sort by

164 publications mentioning mmu-mir-27a (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-27a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 527
Similarly, C2C12 myotubes treated with Specific Inhibitor of Smad3 (SIS3), a compound previously shown to specifically inhibit Smad3 function via suppressing Smad3 phosphorylation [36], displayed significantly increased Mstn expression concomitant with reduced pre-miR-27a/b (Figure 5D & 5E). [score:9]
Mstn upregulates miR-27a/b expression through a Smad3 -dependent mechanism to negatively auto-regulate its own expression. [score:9]
As Mstn is a potent negative regulator of myoblast differentiation [6], we speculate that the elevated miR-27 expression may function to inhibit Mstn expression thus allowing for myogenic differentiation to proceed. [score:8]
Although it is tempting to suggest that epigenetic mechanisms (such as miR-27) could be responsible for regulating Mstn expression during differentiation, we noted that the increase in miR-27 expression during differentiation might not be enough to account for the dramatic drop in Mstn expression observed. [score:8]
We further show the utility of miR-27a/b in regulating Mstn expression and activity in vivo and that in Smad3 -null mice there is increased expression of Mstn, which is due to reduced endogenous miR-27a/b expression in these mice. [score:8]
The ability of CMM to reduce Mstn 3′UTR reporter activity appeared to be dependent on miR-27a/b function, as AntagomiR -mediated inhibition of miR-27a/b, as well as mutation of the miR-27a/b binding site in the Mstn 3′UTR, prevented CMM -mediated inhibition of Mstn expression (Figure 6D & 6E). [score:8]
These data, together with the fact that specific inhibitor of Smad3 (SIS3) treatment was able to significantly reduce miR-27a/b expression, suggest that Smad3 plays an important role in regulating endogenous miR-27a/b expression. [score:8]
Therefore, the increase in Pax7 [+] cells observed in response to over expression of miR-27 is most likely due to miR-27 -mediated inhibition of Mstn as opposed to direct regulation of Pax7 by miR-27. [score:7]
Furthermore, results confirm a role for miR-27a/b in regulating muscle fiber type-specific and tissue-specific expression of Mstn and suggest that miR-27a/b may play a role in regulating Mstn expression and thus function during myogenic differentiation. [score:7]
0087687.g003 Figure 3Over expression of miR-27a targets and represses endogenous Mstn expression and function in vivo. [score:7]
The expression of Mstn was quantified by qPCR 8 days post-injection and as shown in Figure 3A overexpression of miR-27a in vivo resulted in a significant reduction in Mstn expression in TA muscle. [score:7]
miR-27a/b targets and represses Mstn through a miR-27a/b-specific target site in the 3′ UTR of the Mstn geneIn agreement with previously published reports [23], [24], analysis with the TargetScan5.1 (http://www. [score:7]
Over expression of miR-27a targets and represses endogenous Mstn expression and function in vivo. [score:7]
To determine whether Mstn regulates miR-27a/b expression, C2C12 myoblasts and 48 h differentiated myotubes were treated with conditioned medium containing eukaryotic produced CHO-cell secreted Mstn protein (CMM) for 12 h. Pre-miR-27a/b expression was quantified by qPCR and as can be seen in Figure 6A & 6B, the expression of pre-miR-27a/b was significantly increased in both C2C12 myoblasts and myotubes upon treatment with CMM, when compared with cells treated with conditioned medium collected from control CHO cells (CCM) (Figure 6A & 6B). [score:7]
also reveal for the first time that Mstn up regulates the expression of miR-27a/b via Smad3, which in turn targets and represses Mstn, forming the basis of a novel microRNA -mediated Mstn negative auto-regulatory loop during myogenesis. [score:7]
To confirm that the reduced expression of miR-27 was responsible for the elevated Mstn expression detected in Smad3 -null mice we next assessed Mstn expression between WT and Smad3 -null mice primary myoblast cultures following transfection of a miR-27b-specific mimic. [score:7]
Mstn treatment up regulates miR-27a/b expression via Smad3 to negatively auto-regulate it's own expression. [score:7]
miR-27a/b regulates myofiber size and SC function through targeting endogenous Mstn expression in skeletal muscleTo investigate whether miR-27a/b regulates endogenous Mstn levels in skeletal muscle, M. tibialis anterior (TA) muscles of WT mice were intramuscularly injected and in vivo electroporated with either the pcDNA-miR-27a over expression construct or control (pcDNA-miR-neg). [score:7]
Here we now show further evidence to support that Mstn gene expression is regulated by the miR-27a/b, as such AntagomiRs against miR-27a/b were able to increase Mstn expression, reduce myoblast proliferation and induce myotubular atrophy. [score:6]
miR-27a/b regulates myofiber size and SC function through targeting endogenous Mstn expression in skeletal muscle. [score:6]
Furthermore, we now show that miR-27a/b forms the basis of a novel negative auto-regulatory mechanism through which Mstn inhibits it's own expression in muscle. [score:6]
To further study miR-27a/b regulation of Mstn, we cloned the 3′ UTR region of the murine Mstn gene into the pMIR-REPORT™ miRNA Expression Luciferase Reporter Vector and co -transfected together with a miR-27a over expression vector (pcDNA-miR-27a). [score:6]
Importantly, transfection of the miR-27b mimic reduced the expression of Mstn back to levels comparable to that observed in WT controls (Figure 5F), suggesting that reduced miR-27a/b expression may be responsible for the increased levels of Mstn observed in Smad3 -null mice. [score:5]
More recently, microRNA-27 (miR-27) has been shown to target and inhibit Mstn. [score:5]
Similarly, Huang et al revealed that over expression of miR-27a through addition of miR-27a mimics resulted in reduced Mstn mRNA expression and increased myoblast proliferation [24], consistent with known Mstn function. [score:5]
Increased Mstn expression observed in the absence of Smad3 is due to reduced miR-27a/b expressionSmad3 -null mice display severe muscle atrophy, which has been attributed to elevated endogenous levels of Mstn detected in Smad3 -null mice [35]. [score:5]
Further support for Smad3 regulation of miR-27 is seen in published work from Sun et al, which revealed the presence of a Smad binding element in the miR-24-2/miR-23a/miR-27a cluster upstream regulatory sequence and that the Smad binding site was critical for TGF-β1 -mediated inhibition of miR-24-2/miR-23a/miR-27a [31]. [score:5]
These data are in agreement with a recently published report by Chen et al, which shows a similar increase in miR-27 expression and associated decrease in Mstn expression during myogenic differentiation [45]. [score:5]
As predicted, transfection of AntagomiR-27a or AntagomiR-27b resulted in reduced expression of miR-27a (Figure S1A) and miR-27b (Figure S1B) respectively, together with increased Mstn expression (Figure S1C). [score:5]
Therefore we speculate that loss of Smad3 leads to reduced miR-27a/b expression, which in turn increases Mstn mRNA stability and or translation leading to enhanced skeletal muscle wasting. [score:5]
Figure S1 AntagomiR -mediated inhibition of miR-27a/b and enhanced expression of Mstn. [score:5]
The pcDNA 6.2-GW/± EmGFP expression vector containing mature miR-27a (pcDNA-miR-27a) was used for miR-27a over expression studies. [score:5]
miR-27a/b targets and represses Mstn through a miR-27a/b-specific target site in the 3′ UTR of the Mstn gene. [score:5]
0087687.g005 Figure 5Increased Mstn expression in Smad3 -null mice is due to reduced miR-27a/b expression. [score:5]
The expression of Mstn was assessed 8 days post-injection and consistent with reduced miR-27a, Mstn expression was significantly up regulated, albeit modestly, upon AntagomiR -mediated blockade of miR-27a in vivo, when compared to AntagomiR Neg transfected contralateral TA muscle. [score:5]
Therefore, taken together these data suggest that posttranscriptional regulation of Mstn mRNA by miR-27 plays a critical role in controlling timely tissue-specific expression/activity of Mstn during development. [score:5]
Here we have investigated if miR-27a/b could be responsible for the increased Mstn expression observed in Smad3 -null mice; and in agreement with increased Mstn expression we find reduced miR-27a and miR-27b expression in Smad3 -null mice. [score:5]
Next we assessed whether or not the increased miR-27a/b, due to CMM treatment, would in turn target and repress Mstn expression. [score:5]
qPCR analysis of Mstn mRNA expression (D) and precursor-miR-27a/b (pre-miR-27a/b) expression (E) in Heart, Liver, M. Biceps femoris muscle (BF) and M. Soleus muscle (Sol. ) [score:5]
In agreement with this, we observed significantly increased expression of Mstn together with pronounced myotubular atrophy upon AntagomiR -mediated inhibition of miR-27a and miR-27b. [score:5]
As differentiation ensued we noted a decrease in Mstn expression, consistent with previous reports [43], [44], concomitant with a steady increase in miR-27 expression. [score:5]
In addition to regulating fiber type- and tissue-specific Mstn expression, we also show that miR-27a/b could potentially regulate Mstn mRNA levels during myogenic differentiation in vitro. [score:5]
Thus, the expression of Mstn appears to be inversely associated with miR-27a/b expression during C2C12 myoblast differentiation. [score:5]
Increased Mstn expression in Smad3 -null mice is due to reduced miR-27a/b expression. [score:5]
AntagomiR -mediated inhibition of miR-27a enhances endogenous Mstn expression and function in vivo. [score:5]
These data strongly suggest that miR-27a/b is able to negatively regulate Mstn mRNA and that the miR-27a/b target site found within the Mstn 3′UTR is critical for miR-27a/b regulation of Mstn. [score:5]
Correlation between Mstn and miR-27a/b expression in vivo and in vitro While high levels of Mstn are detected in skeletal muscle, lower levels of Mstn are expressed in white adipose tissue, heart and mammary gland [1]– [3]. [score:5]
Increased Mstn expression observed in the absence of Smad3 is due to reduced miR-27a/b expression. [score:5]
miR-27a/b targets and represses Mstn expression. [score:5]
Furthermore, over expression of miR-27a in vivo led to decreased Mstn expression concomitant with myofiber hypertrophy and increased numbers of Pax7 [+] cells and activated myoblasts (MyoD [+]); quite consistent with the fact that loss of Mstn leads to increased muscle mass and enhanced satellite cell number, activation and self-renewal [1], [4], [34]. [score:5]
0087687.g004 Figure 4AntagomiR -mediated inhibition of miR-27a enhances endogenous Mstn expression and function in vivo. [score:5]
These data confirm that Mstn is able to positively regulate miR-27a/b expression in muscle. [score:4]
Interestingly, we now show for the first time that Mstn is able to up regulate the expression of miR-27a/b. [score:4]
Recently published evidence suggests that miR-27 may play a role in regulating skeletal muscle fiber type-specific expression of Mstn [23]. [score:4]
Given that miR-27a and miR-27b have the same “seed” sequence, UGACACU, which recognizes complementary sequences in the 3′UTRs of target genes, it is not surprising that we found no difference in the ability of miR-27a or miR-27b to regulate Mstn. [score:4]
Consistent with blockade of miR-27a/b and with the development of myotube atrophy a significant increase in Mstn expression was observed following transfection of C2C12 myotubes with AntagomiR-27a or AntagomiR-27b (Figure S1D). [score:4]
Therefore these data confirm that Smad3 plays a critical role in the ability of Mstn to up regulate miR-27a/b expression. [score:4]
Consistent with previous reports [23], [24], we show that over expression of miR-27a results in reduced Mstn 3′UTR reporter activity, which is blocked upon mutation of the miR-27a/b binding site in the Mstn 3′ UTR. [score:4]
To investigate whether or not miR-27a/b plays a role in regulating tissue-specific Mstn expression, we analyzed precursor-miR-27a/b (pre-miR-27a/b) and Mstn expression profiles in various tissues. [score:4]
Taken together these data presented here strongly support that miR-27a/b negatively regulates both Mstn expression and function in vitro and in vivo. [score:4]
Since Mstn is known to activate Smad3, we further hypothesized that Mstn may signal to up regulate the expression of miR-27a/b in muscle. [score:4]
To further confirm regulation of endogenous Mstn expression by miR-27a, we also injected either an AntagomiR specific for miR-27a (AntagomiR-27a) or a non-silencing negative control AntagomiR (AntagomiR Neg) into TA muscle of WT mice. [score:4]
Importantly, the elevated Mstn expression was associated with a significant decrease in both mature miR-27a and miR-27b expression in all muscle tissues isolated from Smad3 -null mice, as compared to WT mice (Figure 5B & 5C). [score:4]
In summary, we provide further evidence to support a role for miR-27 in regulating Mstn expression. [score:4]
The data presented above suggested to us that Smad3 may play an important role in regulating basal miR-27a/b expression in muscle. [score:4]
Importantly, in our current experiments we did not observe any significant difference in the ability of miR-27a or miR-27b to regulate Mstn expression or activity. [score:4]
qPCR analysis revealed significantly increased Mstn mRNA expression, concomitant with reduced pre-miR-27a/b expression in the predominantly fast-twitch BF muscle, when compared to the slow-twitch soleus (Sol) muscle (Figure 1D and 1E). [score:4]
The mutated Mstn 3′ UTR was then cloned as a HindIII fragment into the pMIR-REPORT™ expression reporter vector, sequence verified to confirm mutation of the miR-27a/b binding region and named Mstn 3′UTR-mut. [score:4]
Work by Allen and Loh revealed that miR-27a/b is able to reduce Mstn expression and mRNA stability and moreover indicated miR-27a/b may play a role in the increased expression of Mstn observed firstly, in Fast-twitch muscle, when compared to slow-twitch muscle and secondly, in response to Dexamethasone treatment [23]. [score:4]
Evidence suggests that miR-27a and miR-27b play an important role in controlling tissue-specific and muscle fiber type-specific expression of Mstn and regulating Mstn function during myogenesis. [score:4]
Specifically, when compared to heart tissue, we noted higher Mstn expression, concomitant with reduced expression of miR-27a/b in liver tissue. [score:4]
AntagomiR -mediated blockade of miR-27a and miR-27b not only up regulated Mstn expression but also significantly reduced C2C12 myoblast proliferation. [score:4]
When compared to liver and biceps femoris (BF) muscle, we noted reduced expression of Mstn and increased expression of pre-miR-27a/b in the heart (Figure 1D and 1E). [score:4]
The miR-27a promoter (miR-27a pro), miR-27b promoter (miR-27b pro) and the mutant miR-27b promoter reporter construct (miR-27b pro-mut) used in this study were kindly gifted by Dr Xiao Yang (State Key Laboratory of Proteomics, Genetic Laboratory of Development and Diseases, Institute of Biotechnology, Beijing, China) and have been described previously [31], [32]. [score:4]
Since Mstn is a potent negative regulator of skeletal muscle mass and satellite cell (SC) function [1], [4], [7], [34], we also stained TA muscle serial sections with H&E (Figure 3B) and quantified myofiber cross sectional area (CSA), as well as the percentage of Pax7 [+] and MyoD [+] cells in TA muscle following miR-27a overexpression. [score:4]
Furthermore we also observed an ∼52% increase in the number of very large myofibers (>2500 µm [2]) and an ∼60% decrease in the number of very small myofibers (<1500 µm [2]) upon in vivo overexpression of miR-27a (Figure 3D), which is quite consistent with the increased myofiber CSA and loss of Mstn function. [score:3]
A role for miR-27 in regulating myogenic differentiation is not novel, in fact Crist et al recently demonstrated that miR-27b is able to negatively regulate Pax3 protein levels in adult muscle satellite cells to allow for timely entry into the myogenic differentiation program [40]. [score:3]
To identify if miR-27a/b target site was responsible for the reduced luciferase activity observed, the putative miR-27a/b binding site in the Mstn 3′UTR was mutated. [score:3]
Specifically, addition of exogenous Mstn resulted in increased miR-27a/b expression, which in turn led to reduced Mstn 3′ UTR activity. [score:3]
Blockade of miR-27a in vivo also resulted in significantly increased Mstn expression, which was associated with decreased myofiber CSA. [score:3]
org/) algorithm revealed the presence of a single target site for microRNA-27a/b (miR-27a/b) in the 3′UTR of the murine Mstn gene (Figure 1A). [score:3]
Consistent with the data published by Allen and Loh [23], we also observed a difference in Mstn and pre-miR-27a/b expression between fast-twitch and slow-twitch muscles. [score:3]
To assess for the expression of mature miR-27a and miR-27b, cDNA was synthesized from extracted RNA using the miScript II RT kit (Cat# 218161; Qiagen), as per the manufacturer's instructions. [score:3]
In the current manuscript we also found a similar trend in miR-27a/b and Mstn expression between fast and slow muscle fiber types. [score:3]
Specifically, work from Allen and Loh revealed that miR-27a and miR-27b fast-twitch and slow-twitch muscle-specific expression was complementary to that of Mstn. [score:3]
However, we now show that over expression of miR-27 in vivo leads to increased numbers of Pax7 [+] cells. [score:3]
Nevertheless, as satellite cells play a critical role during skeletal muscle regeneration [37] and that loss of Mstn leads to enhanced satellite cell activation, self-renewal and accelerated skeletal muscle regeneration [7], [34] we strongly believe that the increased numbers of Pax7 [+] and MyoD [+] cells observed following over expression of miR-27a is due to loss of Mstn. [score:3]
For co-transfection of reporter plasmids and miR-27a over expressing vectors, C2C12 myoblasts were seeded into 24-well plates at a density of 15,000 cells/cm [2] 24 h before transfection. [score:3]
Inhibition of miR-27a and miR-27b results in increased Mstn activity. [score:3]
qPCR analysis of miR-27a (F) and Mstn (G) expression in differentiated primary myoblast cultures from WT mice following transfection of AntagomiR Neg or AntagomiR-27a. [score:3]
Furthermore the mstn 3′UTR miR-27a/b target site was found to be flanked by AU-rich sequences, which act to boost miRNA efficacy [33]. [score:3]
On the other hand in tissues where relatively higher levels of Mstn were observed, such as liver and BF muscle, lower pre-miR-27a/b expression was detected (Figure 1D and 1E). [score:3]
qPCR analysis of (A) Mstn, (B) miR-27a and (C) miR-27b expression in M. Tibialis anterior muscle (TA), M. Gastrocnemius muscle (GAS) and M. Quadriceps muscle (QUAD) isolated from WT and Smad3 -null mice. [score:3]
These data are consistent with previously published reports demonstrating that excess Mstn inhibits myoblast proliferation [5] and with a recent report, which shows that addition of miR-27a mimics results in decreased Mstn mRNA concomitant with an increase in the number of proliferating C2C12 myoblasts [24]. [score:3]
Therefore we next wanted to test whether or not the increased Mstn levels observed in Smad3 -null mice was due to reduced miR-27a/b expression. [score:3]
Furthermore, Smad3 is critical for Mstn regulation of miR-27a/b as either mutation of the Smad binding site or treatment with SIS3 ablated the Mstn -mediated response. [score:3]
Evidence presented here confirms that Mstn is indeed a target of miR-27a/b both in vitro and in vivo. [score:3]
qPCR analysis of pre-miR-27a/b expression in C2C12 myoblasts (A) and 48 h differentiated C2C12 myotubes (B) following 12 h treatment with conditioned medium from either control CHO cells (CCM) or from CHO-cells designed to produce and secrete Mstn protein (CMM). [score:3]
0087687.g006 Figure 6qPCR analysis of pre-miR-27a/b expression in C2C12 myoblasts (A) and 48 h differentiated C2C12 myotubes (B) following 12 h treatment with conditioned medium from either control CHO cells (CCM) or from CHO-cells designed to produce and secrete Mstn protein (CMM). [score:3]
In addition to over expression studies, we now show that blockade of miR-27a, through addition of an AntagomiR specific for miR-27a, results in enhanced Mstn 3′UTR reporter activity. [score:3]
Correlation between Mstn and miR-27a/b expression in vivo and in vitro. [score:3]
Importantly, TargetScan analysis revealed an 8 mer seed match, defined as a perfect match to positions 2–8 of the mature miRNA followed by an adenine, between the miR-27a and miR-27b seed sequence and the miR-27a/b binding site in the 3′UTR of the murine Mstn gene (Figure 1A). [score:3]
qPCR analysis of precursor-miR-27a/b (Pre-miR-27a/b) and Mstn expression was performed using the CFX96 Real-Time System (Bio-rad). [score:3]
This mechanism was dependent on miR-27a/b, as either blockade of miR-27a/b or mutation of the miR-27a/b binding site in the Mstn 3′ UTR prevented Mstn feedback regulation. [score:3]
Interestingly, here we further show that miR-27a/b and Mstn expression was inversely associated between different tissues. [score:3]
In agreement with the results above, AntagomiR -mediated reduction of miR-27a expression (Figure S1E) did not result in any appreciable myotube atrophy in Mstn -null mice-derived primary myotube cultures, when compared to AntagomiR Neg transfected primary myotubes (Figure 2D & 2E). [score:2]
However, in contrast, AntagomiR -mediated reduction of miR-27a in primary myotubes cultures isolated from WT mice (Figure S1F) led to elevated Mstn expression (Figure S1G) and observable myotubular atrophy (Figure 2D & 2E), with an ∼32% decrease in average myotube area observed in AntagomiR-27a transfected myotubes, when compared to AntagomiR Neg transfected myotubes (Figure 2E). [score:2]
In the present study we have further characterized the role of miR-27a/b in regulating Mstn expression and activity. [score:2]
To confirm whether Smad3 is involved in Mstn regulation of miR-27a/b, C2C12 myoblasts were transfected with either the miR-27a promoter (miR-27a pro), miR-27b promoter (miR-27b pro) or a mutant miR-27b promoter reporter construct, where the smad binding site has been mutated (miR-27b pro-mut) and subjected to treatment with CMM. [score:2]
Recent work from Crist et al has shown that miR-27 is able to down regulate Pax3 protein levels, without affecting the levels of Pax7 [40]. [score:2]
An ∼30% increase in average myofiber CSA was observed in miR-27a overexpressing TA muscle, when compared to the control transfected contralateral TA muscle (Figure 3C). [score:2]
Nevertheless, we did note a significant reduction in the numbers of Pax7 [+] cells and activated myoblasts (MyoD [+]) upon AntagomiR -mediated blockade of miR-27a in vivo, further confirming that miR-27 is able to regulate Mstn. [score:2]
Next we also compared the expression of Mstn and miR-27a/b during differentiation in C2C12 myoblasts. [score:2]
To investigate whether miR-27a/b regulates endogenous Mstn levels in skeletal muscle, M. tibialis anterior (TA) muscles of WT mice were intramuscularly injected and in vivo electroporated with either the pcDNA-miR-27a over expression construct or control (pcDNA-miR-neg). [score:2]
To confirm whether or not the myotube atrophy observed following AntagomiR -mediated blockade of miR-27a/b was due to enhanced Mstn function, we next assessed myotube area in AntagomiR-27a and AntagomiR-27b transfected C2C12 myotubes cultures treated together with soluble Activin type IIB receptor (sActRIIB) Mstn antagonist. [score:1]
In vivo transfection of plasmid DNA (pcDNA-miR-27a or pcDNA-miR-neg) was performed by intramuscular injection of 25 µg (25 µl total volume; in sterile PBS) of each plasmid DNA into the TA muscle of anaesthetized mice. [score:1]
When pcDNA-miR-27a was co -transfected together with the mutant Mstn 3′UTR reporter (Mstn 3′UTR-mut), no significant reduction in luciferase activity was observed (Figure 1C). [score:1]
Unlike the dramatic phenotype observed in vitro, AntagomiR -mediated blockade of miR-27a only resulted in minor muscle atrophy. [score:1]
These results confirm that blockade of miR-27a/b results in myotube atrophy through a mechanism dependent on Mstn. [score:1]
Bars represent mean number ± S. E. M of MyoD [+] cells, per 100 myofibers, from 3 sections each collected from pcDNA-miR-neg and pcDNA-miR-27a transfected WT mice (n = 3). [score:1]
To assess the effect of miR-27a/b blockade on differentiated myotubes and to study the effect of Mstn blockade on AntagomiR-27a/b -mediated myotube atrophy, C2C12 myoblasts were induced to differentiate on Thermanox coverslips under low-serum conditions (DMEM, 2% Horse Serum) for 24 h. Following this, 24 h differentiated C2C12 myoblasts were transfected, using LF2000, with 50 nM each of AntagomiR-27a, AntagomiR-27b or AntagomiR Neg. [score:1]
AntagomiR -mediated blockade of miR-27a/b leads to enhanced Mstn activity. [score:1]
As shown in Figure 6C, addition of SIS3 was able to partially rescue the increased miR-27a- and miR-27b-promoter-reporter luciferase activity observed following treatment with CMM alone (Figure 6C). [score:1]
To assess for miR-27a and miR-27b promoter reporter activity, miR-27a pro, miR-27b pro and miR-27b pro-mut constructs were electroporated (GenePulsar MXcell, Bio-rad, Hercules, CA, USA) into 1 million C2C12 cells and grown to confluency. [score:1]
Bars represent mean number ± S. E. M of Pax7 [+] cells, per 100 myofibers, from 3 sections each collected from pcDNA-miR-neg and pcDNA-miR-27a transfected WT mice (n = 3). [score:1]
Proliferating C2C12 myoblasts were co -transfected with 0.1 µg Mstn 3′UTR or Mstn 3′UTR-mut reporter plasmids and 0.4 µg pcDNA-miR-27a or pcDNA-miR-neg, as a negative control. [score:1]
For co-transfection of reporter plasmids and AntagomiRs against miR-27a/b, 50 nM of AntagomiR-27a, AntagomiR-27b or AntagomiR Neg were co -transfected with Mstn 3′UTR or Mstn 3′UTR-mut using LF2000 (Invitrogen, USA) as per the manufacturer's protocol. [score:1]
Treatment with CMM resulted in a significant increase in promoter-reporter luciferase activity in myoblasts transfected with either the miR-27a or miR-27b promoter constructs (Figure 6C); however, no significant increase in luciferase activity was observed in C2C12 myoblasts transfected with the mutated miR-27b promoter construct following CMM treatment (Figure 6C). [score:1]
After an overnight attachment period, myoblasts were transfected with 25 nM each of AntagomiRs specific for miR-27a (AntagomiR-27a), miR-27b (AntagomiR-27b) or negative control AntagomiR (AntagomiR Neg) (Dharmacon Inc, USA) using Lipofectamine 2000 (LF2000; Invitrogen, USA), as per the manufacturer's gui delines. [score:1]
To study the effect of miR-27a blockade in vivo, 20 nM (25 µl total volume; in sterile nuclease free water) of each AntagomiR (AntagomiR-27a or AntagomiR Neg) oligonucleotides [25], was injected into the M. tibialis anterior (TA) muscle of anaesthetized WT mice (n = 3) using a 28-gauge syringe (Hamilton Co. [score:1]
Right: Graph showing the number of Pax7 [+] cells in pcDNA-miR-neg and pcDNA-miR-27a in vivo transfected TA muscle from WT mice. [score:1]
