR-21 induced by IPost acts directly on myocardium and induces cardioprotective effects through the activation of PTEN/Akt signaling pathway. [score:2]
Yin et al. found that miR-21 had a protective role against I/R injury in an in vitro mo del [36]. [score:1]
IPost -mediated miR-21 can signal through a PTEN/Akt axis in the cardiomyocytes, which is involved in anti-apoptotic effect on cardiac myocytes. [score:1]
However, after transferring antagomir-21 into myocardium to silence the endogenous miR-21 in vivo, the anti-apoptotic effects of IPost were attenuated markedly in vivo. [score:1]
Together, these data disclose that IPost -induced cardiac functional recovery is associated with the increased level of miR-21. [score:1]
In order to transfect the miR-21 mimic in vivo, with the chest open as described above, 50 µg in 100 µl of synthesized miR-21 (GenePharma Co. [score:1]
Taken together, these data clearly demonstrate that miR-21, as an anti-apoptotic miRNA, plays an anti-apoptotic role via activation of the PTEN/Akt signaling pathway in cardiac IPost mo del. [score:1]
In summary, our data suggest that miR-21 plays an important role in IPost -induced protective effects against myocardial I/R injury. [score:1]
The current study for the first time demonstrated that miR-21 plays an important role in IPost -mediated protection against I/R injury. [score:1]
The antagomir sequence complementary to mmu-miR-21 is 5′-gSaScagcccaucgacugcugSuSuSgS-Chol-3′. [score:1]
The protective effect of miR-21 on myocardial apoptosis was further revealed in mouse hearts after IPost treatment in vivo. [score:1]
Our data clearly demonstrate that miR-21 is involved in IPost -mediated cardiac protection against I/R injury and dysfunction through the PTEN/Akt signaling pathway in vivo. [score:1]
To determine the role of IPost -induced miR-21 in IPost -mediated cardiac protection, the mice were divided into the four groups as fellows (Figure 2A): I/R group; I/R+IPost group (I/R mice treated with IPost); Antagomir-21+IPost+I/R group (I/R mice treated with anagomir-21 and IPost); Scramble+IPost+I/R group (I/R mice treated with scramble and IPost). [score:1]
[1 to 20 of 73 sentences]
21
[+] score: 246
As shown in Figure 9C, there was excellent concordance in the data from the miRNA profiling and qPCR, the expression of miR-21, miR-26a, miR-24, miR-30b and miR-29a was down-regulated by EF24 treatment both in vitro and in vivo, while the expression of miR-345, miR-409, miR-10a and miR-206 was upregulated by EF24 treatment. [score:11]
Expression profiling of miRNAs showed that EF24 enhanced the expression of potential tumor suppressor miRNAs, and inhibited the expression of oncogenic miRNAs, including miR-21. [score:11]
EF24 Inhibits miR-21 Expression and Increases the Expression of miR-21 Target Genes. [score:9]
Not surprisingly, miR-21 gene expression was markedly reduced (∼70%), while the expression of PTEN and PDCD4 (miR-21-target genes) was enhanced in tumor tissue from EF24 -treated mice, which is similar to the effect of EF24 on miR-21 gene expression in DU145 cells in vitro (Figure 6C). [score:9]
In vivo EF24 suppressed the growth of DU145 prostate cancer xenografts and the formation of lung metastasis in mice injected with B16 melanoma cells, and reduced miR-21 expression and enhanced the expression of miR-21 target genes in tumor tissue. [score:9]
Among this group of downregulated miRNAs was miR-21, which validates this approach as we have already shown that miR-21 expression is inhibited by EF24 treatment. [score:8]
While knockdown of miR-21 expression in DU145 prostate cancer cells markedly enhanced sensitivity to apoptosis induced by several chemotherapeutic agents, enforced miR-21 expression in the low miR-21 -expressing PC3 prostate cancer cell line markedly reduced sensitivity to apoptosis. [score:8]
The effects of EF24 on miRNA expression and miR-21 target gene expression in DU145 and B16 cells in vitro. [score:7]
In addition, the effects of EF24 on the expression of several growth-related genes as well as miR-21 target gene expression by immunostaining of tumor tissue collected from EF24 treated mice injected with DU145 cells. [score:7]
In the present study we show that EF24 inhibits the NF-κB but not the JAK-STAT signaling pathway in prostate cancer and melanoma cells in vitro, induces apoptosis, and enhances the expression of miR-21 target genes, PTEN and PDCD4. [score:7]
0071130.g004 Figure 4The effects of EF24 on miRNA expression and miR-21 target gene expression in DU145 and B16 cells in vitro. [score:7]
Upon necropsy, while miR-21 expression was markedly diminished in lung tumor tissue from EF24 -treated mice, the expression of miR-21 target genes (PTEN and PDCD4) was enhanced (Fig. 8C). [score:7]
EF24 treatment inhibits miR-21 expression, but does not affect the expression of several other miRNAs, including miR-100, -126, -181a and -200a. [score:7]
As additional evidence that miR-21 is an important target of EF24, EF24 treatment of DU145 cells also results in an increased expression at the mRNA and protein level of known miR-21 target genes, PTEN and PDCD4 [5], [13], [23]– [26]. [score:7]
This point is particularly relevant since we observe a marked decrease in miR-21 expression in B16 lung tumors from EF24 treated mice as well as an enhanced expression of miR-21 target genes, including PTEN and PDCD4. [score:7]
We also found that the expression of the miR-21 target protein PTEN was enhanced in tumor tissue isolated from EF24 -treated mice, while not surprisingly miR-21 expression was reduced. [score:7]
We show that EF24 treatment not only blocks the induction of p65-containing NF-κB complexes by IFN but also inhibits IFN -induced miR-21 expression, which is consistent with our previous findings on the critical role of p65 in miR-21 expression [5]. [score:7]
Although miR-21 appears to be an important miRNA target of EF24, we also found that the expression of other miRNAs could be regulated by EF24 treatment. [score:6]
Based on the findings presented so far and having previously shown that miR-21 gene expression is STAT3 and NF-κB dependent [5], we examined the effect of EF24 on miR-21 gene expression. [score:5]
At 24 hr after EF24 treatment cells were lysed, and the expression of miR-21 target proteins was determined by immunoblotting. [score:5]
Therefore, we examined the effect of EF24 on the expression of these miR-21 targets by qPCR in DU145 and B16 cells and immunoblotting. [score:5]
0071130.g005 Figure 5The effects of EF24 miR-21 target protein expression in DU145 and B16 cells in vitro. [score:5]
Moreover, EF24 inhibits basal as well as IFN -induced miR-21 expression. [score:5]
The effects of EF24 miR-21 target protein expression in DU145 and B16 cells in vitro. [score:5]
In particular miR-21 is overexpressed in various human cancers and plays an important role in cancer development, progression and metastasis [4]. [score:4]
We previously established that IFN induced the binding of the p65 NF-κB subunit and STAT3 to the miR-21 promoter to regulate miR-21 expression [5]. [score:4]
Although EF24 treatment decreased miR-21 expression, we sought to determine whether other miRNAs might also be regulated by EF24. [score:4]
To investigate whether the effects of EF24 in an animal mo del are consistent with its anticancer activity, the expression of several cell cycle regulated genes as well as miR-21 and miR-21-target genes was quantified in RNA extracts of DU145-derived tumor tissue. [score:4]
As shown in Figure 7A, the expression of the miR-21 target gene PTEN was markedly increased in tumor tissue from EF24 -treated mice when compared to controls. [score:4]
In addition, we found that EF24 promotes the apoptosis of prostate cancer and melanoma cells, which in part reflects the EF24 induced down-regulation of the oncogenic miRNA miR-21. [score:4]
In contrast, only 5 miRNAs (miR-21, miR-26a, miR-24, miR-30b and miR-29a) were found to be downregulated both in vitro and in vivo by EF24 treatment. [score:4]
We previously showed that miR-21 expression regulates the sensitivity of prostate cancer cells to chemotherapeutic drugs [5]. [score:4]
Stable pools of DU145 and B16 cells transduced with antagomiR-21 lentivirus resulting in a >80% knockdown of miR-21 expression have been previously described [5], [13]. [score:4]
Taken together, these results show that miR-21 and miR-21-target genes are affected by EF24 treatment. [score:3]
The effect of EF24 treatment on IFN -induced (1000 IU/ml for 6 hr) miR-21 expression was also assessed. [score:3]
Nonetheless, taken together our results suggest that EF24 has potent anticancer activity in melanoma and prostate cancer, which may be mediated in part by targeting a miR-21 anti-apoptotic pathway. [score:3]
These findings are consistent with our previous studies showing that miR-21 target genes are highly cell type specific [5], [13]. [score:3]
As shown in Figure 4A and D EF24 treatment of DU145 and B16 cells, respectively, reduced miR-21 levels by >70%, while it had no effect on the expression levels of miR-100, -126, -181a and -200a (Fig. 4B and E). [score:3]
Since we previously found that DU145 and B16 cells have relatively high levels of miR-21 [5], our present results indicate that prolonged EF24 treatment results in reduced miR-21 expression, which sensitizes cancer cells to EF24 -induced apoptosis. [score:3]
Moreover, knockdown of miR-21 not only hastens the time course of apoptosis induced by EF24, but also results in the induction of apoptosis at lower EF24 concentrations. [score:2]
EF24 Promotes Apoptosis and Enhances the Effect of miR-21 Knockdown. [score:2]
Among the EF24-downpregulated miRNAs, which non-surprisingly included miR-21, miR-26a can transform cells and promotes glioma proliferation in vitro and in vivo [34]. [score:2]
miR-21 is considered an oncomir because it is expressed at higher levels in cancer cell lines and tumor tissue, and plays an important role in cancer cell survival, progression and metastasis [4]. [score:2]
To determine if miR-21 KD enhanced the sensitivity of DU145 cells to EF24 -induced apoptosis, stable pools of DU145 cells with miR-21 levels knocked down by ∼80% were exposed to varying EF24 concentrations. [score:2]
We previously showed that the miRNA, miR-21, plays an important role in cancer cell survival, and that knockdown (KD) of miR-21 sensitized prostate cancer cells to several chemotherapeutic agents [5]. [score:2]
Moreover, EF24 treatment nearly completely abrogated the IFN -induced increase in miR-21 (Fig. 4A and D). [score:1]
0071130.g001 Figure 1The effects of EF24 and miR-21 KD on apoptosis in vitro. [score:1]
Moreover, miR-21 KD not only enhanced basal apoptosis in DU145 cells but also sensitized cells to EF24 -induced apoptosis. [score:1]
Moreover, miR-21 KD also sensitized B16 cells to EF-24 induced apoptosis with increased apoptosis found at 0.5 µM EF24 in miR-21KD cells versus 1 µM in empty vector-transduced B16 cells (Fig. 1D). [score:1]
As shown in Figure 1A, miR-21 KD markedly sensitized DU145 to apoptosis with marked PARP cleavage detected at 1 µM of EF24 and PARP cleavage peaked at 2 µM of EF24. [score:1]
The effects of EF24 and miR-21 KD on apoptosis in vitro. [score:1]
Taken together these results show that EF24 induced apoptosis in DU145 cells and that miR-21 KD enhanced the sensitivity of DU145 to EF24 -induced apoptosis. [score:1]
PTEN, PDCD4 and BCL2 have been previously characterized as miR-21 target genes [23]– [26]. [score:1]
Figure S1 The effects of EF24 and miR-21 KD on apoptosis of DU145 cells in vitro. [score:1]
[1 to 20 of 54 sentences]
22
[+] score: 246
Our results of stellate cells being the primary cell type with leptin -induced mir21 upregulation and its paracrine regulation of sinusoidal injury in Kupffer cells and LSECs further strengthen the importance of the cell type in modulating NASH pathophysiology as shown in S1 and S2 Figs. Future studies regarding sinusoidal injury and its regulation by the larger epigenome in the liver can be targeted in the stellate cells. [score:8]
The upregulation of miR21 strongly correlated to depletion of Grhl3, decrease in NOS3 phosphorylation and increase in the protein levels of sinusoidal endothelial dysfunction markers, while leptin knockout, leptin receptor knockout or miR21 knockout mice did not show any of the described effects. [score:7]
Since miR21 targeted Grhl3 in our studies, we studied the levels of Grhl3 in ob/ob, and leptin supplemented group to establish the direct link between leptin and miR21 linked post-transcriptional modifications to its targets. [score:6]
miR21 upregulation and its corresponding targeting of Grhl3 is known. [score:6]
Upregulation of miR21 has been associated with inflammation, primarily by its effect on different target proteins [43]. [score:6]
It is of paramount importance that miR21 upregulation in NASH would have a significant impact on the target proteins, that would in turn affect positively the NASH progression. [score:6]
Based on the above literature reports, we hypothesized that adipokine leptin mediates endothelial dysfunction; inflammation and fibrosis through upregulation of miR21 and repression of target Grhl3. [score:6]
To elucidate the cellular basis of the leptin -mediated mir21 increase, rat primary liver sinusoidal endothelial cells, hepatic stellate cells and Kupffer cells were incubated with or without leptin for 24 h. showed that LSECs and Kupffer cells showed a down regulation of mir21 while hepatic stellate cells showed a six fold increase in the mir21 expression as shown in S1A Fig. GRHL3 protein levels showed a concomitant decrease in stellate cells while the protein levels were unchanged in other cell types as shown in S1A-B Fig. This might suggest an indirect role of downstream GRHL3 based signaling, albeit as a paracrine modulator in other cell types. [score:5]
0116780.g002 Figure 2A qRTPCR analysis of hepatic miRNA21 expression in toxin and diet mo del of NASH A. BDCM mo del: Y-axis represents fold of miR21 expression in DIO, DIO mice exposed with BDCM for 24h (DIO+BDCM (24h)), for 48h (DIO+BDCM (48h)), for 1week (DIO+BDCM (1w)) and for 4 weeks (DIO+BDCM (4w)). [score:5]
A qRTPCR analysis of hepatic miRNA21 expression in toxin and diet mo del of NASH A. BDCM mo del: Y-axis represents fold of miR21 expression in DIO, DIO mice exposed with BDCM for 24h (DIO+BDCM (24h)), for 48h (DIO+BDCM (48h)), for 1week (DIO+BDCM (1w)) and for 4 weeks (DIO+BDCM (4w)). [score:5]
miR21 knockout mice showed significant upregulation of NOS3 phosphorylation and higher NOS3-p/NOS3 ratio in both the toxin mo del and dietary mo del of NASH (Fig. 5). [score:5]
Increased miR21 expression, subsequent decreased expression of Grhl3 protein and NOS3 phosphorylation is mediated by leptin. [score:5]
miR21 expression and its target Grhl3 in NASH progression are dependent on the presence of leptin. [score:5]
A detailed analysis of target proteins by available literature identified among many other proteins Grhl3 to be a probable target of miR21. [score:5]
Also, we avoided in vitro knockdown of miR21 in a cellular mo del since we wanted to study a direct link of leptin induced miR21 in NASH disease pathology which would have been difficult to interpret in an otherwise in vitro cellular system. [score:5]
Though we have identified stellate cells as the primary cell type for mir21 upregulation in the liver, further studies in the whole animal using pharmacological approaches such as acetylcholine induced vasodilation in the liver sinusoids and primary cells in the liver are required to show leptin based mechanisms for induction of miR21. [score:4]
Having examined leptin’s role in Kupffer cell activation, NADPH oxidase activation and IL-1β release in experimental mo dels of NASH, we studied the role of increased leptin in miR21 upregulation. [score:4]
miR21 knockout mice in both mo dels of NASH were also studied for the expression of endothelial biomarkers VEGFR-2, ICAM-1 and E-selectin and their corresponding localization patterns by immunofluorescence microscopy. [score:4]
The results of higher hepatic leptin and its correlation with higher miR21 and repression of miR21-target protein, Grhl3, in experimental NASH led us to probe the direct role of leptin and its downstream signaling in our mo dels of NASH. [score:4]
miR21 has been shown to target Grhl3 in this study and many other proteins in inflammatory conditions to cause their repression as a post-transcriptional regulatory mechanism [43]. [score:4]
miR21 has been found to target grainyhead-like 3 (Grhl3), causing its repression and this can leading to dephosphorylation of endothelial nitric oxide synthase (NOS3), a crucial mediator of endothelial function [31, 32]. [score:3]
B. Western blot analysis of cell lysates of hepatic stellate, LSECs and Kupffer cells incubated with leptin and LPS for mir21 target GrHL3. [score:3]
Having established the role of leptin in inducing miR21 and its concomitant repression of miR21 target proteins, it was important to study the role of leptin induced miR21 in causing sinusoidal endothelial dysfunction in our mo dels of NASH. [score:3]
Sinusoidal endothelial dysfunction markers VEGFR-2, E-selectin and ICAM-1 as shown by Pasarin R et al, were significantly decreased in miR21 knockout mice suggesting a direct role of miR21 in these events that are crucial for NASH progression. [score:3]
B. CCl [4] mo del: Y-axis represents fold of miR21 expression in DIO and DIO mice exposed with CCl [4] for 1w. [score:3]
Our results showed that hyperleptinemia was associated with significant increases in hepatic miR21 expression in an earlier time point, (one week into the study) in the toxin mo del of NASH and had an elevated level of the microRNA during the entire course of the study in MCD mo del of NASH (Fig. 2). [score:3]
Studies reported earlier show that PTEN, Grhl3, PPARα, cyclinD1 and SMAD7 are few of the several proteins that are targets of miR21 [28, 32, 43, 48, 49]. [score:3]
To show the role of NASH progression in inducing miR21 and its principle target protein Grhl3, qRTPCR analysis was carried out at different time points and in three experimental mo dels of NASH, namely, the two toxin mo dels of NASH in a background of obesity and insulin resistance (DIO+BDCM and DIO+CCl [4]), and the dietary mo del of NASH (MCD diet). [score:3]
D. Western blot analysis of Grhl3 (target of miR21) protein levels in liver homogenate from DIO, DIO+BDCM (24h), DIO+BDCM (48h), DIO+BDCM (1w), DIO+BDCM (4w) and DIO+CCl [4] (1w) mice groups. [score:3]
miR21 induction has been reported in inflammatory diseases [43]. [score:3]
miR21 expression levels in liver tissues. [score:3]
The study can help advance the field of NASH pathogenesis by opening new avenues for research in the use of miR21 inhibitors as potential therapeutic agents. [score:3]
Isolated cells were incubated for 24h and cell lysates were analysed for mir21 expression using Qrtpcr. [score:3]
C. MCD mo del: Y-axis represents fold of miR21 expression in MCS (control for MCD diet), mice fed with MCD diet for 1 week (MCD (1w)), for 4 weeks (MCD (4w)) and for 8 weeks (MCD (8w)). [score:3]
Since the whole objective of the study was to exhibit the mechanism of sinusoidal injury, it was justifiable to use different mo dels of NASH where mir21 expression would be correlated to sinusoidal injury. [score:3]
Thus a decreased mRNA and protein levels of VEGFR-2, ICAM-1 and E-selectin in the sinusoids of Leptin KO mice and mice that have a defective leptin downstream signaling, as shown by immunofluorescence microscopy reflect in part the role of hepatic leptin and probably miR21 in sinusoidal inflammation and dysfunction in our mo dels of NASH because of leptin -induced miR21 expression (Fig. 4). [score:3]
NASH progression results in time -dependent increase in miR21 and concomitant repression of its target protein Grhl3. [score:3]
The decreased protein levels of Grhl3 correlated well with the decreased NOS3 phosphorylation in those time points (Fig. 2E and F), signifying the importance of miR21 -induced Grhl3 suppression being crucial for NO bioavailability in NASH. [score:3]
G. mir21 expression in liver primary cells incubated with LPS and leptin. [score:3]
After 24 h incubation, lyzed cells were analyzed for miR21 expression using quantitative real time PCR. [score:3]
NASH progression mediated by miR21 expression and concomitant repression of Grhl3 protein. [score:3]
Leptin knockout mice did not show increased miR21 levels at the same time points as mice that had NASH symptoms (DIO+BDCM group) (Fig. 3A). [score:2]
These results suggested that leptin was critical for repression of this protein and a miR21 dependent mechanism might be responsible for a post-transcriptional regulation of Grhl3. [score:2]
Western blot analysis of miR21 target protein Grhl3 showed a sharp decrease in both DIO+BDCM group and DIO+CCl [4] group as compared to DIO only group (Fig. 2D). [score:2]
To prove the involvement of leptin induced miR21 in vivo, we used miR21 knockout mice that were co-exposed with a high fat diet and hepatotoxin BDCM. [score:2]
The above described results related to miR21 have relevance to the fact that sinusoidal endothelial dysfunction precedes inflammation and might play a significant role in the events of inflammation and fibrosis that follow in NASH developmental process. [score:2]
The results showed that leptin and leptin signaling through its receptor up regulates miR21 in NASH livers. [score:2]
miR21 and miR155 were found to be significantly up regulated in mice fed with a choline deficient and amino acid deficient diet (CDAA) which developed NASH and hepatocellular carcinoma [30]. [score:2]
Though there are studies which show the mechanism of leptin based on NOS3 uncoupling, we hypothesized that the proinflammatory role of hepatic leptin might be crucial for endothelial dysfunction by up regulating miR21, a microRNA that has a pronounced role in inflammation. [score:2]
At this point, the results obtained reflected only a direct correlation of leptin, levels of miR21 and sinusoidal endothelial dysfunction. [score:2]
This might be due to an existence of a yet to be discovered Grhl3 protein mediated downstream signaling cascade which might also be regulated by miR21. [score:2]
Taken together, our study identifies miR21 as a regulator of sinusoidal endothelial injury, an early event in NASH pathophysiology in rodent mo dels of NASH. [score:2]
miR21 knockout mice do not show decreased Grhl3 and NOS3 phosphorylation and sinusoidal endothelial dysfunction in toxin-exposed and MCD diet-fed NASH mo dels. [score:2]
However, the upstream modulators of miR21 regulation and its biological effect on specific etiologies in NASH have not been explored to its potential. [score:2]
The data were also compared with DIO group as shown in panels a, b and c. miR21 KO mice in MCD mo del of NASH also showed a similar decrease in sinusoidal endothelial dysfunction and injury markers expression at 4w, that might be crucial for NASH progression (Fig. 6B). [score:2]
BKS(D)-Lepr [db]/J) (Leptin receptor knockout, Lepr KO) and mice that contained the disrupted microRNA21 gene (B6;129S6-Mir21a [tm1Yoli]/J) (miR21 KO) were fed with a high-fat diet and treated identically to DIO mice. [score:2]
ob/ob mice (Lep KO), a spontaneous knockout of leptin, and recombinant leptin supplementation in ob/ob mice (Lep KO +Leptin) were used to find the role of leptin in inducing miR21. [score:2]
High-fat diet-fed gene specific knockout (Lep KO, Lepr KO and miR21 KO) mice at 16 weeks were administered BDCM (1.0 mmole/kg, diluted in corn oil) through the intraperitoneal route. [score:2]
A detailed miRNA array analysis done by a commercial vendor identified several miRNAs including miR21 to be up regulated in our mo dels of NASH. [score:2]
Though our study shows conclusively that leptin -induced miR21 is involved in the development of sinusoidal injury in NASH, it falls short of explaining the exact mechanism of leptin in inducing miR21 in the liver. [score:2]
showed that miR21 expression was significantly decreased in ob/ob mice (Lep KO) exposed to the toxins for induction of NASH as compared to wild type DIO mice (Fig. 3A) (P<0.05). [score:2]
miR21 has been shown to be up regulated in a very few studies in NASH [30]. [score:2]
Similarly, mice with null mutation of miR21, fed with a MCD diet were also included. [score:2]
The study also links higher hepatic leptin in inducing miR21 linked sinusoidal endothelial injury and inflammation, molecular events that are crucial for NASH development. [score:2]
A. miR21 expression as measured by quantitative real-time PCR in DIO mice exposed with BDCM (DIO+BDCM (1w)), ob/ob gene deficient mice exposed with BDCM (Lep KO (1w)) and ob/ob gene deficient mice supplemented with leptin exposed with BDCM (Lep KO+Leptin (1w)). [score:1]
These may require identification of leptin or leptin -induced molecular mediators and their probable binding sites in the miR21 promoter sites. [score:1]
Leptin -induced miR21 caused sinusoidal endothelial dysfunction primarily by repressing Grhl3, a protein that has a role in phosphorylating NOS3 and increasing NO bioavailability [31]. [score:1]
To study the mechanisms underlying the leptin-miR21 axis we used toxin -induced experimental NASH mo dels (Bromodichloromethane and Carbon tetrachloride) which included oxidative stress as a second hit in an underlying condition of obesity and insulin resistance. [score:1]
Paraffin-embedded liver tissue from DIO, DIO+BDCM (1w), Lep KO (1w), Lepr KO (1w), MCS (4w), MCD (4w), miR21 KO+BDCM (1w) and miR21 KO+MCD (4w) groups was cut into 5 μm thick sections. [score:1]
The studies with miR21 KO mice were further extended to MCD mo del of NASH. [score:1]
Further, we also show that miR21 KO mice are protected from sinusoidal endothelial dysfunction primarily by increased nitric oxide bioavailability through increased NOS3 phosphorylation. [score:1]
It was necessary that we definitively link the Leptin-miR21 axis in causing the dysfunctional endothelial in NASH mo dels. [score:1]
Further, there was an observable and marked decrease in sinusoidal staining for these biomarkers, suggesting that miR21 was at least in part involved in causing sinusoidal endothelial dysfunction in NASH. [score:1]
miR21 induction by NF-κB binding to its promoter has been shown in in vitro cell culture conditions [44]. [score:1]
A and B. Immunofluorescence images for localization of sinusoidal endothelial dysfunction biomarkers (VEGFR-2, ICAM-1 and E-selectin) from liver sections of toxin mo del groups (fig. A) DIO+ BDCM (1w) and miR21 KO+BDCM (1w) and dietary mo del (fig. B) MCD (4w) and miR21 KO+MCD (4w). [score:1]
Sheedy et al. described miR21 as a central player in the inflammatory response [44]. [score:1]
showed that protein expression of VEGFR-2, ICAM-1 and E-selectin, measured by the immunoreactivity of these markers in liver slices were significantly decreased in miR21 knockout mice as compared to DIO mice co-exposed to high fat and BDCM for NASH induction at 1w post initiation of toxin administration (Fig 6A). [score:1]
