Stem-loop mmu-mir-21a

Accession

MI0000569

Symbol

MGI: Mir21a

Description

Mus musculus mmu-mir-21a precursor miRNA mir-21

Gene
family

RF00658; mir-21

Literature search

663 open access papers mention mmu-mir-21a
(6633 sentences)

Sequence

11621027 reads, 34902 reads per million, 107 experiments

uguaccaccuugucggaUAGCUUAUCAGACUGAUGUUGAcuguugaaucucauggCAACAGCAGUCGAUGGGCUGUCugacauuuugguauc
.((((((...((((((((((((((((.(((((.(((((.((((.((...))))))))))).)))))))))))))))))))))...)))))).

Structure

u      ccu                A     A     A    u  a 
 guacca   ugucggaUAGCUUAUC GACUG UGUUG cugu ga  
 ||||||   |||||||||||||||| ||||| ||||| |||| || u
 uauggu   acaguCUGUCGGGUAG CUGAC ACAAC ggua cu  
c      uuu                -     G     -    -  c 

Annotation confidence High

Genome context

chr11: 86584067-86584158 [-]

Mature mmu-miR-21a-5p

• Accession: MIMAT0000530
• Description: Mus musculus mmu-miR-21a-5p mature miRNA
• Sequence: 18 - UAGCUUAUCAGACUGAUGUUGA - 39
• Evidence: experimental ; cloned [1-2,4-6], Northern [2], Illumina [8]

Mature mmu-miR-21a-3p

• Accession: MIMAT0004628
• Description: Mus musculus mmu-miR-21a-3p mature miRNA
• Sequence: 56 - CAACAGCAGUCGAUGGGCUGUC - 77
• Evidence: experimental ; cloned [6], Illumina [8-9]

References

1. PubMed ID: 12554860
   Numerous microRNPs in neuronal cells containing novel microRNAs
   "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
   "RNA (2003) 9:180-186


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 12919684
   Embryonic stem cell-specific MicroRNAs
   "Houbaviy HB, Murray MF, Sharp PA"
   "Dev Cell (2003) 5:351-358


4. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


5. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


6. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


7. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


8. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


9. PubMed ID: 17687032
   Competing interactions between micro-RNAs determine neural progenitor survival and proliferation after ethanol exposure: evidence from an ex vivo model of the fetal cerebral cortical neuroepithelium
   "Sathyan P, Golden HB, Miranda RC"
   "J Neurosci (2007) 27:8546-8557