Furthermore co-transfection of Mstn 3′UTR with a miR-27a-specific AntagomiR (AntagomiR-27a) resulted in significant increase in Mstn 3′UTR reporter luciferase activity, over and above that observed in control AntagomiR Neg transfected cells (Figure 1B). [score:1]
The effect of AntagomiR-27a appeared to be specific to the miR-27a/b site in the Mstn 3′UTR site, since addition of AntagomiR-27a failed to increase luciferase activity in Mstn 3′UTR-mut reporter transfected myoblasts (Figure 1C). [score:1]
[1 to 20 of 133 sentences]
2
[+] score: 467
MAP downregulates the expression of miR-27a, while miR27a inhibits the activation of the MAPK-p38 signaling pathway by targeting TAB 2. Furthermore, miR-27a negatively regulates the expression of IL-10 by directly targeting IL-10 mRNA at its 3′-UTR. [score:16]
We demonstrated that the expressions of pro-inflammatory cytokines were upregulated by overexpression of miR-27a, whereas these cytokines were reduced by inhibition of miR-27a by transfection with miR-27a inhibitor. [score:12]
We found that upregulation of miR-27a reduced the expression of phosphorylated p38 (Figure 6D) and p-JNK (Figure 6E), while downregulation of miR-27a significantly promoted the expression of p-p38 and p-JNK at all time intervals. [score:11]
We have shown here that miR-27a inhibits IL-10 expression by targeting mRNA at the 3′-UTR of IL-10 as well as inhibition of p38 phosphorylation by targeting TAB 2 mRNA at its 3′-UTR in MAP-infected macrophages. [score:11]
We found that enforced expression of miR-27a suppressed IL-10 protein expression, whereas transfection of cells with an inhibitor of miR-27a resulted in increased IL-10 expression in MAP-infected macrophages. [score:11]
Similarly, we found that overexpression of miR-27a modulated the immune responses during MAP infection by targeting IL-10 at the 3′-UTR or by inhibiting the regulatory pathway for the expression of IL-10. [score:10]
As shown in Figure 6A, upregulation of miR-27a diminished MAP (0908) induced TAB 2 (Figure 6B) and TAB 3 (Figure 6C) expression, while downregulation of miR-27a counteracted these effects. [score:9]
Furthermore, we found that downregulation of miR-27a also inhibited the expression of pro-inflammatory cytokines after 18 h of MAP infection (Figure S3 in). [score:8]
In addition, the downregulation of miR-27a also inhibited various cytokines expression in RAW264.7 macrophages after infection with MAP 0908 and k-10 strains (Figures 5E–H). [score:8]
We have already shown that miR-27a is downregulated in MAP-infected macrophages and also observed the inhibitory effects of miR-27a on IL-10 expression. [score:8]
We already found that miR-27a positively regulates the expression of pro-inflammatory cytokines in MAP-infected macrophages and that overexpression of miR-27a promotes macrophage activation by inhibition of IL-10. [score:8]
To clarify whether miR-27a targets IL-10 alone or IL-10 and TAB 2 together at their 3′-UTR region, we used TargetScan and miRanda algorithm to predict miRNA targets as previously described (56, 57). [score:7]
Upregulation of miR-27a diminished TAB 2 -dependent p38/JNK phosphorylation, subsequently downregulated IL-10 in MAP-infected macrophages. [score:7]
Our results are in line with the finding of Pan and colleagues’ that miR-27a inhibits JNK/p38 expression by targeting MAP2K4 mRNA at its 3′-UTR in human osteosarcoma cells (46). [score:7]
Downregulation of miR-27a Inhibits Inflammatory Responses of MAP-Infected Macrophages. [score:6]
In contrast, an upregulation of IL-10 was observed at protein and mRNA levels in both BMDM and RAW264.7 macrophages transfected with miR-27a inhibitor (Figures 3E,F,H). [score:6]
Our data also suggest that mimic treatment of miR-27a inhibits the expression of IL-10, while promoting the regulation of various pro-inflammatory cytokines in murine macrophages results in line with the study reported by Xie and colleagues (51). [score:6]
Similarly, murine cytomegalovirus downregulated the expression of miR-27a in various mouse cell lines and primary macrophages (34). [score:6]
We also found that upregulation of miR-27a reduced MAP -induced IL-10 expression at both 6 and 18 h postinfection (Figure 3A) and simultaneously reduced L-10 protein levels in BMDM cells after infection with MAP (Figure 3B). [score:6]
Figure 5Downregulation of miR-27a inhibits inflammatory responses of Mycobacterium avium subspecies paratuberculosis (MAP)-infected macrophages. [score:6]
We found that upregulation of miR-27a reduced the activity of the luciferase reporter in BMDM and HEK293 cells containing IL-10 wild-type reporter, while miR-27a failed to inhibit luciferase activity in cells having IL-10 mutant-type reporter (Figures 7D,E). [score:6]
Consistent with the findings in BMDM cells, upregulation of miR-27a also enhanced MAP -induced expression of IL-1β, IL-6, IL-12, IFN-β, and TNF-α in RAW264.7 cells (Figures 4E–H). [score:6]
Our data suggest that downregulation of miR-27a in response to MAP strains and TLR2 treatment shares a common response in both types of macrophages and indicate that the expression of miR-27a in MAP- and TLR2 -treated cells may share a common signaling mechanism. [score:6]
An early study reported that miR-27a upregulated the expression of TNF-α in BMDM cells treated with LPS (51), while TNF-α played a crucial role in macrophage activation in killing intracellular mycobacteria (80), indicating that miR-27a might be required in the macrophage -mediated immune defense against infection. [score:6]
After 4 weeks postinfection, the expression level of miR-27a was significantly downregulated in different tissues of infected mice (Figures 2G–I). [score:6]
The miR-24 and miR-27a modulate immune response by inhibiting Th2 regulation through targeting IL-4 and GATA binding protein 3 (GATA3) of mouse CD4 T cells (33). [score:6]
In addition, miR-27a was downregulated in inhibitor treatment of both MAP-infected and MAP non-infected groups (Figure 3G). [score:6]
Upregulation of miR-27a reduced the survival of MAP (0908) in BMDM cells, while miR-27a inhibitor counteracted that effect (Figure 8A). [score:6]
We found that the expression of miR-27a was downregulated by MAP (0908 and k-10 strain of MAP) both in vitro and in vivo. [score:6]
Cho and colleagues reported that miR-24 and miR-27a collectively inhibit the differentiation of CD4 T cells into Th2 cells by targeting IL-4 and GATA3 (33). [score:5]
On the other hand, BMDMs transfected with miR-27a inhibitor significantly reduced the expression level of miR-27a (Figure 7C). [score:5]
All other experiments were carried out in accordance with the University Institutional Biosafety Committee approved protocol number 20110611-0. MicroRNA miR-27a negative control, mimic, inhibitor control, and inhibitor were purchased from Shanghai GenePharma. [score:5]
To check the transfection efficiency, BMDM cells were transfected with miR-27a control, mimic, and inhibitor for 48 h and then the expression of miR-27a observed with or without MAP infection (0908). [score:5]
BMDM (E,F) and RAW264.7 (H) cells were transfected with 50 nM control inhibitors or miR-27a inhibitors. [score:5]
In addition, miR-27a is a member of the miR-23a/27a/24-2 gene cluster, promoting the expression of M1 cytokines while reducing the expression of M2 cytokines, suggesting that it plays an important role in the activation and polarization of macrophages (39). [score:5]
Also, miR-27a significantly inhibited the expression of TGF-β-activated protein kinase 1 (TAK1) binding protein 2 (TAB 2)/3, an important component of the MAPK signaling pathway (Figure 1). [score:5]
Similarly, overexpression of miR-27a substantially decreased viral infectivity by repressing the expression of many lipid metabolism-related genes, which are essential for the production of HCV particles. [score:5]
Cells were transfected with mimic control, mimic, inhibitor control, and inhibitor of miR-27a for 48 h. MTS reagent (20 µl) was added in each well, and then cells were incubated at 37°C for 3 h in a humidified, 5% CO [2] atmosphere. [score:5]
Our analysis has revealed that miR-27a significantly inhibited the expression of TAB 2 and TAB 3 and has a putative binding site at the 3′-UTR of TAB 2. These observations prompted us to examine whether miR-27a influences the activation of the MAPK pathway during MAP infection. [score:5]
Although the difference for total viable bacterial count between the control and miR-27a inhibitor was less evident, there was a clear significant difference between miR-27a mimic and inhibitor group (Figures 8B,C). [score:5]
In addition, we found that miR-27a also upregulates the expression of pro-inflammatory cytokines after 18 h of MAP infection, compared to miR-27a control (Figure S2 in). [score:5]
miR-27a Upregulation Improves Macrophage Activation in Response to MAP Infection. [score:4]
We observed that mimic treatment of miR-27a promoted inflammatory responses of macrophages infected with MAP and then asked whether downregulation of miR-27a will affect macrophage response against MAP. [score:4]
The downregulation of miR-27a in MAP infection suggested that miR-27a could participate in the activation of macrophages. [score:4]
Figure 7Interleukin (IL)-10 and TGF-β-activated protein kinase 1 binding protein 2 (TAB 2) are direct targets of miR-27a. [score:4]
IL-10 and TAB 2 Are Direct Targets of miR-27a. [score:4]
Our results revealed that miR-27a is downregulated in BMDM and RAW264.7 cells activated with MAP and TLR2 agonist. [score:4]
Similarly, the study of Xie et al. reported that miR-27a was downregulated in mouse BMDM and human macrophages stimulated by TLR4 and TLR2 agonists (51). [score:4]
These findings suggest that both IL-10 and TAB 2 are direct targets of miR-27a. [score:4]
These data suggest that miR-27a negatively regulates the expression of IL-10 at both mRNA and protein levels in MAP-infected macrophages. [score:4]
Ji and colleagues determined that both miR-27a and miR-27b target the 3′-UTR of the retinoid X receptor α and play a similar role in regulating fat metabolism and cell proliferation during rat hepatic stellate cell activation (35). [score:4]
Furthermore, we examined whether miR-27a affects the components of MAPK pathway that regulate the expression of IL-10 during MAP infection. [score:4]
More recently, it has been reported that miR-27a controls various targets to regulate the immune system (34, 39). [score:4]
Our findings show that MAP infection inhibits the regulation of miR-27a and that miR-27a is a key mediator of macrophage polarization into M1 phenotype. [score:4]
Our results indicate that miR-27a negatively regulates the expression of IL-10 and hence promotes the ability of macrophages to eliminate intracellular MAP. [score:4]
BMDM and RAW264.7 cells were transfected with miR-27a (control, mimic, control -inhibitor, and inhibitor) for 48 h, and then cell viability was assessed by using the MTS assay (see ). [score:4]
Our data provide confirmation of the important role of miR-27a in the regulation of IL-10 expression in MAP-infected macrophages. [score:4]
BMDM cells were transfected with miR-27a control, mimic, and inhibitor. [score:3]
Recent studies mentioned that miR-27a and miR-27b play an important role in macrophage polarization by targeting the 3′-UTR of IRF4 (23). [score:3]
Similarly, our results show that miR-27a (miR-27a-3p; a mature form of miR-27a) promotes pro-inflammatory cytokines while inhibiting anti-inflammatory ones and modulating macrophage activation after MAP infection. [score:3]
Luciferase reporter vectors were constructed for wild and mutant 3′-UTR for IL-10 and TAB 2 target site of miR-27a (Figure 7B). [score:3]
The expression level of miR-27a was significantly higher in MAP-infected groups than in the MAP non-infected mimic -treated group (Figure 3C). [score:3]
MAP infection decreased the expression of miR-27a in a time -dependent manner in BMDM (Figures 2A,B) and RAW264.7 cells (Figures 2D,E). [score:3]
Similarly, it has been shown that miR-27a inhibits the production of IL-10 at both mRNA and protein levels and enhanced the signaling of NF-kB for cytokines production in hypoxia and reperfusion injury (67). [score:3]
In addition, Tak et al. reported that miR-27a/b similarly promotes mitochondrial membrane potential and mitochondrial ATP level by targeting the 3′-UTR of the mitochondrial fission factor (36). [score:3]
We observed similar results between miR-27a mimic and inhibitor for MAP (k-10)-infected macrophages (Figures 8B,D). [score:3]
Bone marrow-derived macrophages (BMDM) (A,B) and RAW 264.7 (C,D) cells were transfected with 50 nM miR-27a control, mimic, and inhibitor. [score:3]
miR-27a Promotes Antimicrobial Properties of Macrophages and Inhibits Intracellular Survival of MAP. [score:3]
Figure 2 Mycobacterium avium subspecies paratuberculosis (MAP) infection decreases miR-27a expression in macrophages and mice. [score:3]
A similar IL-10 expression was recorded in RAW264.7 macrophages treated with miR-27a at both protein and mRNA levels (Figure 3D). [score:3]
These results indicate that miR-27a inhibits the intracellular survival of MAP by promoting bactericidal activities of macrophages. [score:3]
MAP Infection Decreases miR-27a Expression in Macrophages and Mice. [score:3]
Furthermore, miR-27a enhanced in vitro IFN signaling, and patients who expressed high levels of miR-27a in the liver showed a more favorable response to antiviral therapy (81). [score:3]
Additionally, qRT-PCR data demonstrated that BMDM transfected with miR-27a mimic significantly increased the expression levels of miR-27a. [score:3]
The observed effects on IL-10 expression prompted us to examine whether miR-27a influences the activation of macrophages induced by MAP infection. [score:3]
The level of miR-27a decreased in BMDM cells by transfecting the cells with miR-27a inhibitor for 48 h and then infected them with MAP 0908. [score:3]
The following day, miR-27a mimic, inhibitor, and control were individually transfected into RAW264.7 and BMDM cells using lipofectamine 2000 reagent, according to manufacturer’s instructions. [score:3]
To test this hypothesis, BMDM cells were transfected with miR-27a control, mimic, and inhibitor. [score:3]
Additionally, transfection of RAW264.7 cells with miR-27a mimic showed a clearer difference in the intracellular survival of MAP than cells transfected with miR-27a inhibitor (0908) (Figure 8C). [score:3]
The expression levels of miR-27a were determined by qRT-PCR analysis. [score:3]
Overexpression of miR-27a decreased the production of IL-10 in MAP-infected macrophages. [score:3]
miR-27a Modulates MAPK Signaling Cascade by Targeting TAB 2 and TAB 3 in MAP-Infected Macrophages. [score:3]
Additionally, TLR2 agonist also showed a decrease in the expression of miR-27a in both types of macrophages (Figures 2C,F). [score:3]
These data suggest that miR-27a is a positive regulator for the induction of inflammatory cytokines in macrophages infected with MAP. [score:2]
Our findings explore the essential role for miR-27a in macrophage activation and MAP elimination and provide important information for the development of therapeutic interventions in paratuberculosis. [score:2]
Therefore, the regulation of miR-27a appears to be fundamental in keeping macrophage modulation and inflammatory responses. [score:2]
These findings suggest that miR-27a regulates macrophage activation by abrogating the anti-inflammatory environment created by MAP in infected macrophages for prolonged survival and growth. [score:2]
miR-27a Attenuates the Regulation of IL-10 in Macrophages Infected with MAP. [score:2]
In addition, miR-27a is one of the differentially regulating miRNAs in U937 macrophages activated with M. tb heat shock protein Hsp16.3 (40). [score:2]
Forty-eight hours after transfection, cells were lysed and the expression levels of miR-27a were determined by real-time PCR assay. [score:2]
We found that the level of miR-27a in BMDM cells increased by transfecting the cells with miR-27a mimic. [score:1]
Cells supernatant was collected at various time intervals (6 and 18 h) post-MAP (k-10 and 0908 strains) infection of different miR-27a transfected groups. [score:1]
We identified a putative binding site of miR-27a/b at the 3′-UTR of IL-10 and TAB 2 transcript in mice and also in other species (Figure 7A). [score:1]
However, miR-27a had no effect on the activity of a luciferase reporter that contained the mutant 3′-UTR of TAB 2 mRNA (Figures 7F,G). [score:1]
The expression of miR-27a was measured by using qRT-PCR analysis. [score:1]
We observed a gradual decrease in the level of miR-27a in MAP-infected murine macrophages and in the spleen and intestinal tissues of MAP-challenged mice. [score:1]
The minimum level of miR-27a was detected at 12–24 h time intervals in all groups. [score:1]
We found that miR-27a mimic -transfected BMDM cells after infection with MAP (0908) significantly reduced the phosphorylation of p38 and JNK at different times, while no significant difference was recorded for phosphorylated ERK. [score:1]
To test this hypothesis, we investigated whether miR27a participates in the expression of inflammatory mediators during MAP infection. [score:1]
The binding elements for miR-27a at the 3′-UTR of IL-10 and TAB 2 mRNAs were obtained by PCR amplification using mouse genomic DNA as template and cloned into pMir-Reporter Luciferase vector (Synbio Tech). [score:1]
Moreover, for in vivo determination of miR27a we challenged mice with MAP (0908) via intraperitoneal route. [score:1]
Cell viability among all transfected groups showed no significant difference after miR-27a transfection (Figures S4A,B in). [score:1]
We further analyzed the effects of miR-27a transfection on macrophage viability. [score:1]
Quantitative real-time PCR was performed by means of the miRcute miRNA qPCR detection kit (SYBR Green) for miRNA’s [miR-27a and internal references, small nucleolar S5 (mouse)]. [score:1]
First, we increased the level of miR-27a in BMDM cells by transfecting with miR-27a mimics for 48 h, and then cells were infected with MAP 0908 strain. [score:1]
Bone marrow-derived macrophage (BMDM) (A,B) and RAW264.7 (D) cells were transfected with 50 nM control mimics or miR-27a mimics. [score:1]
Figure 1Schematic diagram depicting the role of miR-27a in Mycobacterium avium subspecies paratuberculosis (MAP) -mediated signaling pathways in macrophage. [score:1]
HEK293 and BMDM cells were cultured in 24-well plates (2.5 × 10 [4] cells/well) overnight and transfected with 50 nM control mimics or 50 nM/ml miR-27a mimics using a Lipofectamine 2000. [score:1]
Although major milestones have been achieved regarding the study of macrophages as an integral part of the innate immune responses against MAP, further molecular research is required to determine whether therapeutic interventions with miR-27a in the modulation of macrophage activation could be a realistic approach for the control of MAP infection in humans and large animals. [score:1]
Early studies reported that miR-27a and miR-27b have antiviral activities against murine cytomegalovirus infection in different mouse cell lines (34). [score:1]
Our results provide a novel role for miR-27a as a potential biomarker that can be exploited for control strategies of MAP infection. [score:1]
We also found that miR-27a decreased the activity of the luciferase reporter that contained the wild-type 3′-UTR of TAB 2 mRNA in both BMDM and HEK293 cells. [score:1]
The seed sites of miR-27a/b and its binding sites at the 3′-UTR of IL-10 and TAB 2 are shown in blue and red color, respectively. [score:1]
We asked whether miR-27a participates in inflammatory responses associated with MAP (0908 and k-10) infection. [score:1]
We demonstrated that miR-27a enhances pro-inflammatory cytokines, while decreasing IL-10 production and the intracellular survival of MAP, indicating that miR-27a promoted macrophage -mediated bacterial elimination. [score:1]
Recent studies have demonstrated that miR-27a participates in the inflammatory responses of macrophages stimulated by LPS (39). [score:1]
To determine whether miR-27a plays a role in the immune responses against MAP infection, we investigated the expression of miR-27a in vivo and in vitro. [score:1]
These findings suggest that miR-27a modulates MAPK signaling pathways activated by MAP in infected macrophages. [score:1]
[1 to 20 of 118 sentences]
3
[+] score: 337
Whereas, in the cancers of esophagus [18], oral cavity [19], lung [21], and head and neck [34], miR-27a is downregulated, and miR-27a directly targets MET and EGFR and suppresses their expression in lung cancer [21]. [score:11]
In the current study, we found that, similar as SGPP1, Samd2 expression at mRNA and protein levels was upregulated in colorectal cancers and cell lines, exhibiting oncogenic phenotypes; moreover, Smad2 was repressed at transcriptional and translational levels by miR-27a, suggesting the direct target of miR-27a, a novel finding that has not been reported previously. [score:11]
B, miR-27a was frequently downregulated in human colorectal cancers (30 of 41 cancers exhibited downregulation and 11 cases showed upregulation, in comparison to the adjacent normal tissues). [score:10]
Several studies have also observed that miR-27a exhibited oncogenic activity by directly suppressing ZBTB10/RINZF expression [10], [17], resulting in upregulation of transcription factor specificity protein (Sp), vascular endothelial growth factor (VEGF) and VEGF receptor 1 (VEGFR1). [score:9]
Using comprehensive approaches, including qRT-PCR, immublotting and in situ immunohistochemical staining, we showed that the expression of SGPP1 at mRNA and protein levels were upregulated in colorectal cancers and colorectal cancer cell lines, which were inversely correlated with the expression of miR-27a. [score:8]
In comparison with the adjacent normal colon mucosa, 73% (30/41) of colorectal cancer tissues shown reduced miR-27a expression, and only 27% (11/41) colorectal cancers exerted upregulated expression of miR-27a, the difference was significant (Figure 1B, p<0.01). [score:8]
For instance, several studies have reported that miR-27a acts as an oncogene, whose expression is upregulated in breast cancers [11], [12], colon cancer cell lines [13]– [15], and in hepatocellular adenocarcinoma cells [16], and that the increased expression of miR-27a is associated with breast cancer progression and poor outcomes [11], [12]. [score:8]
Using the approaches of miRNA array, systemic biology, in vitro manipulating expression of miR-27a and in vivo tumor-bearing mouse mo del, we found that miR-27a acted as a tumor suppressor in colorectal cancer, which was through targeting SGPP1 and Smad2. [score:7]
To determine whether miR-27a could repress SGPP1 and Smad2 expression by targeting its binding site at 3′-UTR in SGPP1 and Smad2, the PCR products containing full length of 3′-UTR with intact target site of miR-27a recognition sequences were inserted into the luciferase reporter vector. [score:7]
For example, miR-27a directly suppresses ZBTB10/RINZF expression [10], [17]. [score:6]
Importantly, the downregulated miR-27a was also associated with colorectal cancer pathological stages and distant metastasis, showing tumor suppressor roles in colorectal cancer. [score:6]
In summary, we have demonstrated that miR-27a is frequently downregulated in colorectal cancer, and the reduced miR-27a is correlated with cancer distant metastasis and histopathological stages, and thus, miR-27a acts as a tumor suppressor. [score:6]
Previous studies have demonstrated that ZBTB10/RINZF is a direct target of oncogenic miR-27a in breast cancers [10], [17] and colon cancer cell lines [15], but this could not be the case in the colorectal cancer tissues because herein miR-27a seemed to be a tumor suppressor in colorectal cancers. [score:6]
and in turn upregulates VEGF and VEGF receptor in the cancers of breast [11], [12] and colon [13]– [15], and overexpression of miR-27a is associated with poor outcomes [11], [12]. [score:6]
In another hand, miR-27a has also shown tumor suppressor roles, such as miR-27a is downregulated in esophageal cancers [18], oral squamous cell carcinoma [19], acute leukemia [20], and in non-small cell lung cancer (NSCLC) [21]. [score:6]
In NSCLC, miR-27a directly targets MET and EGFR 3′ UTR, leading to reduced expression of MET and EGFR [21]. [score:6]
We further narrowed down the targets using GO program, and the targets at the categories of cellular process, single organism process, biological regulation and metabolic process, etc, exhibited stronger scores, meaning more relevant to miR-27a -associated functions in cancer formation and progression (Supplemental Materials Figure S1B). [score:6]
More importantly, the reduced expression of miR-27a was also associated with colorectal cancer pathological stages – miR-27a levels were more downregulated at stages III/IV than those at stage II (Figure 1C, p<0.0001). [score:6]
As shown in Figure 1D, miR-27a expression was downregulated 95%, 90% and 52% in HCT116, Caco-2 and SW480 cells, respectively, compared to the immortalized normal human colon epithelial cell NCM460. [score:5]
C, miRNA-27a inhibited SGPP1 and Smad2 mRNA expression in HCT116 cells. [score:5]
First, in vitro studies showed that increased expression of miR-27a inhibited colorectal cancer cell proliferation, promoted apoptosis and attenuated cancer cell migration. [score:5]
As SGPP1 and Smad2 were likely the targets of miR-27a, we then determined the expression levels of SGPP1 and Smad2 in human colorectal cancers and cancer cell lines. [score:5]
The mechanistic studies further showed that miR-27a -mediated tumor suppressor could be through targeting SGPP1, Smad2 and STAT3. [score:5]
Among the hundreds of targets, the two novel targets of miR-27a, Sphingosine-1-phosphate phosphatase 1 (SGPP1) and Smad2, were chosen for further studies. [score:5]
Previous studies have also shown therapeutic role of Smad2, that blocking Smad2 could suppress TGF-β -induced tumorigenesis, epithelial-mesenchymal transition (EMT), cell motility, and invasion [45], indicating that targeting miR-27a/Smad2 could have a great impact on developing a novel strategy for colorectal cancer therapy. [score:5]
Both in vivo and in vitro studies have identified SGPP1 and Smad2 as two novel targets of miR-27a, which is linked to STAT3 to regulate cancer cell proliferation, apoptosis and migration. [score:4]
Above findings strongly suggested miR-27a was frequently downregulated in colorectal cancers. [score:4]
miR-27a was down-regulated in Muc2−/− colonic epithelial cells and human colorectal cancers. [score:4]
In this study, we found that miR-27a was significantly downregulated in colorectal cancers and colorectal cancer cells. [score:4]
Therefore, miR-27a could be a useful biomarker for colorectal cancer development and progression, and also could have a therapeutic potential targeting SGPP1, Smad2 and Stat3 for colorectal cancer therapy. [score:4]
These findings strongly suggested that miR-27a could be used as a biomarker to monitor cancer development and progression, and could be used as a potential therapeutic target and even a potential therapeutic agent for colorectal cancer. [score:4]
Both dual luciferase assay and increasing expression of miR-27a further showed the inhibitory effects of miR-27a on SGPP1. [score:4]
Thus, this is the first to reveal that SGPP1 is a potent direct target of miR-27a, although the evidence of direction regulatory interaction is needed for further investigation. [score:4]