To prove conclusively the role of leptin -induced miR21 as a key player in inducing sinusoidal endothelial injury and inflammation, we chose to use mice that were deficient in miR21 (miR21 KO) in the study. [score:1]
The above results suggested that leptin induced miR21 was critical for NOS3 phosphorylation that had a significant role in NOS3 bioactivity. [score:1]
In parallel, leptin administration in ob/ob mice restored the miR21 levels found in DIO mice that had NASH, suggesting the requirement of leptin in induction of miR21. [score:1]
The fact that miR21 KO mice show decreased sinusoidal endothelial dysfunction markers can be probed further for greater understanding of inflammation and fibrosis in NASH. [score:1]
Associations between circulating microRNAs (miR21, miR34a, miR122 and miR451) and non-alcoholic fatty liver has been documented [29]. [score:1]
Since the establishment of miR21 as a key player in sinusoidal endothelium dysfunction was crucial for NASH progression, we chose to include the dietary mo del of NASH that also showed significant fibrosis without obesity. [score:1]
To prove the role of leptin in inducing miR21, we used two different mouse mo dels. [score:1]
Liver homogenates from DIO, DIO+BDCM and miR21 KO (treated with BDCM) at 1 weeks post BDCM administration groups were subjected to SDS page and western blot analysis. [score:1]
also showed that miR21 knockout mice had significantly increased NOS3-p/NOS3 (eNOS-p/eNOS) ratio as compared to the DIO mice that were exposed to the toxin BDCM (DIO+BDCM) (Fig. 5B) (P<0.05). [score:1]
0116780.g006 Figure 6 A and B. Immunofluorescence images for localization of sinusoidal endothelial dysfunction biomarkers (VEGFR-2, ICAM-1 and E-selectin) from liver sections of toxin mo del groups (fig. A) DIO+ BDCM (1w) and miR21 KO+BDCM (1w) and dietary mo del (fig. B) MCD (4w) and miR21 KO+MCD (4w). [score:1]
showed a time -dependent increase in miR21 levels that correlates with NASH histopathology. [score:1]
miR21 play a key role in leptin signaling of sinusoidal endothelial dysfunction. [score:1]
showed that there was a time -dependent increase in miR21 levels (Fig. 2A, 2B and 2C) that correlated well with NASH histopathology and picro-sirius red staining (Fig. 1C and 1D). [score:1]
Our studies for the first time showed the role of leptin -induced miR21 in significantly contributing to the early sinusoidal endothelial injury that is recently thought to contribute to the more progressive phases of NASH. [score:1]
also showed that miR21 levels increased significantly at 24h post BDCM exposure followed by a slight decrease at 48h (Fig. 2A). [score:1]
The mice groups for toxin mo del (fig. A) are DIO+BDCM (1w), DIO+BDCM (4w) and 3 individual miR21 KO mice (M1, M2 and M3) and the mice groups for dietary mo del (fig. C) are MCS (4w), miR21 KO fed with MCS diet (miR21 KO+MCS (4w)), MCD (4w) and miR21 KO mice fed with MCD diet (miR21 KO+MCD (4w)). [score:1]
0116780.g003 Figure 3 A. miR21 expression as measured by quantitative real-time PCR in DIO mice exposed with BDCM (DIO+BDCM (1w)), ob/ob gene deficient mice exposed with BDCM (Lep KO (1w)) and ob/ob gene deficient mice supplemented with leptin exposed with BDCM (Lep KO+Leptin (1w)). [score:1]
Leptin supplementation into mice that did not have leptin showed a significantly increased miR21 levels, and decreased NOS3 phosphorylation (NOS3-p/NOS3 ratio of 2.1) (Fig. 3D and 3E) as compared to leptin knockout mice, thus firmly establishing that leptin induced miR21 -mediated NOS3 phosphorylation, at least in part, plays a role in the sinusoidal endothelial dysfunction that might result from decreased NO bioavailability due to decreased NOS3 phosphorylation. [score:1]
miR21 mediated sinusoidal endothelial dysfunction is the early event in NASH progression. [score:1]
[1 to 20 of 96 sentences]
23
[+] score: 240
Other miRNAs from this paper: hsa-mir-21, mmu-mir-21b, mmu-mir-21c
Moreover, miR-21 shut down in BEAS-2B cells also inhibited the chronic Cr(VI) -induced suppression of its target tumor suppressor, PDCD4 (Figure 5B). [score:9]
In addition, there was an upregulation in the PDCD4 3′-UTR reporter activity when miR-21 gene expression was inhibited (Figure 3D). [score:8]
In addition, catalase overexpression in BEAS-2B cells was also significantly inhibited Cr(VI) -induced miR-21 elevation, PDCD4 suppression and malignant cell transformation. [score:7]
miR-21 binds to the 3′-UTR of tumor suppressor PDCD4 and suppresses its translation [4]. [score:7]
In summary, our findings show that quercetin inhibited Cr(VI) -induced miR-21 elevation and associated inhibition of PDCD4 expression in BEAS-2B cells. [score:7]
PDCD4 is a direct target of miR-21 (binds to 3′ UTR region of mRNA), where it post-transcriptionally down regulates its expression [23– 25]. [score:7]
Similarly, xenograft tumors generated with Cr(VI)-exposed BEAS-2B cells stably knockdown with miR-21 and overexpressed with PDCD4 were also showed relatively less miR-21 level (Figure 6C) and more PDCD4 expression (Figure 6D) in qRT-PCR and immunohistochemical analysis, respectively. [score:6]
Besides, stable knockdown down of miR-21 and overexpression of PDCD4 in BEAS-2B cells significantly inhibited the chronic Cr(VI) -induced malignant transformation. [score:6]
Stable overexpression of catalase remarkably inhibited the chronic Cr(VI) -induced miR-21 elevation (Figure 5G) and PDCD4 reduction (Figure 5H) in BEAS-2B cells, indicating that ROS plays a key role in chronic Cr(VI) -induced miR-21-PDCD4 signaling pathways. [score:5]
We found that quercetin inhibited Cr(VI) -induced miR-21 elevation and PDCD4 reduction thereby inhibited malignant transformation of BEAS-2B cells. [score:5]
These observations clearly demonstrated that quercetin remarkably inhibited ROS and thereby suppressed the chronic Cr(VI) -induced miR-21-PDCD4 signaling and malignant cell transformation. [score:5]
To study the preventive role of antioxidant on chronic Cr(VI) -induced miR-21 elevation and PDCD4 suppression, we overexpressed catalase in BEAS-2B cells (Figure 5F) and treated with Cr(VI) (0.5 μM) for six months. [score:5]
Catalase inhibits chronic Cr(VI) -induced miR-21 elevation and PDCD4 suppression. [score:5]
It has been shown that PDCD4, a novel tumor suppressor is an important functional target of the oncogenic microRNA miR-21 [37]. [score:5]
The co-treatment of quercetin have not shown any significant changes in miR-21 level and PDCD4 expression after Cr(VI) treatment in catalase overexpressed BEAS-2B cells. [score:5]
Hydrogen peroxide (H [2]O [2]) has been implicated in the elevation of miR-21 level and suppression of PDCD4 expression in vascular smooth muscle cells [68]. [score:5]
These results strongly demonstrate that quercetin inhibits Cr(VI) -induced malignant transformation by targeting miR-21-PDCD4 signaling pathway. [score:5]
The tumor suppressor gene PDCD4 has been validated as a miR-21 target in prostate cancer [62], glioblastoma [63], retinoblastoma [64], lung cancer [8], thyroid carcinoma [65], colorectal cancer [66], and renal cell carcinoma [67]. [score:5]
BEAS-2B cells or BEAS-2B cells with stable overexpression of catalase or PDCD4 or BEAS-2B cells with stable knockdown of miR-21 were treated with 0.5 μM Cr(VI). [score:4]
Stable knockdown of miR-21 and overexpression of PDCD4 or catalase in BEAS-2B cells significantly reduces the Cr(VI) -induced cell transformation. [score:4]
Furthermore, stable knockdown of miR-21 and overexpression of PDCD4 reduced the tumorogenicity of chronic Cr(VI) exposed BEAS-2B cells in nude mice. [score:4]
Importantly, miR-21 knock down significantly suppressed the chronic Cr(VI) -induced malignant cell transformation (Figure 5C). [score:4]
B. Stable knockdown of miR-21 and overexpression of PDCD4 reduces the tumorogenicity of chronic Cr(VI) exposed BEAS-2B cells in nude mice. [score:4]
Furthermore, we also confirmed that stable knockdown of miR-21 and overexpression of PDCD4 reduces the tumorigenicity of chronic Cr(VI) exposed BEAS-2B cells in nude mice. [score:4]
Figure 5Stable knockdown of miR-21 in BEAS-2B cells suppresses the Cr(VI) -induced cell transformation. [score:4]
As shown in Figure 5A, miR-21 stable knock down completely inhibited the miR-21 elevation even after chronic Cr(VI) treatment. [score:4]
The co-treatment of quercetin with Cr(VI) in miR-21 knockdown BEAS-2B cells have not exhibited any further significant changes in miR-21 level, PDCD4 expression, and colony number compared to miR-21 knockdown cells treated with Cr(VI) alone. [score:4]
In addition we also demonstrated that stable knockdown of miR-21 and overexpression of PDCD4 reduces the tumorogenicity of chronic Cr(VI) exposed BEAS-2B cells in nude mice (Figure 6B). [score:4]
Stable knockdown of miR-21 in BEAS-2B cells suppresses the Cr(VI) -induced cell transformation. [score:4]
Among various miRNAs, miR-21 described as a key oncomiR [6], was found to be overexpressed in different types of human cancers and implicated in various aspects of carcinogenesis, apoptosis resistance, cell proliferation, tumor progression, invasion and chemoresistance [7– 14]. [score:3]
In short, quercetin protects BEAS-2B cells from Cr(VI) -induced malignant cell transformation by targeting miR-21-PDCD4 signaling pathway (Figure 6I). [score:3]
As shown in Figure 3A and 3B, acute Cr(VI) treatment markedly increased miR-21 level associated with decrease in PDCD4 expression by RT-PCR and Western blot analysis respectively in BEAS-2B cells. [score:3]
Quercetin inhibits Cr(VI) -induced miR-21 elevation and PDCD4 reduction. [score:3]
Human embryonic kidney 293T cells (ATCC, Manassas, VA) were transfected with lentiviral packaging vectors (ABM, Richmond, BC, CA) and lentiviral vectors expressing miR-Off-has-miR-21-puro-GFP or miR-Off- puro-GFP by Lipofectamine™2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol [36]. [score:3]
Consistent with tumor volume data, relatively less miR-21 level and more PDCD4 expression were observed in xenograft tumors generated with BEAS-2B cells chronically co -treated with quercetin and Cr(VI). [score:3]
Moreover, a decreased miR-21 level associated with increased PDCD4 expression was observed in tumors of quercetin treated animals. [score:3]
In our study we found that quercetin markedly inhibited both acute and chronic Cr(VI) -induced miR-21 elevation and PDCD4 reduction in BEAS-2B cells. [score:3]
It was also reported that miR-21 modulates ROS levels through targeting SOD3 and TNFα [69]. [score:3]
These results suggest that quercetin protects BEAS-2B cells from Cr(VI) -induced malignant transformation by targeting miR-21 and PDCD4 signaling pathways. [score:3]
Quercetin inhibits malignant cell transformation, miR-21 elevation and PDCD4 reduction induced by chronic Cr(VI) exposure. [score:3]
Quercetin inhibits chronic Cr(VI) -induced malignant cell transformation, miR-21 elevation and PDCD4 reduction. [score:3]
In particular, miR-21 was found overexpressed in lung cancers [1, 58, 59], and predicts poor patient survival [60, 61]. [score:3]
The pLenti-III-miR-Off-has-miR-21-puro-GFP expression vector and the negative control vector pLenti-III-miR-Off- puro-GFP were purchased from Applied Biological Materials, Inc. [score:3]
BEAS-2B cells were transfected with renilla reporter construct (pGL3-PDCD4_3′-UTR), miR-21 inhibitor (100 nM), negative control (100 nM), and pGL3-promoters and treated with 5 μM Cr(VI) for 6 h in the presence of quercetin (10 μM). [score:3]
Treatment with quercetin (5 and 10 μM) significantly (p<0.05) inhibited Cr(VI) -induced miR-21 elevation and PDCD4 reduction (Figure 3A and 3B). [score:3]
Consistent with our in vitro findings above, we found a significantly increased miR-21 level (Figure 6C) associated with decreased PDCD4 expression (Figure 6D) in xenograft tumors generated with chronic Cr(VI) exposed BEAS-2B cells. [score:3]
Notably, decreased PDCD4 expression has been reported to be inversely correlated with miR-21 level in different tumors [22– 28]. [score:3]
Accumulating evidence suggests that NADPH oxidase-derived ROS is essential for the expression and function of miR-21 [15, 16]. [score:3]
Interestingly, co-treatment of quercetin markedly suppressed the Cr(VI) -induced miR-21 elevation and PDCD4 reduction in a time and dose dependent manner. [score:3]
These results demonstrate that quercetin could inhibit acute Cr(VI) -induced miR-21 elevation and associated PDCD4 reduction. [score:3]
The treatment of quercetin significantly inhibited the Cr(VI) -induced ROS generation, where ROS is critical for miR-21 elevation and PDCD4 reduction in Cr(VI) -induced malignant transformation. [score:3]
We found that there was a significant (p<0.05) increase in the miR-21 level (Figure 4E) associated with a drastic decrease in the PDCD4 expression (Figure 4F) by chronic Cr(VI) exposure. [score:3]
Expression of miR-21-microRNA was determined by the TaqMan miRNA-assay (Applied Biosystems, Foster City, CA, USA), and normalized using the 2^-ΔΔCT -method relative to U6-snRNA. [score:2]
Therefore, miR-21 and PDCD4 were considered as potential targets for novel cancer prevention or anti-cancer therapies. [score:2]
For generating stable miR-21 knockdown cell lines, two days after transfection, supernatants containing viral particles were harvested and used to infect BEAS-2B cells at approximately 70% confluence in DMEM supplemented with 8 μg/ml of polybrene using lentifectin reagent (ABM technologies) following the manufacture's protocol. [score:2]
Stable knockdown of miR-21 in BEAS-2B cells significantly reduces the Cr(VI) -induced cell transformation. [score:2]
To confirm the oncogenic role of miR-21 during Cr(VI) -induced malignant cell transformation, we stably knock down the miR-21 in BEAS-2B cells and treated with Cr(VI) (0.5 μM) for six months. [score:2]
A-C. BEAS-2B cells were stably knockdown with miR-21 shRNA or their corresponding vehicle vector and treated with Cr(VI) (0 or 0.5 μM) with or without quercetin (2 μM) for 6 months. [score:2]
The oncogenic potential of miR-21 has been extensively studied in a variety of cancers [11, 54– 57]. [score:1]
In addition, Cr(VI) -induced binding of miR-21 to the 3′-UTR of PDCD4 was decreased by the treatment of quercetin. [score:1]
We have co -treated quercetin (1 and 2 μM) with Cr(VI) to BEAS-2B cells and measured the miR-21 level and PDCD4 expression at two, four and six months. [score:1]
A. The relative miR-21 level was determined by Taqman real-time PCR. [score:1]
Quercetin ameliorates Cr(VI) -induced miR-21 elevation and PDCD4 reduction. [score:1]
C. The relative miR-21 level was determined by Taqman real-time PCR. [score:1]
E. The relative miR-21 level was determined by Taqman real-time PCR. [score:1]
These results demonstrated that elevation of miR-21 is important for Cr(VI) -induced malignant cell transformation. [score:1]
[1 to 20 of 66 sentences]
24
[+] score: 239
The miR-21 inhibitor also prevented expression of vimentin, α-SMA and ZEB1/2 but did not modify E-cadherin expression significantly, though we did observe the tendency of miR-21 to prevent the decrease in E-cadherin expression (Figure  6). [score:9]
The cells were analyzed on culture day 6. We transfected synthesized miR-200c (Qiagen) and/or a miR-21 inhibitor composed of single-stranded, modified RNAs that specifically inhibit miR-21 function (miScript miRNA Inhibitor; Qiagen) into isolated mouse alveolar type II cells using HiPerFect Transfection Reagent (Qiagen). [score:7]
It has been reported that microRNA-21 is up-regulated in myofibroblasts during fibrosis and promotes transforming growth factor-beta signaling by inhibiting Smad7. [score:6]
The culture conditions that induce EMT by TGF-β up-regulated the expression of miR-21 in cultured alveolar epithelial cells. [score:6]
Transfection of both miR-200c and the miR-21 inhibitor had no significant added effect on the down-regulation of mesenchymal cell markers (Figure  6). [score:6]
miR-21 targets an inhibitory smad, SMAD7 and administration of miR-21 antisense probes attenuated the severity of bleomycin -induced fibrosis by blocking the positive feedback loop of TGF-β signaling [14]. [score:5]
Exogenous administration of a microRNA-21 inhibitor prevented the increased expression of vimentin and alpha-smooth muscle actin in cultured primary mouse alveolar type II cells under culture conditions that induce epithelial-mesenchymal transition. [score:5]
These data showed that each isolated cell type expressed a specific set of gene markers and that miR-21 was more highly expressed in lung epithelial cells than in mesenchymal cells, in agreement with our in situ hybridization data. [score:5]
Neither synthesized miR-200c nor the miR-21 inhibitor prevented the decrease in SFTPC expression. [score:5]
In addition, miR-21 expression was increased in cells surrounding fibrotic foci, rather than in the fibrotic foci themselves, during lung fibrosis, which is in contrast to previously published data showing by in situ hybridization and immunostaining that miR-21 is mainly expressed in myofibroblasts [14, 25]. [score:5]
miR-21 is induced by TGF-β1 and targets the inhibitory Smad, Smad7 [14]. [score:5]
MicroRNA-21 (miR-21) was first identified as an anti-apoptotic factor in glioblastomas [12] and has been described as an oncogenic microRNA targeting many tumor suppressor genes, including PTEN[13]. [score:5]
Although the in vivo inhibition of miR-21 prevents bleomycin -induced lung fibrosis in mice [14], it remains debatable whether the inhibition of EMT improves or worsens the pathological condition of lung fibrosis. [score:5]
A miR-21 inhibitor composed of single-stranded, modified RNAs that specifically inhibit miR-21 function was transfected into the cultured alveolar type II cells. [score:5]
Therefore, we believe that we have carefully analyzed the expression of miR-21 in each lung cell type, including epithelial cells, and that our results reveal that miR-21 is expressed most prominently in lung epithelial cells. [score:5]
The transfections of the microRNA and/or the miR-21 inhibitor were repeated on day 3. The cells were harvested on day 6. Unless otherwise noted, all data presented are expressed as the means ± standard error of the means (SEM). [score:5]
In situ hybridization revealed that miR-21 was upregulated in the fibrotic lungs of both mouse and human, as previously reported [14, 25]. [score:4]
Our study first demonstrated that miR-21 is up-regulated in isolated lung epithelial cells during bleomycin -induced lung injury as well as in cultured lung epithelial cells under EMT-inducing conditions. [score:4]
The specific primer sets for quantification were purchased from Qiagen as follows: MS00001827 for miR-200c; MS00011487 for miR-21; MS00033740 for RNU6B snRNA (a constitutively expressed housekeeping control); QT00121163 for E-cadherin; QT00109424 for Surfactant protein C (SP-C); QT00110467 for VE-cadherin; QT00159670 for Vimentin; QT00140119 for alpha-smooth muscle actin (α-SMA); QT00105385 for ZEB1; QT00148995 for ZEB2 (E-cadherin repressors); QT01658692 for glyceraldehyde-3-phosphate dehydrogenase (GAPDH, a constitutively expressed gene). [score:4]
miR-21 is significantly upregulated in human cancer of various organs [13]. [score:4]
We observed that miR-21 was expressed more in epithelial cells when compared with mesenchymal cells and endothelial cells in mouse lungs and increased miR-21 expression was observed in lung epithelial cells in the lungs of mice with bleomycin -induced fibrosis as well as the lungs of patients with IPF. [score:4]
Our in vivo and in vitro experiments showed that miR-21 was upregulated in mouse lung epithelial cells during EMT. [score:4]
The expression of microRNA-21 was analyzed using both quantitative PCR and in situ hybridization. [score:3]
miR-21 targets the genes related to cell cycle control, apoptosis and invasion; thus, this microRNA behaves as an oncogenic factor [13]. [score:3]
The inhibition of miR-21 attenuates TGF-β -induced epithelial-mesenchymal transition in mouse alveolar type II cells. [score:3]
Inhibiting the function of miR-21 resulted in the prevention of EMT induced by TGF-β. [score:3]
Inhibiting miR-21 prevented the EMT induced in cultured primary mouse alveolar type II cells, suggesting that miR-21 promotes EMT of lung epithelial cells. [score:3]
Inhibition of miR-21 prevents the increase of mesenchymal markers and ZEB factors in cultured lung alveolar epithelial cells under the EMT-inducing conditions promoted by TGF-β. [score:3]
We then examined the expression changes of miR-21 in cultured alveolar type II cells. [score:3]
MicroRNA-21 was also upregulated in the cultured alveolar epithelial cells under the conditions that enhance epithelial-mesenchymal transition. [score:3]
MicroRNA-21 was significantly upregulated in isolated lung epithelial cells during bleomycin -induced lung fibrosis and human idiopathic pulmonary fibrosis. [score:3]
Our data showed that miR-21 expression is increased in lung epithelial cells during mouse experimental lung fibrosis. [score:3]
miR-21-i: cells transfected with miR-21 inhibitor. [score:3]
Note that the cells cultured under EMT-inducing conditions adopted their spindle-like shape with irregular processes, whereas cells transfected with synthesized miR-200c and/or miR-21 inhibitor adopted a cobblestone-like appearance and had granules (lamellar bodies). [score:3]
Next, we examined the changes in expression levels of miR-21 in isolated epithelial, endothelial and mesenchymal cells from lungs treated with saline or bleomycin. [score:3]
Figure 3 Histological analyses for miR-21 expression in mouse and human lung tissues using in situ hybridization. [score:3]
However, expression changes in microRNA-21 and the role of microRNA-21 in epithelial-mesenchymal transition during lung fibrosis have not yet been defined. [score:3]
Because most cancer cells are derived from epithelial cells in various tissues including lung, we hypothesized that miR-21 was also expressed and had a role in EMT of lung epithelial cells by promoting TGF-β signaling during lung fibrosis. [score:3]
In contrast to miR-21, the EMT inducing culture conditions decreased the expression of miR-200c (Figure  5D). [score:3]
Phase contrast images of cultured mouse alveolar type II cells showed that cells cultured under EMT-inducing conditions adopted a spindle-like shape with irregular processes, whereas cells transfected with miR-21 inhibitor as well as synthesized miR-200c adopted a cobblestone-like appearance and had lamellar body-like granules (Figure  7). [score:3]
200c & 21-i: cells co -transfected with both synthesized miR-200c and miR-21 inhibitor. [score:3]
To clarify the contribution of miR-21 to EMT of lung alveolar epithelial cells, we examined whether the inhibition of miR-21attenuated EMT induced by TGF-β in primary mouse alveolar type II cells. [score:3]
Figure 5 The EMT-inducing culture conditions increase miR-21 expression in mouse lung alveolar epithelial cells. [score:3]
In addition, to elucidate the role of miR-21 in EMT, we examined whether inhibition of miR-21 attenuated EMT induced by TGF-β in primary mouse alveolar type II cells. [score:3]
Because TGF-β signaling can induce and maintain EMT, we postulated that miR-21 could contribute to EMT in lung epithelial cells during lung fibrosis, though a previous report showed that increased miR-21 expression was primarily localized to myofibroblasts [14]. [score:3]
These data showed that inhibition of miR-21 attenuated EMT induced by TGF-β in cultured primary mouse alveolar type II cells, suggesting the contribution of miR-21 to EMT in lung epithelial cells Figure 6 miR-21 attenuates TGF-β -induced epithelial-mesenchymal transition in mouse alveolar type II cells. [score:3]
In contrast to miR-21, miR-200c decreased significantly in epithelial cells, implying that miR-200c also functions as an EMT suppressor in lung epithelial cells (Figure  2D). [score:3]
The control culture conditions did not influence the expression of miR-21. [score:3]
However, we observed that miR-21 was expressed in alveolar cells morphologically resembling alveolar type II cells in the normal lung. [score:3]
These data showed that inhibition of miR-21 attenuated EMT induced by TGF-β in cultured primary mouse alveolar type II cells, suggesting the contribution of miR-21 to EMT in lung epithelial cells Figure 6 miR-21 attenuates TGF-β -induced epithelial-mesenchymal transition in mouse alveolar type II cells. [score:3]
miR-21 expression was significantly higher in alveolar type II cells isolated from the lungs of IPF patients than in those present in non-fibrotic lungs (Figure  4B). [score:3]
Therefore, we further examined the expression levels of miR-21 in the lungs of patients with IPF compared to that in non-fibrotic lungs. [score:2]
The culture conditions that induced EMT by TGF-β significantly increased miR-21 expression in alveolar epithelial type II cells when compared with the freshly isolated cells and the cells cultured under the control conditions (Figure  5D). [score:2]
In the saline treated mice, miR-21 was expressed in all lung cell populations, but the level of miR-21 in lung epithelial cells was significantly higher compared with that in endothelial or mesenchymal cells. [score:2]
The hybridization mixture contained 5 nM double-DIG LNA™ microRNA probe for miR-21 or scramble-miR as the negative control (Exiqon) and was applied and hybridized for 1 h at 53°C. [score:1]
To clarify whether culture condition that induce EMT also increased miR-21 in alveolar epithelial type II cells cultured in vitro, we cultured mouse alveolar epithelial type II cells and induced EMT using endogenous and exogenous TGF-β as previously reported [23, 24]. [score:1]
In situ hybridization for miR-21 showed scattered staining for miR-21 in the alveolar cells of non-fibrotic lung tissue (Figure  3E). [score:1]
These observations suggest that miR-21 may also participate in EMT of lung epithelial cells. [score:1]
To investigate the levels of expression of miR-21 in lung epithelial cells precisely, we utilized flow cytometric cell sorting to identify and to isolate epithelial, endothelial and mesenchymal cells (Figure  1A). [score:1]
Our findings suggested that miR-21 works as a potential inducer of EMT in lung epithelial cells by promoting TGF-β signaling. [score:1]
This result is contrary to previous reports showing that myofibroblasts were the main source of the increased miR-21 levels present in bleomycin -treated lungs (Figure  2D). [score:1]
miR-21 is increased in the whole lung of bleomycin-instilled mice [14] as well as in lung biopsy samples of IPF patients [14- 16]. [score:1]
Recently, it has been shown that miR-21 has a role in lung fibrosis. [score:1]
Staining for miR-21 was also observed in alveoli located in areas showing milder fibrotic changes (Figure  3G). [score:1]
We also performed in situ hybridization for miR-21 in lung tissues from saline- or bleomycin -treated mice, and we observed scattered staining for miR-21 in the alveoli of saline -treated mouse lungs (Figure  3A). [score:1]