We found that besides the downregulation of total STAT3 by miR-27a, the phosphorylated STAT-3 (p-STAT3) was also dramatically repressed by miR-27a (Figure 4E). [score:4]
SGPP1 and Smad2 protein levels were also downregulated by miR-27a on both HCT116 and SW480 colorectal cancer cells (Figure 2D). [score:4]
Second, in a tumor-bearing mouse mo del, a direct injection of miR-27a to tumor suppressed tumor growth. [score:4]
The expression levels of miR-27a were further determined in human colorectal cancer cell lines. [score:3]
To determine miR-27a tumor suppressing functions, miR-27a precursor were transfected into the HCT116 cell, and the effects on cell proliferation, apoptosis and migration were analyzed. [score:3]
The repression of SGPP1 and Smad2 expression by miR-27a were determined by qRT-PCR and immunoblotting. [score:3]
miR-27a targets prediction. [score:3]
To determine the role of miR-27a in colonic epithelial cell malignant transformation, miR-27a expression levels were determined in human colorectal cancer and their adjacent tissues. [score:3]
Figure S1 Prediction of miR-27a targets. [score:3]
To determine the mechanisms of miR-27a mediated inhibition of cell proliferation and migration and enhancement of apoptosis, we determined the changes of STAT3 and Caspase3. [score:3]
miR-27a targeted SGPP1 and Smad2. [score:3]
miR-27 tumor suppressor functional studies. [score:3]
SGPP1 and Smad2 were overpressed in human colorectal cancer cells and cancer tissues, which were inversely correlated with miR-27 expression. [score:3]
Therefore, it is essential to determine whether the reduction of miR-27a is involved in colorectal cancer formation and progression, and it is warranted to identify miR-27a targets and reveal the underlying molecular mechanisms. [score:3]
D, miR-27a suppressed SGPP1 and Smad2 protein in colon cancer cells HCT116 and SW480. [score:3]
Expression levels of miR-27a were normalized to the corresponding levels of SNORD44. [score:3]
This study was to determine the expression of miR-27a and association with colorectal cancer formation, progression and the underlying mechanisms. [score:3]
shtml) were used to predict miR-27a targets. [score:3]
A, miR-27a suppressed tumor growth. [score:3]
As shown in Figure 4A and 4B, increasing miR-27a significantly inhibited cancer cell proliferations after 48 and 72 h at HCT116, Caco-2 and SW480 cells, although the effects at 24 h post transfection were not changed. [score:3]
Since genetic deficiency of the Muc2 gene in mice causes colorectal cancer formation, the decreased expression of miR-27a in colonic epithelial cells could be involved in the carcinogenesis. [score:3]
Functional studies have shown that miR-27a has shown both oncogenic and tumor suppressive functions in different cell lines and human cancer tissues. [score:3]
SGPP1 and Smad2 were the targets of miR-27a. [score:3]
To determine miR-27a tumor suppressing effects in vivo, we transplanted murine colon cancer cells MC38 into wild-type C57Bl/6 mice and injected a mixture of miR-27a precursor and Lipofectamine 2000 into the tumors when the tumors were palmable at day 21 post inoculation. [score:3]
C, Differential expression of miR-27a at stage II and stage III/IV cancers. [score:3]
For each sample, firefly luciferase activity was normalized to Renilla luciferase activity and the inhibition of miR-27a on SGPP1 3′-UTR and Smad2 3′-UTR was normalized to the control mimics. [score:3]
We employed multiple tools to predict novel targets of miR-27a. [score:3]
miR-27a inhibited murine colon cancer cell MC38 growth in vivo. [score:3]
0105991.g004 Figure 4 A, miR-27a inhibited cancer cell proliferation at SW480, HCT116 and Caco 2 cells, assayed by MTS. [score:2]
MiR-27a inhibited cell proliferation, enhanced apoptosis and attenuated cancer cell migration. [score:2]
MiR-27a inhibited cancer growth in mice. [score:2]
MiR-27a expression was reduced in Muc2−/− mouse colonic epithelial cells, in human colorectal cancer tissues and colorectal cancer cells. [score:2]
A, miR-27a inhibited cancer cell proliferation at SW480, HCT116 and Caco 2 cells, assayed by MTS. [score:2]
Compared to the adjacent normal colon mucosa, both SGPP1 and Smad2 expression were much higher at colorectal adenocarcinomas (Figure 3B), negatively correlated with miR-27a levels in colorectal cancers in which miR-27a was frequently reduced (Figure 1B). [score:2]
When xenografts were palmbable at day 21, a mixture of miR-27a precursor and Lipofectamine 2000 was directly injected into the tumors. [score:2]
B, miRNA-27a suppressed SGPP1 and Smad2 reporter activities assayed by Dual Luciferases in HCT116 cells. [score:2]
Compared to vector control, miR-27a treatment significantly inhibited cancer cell growth in mice, in terms of significant reduction of tumor sizes and weight (Figure 5A, 5B). [score:2]
MiR-27a expression was reduced in Muc2−/− mouse colonic epithelial cells, in human colorectal cancer tissues and colorectal cancer cellsOur previous studies have demonstrated that Muc2−/− mice spontaneously developed colorectal cancers and the carcinogenesis is linked to chronic inflammation [9], [22], [28], [29]. [score:2]
MiR-27a targets prediction. [score:2]
D, miR-27a expression was reduced in colorectal cancer cell lines, compared to the immortalized normal colon epithelial cell (NCM460). [score:2]
A, There was one miR-27a binding site at SGPP1 3′-UTR, and there were two miR-27a binding sites at Smad2 3′-UTR. [score:1]
6.26 µg of miR-27a precursor or negative miRNA (GenePharma, Shanghai, China) mixed with 1.6 µl transfection reagent Lipofectamine 2000 (Invitrogen) in 50 µl PBS were injected into the tumors every 3 days, for total of 3 times. [score:1]
In addition, reduced miR-27a was correlated with distant metastasis (Table 1). [score:1]
To detect apoptosis, the HCT116 cells were transfected with miR-27a precursor or negative control miRNA precursor. [score:1]
Negative miR-27a precursor (GenePharma, Shanghai) was also transfected as negative controls. [score:1]
E, miR-27a affected STAT3 and Caspase3 levels in HCT116 and SW480 cells. [score:1]
Genomic alignment showed that 3′-UTR of SGPP1 and Smad2 have one or two miR-27a binding sites (Figure 2A). [score:1]
0105991.g002 Figure 2 A, There was one miR-27a binding site at SGPP1 3′-UTR, and there were two miR-27a binding sites at Smad2 3′-UTR. [score:1]
As reported previously [26], the HCT116 cells transiently transfected with miR-27a precursor or negative control miRNA precursor were seeded in a 100-mm Petri dish. [score:1]
We found that miR-27a was significantly reduced in human colorectal cancer tissues and in colorectal cancer cell lines. [score:1]
In addition, increasing miR-27a significantly enhanced cancer cell apoptosis (45% at miR-27a groups versus 15% at vector control group, p<0.01). [score:1]
Since miR-27a was reduced in human colorectal cancers, we determined whether p-STAT3 was increased in colorectal cancers. [score:1]
Both SGPP1 and Smad2 mRNA levels were inversely correlated with the miR-27a levels at these human colorectal cancer cells (Figure 1D). [score:1]
One of the most changed miRNAs was miRNA-27a (miR-27a). [score:1]
As shown in Figure 2C, SGPP1 and Smad2 mRNA levels were repressed about 60% and 50% by miR-27a in HCT116 cells, respectively, consistent with the repression on their reporter luciferase activities. [score:1]
C, miR-27 levels in tumors from untreated (NC) and miR-27a treated groups were validated by qRT-PCR. [score:1]
Briefly, 1×10 [5] cells were seeded into 96-well plate transfected with 0.2 µg of miR-27a precursor with 0.5 µl Lipofectamine (Invitrogen, Carlsbad, CA). [score:1]
SGPP1 and Smad2 were inversely correlated with miR-27a in colorectal cancer. [score:1]
Twenty-four hours after plating, 4.0 µg of miR-27a precursor were transfected to the cells with Lipofectamine (Invitrogen, Carlsbad, CA) following the manufacture’s protocol. [score:1]
In brief, 10 pmol of miR-27a mimics or negative miRNA mimics (negative control) was co -transfected into cells with 100 ng of psiCHECK-2-3′-UTR-SGPP1 or psiCHECK-2-3′-UTR-Smad2, respectively, using DharmaFect Duo reagent (Dharmacon, Lafayette, CO, USA). [score:1]
The new signal pathway of miR-27a-Smad2-TGF-β could also contribute to the inhibitory role of miR-27a on cancer cell migration (Figure 4D), invasion and metastasis, detailed mechanism is under investigation. [score:1]
miR-27a precursor and miR-27a mimics were purchased from Shanghai GenePharma (Shanghai, China). [score:1]
The correlation between miR-27a levels and clinicopathological features. [score:1]
For immunoblotting, the human colon cancer cells HCT116 and SW480 were collected 72 hours after transfection with miR-27a precursor or negative control miRNA precursor. [score:1]
qRT-PCR showed that miR-27a level was still at a higher level in the tumors isolated from mouse xenografts (Figure 5C). [score:1]
Based on potential biology roles in proliferation and inflammation, miRNA profile and published literatures, miR-27a was chosen for further studies. [score:1]
[1 to 20 of 99 sentences]
4
[+] score: 305
Similarly, enhanced expression of hepatic miR-27a alleviated the development of NAFLD in obese mice through inhibiting Fasn and Scd1 expression and hepatic lipogenesis (Fig.   4). [score:8]
Impressively, miR-27a was revealed to be downregulated in human HCC samples and plays as a tumor suppressor in tumor metastasis and vasculogenic mimicry via targeting Twist-1 in HCC [38]. [score:8]
The miR-27a -overexpressed livers exhibited unaltered expression of other lipogenic -associated genes (Fig.   3k), as well as genes involved in hepatic β–oxidation, FFA intake, vLDL secretion and gluconeogenesis (Fig.   S3g), but much lower expression of inflammatory and fibrogenic cytokines (Fig.   3m), indicating alleviated hepatitis and fibrosis. [score:7]
We firstly reported miR-27a directly targeted 3′-UTR of mouse Fasn and Scd1, and regulated their expression in mouse primary hepatocytes (Fig.   1) and livers (Fig.   2). [score:7]
miR-27a directly targets Fasn and Scd1To identify miRNAs involved in the pathogenesis of NAFLD, we explored hepatic miRNAs with alterations in expression levels during the development of NAFLD. [score:7]
To determine whether miR-27a inhibiting hepatic expression of Fasn and Scd1, isolated mouse primary hepatocytes were transfected with miR-27a mimics to raise miR-27a levels (Fig.   1e) or with miR-27a inhibitors to reduce endogenous miR27a (Fig.   1g). [score:7]
In consistent to the results of ex vivo study, in the livers of NCD-fed mice, upregulated miR-27a resulted in dramatic reduction of Fasn and Scd1 mRNA (Fig.   3i), but didn’t alter expression levels of other lipogenic -associated genes, including Accca, Dgat1, Dgat2, Acl, Srebp1c, Pparg and Rxra (Fig.   3i). [score:6]
Shirasaki et al. also demonstrated miR-27a could impair oleic acid -induced lipid accumulation and regulate lipid metabolism in human hepatoma cells through targeting RXRa and ABCA1, and then inhibit Hepatitis C virus replication [21]. [score:6]
To compare miR-27a with other obesity -modified miRNAs, expression levels of hepatic miR-122 and miR-132 were also analyzed and found to be dramatically upregulated in livers of HFD-fed and ob/ob mice (Fig.   S1) as described in previous reports 27, 30. [score:6]
In summary, our study firstly reveals a novel and critical role of miR-27a in regulating hepatic DNL and NAFLD development via targeting Fasn and Scd1. [score:5]
Furthermore, ectopic expression of miR-27a repressed the expression of Fasn and Scd1 rather than other genes involved in hepatic lipid metabolism (Fig.   3). [score:5]
Overexpressed miR-27a reduced lipid accumulation in primary hepatocytes and mice liver by repressing expression levels of Fasn and Scd1. [score:5]
Together, our results demonstrated that miR-27a suppressed oleate -induced hepatic lipid accumulation via suppressing Fasn and Scd1 in primary hepatocytes. [score:5]
Our results reveal miR-27a acts as a negative regulator in hepatic DNL and suppresses the development of NAFLD induced by HCD and genetic obesity. [score:5]
In our present study, we reported that overexpressed miR-27a attenuated DNL and lipid accumulation in both primary hepatocytes and mice livers by targeting 3′-UTR of Fasn and Scd1 mRNAs. [score:5]
However, we didn’t find overexpressed hepatic miR-27a displayed any influence on the expression of Pparg in primary hepatocytes, or liver, skeletal muscle and adipose tissue of NCD-fed or HFD-fed mice or ob/ob mice (Figs 2– 4 and S5 and S7). [score:5]
Adenovirus -mediated overexpression of miR-27a also led to the reduction of mRNA levels of Fasn and Scd1 rather than other lipogenesis -associated genes, and didn’t affect the expression of cytokines involved in inflammation and fibrosis (Fig.   2d). [score:5]
Ectopic expression of miR-27a reduced liver TG content by suppressing hepatic Fasn and Scd1, and thereby ameliorated NAFLD in HCD-fed and ob/ob mice. [score:5]
To investigate molecular targets of miR-27a, we examined miR-27a-modulated signaling pathways by the using of miRNA target prediction algorithm Targetscan (http://www. [score:5]
Surprisingly, enforced expression of Fasn and Scd1 could abolish the inhibition effects of excess miR-27a on TG accumulation (Fig.   1g) but not affect those of miR-122 (Fig.   S2b) in primary hepatocytes. [score:5]
As hepatic DNL is known to be stimulated by HCD feeding but inhibited by HFD feeding, we postulated that miR-27a was involved in the development of NAFLD via regulating DNL in liver. [score:5]
Expectedly, overexpression of miR-27a strongly suppressed oleate -induced reduction of cell viability (Fig.   2e) and reduced cell apoptosis led by oleate treatment (Fig.   2f). [score:5]
Enforced expression of Fasn and Scd1 abolished the inhibition effects of excess miR-27a on TG accumulation (Fig.   2g) but not those of miR-122 (Fig.   S2c) in primary hepatocytes. [score:5]
Moreover, results of trichrome staining of miR-27a -overexpressed livers showed robust reduction of fibrosis and lower NAFLD activity score (Fig.   3f,g), reflecting improved NAFLD development. [score:4]
Ectopic expression of miR-27a in liver attenuated the development of NAFLD induced by HCD feeding and genetic obesity through impairing lipogenic programs. [score:4]
Luciferase activities of wildtype 3′-UTRs reporter plasmids were dramatically downregulated after the addition of miR-27a mimics in HEK293T cells (Fig.   1c,d). [score:4]
Mechanistically, upregulated hepatic miR-27a also attenuated mRNA and protein levels of FAS and SCD1 in livers (Fig.   4I,j) but not in skeletal muscle or adipose tissue (Fig.   S6b,c). [score:4]
miR-27a directly targets Fasn and Scd1. [score:4]
But in livers of HCD-feeding mice, which hepatic lipogenesis is robustly promoted, miR-27a exhibited an insignificant reduction while miR-122 and miR-132 were dramatically upregulated (Fig.   S2b). [score:4]
MiR-27a was recently reported to repress lipid accumulation in rat hepatic stellate cell and human hepatoma cell by targeting RXRα 21, 22 and impair adipocyte differentiation by targeting PPARg [23], indicating its potential role in lipid metabolism. [score:4]
Taken together, these data revealed that miR-27a acts as a crucial repressor in hepatic lipogenesis and suppressed the development of obesity -induced NFALD. [score:4]
Furthermore, ectopic expression of miR-27a or miR-122 could block sodium oleate -induced TG accumulation in primary hepatocytes, respectively (Figs  1g and S2b). [score:3]
To explore the physiological role of miR-27a in vivo, C57BL/6 J mice were injected with adenovirus via tail vein to enforce its expression in livers. [score:3]
The increase of hepatic miR-27a mediated by adenovirus sufficiently inhibited hepatic TG, lipid droplets formation and hepatic steatosis in livers of mice maintained on HCD (Fig.   3). [score:3]
With the fact that obesity-initiated NAFLD markedly increases the risk of HCC, the benefic effects of miR-27a on fatty liver and NAFLD in our studies suggest that excess miR-27a could suppress obesity -induced HCC pathogenesis. [score:3]
Primary hepatocytes were transfected with miR-27a mimics (10 pmol/ml), inhibitors (50 pmol/ml), miR-122 mimics (5 pmol/ml) or negative control (10 pmol/ml) using HiPerFect (Qiagen) as per manufacturer’s instructions and following experiments were performed 48 h after transfection. [score:3]
The cells were firstly transfected with miR-27a mimics or combined with plasmids to overexpress Fasn and Scd1, and then treated with sodium oleate (1 mmol/l) for 24 hours. [score:3]
Figure 4Ectopic expression of miR-27a alleviates hepatosteatosis and NAFLD in ob/ob mice. [score:3]
Further studies revealed that except of liver, adenovirus administration didn’t lead to the changes of miR-27a expression in other main metabolic tissues (including skeletal muscle and adipose tissue) (Figs  S4 and S6), indicating miR-27a of skeletal muscle or adipose tissue doesn’t contribute to the phenotypes in our present study. [score:3]
Ectopic expression of miR-27a alleviated HCD -induced NAFLD via repressing lipogenesis in mice liver. [score:3]
miR-27a suppresses lipid accumulation in primary hepatocytes. [score:3]
Ectopic expression of miR-27a in liver didn’t disturb mRNA levels of other lipogenesis -associated genes (Fig.   4i) or genes involved in β–oxidation, FFA intake and vLDL secretion (Fig.   S5f). [score:3]
These results reveal the critical role of miR-27a-FAS/SCD1 axis in regulating lipid metabolism in liver and the development of NAFLD. [score:3]
In our studies of in vivo, we found that a ~10-fold in NCD-feeding mice, or a ~15-fold in HCD-feeding and ob/ob mice (Figs  3a and 4a) increase of hepatic miR-27a were efficient enough to repress hepatic Fas and Scd1 expression and therefore alleviate NAFLD. [score:3]
More than 900 candidate genes were predicted as targets of miR-27a and functional gene ontology enrichment analysis revealed most of these genes were involved in cytoskeleton remo deling and lipid metabolism signaling pathways, including lipogenesis -associated genes, such as FAS, SCD1, PPARg and RXRa (data not shown). [score:3]
MiRNA double-stranded mimics for miR-27a and miR-122, and inhibitors for miR-27a were obtained from Qiagen. [score:3]
Further studies also revealed overexpression of hepatic miR-27a efficiently repressed HCD-initiated liver damage (Fig.   3h), hyperglycemia and hyperinsulinemia (Fig.   S3d), indicating improved systemic glucose homeostasis and insulin sensitivity. [score:3]
Although RXRα is a critical mediator in hepatic DNL process, we didn’t find overexpressed hepatic miR-27a affected mRNA levels of Rxra in liver, skeletal muscle or adipose tissue of NCD-fed or HCD-fed mice or ob/ob mice (Figs 2– 4 and S4 and S6), which is inconsistent with previous reports 21, 22. [score:3]
These results exclude the possibility that miR-27a exerts its functions on hepatic lipid metabolism via targeting Pparg. [score:3]
Excess miR-27a attenuated expression levels of Fasn and Scd1 but not Accca in primary hepatocytes (Fig.   1f). [score:3]
MiR-27a was identified as a negative regulator of adipocyte differentiation by targeting PPARg [23], which is also a critical mediator in hepatic DNL. [score:3]
In our data, overexpression of hepatic miR-27a dramatically blocked sodium oleate -induced lipid accumulation in mouse primary hepatocytes (Fig.   2) and reduced hepatic TG content by impairing DNL of liver (Fig.   3). [score:3]
Impressively, livers of ad-miR-27a-administered mice displayed a substantial reduction in the synthesis of fatty acids but not sterols relative to control livers (Fig.   3j), indicating impaired lipogenesis in miR-27a -overexpressed livers. [score:3]
To further determine the roles of miR-27a in obesity -induced NAFLD, ob/ob mice were administered with ad-miR-27a to enforce the expression of miR-27a in livers instead of skeletal muscle and adipose tissue (Figs  4a and S6a). [score:3]
Figure 3Ectopic expression of miR-27a attenuates hepatic lipid accumulation and improves HCD -induced NAFLD via repressing hepatic lipogenesis in mice. [score:3]
Previous study indicated miR-27a is involving in lipid metabolism and inhibits lipid droplets formation in rat hepatic stellate cells [22]. [score:3]
Subsequently, mice were maintained on HCD for 8 weeks to induce NALFD and then administered with ad-miR-27a to increase miR-27a expression levels in livers (Fig.   3a). [score:3]
For overexpression of miR-27a, male C57BL/6J mice at the age of 10weeks, ob/ob mice at the age of 16 weeks or 14-week-old C57BL/6J mice after maintained on HCD for 8 weeks were injected intravenously through the tail vein with adenovirus encoding scramble RNA (Ad-NC) or miR-27a (Ad-miR-27a) with PFU at 5 × 10 [9] in 1 mL PBS. [score:3]
Notably, ad-miR-27a-administered ob/ob mice also displayed reduced expression of proinflammatory and fibrogenic genes in liver (Fig.   4k), decreased plasma TG and improved hyperglycemia and hyperinsulinemia (Fig.   S5c,d). [score:3]
Interestingly, Fasn and Scd1 were found to be promising targets of miR-27a and miR-27b in sequence alignments (Fig.   1a,b). [score:3]
The recombinant adenoviruses expressing miR-27a or scramble RNA were generated by the use of AdEasy [TM] Vector System (Invitrogene). [score:3]
Further studies are indeed needed to explore an exact extent of miR-27a expression which is required to improve obese-initiated NAFLD. [score:3]
Ectopic expression of miR-27a improved NALFD in obesity mice. [score:3]
To verify excess miR-27a reduce intracellular lipid accumulation via repressing Fasn and Scd1, we enforced expression of Fasn and Scd1 in primary hepatocytes. [score:3]
To determine miR-27a directly binding to 3′-UTR of Fasn and Scd1, renilla luciferase reporter plasmids were constructed with the insertion of predicted miR-27a binding sites inside of mouse Fasn and Scd1 mRNA (Fig.   1c,d). [score:2]
However, there are still no published studies implicating that hepatic miR-27a promotes liver cancer development. [score:2]
Mutated reporter plasmids were constructed through deleting potential miR-27a binding sites under the instruction of gene mutation kit (Beijing Dingguo). [score:2]
In our present study, miR-27a was revealed to act as a critical repressor in regulating hepatic DNL and obesity-initiated NAFLD progression. [score:2]
Our results revealed that miR-27a exerted its functions in hepatic lipid metabolism via regulating DNL rather than disturbing β-oxidation, FFA uptake and vLDL secretion (Fig.   3), indicating its important role in the pathogenesis of NAFLD. [score:2]
However, mutation of predicted binding sites almost recovered the loss of luciferase activities mediated by excess miR-27a (Fig.   1c,d). [score:2]
These data revealed that miR-27a regulated the stability of Fasn and Scd1 mRNA by binding to their 3′-UTRs. [score:2]
MiR-27a targeted 3′-UTRs of mouse Fasn and Scd1 mRNAs. [score:2]
16-week-old ob/ob mice were administered with Ad-NC and Ad-miR-27a (n = 8 per group). [score:1]
Impressively, ~10-fold increase of miR-27a acquired by transfection with 1 pmol/well was enough to get 20% reduction in TG accumulation induced by sodium oleate in primary hepatocytes (Fig.   S2b). [score:1]
Consistently, excess miR-27a alleviated oleate-initiated lipid accumulation of hepatoytes as well as excess miR-122 (Fig. 2g and S2c). [score:1]
MiR-27a excess was reported to act as an oncogene in the development of gastric and nasopharyngeal cancers 36, 37. [score:1]
Relative to control mice, we didn’t detect any changes of miR-27a levels in skeletal muscle or adipose tissue in the mice administered with ad-miR-27a (Fig.   S4a,b). [score:1]
Moreover, the abrogation of endogenous miR-27a efficiently gave rise to mRNA levels of Fasn and Scd1 rather than Accca (Fig.   1h). [score:1]
These results suggest the functions and underlying molecular mechanisms of miR-27a might be different from other obesity -modified miRNAs (e. g. miR-122 and miR-132) in various contexts of fatty livers. [score:1]
The seed regions of miR-27a and miR27b are indicated in bold. [score:1]
Prepared primary hepatocytes were transfected with either miR-27a mimic or ad-miR-27a, and then were scraped and centrifuged after incubation for 48 h. Livers tissues were homogenized with PBS. [score:1]
Impressively, excess miR-27a robustly impaired intracellular lipid accumulation and TG contents in oleate -treated primary hepatocytes (Fig.   2a–c). [score:1]
Significant alterations of body weight and food intake weren’t detected in mice after ad-miR-27a administration (Fig.   S3a,b). [score:1]
As expected, miR-27a levels were found to increase about 10 times in livers (Fig.   3a) but displayed no difference in other major metabolic organs, including skeletal muscle and adipose tissue (Fig.   S4a,b) of mice administered by ad-miR-27a relative to that of ad-NC. [score:1]
Meanwhile, miR-27a exhibited an insignificant decrease in the livers of mice after feeding HCD for 8 weeks (Fig.   S1b). [score:1]
Administration of ad-miR-27a also displayed reduced contents of free fatty acid (FFA) but equal cholesterol contents in livers (Fig.   3c). [score:1]
To explore the accurate extent of miR-27a excess which is efficient to repress TG accumulation, we transfected primary hepatocytes with serial volumes of miR-27a mimics from 0.1–100 pmol per well (24-well plate) and got different abundance of miR-27a in the cells (Fig.   S2a). [score:1]
In comparison with control mice, ad-miR-27a -treated mice didn’t show any significant changes of mRNA levels of genes involved in hepatic β–oxidation, FFA intake, vLDL secretion and gluconeogenesis, as well as hepatic inflammation and fibrosis in livers under NCD feeding (Fig.   S3f). [score:1]
Strikingly, in comparison to control mice, hepatic miR-27a displayed about 4-fold increase in mice maintained on HFD for 12 weeks (Fig.   S1a) and nearly 2-fold increase in ob/ob mice (Fig.   S1c). [score:1]
Relative to control mice, excess hepatic miR-27a in ob/ob mice resulted in marked reductions in liver weight (Fig.   4b) and hepatic contents of TG, FFA and cholesterol (Fig.   4c), impaired hepatosteatosis (Fig.   4d,e), improved NAFLD (Fig.   4f,g) and liver damage (Fig.   4h), but the same levels body weight and food intake (Fig.   S5a,b). [score:1]
Histology analysis also demonstrated decreased lipid accumulation in the livers of mice with excess hepatic miR-27a (Fig.   3d,e), indicating alleviated hepatic steatosis. [score:1]
In HCD-fed mice, excess hepatic miR-27a led to a much lower levels of FAS and SCD1 in both mRNA and protein in liver (Fig.   3k,l), but not in skeletal muscle and adipose tissue (Fig.   S4c,d). [score:1]
Impressively, with similar liver weight (Fig.   3b), ad-miR-27a -injected mice exhibited significant reduction of hepatic TG contents relative to control mice (Fig.   3c). [score:1]
mRNA of mouse Fasn and Scd1 containing potential miR-27a binding sites were cloned into pMiR-GLO vector (Invitrogene). [score:1]
With similar body weight and food intake as control mice (Fig.   S3a,b), ad-miR-27a -injected mice exhibited reduced liver weight (Fig.   3b) and lower hepatic lipids contents, including TG, FFA and cholesterol (Fig.   3c). [score:1]
Interestingly, in these fatty livers, miR-27a displayed a similar change as miR-122 and miR-132 did. [score:1]
To investigate physiological roles of miR-27a in hepatic lipid metabolism, mouse primary hepatocytes were infected by adenovirus to enforce miR-27a expression and then treated with sodium oleate to induce excess lipid accumulation. [score:1]
In determining the accurate extent of miR-27a excess which is efficient to repress TG accumulation, we found that ~10-fold increase of miR-27a could lead to a 20% reduction of TG accumulation induced by sodium oleate in primary hepatocytes (Fig.   S3b). [score:1]
[1 to 20 of 98 sentences]
5
[+] score: 278
Other miRNAs from this paper: mmu-mir-27b
86±8.33 * Inhibitor-neg 180.26±24.82 0.82±0.13 194.89±24.20 88.91±8.96 miR-27a inhibitor230.25±26.17 *1.42±0.16 *241.70±37.79 *128.15±16.58 * miR-27b inhibitor228.91±25.73 *1.38±0.10 *232.03±38.21 *124.57±17.94 * miR-27a inhibitor+LPL-siRNA163.73±16.25 [#]0.85±0.18 [#]187.52±28.83 [#]78. [score:9]
Compared with respective control groups, LPL expression levels of mRNA and protein were markedly down-regulated in miR-27a/b agomir -treated group, whereas up-regulated in miR-27a/b antagomir -treated group, in aortic roots of apoE KO mice (Fig 2A and 2B). [score:8]
It is possible that miR-27a/b reduces LPL expression, then inhibits lipid accumulation and secretion of proinflammatory cytokines, and subsequently regulates the development of atherosclerotic lesions in apoE KO mice. [score:7]
Considering the inhibitory effects of miR-27a/b on LPL expression and LPL effects on inflammatory response and lipid uptake, we wished to clarify further whether LPL functions as the target gene in miR-27a/b -mediated effects on lipids and proinflammatory cytokine secretion in ox-LDL-stimulated THP-1 macrophages. [score:7]
0157085.g004 Fig 4 THP-1 macrophages were incubated with miR-27a/b mimic or inhibitor for 6 h, and then with ox-LDL for 24 h. SR-A1, LOX-1, CD36 and CXCL16 expression was determined after incubation with miR-27a/b mimic or inhibitor. [score:7]
Our findings indicated that scavenger receptor expression was suppressed by transfection of cells with miR-27a/b mimic, but increased by transfection with miR-27a/b inhibitor. [score:7]
THP-1 macrophages were incubated with miR-27a/b mimic or inhibitor for 6 h, and then with ox-LDL for 24 h. SR-A1, LOX-1, CD36 and CXCL16 expression was determined after incubation with miR-27a/b mimic or inhibitor. [score:7]
0157085.g008 Fig 8 MiR-27, binding to the LPL 3’UTR to accelerate degradation or repress post-transcriptional expression of mRNA, can inhibit the expression of LPL, and then attenuate lipid accumulation and secretion of proinflammatory cytokines. [score:6]
In our study, as shown in Fig 8, miR-27 is negatively associated with the expression and activity of LPL through directly targeting the 3’UTR of macrophage LPL, and serves as an important modulator contributing to the macrophage cellular lipid homeostasis and inflammatory response related to atherogenesis. [score:6]
MiR-27, binding to the LPL 3’UTR to accelerate degradation or repress post-transcriptional expression of mRNA, can inhibit the expression of LPL, and then attenuate lipid accumulation and secretion of proinflammatory cytokines. [score:6]
In addition, miR-27a was detected with twofold lower expression to LPS -induced inflammatory response in the RAW264.7 cells[29], indicating that the targets of miR-27a are involved in inflammatory response. [score:5]
It may be speculated that a novel specific method that effectively regulates miR-27 expression within macrophages might be used to control the development of atherosclerosis. [score:5]
These results illustrated that miR-27a/b inhibited macrophage LPL expression in apoE KO mice. [score:5]
We showed that miR-27 attenuated lipid accumulation and secretion of the pro-inflammatory cytokines, leading to a reduction in the development of atherosclerotic lesions in apoE KO mice, at least partially, by repressing the expression of LPL directly. [score:5]
Furthermore, the effects of miR-27a/b inhibitor on scavenger receptor expression in THP-1 macrophages were attenuated by LPL siRNA (Fig 6). [score:5]
0157085.g003 Fig 3 Expression of NF-κB protein and its phosphorylation status was detected by western blot analysis in THP-1 macrophages treated with miR-27a/b mimic or inhibitor. [score:5]
Our results showed that miR-27a/b mimic significantly repressed the expression of SR-A1, LOX-1, CD36 and CXCL16 both at the mRNA and protein levels, whereas miR-27a/b inhibitor treatment had the opposite effects (Fig 4). [score:5]
Consistently, the expression of LPL mRNA and protein in both THP-1 macrophages (Fig 1A and 1B) and RAW 264.7 cells (Fig 1C and 1D) was changed accordingly by miR-27a/b inhibitor and mimic. [score:5]
Given that miR-27a/b reduced LPL expression and attenuated the ability of lipid uptake in ox-LDL-stimulated THP-1 macrophages, we next detected the expression of associated scavenger receptors in ox-LDL-stimulated THP-1 macrophages to elucidate the mechanism underlying the effects of miR-27a/b on lipid uptake. [score:5]
Nevertheless, miR-27a/b inhibitor -induced effects on mRNA expression of scavenger receptors were dramatically reversed when THP-1 macrophages were transfected with LPL siRNA. [score:5]
Expression of NF-κB protein and its phosphorylation status was detected by western blot analysis in THP-1 macrophages treated with miR-27a/b mimic or inhibitor. [score:5]
Enhancing miR-27a/b function protected apoE KO mice from atherosclerosis as a result of obvious reduction of the expression of LPL, lipid uptake, and pro-inflammatory cytokine secretion, but inhibition of miR-27a/b function had the opposite effects. [score:5]
The current study has also revealed that the expression of NF-κB, a key nuclear factor related to inflammatory response, was significantly altered, and secretion of the proinflammatory cytokines was observably suppressed in THP-1 macrophages in response to treatment with miR-27a/b mimic. [score:5]
Our group has previously demonstrated that miR-27a/b repressed the expression of endogenous LPL through binding directly to the LPL 3’UTR, and then affected the metabolism of cellular cholesterol in THP-1 macrophages[28]. [score:4]
From these results, we conclude that miR-27a/b down-regulates plasma cholesterol levels in apoE KO mice. [score:4]
A role for miR-27 in negative regulation of lipid accumulation and proinflammatory cytokine secretion through targeting LPL gene. [score:4]
Our present study has also revealed miR-27a/b negatively regulates the LPL mRNA and protein expression in aortic lesion areas and peritoneal macrophages of apoE KO mice. [score:4]
Effects of LPL on miR-27a/b-regulated expression of surface scavenger receptors in ox-LDL-stimulated THP-1 macrophages. [score:4]
These anti-atherosclerotic effects of miR-27a/b may result from miR-27 -mediated regulation of the expression of LPL, suggesting a role for scavenger receptors in lipid uptake. [score:4]
To date, however, it is still not clear whether miR-27 plays a role in the development of atherosclerosis through targeting macrophage LPL in vivo. [score:4]
Taken together, these results demonstrated that miR-27a/b inhibits the development of atherosclerotic lesions in apoE KO mice. [score:4]
Taken together, our results have further established a role for miR-27a/b in the negative regulation of endogenous LPL expression in various macrophage cell types. [score:4]
MiR-27a/b inhibits LPL expression in vitro and in vivo. [score:4]
Our group has previously demonstrated that miR-27a/b repressed the expression of endogenous LPL through binding directly to the LPL 3’UTR in THP-1 macrophages[28]. [score:4]
In addition, the expression levels of miR-27 are closely associated with clinical factors and the prognosis of patients with atherosclerosis obliterans, suggesting that it might serve as a potential biomarker for atherosclerosis[20, 42]. [score:3]
Effects of miR-27a/b on the expression of NF-κB in human THP-1 macrophages. [score:3]
miR-27a/b inhibitor. [score:3]
On the contrary, its phosphorylation was increased by treatment of cells with miR-27a/b inhibitor. [score:3]
When cells were treated with miR-27a/b inhibitor, those cytokines were markedly increased. [score:3]
Effects of miR-27a/b on LPL expression and activities in various cell types. [score:3]
Effects of miR-27a/b on the expression of surface scavenger receptors. [score:3]
More studies will be required to elucidate the complete target list of miR-27a/b and fully understand how miR-27a/b affects lipid composition of THP-1 macrophages. [score:3]
Effects of miR-27a/b on LPL expression in apoE KO mice. [score:3]
However, miR-27a/b inhibitor significantly enhanced the levels of those. [score:3]
However, an increase in LPL expression was observed in miR-27a/b antagomir -treated mice (Fig 2C and 2D). [score:3]
As expected, LPL siRNA efficiently reduced the miR-27a/b inhibitor -induced secretion of these pro-inflammatory cytokines (Table 1). [score:3]
To fully understand the connection between the miR-27 and atherosclerosis, more studies are required to explore further the potential mechanisms underlying miR-27 effects on lipid metabolism and pro-inflammatory pathways through targeting the LPL gene in vivo. [score:3]
To investigate further the effects of miR-27a/b on LPL expression in vivo, we assessed LPL expression in tissue homogenate of isolated aortic roots in apoE KO mice treated with miR-27a/b agomir or antagomir or their respective scrambled controls. [score:3]
Furthermore, we further explored the effect of miR-27a/b on the lipid composition in apoE KO mice, and found that enhancing miR-27a/b function with agomir reduced intracellular TC, CE and FC, but inhibiting miR-27a/b increased those in peritoneal macrophages. [score:3]
Thus, these results suggest that miR-27a/b regulates not only cellular lipid uptake but also lipid composition in ox-LDL-stimulated macrophages. [score:2]
These results suggest that scavenger receptor family may play an important role in the lipid uptake process regulated by miR-27a/b. [score:2]
MiR-27 was found to inhibit adipocyte differentiation that is closely associated with the onset of obesity[25, 26], and also participate in lipid metabolism in the liver[27]. [score:2]
MiR-27a/b inhibits aortic atherosclerosis. [score:2]
At the same time, the activity assay showed that LPL activities were decreased in the cells transfected with miR-27a/b mimic, but increased in the cells transfected with miR-27a/b inhibitor (Fig 1E). [score:2]
It has been proposed that two isoforms of the miR-27 family, miR-27a and -27b present in the macrophage cell lines, may participate in the initiation and progression of atherosclerosis as we recently reviewed[20]. [score:1]
At the same time, our results have shown a positive effect of miR-27 on the pathological process of atherosclerosis through reducing accumulation of intracellular lipids and secretion of pro-inflammatory cytokines in apoE KO mice. [score:1]
Furthermore, in peritoneal macrophages of apoE KO mice treated with miR-27a/b agomir, we found a significant reduction in LPL mRNA and protein levels. [score:1]
Our previous study has revealed that miR-27a/b attenuated ox-LDL uptake and affected cholesterol constitutes in THP-1 macrophages. [score:1]
The Effects of miR-27a/b on body weight and plasma lipid profile in apoE KO mice. [score:1]
AG-NC: miR-27a/b agomir negative control; AGa: miR-27a agomir; AGb: miR-27b agomir; AN-NC: miR-27a/b antagomir negative control; ANa: miR-27a antagomir; ANb: miR-27b antagomir; IL-1β: Interleukin-1β IL-6: Interleukin-6; MCP-1: monocyte chemotactic factor-1; TNF-α: tumor necrosis factor alpha. [score:1]
MiR-27a/b agomir reduced the number and size of plaques in the aortic arch and thoracic aorta region, but miR-27a/b antagomir had the opposite effects (Fig 7A). [score:1]
Furthermore, it has been reported that miR-27 has provided a potent atheroprotective function in endothelial cells activated by laminar shear stress[43]. [score:1]
Recently, a notable role for miR-27 in the pathogenesis of atherosclerosis has been noticed and studied extensively, although previous studies about miR-27 were more involved in the field of tumor research. [score:1]
As shown in Table 1, the levels of IL-1β, IL-6, MCP-1, and TNF-α were significantly decreased by treatment of cells with miR-27a/b mimic. [score:1]
The assessment of plaque in the hematoxylin- and eosin-stained cross-sections of the aortic root revealed that the plaque area in miR-27a/b agomir -treated mice was less than that those in mice treated with miR-27a/b scrambled agomir. [score:1]
In this study with gain- and loss-of-function experiments, we used artificial microRNA mimics/inhibitor or agomir/antagomir to investigate the roles of miR-27a/b in lipid metabolism and inflammatory response and atherosclerotic lesion formation in vitro or in vivo. [score:1]
The magic and mystery of microRNA-27 in atherosclerosis. [score:1]
0157085.g006 Fig 6 The mRNA levels of SR-A1, LOX1, CD36 and CXCL16 were measured by RT-qPCR in THP-1 macrophages transfected with LPL siRNAs and then incubated with miR-27a/b inhibitors, respectively. [score:1]
All mice were randomly allocated to 6 groups: miR-27a/b agomir group (AGa and AGb), miR-27a/b scrambled agomir negative control group (AG-NC), miR-27a/b antagomir group (ANa and ANb) and miR-27a/b scrambled antagomir negative control group (AN-NC). [score:1]
Effects of miR-27a/b on lipid accumulation in macrophages in abdominal cavity of apoE KO mice. [score:1]
Because LPL hydrolyzes triglyceride and impacts macrophage lipid profile, we next examined the effects of miR-27a/b on plasma lipid levels in apoE KO mice. [score:1]
Specifically, systemic treatment with miR-27a/b agomir significantly decreased lesion size and lipid contents in the aorta of apoE KO mice. [score:1]
As shown in Table 2, treatment of apoE KO mice with miR-27a/b agomir significantly decreased the levels of IL-1β, IL-6, MCP-1 and TNF-α compared with those in control mice, consistent with the regulatory role of miR-27a/b in affecting inflammatory response in vitro. [score:1]
The role of LPL in the effect of miR-27a/b on the lipid uptake and proinflammatory cytokine secretion in THP-1 macrophages. [score:1]
Male 8-week-old apoE KO mice (n = 10 mice per group) fed high fat diet were given a tail vein injection with miR-27a/b agomir negative control (AG-NC), miR-27a/b agomir (AGa/AGb), miR-27a/b antagomir negative control (AN-NC) and miR-27a/b antagomir (ANa/ANb). [score:1]
0157085.g002 Fig 2 Eight-week-old male apoE KO mice (n = 10 mice per group) fed high-fat diet were given a tail vein injection with miR-27a/b agomir (AGa and AGb) or its scrambled agomir negative control (AG-NC), miR-27a/b antagomir (ANa and ANb) or its scrambled antagomir negative control (AN-NC). [score:1]
Conversely, as shown in Fig 7C, the aortic root of miR-27a/b antagomir -treated mice contained more severe lesion than miR-27a/b scrambled antagomir -treated mice. [score:1]
Eight-week-old male apoE KO mice (n = 10 mice per group) fed high-fat diet were given a tail vein injection with miR-27a/b agomir (AGa and AGb) or its scrambled agomir negative control (AG-NC), miR-27a/b antagomir (ANa and ANb) or its scrambled antagomir negative control (AN-NC). [score:1]
These findings suggest that miR-27 may have a close relationship with atherosclerosis. [score:1]
The levels of intracellular lipids were assessed using HPLC after miR-27a/b functions were manipulated. [score:1]
Effects of miR-27a/b on secretion of proinflammatory cytokines in ox-LDL- treated THP-1 macrophages. [score:1]
These data suggest that transfection with miR-27a/b could negatively affect the inflammatory response of ox-LDL-stimulated THP-1 macrophages. [score:1]
Given that miR-27a/b reduced proinflammatory cytokine production in vitro, we next measured the expression of plasma inflammatory cytokines in apoE KO mice to further explore the effects of miR-27a/b on inflammation in vivo. [score:1]
Effects of miR-27a/b on inflammatory cytokine production in the blood of apoE KO mice. [score:1]
AG-NC: miR-27a/b agomir negative control; AGa: miR-27a agomir; AGb: miR-27b agomir; AN-NC: miR-27a/b antagomir negative control; ANa: miR-27a antagomir; ANb: miR-27b antagomir; BW: body weight; TG: triglyceride; TC: total cholesterol; HDL-C: high density lipoprotein cholesterol; LDL-C: low-density lipoprotein cholesterol. [score:1]
The results revealed that phosphorylation of NF-κB was reduced in THP-1 macrophages treated with miR-27a/b mimic, suggesting that NF-κB might be involved in the effects of miR-27a/b on atherosclerosis. [score:1]
ApoE KO mice fed high-fat diet were given a tail vein injection with miR-27 agomir/antagomir or their respective scrambled controls to explore the potential effects of miR-27. [score:1]
0157085.g007 Fig 7. Male 8-week-old apoE KO mice (n = 10 mice per group) fed high fat diet were given a tail vein injection with miR-27a/b agomir negative control (AG-NC), miR-27a/b agomir (AGa/AGb), miR-27a/b antagomir negative control (AN-NC) and miR-27a/b antagomir (ANa/ANb). [score:1]
To investigate the functional consequences of miR-27a/b expression, we examined the production of pro-inflammatory cytokines in ox-LDL-stimulated THP-1 macrophages using ELISA. [score:1]
The mRNA levels of SR-A1, LOX1, CD36 and CXCL16 were measured by RT-qPCR in THP-1 macrophages transfected with LPL siRNAs and then incubated with miR-27a/b inhibitors, respectively. [score:1]
Taken together, our data suggest an essential role for LPL as a mediator of the biological effects of miR-27a/b in ox-LDL -treated THP-1 macrophages. [score:1]
Furthermore, miR-27a/b decreased the levels of plasma inflammatory cytokines, consistent with the results in cell culture experiments. [score:1]
Therefore, we measured the scavenger receptor expression to reveal the effect of miR-27a/b on lipid uptake in ox-LDL -treated THP-1 macrophages. [score:1]
However, we measured the effects of miR-27a/b on the expression of only a few scavenger receptors. [score:1]
On the other hand, miR-27a/b antagomir decreased plasma TG levels, but increased plasma TC and plasma LDL-C levels in comparison with miR-27a/b antagomir negative control (Table 4). [score:1]
As demonstrated in Fig 3, phosphorylation of NF-κB was decreased in response to miR-27a/b mimic treatment. [score:1]
Many pieces of research have shown that miR-27 is involved in angiogenesis, adipogenesis, oxidative stress, insulin resistance, which are the known processes associated with atherosclerosis. [score:1]
AG-NC: miR-27a/b agomir negative control; AGa: miR-27a agomir; AGb: miR-27b agomir; AN-NC: miR-27a/b antagomir negative control; ANa: miR-27a antagomir; ANb: miR-27b antagomir; TC: total cholesterol; FC: free cholesterol; CE: cholesterol ester. [score:1]
[1 to 20 of 98 sentences]
6
[+] score: 254
To confirm the role of miR-27a in alterations in PPARγ expression, HPAECs (passages 3–7) were transfected, using GeneSilencer siRNA transfection reagent (San Diego, CA), with anti-miR-27a (25–50 nM) or an equivalent amount of anti-miR negative control for miRNA downregulation, or mimic miR-27a (30–50 nM) or scrambled siRNA for miRNA overexpression (Qiagen). [score:8]
E. miR-27a levels were upregulated in lungs from endothelial -targeted PPARγ knockout (ePPARγ KO) mice. [score:7]
To our knowledge, the current report provides the first evidence that hypoxia inhibits PPARγ expression and increases ET-1 expression and HPAEC proliferation through miR-27a -mediated post-transcriptional mechanisms in vivo and in vitro. [score:7]
To examine the effect of miR-27a inhibition on hypoxia -induced reductions in HPAEC PPARγ expression and proliferation, loss-of-miR-27a function was achieved by transfecting HPAECs with a miR-27a inhibitor. [score:7]
As illustrated in Figure 5E, compared to lungs from littermate control mice, miR-27a levels were upregulated in lungs from endothelial -targeted PPARγ knockout (ePPARγ KO) mice [39]. [score:6]
These findings support previous evidence that miR-27a is upregulated under conditions associated with PH and establish that miR-27a reduces PPARγ expression. [score:6]
miR-27a Downregulation and Overexpression. [score:6]
These result clearly indicated that miR-27a directly binds to the PPARγ-3′UTR, and suppresses PPARγ expression. [score:6]
Transcription factors such as SP1 [40] and EGR1 [41] promote miR-27a expression, whereas PPARγ activation inhibits SP1 [59] and EGR1 [60] in selected systems. [score:5]
First, the 3′untranslated region (3′UTR) of PPARγ contains a binding site for miR-27, and miR-27 targets PPARγ mRNA in cardiomyocytes [34] and macrophages [35]. [score:5]
Further studies will be required to fully elucidate the molecular mechanisms by which hypoxia increases miR-27 expression and if preventing increases in miR-27a levels is sufficient to prevent or reverse hypoxic -induced ET-1 expression and PH in vivo. [score:5]
miR-27a Inhibition Attenuates HPAEC Proliferation and Increases PPARγ Expression. [score:5]
Hypoxia increases miR-27a levels which reduce PPARγ expression and increase ET-1 expression and promote PH. [score:5]
The current study focused on miR-27 because it: 1) regulates PPARγ, 2) is highly expressed in the lung and heart [49]– [51], 3) is increased in the lungs of animals with PH [22] and in PASMC isolated from patients with IPAH [30], and 4) participates in the regulation of proliferation and differentiation in multiple cell types [23], [35], [45], [52]– [56]. [score:5]
miR-27a Overexpression Stimulates HPAEC Proliferation and Reduces PPARγ Expression. [score:5]
Hypoxia upregulated miR-27a and -27b levels in HPAECs, whereas only miR-27a was increased in mouse lungs. [score:4]
However the precise mRNA targets regulated by miR-27 and their contribution to the pathogenesis of PH have not been defined. [score:4]
Knockdown of Transcription Factors, SP1 and EGR1, Attenuates miR-27a Expression. [score:4]
Conversely, activating PPARγ with rosiglitazone attenuated hypoxic upregulation of miR-27a and ET-1. These findings suggest that PPARγ ligands attenuate alterations in miR-27a and ET-1 levels to reduce PH. [score:4]
miR-27a levels were downregulated following SP1 (B) or EGR1 (D) depletion in HPAECs. [score:4]
Secondly, our study does not directly address how hypoxia increases miR-27a levels or how PPARγ activity suppresses this effect. [score:4]
Taken together, the findings in Figures 3 and 4 provide compelling evidence that miR-27a regulates PPARγ expression and HPAEC proliferation. [score:4]
Knockdown of transcription factors, SP1 and EGR1, attenuates miR-27a expression. [score:4]
Taken together, these findings provide compelling evidence that SP1 or EGR1 regulate miR-27a expression in HPAECs. [score:4]
As shown in Figure 4, treating HPAEC with graded concentrations of anti-miR-27a reduced miR-27a levels as expected (Figure 4A), attenuated basal HPAEC proliferation (Figure 4B) and decreased ET-1 expression (Figure 4C and 4D), and increased PPARγ mRNA (Figure 4C) and protein levels (Figures 4D). [score:3]
The current findings indicate that hypoxia increases lungs miR-27a expression and that increases in miR-27a reduce PPARγ levels which stimulates increased ET-1 levels and pulmonary vascular cell proliferation. [score:3]
Transcription factors such as SP1 [40] and EGR1 [41] have been reported to stimulate miR-27a expression. [score:3]
Each bar represents the mean ± SE miR-27a (A), proliferation (B), or PPARγ or ET-1 mRNA relative to ribosomal S9 (9S RNA) (C), or PPARγ or ET-1 protein relative to CDK4 protein (D) expressed as fold-change vs. [score:3]
miR-27a levels in lungs from endothelial -targeted PPARγ KO mice were determined with qRT-PCR. [score:3]
These findings provide evidence for a previously unrecognized mutually repressive relationship between PPARγ and miR-27a and indicate that strategies to maintain PPARγ expression and function in pulmonary vascular cells may provide therapeutic benefit in PH. [score:3]
PPARγ is a target gene of miR-27a. [score:3]
Although several miRNAs are aberrantly expressed in PH, the current study focused on miR-27a for several reasons. [score:3]
The findings in Figure 7B and 7D illustrate that depletion of either SP1 or EGR1 was sufficient to significantly attenuate miR-27a expression. [score:3]
Additionally, this study provides novel evidence that activation of the PPARγ receptor attenuates hypoxia -induced miR-27a expression. [score:3]
While the findings in Figures 3 and 4 demonstrate that miR-27a regulates PPARγ, the results in Figure 5 suggest that PPARγ reciprocally regulates miR-27a levels. [score:3]
In contrast, no changes in luciferase activity were observed in the psiCHECK2 wild-type reporter without PPARγ-3′UTR or psiCHECK2-PPARγ-3UTR [mut] construct (mut-3′UTR) upon miR-27a overexpression or scrambled miRNA. [score:3]
Each bar represents the mean ± SE miR-27a relative to RNU6B expressed as fold change vs. [score:3]
The current results clarify that hypoxia reduces PPARγ through post-transcriptional pathways involving miR-27a that increase endothelial ET-1 expression and proliferation. [score:3]
To confirm the impact of miR-27a on HPAEC PPARγ expression and proliferation, HPAEC were treated with graded concentrations of miR-27a mimic (10–30 nM). [score:3]
PPARγ is a Target of miR-27a. [score:3]
Each bar represents the mean ± SE level of miR-27a relative to RNU6B expressed as fold-change vs. [score:3]
These results provide novel evidence that PPARγ activation suppresses hypoxic increases in miR-27a. [score:3]
Each bar represents the mean ± SE miR-27a/RNU6B (A), proliferation (B), PPARγ or ET-1 mRNA relative to ribosomal S9 (9S RNA) (C), or PPARγ or ET-1 protein relative to CDK4 protein (D) expressed as fold-change vs. [score:3]
Whereas increased levels of miR-27a reduced PPARγ and stimulated HPAEC proliferation (Figure 3), miR-27a inhibitor had the opposite effect. [score:3]
0079503.g008 Figure 8 The current findings indicate that hypoxia increases lungs miR-27a expression and that increases in miR-27a reduce PPARγ levels which stimulates increased ET-1 levels and pulmonary vascular cell proliferation. [score:3]
Each bar represents the mean ± SE miR-27a relative to RNU6B expressed as fold changed vs. [score:3]
Collectively, these studies demonstrate that miR-27a and PPARγ mediate mutually repressive actions in hypoxic pulmonary vasculature and that targeting PPARγ may represent a novel therapeutic approach in PH. [score:3]
Overexpression of miR-27a with a miR-27a mimic increased miR-27a levels, HPAEC proliferation, and ET-1 levels and reduced PPARγ levels. [score:3]
Anti-miR-27a reduced HPAEC miR-27a levels, HPAEC proliferation, and ET-1 levels and increased PPARγ expression. [score:3]
As shown in Figure 3, miR-27a mimic produced concentration -dependent increases in HPAEC miR-27a levels (Figure 3A) that were associated with increases in HPAEC proliferation detected by MTT assay (Figure 3B,) and ET-1 expression (Figures 3C and 3D) and reductions in PPARγ mRNA (Figure 3C) and protein (Figure 3D) levels. [score:2]
The findings in Figures 3 and 4 indicate that alterations in miR-27a levels are sufficient to regulate PPARγ levels and HPAEC proliferation. [score:2]
Our results demonstrate that knockdown of SP1 or EGR1attenuated miR-27a levels in HPAECs. [score:2]
Putative pathways by which PPARγ and miR-27a regulate ET-1 in PH. [score:2]
As illustrated in Figure 1A, of the miRNAs that were examined and predicted to regulate PPARγ, hypoxia selectively increased miR-27a in mouse lung. [score:2]
Second, the miR-27 gene family (miR-23a∼27a∼24-2 cluster) contributes to regulation of hypoxic responses including [36]– [38], cell cycle progression, proliferation, and hypertrophy [36]. [score:2]