We observed an increase of miR-21 in isolated lung epithelial cells in which EMT occurred in vivo during bleomycin -induced lung injury. [score:1]
To investigate the role of microRNA-21 in epithelial-mesenchymal transition, we transfected cells with a microRNA-21 inhibitor. [score:1]
To investigate the roles of miR-21 in EMT of lung alveolar epithelial cells during lung fibrosis, we first examined the miR-21 expression changes in lung epithelial cells during bleomycin -induced lung fibrosis. [score:1]
In bleomycin -treated mice, staining for miR-21 was observed in cells surrounding fibrotic foci but not in cells within fibrotic foci (Figure  3C). [score:1]
Figure 2 miR-21 is increased in lung epithelial cells during experimental bleomycin -induced lung injury. [score:1]
In IPF lung tissues, staining for miR-21 was observed in cells surrounding fibrotic foci, but not in cells within fibrotic foci (Figure  3F). [score:1]
The examinations by in situ hybridization and immunohistochemistry showed that myofibroblasts were the main source of the increased miR-21 levels during bleomycin -induced lung fibrosis [14, 16]. [score:1]
Taken together, our data suggest that miR-21 promotes EMT in lung epithelial cells during lung fibrosis. [score:1]
Thus, miR-21 amplifies TGF-β signaling in a positive feedback fashion. [score:1]
Figure 4 miR-21 is increased in lung alveolar type II cells from idiopathic pulmonary fibrosis (IPF) patients. [score:1]
The biological functions of miR-21 have also attracted the attention of researchers in various fields, including oncology. [score:1]
Therefore, it is likely that microRNAs, including let-7d, miR-21 and miR200c, that are involved in TGF-β signaling also play a significant role in EMT during lung fibrosis [2, 11, 14]. [score:1]
These observations indicated that miR-21 increased in pulmonary epithelial cells both in vivo and in vitro when EMT had occurred in those cells. [score:1]
Previous reports showed that miR-21 is increased in whole lung samples both in bleomycin -induced mouse mo dels of lung fibrosis and in human patients with IPF [14- 16, 25]. [score:1]
Our experiments demonstrate that microRNA-21 is increased in lung epithelial cells during lung fibrosis and that it promotes epithelial-mesenchymal transition. [score:1]
To investigate the changes in miR-21 expression in human lung epithelial cells from patients with IPF more precisely, we isolated alveolar type II cells from human lung specimens by flow cytometric cell sorting (Figure  4A) [20]. [score:1]
In summary, we demonstrated that miR-21 is increased mainly in lung epithelial cells in a mouse mo del of lung fibrosis as well as in isolated alveolar type II cells cultured under EMT-inducing conditions. [score:1]
miR-21 is increased in lung epithelial cells from patients with IPF. [score:1]
Arrows indicate staining for miR-21. [score:1]
To investigate the expression levels of miR-21 in lung epithelial cells during lung fibrosis, we used the mouse mo del of bleomycin -induced lung fibrosis. [score:1]
miR-21 increases in lung epithelial cells during experimental bleomycin -induced lung injury. [score:1]
miR-200c & miR-21-i: cells co -transfected with both synthesized miR-200c and miR-21-i. The data were analyzed by one-way analysis of variance with a post hoc test (Scheffé’s test). [score:1]
[1 to 20 of 87 sentences]
25
[+] score: 229
Other miRNAs from this paper: mmu-mir-34a, mmu-mir-21b, mmu-mir-21c
[17] miR-21 expression was up-regulated during early stages of liver regeneration and targeting of Peli1 provides a negative feedback loop regulating NF-κB signaling. [score:9]
MicroRNA-21 (miR-21) is a unique miRNA that it is overexpressed in most inflammatory diseases, tumour, and cardiac disease. [score:7]
These results are consistent with the study of Schaefer et al that the expression of miR-21 is up-regulated in development of colonic inflammation in IL-10 KO mice. [score:7]
Therefore, attenuated expression of miR-21 in gut may prevent the onset or progression of inflammatory bowel disease in patients. [score:5]
All these results demonstrate that miR-21 was not an indispensable factor to modulate target gene expression. [score:5]
MiR-21 acts as a potent regulator of gene expression and is differentially expressed in IBD, including UC and CD. [score:5]
miR-21 and miR-34a mediated inhibition of endogenous WNT1 and JAG1 expression was important for proper monocyte derived dendritic cell (MDDC) differentiation. [score:5]
MicroRNA-21 (miR-21) is overexpressed in most inflammatory diseases, but its physiological role in gut inflammation and tissue injury is poorly understood. [score:5]
[19] miR-21 is negatively regulated in G1-S transition, and participates in DNA damage -induced G2-M checkpoint through down-regulation of Cdc25A. [score:5]
[9]– [11] Therefore, miR-21 is likely involved in the pathogenesis of IBD via regulation of relevant gene expression. [score:4]
Our results suggest that miR-21 is overexpressed in intestinal inflammation and tissue injury, while knockout of miR-21 in mice improve the survival rate in DSS -induced fatal colitis through protecting against inflammation and tissue injury. [score:4]
It is difficult to assess whether the up-regulation of miR-21 is a part of causative or a correlative effect in human IBD, but the experiments in mice would favor this view. [score:4]
Knockdown of miR-21 could decrease the level of Cyclin D1 protein and inhibit hepatocyte proliferation [19]. [score:4]
[20] Moreover, miR-21 inhibited the metabolism of superoxide to hydrogen peroxide by directly attenuating SOD3. [score:4]
Disease severity was measured daily and expressed in terms of (B) body weight loss,(C) fecal blood, (D) diarrhea, and (E) disease activity index (n = 6 per time point for miR-21 KO mice compared with WT control n = 10, *p<0.05, ***p<0.001, Student’s t test). [score:4]
Meanwhile, the study of Wu et al. has found that miR-21 is up-regulation in active UC compare to inactive UC. [score:4]
Furthermore, miR-21 up-regulation was observed in intestine of IBD and AIO patients and IL-10 KO mice. [score:4]
Finally, we found that miR-21 regulated the intestinal barrier function through modulating the expression of RhoB and CDC42. [score:4]
Up-regulation of miR-21 in Inflammation- and Injury-involved Intestine. [score:4]
Therefore, down-regulated miR-21 may serve as a new approach for treatment of inflammation and injury observed in patients with IBD. [score:4]
To determine the knockout efficiency, we performed QRT-PCR to confirm loss of miR-21 expression in small intestine and colon of miR-21 KO mice (Figure 1E). [score:4]
[43] Thus, we speculated that miR-21 regulated pathogenesis of IBD through modulating the expression of Cdc42 and RhoB. [score:4]
miR-21 was overexpressed in intestine of inflammatory bowel diseases (IBD) and acute intestinal obstruction (AIO) patients when compared with normal intestinal tissues. [score:4]
Although multiple targets of miR-21 have been identified, including PTEN, PDCD4, FasL, SOD3, Cdc25A, RhoB, IL-12p35, Bcl-2, Pellino, TPM1, JAG1 and WNT1 [4], [5], [12], [14], [15], [17]– [21], the role of miR-21 in gut damage and inflammation remains unclear. [score:3]
The anti-apoptotic function of AKT is partly through miR-21 -dependent suppression of Fas ligand. [score:3]
Normal colonic mucosa of human show low expression of miR-21 when compare with AIO- and IBD-involved mucosa (Figure 1A,B). [score:3]
In addition, reduced intestinal permeability and epithelial cells apoptosis in miR-21 KO mice after DSS treatment is likely due to inhibited inflammation and injury in KO mice, which lead to decreased cytokine production and epithelial cells apoptosis. [score:3]
Disease activity index(DAI), blood parameters, intestinal permeability, histopathologic injury, cytokine and chemokine production, and epithelial cells apoptosis were examined in colons of miR-21 KO and WT mice. [score:3]
However, we found no significantly different expression of NF-κB, PDCD4, Cdc25A, and Cyclin D1 between WT and miR-21 KO mice after 7 days of DSS treatment. [score:3]
However, mRNA expression level of PDCD4,Cdc25A, NF-κB, and Cyclin D1 have no significant changes in colon of miR-21 KO mice(Figure 7B,C,D,E). [score:3]
It has been shown that miR-21 was primarily detected in the cytoplasm of mononuclear and multinucleated myeloid cells and its expression significantly increases in asthma. [score:3]
miR-21 was first noted as an apoptotic suppressor in various cell lines [16]. [score:3]
Likewise, miR-21 was up-regulated in colon of IL-10 KO mice when compared with control mice. [score:3]
Effects of miR-21 KO on expression of relevant gene. [score:3]
Additionally, miR-21 also promoted dendritic cell (DC) apoptosis by targeting Bcl-2. [15]. [score:3]
Expression of miR-21 in inflammation- and injury-involved intestine and miR-21 KO mice. [score:3]
Alternatively, miR21 can reduce SOD2 level by inhibition of TNF-α production. [score:3]
[33] In addition, the expression of miR-21 is significantly increased in DSS -treated colon of WT mice when compare with untreated WT mice (Figure 1D). [score:3]
[18], [34], [35] Meanwhile, miR-21 targets multiple of genes including PDCD4 and Cdc25A and modulates inflammatory processes [35] and cell cycle progression [20], respectively. [score:3]
[6] Consistently, miR-21 is significant overexpressed in colon of IL-10 KO mice when compare with control mice (Figure 1C). [score:3]
Taking advantage of this unique genetic mo del together with dextran sodium sulphate (DSS) -induced experimental colitis, we examined the hypothesis that the colonic epithelial damage and cell apoptosis in colitis may be linked to the differential expression of miR-21. [score:3]
Interestingly, we found a significant difference expression of Cdc42 and RhoB between WT and miR-21 KO mice after DSS treatment. [score:3]
[6]– [8] In this study, our results show that miR-21 is over-expressed in intestine of IBD and AIO patients and colon of IL-10 KO mice. [score:3]
MiR-21 KO mice have a significant amelioration in the severity of DSS-colitis at day 5, as shown by a significant reduction in the clinical disease activity index (Figure 2E). [score:2]
Increasing evidences have indicated that miR-21 play an important role in regulating inflammatory processes. [score:2]
All these results suggested that miR-21 may play a crucial role in regulating inflammatory and injury response in the gut. [score:2]
To explore the role of miR-21 in gut damage and inflammatory response in vivo, we developed miR-21 knockout (miR-21 KO) mouse mo del. [score:2]
MicroRNA-21 is involved in diverse biological processes, including cell differentiation, proliferation, and apoptosis, presumably through its various targets. [score:2]
All these results suggesting that miR-21 may regulate pathogenesis of colitis through a unique molecular mechanism. [score:2]
[18] Knocking down of miR-21 impaired cell cycle progression of hepatocytes into S phase, mainly through a decrease in cyclin D1 protein level. [score:2]
0066814.g001 Figure 1 (A) Representative photomicrographs in situ detection (200×magnification, n = 3 per group) and (B) QRT-PCR (n = 5 per group) shown miR-21 is overexpressed in intestinal tissue of IBD and AIO patients when compared with normal intestinal tissues (NIT) of human. [score:2]
What is clear is that the absence of miR-21 in the mice drastically ameliorates the development of colitis. [score:2]
On the contrary, RhoB was significantly increased in colon of miR-21 KO mice after DSS treatment (Figure 7G). [score:1]
[40]- [42] Meanwhile, our latest study has found that increased miR-21 in Caco-2 cell and tissues of UC induce the degradation of RhoB mRNA, which led to the depletion of RhoB and the impairment of tight junctions in intestinal epithelial cells. [score:1]
Colon tissue sections from miR-21 KO and WT mice were immunostained with antibodies for (E, F) CD68 and (G, H) CD3 (200×magnification). [score:1]
Homozygous miR-21 KO mice in C57BL/6 background were intercrossed to generate miR-21 KO mice (Figure 1F). [score:1]
WT mice lost weight more rapidly than miR-21 KO mice, with significant difference in body weight at day 5. The greatest percentage of body weight lost in WT and miR-21 KO mice were 36.5% and 29.1%, respectively. [score:1]
Fluorescence micrographs of colons in WT (F, H) and miR-21 KO (G, I) mice stained for terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling (TUNEL) (green). [score:1]
Effects of miR-21 KO on mucosal cytokine production, intestinal permeability and epithelial cells apoptosis before and after DSS treatment. [score:1]
There were significant difference in red blood cells count, hematocrit, and hemoglobin between before and after DSS treatment, but no significant difference between miR-21 KO and WT mice (Figure 3A, B, C). [score:1]
DSS -induced Increase of Intestinal Permeability and Epithelial Cells Apoptosis were Attenuated in miR-21 KO Mice. [score:1]
No differences in epithelial cell apoptosis were found in miR-21 KO and WT mice before DSS treatment (Figure 6F, G, J). [score:1]
Interestingly, deletion of miR-21 in mice results in a dramatic decrease in susceptibility to DSS -induced colitis, as assessed by weight loss, DAI, WBC count, histologic severity, length and weight of colon, and low mortality rates. [score:1]
To investigate the expression levels of miR-21 in different pathological conditions in intestine, we performed in situ hybridization of miR-21 in 3 ulcerative colitis (UC), 3 acute intestinal obstruction (AIO), and 3 control colonic specimens. [score:1]
QRT-PCR were performed to measure the expression of miR-21(A), PDCD4(B), Cdc25A(C), NF-κB(D), Cyclin D1(E), Cdc42 (F), and RhoB (G) in colon of miR-21 KO and WT mice after administration of 3.5% DSS for 7 days. [score:1]
The intestinal permeability was significantly increased in both WT mice and miR-21 KO mice after DSS administrated (Figure 6E). [score:1]
Because of the similar expression pattern of miR-21 in murine experimental colitis and human IBD and AIO patients, we take advantage of miR-21 -null mice to investigate its functional role in IBD pathogenesis. [score:1]
In conclusion, our study shows an important role of miR-21 that improve the survival rate following DSS -induced fatal colitis through protecting against inflammation and tissue injury. [score:1]
miR-21 KO mice have attenuation in intestinal epithelial injury and inflammatory infiltration. [score:1]
[36] Therefore, miR-21 maybe not a key factor for induced occurs of intestinal inflammation and damage but it have an important role in modulation the severity of intestinal inflammation and damage in IBD patients. [score:1]
Experimental colitis was induced in miR-21 KO and wild-type (WT) mice by 3.5% dextran sulphate sodium (DSS) administration for 7 days. [score:1]
0066814.g007 Figure 7 QRT-PCR were performed to measure the expression of miR-21(A), PDCD4(B), Cdc25A(C), NF-κB(D), Cyclin D1(E), Cdc42 (F), and RhoB (G) in colon of miR-21 KO and WT mice after administration of 3.5% DSS for 7 days. [score:1]
Expression of macrophage inflammatory protein-2 (MIP-2) (A,C)and tumor necrosis factor α (TNF-α) (B,D) in WT and miR-21 KO mice were measured in serum (C,D) and colon culture supernatants (A,B) (mean±SEM, n = 6 per group of DSS treatment, n = 4 per group of water treatment, *p<0.05, **p<0.01,***p<0.001, Student’s t test). [score:1]
Decreased Susceptibility to Experimental Colitis in miR-21 KO Mice. [score:1]
miR-21 KO mice(Obtained from Prof Zonglai Jiang, School of Life Sciences & Biotechnology, Shanghai Jiao Tong University, Shanghai, China) and wild-type (WT) C57BL/6J controls were housed in specific pathogen-free conditions with free access to food and water. [score:1]
Decreased Susceptibility to Experimental Colitis in miR-21 KOMice carrying miR-21 KO allele offers us a unique tool to examine its role in intestine. [score:1]
In situ hybridization was performed with 5′-locked digoxigenin- labeled LNA™ miR-21 probe complementary to human mature miR-21 and LNA™ U6 snRNA as positive control (Exiqon, Vedbaek, Denmark). [score:1]
The goal of this work is to understand the role of miR-21 in colitis and damage progression of intestine in a genetically modified murine mo del. [score:1]
miR-21 KO mice have a attenuation in the severity of DSS-colitis. [score:1]
Elevated levels of TNF-α and macrophage inflammatory protein-2(MIP-2) in colon culture supernatants from WT mice exhibited significant higher than miR-21 KO mice. [score:1]
The panels are representative of 5 WT and 5 miR-21 KO mice (200×magnification). [score:1]
Severe experimentally induced colitis in miR-21 KO mice. [score:1]
Blood parameters in miR-21 KO and WT mice following experimentally induced colitis. [score:1]
There was no difference in intestinal permeability between WT and miR-21 KO mice before DSS treatment. [score:1]
We verified loss of miR-21 in colon of miR-21 KO mice (Figure 7A). [score:1]
Furthermore, at day 7 of DSS administration, the colons of WT animals were significantly lighter and shorter than miR-21 KO mice (Figure 4A, B, C), and when moribund the entire colon and caecum were filled with loose, bloody stool (Figure 4C). [score:1]
DSS -induced Increase of Intestinal Permeability and Epithelial Cells Apoptosis were Attenuated in miR-21 KOThere was no difference in intestinal permeability between WT and miR-21 KO mice before DSS treatment. [score:1]
WT mice were moribund at day 5, while 100% of miR-21 KO mice survived at day 6 (Figure 2F). [score:1]
WT mice rapidly lost weight and were moribund 5 days after treatment with 3.5% DSS, while miR-21 KO mice survived for at least 6 days. [score:1]
A 912 bp amplicon defined wild-type and no amplification product reflected the miR-21 KO (Figure 1D). [score:1]
Colon architecture of miR-21 KO mice were indistinguishable from WT mice by H&E staining before DSS treatment. [score:1]
0066814.g006 Figure 6Expression of macrophage inflammatory protein-2 (MIP-2) (A,C)and tumor necrosis factor α (TNF-α) (B,D) in WT and miR-21 KO mice were measured in serum (C,D) and colon culture supernatants (A,B) (mean±SEM, n = 6 per group of DSS treatment, n = 4 per group of water treatment, *p<0.05, **p<0.01,***p<0.001, Student’s t test). [score:1]
carrying miR-21 KO allele offers us a unique tool to examine its role in intestine. [score:1]
Reduced Inflammatory Response in miR-21 KO Mice. [score:1]
[1 to 20 of 94 sentences]
26
[+] score: 224
After identification of miR-21 as a potential downstream target of Per2 mediated cardioprotection, we confirmed a Per2 dependent miR-21 regulation in cardiac tissue from wildtype or Per2 [-/-] mice; while IPC resulted in a 2.4-fold induction of miR-21 in wildtype mice (Fig 1A), no upregulation was observed in Per2 [-/-] mice (Fig 1B). [score:7]
Here we found that miR-21 was exclusively upregulated during conditions of low oxygen availability, indicating that endothelial expressed miR-21 is critical during acute myocardial ischemia. [score:6]
Taken together, while miR-21 is predominantly expressed in cardiac fibroblasts at baseline, only cardiac endothelial cells revealed a significant upregulation of miR-21 upon hypoxia exposure. [score:6]
After confirming that miR-21 is a hypoxia regulated micro RNA with predominant upregulation in hypoxic cardiac endothelial cells, we next analyzed the role of miR-21 in known Per2 regulated pathways. [score:6]
In contrast, our gain of function (GOF) studies done by overexpressing a miR-21 mimic (22-fold overexpression, Fig 4F) significantly increased glycolysis (1.3-fold, Fig 4G and 4H), glycolytic capacity (1.6-fold, Fig 4I) and glycolytic reserve (2.3-fold, Fig 4J) in HMEC-1s. [score:5]
Taken together, our studies show that murine miR-21 expression oscillates over the circadian day in heart and lungs (ZT3 vs ZT15, p < 0. 05), like Per2 which implies a putative circadian expression pattern of miR-21. [score:5]
After finding that Per2 dependent miR-21 was critical for Per2 regulated glycolysis or light elicited cardioprotection, we next extended our in vivo studies to determine if exposing mice to intense light–a strategy to overexpress cardiac Per2 [10]–induces cardiac miR-21. [score:4]
Further analysis using human microvascular endothelial cells (HMEC-1) confirmed a miR-21 upregulation in hypoxia (8.6-fold increase in 1% hypoxia, Fig 3E). [score:4]
Moreover, IPC -mediated cardiac protection against ischemia/reperfusion injury was inhibited by knockdown of cardiac miR-21 [22]. [score:4]
Based on findings that miR-21 overexpression was associated with increased glycolysis in vitro, we next determined plasma phosphofructokinase activity, the key regulatory enzyme in the glycolytic pathway. [score:4]
We propose miR-21 to be circadian based on a Per2 dependent regulation and findings on a diurnal expression pattern like that of Per2. [score:4]
3.3 miR-21 is exclusively upregulated in hypoxic cardiac endothelial cells. [score:4]
In fact, analysis of relative miR-21 expression levels indicated an abundant expression of miR-21 in cardiac fibroblasts when compared to other cardiac cell types (Fig 3A). [score:4]
We first confirmed a knockdown of miR-21 in HMEC-1s and found a 70% reduction of miR-21 expression (Fig 4A). [score:4]
Using in vitro, murine in vivo and human studies, our data suggest miR-21 is a novel downstream target of light and IPC elicited Per2 regulation of cardioprotection and carbohydrate metabolism. [score:4]
After confirming that miR-21 is a Per2 regulated micro RNA with a diurnal expression pattern in heart and lungs, we next investigated which cardiac cell type expressed miR-21 during conditions of low oxygen availability. [score:4]
Remarkably and in line with our findings, miR-21 is one of the most robustly up-regulated miRNAs in hearts after IPC [21]. [score:4]
For loss of function experiments, we used an anti-miR-21 (Qiagen, MIMAT0000076: 5'UAG CUU AUC AGA CUG AUG UUG A, MIMAT0004494: 5'CAA CAC CAG UCG AUG GGC UGU, MIMAT0004494: 5'CAA CAC CAG UCG AUG GGC UGU; MIMAT0000076: 5'UAG CUU AUC AGA CUG AUG UUG A) and a miScript Inhibitor Negative Control (Qiagen, cat. [score:3]
Control, scrambled [SCR]) and anti-mir-21 (LOF) treated HMEC-1. (F) Overexpression in miR-21Mimic (gain of function [GOF]) treated HMEC-1. (G-J) Glucose metabolism from control (miScript miRNA Mimic Neg. [score:3]
Studies on miR-21 expression revealed a Per2 dependent and putative circadian profile. [score:3]
Despite these contrary findings, other studies have shown a protective role for miR-21 in ischemic preconditioning [55], postconditioning [41], or protection form ischemia and reperfusion injury of the heart [56], using miR-21 inhibitors or mimetics, supporting our current findings. [score:3]
miR-21 expression in different cardiac tissues at baseline and during hypoxia. [score:3]
3.2 Diurnal expression pattern of miR-21 in the murine heart and lung. [score:3]
These data suggest that endothelial expressed miR-21 plays a critical role during conditions of low oxygen availability, such as myocardial ischemia. [score:3]
However, isolated murine cardiac endothelial cells exposed to hypoxia revealed a robust and significant upregulation of miR-21 (4.9-fold increase compared to ambient oxygen levels, Fig 3D). [score:3]
Furthermore, miR-21 has also been found to be a HIF1A target gene [18]. [score:3]
Profiling the Per2 dependent expression of 352 micro RNAs following cardioprotective ischemic preconditioning (IPC) of the heart indicated an exclusive role for miR-21. [score:3]
Out of 352 most abundantly expressed micro RNAs, we identified miR-21 amongst the top Per2 dependent micro RNAs that may play a role in metabolic and IPC mediated cardioprotection. [score:3]
Based on these observations we exposed primary fibroblasts, cardiomyocytes or endothelial cells from C57BL6/J mouse hearts to hypoxia and analyzed miR-21 expression. [score:3]
Based on previous findings that miR-21 is predominantly expressed in cardiac fibroblasts [38], we obtained fibroblasts, myocytes or endothelial cells from wildtype mouse hearts. [score:3]
To understand a potential role of miR-21 in glycolysis, we first performed loss of function (LOF) studies using miR-21 inhibitors. [score:3]
Fibroblasts or myocytes were isolated from C57BL6/J mouse hearts and endothelial cells isolated from C57/BL6 mice were purchased from Cell Biologics for analyzing miR-21 expression at baseline or hypoxic (1% oxygen) conditions. [score:3]
Diurnal expression of miR-21 in murine hearts and lungs. [score:3]
Taken together, these data show that intense light mediated cardioprotection is abolished in miR-21 [-/-] mice and suggest that miR-21 is a downstream target of light elicited Per2 in cardioprotection from myocardial ischemia and reperfusion injury. [score:3]
However, high temporal resolution gene expression analysis would be necessary to further support that miR-21 is indeed circadian [46]. [score:3]
0176243.g003 Fig 3Fibroblasts or myocytes were isolated from C57BL6/J mouse hearts and endothelial cells isolated from C57/BL6 mice were purchased from Cell Biologics for analyzing miR-21 expression at baseline or hypoxic (1% oxygen) conditions. [score:3]
Data from these studies would therefore suggest that Per2-HIF1A complex is responsible for the transcriptional regulation of miR-21 during myocardial ischemia. [score:2]
In addition, while miR-21 was found to play a key role in cardiac IPC [22, 41] or preventing apoptosis in cardiomyocytes [18], long-term elevation of miR-21 may be also be detrimental to the organ by promoting the development of fibrosis in an acute cardiac allograft transplantation mo del [42]. [score:2]
3.1 Differential and Per2 dependent regulation of micro RNA miR-21 after ischemic preconditioning (IPC). [score:2]
We found significantly higher cardiac miR-21 expression levels at ZT15 compared to ZT3 (1.8-fold increase from ZT3 to ZT15, Fig 2A). [score:2]
Like Per2, miR-21 was light inducible, mediated light elicited cardioprotecion and regulated glycolysis in human endothelial cells or in human subjects. [score:2]
Studies of miR-21 regulation in wiltype and Per2 [-/-] mice after cardiac ischemic preconditioning. [score:2]
Effects of intense light on miR-21 regulation in mice and human subjects. [score:2]
After we found intense light regulation of cardiac miR-21, we next pursued studies on light therapy in healthy human volunteers. [score:2]
Taken together, these data demonstrate that IPC induced Per2 regulates cardiac miR-21. [score:2]
Considering cardiac miR-21 is regulated in a Per2 dependent manner, and cardiac Per2 has a diurnal oscillation pattern, we next investigated the expression pattern of this micro RNA over a 12h period. [score:2]
As such, intense light induction of Per2 regulated cardiac miR-21 is not very surprising. [score:2]
0176243.g001 Fig 1Studies of miR-21 regulation in wiltype and Per2 [-/-] mice after cardiac ischemic preconditioning. [score:2]
0176243.g004 Fig 4 (A) Knockdown confirmation in anti-mir-21 (loss of function, LOF) treated human endothelial cells (HMEC-1). [score:2]