24 h. To confirm that miR-27a binds directly to the 3′UTR of PPARγ (Figure 2A), we constructed a luciferase reporter DNA construct of the human 236 bp PPARγ mRNA 3′UTR containing the miR-27a binding site and used the psiCHECK2 vector to insert it into HPAECs. [score:2]
This analysis indicated miR-27a/b, miR-130a/b, miR-301a/b, and miR-454 as potential regulators of PPARγ. [score:2]
The miR-27a seed sequence is shown in bold font. [score:1]
Taken together our findings provide evidence for a mutually repressive relationship between miR-27a and PPARγ. [score:1]
qRT-PCR was employed to detect alterations in miR-27a, PPARγ, and ET-1 levels. [score:1]
A. Schematic illustration of the human PPARγ 3′UTR which contains a putative binding site (open arrowhead) for miR-27a. [score:1]
0079503.g002 Figure 2 A. Schematic illustration of the human PPARγ 3′UTR which contains a putative binding site (open arrowhead) for miR-27a. [score:1]
The levels of miR-27a expression were analyzed by qRT-PCR using Qiagen miRNA primer assay (Qiagen) according to the manufacturer’s instructions. [score:1]
[12] Lung miR-27a levels were measured with qRT-PCR and are expressed relative to lung RNU6B. [score:1]
Consistent with evidence that activation of PPARγ with rosiglitazone attenuates hypoxic reductions in PPARγ in rat lung, rosiglitazone treatment attenuated hypoxia -induced increases in miR-27a in mouse lung and in HPAEC (Figure 6). [score:1]
0079503.g004 Figure 4HPAECs were treated with either scrambled (SCR) or 25–50 nM anti-miR-27a for 72 hours. [score:1]
Human scrambled siRNA, mimic-miR-27a, and anti-miR-27a were purchased from Qiagen (Valencia, CA). [score:1]
Figure 6A illustrates lung miR-27a levels in mice exposed to hypoxia (10% O [2]) for 3-weeks ± treatment with the PPARγ ligand, RSG, during the final 10-days of exposure. [score:1]
On the other hand, activating the PPARγ receptor with pharmacological ligands attenuated hypoxia -induced increases in miR-27a. [score:1]
However, stimulating the activity of remaining levels of PPARγ with pharmacological ligands can reduce miR-27a (Figure 6). [score:1]
Figure 2A shows the predicted conserved binding sequence for miR-27a in the human PPARγ-3′UTR. [score:1]
Positions 3–6 of the seed match were mutated by the QuikChange Site-Directed Mutagenesis Kit (Stratagene), termed psiCHECK2-PPARγ-3′UTR [mut] (mut-3′UTR) using RT-PCR with primers 5′- ATTCTGAGGGAAAATCTGACACCTAAGAAATTTAC ACACAAAAAGCATTTTAAAAAGAAAAGGTTTTAGAATAT-3′(Forward) and 5′- ATATTCTAAAACCT TTTCTTTTTAAAATGCTTTTT GTGTGTAAATTTCTTAGGTGTCAGATTTTCCCTCAGAAT-3′(Reverese), and confirmed by DNA sequencing analysis (Bold letters denote the miR-27a seed match sequence, with the mutated bases of the miR-27a seed match underlined. [score:1]
siRNA -mediated reductions in PPARγ increased HPAEC ET-1, proliferation, and miR-27a levels. [score:1]
qRT-PCR was performed for miR-27a, PPARγ, and ET-1 levels. [score:1]
Because increased levels of miR-27a are predicted to reduce PPARγ in mouse lung and in HPAECs, we focused on increased miR-27a levels as a putative mechanism for previously reported reductions in PPARγ [12], [16]. [score:1]
The findings in Figure 6B demonstrate that hypoxia also increased HPAEC miR-27a levels in vitro and that treatment with RSG attenuated increases in miR-27a in hypoxia-exposed cells. [score:1]
Reductions in PPARγ caused by 30 nM miR-27a mimic were comparable to those caused by hypoxia as previously reported [12], and 30 nM miR-27a mimic also caused maximal increases in HPAEC proliferation. [score:1]
0079503.g003 Figure 3HPAECs were exposed to normoxia (NOR) for 72 h and treated with graded concentrations of miR-27a mimic. [score:1]
To further examine the association between PPARγ and miR-27a, levels of miR-27a in siPPARγ HPAECs were examined. [score:1]
In addition to increasing miR-27a as shown in Figure 1, hypoxia reduces PPARγ and stimulates HPAEC proliferation [10]. [score:1]
Hypoxia Increases miR-27a in in vivo and in vitro. [score:1]
Alterations in miR-27a, ET-1, and PPARγ levels were examined using qRT-PCR and Western blotting. [score:1]
These findings suggest that PPARγ activation could lead to transrepression of hypoxia-activated transcription factors that activate the miR-27a promoter. [score:1]
Each bar represents the mean miR-27a level relative to RNU6B ± SE. [score:1]
Reductions in PPARγ significantly increased miR-27a levels (Figure 5D). [score:1]
Wild-type vector (psiCHECK2) or psiCHECK2-PPARγ construct, or mut-3′UTR construct with or without 30 nM of miR-27a mimic or scrambled miRNA (SCR) were transiently co -transfected into HPAECs. [score:1]
Furthermore, these studies provide novel evidence for a previously unrecognized mutually repressive relationship between PPARγ and miR-27a in hypoxic pulmonary vasculature. [score:1]
Third, miR-27 is increased in the lungs of animals with PH [22] and in human pulmonary artery smooth muscle cell (HPASMC) isolated from patients with idiopathic PAH (IPAH) [30]. [score:1]
Furthermore, our studies demonstrate that miR-27a mimic reduced PPARγ, increased ET-1, and stimulated HPAEC proliferation whereas anti-miR-27a increased PPARγ and reduced ET-1 and HPAEC proliferation. [score:1]
As illustrated in Figure 8, these findings suggest a pathogenic cascade wherein hypoxia -induced increases in miR-27a reduce PPARγ and increase ET-1 to stimulate HPAEC proliferation. [score:1]
HPAECs were treated with either scrambled (SCR) or 25–50 nM anti-miR-27a for 72 hours. [score:1]
Hypoxia also caused significant increases in lung miR-27a levels that were attenuated by treatment with RSG (Figure 6A). [score:1]
Because these findings demonstrated that hypoxia increased miR-27a and reduced PPARγ in vitro and in vivo and because PPARγ ligands restored hypoxia -induced reductions in PPARγ [11], we examined the ability of PPARγ activation with pharmacological ligands to attenuate hypoxic increases in miR-27a levels. [score:1]
PPARγ Activation Attenuates Increases in miR-27a Levels in Hypoxia-exposed Mouse Lung or HPAECs. [score:1]
A PPARγ ligand attenuates hypoxic increases in miR-27a levels in mouse lung or in HPAECs. [score:1]
HPAECs were exposed to normoxia (NOR) for 72 h and treated with graded concentrations of miR-27a mimic. [score:1]
[1 to 20 of 96 sentences]
7
[+] score: 237
Figure 5miR-27a* expression reduces tumor growth in vivo and direct intratumoral injection reduces tumor growth (A) Orthotopic xenografts of 22B cells expressing miR-27a* (pSuper-27a*) show reduced growth compared to control vector (pSuper); * at day 16 indicates point at which differences in tumor volume became statistically significant, p<0.05; (B) Tumor growth curve of 22B cells with inducible miR-27a* expression. [score:7]
Inhibition of miR-27a* did not significantly affect cell viability, but did result in a slight increase in targeted protein expression. [score:7]
Figure 4 (A) The effect of miR-27a* on cell viability is decreased in 22A and 22B cells by overexpression of EGFR, AKT1 and mTOR 48 hrs prior to miR-27a* expression as compared to control vector, *p<0.01; (B) Overexpression following transfection with EGFR, AKT1 and mTOR (EAmT) vectors was confirmed by immunoblot analysis. [score:6]
22B-pSuper-27a* constitutively expresses miR-27a* and decreases the expression of EGFR, AKT1, and mTOR. [score:5]
Given that miR-7 has known interactions with EGFR as both a tumor suppressor and oncogene [25, 29], but did not show an effect on cell viability in HNSCC, we postulated that miR-27a* targets additional genes in the EGFR signaling axis to reduce cell survival. [score:5]
Coordinated Downregulation of EGFR, AKT1 and mTOR is the Result of Independent, Direct Interactions with miR-27a*. [score:5]
This suggests differential expression of miR-27a target genes across multiple tumor types and divergent functional effects. [score:5]
In vivo Expression and Delivery of miR-27a* Reduces HNSCC Tumor GrowthIn order to assess the therapeutic potential of miR-27a* in a preclinical mo del, we created cell lines that stably express miR-27a*. [score:5]
Although miR-27a* targets EGFR, AKT1 and mTOR directly and independently within the EGFR signaling pathway, the specific effect of those regulatory events on the overall decreased viability of HNSCC cells has not been established. [score:5]
miR-27a* Inhibits Expression of Multiple EGFR Signaling Axis Components. [score:5]
Finally, by targeting several components of the EGFR axis, miR-27a* may enhance the effect of existing treatment options and possibly provide therapeutic benefits to patients with EGFR -inhibitor resistant cancers. [score:5]
miR-27a* coordinately downregulates the EGFR signaling axis via independent direct interactions with EGFR, AKT1, and mTOR. [score:5]
Although miR-27a demonstrated decreased expression in HNSCC as compared to normal tissues, analysis of the matched samples did not demonstrate significantly decreased expression in the tumors (Fig. S1B). [score:4]
miR-27a* expression reduces tumor growth in vivo and direct intratumoral injection reduces tumor growth. [score:4]
We examined the expression of the candidate miRNAs in HNSCC cell lines by quantitative real-time polymerase chain reaction (qRT-PCR) and found that only miR-27a and −27a* had significantly decreased expression as compared to normal oral keratinocyte cell lines (Fig. 1C). [score:4]
Having demonstrated coordinate downregulation of the EGFR signaling axis, we analyzed the functional effects of miR-27a* in HNSCC. [score:4]
In conclusion, we have identified miR-27a* as a regulator of multiple targets within the EGFR signaling axis. [score:4]
miR-27a* and miR-27a Are Downregulated in HNSCC Cells and Tissues. [score:4]
Transfection of E3908-pGL3 (WT) and miR-27a* decreased luciferase activity, but transfection of MT and miR-27a* did not, confirming that direct miR-27a* interaction with the 3'UTR contributes to decreased EGFR expression. [score:4]
To verify a direct interaction between miR-27a* and its target genes, we created reporter plasmids with inserted sequences from EGFR, AKT1 or mTOR downstream of a luciferase gene. [score:4]
These results confirm a direct interaction between miR-27a* and its respective targets EGFR, AKT1, and mTOR. [score:4]
MiR-27a was previously described as an oncogenic miRNA in pancreatic and bronchial cells [36, 37]; however, our results show that miR-27a is downregulated in HNSCC and its re-introduction into HNSCC cells does not have a pro-tumorigenic effect. [score:4]
Values normalized to OKF-6, p<0.005; (D) Analysis of miR-27a* RNA in human HNSCC and normal mucosal specimens by qRT-PCR revealed an overall decrease in miR-27a* expression levels in HNSCC, p<0.0001; (E) Comparison of miR-27a* levels in matched normal/HNSCC tissue pairs demonstrated decreased expression in the tumors as compared to matched normal tissue, p<0.01. [score:4]
Further in silico analysis identified AKT1 and mTOR as additional targets of miR-27a* (Fig. 3A). [score:3]
Overexpression of EGFR axis signaling components reverses the loss of HNSCC cell viability mediated by miR-27a*, which increases apoptosis and reduces migration. [score:3]
Cells were transfected with miRNA mimics (Ambion), miRNA inhibitors (Dharmacon) and the synthesized miR-27a step-loop structure (Dharmacon) using Lipofectamine 2000 (Invitrogen) per the manufacturer's instruction. [score:3]
Additionally, we employed an antagomir, miR-27a* -inhibitor (miR-27a*-IH), to assess potential loss-of-function effects [28]. [score:3]
This report reveals the tumor suppressive properties of miR-27a* (miR-27a-5p) acting upon the EGFR signaling axis at three independent points, resulting in decreased tumorigenicity in vitro and in vivo. [score:3]
Figure 1(A) Identification of specific miR-27a(), −27a*(), −27b(), −27b*(#), −7(), −128() candidate binding sites within EGFR mRNA using in silico screening methods; (B) Hairpin representation of the pre-miR-27a with the sequences of miR-27a* (green) and miR-27a (magenta) highlighted; (C) Decreased expression of mature miR-27a and −27a* by qRT-PCR in 10 HNSCC cell lines and normal oral keratinocytes (OKF-6 and HOK16B). [score:3]
However, expression of these EGFR signaling pathway components did not completely abrogate the effect of miR-27a* on HNSCC cell viability. [score:3]
Establishment of miR-27a* expressing cell lines. [score:3]
miR-27a* has putative binding sites in EGFR mRNA and shows decreased expression in HNSCC cell lines and human tumor tissues. [score:3]
Thus, these findings suggest that the effect of miR-27a* expression on HNSCC cell viability was related, at least in part, to the EGFR signaling pathway. [score:3]
22B-pSingle-27a* contains an inducible vector system resulting in miR-27a* expression when treated with doxycycline. [score:3]
EGFR, AKT1 and mTOR CDS expression vectors were transfected into HNSCC cells prior to the introduction of miR-27a*. [score:3]
Inhibition of the EGFR Signaling Axis by miR-27a* Increases Apoptosis and Decreases Cellular Migration in HNSCC. [score:3]
In order to assess the therapeutic potential of miR-27a* in a preclinical mo del, we created cell lines that stably express miR-27a*. [score:3]
Since miR-27a and 27b had the same seed region sequence, their target sites were the same. [score:3]
We also observed a trend toward decreased miR-27a* expression with advanced tumor stage (p=0.056). [score:3]
Most importantly, miR-27a* demonstrated a tumor-suppressive function that miR-27a did not exhibit in HNSCC cells, which may potentially be the result of an alteration in the processing machinery. [score:3]
In contrast, miR-27a and −7 decreased EGFR expression without modulation of AKT1 or mTOR (Figs. 3B and 3C). [score:3]
Four potential binding sites were identified for miR-27a* in the 3'-untranslated region (3'UTR) and three in the coding DNA sequence (CDS). [score:3]
Inhibits the Effect of miR-27a* on HNSCC Cell Viability. [score:3]
Thus, utilizing miR-27a* expression as a treatment option for HNSCC may be more effective and result in fewer unintended consequences. [score:3]
Based on these findings, we hypothesized that miR-27a* and/or −27a suppression might contribute to the malignant phenotype and that re-introduction of these miRNAs into HNSCC cells might alter tumor behavior. [score:3]
Figure 3(A) Further in silico screening of downstream members of the EGFR signaling axis, identified 5 putative binding sites for miR-27a* (black bars) on AKT1 and 11 binding sites for miR-27a* on mTOR; (B) Immunoblot shows decreased EGFR expression after the transfection of miR-27a*, −27a and −7 precursors. [score:3]
In HOK16B, EGFR expression was decreased by miR-27a* and slightly increased by miR-27a*-IH. [score:3]
One group of mice was treated with doxycycline (Doxy) to induce miR-27a* expression after tumors developed (day 0). [score:3]
Overexpression of EGFR signaling pathway components decreased the overall effect of miR-27a* on HNSCC cell viability, suggesting the possibility that other signaling pathways may also be affected by miR-27a*. [score:3]
In vivo Expression and Delivery of miR-27a* Reduces HNSCC Tumor Growth. [score:3]
decreased the effect of miR-27a* expression on HNSCC cell viability as compared to control vector alone (Fig. 4A). [score:2]
MiR-27a, −27b and −7 were predicted to have two target sites in the 3'UTR and one in the CDS. [score:2]
Analysis of this cohort demonstrated a consistent pattern of significantly decreased miR-27a* expression in HNSCC tumor specimens compared to normal tissues (Fig. 1D). [score:2]
These findings were confirmed with analysis of protein expression in HNSCC cells transfected with miR-27a*, resulting in reduced protein levels of EGFR, AKT1 and mTOR compared to miR-control (Control). [score:2]
Taken together, these results demonstrate post-transcriptional regulation of EGFR, AKT1, and mTOR by miR-27a*. [score:2]
These findings will drive future studies to examine other pathways regulated by miR-27a* and to understand potential loss-of-function effects related to miR-27a*. [score:2]
Increased miR-27a* expression was confirmed by qRT-PCR in the tumors of the doxycycline -treated animals as compared to the control animals (Fig. 5C). [score:2]
MiR-27a* expression significantly reduced the growth and viability of HNSCC in a preclinical mo del. [score:2]
To assess the delivery of miR-27a* in vivo, 17B oral tumors were directly injected with PBS, pSuper-empty, or pSuper-27a*, all mixed with liposome at a ratio of 5:1 [46, 47]. [score:2]
MiR-27a* simultaneously decreases expression of EGFR, AKT1, and mTOR leading to decreased solid tumor viability. [score:2]
Transfection of HNSCC cells with miR-27a*-IH slightly increased EGFR, AKT1 and mTOR expression as compared to miR-27a* and -Control (Fig. S3B). [score:2]
Combined with the viability assays, these results expand the tumor suppressive functions of miR-27a* to include apoptosis and impaired migration in HNSCC cells. [score:2]
To verify that the effects on cell viability were specific to miR-27a*, we transfected the miR-27a stem-loop structure (miR-27a-SL; Fig. 1B), which is processed into miR-27a and miR-27a*, in HNSCC and oral keratinocyte cells (Fig. S2B). [score:1]
We then transfected the miRNA mimics into pancreatic, breast, prostate, and endometrial carcinoma cell lines and observed decreased cell viability with miR-27a*, but not miR-27a and −7 (Fig. 2C), suggesting the biologic effects of miR-27a* are not restricted to HNSCC. [score:1]
The interaction of miR-27a* with the CDS of the EGFR sequence, as observed in our work, appears to be the first example of this interaction in human cells. [score:1]
miR-27a* transfection decreases cell viability in HNSCC cells and other solid tumor types. [score:1]
Cell cycle analysis indicated a marked increase in the sub-G1 apoptotic fraction (Figs. S4B and S4C) and Annexin V staining showed a significant increase in both early and late apoptotic cells, following miR-27a* transfection but not transfection of miR-27a and −7 (Figs. 4C and S4A). [score:1]
Although there was a decrease in cell viability in HNSCC cells with miR-27a-SL, the effect was not as dramatic as with miR-27a* alone and there was no significant effect of miR-27a*, −27a or miR-27a-SL on HOK16B cells. [score:1]
Transfection of these EGFR reporter constructs and miR-27a* in HNSCC cells showed that the candidate binding site in E160-pGL3 was not functional (Fig. S3C). [score:1]
Cell viability in the HNSCC or HOK16B cells was not affected by miR-27a*-IH (Fig. S2C). [score:1]
The mature miR-27a* sequence was synthesized (Sigma Aldrich) and inserted into pSuper (Oligoengine) and pSingle (Clontech). [score:1]
Evaluation of matched normal and tumor samples (n=7 pairs) also showed significantly decreased miR-27a* expression in the tumors (Fig. 1E). [score:1]
We also assessed the potential for exogenous delivery of miR-27a* to affect the growth of 17B cells in vivo by local delivery of miR-27a* using a liposomal vehicle. [score:1]
This theory is supported by our studies as miR-27a* transfection into HNSCC cells had significant functional effects while its complementary strand, miR-27a, did not. [score:1]
Moreover, we confirmed the effect of miR-27a* on mRNA levels by qRT-PCR (Fig. S3A). [score:1]
Similarly, studies with E2145-pGL3 (WT) and (MT) demonstrated miR-27a* interactions with the 2 distal binding sites in the CDS (Fig. 3E). [score:1]
We used software prediction programs to identify candidate binding sites of miRNAs within the EGFR gene and identified miR-7, −27a (miR-27a-3p), −27a*, −27b (miR-27b-3p), −27b* (miR-27b-5p), and −128 (Fig. 1A). [score:1]
These results suggest that miR-27a* alters HNSCC tumor growth in vivo and can serve as a potential therapeutic regimen in the treatment of patients with HNSCC. [score:1]
We confirmed these findings by evaluating the expression of miR-27a* in patients with HNSCC. [score:1]
Reporter constructs for the 3'UTR of AKT1 and mTOR (Fig. S3D) demonstrated similar decreased transcriptional activity when introduced into HNSCC cells along with miR-27a* (Fig. S3E). [score:1]
Similarly, miR-27a*-IH did not affect luciferase activity with the E3908-pGL3 (WT), AKT1-pGL3, mTOR-pGL3 or MT counterparts (Fig. S3F). [score:1]
Nevertheless, our current studies suggest that miR-27a* is an attractive therapeutic option for the treatment of solid tumors. [score:1]
PARP cleavage verified the increase in apoptosis following transfection of miR-27a* into HNSCC cells (Fig. 4D). [score:1]
miR-27a* Decreases Cell Viability in HNSCC and Other Solid Tumors. [score:1]
This analysis suggested that miR-27a* levels may be significantly altered in HNSCC and perhaps related to prognostic clinical features. [score:1]
[1 to 20 of 85 sentences]
8
[+] score: 193
Other miRNAs from this paper: hsa-mir-27a
To identify a direct target of miR-27a among the differentially expressed proteins, we inquired several algorithms and predicted calreticulin as a putative target owing to a conserved seed recognition sequence in the 3′UTR of the corresponding mRNA (Figure 4a). [score:8]
Calreticulin, ERp57, GRP78/BiP, Annexin1 and Tapaxin were downregulated in western blotting analysis of extracts from HCT116 tumours, whereas they were all upregulated in those with a silenced miR-27a. [score:7]
miR-27a expression in CRC inversely correlates with MHC class I and calreticulin expression and with CD3 [+] and CD8 [+] T cells' infiltration/activationTo correlate the data obtained in vitro and in mouse xenografts with human CRCs, we performed quantitative western blotting analysis of some representative samples: high miR-27a -expressing CRCs displayed low MHC class I molecules and calreticulin (Figures 6a and b). [score:7]
All together these data demonstrate that the surface expression of MHC class I molecules is downregulated by miR-27a. [score:6]
Synthetic miR-27a mimic (Syn-hsa-miR-27a), miR-27a inhibitor (anti-hsa-miR-27a) or the appropriate scrambled controls (AllStar or mirScript Inhibitor-Negative Control) were purchased from Qiagen (Hilden, Germany). [score:5]
25, 26 The in vivo data support this notion: high miR-27a -expressing tumours inversely correlate with MHC class I expression in our CRC series. [score:5]
The specificity and efficacy of miR-27a inhibition or overexpression was verified by qRT-PCR on total RNAs extracted from the two different types of tumours. [score:5]
miR-27a expression in CRC inversely correlates with MHC class I and calreticulin expression and with CD3 [+] and CD8 [+] T cells' infiltration/activation. [score:5]
[22] A miScript Target Protector (TP) was designed against this recognition sequence to selectively prevent the binding of miR-27a to the corresponding mRNA, without interfering with the action of the miRNA on other targets. [score:5]
HCT116 and HT29, representative of miR-27a -overexpressing or -downexpressing cells, respectively, were subcutaneously transplanted into nude mice. [score:5]
Accordingly, IHC of tissue microarrays showed that high miR-27a -expressing tumours frequently displayed a weak or absent membrane staining for MHC class I molecules and calreticulin; the staining was stronger in low miR-27a -expressing tumours (Figure 6c). [score:5]
miR-27a upregulation occurs from the very early phases of colorectal tumourigenesis and persists throughout the progression accounting for a more aggressive development. [score:5]
Although further studies are required to provide mechanistic insight into the link between miR-27a and MHC class I antigen presentation and, ultimately, CD8 [+] T cells' recognition and activation, our present data indicate that the miR-27a/calreticulin axis regulates MHC class I cell surface expression. [score:4]
In conclusion, we demonstrate for the first time that miR-27a modulates MHC class I surface exposure by directly targeting calreticulin. [score:4]
miR-27a directly targets calreticulin affecting MHC class I exposure. [score:4]
Collectively, miR-27a acts as an oncomiRNA from the early phases of colon tumourigenesis, impairs MHC class I and calreticulin expression, correlates with CD3 [+]/CD8 [+] infiltration, development of distant metastases and poorer outcome likely affecting the host antitumour immune response in vivo. [score:4]
Calreticulin, thus, is a direct target of miR-27a and mediates the effects on MHC class I exposure. [score:4]
Specifically, miR-27a represses MHC class I surface exposure directly targeting calreticulin, a protein involved in the quality control of the assembly of this multi-subunit complex contributing to its stability and retrieval of suboptimally assembled MHC class I molecules. [score:4]
miR-27a is upregulated in human adenoma and CRC. [score:4]
After 2 weeks, a miR-27a inhibitor or scrambled controls were intratumourally injected every 7 days for four times in HCT116-derived tumours. [score:3]
The miR-27a-antisense (MZIP27a-PA-1), the pre-miR-27a expression constructs (PMIRH27a-onlyPA-1) and scrambled control miRNAs (MZIP000-PA-1; PMIRH000PA-1) plasmids (System Biosciences, Mountain View, CA, USA) were transfected in the different CRC cell lines. [score:3]
miR-27a was already elevated in about 60% of adenomas and further increased during tumour progression (stages I–II, n=48; stages III–IV, n=32), suggesting that its aberrant expression is an early event in colon tumourigenesis (Figure 1D). [score:3]
We selected miR-27a for further analysis and assessed its expression in our series of adenomas (n=32) and sporadic CRCs (n=80) by quantitative RT-PCR analysis. [score:3]
[24] Consistently, Kaplan and Meier analysis of patients' survival showed that low calreticulin expression (P<0.001) and CD3 [+] and CD8 [+] low infiltrates (P<0.001), taken alone, were significantly associated with a shorter overall survival, whereas high miR-27a showed only a trend (P=0.104; Supplementary Figures S4A and B). [score:3]
17, 18, 19, 20 We also transfected HCT116 cells with a plasmid carrying the miR-27a mimic and, among the overexpressing clones, we selected one hereafter named miR27a_OE. [score:3]
In line, CRCs expressing the combination high miR-27a/low calreticulin are associated with reduced CD3 [+]/CD8 [+] T cells' infiltrates and cytotoxic activity, a more aggressive behaviour, metastatic spreading and worse outcome. [score:3]
At day 36, tumour masses were measured, excised and further analysed; qRT-PCR was performed on RNA from xenografts to establish the efficiency of miR-27a inhibition/overexpression. [score:3]
The analysis of the same markers in HT29 tumours produced an opposite scenario, in line with the lower expression of miR-27a that was reversed upon injection of the corresponding mimic. [score:3]
The efficacy of the silencing was established by assessing diminution of miR-27a and increase of validated targets (PPARG, ZBTB10 and FBXW7) (Figure 2c and Supplementary Figure S1A). [score:3]
Accordingly, we assessed cell-surface exposure of MHC class I molecules in three different cell lines (HCT116, HT29 and R KO) and their derivative clones with either a silenced or overexpressed miR-27a. [score:3]
[23] Thus CD8 [+]/perforin [+] and CD8 [+]/LAMP-1 [+] double -positive cells, detected by immunofluorescence on CRC specimens, were higher in low miR-27a -expressing tumours (Figures 7A and B). [score:3]
Only cytoplasmic miR-27a intensity was retained for scoring, and miRNA expression was quantified analysing chromogen-specific intensity by Image J. [38] IHC for CD8 [+] (Clone C8/144B; Dako) and perforin (Diagnostic Biosystem) were performed on the Benchmark LT automated system from Leica Microsystems Bondmax (Leica, Wetzlar, Germany) according to the manufacturer's specifications. [score:3]
27, 28 miR-27a is crucial in immune cells, as it inhibits DCs maturation and T cells' proliferation and activation, whereas induces M2b and M2c macrophage subtypes maturation. [score:3]
In each experiment, the extent of miR-27a silencing/overexpression and calreticulin silencing were assessed by qRT-PCR and western blotting analysis, respectively. [score:3]
In accordance with the size, Ki67 positivity was stronger in the high miR27a -expressing tumours than the lower ones, supporting a role of this miRNA in cell proliferation (Supplementary Figures S3A and B). [score:3]
Collectively, mouse xenografts confirmed that miR-27a affects cell growth and apoptosis also in CRC and clearly showed that it negatively modulates a specific set of proteins identified in vitro that specifically contribute to MHC class I expression. [score:3]
15, 16 miR-27a expression remarkably increased with tumour staging and inversely correlated with patients' overall survival, consistent with the results of our data set (Supplementary Figure S5A). [score:3]
To correlate the data obtained in vitro and in mouse xenografts with human CRCs, we performed quantitative western blotting analysis of some representative samples: high miR-27a -expressing CRCs displayed low MHC class I molecules and calreticulin (Figures 6a and b). [score:3]
4, 5, 13 By a 2DE-DIGE proteomic approach, we identify a series of proteins modulated by miR-27a implicated in MHC class I expression. [score:3]
For miR-27a/CD8 [+]/perforin expression analysis, primary sporadic CRCs were considered. [score:2]
Identification of novel genes and pathways regulated by miR-27a by differential proteome analysis. [score:2]
By contrast, apoptosis was greatly reduced in the same tumours, whereas large areas of apoptosis were detected in those expressing low miR-27a by a terminal deoxynucleotidyl transferase (TdT) -mediated dUTP nick end-labelling test (TUNEL) assay (Figures 5b and c). [score:2]
The staining was, instead, remarkably localized as ‘patches' on cell membranes in tumours injected with a miR-27a antisense (Figure 5b). [score:1]
A more quantitative western blotting analysis on extracts from the same tumours confirmed in a mouse mo del that miR-27a silencing was associated with an overall increase of MHC class I proteins (Figures 5b, d and e). [score:1]
At a higher magnification, the staining was localized at the cell membrane, consistent with stimulation of MHC class I cell surface translocation upon miR-27a silencing. [score:1]
When the CD8 [+] infiltrates were associated with miR-27a levels, the combination low CD8 [+]/high miR-27a had the worse prognosis; hazard ratios analysis of all possible associations highlighted the presence of CD8 [+] infiltrates as a dominant variable (Figures 7C and D). [score:1]
Also, the tumours obtained upon injection of a miR-27a mimic into HT29 cell-derived masses were >50% larger than those from the parental cells (Figure 5a). [score:1]
miR-27a inversely associated also with CD3 [+] and CD8 [+] T cells' mRNAs from the early tumour stages and correlated with poor prognosis, supporting the results of our series (Supplementary Figures S6C–E). [score:1]
A plasmid vector carrying a short hairpin anti-miR-27a RNA (shRNA) and the GFP (green fluorescence protein) cassette was stably transfected into HCT116 cells (CTRL); a cell clone, hereafter defined miR27a_KD, was chosen for further studies (Figure 2b). [score:1]
7, 8, 9, 10, 11 Mechanistically, calreticulin is a major downstream effector of miR-27a in repressing MHC class I surface exposure, a pivotal event in eliciting an efficient immune response and tumour eradication. [score:1]
Altogether, these results suggest that miR-27a could impair T cells' infiltration, activation, proliferation and degranulation. [score:1]
Alternatively, a miR-27a mimic or scrambled controls were injected in HT29-derived tumours. [score:1]
Formalin-fixed paraffin-embedded (FFPE) sections of tubular adenomas with low-grade/high-grade dysplasia or colorectal adenocarcinomas (G1, G2 and G3) were stained for miR-27a. [score:1]
Interestingly, whereas calreticulin mRNA was elevated in all data sets, the corresponding protein was reduced, a discrepancy explained by the posttranscriptional control mediated by miR-27a reported here (Supplementary Figures S6A and B; Figures 6a–c). [score:1]
To identify novel proteins and pathways modulated by miR-27a, we employed a proteomic approach. [score:1]
Furthermore, miR-27a inversely correlated with CD3 [+] and CD8 [+] T cells' infiltration and perforin positivity whose relative abundance was determined (Figures 6c and d). [score:1]
These results definitely demonstrate that miR-27a is a CRC tumour-inducing factor acting as an oncomiRNA. [score:1]
29, 30, 31 Here we provide evidence that miR-27a has a key role also in tumour cells by repressing MHC class I cell surface exposure. [score:1]
miR-27a appears to be a multifaceted signaling molecule that may influence tumour cells–host immunological interactions likely disabling components of the immune system that have been dispatched to eliminate them. [score:1]
of extracts from the same tissues exhibited an overall increase of calreticulin only in those masses with a reduced miR-27a (Figures 5d and e). [score:1]
miR-27a downmodulates MHC class I cell surface exposure. [score:1]
Serial sections obtained from the original paraffin blocks were stained for miR-27a, CD8 [+] and perforin. [score:1]
In situ RNA hybridizationFormalin-fixed paraffin-embedded (FFPE) sections of tubular adenomas with low-grade/high-grade dysplasia or colorectal adenocarcinomas (G1, G2 and G3) were stained for miR-27a. [score:1]
The size of HCT116-derived malignancies was remarkably larger (>50%) than those injected with the miR-27a antisense. [score:1]
High miR-27a/low calreticulin was also associated with the development of liver metastasis and CD3 [+]/CD8 [+] T cells' infiltrates were reduced in metastases compared with matched primary tumours (Supplementary Figures S4C–E). [score:1]
The signal detected on tissue sections from miR-27a antisense -injected tumours was stronger than from the scrambled injected or parental cell tumours. [score:1]
Mouse xenografts recapitulate miR-27a effects on the proteomic profile and cell growth. [score:1]
miR-27a probe was labelled with 5-digoxigenin and synthesized by Exiqon (Vedbaek, Denmark). [score:1]
Our data support that miR-27a has a critical role in colon tumourigenesis likely influencing the antitumour immune response. [score:1]
The low calreticulin/high miR-27a association (n=26) was the one with the worst outcome when these characteristics were combined; hazard ratios analysis of all possible associations identified calreticulin as a dominant variable that was even more discriminant when coupled with high miR-27a expression. [score:1]
To determine the impact of the miR-27a/calreticulin axis on MHC class I molecules surface exposure, we transfected calreticulin TP and siRNAs in the three cell lines. [score:1]
35, 36 Two weeks after transplantation, when tumours reached the volume of 200 mm [3], mice were grouped (N=5/group) and intratumourally injected every 7 days for four times with anti–miR-27a (4 ng/mm [3]) for HCT116 or with miR-27a mimic (2 ng/mm [3]) for HT29 xenograft mo dels. [score:1]
gov/docs/publications/coadread_2012), respectively, were analysed for miR-27a expression in adenoma and CRC tissues to evaluate its prognostic significance. [score:1]
[1 to 20 of 73 sentences]
9
[+] score: 180
Collectively, the results indicate that over expression of miR-27a-3p inhibits Wnt3a expression at protein level. [score:7]
Over-Expression of MiR-27a-3p in Melanocytes Inhibits the Expression of Wnt3a and β-Catenin. [score:6]
These results demonstrate that miR-27a-3p can regulate Wnt3a expression by affecting Wnt3a protein translation. [score:6]
In contrast to miR-27a-3p mimic treatment, miR-27a-3p inhibitor treatment displayed the opposite effect on Wnt3a protein expression: Wnt3a expression was increased in the miR-inhi group compared with that in the inhi-NC group (p < 0.01, Figure 4). [score:6]
The expression levels of miR-27a-3p in miR-27a inhi groups are significantly less than other groups (p < 0.05); (B) There are no significant difference in Wnt3a mRNA expression levels between control and other groups. [score:5]
These data suggest that over expression of miR-27a-3p in melanocytes could inhibit melanogenesis. [score:5]
Figure 4Expression levels of Wnt3a protein in melanocytes transfected with miR-27a mimic or inhibitor as well as their controls. [score:5]
Figure 5Expression levels of β-catenin mRNA in melanocytes transfected with miR-27a mimic or inhibitor as well as their controls. [score:5]
In conclusion, our results demonstrated that Wnt3a is a target of miR-27-3p, and miR-27a-3p can inhibit melanogenesis in melanocytes. [score:5]
Expression of β-catenin mRNA in the miR-27a mimic or inhibitor or their negative control transfected groups were determined by real-time PCR. [score:5]
The transfection groups included control (untransfected), miR-NC (transfected with miR-27a-3p mimic negative control), miR-27a (transfected with miR-27a-3p mimic), inhi-NC (transfected with miR-27a-3p inhibitor negative control), and miR-27a inhi (transfected with miR-27a-3p inhibitor). [score:5]
Results indicate that miR-27a affects Wnt3a protein expression, which in turn affects β-catenin expression. [score:5]
So miR-27-3p represses Wnt3a protein expression to inhibit melanogenesis. [score:5]
The treatment groups included control (untransfected), miR-NC (miR-27a-3p mimic negative control), miR-27a (miR-27a-3p mimic), inhi-NC (miR-27a-3p inhibitor negative control), and miR-27a inhi (miR-27a-3p inhibitor). [score:5]
Expression of Wnt3a mRNA and protein in the miR-27a mimic or inhibitor -transfected groups were quantified by real-time PCR and Western blotting, respectively. [score:5]
As a result, miR-27a-3p inhibits melanogenesis, Wnt3a protein expression and β-catenin in mouse melanocytes. [score:5]
Zhu H. Wu H. Liu X. Evans B. R. Medina D. J. Liu C. G. Yang J. M. Role of microRNA miR-27a and miR-451 in the regulation of MDR1/P-glycoprotein expression in human cancer cells Biochem. [score:4]
Over-Expression of MiR-27a-3p in Melanocytes Inhibits Melanogenesis. [score:4]
Figure 6Melanin contents in melanocytes transfected with miR-27a mimic or inhibitor as well as their controls. [score:3]
The results indicate that miR-27a-3p mimic, inhibitor and their NC can be transfected into melanocytes efficiently. [score:3]
MiR-27a-3p Targets the Predicted miRNA Binding Site in the 3' UTR of Wnt3a. [score:3]
Figure 1Expression of miR-27a-3p and Wnt3a mRNA in brown and gray mouse skin. [score:3]
The inverse relationship between the expressions of miR-27a-3p and Wnt3a mRNA in brown vs. [score:3]
The constructs were co -transfected into HEK293T cells with the pMSCV-miR-27a-3p expression plasmid or negative control plasmid. [score:3]
A partial 3' UTR (671 bp) of the mouse Wnt3a gene with the miR-27a-3p binding site was PCR amplified, TA cloned and then subcloned into pmirGL0 dual-luciferase miRNA target vector (Promega, Madison, WI, USA) with Sac I and Xba I restriction sites to generate the wild-type construct (pmirGL0-Wnt3a-wt-3' UTR). [score:3]
Figure 3Expression levels of miR-27a-3p and Wnt3a mRNA in miR-NC, miR-27a, Inhi-NC, miR-27a inhi and Control group. [score:3]
The target genes of miR-27a-3p were predicted using miRanda (http://www. [score:3]
The expression of miR-27a-3p in miR-27a inhi group is significantly less than other groups (p < 0.05) (Figure 3A). [score:3]
To evaluate the effect of miR-27a-3p on the expression of endogenous Wnt3a in melanocytes, Wnt3a protein was stained using immunofluorescence in mouse melanocytes and cultured mouse melanocytes were transfected with miR-27a-3p mimic or inhibitor, and their negative controls. [score:3]
In this study, we provided evidence to support a functional role of miR-27a-3p in inhibiting melanogenesis in mouse melanocytes by repressing Wnt3a. [score:3]
Results indicated that the relative expression of miR-27a-3p in gray mouse skin is significantly higher (3.14 times, p < 0.01) than that in brown mouse skin (Figure 1A). [score:3]
Figure 2Wnt3a is a target of miR-27a-3p. [score:3]
gray mouse skin suggests that Wnt3a might be a potential target of miR-27a-3p. [score:3]
In the present study, we provided evidence supporting a role of miR-27a-3p in inhibiting melanogenesis. [score:3]
Ji J. Zhang J. Huang G. Qian J. Wang X. Mei S. Over-expressed microRNA-27a and 27b influence fat accumulation and cell proliferation during rat hepatic stellate cell activation FEBS Lett. [score:3]
Thus, miR-27a-3p could repress Wnt3a to inhibit melanogenesis in mouse melanocytes. [score:3]
The miR-27a-3p mimic, miR-27a-3p inhibitor and their negative control molecules were synthesized by QIAGEN (Hilden, Germany). [score:3]
We performed real time PCR analysis to determine the expression of miR-27a-3p in gray vs. [score:3]
The mutant construct (pmirGL0-Wnt3a-mut-3' UTR) with mutations in the miR-27a-3p binding site of the Wnt3a 3' UTR sequence was created using the Site-Directed Gene Mutagenesis Kit (Beyotime, ShangHai, China) and specific primers containing mutated nucleotides (Table 1). [score:2]
Expression of MiR-27a-3p and Wnt3a mRNA in Brown and Gray Mouse Skin. [score:2]
Real time PCR analysis shows that expression of miR-27a-3p is significantly higher in miR-27a mimic transfected group compared to other groups (p < 0.01). [score:2]
Guttilla I. K. White B. A. Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells J. Biol. [score:2]
Synthesis of cDNA for real-time PCR analysis of miR-27a-3p expression in mouse skin and cultured melanocytes was performed using the PrimeScriptTM RT Master Mix (Perfect Real Time) kit (TAKARA, Dalian, China) and a miR-27a-3p stem loop primer according to the manufacturer’s instructions. [score:2]
The results indicate that miR-27a-3p can bind and regulate Wnt3a specifically through the predicted binding site in the 3' UTR of the gene. [score:2]
Based on the skin miRNAomes of alpaca with brown and white coat color, expression of miR-27a-3p is nearly six times higher in white alpaca skin compared to brown skin [15]. [score:2]
MiR-27a-3p has been reported to regulate multiple genes in cancer cells [25, 26], as well as in fat metabolism and cell proliferation during hepatic stellate cell activation [27]. [score:1]
The predicted binding site for miR-27a-3p lies between positions 2457 to 2464 bp in Wnt3a cDNA. [score:1]
To determine the effect of miR-27-3p on the production of melanin in melanocytes, the melanin contents in the cells transfected with miR-27a-3p mimic or miR-27a-3p inhibitor, as well as their negative controls were measured. [score:1]
Treated cells were divided into 5 groups: miR-NC, miR-27a, Inhi-NC, miR-27a inhi and untransfected control. [score:1]
To validate the specificity of miR-27a-3p regulation of Wnt3a through the predicted miRNA binding site, luciferase reporter assays were performed using luciferase reporter constructs containing either the wild type Wnt3a 3' UTR (pmirGL0-Wnt3a-wt-3' UTR) or the mutant Wnt3a 3' UTR (pmirGL0-Wnt3a-mut-3' UTR). [score:1]
Quantification of miR-27a-3p transcript abundance was performed using the comparative threshold cycle (C [t]) method. [score:1]
The melanin content was normalized relative to miR-27a group. [score:1]
Twenty-four hours after seeding, cells were transfected with 150 ng of pmirGL0-Wnt3a-wt-3' UTR or pmirGL0-Wnt3a-mut-3' UTR together with 250 ng of pMSCV-pre-miR-27a or negative control. [score:1]
The differences in abundance of miR-27a-3p and Wnt3a mRNA between gray and brown mouse skin, and the differences in Wnt3 and β-catenin mRNA, Wnt3a protein and melanin content in miR-NC, miR-27a, inhi-NC, miR-27a inhi and control groups (n = 3) were determined by analysis of variance using SPSS software (IBM, Armonk, NY, USA). [score:1]
MiR-27a-3p was shown to be expressed significantly higher in white skin compared to brown skin of alpaca [15]. [score:1]
The luciferase activity of cells co -transfected pGL0 Wnt3a 3' UTR (wt) with pMSCV-pre-miR-27a decreased 41%. [score:1]
Mouse pri-miR-27a was PCR amplified and TA cloned into the pUC-T vector (CWBIO, Beijing, China). [score:1]
The abundance of miR-27a-3p was normalized relative to that of U6 snRNA. [score:1]
[1 to 20 of 58 sentences]
10
[+] score: 173
The aforementioned experiments suggested that in addition to effecting erythroid differentiation, upregulated GATA-1 bound and activated the miR-27a and miR-24 genes, which led to further repression of GATA-2 translation and facilitated GATA-1 replacement of GATA-2 at miRNAs promoter (Figure 6A). [score:6]
Our findings were in consistent with studies using the hemin -treated K562s or EPO -induced CD34+ HPCs to differentiate into mature erythrocytes, revealing the upregulation of miR-23a, miR-27a or miR-24 during erythropoiesis, whereas an activin A -mediated erythroid mo dels reported the inhibitory role of miR-24 in haemaglobin accumulation. [score:6]
Here, miR-27a and miR-24 perform post-transcriptional protection through repressing the translation of GATA-2, which should not be expressed in differentiated erythroid cells. [score:5]
Additionally, the ectopic expression of miR-27a or 24 in K562s reduced GATA-2 levels by ∼3-fold, whereas GATA-2 levels increased by ∼2-fold when endogenous miRNAs were inhibited (Figure 4C). [score:5]
In contrast to miR-451 locus whose expression was restricted to the fetal liver in embryonic day (E) 16.5 mouse embryos, the major site of haematopoiesis and erythropoiesis at this stage of development, miR-27a and miR-24 seem to serve as universal regulators in different cell types. [score:5]
As expected, the percentage of benzidine -positive cells (Supplementary Figure S4A) and gamma-globin accumulation (Supplementary Figure S4B) increased in miR-27a or miR-24 over-expressed K562s, whereas the percentage of benzidine -positive cells decreased in K562s following the inhibition of miR-27a or miR-24. [score:5]
Inhibition of GATA-1 repressed pri-miR-27a∼24 and mature miRNAs by ∼3-fold and ∼2-fold, respectively (Figure 1H), whereas overexpression of GATA-1 enhanced the levels of primary and mature miRNAs (Figure 1H). [score:5]
To further validate our findings, a northern blot was performed and showed that both precursor and mature levels of miR-27a, 24 and 23a were upregulated during erythroid differentiation (Figure 1C). [score:4]
Primary and mature transcripts of the miR-23a∼27a∼24-2 cluster were upregulated in differentiated erythroid cellsThe miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24. [score:4]
Figure 5. The GATA switch regulated miR-27a and miR-24 expression. [score:4]
Therefore, miR-27a and miR-24 accelerated the development of mature erythroid populations by repressing GATA-2 expression in transplanted mouse mo dels. [score:4]
Collectively, the expression patterns of miR-27a and miR-24 in two separate erythroid differentiation mo dels (K562s and HPCs) suggested that they may be two potential regulators of erythroid differentiation. [score:4]
Increased GATA-2 expression led to a decrease in the levels of Pri-27a∼24 and mature miR-27a or miR-24 (Figure 5E), whereas GATA-2 knock-down increased the transcription and maturation of miR-27a and miR-24 (Figure 5E). [score:4]
These binding changes resulted in transcriptional changes of miR-27a and miR-24, as evidenced by an increase or decrease in their primary and mature transcripts on GATA-1 over -expression or silencing (Figure 1H). [score:3]
By the light of nature, we further demonstrated the GATA-1/miR-27a/24/GATA-2 regulatory circuit in human erythroid cells, representing the decoding of an expansive regulatory layer of GATA-1 and GATA-2. In details, GATA-2 localized to chromatin sites of the miRNA promoter and transcriptionally repressed miR-27a and miR-24 in early stage erythroblasts. [score:3]
MiR-27a and miR-24 co -targeted GATA-2 in erythrocytes. [score:3]
Remarkably, only a few reports have raised concerns about the expression of miR-27a and miR-24 in haematopoiesis (30, 31). [score:3]
The change of GATA factor occupancy was in parallel with their expression (Figure 5H, bottom panel) during HPCs erythroid differentiation and the accumulation of Pri-miR-27a∼24 (Figure 5H, top panel). [score:3]
Over -expression of miR-27a or miR-24 decreased the binding of GATA-2 and increased GATA-1 occupancy (Figure 6B and C). [score:3]
To determine whether GATA-1 would influence the expression of miR-27a and miR-24, the primary and mature transcripts of miR-27a and miR-24 were evaluated in K562s transfected with siRNAs specific to GATA-1 or constructs overexpressing GATA-1 (Figure 1G). [score:3]
Enforced expression of miR-27a and miR-24 in mouse enhanced mature erythroid populations. [score:3]
Our study demonstrates that GATA factors elaborately control the transcription of miR-27a and miR-24 and reveals a regulatory circuit that regulates the GATA-1/2 switch via miR-27a and miR-24 to promote erythroid maturation. [score:3]
Another recent study also indicated the suppression of GATA-2 by miR-27a on earlier stages of blood differentiation, which forcefully supports our findings in haematopoiesis (37). [score:3]
Similarly, inhibition of miR-27a or miR-24 resulted in increased GATA-2 occupancy and decreased GATA-1 binding with DNA sequences (Figure 6B and C). [score:3]
Animals that displayed miR-27a and miR-24 overexpression demonstrated an increase in region 3 (R3) of CD71 [low]/TER119 [high] erythrocytes and a concomitant decrease in region 1 (R1) of CD71 [high]/TER119 [high] erythroblasts from bone marrow and spleen (Figure 7A, B). [score:3]
These data suggested that the inhibition of GATA-2 could rescue the erythroid deficiency caused by miR-27a or miR-24 silencing. [score:3]
Figure 3. Suppression of miR-27a or miR-24 blocked erythroid differentiation in zebrafish. [score:3]
These results were consistent with the expression levels of miR-27a and miR-24 (Figure 5E). [score:3]
miRNA mimics (miR-27 a and miR-24), miRNA inhibitors (Anti-27a and Anti-24) and negative control molecules (Scramble) were obtained from Dharmacon (Austin, TX, USA) and transfected with DharmFECT1 (Dharmacon, Austin, TX, USA) at a final concentration of 60 nM. [score:3]
Figure 7. MiR-27a and miR-24 overexpression enhanced erythropoiesis in mice. [score:3]
In this study, we demonstrated the co-regulation of miR-27a∼24 and Gata-2 transcription by GATA-1 and the co-regulation of GATA-2 production by GATA-1 and miR-27a/24. [score:3]
The effect of GATA-1 on miR-27a and miR-24 expression in HPC erythroid differentiation was examined. [score:3]
Suppression of miR-27a or miR-24 blocked erythroid differentiation in zebrafish. [score:3]
As expected, treatment with miR-27a or miR-24 mimics increased the level of primary transcript in K562s, whereas repression of miR-27a or miR-24 by miRNA inhibitors decreased the level of pri-miRNA (Figure 6D). [score:3]
GATA-2 modulated the regulatory effects of miR-27a and miR-24 on erythroid differentiation. [score:2]
MiR-27a and miR-24 mediated a forward regulatory circuit composed of a GATA switch. [score:2]
Figure 6. A regulatory circuit involving GATA-1, GATA-2 and miR-27a/24 in erythropoiesis. [score:2]
Zebrafish demonstrate increased miR-27a and miR-24 levels during development and is a classic and reliable mo del to study haematopoietic gene function (Figure 3B). [score:2]
To analyse the roles of miR-27a and miR-24 in vivo, we used miRNA MOs to test whether the knock-down of endogenous miRNAs would affect zebrafish erythropoiesis. [score:2]
Thus, a feed-forward circuit containing miR-27a/24, GATA-2 and GATA-1 may positively regulate erythroid differentiation. [score:2]
Therefore, miR-27a/24 and GATA-1/2 form a regulatory circuit that supports the activation of their own genes. [score:2]
Conversely, a miRNA loss-of-function study using recombinant lentivirus carrying antisense RNAs specific to miR-27a (Zip-27a) or 24 (Zip-24) (the efficiency of miRNA inhibition is shown in Supplementary Figure S2A) demonstrated impaired erythroid maturation, as revealed by fluorescence-activated cell sorting (FACS) analysis (Supplementary Figure S2B; Figure 2E), morphological analysis (Figure 2E and F), gamma-globin detection (Figure 2G) and colony-forming assays (Figure 2H; Supplementary Figure S2F). [score:2]
MiR-27a and miR-24 display completely evolutionary conservation among eukaryotes and are organized in a cluster on chromosome 19 of the human genome. [score:1]
To determine the effect of miR-27a and miR-24 on erythrocyte differentiation in adult haematopoietic tissues, a flow cytometry analysis was performed 8 weeks post-transplantation. [score:1]
Thus, our attempt to investigate the regulatory mechanism of miR-27a and miR-24 during erythropoiesis led to the identification of another erythroid GATA member, GATA-2. Figure 4. GATA-2 was post-transcriptionally regulated by miR-27a and miR-24 during erythropoiesis. [score:1]
Moreover, the miRNA-transduced HPCs generated larger colonies, when a typical BFU-E generated by GFP-transduced HPCs was ∼30∼60 μm, whereas the miR-27a- or miR-24 colonies were larger than 100 μm (Supplementary Figure S2E). [score:1]
As expected, miR-27a and miR-24 reduced luciferase gene activity by ∼50% and ∼30%, respectively. [score:1]
These results introduced the possibility that the higher occupancy of GATA-1 following hemin treatment may contribute to miR-27a and 24 activation. [score:1]
Cell-counting analyses at different stages of differentiation showed an increase of mature erythroblasts (orthochromatic and erythrocyte) in miR-27a- or miR-24-transduced HPCs with a concomitant decrease of immature erythroblasts (basophilic and polychromatic erythroblasts) (Figure 2A and B). [score:1]
Additionally, mature miR-27a and 24 were also increased in hemin -treated K562s (Figure 1B). [score:1]
For measurement of Pri-miR-27a∼24-2, miR-27a and 24 expression, q-PCR was performed using Taqman probes (Applied Biosystems, Foster City, CA, USA): pri-miR-27a∼24 (Hs03294931_pri), miR-27a (TM408), miR-24 (TM402), human GAPDH (Hs9999905_M1), RNU6B (TM1093) according to manufacturer’s instruction. [score:1]
With the exception of observations from the activin -induced haematopoietic differentiation mo del (32), miR-27a and miR-24 have been constantly demonstrated increased accumulation as differentiation proceeds, which support the idea that activation of the miR-27a and miR-24 loci might be required for the terminally differentiated cells. [score:1]
Figure 2. MiR-27a and miR-24 promoted erythroid differentiation in CD34+ HPCs. [score:1]
The miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24. [score:1]
Here, we demonstrate that the GATA-1/2 switch occurs at the common gene locus encoding miR-23a, miR-27a and miR-24. [score:1]
The levels of pri-miR-27a∼24 and mature miRNAs in these HPCs were then examined. [score:1]
Taken together, these results demonstrated that miR-27a and miR-24 were required for the proper erythroid differentiation in primary cultured CD34+ HPCs. [score:1]
Our results not only identified miR-27a and 24 as novel enhancers of erythropoiesis but also provided a dynamic change of GATA-1/-2 occupancy at miR-27a∼24-2 gene promoter, which conferred the activation of this locus during erythroid maturation. [score:1]