In miR-21 knockdown HMEC-1s, we assessed glycolysis, glycolytic capacity, and glycolytic reserve using a glycolytic stress test and Seahorse Bioanalyzer (Fig 4B). [score:2]
Using miR-21 LOF or GOF in HMEC-1s revealed a critical role of miR-21 for Per2 regulated cellular glycolysis. [score:2]
The critical role of miR-21 in glycolysis seems surprising. [score:1]
Indeed, analysis of lung tissue from these wildtype mice at the indicated times revealed lung miR-21 and Per2 mRNA levels significantly higher at ZT15 than ZT3, which was consistent with our findings in the heart (lung miR-21 3.7-fold increase and lung Per2 mRNA 6.9-fold increase from ZT3 to ZT15, respectively, Fig 2C and 2D). [score:1]
Intense light exposure in mice or humans increased miR-21 levels and light exposure in humans also increased phosphofructokinase activity. [score:1]
Studies on myocardial ischemia and reperfusion injury revealed larger infarct sizes and abolished light elicited Per2 cardioprotection in miR-21 [-/-] mice. [score:1]
Light elicited cardioprotection in wildtype and miR-21 [-/-] mice. [score:1]
In a Per2 dependent manner miR-21 and phosphofructokinase (PFK) are transcriptionally induced which finally leads to increased PFK activity, glycolytic capacity and cardioprotection. [score:1]
3.6 Light elicited cardioprotection is abolished in miR-21 [-/-] miceAfter confirming a cardio-protective role of miR-21 in myocardial ischemia and reperfusion injury, we next investigated miR-21 as a potential downstream target of Per2 in myocardial ischemia and reperfusion injury. [score:1]
Therefore, it is surprising to find a role for miR-21 in cardioprotection from acute myocardial ischemia and reperfusion injury. [score:1]
While studies on cardioprotective effects of light exposure in humans are missing, light induced cardioprotective miR-21 could be one mechanism by which intense light exposure reduced myocardial damage in murine studies [10]. [score:1]
Taken together, these studies demonstrate that miR-21 is necessary to maintain glycolysis, critical for the cell to maximally respond to glycolytic demand (glycolytic capacity), and pertinent for glucose reserves to be available for use through glycolysis beyond baseline (glycolytic reserve). [score:1]
The miR-21 Mimic was delivered to human microvascular endothelial cells (HMEC-1) using DharmaFect I Transfection Reagent (Dharmacon). [score:1]
In fact, computational analysis revealed a selective role for miR-21 in cardiac ischemia reperfusion injury, hypoxia [17, 18], and metabolic [19, 20] pathways. [score:1]
As shown in Fig 5A, miR-21 [-/-] mice had significant larger infarct sizes after 60 minutes of ischemia and 120 min of reperfusion than their littermate controls (miR-21 [-/-]: 68 ± 9% vs. [score:1]
Analysis of three cardiac tissues revealed hypoxia induced miR-21 predominantly in cardiac endothelial cells. [score:1]
3.5 miR-21 [-/-] mice have larger infarct sizes in myocardial ischemia and reperfusion. [score:1]
However, identical intense light exposure conditions in miR-21 [-/-] mice failed to induce cardioprotection (Room light vs intense light: 68 ± 9% vs. [score:1]
In line with these findings, recent studies on miR-21 in small lung cancer cells revealed a similar connection between miR-21, glycolysis and HIF1A [51]. [score:1]
Loss of miR-21 significantly reduced glycolysis (10.7-fold, Fig 4C), glycolytic capacity (31-fold, Fig 4D) and glycolytic reserve (31-fold, Fig 4E). [score:1]
cDNA from miRNA was generated using miScript RT II kits (Qiagen) and miR-21 or Per2 transcript levels were determined by real-time RT-PCR (iCycler; Bio-Rad Laboratories Inc. [score:1]
Plasma samples were analyzed for miR-21 levels and PFK (phosphofructokinase) activity. [score:1]
3.4 miR-21 is critical for cellular glycolysis, glycolytic capacity, and glycolytic reserve. [score:1]
3.8 Intense light exposure increases miR-21 and PFK activity in healthy human volunteers. [score:1]
MiR-21 is predominantly expressed in cardiac fibroblasts when compared with other cell types of the heart [39]. [score:1]
miR-21 is located on chromosome 17 and is highly conserved in many species, including human, rat, mouse, fish and frog. [score:1]
3.6 Light elicited cardioprotection is abolished in miR-21 [-/-] mice. [score:1]
0176243.g002 Fig 2Analysis of cardiac (A) or lung (B) mir-21 and Per2 levels from wildtype mice at Zeitgeber Time (ZT) 3 or ZT15. [score:1]
Anti-miR-21 inhibitors were transfected into human microvascular endothelial cells (HMEC-1), a cell line well characterized for hypoxic, metabolic and Per2 pathways [10]. [score:1]
Taken together, using a wide microRNA screen in Per2 [-/-] mice we found cardioprotective miR-21 to be Per2 dependent. [score:1]
In contrast, other studies on miR-21 null mice did not find any significant differences in infarct sizes during myocardial ischemia and reperfusion injury [52, 53]. [score:1]
Thus, we first exposed miR-21 [-/-] or control mice (B6129SF1/J) to myocardial ischemia and reperfusion injury. [score:1]
After confirming a cardio-protective role of miR-21 in myocardial ischemia and reperfusion injury, we next investigated miR-21 as a potential downstream target of Per2 in myocardial ischemia and reperfusion injury. [score:1]
0176243.g005 Fig 5Light elicited cardioprotection in wildtype and miR-21 [-/-] mice. [score:1]
Taken together, these studies show that miR-21 is functional and cardioprotective in myocardial ischemia and reperfusion injury. [score:1]
Glycolysis in miR-21 gain or loss of function human endothelial cells. [score:1]
Plasma samples were used to isolate micro RNAs and to determine miR-21 plasma levels. [score:1]
However how miR-21 controls glycolysis would need further mechanistic studies. [score:1]
Analysis of cardiac (A) or lung (B) mir-21 and Per2 levels from wildtype mice at Zeitgeber Time (ZT) 3 or ZT15. [score:1]
Taken together, one week of intense light exposure in human subjects increases miR-21 levels in blood plasma samples which is associated with increased phosphofructokinase activity. [score:1]
As shown in Fig 3B and 3C, no significant regulation of miR-21 was found in fibroblasts or myocytes upon hypoxia exposure when compared to cells at ambient oxygen levels (normoxia). [score:1]
The anti-miR-21 was delivered to HMEC-1 using HiPerFect Transfection Reagent (Qiagen). [score:1]
For gain of function experiments, we used a MISSION hsa-miR-21 Mimic (Sigma-Aldrich, cat. [score:1]
Taken together, exposing mice to intense light increases miR-21 levels in cardiac tissues, like Per2 mRNA, which supports that miR-21 could be indeed a circadian micro RNA downstream of Per2. [score:1]
Based on our findings that IPC increased cardiac miR-21 in a Per2 dependent manner, we next exposed wildtype controls or miR-21 [-/-] mice to 3 h of intense light prior to myocardial ischemia and reperfusion injury as done previously in Per2 [-/-] mice [10]. [score:1]
While miR-21 is one micro RNA that has a strong involvement in cardioprotective pathways such as IPC [22] or metabolic pathways [19], other identified microRNAs could be possible candidates for Per2 mediated pathways. [score:1]
2.2 Per2 [-/-] mice Per2 [-/-] or miR-21 [-/-] and controls (C57BL/6J or B6129SF1/J) were obtained from the Jackson Laboratories [24, 25]. [score:1]
Per2 [-/-] or miR-21 [-/-] and controls (C57BL/6J or B6129SF1/J) were obtained from the Jackson Laboratories [24, 25]. [score:1]
Our findings show that intense light significantly increased miR-21 in human plasma samples which was associated with increased phosphofructokinase activity, the key enzyme of glycolysis. [score:1]
Taken together, these studies suggest manipulation of miR-21 through intense light or IPC to increase glycolysis, a potential therapeutic strategy for myocardial ischemia (Fig 7). [score:1]
Five days of intense light therapy significantly increased miR-21 plasma levels in human subjects (3.5-fold, Fig 6D). [score:1]
In fact, a recent study on myocardial ischemia and reperfusion injury found protective effects of miR-21 in endothelial injury, further supporting our findings [48]. [score:1]
Ingenuity analysis revealed a selective role for miR-21 in protection from reperfusion injury of the heart. [score:1]
Together, these findings support our hypothesis, that miR-21 is downstream of Per2 and indicate a critical role for miR-21 in light or Per2 mediated cardioprotection. [score:1]
In fact, we found intense light elicited cardioprotection to be abolished in miR-21 [-/-] mice. [score:1]
3.7 Intense light exposure induces cardiac miR-21. [score:1]
Plasma samples were analyzed for miR-21 levels and PFK (phosphofructokinase) activity (mean±SD, n = 7, p<0.05). [score:1]
2.10 Metabolic analysis in miR-21 gain or loss of function. [score:1]
To verify a diurnal nature of miR-21 we analyzed another organ in addition to the heart. [score:1]
Proposed mo del of IPC or light induced miR-21 and glycolysis. [score:1]
[1 to 20 of 109 sentences]
27
[+] score: 223
Other miRNAs from this paper: mmu-mir-21b, mmu-mir-21c
In our experiments, RPE treatment blocked the p38MAPK pathway and inhibited NF-κB activation by suppressing Fstl 1 expression via downregulation of miR-21 expression. [score:12]
Therefore, in addition to downregulating miR-21 and Fstl l expression, puerarin might interrupt the TGF-β autocrine pathway by inhibiting MMP-9 activity and, thereby, suppress PQ -induced pulmonary fibrosis. [score:10]
This likely reduced expression of profibrogenic genes and directly suppressed pulmonary fibrosis, thus protecting against miR-21 -mediated injury and downregulating the major signalling transducer, Smad2/3. [score:9]
The ameliorating effects of RPE on these histological alterations indicated suppression of Fstl l mediated effects by downregulating miR-21 expression, preventing accumulation of HYP in lungs of mice treated with PQ. [score:8]
This mechanism involves blocking profibrotic gene and protein expression though decreasing Fstl l expression via downregulation of miR-21. [score:8]
In our study, PQ markedly upregulated miR-21 expression, stimulated FSTL1 expression, facilitated TGF-β/Smad2/3 and p38MAPK signal transduction and induced pulmonary fibrosis. [score:8]
RPE treatment significantly downregulated Fstl l expression by decreasing miR-21 expression. [score:8]
In this study, puerarin increased HO-1 and Nrf2 expression, suppressed ROS and MDA levels, significantly increased SOD activity and GSH levels, decreased miR-21 and Fstl 1 expression and attenuated PQ -induced pulmonary fibrosis. [score:7]
Inhibiting miR-21 expression in the lung successfully ameliorated pulmonary fibrosis and it was suggested that miR-21 promoted fibrosis by targeting the anti-fibrotic protein Smad7 [41]. [score:7]
In our study, RPE, extracts that contain puerarin, inhibited miR-21 expression, blocked FSTL1 expression and increased HO-1 and Nrf2 protein levels in lungs from PQ -treated mice. [score:7]
However, administration of RPE significantly suppressed PQ -induced miR-21 expression, blocked FSTL1 expression, decreased p-p38MAPK, NF-kB65, p-Smad2/3 and MMP-9 protein levels and attenuated pulmonary fibrosis. [score:7]
In addition, miR-21 was significantly upregulated during liver fibrosis of different aetiologies [39], further indicating that miR-21 is a common effector in fibrotic disease. [score:6]
a Typical patterns of miR-21 expression as assessed by real-time PCR (a, control (scrambled oligonucleotide) group; b, miR-21 knockdown group; c, wild type group); b of miR-21 expression. [score:6]
miR-21 is upregulated in the lungs of patients with idiopathic pulmonary fibrosis (IPF) and inhibition of miR-21 attenuates lung fibrosis in mice [11, 12]. [score:6]
We found that RPE ameliorated lung fibrosis and blocked reactive oxygen species (ROS) -associated Fstl 1 activation, oxidative stress and inflammatory signalling pathways by downregulating miR-21 expression. [score:6]
Our study demonstrated that Fstl l was upregulated through miR-21 expression after PQ challenge, resulting in increased Smad2/3 and p38MAPK phosphorylation and progressive PQ -induced pulmonary fibrosis. [score:6]
Huang Y He Y Li J MicroRNA-21: a central regulator of fibrotic diseases via various targetsCurr Pharm Des. [score:5]
These findings demonstrated that RPEs blocked PQ -induced Fstl 1 pathways and oxidative stress by inhibiting miR-21 expression, leading to attenuation of PQ -induced lung fibrosis. [score:5]
miR-21 knockdown decreased FSTL1 expression and mitigated PQ -induced pulmonary fibrosis. [score:4]
Previous studies indicated that miR-21 was upregulated during fibrogenesis in the heart, kidney and lung [36– 38]. [score:4]
As shown in Fig.   2, real-time PCR demonstrated no miR-21 expression in lungs from the miR-21 knockdown mice, that is, those that had been treated with the anti-miR-21 oligonucleotides. [score:4]
miRNA-21 (miR-21) is one of the most important miRNAs upregulated during fibrogenesis in various tissues [10]. [score:4]
As shown in Fig.   3, after PQ treatment, lung expression of FSTL1 was increased and pulmonary fibrosis exacerbated in miR-21 knockdown and wild-type (WT) mice. [score:4]
Upregulation of miR-21 was observed in the cardiac fibroblasts of failing hearts and treatment with an miR-21 antagomir in amouse mo del of cardiac hypertrophy prevented interstitial fibrosis and improved cardiac function [40]. [score:4]
Fig. 3Effect of miR-21 knockdown on FSTL1 expression and PQ -induced pulmonary fibrosis. [score:4]
Effect of miR-21 knockdown on miR-21 expression in lungs from PQ -treated mice. [score:4]
Fig. 2Effect of miR-21 knockdown on miR-21 expression in lungs from PQ -treated mice. [score:4]
However, protein expression of FSTL1 was significantly decreased and pulmonary fibrosis was attenuated in the miR-21 knockdown mice, as compared with in WT mice. [score:3]
RPE radix puerariae extract Fstl l follistatin-like 1 gene FSTL1 follistatin-like 1 protein miR-21 microRNA-21 PQ paraquat CTGF connective tissue growth factor MMP-9 matrix metalloproteinase-9 ECM extracellularmatrix TIMPs tissue inhibitors of metalloproteinases Nrf2 nuclear factor erythroid 2p45-related factor-2 MAPKs mitogen-activated protein kinases NF-κB nuclear factor kappa α-SMA alpha-smooth muscle actin ROS reactive oxygen species HO-1 heme oxygenase-1 SOD superoxide dismutase TGF-β transforming growth factor-β MDA malondialdehyde GSH reduced glutathione GSSH oxidised glutathione HSCs hepatic stellate cells The authors thank Prof. [score:3]
Fig. 4Effects of RPE on miR-21, FSTL1, p-p38MAPK, NF-kB65, p-Smad2/3, and MMP-9 expression in lungs from mice treated with PQ. [score:3]
TGF-β1 canstimulate miR-21 expression, detected in the liver, heart, kidneys and lungs of mice [10]. [score:3]
RPE reduced features of lung fibrosis by blocking Fstl 1 pathways and oxidative stress through decreased miR-21 expression. [score:3]
RPE blocked miR-21, FSTL1, p-p38MAPK, NF-kB65, p-Smad2/3 and matrix metalloproteinase 9 (MMP-9) expression in lungs from PQ -treated mice. [score:3]
In our study, RPE extracts appeared to attenuate PQ -induced lung fibrosis through blocking TGF-β1 and CTGF expression, as a result of decreased miR-21 levels. [score:3]
a and b Histopathological changes in lung tissues from mice (a: HE staining, 200× magnification; b: Masson’s trichrome staining, 200× magnification; a, control (scrambled oligonucleotide); b, miR-21 knockdown; c, WT); c: Representative western blots showing FSTL1 levels (a, control (scrambled oligonucleotide); b, miR-21 knockdown; c, WT) and statistical analysis of FSTL1 protein levels. [score:3]
This implies that miR-21 is an attractive potential therapeutic target against fibrosis under various pathological conditions. [score:3]
miR-21 expression in pulmonary tissue was determined using real-time PCR. [score:3]
miR-21 expression in pulmonary tissue was determined by real-time PCR. [score:3]
On day 14 after administration of RPE and PQ challenge, miR-21, FSTL1, p-p38MAPK, NF-kB65, p-Smad2/3 and MMP-9 expression were assessed by real-time PCR (a) and p-p38MAPK, NF-kB65, p-Smad2/3 and MMP-9 protein levels by western blotting (b) Groups are as defined in. [score:3]
This suggested that PQ -induced fibrosis might be mediated by miR-21-stimulated expression of the profibrotic factors TGF-β1 and CTGF. [score:3]
As shown in Fig.   4, expression levels of miR-21, FSTL1, p-p38MAPK, NF-kB65, p-Smad2/3 and MMP-9 in the lung were increased during PQ -induced pulmonary fibrosis. [score:3]
Long-term challenge with PQ enhanced miRNA-21 (miR-21), Fstl 1 pathways, oxidative stress and development of fibrotic features in the lungs. [score:2]
We investigated effects of miR-21 knockdown on miR-21 expression in lung tissue from mice treated with PQ. [score:2]
This pulmonary fibrosis mo del was established in both miR-21 knockdown and wild-type (WT) mice. [score:2]
Because miR-21 is one of the most abundant microRNAs, it plays an important role in the pathogenesis and development of fibrosis. [score:2]
In vivo miR-21 knockdown using locked nucleic acid -modified anti-miR-21. [score:2]
Lung fibrosis Radix puerariae extracts miR-21 Connective tissue growth factor Nuclear factor erythroid 2p45-related factor-2 Nuclear factor-κB Oxidative stress Mice Paraquat, (PQ) wi dely used as an herbicide, is controversial because of the high mortality of PQ exposure, with a typical case fatality of 50–90 % [1]. [score:1]
Gene expression levels of miR-21, Fstl 1, transforming growth factor-β1 (TGF-β1), connective tissue growth factor (CTGF), collagen-1 and collagen III were measured by real-time PCR. [score:1]
Locked nucleic acid (LNA) -modified scrambled or anti-miR-21 oligonucleotides (Exiqon, Woburn, MA, USA) were diluted in saline (5 mg/mL) for administration through intraperitoneal (i. p. ) injection (10 mg/kg) at least 30 min before PQ exposure [18]. [score:1]
We examined effects of miR-21 on follistatin-like 1 (Fstl 1) pathways and oxidative stress in the lung. [score:1]
[1 to 20 of 50 sentences]
28
[+] score: 222
Other miRNAs from this paper: mmu-mir-21b, mmu-mir-21c
Real time RT-PCR results showed that expression of miR21 in ECs of the knockout group (miR21 flox/ flox with Tek-Cre expression, miR21 endothelial-specific KO) was significantly lower when compared to the control group (miR21 flox/ floxed without Cre expression, miR21 positive) (Figure 2D). [score:7]
Here we found that expression of collagen III was down-regulated on 21 days after birth, which implied that miR21 may relate to collagen III directly in vascular remo deling process. [score:7]
In the cultured ECs, the expression of Smad7 is up-regulated with deletion of miR21. [score:6]
As shown in Figure 7A, the expression of Smad7 was up-regulated with deletion of miR21. [score:6]
0059002.g001 Figure 1. (A) Diagram for miR21 exon1- floxed targeting construct and location of primers used for genotyping of targeted locus and FLP, Cre -mediated excised targeted locus. [score:6]
The expression of Smad protein family, Smad7, having been reported as a target of miR21 [29], and Smad2, which reported as a negative regulating factor for miR21 [30], Smad5, which mediated induction of both pre- and mature miR21 [31] were all examined. [score:6]
Our results showed TGF-β1 unchanged, while CTGF level is elevated in the miR21 endothelial-specific KO mice, which may cause the proliferation of connective tissue cells [48] and VSMCs, and influence the expression of ECM by MMP/TIMP expression [49], [50]. [score:5]
Mouse bearing targeted miR21- floxed allele was crossed with a Tek-Cre transgenic mouse line that expressed Cre recombinase specifically in EC lineage (Figure 1C and D). [score:5]
Here, we detected the expression of several MMPs/TIMPs, and found that MMP-2, MMP-10 were elevated in the miR21 endothelial-specific KO mice significantly, but TIMP-4 was reduced as the results of ECM expression (Figure 7D). [score:5]
Two clones with a properly targeted miR21 allele were injected into 3.5-d C57BL/6 blastocysts, and high-percentage chimeric male mice were crossed to C57BL/6 females to achieve germline transmission of the targeted alleles. [score:5]
The western results showed that the expression of collagen III was down- regulated to a low level at 21 days after birth in the miR21 endothelial-specific KO group (Figure 6D). [score:4]
To generate miR21 endothelial-specific KO mice, targeting vector for generating null alleles of miR21 deletion mutation was constructed using the pBR322 vector, which contains a neomycin resistance gene driven by the pGK promoter, flanked by FRT sites. [score:4]
We generated this knock-out mouse mo del and examined the expression of miR-21 at different levels. [score:4]
This targeting construct was used to generate miR21 flox/ flox mice, which were crossed with FLP mice to excised neo mice, crossed with Tek-Cre mice to produce an endothelial-specific miR21 knockout. [score:4]
We detected several MMPs and TIMPs, and found that MMP-2 and MMP-10 are elevated, but TIMP-4 is reduced in the miR21 endothelial-specific KO mice, which demonstrated a decreased expression of ECM correlate with the results of elastin and collagen. [score:3]
Its limitation is that although a knockout mo del is established and studied in vivo, we can not elucidate the underlying molecular mechanisms how miR21 knocked out in ECs induces vascular remo deling. [score:3]
To determine if miR21 directly regulated only Smad7 in Smads protein family, Smad 2, Smad 5 were also examined. [score:3]
Effects of miR21 deletion on Smads, TGF-β1, CTGF, p-Smads and MMP/TIMP expressions in aorta of the miR21 endothelial-specific KO mice. [score:3]
Figure 7C showed that expression of TGF-β1 was unchanged but CTGF was elevated significantly in the miR21 endothelial-specific KO mice. [score:3]
The expression of TGF-β1 was unchanged but CTGF was decreased in the miR21- deletion ECs, which showed the same trend as reported [46] (Figure S4B). [score:3]
In both the miR21 KO mice and the control, ACh -induced relaxations were abolished upon eNOS inhibition with L-NAME (Figure 4C). [score:3]
MiR21 deletion affected the expression of Smad2/5/7 in aorta of the miR21 endothelial-specific KO mice. [score:3]
The exon1 of miR21 and 3.2 kb, 5 kb genomic fragments flanking exon1 (left and right arm) were PCR-amplified and subcloned into a targeting vector such that exon1 of miR21 was followed by a neo cassette, and exon1 was flanked by two loxP sites, neo was flanked by two FRT sites. [score:3]
For the targeting vector of miR21, a 3.2 kb fragment upstream of pre-miR21 and a 5 kb fragment downstream were generated as the 5′ and 3′ arms, respectively. [score:3]
We hypothesize that change of miR21 expression in ECs may influence the vascular remo deling significantly. [score:3]
Effects of miR21 deletion on ECM expression in aorta of the miR21 endothelial-specific KO mice. [score:3]
The results will help to improve our understanding of the effects of miR21 in vascular biology and the pathogenesis of vascular diseases. [score:3]
0059002.g007 Figure 7(A) Western analysis detected expression of Smad2/5/7 in aorta of the miR21 endothelial-specific KO mice and control mice. [score:3]
The results showed that expressions of these ECMs, elastin, collagen I and collagen III, on mRNA level or on protein level, were decreased in the miR21 endothelial-specific KO group (Figure 6A, B, C and E). [score:3]
MiR21 deletion changed expressions of elastin, collagen I and collagen III in aorta of the miR21 endothelial-specific KO mice at 21 days and 8 weeks after birth. [score:3]
MiR21 targeting strategies were designed to replace the pre-miR sequences (391bp) flanked by loxP sites with the neomycin resistance cassette. [score:3]
For screening of ES cell clones positive for targeted miR21 flox/ flox allele, electroporated G418-resistant ES cells were digested and analyzed by PCR. [score:3]
Overexpressing miR21 decreased apoptosis and increased eNOS phosphorylation and nitric oxide production in ECs [9]. [score:3]
Figure S4 Effects of miR21 deletion on Smads, TGF-β1, CTGF, p-Smads expression in ECs from the miR21 endothelial-specific KO mice and the control. [score:3]
It was reported that overexpressing miR21 increased eNOS phosphorylation and nitric oxide production in ECs [9] and this result is corresponding with our endothelial relaxation result. [score:3]
MiR21 is expressed in endothelial and all vessel support cells. [score:2]
Construction of miR21 flox/ flox, Tek-Cre/Flp knockout mice and PCR identification. [score:2]
In present study, miR21 endothelial-specific knockout (KO) mice were established by using site-specific recombination Cre/LoxP systems. [score:2]
When miR21 was knocked out in ECs, the P-V relationship of thoracic aorta downward shifted in the compliance curve as shown in Figure 5H. [score:2]
When miR21 is knocked out, Smad7 is increased significantly in our results. [score:2]
Among these miRs, MiR21 is found to participate in vascular remo deling by regulating proliferation, apoptosis and phenotype transformation of vascular smooth muscle cells (VSMCs) [4]– [8]. [score:2]
0059002.g003 Figure 3(A) There were no difference in systolic pressure between the knockout group and the control group, but diastolic pressure was significantly reduced in the miR21 endothelial-specific KO mice. [score:2]
MiR21 expression was reduced in late-passage senescent human aorta ECs featuring reduced cell proliferation, enhanced apoptosis and inflammation and reduced eNOS [10]. [score:2]
in miR21 flox/ flox, Tek-Cre group (miR21 endothelial-specific KO group) showed that there was not miR21 in EC of knockout mice. [score:2]
Sequences of primers are in Table 1. (B) Analysis of the targeting construction for the miR21 locus. [score:2]
Figure 2A showed that there was only minimal background staining in the miR21 -knockout ECs. [score:2]
Generation of the miR21 endothelial-specific knockout mice. [score:2]
The results suggested that the contractile response to norepinephrine and the ability of the endothelium to produce nitric oxide are impaired, but there are no changes in the VSMC ability to respond to nitric oxide in the miR21 endothelial-specific knockout mice. [score:2]
0059002.g004 Figure 4(A) The response of maximal tension of aortic strips to 10 [−6]M NE reduced significantly in the miR21 endothelial-specific deletion mice. [score:1]
Heterozygous miR21 neo/+ mice were intercrossed with Flp-transgenic mice (J003800, Jackson laboratories) to remove the neo cassette, and Tek-Cre transgenic mice (J004128, Jackson laboratories) to remove miR21 in ECs. [score:1]
Understanding of the effect of miR21 on modulating vascular remo deling will help to define the molecular mechanisms underlying vascular homeostasis and the vascular pathology, as well as general cell biological processes. [score:1]
Figure S3 Morphomety of the thoracic aorta, ascending aorta and carotid artery of miR21 flox/ flox and miR21 flox/ flox, Tek-Cre mice. [score:1]
The present results indicated that the miR21 endothelial-specific KO results in vascular function remo deling. [score:1]