Meanwhile, CD34+ HPCs were transduced with a recombinant lentivirus harbouring miR-27a (Lenti-27a) or 24 (Lenti-24) following days 7, 11 and 15 of E culture. [score:1]
Data from control (SCR, n = 3), miR-27a (n = 3) and miR-24 (n = 3) animals are shown as the means ± SD. [score:1]
A conservation analysis of miR-27a and miR-24 sequences indicated that they are highly conserved among multiple species, including zebrafish (Figure 3A). [score:1]
We speculate that miR-27a and miR-24 may serve at a ‘standby state’, which means they are ready for the manipulation by different cellular factors, as GATA-1 in erythropoiesis, c-MYC in tumour metastasis (33), Runx2 in osteoblast differentiation (28) and PU. [score:1]
These results suggested that miR-27a and miR-24 are required for erythroid differentiation during primitive haematopoiesis in zebrafish. [score:1]
A bioinformatic analysis showed that the GATA-2 3′ UTR has potential binding sites for both miR-27a and miR-24 (Figure 4A). [score:1]
This cluster is composed of three members, miR-23a, miR-27a and miR-24, and has been linked to osteoblast differentiation, angiogenesis, cardiac remo delling, skeletal muscle atrophy and tumorigenesis (27–29). [score:1]
Meanwhile, in vitro and in vivo functional analyses indicated that miR-27a and miR-24 promoted erythroid differentiation in CD34+ HPCs, zebrafish and mice. [score:1]
Overall, the aberrant miR-27a or miR-24 levels fed back to positively modulate the level of their own primary transcripts. [score:1]
As erythropoiesis proceeds, GATA-1 level increased, and GATA-1 displaced GATA-2 from their shared binding site, thus leading to transcriptional activation of miR-27a and miR-24 (Figure 6E). [score:1]
To clarify the biological links among miR-27a/24, GATA-2 and erythroid phenotype, we used a ‘rescue’ experiment to assess their functional relevance in differentiating K562s. [score:1]
MiR-27a and miR-24 promoted erythroid differentiation in CD34+ HPCs. [score:1]
Furthermore, q-PCR using specific Taqman probes revealed that pri-miR-23a∼27a∼24-2 and mature miR-27a, miR-24 and miR-23a were increased in EPO -driven erythroid differentiation of primary cultured human CD34+ HPCs (Figure 1D). [score:1]
To test the roles of miR-27a and miR-24 in vivo, we conducted transplantation experiments in mice. [score:1]
Additionally, a reduction in hbbe3 and scl staining was also observed in miR-27a and miR-24 MOs -injected embryos at 10 somites (Figure 3G), which suggested an impairment of early erythroid differentiation by miRNA MOs treatment. [score:1]
The self-inactivating transfer vector plasmid containing miR-27a or 24 (pMIR-27a or 24) or antisense RNAs to miR-27a or 24 (pZip-27a or 24) and the packaging kit were purchased from System Biosciences (SBI, CA, USA) and operated according to the manufacturer’s instructions. [score:1]
To further establish the connection between GATA-2 and miR-27a/24, the levels of both the primary and mature miR-23a∼27a∼24-2 clusters were evaluated in K562s transfected with either siRNAs specific to GATA-2 or constructs over -expressing GATA-2 (Figure 5D). [score:1]
[1 to 20 of 75 sentences]
11
[+] score: 128
The up-regulation of Serpini1 mRNA and protein by miR27a may appear at first sight surprising, given that miRNAs have typically been associated with down-regulation of gene expression (i. e., translation repression and/or mRNA degradation) (He and Hannon, 2004). [score:11]
Four out of the six miRNAs undergoing validation exhibited congruence between miRNA profiling and qRT-PCR results, ranging from ~2-fold down-regulation to ~2-fold up-regulation [Table 1 and Figure 3; miR27a: t [(10)] = 2.848, p = 0.0173; miR146b: t [(10)] = 3.448, p = 0.0063; miR505: t [(10)] = 10.471, p = 0.0001; miR202-5p: t [(10)] = 3.222, p = 0.0091]. [score:7]
Our findings can be summarized as follows: (a) COA decreases the expression of miR-27a in mice that develop tolerance (Figures 2, 3), (b) miR-27a increases, not decreases, serpini1 expression (Figures 5, 6), thus decreased miR-27a may decrease Serpini1 expression, (c) COA decreases Serpini1 protein levels in the PFC (Figure 7), and (d) Serpini1 is negatively correlated with tolerance (less Serpini1 is associated with greater tolerance; Figure 4A). [score:7]
First, as regards miR-27a, there were an unusually high number of PFC mRNAs predicted to be targeted by miR-27a (18 targets total). [score:5]
Figure 5Putative targeting miRNA's miR-27a and miR-9 increase Serpini1 expression. [score:5]
In particular, a specific role for miR27a and Serpini1 in the behavioral response to COA is proposed and suggest that a larger role for differential miRNA expression and mRNA targeting may underlie the neuroadaptations that mediate tolerance to the analgesic effects of morphine. [score:5]
The results thus far support the hypothesis that in mice readily developing tolerance under pharmacologically-relevant conditions, COA decreases the expression of miR-27a, which in turn decreases serpini1 mRNA and protein expression thereby leading to analgesic tolerance. [score:5]
miR-27a modulates Serpini1 mRNA expression and protein levelsThe mouse Serpini1 3′-untranslated region (3′-UTR) is comprised of 1599 nucleotides. [score:5]
In vitro reporter assay confirmed the targeting of the Serpini1 3′-untranslated region by miR27a. [score:4]
Transfection of miR-27a mimic in mouse N1E-115 and N2A neuroblastoma cell lines resulted in up-regulation of Serpini1 protein. [score:4]
miR name miR changemiR Log [2] value Gene miRSVR score mRNA change mmu-miR-146b ↓ −0.3362 Gripap1 −0.6473 ↓ ↓ Fstl1 −0.4896 ↓ ↓ Dlgap1 −0.4727 ↓ ↓ Vps26a −0.2555 ↓ ↓ Gosr2 −0.1763 ↓ ↓ Gprasp1 −0.1232 ↓ ↓ Zfand6 −0.1105 ↓ ↓ Serpini1 −0.1097 ↓ mmu-miR-27a ↓ −0.3670 ↓ Ppp1r9a −0.8020 ↓ ↓ Ubqln1 −0.7975 ↓ ↓ Rps6ka5 −0.7940 ↓ ↓ Gosr2 −0.7700 ↓ ↓ Canx −0.7310 ↓ ↓ AI593442 −0.5274 ↓ ↓ Nsf −0.4902 ↓ ↓ Dgkb −0.4384 ↓ ↓ Dlgap1 −0.3411 ↓ ↓ Atp2b2 −0.2743 ↓ ↓ Zfand6 −0.1456 ↓ ↓ Nufip1 −0.1278 ↓ mmu-miR-505 ↑ 1.1166 Sap25 −1.2974 ↑ ↑ Parp11 −1.0018 ↑ ↑ Srbd1 −0.6136 ↑ ↑ Dicer1 −0.3529 ↑ ↑ Txnip −0.2797 ↑ ↑ Phf17 −0.1855 ↑ ↑ Ccnf −0.1480 ↑ Green up arrow: up-regulated in morphine vs. [score:4]
Unexpectedly in a dual luciferase assay employing an mRNA reporter construct of the luciferase open reading frame fused to the Serpini1 3′UTR, luciferase protein expression was significantly increased by miR-27a [t [(4)] = 8.46, p = 0.011] (Figure 5) and another putative targeting miRNA, miR-9 [t [(4)] = 17.56, p < 0.001]; but not miR-206 (p > 0.05), a miRNA with no binding sites to Serpini1, and a nonsense sequence control. [score:4]
The experiments confirmed miR-27a regulation of Serpini1 mRNA and protein as well as demonstrating altered analgesic tolerance development in Serpini1 KO animals. [score:3]
In order to determine if there was a causal association between miR-27a alteration of Serpini1 expression and the development of analgesic tolerance, we characterized the development of tolerance in Serpini1 KO animals and the corresponding B6 control group (Figure 8). [score:3]
These miRNAs have been shown to bind cis-acting sites that are adjacent/overlapping AU-rich motifs in the 3′-UTR of the targeted mRNA, as is the case for miR27a/ Serpini1 3′-UTR (see Figure 4B). [score:3]
MiR-9 was found to be overexpressed following COA and specifically by miR-27a (Figure 5). [score:3]
MiR-27a and miR-9 target Serpini1 (mirSVR scores −1.9, −0.7, respectively) while miR-206 does not. [score:3]
miR-27a modulates Serpini1 mRNA expression and protein levels. [score:3]
Renilla luciferase activity was normalized by firefly luciferase expression levels and is presented as percentage of activity achieved by the 3′-UTR of Serpini1 in the presence of mimics (miR27a, miR-9, miR-206, nonsense). [score:3]
In order to determine if there was a causal association between miR-27a alteration of Serpini1 expression and the development of analgesic tolerance, we characterized the development of tolerance in Serpini1 KO animals. [score:3]
org identified 2 conserved mmu-miR-27a target sites in the Serpini1 3′-UTR, at positions 225 and 435 (Figure 4B). [score:3]
Computational prediction that miR-27a targets Serpini1 was verified by individually transfecting mouse neuronal cell lines N2A and N1E115 with 5 pmol of mmu-miR-27a or nonsense control mimic (Exiqon, Woburn, MA). [score:3]
Figure 6 MiR27a up-regulates Serpini1 protein levels. [score:3]
Interestingly, miR27a was found to positively regulate Serpini1 mRNA and protein levels in multiple neuronal cell lines and to be associated with the development of morphine -induced analgesic tolerance. [score:3]
Several factors led us to investigate miR-27a, such as the very high number of putative mRNA targets within previously identified COA-relevant mRNAs in the same brain region and its putative targets involved in neuroplasticity. [score:3]
We chose to investigate and validate the predicted miR-27a-Serpini1 mRNA pairing due to (a) the unusually high number of PFC tolerance-related mRNAs predicted to be targeted by miR-27a (18 out of 78), (b) the high miRSVR score for miR-27a targeting Serpini1, (c) the fact that the Serpini1 is contained within a relevant analgesia QTL (Belknap and Crabbe, 1992; Belknap et al., 1995; Bergeson et al., 2001), (d) the demonstrated positive correlation between Serpini1 mRNA levels and the prevention of analgesic tolerance (see Figure 4A), and (e) the fact that Serpini1 is intricately involved in modulating an important neuroplastic element in response to chronic morphine administration, namely altered dendritic spine density (Robinson et al., 2002; Robinson and Kolb, 2004; Ballesteros-Yanez et al., 2007; Zheng et al., 2010b; Kobrin et al., 2015). [score:3]
MiR-27a and miR-9 increased Serpini1 expression, [***] p < 0.05. [score:3]
At baseline (saline treated) expression level of miR27a and miR146b were significantly greater in D2 mice compared to the B6 mice while miR505 was equivalent and miR202-5p was significantly less than the B6 mice [miR27a: t [(8)] = 8.411, p = 0.0001; miR146b: t [(8)] = 3.448, p = 0.0007; miR505: t [(8)] = 0.261, ns; miR202-5p: t [(8)] = 3.000, p = 0.0171]. [score:2]
MiR-27a induced alterations in Serpini1 (also referred to as neuroserpin) may alter neural signaling as its overexpression significantly influences the levels of a major postsynaptic scaffolding protein, postsynaptic density protein 95 (Tsang et al., 2014), and affects the density and shape of dendritic spines (Borges et al., 2010) and neurite outgrowth (Parmar et al., 2002; Navarro-Yubero et al., 2004; Lee et al., 2012). [score:2]
This point is relevant since we chose to further investigate a miRNA that was down-regulated, namely miR-27a. [score:2]
, Grand Island, NY) with 200 ng of psiCHECK2- Serpini1-3′ UTR plasmid and 5 pmol of Mus musculus (mmu)-miR-27a, mmu-miR-9, or nonsense mimics (Exiqon, Woburn, MA). [score:1]
The current set of experiments are the first to report the confirmed association of miRNAs miR-27a, -9, -483, -505, -146b, and -202) using pharmacologically-relevant doses of morphine. [score:1]
MiR-27a regulation of serpini1 protein levels in mouse neuronal cell lines. [score:1]
Each independent experiment is defined as a culture of cells treated with nonsense (NS) miRNA and a separate culture treated with the miR-27a mimic. [score:1]
Accordingly, our findings that COA decreased both miR-27a and Serpini1 protein aligns with previously observed decreases in PFC cortex spine density following COA (Robinson et al., 2002). [score:1]
COA does not alter miRNA in these non-tolerant D2 providing increased support to these particular miRNA as high value candidates (miR27a; miR146b; miR505; miR202-5p, all ns). [score:1]
These results provide evidence to support a role for miR27a and Serpini1 in the behavioral response to COA. [score:1]
Interestingly, a lower baseline level of miR-27a was observed in B6 vs. [score:1]
Thus, a decrease in miR-27a may lead to a decrease in Serpini1 that in turn leads to tolerance. [score:1]
Each independent experiment was defined as a culture of cells treated with NS control mimic and a separate culture treated with the miR-27a mimic. [score:1]
miR name miR changemiR Log [2] value mRNA miRSVR score mRNA change mmu-miR-146b ↓ −0.3362 Enpp5 −1.0510 ↑ ↓ Pet112l −1.0474 ↑ ↓ Afmid −1.0327 ↑ ↓ Ccna2 −0.6094 ↑ ↓ Baiap2l1 −0.3049 ↑ ↓ Phf17 −0.2832 ↑ ↓ Pcbp2 −0.1396 ↑ ↓ Dicer1 −0.1357 ↑ ↓ C86695 −0.1061 ↑ mmu-miR-202-5p ↑ 4.0723 Dlgap1 −1.2131 ↓ ↑ AI593442 −1.0566 ↓ ↑ Rps6ka5 −0.9715 ↓ ↑ Meis1 −0.7075 ↓ ↑ Fstl1 −0.6275 ↓ ↑ Atp2b2 −0.4273 ↓ ↑ Rab6b −0.2834 ↓ ↑ Ubqln1 −0.1476 ↓ ↑ Ppp1r9a −0.1379 ↓ ↑ Ralgps1 −0.1185 ↓ mmu-miR-27a ↓ −0.3690 Fmn2 −0.7565 ↑ ↓ Dicer1 −0.7044 ↑ ↓ Rufy3 −0.6805 ↑ ↓ Dusp9 −0.3455 ↑ ↓ Baiap2l1 −0.2262 ↑ mmu-miR-505 ↑ 1.1166 Meis1 −1.2283 ↓ ↑ Serpini1 −0.8085 ↓ ↑ Ralgps1 −0.4115 ↓ ↑ Canx −0. [score:1]
[1 to 20 of 41 sentences]
12
[+] score: 112
Down-regulation of miR-27a could significantly decrease the expression of P-glycoprotein and cyclin D1, and up-regulate the expression of p21. [score:11]
Down-regulation of miR-27a could significantly decrease the expression of P-glycoprotein and the transcriptional activity of cyclin D1, and up-regulate the expression of p21. [score:11]
Tumorigenesis was found profoundly decreased in miR-27a-downregulating cells as compared with control groups (Figure 1D), suggesting that down-regulation of miR-27a might inhibit the growth of MKN45 cells in vitro and in vivo. [score:8]
In conclusion, down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells through regulation of P-gp, cyclin D1 and p21. [score:7]
Down-regulation of miR-27a inhibited the growth and tumorigenecity of gastric cancer cells. [score:6]
Down-regulation of miR-27a could inhibit porliferation of gastric cancer cells in vitro and in vivo. [score:6]
The results of FCM showed that down-regulation of miR-27a increased ADR accumulation and retention and decreased ADR releasing index, indicating that miR-27a had a direct or indirect function of pumping drug out of cells. [score:6]
As shown in Figure 1C, down-regulation of miR-27a significantly inhibited the number of colonies formed by gastric cancer cells. [score:6]
Cell growth was assayed, and down-regulation of miR-27a significantly inhibited proliferation of MKN45 cells as compared with control (P < 0.05) (Figure 1B). [score:4]
Down-regulation of miR-27a could also confer sensitivity of drugs on gastric cancer cells, and might increase accumulation and decrease releasing amount of adriamycin in gastric cancer cells. [score:4]
The antagomirs of miR-27a could significantly inhibit the expression of miR-27a by almost 67% as compared with that of control. [score:4]
Down-regulation of miR-27a might reverse drug resistance of gastric cancer cells. [score:4]
The results of real-time PCR and western blot showed that miR-27a might mediate the expression of P-gp, which might function as an ATP -dependent drug-efflux pump. [score:3]
The results of MTT assay and soft agar assay revealed that down-regulation of miR-27a inhibited cell growth of gastric cancer cells in vitro, which was consistent with the data of nude mice assay. [score:3]
MiR-27a was wi dely expressed in cancer cells and might function as an oncogene through regulating cell survival and angiogenesis [6- 11]. [score:3]
The results of MTT assay indicated that down-regulation of miR-27a promoted drug sensitivity of gastric cancer cells. [score:3]
Figure 3 Effects of a miR-27a on expression of cyclin D1, P-gp, p21 and p27 in gastric cancer cells. [score:3]
As shown in Figure 5, co-transfection of increasing amounts of antagomirs of miR-27a with cyclin D1 reporter gene led to significantly decrease in cyclin D1 promoter activity, suggesting that miR-27a might target cyclin D1. [score:3]
Effect of mir-27a on protein regulating proliferation and drug resistance. [score:2]
Here we clearly showed for the first time that miR-27a might mediate cell proliferation by regulation of cyclin D1 and p21. [score:2]
The mRNA level of the control cell (MKN45-control) was arbitrarily set at 1, and the mRNA levels of miR-27a in MKN45-antagomir cells were normalized to the control. [score:1]
Figure 2 Effect of miR-27a on ADR intracellular accumulation and releasing of MKN45 cells. [score:1]
Cyclin D1 might play important roles in facilitating the transition from G [1 ]phase into S. The results of luciferase reporter assay suggested that miR-27a might be a transcriptional regulator of the cyclin D1 gene. [score:1]
This transfection was done concurrently with the transfection of the antagomirs of miR-27a. [score:1]
In this study, we have firstly found that miR-27a might play important roles in mediating proliferation and drug resistance of gastric cancer. [score:1]
MiR-27a might mediate drug resistance of esophageal cancer cells through regulation of MDR1 and apoptosis [3]. [score:1]
As Figure 1A showed, MKN45 cells were transfected with either the antagomirs of miR-27a or control RNA. [score:1]
Figure 5 The effect of antagomirs of miR-27a on cyclin D1 promoter activity. [score:1]
However, the role of miR-27a in gastric cancer was not reported yet. [score:1]
MiR-27a might be considered as a valuable target for cancer therapy. [score:1]
MiR-27a might be considered as a useful target for cancer therapy. [score:1]
A, Relative level of miR-27a in MKN45 cells after transfection. [score:1]
Cells were plated in plates and cultured for 16 h, and then transfected with the antagomirs of miR-27a or control RNA (Lafayette, CO) as described previously [3]. [score:1]
[1 to 20 of 33 sentences]
13
[+] score: 109
Other miRNAs from this paper: mmu-mir-27b
miR-27a Targets MCPH1 The low rates of LOH, mutation and promoter methylation of MCPH1 in OSCC samples suggested that they may not be the major mechanisms for the downregulation of MCPH1. [score:7]
We have shown for the first time that MCPH1, being a tumor suppressor gene, is regulated by miR-27a in oral cancer and uses both of its target seed regions in its 3′-UTR. [score:6]
This is due to the fact that miR-27a could have other targets and hence, pre-miRNA processed at the 4 µg concentration was optimal for MCPH1 downregulation. [score:6]
Note the reduced expression of MCPH1 upon overexpression (4 µg) of pcDNA3/pre-miR-27a/ EGFP. [score:5]
In the remaining one matched sample (pt# 128), the level of miR-27a was downregulated in tumor, but the level of MCPH1 was unchanged in the tumor tissue. [score:4]
We then used five miRNA prediction softwares and identified miR-27a and miR-27b as potential miRNAs which could target and regulate MCPH1 (Table S6 in File S1). [score:4]
The design of anti-mir oligos for miR-27a, which can upregulate MCPH1, can also be used for therapy. [score:4]
We have for the first time shown that miR-27a targets MCPH1 and regulates its level. [score:4]
In the remaining pair (pt# 128), the level of miR-27a was downregulated in tumor, but the level of MCPH1 remained unchanged between normal and tumor tissues (Figure 9B). [score:4]
Intriguingly, we observed that the downregulation of MCPH1 by miR-27a occurred only when the KB cells were transfected with 4 µg of the pcDNA3/pre-miR-27a/ EGFP construct. [score:4]
To validate if miR-27a targets MCPH1, we co -transfected the pMIR-Report-3′-UTR-S construct containing both the seed regions (full-length 3′-UTR) of MCPH1 in a sense orientation and the pcDNA3/pre-miR-27a/ EGFP construct containing the pre-miR-27a in KB cells. [score:3]
Note a significantly reduced luciferase activity in cells co -transfected with pMIR-Report-3′-UTR-S and pcDNA3/pre-miR-27a/ EGFP (0.2 or 0.4 µg) in comparison to those with pMIR-Report or pMIR-Report-3′-UTR-AS, suggesting miR-27a targets MCPH1. [score:3]
As with SDR1, miR-27a also targets SDR2. [score:3]
Note a significantly reduced luciferase activity in cells co -transfected with pMIR-Report-3′-UTR-S1 and pcDNA3/pre-miR-27a/ EGFP (0.2 or 0.4 µg) in comparison to those with pMIR-Report, suggesting miR-27a targets SDR1 of MCPH1. [score:3]
miR-27a targets both the seed regions of MCPH1 cloned separately. [score:3]
Representative images of the correlative expression of MCPH1 protein level after the transient transfection of the pcDNA3/pre-miR-27a/ EGFP construct in KB cells. [score:3]
miR-27a targets both the seed regions of MCPH1 cloned together. [score:3]
miR-27a Targets MCPH1. [score:3]
0054643.g009 Figure 9(A) miR-27a negatively regulates MCPH1 level in KB cells. [score:2]
The results of our study show that MCPH1 has many of these signatures, functions as a TS gene and is regulated by miR-27a. [score:2]
To determine if both or only one of the seed regions are binding to miR-27a, we mutated each of the two SDRs by site-directed mutagenesis (Table S5 in File S1). [score:2]
To further validate the interaction of miR-27a with SDR1 or SDR2, we mutated each of the two SDRs by site-directed mutagenesis (Table S5 in File S1). [score:2]
Although no dose -dependent relationship between the quantity of transfected pcDNA3/pre-miR-27a/ EGFP construct and the level of MCPH1 was found, a reduced level of MCPH1 was observed when the cells were transiently transfected with 4 µg of the pcDNA3/pre-miR-27a/ EGFP construct (Figure 9A), suggesting that the miR-27a indeed negatively regulates MCPH1 level in vitro. [score:2]
miR-27a negatively regulates MCPH1. [score:2]
We selected a panel of 10 matched normal oral and OSCC tissues and determined the levels of miR-27a and MCPH1 using semi-quantitative RT-PCR and Western blotting, respectively. [score:1]
We then co -transfected the pMIR-Report-3′-UTR-M1F construct containing the mutated SDR1 and the wild-type SDR2, pMIR-Report-3′-UTR-M2F construct containing the wild-type SDR1 and the mutated SDR2 or pMIR-Report-3′-UTR-MF construct containing both the mutated SDR1 and SDR2 separately in KB cells along with pcDNA3/pre-miR-27a/ EGFP. [score:1]
As a second control, we also co -transfected the pMIR-Report-3′-UTR-AS1 containing SDR1 of MCPH1 in an antisense orientation and the pcDNA3/pre-miR-27a/ EGFP. [score:1]
Further to see the effect of miR-27a on the level of endogenous MCPH1, we transiently transfected the pcDNA3/pre-miR-27a/ EGFP or pcDNA3/ EGFP (empty vector) separately in KB cells and after 2 days the cells were lysed and the level of MCPH1 was determined by Western blot analysis. [score:1]
Similar results were obtained with the construct pMIR-Report-3′-UTR-S2 containing seed region 2 (SDR2) of MCPH1 in a sense orientation and the pcDNA3/pre-miR-27a/ EGFP construct (Figure 8B), corroborating the above observations that both seed regions bind to miR-27a. [score:1]
We then wanted to see if a negative correlation exists between endogenous levels of miR-27a and MCPH1 in OSCC samples. [score:1]
The 5.4 kb 3′-UTR of MCPH1 contains two miR-27a seed regions (SDRs): seed region 1 (75–81 nt) and seed region 2 (5383–5389 nt) (Figure S16 in File S2). [score:1]
Further, the luciferase activity was significantly higher in cell transfected with the double mutant pMIR-Report-3′-UTR-MF and pcDNA3/pre-miR-27a/ EGFP in comparison to cells transfected with single mutants pMIR-Report-3′-UTR-M1F or pMIR-Report-3′-UTR-M2F with pcDNA3/pre-miR-27a/ EGFP (Figure 7). [score:1]
However, no correlation between the levels of miR-27a and MCPH1 was observed in three matched samples: 62, 92 and 140. [score:1]
As compared to both the controls, the luciferase activity was significantly decreased in cells co -transfected with pMIR-Report-3′-UTR-S and pcDNA3/pre-miR-27a/ EGFP, suggesting that miR-27a negatively regulates MCPH1 level (Figure 7). [score:1]
The results showed a significant increase in the luciferase activity in cells transfected with pMIR-Report-3′-UTR-MF and pcDNA3/pre-miR-27a/ EGFP in comparison to cells transfected with pMIR-Report-3′-UTR-S and pcDNA3/pre-miR-27a/ EGFP (Figure 7). [score:1]
Further, the luciferase activity was significantly decreased in cells transfected with pMIR-Report-3′-UTR-S and pcDNA3/pre-miR-27a/ EGFP in comparison to cells transfected single mutants, pMIR-Report-3′-UTR-M1F or pMIR-Report-3′-UTR-M2F and pcDNA3/pre-miR-27a/ EGFP (Figure 7). [score:1]
Moreover, our results suggest that miR-27a is oncogenic in the context of MCPH1. [score:1]
Few studies have already reported the oncogenic role of miR-27a. [score:1]
However, no correlation between the levels of miR-27a and MCPH1 was observed in three pairs: pt# 62, 92 and 140. [score:1]
Henceforth, we chose miR-27a for further analysis. [score:1]
As compared to controls, the luciferase activity was decreased in cells co -transfected with pMIR-Report-3′-UTR-S1 and pcDNA3/pre-miR-27a/ EGFP, suggesting that miR-27a negatively regulates MCPH1 level (Figure 8A). [score:1]
Note a negative correlation between the levels of miR-27a and MCPH1 in six matched samples: 63, 68, 109, 155, 183 and 191. [score:1]
As expected, no significant difference in luciferase activity was observed in cells co -transfected with pMIR-Report-3′-UTR-AS1 or pMIR-Report-3′-UTR-M1 with pcDNA3/pre-miR-27a/ EGFP (0.2 or 0.4 µg) in comparison to those with pMIR-Report. [score:1]
A negative correlation between the levels of miR-27a and MCPH1 was found in six matched samples: pt# 63, 68, 109, 155, 183 and 191 (Figure 9B). [score:1]
We also cloned both the seed regions separately in the pMIR-Report vector and co -transfected the pMIR-Report-3′-UTR-S1 construct containing seed region 1 (SDR1) of MCPH1 in a sense orientation and the pcDNA3/pre-miR-27a/ EGFP construct in KB cells. [score:1]
Semi-quantitative RT-PCR of miR-27a. [score:1]
Note that both the seed regions in the 3′-UTR of MCPH1 are important for the interaction with miR-27a as a significant increase in the luciferase activity was observed in cells transfected with pMIR-Report-3′-UTR-M1F, pMIR-Report-3′-UTR-M2F or pMIR-Report-3′-UTR-MF along with pcDNA3/pre-miR-27a/ EGFP in comparison to cells transfected with pMIR-Report-3′-UTR-S and pcDNA3/pre-miR-27a/ EGFP. [score:1]
These observations suggest that both SDRs bind to miR-27a. [score:1]
As a second control, we also co -transfected the pMIR-Report-3′-UTR-AS construct containing the full-length 3′-UTR region of MCPH1 in an antisense orientation and the pcDNA3/pre-miR-27a/ EGFP. [score:1]
[1 to 20 of 49 sentences]
14
[+] score: 105
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
DEX treatment up-regulated the expression of miRNA-483, miRNA-181a-1, miRNA-490 and miRNA-181b-1, while it down-regulated the levels of miR-122, miR-466b, miR-200b, miR-877, miR-296, miRNA-27a and precursor of miR-504. [score:9]
ACTH up-regulated the expression of miRNA-212, miRNA-182, miRNA-183, miRNA-132, and miRNA-96 and down-regulated the levels of miRNA-466b, miRNA-214, miRNA-503, and miRNA-27a. [score:9]
Both ACTH and 17α-E2 up-regulated the expression of miRNA-212, miRNA-132, miRNA-154, miRNA-494, miRNA-872, miRNA-194, and miRNA-24-1, but reduced the expression of miRNA-322, miRNA-20b, miRNA-339, miRNA-27a, miRNA-551b, and miRNA-1224. [score:8]
Real-time PCR (qRT-PCR) measurements demonstrated that ACTH treatment upregulated the expression of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96, while down -regulating the expression of miRNA-466b, miRNA-214, miRNA-503 and miRNA-27a. [score:7]
Real-time quantitative PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats. [score:7]
qRT-PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats (Fig. 3 ). [score:7]
The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. [score:7]