The floxed miR21 was identified as a 925 bp band marked by 1, while 713 bp band marked by 2 for wild-type miR21 and 427 bp band marked by 3 for floxed miR21 excised by Cre recombinase. [score:1]
The elastin content was 11.6±2.8 µg/mg of the wet weight of the vessel in the miR21 endothelial-specific KO group, while the elastin content of the control group was 15.8±1.5 µg/mg. [score:1]
The primers for genotyping of miR21 knockout are in Table 1. 10.1371/journal. [score:1]
Loss of miR-21 resulted in diastolic pressure dropping of the miR21 endothelial- specific KO mice. [score:1]
As a conclusion, the present study identified miR21 as a critical molecule to modulate vascular remo deling process. [score:1]
As showed in Figure 3A, diastolic blood pressure was significantly reduced to 71.9±3.5 mmHg in the miR21 endothelial-specific KO mice, while the systolic blood pressure was not altered. [score:1]
The results showed a decreasing trend in the miR21 endothelial-specific KO mice, which also matched with the Western blotting results of MMP/TIMP (Figure 7D). [score:1]
The results suggested that Smad proteins may mediate vascular remo deling induced by miR21 deletion. [score:1]
Thus, miR21 may mediate vascular remo deling mainly through Smad7. [score:1]
MiR21 deletion decreased the contents of elastin and collagen in thoracic aorta of the miR21 endothelial-specific KO mice and the stiffness. [score:1]
Figure S4C revealed that p-Smad5 levels increased in the cultured miR21- deletion ECs. [score:1]
The primers for genotyping of miR21 knockout are in Table 1. 10.1371/journal. [score:1]
To determine whether miR-21 was deleted in ECs, PCR (Figure 2C), and ISH (Figure 2A), RT-real time PCR (Figure 2D), Semi-quantitative RT-PCR (Figure 2E) were performed to prove that miR-21 was deleted on both DNA and RNA level in ECs. [score:1]
The results demonstrated that miR21 deletion decreases the content of elastin of thoracic aorta in the miR21 endothelial-specific KO mice, which implies that the flexibility of blood vessel wall is reduced after the deletion of miR21 in ECs. [score:1]
The maximal tension of aortic strips by response to norepinephrine was reduced significantly in the miR21 endothelial-specific deletion mice (Figure 4A). [score:1]
Morphomety of the thoracic aorta of miR21 flox/ flox and miR21 flox/ flox, Tek-Cre mice. [score:1]
The aortic collagen content was 22.4±1.7 µg/mg of the wet weight of the vessel in the miR21 endothelial-specific KO group, while the collagen content of the control group was 25.8±0.9 µg/mg. [score:1]
The present study revealed that aortic elastin content in the miR21 endothelial-specific KO mice is decreased when normalized to area. [score:1]
These data demonstrated that miR21 has been endothelial-specifically deleted in the miR21 mutant mice. [score:1]
The results revealed a decrease of the percentage in the miR21 endothelial-specific KO mice (Figure 5A and C). [score:1]
Our result showed the downward shift in the compliance curve after miR21 deletion (Figure 5H), which means the compliance of aorta is reduced. [score:1]
Taken together, these results suggested that miR21 in ECs plays a critical role in mediating the vascular remo deling. [score:1]
The morphometry results showed that wall thickness of thoracic aorta media is increased by vascular remo deling resulting from the miR21 deletion in ECs. [score:1]
The altered aortic function of the miR21 endothelial-specific KO mice. [score:1]
In the present study, we found that miR21 specific deletion in ECs modulates vascular remo deling. [score:1]
In the miR21 endothelial-specific KO mice, the aortic opening angles are elevated significantly with decreasing elastin content, indicating increased residual stress in elastin-insufficient vessels [34], [35]. [score:1]
The thoracic aorta from the miR21 endothelial-specific KO mice was treated by 2 mg/ml collagenase I (sigma) for 45 minutes at 37°C. [score:1]
MiR21 deletion increased opening angle of thoracic aorta in the miR21 endothelial -specific KO mice. [score:1]
The results showed that the diastolic pressure is significantly reduced in the miR21 endothelial-specific KO mice. [score:1]
We also detected a reduced mean blood pressure (87.4±3.1 mmHg) in miR21 endothelial-specific KO group to enhance our results about diastolic pressure reduction, but the heart rate did not change (Figure 3B and C). [score:1]
A miR21- floxed allele was produced by inserting loxP sites in the 5′ and 3′ region of exon of mouse miR21 (Figure 1A and B). [score:1]
These data demonstrated that the miR21 endothelial-specific KO induces an increase in the opening angle of the zero-stress state, which indicates that aorta undergo vascular remo deling. [score:1]
These findings strongly suggest that miR21 have a crucial role in modulating EC biology. [score:1]
0059002.g002 Figure 2(A) Aortic ECs were isolated from the miR21 endothelial-specific KO mice and cultured in growth medium. [score:1]
miR21 flox/ flox, Tek-Cre by Student's unpaired t test. [score:1]
The data also showed that Smad7 as well as CTGF and downstream MMP/TIMP are involved in the effects of miR21 deletion in ECs. [score:1]
After establishing miR21 endothelial-specific KO mice, the blood pressure was observed and the opening angle, compliance and micro-structure of the thoracic aorta were assessed to ascertain the vascular remo deling. [score:1]
Maximal tension and ACh -induced endothelium -dependent relaxation of aorta were impaired in the miR21 endothelial-specific deletion mice. [score:1]
The result suggested that the compliance of arota is reduced by the miR21 deletion in ECs. [score:1]
Although the role of miR21 in vascular biology was well studied in vitro, little is known how miR21 modulates vascular remo deling in vivo. [score:1]
The miR21 endothelial-specific KO group showed a significant increase in aortic stiffness (Figure 5G). [score:1]
All the miR21 endothelial-specific KO mice in the study were products of intercrossing miR21 flox/ flox (neo) mice. [score:1]
Although the low diastolic pressure is also likely to be caused by other factors such as smooth muscle cells and/or fibroblast, rather than ECs, the maximal tension of aorta is reduced significantly in the miR21 endothelial-specific deletion mice may interpret the reason for low diastolic pressure. [score:1]
The results showed that the maximal tension of aorta was significantly reduced and the endothelium -dependent relaxation of aorta was also impaired in the miR21 endothelial-specific deletion mice. [score:1]
It showed that miR21- floxed alleles were almost excised in ECs. [score:1]
These results demonstrated that the miR21 endothelial-specific KO mice are successfully established, and the mice mo del can be used to view the function of miR-21 in endothelial in vivo. [score:1]
To determine if miR21 was deleted on DNA level, PCR analysis was performed and demonstrated that miR21 was almost deleted in ECs on DNA level but it existed in the aorta (Figure 2C). [score:1]
The elastin content of aorta was reduced significantly in the miR21 endothelial-specific KO group (Figure 5E). [score:1]
The inner diameter of thoracic aorta of miR21- KO group was significantly decreased and the wall thickness/inner diameter ratio of that was significantly increased. [score:1]
No changes in collagen staining area were observed in the miR21 endothelial-specific KO group (Figure 5B and D). [score:1]
Different amount of RNA were reverse transcribed with M-MuLV reverse transcriptase (Fermentas) according to qPCR Quantitation Kit instruction (GenePharma) for miR21, U6, elastin, collagen I, collagen III and GAPDH (Table 2). [score:1]
To address the role of miR21 in vascular biology in vivo, mice of EC specific ablation of miR21 were established. [score:1]
The sequences of miR21 probe and the scramble control probe for a negative control were 5′-/56-FAM/TCAACATCAGTCTGATAAGCTA-3′ and 5′-/56-FAM/GTGTAACACGTCTATACGCCCA-3′, respectively. [score:1]
Identification of the miR21 deletion in ECs. [score:1]
[1 to 20 of 107 sentences]
29
[+] score: 221
Other miRNAs from this paper: mmu-mir-21b, mmu-mir-21c
Among them, miR21 can target Bcl-2 expression by binding to Bcl-2 3’-untranslated region (610–617 bp) and stably expressed in peripheral blood and closely related to disease outcome in B-cell lymphoma as previously reported [15– 17]. [score:11]
b-c ABT-199 -mediated inhibition of HUVEC growth was associated with decreased tube formation (b) and increased HUVEC apoptosis, as revealed by (c) Of note, Bcl-2 expression was increased on HUVEC co-cultured with miR21 -overexpressing SU-DHL-4 cells or SU-DHL-8 cells, which was downregulated upon ABT-199 treatment (Fig.   5a). [score:10]
b-c ABT-199 -mediated inhibition of HUVEC growth was associated with decreased tube formation (b) and increased HUVEC apoptosis, as revealed by (c) Of note, Bcl-2 expression was increased on HUVEC co-cultured with miR21 -overexpressing SU-DHL-4 cells or SU-DHL-8 cells, which was downregulated upon ABT-199 treatment (Fig.   5a). [score:10]
Meanwhile, pharmacological inhibition of STAT3 by the STAT3 inhibitor abrogated the increased expression of ICOS on Treg cells induced by miR21 overexpression (Fig.   3d). [score:9]
e-g Addition of ICOS antibody in HUVEC counteracted ABT-199 -mediated reduction of Bcl-2 expression (e), inhibition of tube formation (f) and induction of cell apoptosis (g) Together, miR21 increased interaction of Treg cells with endothelial cells via ICOS/ICOSL axis and stimulated tumor angiogenesis, which was interrupted by ABT-199 through targeting Bcl-2 expression on endothelial cells. [score:9]
e-g Addition of ICOS antibody in HUVEC counteracted ABT-199 -mediated reduction of Bcl-2 expression (e), inhibition of tube formation (f) and induction of cell apoptosis (g) Together, miR21 increased interaction of Treg cells with endothelial cells via ICOS/ICOSL axis and stimulated tumor angiogenesis, which was interrupted by ABT-199 through targeting Bcl-2 expression on endothelial cells. [score:9]
MiR21 overexpression induced Bcl-2 expression on SU-DHL-4, but not on SU-DHL-8. c MiR21 overexpression induced lymphoma cell resistance to doxorubicin (50 nm in SU-DHL-4, 55 nm in SU-DHL-8) or cisplatin (5 μM in SU-DHL-4, 7 μM in SU-DHL-8) in the monoculture system and in the co-culture system, but sensitivity to ABT-199 (14 nm in SU-DHL-4, 32 nm in SU-DHL-8) in the co-culture system To clarify the underlying mechanism behind miR21 -mediated sensitization of ABT-199 on B-cell lymphoma, Treg cells were sorted from the co-culture system and the effect of tumor miR21 on Treg cells was studied. [score:7]
The patients with miR21 expression level over and equal to the median value were regarded as high miR21 expression, while those below to the median value were included into the low miR21 expression Bcl-2 [postive] B-lymphoma cells SU-DHL-4 and Bcl-2 [negative] B-lymphoma cells SU-DHL-8 were treated with different concentrations of doxorubicin, cisplatin and ABT-199. [score:7]
When co-cultured with immune cells and endothelial cells, miR21 -overexpressing B-lymphoma cells were resistant to chemotherapeutic agents, but sensitive to Bcl-2 inhibitor ABT-199, irrespective of Bcl-2 expression on lymphoma cells. [score:7]
The patients with miR21 expression level over and equal to the median value were regarded as high miR21 expression, while those below the median value were included into low miR21 expression. [score:7]
a HUVEC cells were sorted from the co-culture system for further study, Bcl-2 expression on HUVEC was increased by miR21 overexpression and decreased by ABT-199 treatment in the co-culture system of SU-DHL-4 and SU-DHL-8 cells. [score:5]
MiR21 induced ICOS expression on Treg cells through p-STAT3 upregulation. [score:5]
Ectopic expression of miR21 of lymphoma cells significantly increased ICOS expression on Treg cells in both co-culture systems of SU-DHL-4 and SU-DHL-8 cells (P = 0.036 and P = 0.015, Fig.   3a). [score:5]
In a murine xenograft mo del established with subcutaneous injection of B-lymphoma cells, ABT-199 particularly retarded the growth of miR21 -overexpressing tumors, consistent with the induction of endothelial cell apoptosis and inhibition of tumor angiogenesis. [score:5]
Thus, miR21 -mediated p-STAT3 phosphorylation was necessary for the induction of ICOS expression on Treg cells, independent of Bcl-2 expression of lymphoma cells. [score:5]
a Treg cells were sorted from the co-culture system for further study, ICOS expression on Treg cells was increased by miR21 overexpression in the co-culture systems of SU-DHL-4 and SU-DHL-8 cells. [score:5]
In both co-culture systems of Bcl-2 [positive] and Bcl-2 [negative] B-lymphoma cells, miR21 induced inducible co-stimulator (ICOS) expression on regulatory T (Treg) cells. [score:4]
In clinical settings, increased circulating miR21 level in sera from DLBCL patients is associated with matched tumor tissue, advanced disease stage and inferior overall survival [26, 27]. [score:3]
To overexpress miR21 in A20 cells, purified plasmids pGMLV-miR21 or control vector were transfected into HEK-293 T cells with package vectors using lipofectamine 2000. [score:3]
ABT-199 exhibited in vivo activity on miR21 -overexpressing lymphoma. [score:3]
Our study showed that ectopic expression of miR21 led to chemoresistance of B-lymphoma cells, more profoundly when lymphoma cells were co-cultured with immune cells and endothelial cells, main components of tumor microenvironment. [score:3]
c with high serum miR21 expression displayed significantly increased tumor CD31 positivity. [score:3]
b A significant correlation was observed between serum and tumor miR21 expression level. [score:3]
To our knowledge, we provided the first evidence that miR21 enhanced the interaction of Treg cells with endothelial cells, induced ICOS expression on Treg cells, stimulated tumor angiogenesis via ICOS/ICOSL signaling, and led to chemoresistance of B-cell lymphoma. [score:3]
Microvessels were indicated by red broken lines and apoptotic bodies by red arrow MiR21 is a key regulator of disease progression in B-cell lymphoma [23, 24]. [score:3]
As revealed by immunohistochemistry in tumor samples of DLBCL (25 each with high or low miR21 expression), CD31 -positive microvessels were more frequently observed in high miR21 group than in low miR21 group (P = 0.002, Fig.   1c). [score:3]
Different from the monoculture condition, miR21 overexpression resulted in lymphoma cell resistance to chemotherapeutic agents, but its sensitivity to ABT-199, is found not only in the co-culture system of Bcl-2 [postive] SU-DHL-4 cells, but also in the co-culture system of Bcl-2 [negative] SU-DHL-8 cells (Fig.   2c). [score:3]
Fig. 6ABT-199 exhibited in vivo activity on miR21 -overexpressing lymphoma. [score:3]
A significant correlation between serum and tumor miR21 expression was observed by Pearson correlation coefficient analysis (r = 0.675, Fig.   1b). [score:3]
Serum miR21 was significantly elevated in patients and associated with advanced disease stage, International Prognostic Index indicating intermediate -high and high-risk, and increased tumor angiogenesis. [score:3]
d- e Bcl-2 expression (d) and cell apoptosis revealed by ultrastructural analysis (e) were increased in microvessels of ABT-199 -treated pGMLV-miR21 tumors. [score:3]
The median expression of miR21 was 0.318 in DLBCL. [score:3]
Experimentally, the overexpression of miR21 leads to a pre-B malignant lymphoid-like phenotype [25]. [score:3]
a MiR21 -overexpressing pGMLV-miR21 tumors grew more quickly than the control pGMLV-ct tumors and were more sensitive to ABT-199 treatment. [score:3]
a HUVEC cells were sorted from the co-culture system for further study, HUVEC growth was enhanced by miR21 overexpression and reduced by ABT-199 treatment in the co-culture systems of SU-DHL-4 and SU-DHL-8 cells. [score:3]
b Comparing with the control mimics, transfection with miR21 mimics in SU-DHL-4 and SU-DHL-8 cells resulted in significantly increased miR21 expression. [score:3]
In the present study, we assessed serum miR21 expression in a large cohort of DLBCL patients and revealed the biological function of miR21 on tumor microenvironment both in vitro and in vivo. [score:3]
MiR21 overexpression of lymphoma cells significantly enhanced HUVEC growth (P = 0.015 and P = 0.028), which was retarded upon ABT-199 treatment (P = 0.043 and P = 0.037, Fig.   4a). [score:2]
Here we not only confirmed miR21 as a serum oncogenic biomarker of DLBCL, but also provided a direct link of miR21 with lymphoma progression and tumor angiogenesis. [score:2]
Previous study reported that miR21 regulates tumor progression through the miR21-PDCD4-STAT3 pathway [22]. [score:2]
MiR21 can modulate ICOS-ICOSL expression and contribute to the progression of colorectal cancer [36]. [score:2]
MiR21 overexpression enhanced B-lymphoma cell chemoresistance but ABT-199 sensitivity involving tumor microenvironment. [score:2]
MiR21 is overexpressed in diffuse large B-cell lymphoma (DLBCL) and its biological impact on tumor microenvironment remains unclear. [score:2]
ABT-199 counteracted miR21 -mediated tumor angiogenesis through ICOS/ICOSL -mediated interaction of Treg cells with endothelial cells. [score:1]
Serum miR21 was elevated in B-cell lymphoma and indicated lymphoma progression. [score:1]
The tumor size of pGMLV-miR21 group was significantly larger than that of pGMLV-ct group (P = 0.043 at Day 6 and P = 0.005 at Day 7, Fig.   6a). [score:1]
These data suggested that serum miR21 was related to tumor progression and tumor angiogenesis in B-cell lymphoma. [score:1]
This is in accordance with previous studies which showed miR21 provokes myeloma cell adhesion to bone marrow stromal cells and resistance to chemotherapeutic agents [30], in addition, miR21 initiates inflammatory signaling in HER2 -positive breast cancer and reduces the cytotoxic effect of neoadjuvant trastuzumab and chemotherapy [31]. [score:1]
MicroRNA21 B-cell lymphoma ABT-199 Tumor microenvironment Regulatory T cells Endothelial cells Diffuse large B-cell lymphoma (DLBCL) represents the most common neoplastic disorder of B-lymphocytes. [score:1]
Here, both in vitro and in vivo, our study characterized a Bcl-2 -dependent inhibition of ABT-199 on tumor angiogenesis, mediated by intrinsic miR21-Treg cell pathway, leading to sensitizing effect of ABT-199 on B-cell lymphoma. [score:1]
Difference of miR21 expression among groups was calculated using Mann–Whitney U test. [score:1]
The above data demonstrated that miR21 plays an oncogenic role in B-cell lymphoma by modulating tumor microenvironment and supported clinical rationale for using miR21 as a biomarker to select chemoresistant B-lymphoma patients who may benefit from ABT-199 treatment. [score:1]
Murine xenograft mo del was established with subcutaneous injection of A20 cells either stably transfected with pGMLV-miR21 or control vector pGMLV-ct. [score:1]
As a serum oncogenic biomarker of B-cell lymphoma, miR21 indicated B-lymphoma cell sensitivity to ABT-199 via ICOS/ICOSL -mediated interaction of Treg cells with endothelial cells. [score:1]
Microvessels were indicated by red broken lines and apoptotic bodies by red arrow Comparing with healthy volunteers, serum miR21 was significantly increased in patients with DLBCL (P = 0.009, Fig.   1a). [score:1]
Serum and tissue miR21 detection. [score:1]
To determine the biological function of miR21, SU-DHL-4 and SU-DHL-8 cells were transfected with miR21 mimics. [score:1]
Therefore, in addition to the oncogenic role of miR21 on malignant B-lymphocytes [38], miR21 possessed a potential activity on tumor microenvironment, indicative an alternative mechanism of B-lymphoma cell response to ABT-199. [score:1]
The mechanism of action of miR21 on lymphoma progression and tumor angiogenesis was examined in vitro in B-lymphoma cell lines and in vivo in a murine xenograft mo del. [score:1]
a Serum miR21 was significantly higher in DLBCL patients than in health volunteers. [score:1]
SU-DHL-4 and SU-DHL-8 cells were transfected with miR21 mimics (Riobio, Guangzhou, China) or negative control (Riobio) using lipofectamine 2000 (Invitrogen) following the manufacturer’s instruction. [score:1]
More recently, gene ontology and pathway analysis has suggested that cell-environment interaction is another important miR21 pathogenic mechanism [28]. [score:1]
Although potentially oncogenic, miR21 enhanced the sensitivity of B-lymphoma cells to ABT-199, through an alternative mechanism involving tumor angiogenesis. [score:1]
Consistent with in vitro study, p-STAT3 -positive Treg cells, as well as ICOS/ICOSL -mediated interaction of Treg cells with endothelial cells, were increased in untreated pGMLV-miR21 tumors (Fig.   6b and c). [score:1]
HEK-293 T cells were transfected with luciferase reporter and miR21 mimics, using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. [score:1]
Comparing with healthy volunteers, serum miR21 was significantly increased in patients with DLBCL (P = 0.009, Fig.   1a). [score:1]
b- c p-STAT3 -positive Treg cells (b) and ICOS/ICOSL interaction (c) were decreased in untreated pGMLV-miR21 tumors. [score:1]
Elevated miR21 levels were associated with advanced Ann Arbor stage and International Prognostic Index indicating intermediate -high and high-risk (P = 0.027 and P = 0.013, Table  1). [score:1]
Therefore, irrespective of lymphoma cell Bcl-2 status, miR21 sensitized B-lymphoma cells to ABT-199 in the presence of tumor microenvironment. [score:1]
Instead, Bcl-2 -positive microvessels were reduced in pGMLV-miR21 tumors upon ABT-199 treatment (Fig.   6d), in parallel with the induction of apoptotic bodies in endothelial cells, as revealed by ultrastructural study (Fig.   6e). [score:1]
Fig. 4ABT-199 counteracted miR21 -mediated angiogenesis. [score:1]
Fig. 1Serum miR21 was elevated in B-cell lymphoma and indicated lymphoma progression. [score:1]
[1 to 20 of 72 sentences]
30
[+] score: 205
Other miRNAs from this paper: mmu-mir-184, mmu-mir-21b, mmu-mir-21c
For example, miR-21, whose expression is upregulated in chronic inflammatory conditions or by transforming growth factor β (TGF-β), has been shown to potentiate TGF-β responses by downregulating the level of the inhibitory Smad, Smad7 [14]. [score:11]
These results suggest that miR-21, the expression of which is upregulated by a TGF-β -dependent gene response [15, 21], may potentiate fibrotic responses in myofibroblasts and fibroblasts recruited to the damaged areas through suppression of Smad7. [score:8]
As predicted, expression of exogenous miR-21 alone downregulated Smad7 expression while enhancing Smad2 phosphorylation, resulting in an increase in collagen type III α from COL3A. [score:8]
This analysis indicated that miR-21 and miR-184, which are upregulated in idiopathic pulmonary fibrosis (IPF) [19, 20], were significantly upregulated in IR-injured mouse lung tissue (Fig 2A). [score:7]
We found that inhibition of miR-21 in MRC-5 human lung fibroblast cells by anti-sense-21 (or miR-21 inhibitor) (Fig 5A) suppressed collagen synthesis (e. g., Col1A2 and Col3A1) at both the mRNA (Fig 5B) and protein (Fig 5C) levels. [score:7]
These results clearly indicated that IR induction of miR-21 expression primarily contributes to collagen production by fibroblasts or fibroblast-like cells rather than to EndMT in ECs through the downregulation of Smad7. [score:6]
Because miR-21 -induced Smad7 downregulation contributes to bleomycin -induced pulmonary fibrosis (BLM fibrosis) [15], miR-21 induction in mesenchymal cells may promote the TGF-β gene response by suppressing Smad7. [score:6]
Monitoring the levels of nine genes, whose expression is regulated by miR-21, in microarrays, showed that several of these target genes, including Spry2, Tpm1, Reck, Bmpr2, Pdcd4 and Smad7 (http://www. [score:6]
In agreement with results showing that miR-21 is induced in BLM fibrosis [15], this study found that miR-21 levels progressively increased during collagen production at SBRT-damaged sites, accompanied by the significant downregulation of several miR-21 targets, including Smad7, suggesting that increased miR-21 contributes to fibrotic responses. [score:6]
This study found that miR-21 [39], which is expressed in serum, was significantly upregulated in SBRT lung tissue. [score:6]
Notably, while M-HPECs displayed mesenchymal properties (Fig 3A, 3B, 3C and 3D), their levels of miR-21 expression were also significantly upregulated, similar to findings in IR-damaged lung tissue, which indicated that miR-21 induction at IR-damaged areas of the lung may contribute to either EndMT or collagen production (Fig 3E and S3B Fig). [score:6]
More importantly, the increased expression of miR-21 in damaged lungs (Fig 2C) strongly correlated with the level of collagen expression (Fig 1B and 1C), a phenotype typical of fibrosis. [score:5]
To confirm this unexpected observation, miR-21 was overexpressed 150- to 200-fold in HPECs to determine whether this overexpression could convert endothelial-like HPECs to mesenchymal-like cells. [score:5]
HPECs were therefore treated with anti-sense miR-21 to inhibit miR-21 expression [15], followed by EndMT induction by exposure to IR. [score:5]
These findings indicated that expression of exogenous miR-21 activated Smad -dependent TGF β signaling (S4A and S4B Fig), whereas inhibition of miR21 resulted in a Smad gene response (S4C Fig). [score:5]
We therefore tested whether increased miR-21 expression could augment the mesenchymal properties of fibroblast-like cells or fibroblasts after the completion of EndMT in ECs [30] by determining whether miR-21 inhibition alters collagen production in lung fibroblasts. [score:5]
Despite the efficient inhibition of miR-21 by anti-sense miR-21, even after IR exposure (Fig 4A), as well as the response to radiation as determined by the induction of ICAM-1 (Fig 4B), the expression of EndMT markers, such as α-SMA, FN (Fig 4C) and ColA2 and ColA3 (Fig 4D), was not affected. [score:5]
Unlike results showing that miR-21 is partly responsible for TGF-β -mediated EndMT [30], this study found that miR-21 inhibition failed to rescue EndMT progression, with overexpression of exogenous miR-21 having only a slight effect on EndMT in pulmonary ECs. [score:5]
Analysis of miR arrays showed that miR-21 was induced in damaged areas of the lungs and that miR-21 expression, along with the suppression of Smad7, contributed to collagen production by fibroblast-like cells after radiation damage. [score:5]
MicroRNA-21 targets a network of key tumor-suppressive pathways in glioblastoma cells. [score:4]
Smad3 -mediated upregulation of miR-21 promotes renal fibrosis. [score:4]
jp/kegg-bin/show_pathway?hsa05206), were significantly downregulated at 3 and 4 weeks, at the time of miR-21 induction (Fig 2D). [score:4]
In order to quantify the different expressions of specific miR, we analyzed the expression of miRs (miR-21; 000397, U6; 001937; Ambion, Austin, Tx) in the total RNA extracted from various tissue samples and cells via real-time PCR using a TaqMan microRNA Assay kit (Applied Biosystems, Carlsbad, CA). [score:4]
Upregulation of miR-21 in IR-damaged lung tissue. [score:4]
Indeed, miR-21 has been shown to play a role in other fibrotic diseases, including renal [21, 41] and cardiac [42] failure. [score:3]
These findings suggested that miR-21 may be a potential molecular target for modulating pulmonary fibrosis [15]. [score:3]
Similarly, miR-21 inhibition had no effect on IR -induced reductions in CD31 antigen levels (Fig 4F). [score:3]
In contrast to findings in HPECs (Fig 4F and 4G), the expression of exogenous miR-21 in MRC-5 cells (Fig 5D) enhanced collagen synthesis at both the mRNA (Fig 5E) and protein (Fig 5F) levels in a time -dependent manner. [score:3]
The finding that miR-21 was induced in M-HPECs after IR exposure (Fig 3E), similar to results in IR-injured lung tissue (Fig 2), suggests that miR-21 expression in M-HPECs may be important for EndMT. [score:3]
C) or miR-21 inhibitor (anti-miR-21) transfection was determined by taqman miR realtime-PCR. [score:3]
miR-21 expression is dispensible for EndMT. [score:3]
These findings suggest that a strategy to inhibit miR-21 induction after SBRT would be therapeutically effective in preventing the onset of RILF and RILF -associated pathological symptoms. [score:3]
We therefore tested the ability of an anti-sense oligonucleotide to miR-21, which specifically inhibits miR-21, to delay the fibrotic response, finding that this anti-sense-miR21 was effective [15, 21, 42]. [score:3]
Modulation of miR-21 expression by anti-sense-21 would still be a valid approach, as serum levels of miR-21 may increase after SBRT. [score:3]
In particular, miR-21 levels are significantly increased in the lungs of bleomycin- and TGF-β -treated mice and are involved in the pro-fibrogenic responses of TGF-β through the suppression of Smad7 [15]. [score:3]
Moreover, miR-21 inhibition had no effect on IR -induced morphological changes in HPECs, as shown by increases in stress actin fibers and by losses of VE-cadherin (Fig 4E). [score:3]
C inh) or miR-21 inhibitor (anti-miR-21) (500nM). [score:3]
miR-21 expression is dispensible for EndMT HPECs were transfected with scramble miRs (miRN. [score:3]
By contrast, the inhibition or induction of miR-21 affected fibrotic responses only in mesenchymal cells. [score:3]
miR-21 controls Smad dependent gene response through Smad7. [score:1]
Finally, in situ hybridization showed that miR-21 was markedly increased only at IR-damaged areas (Fig 2E, white circles), suggesting that the local induction of miR-21 in these IR-damaged lung areas may contribute to the progression of pulmonary fibrosis. [score:1]
Because miR-21 is involved in fibrosis of multiple tissues, including the lungs [15] and kidneys [21], we focused on miR-21 in IR-injured mouse lungs. [score:1]
This study also showed that miR-21 induction was concurrent with collagen production at SBRT-damaged sites, promoting collagen production by mesenchymal cells but not by pulmonary ECs. [score:1]
Pixel density of miR-21 positive area was quantified and shown as a bar graph (right panel). [score:1]
This hypothesis was also supported by results showing that miR-21 contributes in part to TGF-β -induced EndMT [30]. [score:1]
miR-21 contributes to collagen production in fibroblasts. [score:1]
These results demonstrated that increased levels of miR-21 are dispensible for EndMT in HPECs. [score:1]
ISH probe for miR-21 and scramble control were 5’ and 3’- digoxigenin (DIG) labeled. [score:1]
Therefore, we tested whether miR-21 induction in damaged lung tissue (Fig 2) was associated with EndMT. [score:1]
miR-21 contributes to collagen production in fibroblasts MRC-5 cells were transfected with 500nM of anti-miR-21 and then were harvested at indicative times. [score:1]
IR promotes EndMT in lung ECs concurrent with miR-21 induction. [score:1]
S4 Fig (A) The level of miR-21 was determined after transfection with hsa-miR-21 mimic (miR-21). [score:1]
Real-time RT-PCR analysis confirmed that miR-21 was induced in IR-damaged lung tissue after 3 and 4 weeks (Fig 2B). [score:1]
Human pulmonary microvascular ECs (HPECs) were exposed to IR, inducing EndMT [25], and miR-21 expression was evaluated. [score:1]
The pixel density of miR-21 positive area was determined by ImageJ (https://imagej. [score:1]
β-actin for a loading control (E) The level of miR-21 of HPECs was determined via taqman miR real-time PCR using U6 snRNA for an internal control. [score:1]
IR promotes EndMT in lung ECs concurrent with miR-21 induction HPECs were exposed with either 5 or 20 Gy of X-ray and were harvested after 3 days. [score:1]
These data suggest that EndMT does not require miR-21 induction by SBRT. [score:1]
0154942.g005 Fig 5 MRC-5 cells were transfected with 500nM of anti-miR-21 and then were harvested at indicative times. [score:1]
The average ct values for miR-21 of 3 week and 4 week are 18.6 and 17.43 respectively. [score:1]
Several mRNAs, including those encoding p53, have been shown to interact with miR-21 (S1B Fig) [22, 23]. [score:1]
Increased levels of miR-21 are concurrent with IR -induced EndMT. [score:1]
[1 to 20 of 62 sentences]
31
[+] score: 204
Other miRNAs from this paper: mmu-mir-21b, mmu-mir-21c
While a definitive linear relationship between miR-21 target gene and the increased apoptosis of miR-21 [−/−] eosinophil progenitors is not proven, we hypothesize that miR-21 exerts modest effects on direct targets that synergistically interact to ultimately regulate eosinophilopoeisis. [score:7]
To further examine the effect of miR-21 deficiency on eosinophil levels in vivo, we induced an experimental mo del of eosinophilic esophagitis in which eosinophil infiltration is a prominent feature of the disease and miR-21 has been shown to be the most up-regulated microRNA [11]. [score:6]
We hypothesize that the observed decreased growth capacity of the miR-21 [−/−] eosinophil progenitors could potentially be due to modest regulation of a combination of miR-21 targets, including those not identified by the genomic screen due to the modest gene expression changes. [score:6]
One of the up-regulated genes, Psrc1, is a predicted target of miR-21 based on sequence conservation and binding site potential [9]. [score:6]
Herein, we show that miR-21 is up-regulated during eosinophil differentiation from eosinophil progenitors and that targeted ablation of miR-21 decreases eosinophil progenitor cell growth. [score:6]
MiR-21 [−/−] have Decreased Esophageal Eosinophil Level in an Animal Mo del of Eosinophilic EsophagitisTo further examine the effect of miR-21 deficiency on eosinophil levels in vivo, we induced an experimental mo del of eosinophilic esophagitis in which eosinophil infiltration is a prominent feature of the disease and miR-21 has been shown to be the most up-regulated microRNA [11]. [score:6]
At day 8 of the eosinophil progenitor culture, 7 genes were up-regulated in the miR-21 [−/−] eosinophil progenitor culture compared to the miR-21 [+/+] culture and there were no down-regulated genes (Fig. 5A; Table S1). [score:6]
Several other reports have shown that miR-21 targets multiple tumor suppressor and anti-proliferative genes such as PDCD4 and PTEN, mostly in cancer cell lines, generally by inducing modest changes in mRNA [27]– [30]. [score:5]
Red: up-regulated in miR-21 [−/−] eosinophil progenitor culture compared to miR-21 [+/+] eosinophil progenitor culture; blue: down-regulated in miR-21 [−/−] eosinophil progenitor culture compared to miR-21 [+/+] eosinophil progenitor culture. [score:5]
Since mature eosinophils loose their proliferative capacity and do not divide, we hypothesize that the up-regulation of miR-21 likely prevents premature loss of the proliferative potential of eosinophil progenitors. [score:4]
This finding is of significance since miR-21 is a top upregulated miRNA in human eosinophilic esophagitis [11], [32]. [score:4]
There are no differentially regulated genes at day 4 (data not shown), which is consistent with the miR-21 expression data and the lack of any observed phenotype at day 4 of the culture (Fig. 2). [score:4]
MiR-21 has been known to promote cell growth in various cell types, most notable in tumor cells by targeting a variety of pro-apoptotic genes both directly and indirectly [20], [21]. [score:4]
Herein, we have shown that miR-21 is progressively up-regulated during eosinophil progenitor cell growth. [score:4]
MiR-21 has been found to be over-expressed in allergic diseases with significant eosinophilia [9], [11], [32]. [score:4]
We have previously reported that miR-21 could regulate the immunoinflammatory responses by targeting the IL12/IFNγ pathway [9], [12]. [score:4]
While only one (Psrc1) is a predicted target of miR-21, it is notable that computational analysis identified an overall functional effect in the pathways (e. g. regulation of cell proliferation and cell cycle) associated with the observed phenotype and the known role of miR-21 in other systems [20], [21]. [score:4]
While not experimentally proven, we hypothesize that the up-regulation of Psrc1 could contribute to the decreased growth of miR-21 [−/−] eosinophil progenitors. [score:4]
Data are representative of 3 independent experiments for panels A and C; data are representative of 2 independent experiments for panel B. Eosinophil Cultures Derived from miR-21 [−/−] have Increased Apoptosis Compared to Littermate ControlsMiR-21 has been reported to be pro-proliferative and anti-apoptotic by targeting multiple tumor suppressor genes [20]– [22]. [score:4]
Data are representative of 3 independent experiments for panels A and C; data are representative of 2 independent experiments for panel B. MiR-21 has been reported to be pro-proliferative and anti-apoptotic by targeting multiple tumor suppressor genes [20]– [22]. [score:4]
Our data indicate that miR-21 can directly regulate the development of eosinophils by influencing the growth capacity of eosinophil progenitors. [score:4]
Whole-genome Microarray Analysis of Genes Differentially Regulated between miR-21 [+/+] and miR-21 [−/−] Eosinophil Progenitor CulturesIn order to gain insight into potential molecular mechanisms by which miR-21 regulates eosinophil development, we performed a whole genome microarray analysis at days 4, 8 and 12 of the culture of miR-21 [+/+] and miR-21 [−/−] cells. [score:4]
We have found that miR-21 was among the most up-regulated miRNAs in patients with eosinophilic esophagitis and has the highest correlation with esophageal eosinophil levels [11]. [score:4]
We found up-regulation of miR-21 during the eosinophil differentiation from day 4 to day 14 (Fig. 1B). [score:4]
We also found regulation of inflammatory response as one of the significantly enriched pathways represented by the differentially expressed genes in the miR-21 -deficient eosinophil progenitor cultures (Fig. S2). [score:4]
The Affymetrix Mouse Gene 1.0ST array was used to compare gene expression profile between miR-21 [+/+] and miR-21 [−/−] eosinophil progenitor cultures at day 4, day 8 and day 12. [score:3]
Red: up-regulated in miR-21 [−/−] eosinophil progenitor culture compared to miR-21 [+/+] eosinophil progenitor culture. [score:3]
MiR-21 has been reported to be up-regulated in a variety of disorders with significant eosinophilia including asthma [9], ulcerative colitis [10], and eosinophilic esophagitis [11]. [score:3]
Whole-genome microarray analysis of differentially regulated genes between miR-21 [+/+] and miR-21 [−/−] eosinophil progenitor cultures identified miR-21 -dependent pathways involved in the regulation of cell growth, cell cycle and immunity. [score:3]
These results suggest that miR-21 could have additional roles in regulating the immunoinflammatory responses beyond regulation of the IL12/IFNγ pathway. [score:3]
In order to gain insight into potential molecular mechanisms by which miR-21 regulates eosinophil development, we performed a whole genome microarray analysis at days 4, 8 and 12 of the culture of miR-21 [+/+] and miR-21 [−/−] cells. [score:3]
Given our finding that miR-21 could also affect eosinophil progenitor growth, potential therapeutic interventions targeting miR-21 might have a beneficial role in reducing the levels of eosinophilia in some circumstances. [score:3]
Expression of miR-21 in an ex vivo Culture of Bone Marrow-derived Eosinophils. [score:3]
The miR-21 gene -targeted mice were backcrossed for 5 generations into the C57BL/6 background as previously described [12]. [score:3]
Targeted ablation of miR-21 in the eosinophil progenitor cultures led to decreased growth capacity with an increased level of apoptosis in vitro. [score:3]
Figure S1 Expression level of Pdcd4 in miR-21 [+/+] and miR-21 [−/−] eosinophil progenitor cultures. [score:3]
We analyzed the levels of Pdcd4 and Pten by qRT-PCR and found a modest up-regulation of Pdcd4 mRNA in miR-21 [−/−] eosinophil progenitors compared to miR-21 [+/+] controls (Fig. S1). [score:3]
These results demonstrate that miR-21 has an important role in regulating and fine-tuning the proliferative capacity of eosinophil progenitors. [score:2]
0059397.g005 Figure 5Differentially regulated genes between miR-21 [+/+] and miR-21 [−/−] eosinophil progenitor cultures at day 8 and day 12. [score:2]
In summary, we have identified miR-21 as a regulator of eosinophil progenitor growth. [score:2]
This supports our data that progenitor cell growth under the influence of SCF and FLT-3L is not regulated by miR-21. [score:2]
Table S2 List of differentially regulated genes between miR-21 [+/+] and miR-21 [−/−] eosinophil progenitor cultures at day 12. [score:2]
To determine the role of miR-21 in eosinophil development and function, we utilized a murine ex vivo bone marrow-derived eosinophil culture mo del that generates of >90% eosinophils after 14 days of culture [13]. [score:2]
Table S1 List of differentially regulated genes between miR-21 [+/+] and miR-21 [−/−] eosinophil progenitor cultures at day 8. (PDF) Click here for additional data file. [score:2]
Differentially regulated genes between miR-21 [+/+] and miR-21 [−/−] eosinophil progenitor cultures at day 8 and day 12.. [score:2]
To determine the effect of miR-21 on eosinophil development, we cultured progenitor cells into eosinophils and noted a profound phenotype in cellular growth. [score:2]
Further elucidating and understanding the roles of miR-21 in regulating the levels of eosinophils and in immunoinflammatory responses may lead to novel therapeutic options for eosinophilic disorders. [score:2]
Eosinophil Progenitor Growth in Eosinophil Cultures Derived from miR-21 [−/−]To determine the effect of miR-21 on eosinophil development, we cultured progenitor cells into eosinophils and noted a profound phenotype in cellular growth. [score:2]
However, the function of miR-21 during eosinophil development is not known. [score:2]
Whole-genome microarray analysis of miR-21 [+/+] and miR-21 [−/−] eosinophil progenitor cultures identified regulation of cell growth, cell cycle and immune response as the most significantly affected pathways by miR-21. [score:2]
Ingenuity analysis of the most significant biological functions represented by the differentially regulated genes between miR-21 [+/+] and miR-21 [−/−] eosinophil progenitor cultures. [score:2]
Whole-genome Microarray Analysis of Genes Differentially Regulated between miR-21 [+/+] and miR-21 [−/−] Eosinophil Progenitor Cultures. [score:2]
Levels of apoptosis in the eosinophil progenitor culture from the miR-21 [+/+] and miR-21 [−/−] mice. [score:1]
We also measured the protein level of PSRC1 and found that PSRC1 was up-regulated in miR-21 [−/−] eosinophil progenitor cultures at day 12 compared to miR-21 [+/+] controls (Fig. 5D). [score:1]
Blood eosinophil percentage and bone marrow eosinophil colony forming unit capacity in the miR-21 [+/+] and miR-21 [−/−] mice. [score:1]
The miR-21 [+/+] and miR-21 [−/−] bone marrow derived eosinophils were morphologically indistinguishable from each other at day 12 (Fig. 2C). [score:1]
Growth of eosinophil progenitor cells from miR-21 [−/−] mice and miR-21 [+/+] controls during the ex vivo eosinophil culture. [score:1]
0059397.g002 Figure 2Growth of eosinophil progenitor cells from miR-21 [−/−] mice and miR-21 [+/+] controls during the ex vivo eosinophil culture. [score:1]
Furthermore, miR-21 [−/−] mice have decreased eosinophil colony-forming unit capacity in the bone marrow and decreased eosinophil levels in the blood. [score:1]
To examine the consequences of miR-21 on eosinophil hematopoiesis in vivo, we determined the blood eosinophil level in the miR-21 [−/−] mice. [score:1]
The miR-21 [−/−] mice have decreased eosinophils in the blood and decreased eosinophil colony-forming unit capacity in the bone marrow, in agreement with the observed phenotype in the ex vivo eosinophil cultures. [score:1]
Furthermore, miR-21 [−/−] mice had decreased eosinophil colony-forming unit capacity in the bone marrow (Fig. 4B). [score:1]
0059397.g003 Figure 3Levels of apoptosis in the eosinophil progenitor culture from the miR-21 [+/+] and miR-21 [−/−] mice. [score:1]
We have previously reported that miR-21 also modestly modulates IL-12p35 and that this has a profound effect on modifying the course of immune hypersensitivity responses in vivo [9], [12]. [score:1]
Data are representative of 3 independent experiments for panels A and C; data are representative of 2 independent experiments for panel B. Total cell number of (A) eosinophil and (B) neutrophil cultures derived from miR-21 [+/+] and miR-21 [−/−] mice is shown. [score:1]
Esophageal eosinophil level in an allergen -induced experimental eosinophil esophagitis mo del in miR-21 [+/+] and miR-21 [−/−] mice. [score:1]
Eosinophil Progenitor Growth in Eosinophil Cultures Derived from miR-21 [−/−] Mice. [score:1]
MiR-21 [−/−] have Reduced Eosinophilia in the Blood and Reduced Eosinophil Colony-forming Unit Capacity in the Bone MarrowTo examine the consequences of miR-21 on eosinophil hematopoiesis in vivo, we determined the blood eosinophil level in the miR-21 [−/−] mice. [score:1]
Total cell number of (A) eosinophil and (B) neutrophil cultures derived from miR-21 [+/+] and miR-21 [−/−] mice is shown. [score:1]
The resulting probe sets were then baseline transformed and filtered on at least 1.5-fold difference between miR-21 [+/+] and miR-21 [−/−] eosinophil progenitor cultures. [score:1]
0059397.g006 Figure 6Esophageal eosinophil level in an allergen -induced experimental eosinophil esophagitis mo del in miR-21 [+/+] and miR-21 [−/−] mice. [score:1]
0059397.g004 Figure 4Blood eosinophil percentage and bone marrow eosinophil colony forming unit capacity in the miR-21 [+/+] and miR-21 [−/−] mice. [score:1]
This suggests that the growth of stem/progenitor cells under the influence of SCF and FLT-3L is not dependent on miR-21. [score:1]
[1 to 20 of 73 sentences]
32
[+] score: 204
Furthermore, cell growth analysis was conducted to determine the alterations in cell viability corresponding with the expression level variations of targeted proteins, and we observed that miR-21 overexpression prevent the suppressive impact of 5-fluorouracil (Figure. [score:9]
5-fluorouracil and pirarubicin treatment leads to miR-21 downregulation in HCC cells via inhibiting the expression of AP-1 proteins. [score:8]
Chemotherapeutic drugs exert suppressive effects on HCC progression through regulating miR-21 expression. [score:6]
For example, the correlation between miR-21 expression and the clinicopathological variables in HCC patients is unknown, and it is also unclear whether deregulated miR-21 expression in HCC is a response to HAIC. [score:6]
A and B: miR-21 inhibition in combination with 5-fluorouracil and pirarubicin treatment suppressed HCC xenograft growth. [score:5]
We also investigated whether cisplatin exerted its suppressive effects on HCC cells via inhibiting miR-21 expression. [score:5]
miR-21 suppression combined with 5-fluorouracil and pirarubicin treatment inhibits HCC xenograft growth. [score:5]
C: Modulation of miR-21 targets expression in 5-fluorouracil -treated Hep3b (i), SMMC7721 (ii) cells, and pirarubicin -treated Hep3b (iii), SMMC7721 (iv) cells was performed by transfection with miR-21 mimic. [score:5]
Similarly, we have previously revealed that miR-21 functions as an oncomiR through suppressing the expression of PTEN, PDCD4, and RECK [21]. [score:5]
miR-21 expression is suppressed in HCC cells with 5-fluorouracil and pirarubicin treatment. [score:5]
Figure 2 A and B: miR-21 inhibition in combination with 5-fluorouracil and pirarubicin treatment suppressed HCC xenograft growth. [score:5]
miR-21 expression is suppressed by 5-fluorouracil and pirarubicin in HCC cells. [score:5]
We further generated subcutaneous xenografts by inoculating Hep3b cells with or without miR-21 inhibition to evaluate the antitumor effect of 5-fluorouracil and pirarubicin treatment in vivo, which indicated that miR-21 suppression in combination with 5-fluorouracil and pirarubicin treatment markedly inhibited HCC xenograft growth. [score:5]
5-fluorouracil and pirarubicin suppress HCC cell growth via regulating the miR-21 -mediated program. [score:4]
Based on the fact that HCC patients with low miR-21 levels in tumors had a better response to HAIC treatment with 5-fluorouracil and pirarubicin, we asked whether these two drugs offered a clinical benefit via down -regulating miR-21 expression. [score:4]
Previous studies have demonstrated that the AP-1 transcription factor family is involved in regulating miR-21 expression [27- 28]. [score:4]
We observed that miR-21 inhibition combined with 5-fluorouracil and pirarubicin treatment exerted a dramatically suppressive effect on the tumorigenicity of Hep3b cells in vivo, as compared to all other experimental groups (Figure. [score:4]
5-fluorouracil and pirarubicin treatment lead to miR-21 downregulation through AP-1 proteins. [score:4]
To further probe the correlation between cell phenotypic alterations and drugs -mediated AP-1/miR-21 axis, we performed a rescue assay that increased and then decreased the level of miR-21 targets via drugs treatment in combination with miR-21 overexpression in HCC cells. [score:4]
The correlation between miR-21 and their targets was further validated in Hep3b cells, indicating that PTEN, PDCD4, and RECK were direct effectors of miR-21 in this cell line (Figure. [score:4]
To this aim, we conducted miR-21 suppression in Hep3b cells by using a lentiviral system (Lenti-miR-21-i) (Figure. [score:3]
F: qRT-PCR analysis of miR-21 expression in 4 pairs of HCC samples. [score:3]
Figure 1 A: qRT-PCR analysis of miR-21 expression in 148 pairs of HCC tissues (C) and matched adjacent normal liver tissues (N). [score:3]
Hep3b HCC cells with or without miR-21 inhibition by using lentiviral system (Lenti-miR-21-I and Lenti-scr) were propagated (6 × 10 [6] cells saline/Matrigel (BD Pharmigen San Jose, Ca), 1:1 v/v) and inoculated s. c. into the dorsal flanks of 20 mice (5 for each group as described). [score:3]
In the present study, we demonstrated that 5-fluorouracil and pirarubicin offered chemopreventive effects via inhibiting AP-1 activation, thereby leading to a modification of miR-21 -mediated program in HCC cells. [score:3]
These findings suggest that HCC patients with lower miR-21 expression levels in tumors have a better response to HAIC treatment, especially at the early stages. [score:3]
In doing so, qRT-PCR analysis was conducted to evaluate miR-21 levels in 148 paired HCC samples, which indicated that miR-21 expression were upregulated in the majority of HCC specimens compared with the matched normal liver tissues (Figure. [score:3]
We further investigated whether 5-fluorouracil and pirarubicin exerted their suppressive effect on miR-21 expression at the transcriptional level. [score:3]
Although several reports indicate that miR-21 inhibition lead to an improvement of cisplatin sensitivity[38- 39], our qRT-PCR analysis revealed that cisplatin treated-Hep3b and SMMC7721 cells depicted no significant change in miR-21 levels (Figure. [score:3]
The relationship between miR-21 expression and variable pathological grade was also determined, and no significant differences among well, moderate, and poorly differentiated HCC tissues were found (Figure. [score:3]
We also showed that HCC patients with a longer DFS tended to express lower miR-21 levels in tumors, albeit not to a significant degree (P=0.055). [score:3]
A: qRT-PCR analysis of miR-21 expression in 148 pairs of HCC tissues (C) and matched adjacent normal liver tissues (N). [score:3]
To this aim, 4 HCC specimens (miR-21 -high, 2; miR-21-low, 2) were selected to determine the expression of miR-21 and AP-1 proteins. [score:3]
The analysis revealed that the HCC tissues with augmented AP-1 levels had increased miR-21 expression (Figure. [score:3]
B and C: qRT-PCR analysis was conducted to quantify the expression of miR-21 in Hep3b (B) and SMMC7721 (C) cells following 5-fluorouracil and pirarubicin treatment. [score:3]
Thus, HCC patients were divided into 2 groups, namely, early stage (pTNM I) and advanced stage (pTNM II-IV), based on our correlation analysis between miR-21 expression and pTNM stage. [score:3]
Cut-off values for miR-21 (high/low expression) were determined through ROC analysis. [score:3]
We observed that HCC patients at an early stage with lower miR-21 expression levels had a longer DFS after 5-fluorouracil and pirarubicin treatment via HAIC. [score:3]
Here, we indicated that patients with higher miR-21 expression in tumors tended to relapse, which implied the prognostic significance of miR-21 for predicting the clinical benefit of HAIC with 5-fluorouracil and pirarubicin for HCC treatment. [score:3]
A Kaplan-Meier analysis revealed that lower miR-21 levels were associated with longer disease-free survival (DFS) (P=0.004; Figure. [score:3]
The above findings promoted us to further investigate whether 5-fluorouracil and pirarubicin treatment represented a better suppressive effect on tumor growth of HCC cells with miR-21 inhibition in vivo. [score:3]
A: The correlation between miR-21 and its targets was validated in Hep3b cells via luciferase reporter assay (i) and immunoblots (ii) analysis. [score:2]
The Kaplan-Meier method also indicated that HCC patients with low miR-21 levels in tumors tended to have a longer DFS compared with those with high miRNA-21 expression, although the difference did not reach significance (P=0.055; Figure. [score:2]
Figure 5A: The correlation between miR-21 and its targets was validated in Hep3b cells via luciferase reporter assay (i) and immunoblots (ii) analysis. [score:2]
However, the link between deregulated miR-21 and the prognosis of HCC patients undergoing HAIC has not been established. [score:2]
We observed that miR-21 expression was substantially higher in the tissues of HCC patients who recurred compared with those without recurrence (Figure. [score:2]
Herein, we indentify miR-21 as a potential biomarker for predicting HAIC effects. [score:1]
S2A-C) and the subcutaneous xenografts were generated through inoculating the Hep3b cells infected with Lenti-miR-21-i and Lenti-scr, respectively. [score:1]
To this aim, we first evaluated the expression of miR-21 in several HCC cell lines using qRT-PCR (Figure. [score:1]
Figure 3 A: qRT-PCR analysis was conducted to quantify endogenous miR-21 levels in normal liver (NC), Hep3b, SMMC7721, Huh7, HepG2, and Bel7402 cells. [score:1]
No significant difference between miR-21-low and miR-21 -high groups in HCC patients was found at advanced stages (pTNM stage II, III, and IV; P=0.511; Figure. [score:1]
Because miR-21 has been validated as an oncomiR in hepatocarcinogenesis that leads to drug resistance [21, 24, 26], we investigated whether its expression responded to HAIC treatment. [score:1]
3A), and the IC50 values of these drugs in Hep3b (miR-21 -high) and SMMC7721 (miR-21-low) cells were determined. [score:1]
we further demonstrate that chemotherapeutic drugs have clinical promise for HCC therapy through modulating a critical genetic pathway involving an miR-21 -mediated program. [score:1]
We further conducted Kaplan-Meier analyses on patients with early stage HCC (pTNM stage I) and observed that higher miR-21 levels correlated with shorter DFS in early-stage HCC patients after HAIC (P=0.033; Figure. [score:1]
For example, circulating miR-21 serves as a biomarker for HCC diagnosis [23, 33]. [score:1]
To assess the levels of miR-21, qRT-PCR analysis was conducted by using Taqman probes (Invitrogen, Carlsbad, CA, USA) in the Bio-Rad IQ5 qRT-PCR system according to the manufacturer's instruction. [score:1]
B: The protein levels of miR-21 target proteins in Hep3b and SMMC7721 cells after treatment with 5-fluorouracil (i) or pirarubicin (ii) as measured through immunoblot analysis. [score:1]
B: HCC patients with high levels of miR-21 tended to recur after HAIC treatment. [score:1]
Collectively, these findings indicate that chemotherapy has a clinical benefit against HCC through modifying the AP-1/miR-21 -mediated axis (Figure. [score:1]
C: Kaplan-Meier survival curves for DFS of HCC patients (i), HCC patients at the early stage (ii) and the advanced stage (iii) in relation to miR-21. [score:1]
In-depth clinicopathological analysis was conducted on 109 patients with detailed information selected from the aforementioned HCC tissues, which showed that high miR-21 levels correlated with a more aggressive tumor phenotype (P<0.001) and more extensive invasion (P=0.03) (Figure. [score:1]
miR-21 is a potential predictor of HAIC treatment with 5-fluorouracil and pirarubicin for HCC patients. [score:1]
miR-21 is a potential predictor of HAIC treatment for HCC patients. [score:1]
To assess the levels of pri-miR-21 and AP-1 components in tested HCC cells, qRT-PCR analysis was conducted by using Taqman probes (Invitrogen, Carlsbad, CA, USA) in the Bio-Rad IQ5 qRT-PCR system according to the manufacturer's instruction. [score:1]
miR-21 could function as a potential biomarker for predicting the prognosis of HCC patients receiving HAIC treatment. [score:1]
To further characterize the related genetic pathway affected by 5-fluorouracil and pirarubicin involving the miR-21 -mediated program in HCC cells, we examined the associated target genes including p-AKT, AKT, p-GSK3β, GSK3β, cyclin D1, cyclin E1, CDK2, and CDK4. [score:1]
Taken together, our findings indicate that HAIC prevention using 5-fluorouracil and pirarubicin has clinical promise for HCC patients through modulating the AP-1 and miR-21 axis. [score:1]
These findings imply that miR-21 is a candidate for HCC prognosis and therapy. [score:1]
Altogether, these data provide the evidence that 5-fluorouracil and pirarubicin have clinical benefits through modulating the AP-1/miR-21 axis in HCC. [score:1]
Various reports focusing on miR-21 have indicated a crucial role for this oncomiR in hepatocarcinogenesis [21- 22] and demonstrate the extensive association of miR-21 with HCC prognosis and therapy [23- 24]. [score:1]
Increasing evidence clearly demonstrate that miR-21 not only is a crucial tumor promoter in hepatic tumorigenesis but also functions as a prognostic factor in HCC patients[21- 22, 31]. [score:1]
F: 5-fluorouracil and pirarubicin have clinical benefit for HCC treatment through modulating the AP-1 and miR-21 -mediated axis. [score:1]
The miR-21 -mediated program is modified by 5-fluorouracil and pirarubicin treatment in HCC cells. [score:1]
A: qRT-PCR analysis was conducted to quantify endogenous miR-21 levels in normal liver (NC), Hep3b, SMMC7721, Huh7, HepG2, and Bel7402 cells. [score:1]
[1 to 20 of 75 sentences]
33
[+] score: 198
The major findings of our study are as follows: firstly, we demonstrated that antagomir-21 could down-regulate the miR-21 expression in 4T1 cells and HUVECs; secondly, we found that antagomir-21 could suppress 4T1 cells proliferation in vitro and in vivo; thirdly, antagomir-21 induces 4T1 cells and HUVECs apoptosis via targeting PTEN. [score:10]
Accordingly, we also found that, compared with control the expression of miR-21 was up-regulated with mimic transfection and down-regulated with antagomir-21 transfection in 4T1 cells and HUVECs (P<0.05), while the antagomir-21 scramble had no effect on miR-21 expression (P>0.05) (Figure 2A and 2B). [score:10]
Moreover, we confirmed that antagomir-21 could suppress miR-21 expression in breast tumor tissues, which is involved in inhibiting angiogenesis by targeting HIF-1α/VEGF/VEGFR2 signaling pathway in breast cancer. [score:9]
Down-regulation of miR-21 with antagomir-21 inhibits angiogenesis through targeting HIF-1α/VEGF/VEGFR2 signaling pathway. [score:8]
Concomitantly, the production of PTEN was enhanced by miR-21 down-regulation, contrarily the expression of HIF-1α, VEGF and VEGFR2 were markedly decreased by antagomir-21, while the scramble could not produce the same effects in angiogenesis inhibition (Figure 7B–7E). [score:8]
Down-regulation of miR-21 expression in 4T1 cells and HUVECs increased PTEN and Caspase-3 expression. [score:8]
The above results reveal that down-regulation of miR-21 with antagmir-21 inhibits angiogenesis in breast tumor via targeting HIF-1α/VEGF/VEGFR2 -associated signaling pathway. [score:8]
From our data, knockdown of miR-21 expression with antagomir-21 treatment could obviously suppress proliferation and induce apoptosis via targeting PTEN in 4T1 cells and HUVECs. [score:8]
Knockdown of miR-21 expression inhibits angiogenesis of breast tumors. [score:6]
In addition, Liu and his cooperators proved that down-regulation of miR-21 can decrease the expression of VEGF in prostate tumor [16]. [score:6]
For knockdown of miR-21, chemically modified antagomir-21 was used to inhibit miR-21 expression. [score:6]
These data suggest that suppression of miR-21 expression in breast tumor likely increases tumor cell apoptosis, supporting the notion that antagomir-21 has a therapeutic potential. [score:5]
However, the expression of miR-21 could not be suppressed by scramble treatment (Figure 7A). [score:5]
Knockdown of miR-21 in MCF-7 cells could markedly suppress tumor proliferation and metastasis, indicating that miR-21 plays an important role in breast tumor development [13]. [score:5]
Liu and his cooperators demonstrated that inhibition of miR-21 can decrease HIF-1α and VEGF proteins expression in prostate cancer cells [16]. [score:5]
Two weeks after antagomir-21 treatment, using qRT-PCR assay, we found that miR-21 expression was markedly inhibited by antagomir-21 relative to control. [score:4]
Recently, miR-21 has been demonstrated to modulate apoptosis in HUVECs by down-regulation of PTEN [17]. [score:4]
Taken together, these data suggest that down-regulation of miR-21 may play pro-apoptotic effect both in 4T1 cells and HUVECs. [score:4]
In Figure 2C and 2D, the data showed that knockdown of miR-21 with antagomir-21 induced overexpression of PTEN both in 4T1 cells and HUVECs (P<0.01), while scramble could not play the same role (P>0.05). [score:4]
Knockdown of miR-21 with Antagomir-21 Inhibits Tumor Angiogenesis through Immunofluorescence Analysis. [score:4]
For up-regulation of miR-21, the cells were transfected with miR-21 mimic (GenePharma Co. [score:4]
In our study we also found that miR-21 is involved in regulating apoptosis in 4T1 cells and HUVECs via targeting PTEN. [score:4]
Down-regulation of miR-21 with Antagomir-21 induces Tumor Cell Apoptosis. [score:4]
Recently, miR-21 was demonstrated to attenuate apoptosis of HUVECs by down-regulation of PTEN [17]. [score:4]
To knockdown the expression of miR-21 in tumor in VEGFR2-luc transgenic mouse mo del, intratumor injections were processed with antagomir-21 or scramble through a 26-gauge needle (50 mg/kg antagomir-21 or scramble dissolved in 100 µL mixed solution) according to the manufacturer’s instructions. [score:4]
In addition, recent evidence from breast cancer studies indicated that inhibition of miR-21 level leads to a significant decrease in tumor growth and an increase in Caspase activity [31]. [score:3]
0071472.g002 Figure 2Expression of miR-21 was showed in 4T1 cells (A) and HUVECs (B) that transfected with miR-21 mimic, antagomir-21, or scramble. [score:3]
This study indicated that manipulation of the expression of miR-21 represents a promising therapeutic strategy for breast cancer. [score:3]
0071472.g007 Figure 7(A)Expression levels of miR-21 in tumors treated with miR-21 mimic, antagomir-21 or scramble. [score:3]
Proteins expression in normal cells, cells transfected with miR-21 mimic, antagomir-21 or scramble were examined by Western blotting. [score:3]
Expression of miR-21 was showed in 4T1 cells (A) and HUVECs (B) that transfected with miR-21 mimic, antagomir-21, or scramble. [score:3]
MiR-21 has been demonstrated to play a role in regulating cell apoptosis through modulating target genes as Bcl-2 and PDCD4 [12]. [score:3]
MiR-21 has been shown to post-transcriptionally regulate the expression of the pro-apoptotic gene PTEN in human hepatocellular cancer [23]. [score:3]
Treated with antagomir-21, not scramble, the miR-21 expression was reduced significantly in tumor-bearing mouse mo del relative to control group (Figure 7A). [score:3]
Among the different genes reported to be targets of miR-21, PTEN has been identified as one angiogenesis modulator [14]. [score:3]
Oligo Transfection, miR-21 Knockdown in Cultured Murine 4T1 Cells and HUVECs. [score:2]
Recently, more attention is focused on the function of miR-21 in angiogenesis during tumor development. [score:2]
Knockdown of miR-21 by Antagomir-21 Decreases Cell Proliferation and Induces Apoptosis in 4T1 Cells and HUVECs. [score:2]
In our study, we also found that knockdown of miR-21 with angatomir-21 could induce apoptosis both in 4T1 cells and HUNECs. [score:2]
Thus, blocking the action of miR-21 in breast tumor development implies tremendous therapeutic value. [score:2]
In addition, the TUNEL staining results showed that transfection with miR-21 antagomir, but not with mimic, increased the percentage of TUNEL -positive cells both in the 4T1 cells and HUVECs, suggesting that miR-21 may play anti-apoptotic effect both in 4T1 cells and HUVECs (P<0.05) (Figure 1C–1F). [score:1]
Furthermore, the data showed that PTEN and Caspase-3 were decreased in miR-21 mimic treatment group only in 4T1 cells (P<0.05) (Figure 2C and 2E). [score:1]
Taken together, these data support that miR-21 is closely related to tumor angiogenesis, which prompts us to disclose the underlying role of miR-21 in breast angiogenesis and tumor growth. [score:1]
However, few investigations have been focused on the role of miR-21 and its target genes in breast tumor angiogenesis. [score:1]
Opti-MEM medium was replaced 4 h post-transfection with the regular culture medium and incubated for another 48 h. 4T1 cells and HUVECs were plated in 96-well plates and transfected with miR-21 mimic, antagomir-21, and scramble respectively for 4 h. After the transfection, the serum-free medium was removed and cells were cultured with regular culture medium for another 48 h. To monitor cell survival, 4T1 cells and HUVECs in each well were incubated for 4 h with 0.5 mg/mL of MTT (Sigma). [score:1]
The 4T1 cells and HUVECs viability determined by MTT analysis were reduced significantly in cells upon transfection with miR-21 antagomir (P<0.05), but not with the miR-21 mimic and scramble, which did not affect the viability of 4T1 cells or HUVECs (P>0.05) (Figure 1 A and 1B). [score:1]
The SYBR Green PCR Master Mix Kit (Applied Biosystems) was used in qRT-PCR to quantify the level of miR-21, with U6 as an internal control. [score:1]
The effect of miR-21 antagomir on the cell proliferation and apoptosis. [score:1]
We evaluated whether miR-21 contributes to 4T1 cells or HUVECs survival by blocking its expression with a specific antagomir. [score:1]
We firstly performed experiments in vitro to demonstrate the anti-apoptotic role of miR-21 in 4T1 cells and HUVECs. [score:1]
MiR-21 is one of the well characterized miRNAs, which is overexpressed in many kinds of tumors, especially in breast tumor [12]. [score:1]
[1 to 20 of 51 sentences]
34
[+] score: 187
Other miRNAs, such as miR-23a, miR-31, miR-132, or miR-16, were also significantly downregulated with cardamonin treatment for 24 h compared to that of treatment for 3 h. Since most of miRs have been downregulated and miR-21 was strongly suppressed by cardamonin, we used miR-21 mimics and miR-21 inhibitors to test the function of cardamonin on HUVECs. [score:10]
When miR-21 expression was decreased by transfection of miR-21 inhibitors, the migration inhibition was further downregulated by another 12.6%. [score:10]
Results indicated that treatment with miR-21 mimics abrogated the cardamonin -mediated inhibition of HUVEC proliferation, migration, and angiogenesis, while treatment with miR-21 inhibitors aggravated the cardamonin -mediated inhibition of HUVEC proliferation, migration, and angiogenesis, indicating that miR-21 might play a vital role in cardamonin -induced inhibition of angiogenesis triggered by VEGF. [score:9]
Inhibitory Effect of Cardamonin on Tube Formation in HUVECs Associated with Downregulation of the Expression of miR-21. [score:8]
Inhibitory Effect of Cardamonin on Endothelial Migration in HUVECs Associated with Downregulation of the Expression Level of miR-21. [score:8]
In our present study, we found VEGF could upregulate miR-21 expression, and overexpression miR-21 could significantly enhance VEGF -induced HUVEC migration and tube formation, which confirmed the importance of miR-21 on angiogenesis. [score:8]
Because cardamonin caused downregulation of miR-21, we hypothesized that this inhibition was associated with the expression of miR-21. [score:8]
These data reconfirmed that cardamonin inhibits tube formation in HUVECs associated with downregulation of the expression of miR-21. [score:8]
To understand the effect of miR-21 on HUVECs migration, miR-21 mimic and miR-21 inhibitor were transfected; the results indicated that miR-21 overexpression can significantly increase HUVECs migration (118.2%) induced by VEGF; otherwise, HUVECs migration was remarkably inhibited by 26.4%, which confirmed the importance of miR-21 on HUVECs migration. [score:7]
As shown in Figure 1, expression of miR-21 of HUVECs was augmented when cells were transfected with 30 nM miR-21 mimics, while expression of miR-21 was significantly reduced when transfected with 30 nM miR-21 inhibitors. [score:7]
However, cardamonin treatment alone could also significantly suppress the formation of capillary-like structures by HUVECs, as compared to VEGF treatment alone, and cardamonin cotreatment with miR-21 inhibitor could further inhibit tube formation, and this could be remarkably reversed by cotreatment cardamonin with miR-21 mimic. [score:6]
When miR-21 expression was upregulated by mimic treatment, the mobility of HUVECs increased significantly by 15.4%. [score:6]
3.1. miR-21 Expression Was Downregulated in HUVECs Induced by VEGF after Cardamonin Treatment. [score:6]
Neither the miR-21 mimic NC nor miR-21 inhibitor NC had a significant effect on the regulation of cardamonin -inhibited HUVECs mobility (Figure 3). [score:6]
These data suggested that cardamonin inhibited HUVECs by downregulation of miR-21. [score:6]
Neither the miR-21 mimic NC nor the inhibitor NC had a significant effect on the regulation of cardamonin -inhibited tube formation (Figure 4). [score:6]
Cells were allowed to grow for 24 h after being transfected with miR-21 mimic, miR-21 mimic negative control (NC), miR-21 inhibitor, and miR-21 inhibitor NC RNAs and the monolayers of HUVECs were scratch-wounded to a 1 mm depth in a straight line using a 10  μL pipette-tip when cells were at 70–80% confluence. [score:5]
Cardamonin-Mediated Inhibition of HUVECs Proliferation through the Expression of miR-21. [score:5]
To test whether the inhibitory effect was associated with miR-21, miR-21 inhibitor was added together with cardamonin. [score:5]
To test whether cardamonin' inhibitory effect could be stopped by increasing the expression of miR-21, miR-21 mimic was given together with cardamonin. [score:5]
Herein, we found for the first time that miR-21 was downregulated strikingly after treatment with cardamonin (50  µM) in a time dependent manner. [score:4]
Guduric-Fuchs et al. reported that downregulation of miR-21 reduced the proliferation, migration, and tube-forming capacity of retinal microvascular endothelial cells (RMECs) [30]. [score:4]
Zhao et al. evidenced that miR-21 can mediate arsenite induced HUVEC upregulation VEGF and promote angiogenesis [31]. [score:4]
Lower expression level of miR-21 caused a significantly stronger inhibition of HUVECs proliferation by 57.8% compared with cardamonin alone. [score:4]
HUVECs in 96-well plate were transfected with miR-21 mimic, miR-21 mimic negative control, miR-21 inhibitor, and miR-21 inhibitor NC and were allowed to grow for 24 h. After medium was changed, VEGF (8 ng/mL) [14] was added into the wells with or without 50  µM cardamonin except for the control group, and the incubation was continued for another 24 h. Cell proliferation was assayed by 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega, Beijing, China) test according to the manufacturer's protocol. [score:4]
As noted, miR-21 was suppressed the most among these 11 miRs (with 58% inhibition compared with VEGF alone) (Table 2). [score:4]
Transfection with miR-21 mimic significantly stimulated the formation of capillary-like structures, when compared to VEGF treatment alone, and this action was significantly suppressed by transfection with miR-21 inhibitor alone; these data suggested that miR-21 plays an important role during angiogenesis. [score:4]
Transfection with miR-21 Mimics or Inhibitors Aggravates or Attenuates the Intracellular Level of miR-21. [score:3]
The excessive expression of miR-21 induced by transfection of miR-21 completely eliminated cardamonin's action and showed a higher proliferation above its basal level (stimulated by VEGF). [score:3]
Concerning the mechanism of cardamonin on antiangiogenesis, miR-21 mimics and inhibitors were transfected on HUVEC. [score:3]
As miR-21 is frequently overexpressed in human cancers and acts as oncogene and is involved in promoting cell proliferation, invasion, and migration [27– 29], it may also play pivotal role in endothelial cell proliferation and migration and influence angiogenesis. [score:3]
miR-21 inhibitors or miR-21 mimics, obtained from Ambion (Austin, Texas, USA), were transfected into HUVECs with the Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, California, USA) at a final concentration of 30 nM. [score:3]
We selected 14 of these miRs which might have been involved in regulation of angiogenesis, including miR-17-5p, miR-19a, miR-23a, miR-24, miR-31, miR-34a, miR-126, miR-130a, miR-132, miR-16, miR-21, miR-217, miR-221, and miR-378 for our study. [score:2]
Thus, the interactions between miR-21 and AKT and ERK pathways require further study. [score:1]
It is suggested that miR-21 induces angiogenesis and promotes carcinoma progression through AKT and ERK pathways [35, 36]. [score:1]
To investigate whether the inhibitory effects of cardamonin is associated with miR-21 expression, we evaluated the effects of cardamonin on VEGF -induced tube formation in HUVECs after being transfected with miR-21 mimic. [score:1]
[1 to 20 of 36 sentences]
35
[+] score: 182
Other miRNAs from this paper: hsa-mir-21, mmu-mir-21b, mmu-mir-21c
Our data suggest that it would be useful to carry out further studies of the biomarker potential of MIR21 as a guide treatment with HSP90 inhibitors, as well as to pursue the combination of HSP90 inhibitors with MIR21 inhibitors in CCA. [score:7]
We tested the effects of HSP90 inhibitors on cells with disruption of the MIR21 gene, cells incubated with MIR21 inhibitors, and stable cell lines with inducible expression of MIR21. [score:7]
Transgenic expression of DNAJB5 in CCA cells that overexpressed MIR21 re-sensitized them to HSP90 inhibitors. [score:7]
In parallel, PDOs derived from a colorectal cancer patient with low endogenous expression of MIR21 were characterized (personal data) and tested against AUY922 before and after MIR21 expression, confirming the relationship between miRNA expression and sensitivity to HSP90 inhibition (Supplementary Figure 5). [score:7]
Supplementary Figure 3(A) miR-21 KO DLD-1 cells were stably infected with a Tet-on TRIPZ vector enabling over -expression of miR-21 and RFP, or a control (CTRL) empty vector expressing RFP. [score:5]
Interestingly, enforced expression of DNAJB5 in MIR21 over -expressing cells re-sensitized CCLP cells to AUY922 (Figure 3 E), confirming that DNAJB5 may be a mediator of MIR21 -induced resistance. [score:5]
MIR21 expression was confirmed to be inactivated in the tumor after withdrawal of doxycycline diet, while an increase in DNAJB5 protein expression was detected (Figure 6 D). [score:5]
CCA cells that expressed transgenic MIR21 were more resistant to HSP90 inhibitors than cells transfected with control vectors; inactivation of MIR21 in these cells restored sensitivity to these agents. [score:5]
Despite a general over -expression of MIR21 in cancer tissues, it is known that MIR21 is remarkably over-expressed in a proportion of cancer patients and may therefore serve as a valuable biomarker. [score:5]
Interestingly, we noticed that MIR21 expression reflected the sensitivity of CCA cells to AUY922, as cell lines with high levels of MIR21 expression had higher GI [50] values for AUY922 (Figure 2 C). [score:5]
Western blot analysis confirmed induction of DNAJB5 upon AUY922 treatment and reduction in DNAJB5 expression in MIR21 over -expressing cells (Figure 3 C), and a luciferase reporter assay confirmed a direct interaction between MIR21 and the 3’UTR of DNAJB5 (Figure 3 D). [score:5]
Sensitivity of patient-derived organoids to HSP90 inhibitors, in culture and when grown as xenograft tumors in mice, depended on expression of miRNA21. [score:5]
To validate the relationship between MIR21 expression and AUY922 sensitivity, we conducted a high-throughput compound screen in R KO cells that had been engineered to knock out the MIR21 locus (MIR21 KO) and parental isogenic wild type (WT) cells. [score:4]
Sensitivity to AUY922 was significantly increased in CCA cells transfected with a locked nucleic acid MIR21 inhibitor compared with those transfected with a negative control locked nucleic acid inhibitor (Figure 2 D). [score:4]
HSP90 inhibitors may be promising in the treatment of cholangiocarcinoma that do not express high levels of microRNA21. [score:4]
miRNA21 appears to mediate resistance of CCA cells to HSP90 inhibitors by reducing levels of DNAJB5. [score:3]
After 72 hours, doxycycline was removed to deactivate MIR21 expression (indicated by grey area). [score:3]
miR-21 expressing cells were more resistant to AUY922. [score:3]
[40] A number of HSP90 inhibitors produced a larger reduction in cell viability in MIR21 KO cells in comparison with WT cells (Supplementary Figure 2 A), with AUY922, 17-AAG, 17-DMAG, and ganetespib showing the highest activity. [score:3]
When treated with HSP90 inhibitors, MIR21 KO R KO cells were more sensitive than WT R KO cells (Supplementary Figure 2 B). [score:3]
[34] Thus, circulating MIR21 may represent an easily accessible tool for the identification of patients likely to benefit from treatment with HSP90 inhibitors. [score:3]
To validate the role of MIR21 in driving resistance to HSP90 inhibition, we infected MIR21 KO DLD-1 cells with an inducible MIR21 or control (CTRL) viral vector (Supplementary Figure 2 F) and monitored their response to AUY922. [score:3]
Sensitivity of cells to HSP90 inhibitors correlated inversely with baseline level of MIR21. [score:3]
MIR21 was previously shown to modulate cytotoxic drug response [58] and is predicted to target genes that act as client proteins for HSP90. [score:3]
Figure 3DNAJB5 is a target of MIR21. [score:3]
Cells were exposed to doxycycline to induce miR-21/CTRL and RFP expression that were under the same promoter. [score:3]
In line with previous data, CCLP cells with enforced expression of MIR21 were significantly more resistant to AUY922 than cells transfected with the CTRL vector. [score:3]
To ascertain if these results could be extended to CCA, we generated Tet-on inducible clones for the over -expression of MIR21 in the CCLP cell line (Figure 2 E). [score:3]
Mice were treated with AUY922 or vehicle while changes in their diet were applied to modulate the expression of MIR21. [score:3]
MIR21 was shown to target the DnaJ heat shock protein family (Hsp40) member B5 (DNAJB5). [score:3]
MIR21 as Driver of Resistance to HSP90 Inhibitors. [score:3]
[60] We observed that MIR21 can drive tumor cell proliferation in the presence of HSP90 inhibitors. [score:3]
Figure 5Sensitivity of CCA PDOs to HSP90 inhibition with and without MIR21 modulation. [score:3]
Disruption of MIR21 increased cell sensitivity to HSP90 inhibitors. [score:3]
We speculate that MIR21 can interfere with this balance and thus, with the HSP90 -mediated activation of client proteins, by modulating the expression of HSP40. [score:3]
CCA PDOs were sensitive to AUY922 (Figure 5 F, G), and this sensitivity was significantly enhanced after inducible inhibition of MIR21 (Figure 5 H, I). [score:3]
Enforced expression of MIR21 significantly increased resistance to AUY922 (P < . [score:3]
RFP+ cells represented cells that over-expressed miR-21, while RFP- (bright-field) cells represented miR-21 KO cells. [score:3]
HSP90 inhibitors might be developed for the treatment of CCA and miRNA21 might be a marker of sensitivity to these agents. [score:3]
After 72 hrs doxycycline was removed to deactivate miR-21 expression. [score:3]
[39] In addition, there is evidence that levels of circulating MIR21 can define the prognosis of cancer patients and may act as surrogate for miRNA expression in the tumour. [score:3]
Correlation Between MIR21 Expression and Sensitivity to AUY922 in PDOs and PDO-derived Tumor Xenografts. [score:3]
Baseline miR-21 expression is higher in R KO compared to DLD-1 WT cells. [score:2]
miR21 expression was assessed by Taqman assays and normalized to that of RNU48. [score:2]
Next, we generated CCA PDO-derived tumor xenografts by inoculating Tet-on MIR21 PDOs in the flank of NOD scid gamma mice. [score:1]
Interestingly, we could detect no difference in the sensitivity to AUY922 in WT and MIR21 KO DLD1 cells, which is consistent with the lower baseline level of MIR21 in DLD-1 cells and their likely lower dependence on MIR21 (Supplementary Figure 2 D). [score:1]
DNAJB5 is a Mediator of MIR21 -dependent Resistance to AUY922. [score:1]
1, 4, 30, 31, 32, 33, 34, 35, 36, 37 MIR21 is an oncogenic miRNA that drives CCA pathogenesis and sensitization to conventional chemotherapy drugs. [score:1]
Levels of microRNA 21 (MIR21 or miRNA21) are increased in CCAs. [score:1]
Representative pictures of in situ hybridization for MIR21 and IHC for DNAJB5 are shown. [score:1]
Correspondingly, the GI [50] for AUY922 was found to be 35 nmol/L in WT cells and 17 nmol/L in MIR21 KO cells (Supplementary Figure 2 C). [score:1]
In silico analysis of the DNAJB5 sequence revealed a binding site for MIR21 within its 3’UTR (Figure 3 B). [score:1]
One hundred μL of matrigel containing approximately 20,000 small MIR21 TRIPZ organoids were injected subcutaneously in the flank of 6- to 7-week-old NOD scid gamma animals (Charles River Laboratories, Wilmington, MA) while they were kept on doxycycline diet (LabDiet 5053 w/1250 ppm doxycycline blue; LabDiet, St. [score:1]
Supplementary Figure 4EGI-1 cells were infected with miR-21 or CTRL TRIPZ viral vector to generate inducible stable clones. [score:1]
Linear fold change of MIR21 vector relative to CTRL vector is 0.89 for HSP60, 0.88 for HSP70, and 0.52 for HSP40. [score:1]
To gain insight into the relationship between MIR21 and the HSPs, we measured the expression levels of a panel of HSPs and co-chaperones in Tet-on MIR21 vector CCLP cells treated with AUY922. [score:1]
We have shown here that MIR21 drives resistance both in CCA and in non-CCA carcinoma cells. [score:1]
Indeed, in co-culture with non-infected MIR21 KO DLD-1 cells, MIR21 -induced DLD-1 cells could proliferate in the presence of AUY922 (Supplementary Figure 3 B and Supplementary Video 2). [score:1]
Indeed, DLD-1 WT cells were more sensitive to AUY922 than R KO WT, while silencing of MIR21 in R KO cells restored their sensitivity (Supplementary Figure 2 E, F). [score:1]
We investigated whether miRNA21 mediates resistance of CCA cells and organoids to HSP90 inhibitors. [score:1]
38, 39 Thus, we investigated if MIR21 could be used as a biomarker of response to HSP90 inhibition in CCA. [score:1]
[1 to 20 of 61 sentences]
36
[+] score: 181
Other miRNAs from this paper: mmu-mir-21b, mmu-mir-21c
The results of the present study suggest that miR-21 overexpression can upregulate CD13, Ep-CAM, CD90, and OCT4 expression. [score:8]
Inhibiting miR-21 expression increases sensitivity to chemotherapy and inhibits colony-forming ability. [score:7]
CSC marker expression may regulate the expression and activity of miR-21, thereby reinforcing the stem cell phenotype. [score:6]
Previous work showed that miR-21 can promote tumor spread by upregulating the expression of phosphatase and tensin homolog (PTEN), programmed cell death 4 (PDCD4) protein, and reversion-inducing cysteine-rich protein with Kazal motifs (RECK) [22]. [score:6]
Fig. 2Expression of LCSC markers in an MHCC-97H cell line stably overexpressing miR-21 cells. [score:5]
LCSCs, like other CSCs, have been shown to express higher levels of miR-21 than bulk HCC cells [21], and studies in which LCSCs were transfected with an miR-21 mimic or inhibitor suggest that miR-21 drives HCC recurrence and metastasis [22]. [score:5]
We found that miR-21 overexpression was associated with increases in expression of these markers and of the LCSC markers CD13 and OCT4. [score:5]
Expression of the four corresponding proteins was also significantly higher in miR-21 -overexpressing cells (p < 0.05; Fig.   2b). [score:5]
Our observation that miR-21 overexpression leads to faster tumor growth in a nude mouse xenograft mo del is consistent with a report that inhibiting miR-21 in pancreatic CSCs substantially decreased the growth of pancreatic tumor xenografts [42]. [score:5]
Expression of the LCSC markers CD13, Ep-CAM, CD90, and OCT4 was significantly higher in the miR-21 -overexpressing cell line than in the negative control at both mRNA and protein levels. [score:5]
Here, we confirm and extend previous work in isolated LCSCs by showing that overexpression of miR-21 in the HCC cell line MHCC-97H directly affects numerous functional characteristics of LCSCs, providing mechanistic insight into the events that may drive HCC recurrence and suggesting a potential therapeutic target. [score:4]
The miR-21 -overexpressing cell line formed larger, tighter, and more numerous spheroids In Transwell assays, miR-21 -overexpressing cells showed greater migration and invasion ability than the negative control cells. [score:4]
Recent studies have shown that microRNA-21 (miR-21) is expressed at higher levels in various CSCs than in the corresponding bulk tumor cells and that it influences CSC behavior [20]. [score:3]
Indeed, inhibiting miR-21 in MHCC-97H cells reduced these abilities [41]. [score:3]
Overexpression of miR-21 strengthens the phenotype of LCSCs, facilitating invasion, migration, and tumorigenesis in hepatocellular carcinoma. [score:3]
Liver cancer stem cells (LCSCs) have been shown to express higher levels of microRNA-21 (miR-21). [score:3]
Fig. 1An MHCC-97H cell line stably overexpressing miR-21 was selected and cultured in the presence of puromycin (magnification, ×200). [score:3]
The effects of miR-21 overexpression were also examined in tumors in nude mice. [score:3]
Fig. 3Overexpression of miR-21 promotes spheroid formation. [score:3]
Our observation that miR-21 overexpression increases the ability of MHCC-97H cells to invade and metastasize echoes a report that transfecting SMMC-7721 cells with an miR-21 analog markedly enhanced their invasion and metastasis abilities. [score:3]
The resulting pBABE-puro-pre-miR-21 was used to create an MHCC-97H cell line stably overexpressing miR-21 (Fig.   1). [score:3]
The expression construct pBABE-puro-pre-miR-21 was transformed into E. coli DH5. [score:3]
We then analyzed in vitro the effects of constitutive miR-21 overexpression on the expression of various LCSC markers (CD13, Ep-CAM, CD90, OCT4) as well as on several LCSC functional characteristics (spheroid formation, invasion, migration). [score:3]
miR-21 increased the expression of LCSC markers. [score:3]
a Representative xenograft tumors grown for 34 days using MHCC-97H cells stably overexpressing miR-21 or the corresponding negative control (NC) cells. [score:3]
g Relative expression of miR-21 was determined by RT-PCR. [score:3]
An HCC cell line stably overexpressing miR-21. [score:3]
That work further showed that miR-21 overexpression can induce the appearance of colorectal CSCs. [score:3]
The hepatocellular carcinoma cell line MHCC-97H was stably transformed with a retroviral vector to establish cells overexpressing miR-21, while a cell line transformed with empty vector served as a negative control. [score:3]
These results indicate that miR-21 overexpression strengthened the LCSC phenotype. [score:3]
Tumors were visible after 5 days in both groups of mice, but tumors from cells overexpressing miR-21 grew significantly faster (Fig.   5b). [score:3]
An MHCC-97H cell line was constructed that stably overexpresses miR-21 at 7.78 ± 1.51-fold higher levels than the negative control cell line. [score:3]
RT-PCR analysis showed that miR-21 expression was 7.78 ± 1.51-fold higher in the miR-21 -transfected cultures than in the negative control cultures (p < 0.05). [score:3]
Fig. 4Overexpression of miR-21 promotes cell migration and invasion. [score:3]
Sphere morphology was analyzed in detail using light microscopy, which showed that miR-21 -overexpressing cells formed tighter, larger, more numerous, and more confluent spheres (Fig.   3). [score:3]
To complement these in vitro studies, we examined the effects of miRNA-21 overexpression on tumorigenicity in nude mice. [score:3]
a, b MHCC-97H cell line stably overexpressing miR-21 and the corresponding negative control (NC) cell line were induced to form spheroids for 14 days. [score:3]
Similarly, silencing trans-expressed miR-21 in isolated LCSCs reduced their migration and invasion [22]. [score:3]
104.8 ± 6.5, p < 0.001), and the relative number of cells that invaded through the extracellular matrix coating was significantly higher for the miR-21 -overexpressing cultures (107.3 ± 2.3) than for the negative control cultures (56.7 ± 2.5, p < 0.001; Fig.   4). [score:3]
Future studies should aim to determine the full range of target genes affected by miR-21, since this may help clarify the complex literature on risk factors of HCC recurrence. [score:3]
Fig. 5Overexpression of miR-21 promotes the growth of subcutaneous xenograft tumors in nude mice. [score:3]
Overexpression of miR-21 was associated with greater cell migration and invasion. [score:3]
a- d Transwell migration and Matrigel invasion assays were carried out using MHCC-97H cells stably overexpressing miR-21 or the corresponding negative control (NC) cells. [score:2]
Here, we examine the possible contributions of miR-21 to the phenotype of LCSCs in culture and in xenograft tumors in nude mice. [score:1]
These studies were performed on isolated LCSCs, leaving open the question of whether overexpression of miR-21 strengthens stem cell-like characteristics in a hepatocellular carcinoma cell line, which may provide an excellent in vitro system for studying processes that occur in postoperative HCC patients. [score:1]
Quantitative real-time reverse transcription-PCR (RT-PCR) to measure expression of miR-21 and CSC marker genes. [score:1]
b The levels of CD13, Ep-CAM, CD90, and OCT4 protein in the miR-21 -overexpressing cell line and corresponding negative control (NC) line were measured using Western blotting. [score:1]
miR-21 increased clonogenicity. [score:1]
Mean tumor volume at the end of the 34-day observation period was 773.62 ± 163.46 mm [3] in the miR-21 group and 502.79 ± 33.94 mm [3] in the negative control group (p = 0.048), while the corresponding mean weights were 0.422 ± 0.019 g and 0.346 ± 0.006 g (p = 0.003, Table  2 and Fig.   5c), respectively. [score:1]
RT-PCR and Western blotting were used to evaluate the effects of miR-21 overexpression on the expression of various LCSC markers, a Transwell assay was used to assess the effects on cell migration and invasion, and a spheroid formation assay was used to examine the effects on clonogenesis. [score:1]
The analysis of PCR reactions on 1.0 % agarose showed the desired 589-bp miR-21 amplicon, which was digested with BamHI and SalI for insertion into the retroviral vector. [score:1]
In another study, colorectal cancer cells were stably transfected with miR-21 plasmid and subcutaneously injected into female SCID mice [43]. [score:1]
The number of migrating cells measured in randomly selected fields of the Transwell culture insert was significantly higher with the miR-21 -overexpressing cultures than the negative control cultures (210.3 ± 5.8 vs. [score:1]
Then, the cells were infected with retroviral particles lacking miR-21 (negative control) or containing miR-21 in the presence of polybrene (8 μg/ml, Sigma-Aldrich, USA) and incubated for 24 h at 37 °C. [score:1]
Hepatocellular carcinoma Liver cancer stem cells microRNA-21 Cancer stem cell Retroviral vector Hepatocellular carcinoma (HCC) is one of the most common malignant tumors and a leading cause of cancer-related deaths worldwide [1], making it a major health burden [2]. [score:1]
Negative control cells or cells stably transfected with miR-21 (1 × 10 [7]) were suspended in a 1:1 (v/ v) mixture of 100 μl PBS and Matrigel (BD, USA) and injected subcutaneously into both sides of five male BALB/C nude mice aged 5–6 weeks (Laboratory Animal Center, Guangxi Medical University). [score:1]
miR-21 promoted migration and invasion. [score:1]
Another is that miR-21 in non-progenitor tissue triggers tumor cell differentiation, leading to CSC production. [score:1]
A third is that miR-21 in non-progenitor cells produces growth factors that benefit CSCs. [score:1]
Therefore, in the present study, we generated an MHCC-97H cell line stably transfected with a retroviral vector encoding miR-21. [score:1]
How miR-21 may promote the behavior of LCSCs, or of CSCs in general, remains unclear. [score:1]
a, b Negative control (NC) cultures and cultures stably transfected with miR-21 were mock -transfected in the absence of retroviral particles. [score:1]
miR-21 accelerated tumor growth in BALB/C nude mice. [score:1]
When cells were 60–70 % confluent, they were transfected with 1 μg of packaging plasmid PIK [30, 31] (kindly provided by the Department of Immunology, Guangxi Medical University), empty pBABE-puro vector, or pBABE-puro-pre-miR-21 using Lipofectamine 2000 (Invitrogen, USA) in OPTI-MEM I medium (Invitrogen) according to the manufacturer’s instructions. [score:1]
One is that miR-21 acts within the tumor progenitor cells to modulate their self-renewal. [score:1]
At 6 weeks after injection, tumors were larger in mice injected with cells stably transfected with miR-21 than in mice injected with the corresponding empty vector. [score:1]
The resulting construct was named pBABE-puro-pre-miR-21. [score:1]
[1 to 20 of 67 sentences]
37
[+] score: 180
Other miRNAs from this paper: rno-mir-21, mmu-mir-21b, mmu-mir-21c
miR-21 overexpression significantly inhibited BTG2 protein expression (p < 0.01, n = 3) whereas knock-down miR-21 expression obviously increased BTG2 protein expression (p < 0.01, n = 3) (Figure 5B). [score:12]
In contrast, DOX -induced apoptosis and the release of LDH were exacerbated after down-regulation of miR-21 expression via miR-21 inhibitor. [score:8]
Interestingly, up-regulation of miR-21 expression via miR-21 mimic inhibited DOX -induced apoptosis and the release of LDH. [score:8]
It is worth noting that our recent study with a transgenic mo del of myocardial overexpression of nucleolin revealed that miR-21 was one of eleven miRNAs whose expression was up-regulated by nucleolin (Jiang et al., 2015, unpublished data). [score:8]
Zhang S. Han L. Wei J. Shi Z. Pu P. Zhang J. Yuan X. Kang C. Combination treatment with doxorubicin and microRNA-21 inhibitor synergistically augments anticancer activity through upregulation of tumor suppressing genes Int. [score:8]
Thus, targeting miR-21 and inhibiting its activity may be emerging as a promising therapeutic option and offers a potential new mode of cancer therapy. [score:5]
The results showed that BCL-2, BTG2, FGF18, PDCD4, FASLG may be the biological targets of miR-21 by the gain- and loss- of-function approaches with a miR-21 mimic and an inhibitor (Figure 4). [score:5]
To further define the potential role of miR-21 in mediating DOX -induced cardiotoxicity, miR-21 expression was modulated by using both miR-21 mimic and inhibitor, respectively. [score:5]
We used bioinformatics software (TargetScan or PicTar) to predict 9 biological targets of miR-21. [score:5]
Compared with that in the cells treated with scramble, the expression level of miR-21 was increased to 2.17-fold in H9C2 cells transfected with rno-miR-21 mimics (p < 0.01, n = 3); Compared with that in the cells treated with scramble, the expression levels of miR-21 was decreased to 0.55 folds in H9C2 cells transfected with a rno-miR-21 inhibitor (p < 0.05, n = 3) (Figure 3A). [score:5]
These results suggest that miR-21 attenuates DOX -induced injury on cardiac myocytes, whereas inhibition of its expression may aggravate DOX -induced apoptosis of cardiac myocyte. [score:5]
Figure 4The expression of target mRNAs of miR-21 were tested by qRT-PCR. [score:5]
In this study, we found that miR-21 regulated the expression of BTG2. [score:4]
Prior to this study, it was not clear whether BTG2 was the true target of miR-21 in cardiac myocytes and whether miR-21 protected cardiac myocytes from DOX -induced injury through regulating BTG2, so we have chosen BTG2 for further study. [score:4]
MicroRNA-21 target genes in mouse were screened by merging the results of computational prediction algorithms provided at the TargetScan (http://www. [score:4]
In summary, in this study, we have documented that miR-21 is a potent protector for cardiomyocytes against DOX -induced cardiotoxicity probably via regulating the expression of BTG2, a member of an anti-proliferative gene family. [score:4]
Roy S. Khanna S. Hussain S. R. Biswas S. Azad A. Rink C. Gnyawali S. Shilo S. Nuovo G. J. Sen C. K. MicroRNA expression in response to murine myocardial infarction: miR-21 regulates fibroblast metalloprotease-2 via phosphatase and tensin homologue Cardiovasc. [score:4]
Our next plan is to further elucidate how miR-21 regulates BTG2 expression and what precise role it plays in mediating DOX -induced apoptosis of cardiomyocytes. [score:4]
These results suggest that BTG2 is target gene of miR-21 in cardiac myocytes and that miR-21 may protect cardiacmyocytes from DOX -induced injury through post-transcriptional regulation of BTG2. [score:4]
Figure 3Overexpression and knockdown of miR-21 influenced the DOX -induced cytotoxicity in H9C2 cells. [score:4]
Regarding how miR-21 protected cardiac myocytes from DOX -induced injury, a bioinformatic analysis suggests that BTG2 may be a potential target of miR-21. [score:3]
However, the study by Tong’s group reported that miR-21 promoted cardiac fibrosis and development of heart failure with preserved left ventricular ejection fraction by up -regulating BCL-2 [25]. [score:3]
As shown in Figure 2B, exposure of cardiac myocytes to DOX at doses ranging from 0–4 µM for 24 h resulted in a significantly dose -dependent increase in miR-21 expression level in H9C2 cells (p < 0.01, n = 3). [score:3]
Importantly, we found that the mechanism underlying the cardioprotective effects of miR-21 against DOX toxicity is probably mediated through targeting BTG2. [score:3]
Recent studies have demonstrated that BTG2 is a new target gene of miR-21 in prostate cancer cells, laryngeal cancer cells and melanoma cells. [score:3]
The Effects of miR-21 Mimics and Inhibitors on the Injury Mediated by DOX in H9C2 Cells. [score:3]
Moreover, recent studies have indicated that miR-21 had a protective effect on ischemia -induced cell apoptosis that was associated with its target gene programmed cell death 4 and activator protein 1 pathway [13]. [score:3]
Figure 2The effects of DOX on the expression of miR-21 in myocardium and H9C2 cells. [score:3]
H9C2 cells at 80% confluence were transfected with rno-miR-21 mimics (5′-UAGCUUAUCAGACUGAUGUUGA-3′) or rno-miR-21 inhibitors (5′-UAGCUUAUCAGACUGAUGUUGA-3′), or scrambled controls (Qiagen, Cambridge, MA, USA), respectively, at a final concentration of 20 μM with the use of hiperfect transfect reagent (Qiagen). [score:3]
The Effect of DOX Treatment on the Expression of miR-21 in Mice Myocardium and H9C2 Cells. [score:3]
Dong S. Cheng Y. Yang J. Li J. Liu X. Wang X. Wang D. Krall T. J. Delphin E. S. Zhang C. MicroRNA expression signature and the role of microRNA-21 in the early phase of acute myocardial infarction J. Biol. [score:3]
Recent studies have indicated that miR-21 has a protective effect on ischemia -induced cell apoptosis associated with its target genes, such as PDCD4 and PTEN (phosphatase and tensin homolog) [13, 14]. [score:3]
Jazbutyte V. Thum T. MicroRNA-21: From cancer to cardiovascular disease Curr. [score:2]
Dong S. Ma W. Hao B. Hu F. Yan L. Yan X. Wang Y. Chen Z. Wang Z. MicroRNA-21 promotes cardiac fibrosis and development of heart failure with preserved left ventricular ejection fraction by up -regulating BCL-2 Int. [score:2]
However, it was not clear whether miR-21 protected cardiac myocytes from DOX -induced injury through regulating BTG2. [score:2]
Liu M. Wu H. Liu T. Li Y. Wang F. Wan H. Li X. Tang H. Regulation of the cell cycle gene, BTG2, by MIR-21 in human laryngeal carcinoma Cell Res. [score:2]
Knocking down miR-21 obviously decreased the cell viability (p < 0.05, n = 6) and obviously increased the release of LDH (p < 0.05, n = 6) (Figure 3C,D). [score:2]
Compared with that in the cells treated with the scramble + DOX, apoptotic rate was decreased from 37% ± 2.1% to 18% ± 2.8% in cells treated with miR-21 mimics(p < 0.05, n = 3), but the percentage of the apoptotic cardiac myocytes was increased to 57% ± 4.3% in the cells treated with miR-21 inhibitor (p < 0.05, n = 3) (Figure 3B). [score:2]
Moreover, the regulation of BTG2 by miR-21 has been reported in human laryngeal carcinoma [29]. [score:2]
As shown in Figure 2A, the expression level of miR-21 in C-DOX group was significantly increased to 1.8-fold as compared with that in C-NS group (1.800 ± 0.4078 vs. [score:2]
The expression level of miR-21 in A-DOX group was no significant difference compared with that in A-NS group (1.520 ± 0.2307 vs. [score:2]
During carcinogenesis, miR-21 plays an important role in regulating BTG2 genes [15]. [score:2]
MicroRNA-21 (miR-21) is one of the first identified mammalian miRNAs. [score:1]
The present study aimed to determine the role of miR-21 in protection of cardiomyocytes against DOX-triggered cardiotoxicity and the underlying mechanisms. [score:1]
In renal I/R injury, miR-21 is more likely a double-edged sword, which has both protective and pathological roles [24]. [score:1]
We speculated that this could be due to the face that miR-21 exerted its biological functions through different signaling pathways under different circumstances. [score:1]
These results clearly suggest that miR-21 has anti-apoptotic and anti-cell death effects against DOX -induced cardiotoxicity (Figure 3). [score:1]
However, the potential benefits of miR-21 action on DOX -induced injury and its underlying mechanism(s) are largely unknown. [score:1]
Taking together, these studies have identified important connections of nucleolin-miR21-BTG2. [score:1]
The results in Figure 5A showed the predicted consequential pairing of BTG2 (top) and miR-21 (bottom) (http://www. [score:1]
*, p < 0.05, compared to that of cells treated with scramble, n = 3; **, p < 0.01, compared to that of cells transfected with scramble, n = 3; (B) Apoptosis induced by DOX (1 µM for 24 h) in H9C2 cells transfected with miR-21 mimics/inhibitors. [score:1]
Our results demonstrate that miR-21 can alleviate DOX -induced cardiomyocyte apopotosis and further increase cell viability in rat H9C2 cardiomyocytes. [score:1]
However, the effect of miR-21 on DOX induced cardiotoxicity is not clear. [score:1]
Therefore, on the basis of these findings, we postulated that miR-21 would protect against DOX-triggered cardiotoxicity. [score:1]
Furthermore, miR-21 exerted an anti-apoptotic function in ischemia/reperfusion- and hypoxia/reoxygenation -induced cardiocyte apoptosis via the phosphatase and tensin homolog/akt -dependent mechanism [14]. [score:1]
[1 to 20 of 55 sentences]
38
[+] score: 179
miR-21 upregulation might influence pain behavior by translational downregulation of multiple targets. [score:11]
In naïve old B7-H1 mice miR-21 expression was not different from WT littermates and did not change after surgery, however, in WT mice miR-21 expression was increased on day 7 after SNI (p < 0.01) and again showed a higher miR-21 expression compared to baseline values on day 15 (middle-aged: p < 0.01, old: p < 0.05, Figures 9A,B). [score:6]
We used the B7-H1 ko mouse as a potential mo del of miR-21 overexpression, but did not detect miR-21 upregulation in the nervous tissue of our mice. [score:6]
miR-21 controls pro- and anti-inflammatory responses in leukocytes and non-hematopoietic cells (Sheedy, 2015), it was upregulated in the dorsal root ganglia (DRG) of neuropathic rats after spinal nerve ligation and neuropathic pain behavior was relieved by intrathecal administration of a miR-21 inhibitor (Sakai and Suzuki, 2013). [score:6]
We thus hypothesized that the lack of B7-H1 together with miR-21 upregulation might determine the pain phenotype in B7-H1 knock-out (ko) mice. [score:5]
Several targets of miR-21 influence neuronal associated pathways, and their inhibition is leading to pain. [score:5]
The expression levels of miR-21–5p (5′-3′ TAGCTTATCAGACTGATGTTGA) were normalized to the expression of the endogenous control Sno202 (5′-3′ GCTGTACTGACTTGATGAAAGTACTTTTGAACCCTTTTCCATCTGATG). [score:5]
Besides, miR-21 suppresses the production of tumor necrosis factor alpha (TNF) via PTEN (Sheedy, 2015) and inhibition of PTEN enhances outgrowth of adult peripheral axons (Yu et al., 2011), suggesting an additional role for PTEN in neuron sprouting. [score:5]
miR-21 is upregulated in the injured nerve. [score:4]
After SNI miR-21 Is Upregulated Only in the Uninjured Sural Nerve of WT Mice. [score:4]
Furthermore, an upregulation of miR-21 was reported in the injured DRG after spinal nerve ligation and nerve resection in mice and rats (Strickland et al., 2011; Hori et al., 2016). [score:4]
Others reported an upregulation of miR-21 in the spinal cord after CCI (Genda et al., 2013), suggesting a potential role of miR-21 in neuropathic pain. [score:4]
miR-21 was the micro -RNA with the highest upregulation in mouse sciatic nerve after crush in a miRNA microarray (Wu et al., 2011). [score:4]
We speculate that a compensatory increase in PD-L2 expression might shift B7-H1 to subordinate relevance in miR-21 regulation. [score:4]
In summary miR-21 is upregulated after SNI in the sural nerve of WT mice, while B7-H1 ko mice seem to be spared. [score:4]
These results suggest that miR-21 upregulation is related to the locus of injury and could also be associated with inflammation. [score:4]
Middle-aged B7-H1 ko mice showed a 3-fold higher baseline miR-21 expression in the sural nerve compared to WT mice (p < 0.05) which did not change after surgery (Figures 9A,B), while miR-21 expression was increased on day 7, and 15 after SNI in middle-aged WT mice (p < 0.01 each, Figure 9B). [score:4]
Nerve injury -induced upregulation of miR-21 in the primary sensory neurons contributes to neuropathic pain in rats. [score:4]
A recent study showed that miR-21 induction in macrophages leads to a downregulation of PDCD4, which in turn results in an enhanced production of the anti-inflammatory cytokine interleukin-10 (IL-10; Das et al., 2014). [score:4]
Here, we show an upregulation of miR-21 in the injured tibial and common peroneal nerves of B7-H1 ko and WT mice after SNI surgery, and in the uninjured sural nerve only in middle-aged and old WT mice. [score:4]
An upregulation of miR-21 has been shown in T cells of PD-1 ko mice (Iliopoulos et al., 2011). [score:4]
However, our data spot miR-21 as a promising candidate to determine potentially druggable downstream targets for future neuropathic pain treatment and add to the growing evidence on the crucial role of miRNAs in the regulation of neuro-immune circuits contributing to neuropathic pain. [score:4]
Boxplots show the