Bt [2]cAMP stimulation of granulosa cells caused down-regulation of a majority of miRNAs, including miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, miRNA-138 and miRNA-19a, but expression levels of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 were significantly increased. [score:6]
Expression of miRNA-27a (1.32-fold) was also down-regulated by DEX. [score:6]
Using qRT-PCR, we confirmed the down-regulation of miRNA-200b, miR-122, miR-19a, miRNA-466b, and miRNA-27a expression (Fig. 3 ). [score:6]
qRT-PCR measurements indicated that exposure of primary rat granulosa cells to Bt [2]cAMP for 24 h inhibited the expression of miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, and miRNA-138 and miRNA-19a while enhancing the expression of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 (Fig. 4 ). [score:5]
Significant expression was also observed for miRNA-27a, miRNA-132 and miRNA-214, whereas very low expression was noted for all of the remaining (seven) miRNAs. [score:5]
The levels of miR-27a and miR-551b were down-regulated by all three hormones, ACTH, 17α-E2 and DEX. [score:4]
Significant ACTH -induced down-regulation of miRNA-466b, miRNA-214, miRNA-503 and miRNA-27a was also observed (Fig. 3 ). [score:4]
Finally the expression levels of miRNA-27a and miRNA-551b were significantly reduced in adrenals of ACTH, 17α-E2 or DEX treated animals. [score:3]
More specifically, we assessed the impact of Bt [2]cAMP treatment on the expression of miRNA-212, miRNA-122, miRNA-27a, miRNA-466b, miRNA-200b, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96 and miRNA-19a. [score:3]
We next evaluated the effects of Bt [2]cAMP stimulation of rat ovarian granulosa cells and of mouse MLTC-1 Leydig tumor cells on the expression of twelve miRNAs (miRNA-212, miRNA-122, miRNA-183, miRNA-200b, miRNA-466b, miRNA-182, miRNA-96, miRNA-27a, miRNA-132, miRNA-214, miRNA-138 and miRNA-19a) whose adrenal expression was differentially altered in response to treatment of rats with ACTH, 17α-E2 or DEX. [score:3]
Furthermore, such DEX alteration of adrenal miRNA levels demonstrates that DEX suppression of endogenous ACTH secretion modulates a set of adrenal miRNAs, with the exception of miRNA-96, miRNA-466, and miRNA-27a, that are distinct from those modulated by treatment with exogenous ACTH. [score:3]
Dexamethasone treatment decreased miRNA-200b, miR-122, miR-19a, miRNA-466b and miRNA27a levels, but increased miRNA-183 levels. [score:1]
Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
0078040.g003 Figure 3Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
[1 to 20 of 21 sentences]
15
[+] score: 86
Other miRNAs from this paper: mmu-mir-23b, mmu-mir-27b, mmu-mir-24-1, mmu-mir-23a, mmu-mir-24-2
Luciferase activity was decreased in the presence of ectopic miR-27a expression, and this suppression was relieved by expressing a miR-27a decoy (Fig. 3c). [score:7]
Prdm16 is a direct target of miR-27a and suppresses Sost. [score:6]
Taken together with the data of direct suppression of Prdm16 by miR-27a shown in Fig. 3c,d, we conclude that Prdm16 is a negative regulator of osteoblast terminal differentiation into osteocytes, which is controlled post-transcriptionally by the miR-23a cluster. [score:5]
List of predicted targets of miR-23a, miR-27a and miR-24-2 among differentially expressed genes. [score:5]
In agreement with the reduced osteoblast activity and number observed in Col1a1-miR-23aC GOF mice, expression of Satb2, a previously reported target of both miR-23a and miR-27a identified in murine osteoblast studies in vitro 5, was significantly decreased in these mutants (Fig. 2k). [score:5]
Prdm16 is a direct target of miR-27a and suppresses SostTo investigate the molecular mechanisms through which miR-23a regulates bone homeostasis and terminal differentiation of osteoblasts into osteocytes, we performed analysis on RNA isolated from calvarial bones of Col1a1-miR-23aC mice and WT littermates (). [score:5]
These data support that Prdm16 is a direct target of miR-27a and can be regulated post-transcriptionally in osteoblast lineage cells. [score:5]
Our study further emphasizes the function of TGF-β signalling in osteocytes by revealing an upstream regulatory factor, Prdm16, directly regulated by miR-27a. [score:4]
To examine the physiological role of each individual miRNA in the miR-23a cluster, we generated osteogenic-specific LOF transgenic mouse mo dels expressing decoys for miR-23a, miR-27a or miR-24-2 individually under the control of the Col1a1-2.3 kb promoter (Supplementary Fig. 1a). [score:3]
To confirm that Prdm16 is a direct target of miR-27a in osteoblastic cells, we performed a luciferase reporter assay by cloning the 3′UTR of Prdm16 into the psiCHECK vector in HEK293T cells. [score:3]
Cg-Tg(SBE/TK-luc)7Twc/J) and bred to Col1a1-miR23aC, Col1a1-miR-23a decoy and Col1a1-miR-27a decoy transgenic mice to generate the GOF and LOF mice expressing the TGF-β reporter transgene and wild-type littermates. [score:3]
1 vector (addgene) to express miR-27a; the 368 bp miRNA miR-27a decoy DNA fragment synthesized at BlueHeron was cloned into the pL KO. [score:3]
In vivo bioluminescence imagingWe injected P3 transgenic Col1a1-miR23aC, Col1a1-miR-23a decoy, Col1a1-miR-27a decoy mice and WT littermates expressing the TGF-β reporter transgene with D-luciferin (Gold Bio, 150 mg kg [−1], i. p. ), anaesthetized them with isoflurane (Piramal) and performed imaging 10 min after injection using a bioluminescence imaging system (Xenogen). [score:3]
1 vector to express the miR-27a decoy. [score:3]
We injected P3 transgenic Col1a1-miR23aC, Col1a1-miR-23a decoy, Col1a1-miR-27a decoy mice and WT littermates expressing the TGF-β reporter transgene with D-luciferin (Gold Bio, 150 mg kg [−1], i. p. ), anaesthetized them with isoflurane (Piramal) and performed imaging 10 min after injection using a bioluminescence imaging system (Xenogen). [score:3]
Consistent with our previous data, induction of miR-27a suppressed Prdm16 reporter activity in the stable MC3T3-E1 cell lines (Fig. 3d). [score:3]
HEK293T cells were co -transfected with the luciferase reporter vector and the vector expressing miR-27a, miR-27a decoy or GFP control. [score:3]
First, we generated stable MC3T3-E1 cell lines, which can be induced to express miR-27a or miR-27a decoy after treatment with doxycycline. [score:3]
In the bones of Col1a1-miR-23aC mice, mature miR-23a, miR-27a and miR-24-2 were overexpressed 2.5-, 2.5- and 4.1-fold, respectively, compared to WT littermates, as determined by quantitative real-time PCR (qRT–PCR; Supplementary Fig. 1d). [score:2]
More interestingly, the 3′UTR of Prdm16 contains a miR-27a -binding site conserved across species (Fig. 3b and ), and Prdm16 has been shown to be regulated by miR-27a during adipogenesis 16. [score:2]
Col1a1-miR-23 decoy (N=7 for WT, 11 for 23D); Col1a1-miR-27 decoy (N=8 for WT, 11 for 27D); 24D, Col1a1-miR-24 decoy (N=10 for WT, 7 for 24D). [score:1]
Taken together, these results suggest that miR-23a and miR-27a in the miR-23a cluster both contribute to bone homeostasis. [score:1]
Col1a1-miR-23 decoy (23D) and Col1a1-miR-27 decoy (27D) mice showed a low bone mass phenotype, but not Col1a1-miR-24 decoy (24D) mice. [score:1]
In the miR-23a or miR-27a LOF mo dels osteocyte differentiation was affected primarily in trabecular bone in the spine, but not in cortical bone in the femur. [score:1]
A 236 bp fragment of genomic DNA containing miRNA miR-27a was cloned into the pL KO. [score:1]
Col1a1-miR-23a decoy (Col1a1-miR-23D) and Col1a1-miR-27a decoy (Col1a1-miR-27D) transgenic mice were fed soft chow because of dentin defects. [score:1]
23aC, Col1a1-miR-23aC; 23D, Col1a1-miR-23a decoy; 27D, Col1a1-miR-27a decoy. [score:1]
By contrast, the Col1a1-miR-23a decoy and Col1a1-miR-27a decoy LOF reporter mice showed decreased bioluminescence (Fig. 4a,b). [score:1]
A 1,516 bp DNA fragment with the predicted miR-27a -binding site (Fig. 3b) from the 3′UTR of Prdm16 was cloned from FVB/N mouse genomic DNA to the multiple cloning regions of the luciferase reporter psiCHECK-2 vector (Promega). [score:1]
N/Bone area) was increased in Col1a1-miR-23aC mice but decreased in Col1a1-miR-23a decoy and Col1a1-miR-27a decoy mice (N=7). [score:1]
[1 to 20 of 30 sentences]
16
[+] score: 65
Other miRNAs from this paper: mmu-mir-23a, mmu-mir-24-2
Since overexpression of ZBTB10 and antisense-miR-27a also decreases expression of Sp1, Sp3, Sp4 and Sp-regulated genes in colon cancer cells [36], the mechanism of action of BA in R KO cells is linked to disruption of miR-27a:ZBTB10 as previously reported for CDODA-Me and GT-094 in colon cancer cells [36, 38]. [score:6]
BA decreased luciferase activity in R KO cells transfected with constructs containing several GC-rich promoter inserts (Figures 3B-D) and also decreased expression of miR-27a and induced expression of ZBTB10 in R KO cells (Figures 5A-C). [score:5]
3. BA decreases Sp and Sp regulated gene expression in R KO cells through disruption of miR-27a:ZBTB10. [score:4]
BA also decreased luciferase activity in R KO cells transfected with a construct containing the -639 to +39 region of the miR-27a promoter, and we are currently examining the mechanisms associated with ROS -dependent effects on critical transcription factors interacting with the promoter and also the functional significance of ROS -dependent downregulation of miR-23a and miR-24-2 which form part of the miR-23a-miR-27a-miR24-2 cluster. [score:4]
of this study show that BA also induced ROS -downregulated Sp1, Sp3, Sp4 and miR-27a and induced ZBTB10 in R KO cells, and all of these responses were significantly attenuated in cells cotreated with BA plus catalase (Figure 4). [score:4]
Moreover, for GT-094 and CDDO-Me, the mechanism of ROS -dependent downregulation of Sp1, Sp3, and Sp4 involves disruption of miR-27a:ZBTB10 [33, 38]. [score:4]
Moreover, downregulation of miR-27a was also paralleled by decreased luciferase activity in R KO cells transfected with a construct (pmiR-27a-luc) containing the -639 to +36 region of the promoter for the miR-23a-miR-27a-miR-24-2 [41] cluster (Figure 5B). [score:4]
The effects of BA on Sp proteins and Sp-regulated gene products were analyzed by western blots, and real time PCR was used to determine microRNA-27a (miR-27a) and ZBTB10 mRNA expression. [score:4]
Previous studies show that ROS -dependent disruption of miR-27a:ZBTB10 is important for Sp downregulation [33, 38] and Figure 5A shows that BA decreased miR-27a, as determined by, and semi-quantitative RT-PCR confirmed induction of ZBTB10. [score:4]
We have previously reported that the synthetic triterpenoid CDODA-Me and the NO-NSAID GT-094 decrease Sp protein expression in SW480 and R KO colon cancer cells through a transcriptional repression pathway in which miR-27a is decreased and this results in the induction of ZBTB10, a transcriptional repressor [36, 38]. [score:3]
Role of BA -induced ROS on expression of miR-27a and ZBTB10 (C) and Myt-1 (D). [score:3]
These results confirm that BA -induced suppression of Sp1, Sp3 and Sp4 is linked to induction of ROS and ROS -mediated disruption of miR-27a:ZBTB10. [score:3]
R KO cells were treated with DMSO or BA and miR-27a and ZBTB10 expression were determined by Northern blot and semi-quantitative RT-PCR, respectively, as described in the Materials and. [score:3]
Using real time PCR, BA significantly decreased miR-27a and induced ZBTB10 (Figure 5C) expression and these responses were all significantly attenuated in R KO cells cotreated with BA plus catalase. [score:3]
Figure 5 Role of miR-27a in regulation of BA -mediated responses. [score:2]
BA induced Myt-1 mRNA in R KO cells; this response was also attenuated in cells cotreated with BA plus catalase (Figure 5D) and this was consistent with ROS -mediated regulation of miR-27a and ZBTB10 (Figure 5C). [score:2]
Real time PCR for determining miR-27a, ZBTB10 and Myt-1 RNA levels were determined essentially as described [20- 23]. [score:1]
R KO cells were treated with DMSO, BA, catalase or BA plus catalase for 36 h and miR-27a, ZBTB10 and Myt1 mRNA levels were determined by real time PCR as described in the Materials and. [score:1]
PL carried out some of the in vitro experiments including the studies on miR-27a:ZBTB10. [score:1]
In R KO cells, the mechanism of BA -induced repression of Sp1, Sp3 and Sp4 was due to induction of reactive oxygen species (ROS), ROS -mediated repression of microRNA-27a, and induction of the Sp repressor gene ZBTB10. [score:1]
The response in R KO cells involves loss of MMP and induction of ROS as previously reported for BA in other studies [39, 40] and this is coupled with ROS -dependent disruption of miR-27a:ZBTB10. [score:1]
For miRNA analysis, 20 μg total RNA per lane was electrophoresed on 15% TBE urea polyacrylaminde gel (Invitrogen), electrophoretically transferred in 0.5 × TBE at 300 mÅ for 45 min to GeneScreen Plus membrane (PerkinElmer, Boston, MA), UV cross-linked and hybridized in ULTRAhyb-Oligo hybridization buffer (Ambion, Austin, TX) at 42°C with [32]P end-labeled DNA oligonucleotides complementary to miR-27a. [score:1]
The Myt-1 gene is associated with G [2]/M arrest and is repressed by miR-27a in colon and breast cancer cells [22, 36]. [score:1]
[1 to 20 of 23 sentences]
17
[+] score: 61
In the noncirrhotic subgroup, the R value was 1.707±0.455, indicating an upregulation of miR-27a expression. [score:6]
These and our findings may indicate a relevant role of miR-21, miR-24 and miR-27a in the malignant behavior of cervical cancer and HCC cell lines; for this reason we monitored their expression levels in human HCC tissues and their PT counterparts and then matched the miR expression levels with clinical patient features. [score:5]
miR-27a was found to function as a tumor suppressor by targeting the anti-apoptotic protein FADD in human embryonic kidney cells (33). [score:5]
This suggests that downregulation of miR-24 and miR-27a influences the hepatocyte transformation of cirrhotic tissues. [score:4]
We also found that miR-24 and miR-27a were downregulated in HCC cancer developed in cirrhotic liver. [score:4]
In this context, considering the subclass of HCC tumors developed in cirrhotic liver, miR-24 and miR-27a were downregulated in HCC in respect to PT tissues. [score:4]
In the cirrhosis subgroup, the R value of 0.408±0.084 (p<0.0001) underlines the downregulation of miR-27a in HCC with respect to cirrhotic PT tissues. [score:4]
In this tumor subclass miR-27a was upregulated in HCC tissues with respect to PT. [score:4]
For miR-27a, a significant decrease in expression was detected in the HBV, HCV and HBV/HCV subclasses (R=0.302, p=0.0084; R=0.412, p=0.0024; R=0.35, p=0.0234, respectively). [score:3]
We analyzed the expression profile of the miRs most frequently cloned (miR-24, miR-27a and miR-21) in the tumor and peritumoral tissues from biopsy specimens of patients presenting with HCC. [score:3]
miR-24 and miR-27a displayed the same expression trend in 66.7% of the cases examined; this may have occurred due to the fact that they are clustered in 1 transcript on chromosome 19. [score:3]
miR-24, miR-27a and miR-21 differential expression in HCC tissues from human biopsy specimens. [score:3]
miR-27a modification was different in cases without cirrhosis (but with other background diseases). [score:3]
Our data revealed miR-24 and miR-27a dysregulation in HCC in respect to their corresponding PT tissues and distinguished a profile in cirrhotic but not in non-cirrhotic tissues. [score:2]
Similar to miR-24, miR-27a (Figs. 3 and 5) did not show dysregulation among the 41 cases, as the average R value was 0.915±0.204. [score:2]
In particular, the miRs cloned with the highest frequency were miR-21, miR-27a and miR-24 as noted in our study. [score:1]
The expression levels of the most frequently cloned miRNAs, miR-24, miR-27a and miR-21, were evaluated using real-time PCR in the tumor and corresponding PT tissues from the biopsy specimens of 41 HCC patients. [score:1]
Real-time quantification of mature miR-24, miR-27a and miR-21 by stem-loop RT-PCR. [score:1]
The most frequently isolated miRNAs were miR-24, miR-27a and miR-21 (Table III). [score:1]
More studies are necessary to better explore the biological role of miR-24 and miR-27a in HCC and in other cancers. [score:1]
Among the 200 bacterial clones sequenced, 118 clones corresponded to 31 known miRs cloned with different frequencies and the miR-24, miR-27a, miR-21 were cloned with the highest frequency. [score:1]
[1 to 20 of 21 sentences]
18
[+] score: 58
As expected, miR-27a- and miR-27b -mediated suppression of the Firefly/Renilla luciferase activity was abolished when we mutated the miR-27a and miR-27b binding sites in the SDF-1α-3′UTR (Figure 5D, E), suggesting that miR-27a and miR-27b inhibit SDF-1α translation by directly binding to the SDF-1α 3′UTR. [score:8]
We also found that several miRNAs suppressed SDF-1α protein expression, while just miR-27a and miR-27b directly bound to the SDF-1α 3′UTR. [score:6]
The error bars represent S. D. The above results clearly demonstrate that miR-27a and miR-27b greatly suppressed the expression of SDF-1α. [score:5]
We therefore showed that forced overexpression of miR-27b on burn wound margins significantly inhibited the mobilization of MSCs to the epidermis (Figure 7) and wound closure (Figure 8), while miR-1 and miR-27a had no obvious effects on the homing of MSCs in vivo. [score:5]
First, we overexpressed specific miRNAs in mMSCs to reduce SDF-1α secretion and found that miR-1 (see Figure 6 and Figure S1), miR-27a and miR-27b significantly inhibited the migration of other normal mMSCs compared to negative controls in vitro (p<0.05) (Figure 6). [score:4]
Thus, we performed mutation assays of the putative binding sites to confirm that the SDF-1α 3′UTR is a direct target of miR-27a and miR-27b (Figure 5 E). [score:4]
Moreover, the forced over -expression of miR-27a and miR-27b significantly reduced the directional migration of mMSCs in vitro. [score:4]
miR-23a, miR-27a and miR-27b expression was significantly lower in the burned skin than in the normal skin (p<0.05). [score:3]
We speculated that miR-27a and miR-27b may function as chemotaxis inhibitors in burn wound healing. [score:3]
These results suggest that miR-23a, miR-27a, and miR-27b might be involved in the regulation of SDF-1α in the context of burned skin. [score:2]
The expression of miR-23a, miR-27a and miR-27b were significantly lower in the burned skin compared to the normal skin (p<0.05) (Figure 4B). [score:2]
Therefore, we performed luciferase reporter assays to determine whether miR-27a and miR-27b are capable of binding the 3′UTR of SDF-1α to prevent its translation. [score:2]
The error bars represent S. D. (D) The predicted miR-27a and miR-27b binding sites in SDF-1α were mutated by site-directed mutagenesis of the miRNA seed region. [score:2]
The gene-specific primer pairs used to amplify specific target genes were as follows, and GenBank accession numbers also be included: mmu-miR-1(NR_029528.1): GSP, 5′-GGGGTGGAATGTAAAGAAGT-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-136(AJ 459747.1): GSP, 5′-GGAACTCCATTTGTTTTGA-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-214(NR_029796.1): GSP, 5′-GACAGCAGGCACAGACA-3′ and reverse, 5′-TGCGTGTCGTGGAGTC-3′; mmu-miR-23a (NR_029740.1): GSP, 5′-CCATCACATGCCAGG-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-27a (NR_029746.1): GSP, 5′-GGGGTTCACAGTGGCTAA-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-27b(NR_029531.1): GSP, 5′-GGGGTTCACAGTGGCTAAG′ -3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; U6(NM_001204274.1): forward, 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse, 5′-CGCTTCACGAATTTGCGTGTCAT-3′; VEGF (NC_000083.6): forward, 5′-GTCCAACTTCTGGGCTCTTCT-3′ and reverse, 5′-CCTTCTCTTCCCCTCTCT-3′. [score:2]
0068972.g006 Figure 6 (A) The migration capacity of MSCs over -expressing miR-27a and miR-27b was analyzed with a transwell migration assay compared to the blank control and negative control. [score:1]
The effects of miR-27a and miR-27b on MSC migration. [score:1]
They were named LV-mmu-mir-1, LV-mmu-mir-136, LV-mmu-mir-214, LV-mmu-mir-23a, LV-mmu-mir-27a, LV-mmu-mir-27b, and LV-cel-mir-67 (the negative control). [score:1]
As shown in Figure 5A, miR-27b, miR-27a, miR-1, miR-136, and miR-214 reduced the level of SDF-1α protein. [score:1]
The error bars represent S. D. (A) The migration capacity of MSCs over -expressing miR-27a and miR-27b was analyzed with a transwell migration assay compared to the blank control and negative control. [score:1]
Lane 1, MSCs; lane 2, MSCs/cel-miR-67; lane 3, MSCs/miR-27b; lane 4, MSCs/miR-27a; lane 5, MSCs/miR-1; lane 6, MSCs/miR-23a; lane 7, MSCs/miR-136; lane 8, MSCs/miR-214. [score:1]
[1 to 20 of 20 sentences]
19
[+] score: 54
A number of dysregulated microRNAs in this mo del were already described in the pathogenesis of liver disease and showed concordant level of expression with respect to that already described in literature (miR-155, miR-20a, miR-182, miR-200a, miR-200c, miR-27a, miR-31, miR-99b) or discordant expression level (miR-193b, miR-93, miR-125a-5p). [score:8]
Some miRNAs were overexpressed in tumors (miR-155, miR-193b, miR-27a, miR-31, miR-99b, miR-484, miR-574-3p, miR-125a-5p, miR-182), whereas others displayed down-regulation (miR-20a, miR-200c, miR-93, miR-340-5p, miR-720) or a comparable level of expression (miR-200a) with respect to non tumor tissues. [score:8]
Seen in this context, it could be supposed that miR-27a hypoexpression (6M, weak, and 12M) in HF diet mo del might act as a protective mechanism in limiting the progression of liver damage during the phases of the disease, and, on the other hand, its over -expression in tumors could be associated to promotion of heavier liver injury with consequent HCC initiation. [score:7]
Literature data reveal that miR-27a may have an oncogenic role, being up-regulated in HBV-related HCC tissues and HCC cell lines [55], and promoting proliferation in liver cancer cells by diminishing TGF-β tumor suppressive activity [56]. [score:6]
In the above-mentioned study, miR-27a/b downregulation was demonstrated to be able to activate HSCs to switch to a more quiescent phenotype, with decreased cell proliferation and restored cytoplasmic lipid droplets. [score:4]
MiR-20a, miR-200c, miR-27a, miR-99b displayed a global, more or less marked, down-regulation during the treatment. [score:4]
MIR-27a was described to be involved in lipid metabolism, by regulating RXRα, PPARα/γ, FASN, SREBP1, SREBP2, and was able to inhibit HCV replication in human hepatoma cells [58]. [score:4]
Ji J Zhang J Huang G Qian J Wang X Mei S Over-expressed microRNA-27a and 27b influence fat accumulation and cell proliferation during rat hepatic stellate cell activationFEBS Lett. [score:3]
Shirasaki T Honda M Shimakami T Horii R Yamashita T Sakai Y MicroRNA-27a regulates lipid metabolism and inhibits hepatitis C virus replication in human hepatoma cellsJ Virol. [score:3]
Ji et al. [59] demonstrated that miR-27a/b were over-expressed in primary culture activated rat hepatic stellate cells (HSCs). [score:3]
MiR-27a showed expression decrease, starting faintly after 3 months up to 12 months of HF diet administration. [score:2]
MiR-27a was also found in a hypomethylated status which led to its over -expression in HCC cells [57]. [score:2]
[1 to 20 of 12 sentences]
20
[+] score: 53
Table S1 provides the human orthologs of all predicted target genes: 747 conserved targets for miR-26b (832 conserved and 248 poorly conserved sites); 1003 conserved targets for miR-27a (1098 conserved and 440 poorly conserved sites); 276 conserved targets for miR-143 (289 conserved and 105 poorly conserved sites) and 201 conserved targets for miR -150 (207 conserved and 109 poorly conserved sites). [score:11]
747 conserved targets for miR-26b (832 conserved and 248 poorly conserved sites); 1003 conserved targets for miR-27a (1098 conserved and 440 poorly conserved sites); 276 conserved targets for miR-143 (289 conserved and 105 poorly conserved sites) and 201 conserved targets for miR -150 (207 conserved and 109 poorly conserved sites). [score:9]
Selecting for target genes related to site conservation resulted in 1938 putative target genes, most of them associated with miR-27a (1003 targets) and miR-26b (832 targets). [score:9]
As shown in Figure 3, the expression levels of several miRs were significantly decreased, including miR-26b (0.46±0.17, p = 0.02), miR-27a (0.77±0.27, p = 0.03) and miR-143 (0.73±0.28, p = 0.02), in the exercised group at day 7. Furthermore, we detected a remarkable increase in miR-150 expression at 35 days (1.87±0.31, p = 0.01) of training. [score:5]
In addition, miR-27 has been implicated in the regulation of several tumor suppressors, such as FBW7, which is involved in cyclin E degradation and cell cycle progression [42], and FOXO1, which is a transcription factor that controls the genes involved in the apoptotic response and cell cycle checkpoints in breast cancer cells [43]. [score:4]
Surprisingly, our data suggest a down-regulation of GATA4 (a predicted target of miR-27a) early after initiation of spontaneous exercise, an intriguing finding that deserves further investigation, but suggests that pathological and physiological LVH might involve different intracellular pathways. [score:4]
Interestingly, Fernandes et al. [14] have shown an increase in miR-27a and -27b expression in the hearts from rats subjected to a forced swimming protocol. [score:3]
The miR-27 family has been implicated in the development of cardiac hypertrophy, although it remains unclear how these molecules modulate growth of cardiomyocytes in response to different stimuli. [score:2]
MiR-27a has been implicated in carcinogenesis, angiogenesis and endothelial cell repulsion by targeting semaphorin 6A [41]. [score:2]
Only 3 miRs were found to have anti-hypertrophic potential (miR-27a, -27b and -133) [11]. [score:1]
Additionally, selected miRs that were significantly altered in our microarray, such as miR-26b, miR-27a, miR-143, miR-150, miR-328, miR-341*, miR-680 and miR-1224, were validated. [score:1]
The qRT-PCR analysis demonstrated an increase in miR-150 levels after 35 days and a decrease in miR-26b, miR-27a and miR-143 after 7 days of voluntary exercise. [score:1]
We detected a reduction in miR-27a levels at 7 days of training; this finding is in agreement with recent data from Jentzsch et al. [11]. [score:1]
[1 to 20 of 13 sentences]
21
[+] score: 37
Also, mRNA levels of the tumor suppressor gene Fbxw7, a known target of miR-27 [39], was down-regulated (P<0.01) in the hearts of CR vs. [score:8]
We also validated by qPCR the expression levels of known targets of three miR (miR-27, -29 and -214), which were up-regulated in the CR group. [score:8]
0130658.g006 Fig 6 (A) qPCR validation of selected miRs from the microRNA array showing significant down-regulation of miR-21 and miR-92a and significant up-regulation of miR-27, miR-29, miR-208 and miR-214 in CR compared to Ad lib. [score:6]
We then annotated the enrichment map with the predicted targets of two miR with the highest fold change in CR (miR-27 and -29) to highlight gene sets that are significantly modulated (hyper-geometric P<0.05) as a percentage of miR targets (Fig 6B and 6C). [score:5]
In addition, miR-27, miR-29, miR-208 and miR-214 were significantly up-regulated in CR as compared to AL groups (+2.969±0.5318, P<0.05; +7.483±1.084, P<0.002; +2.483±0.9468, P<0.009; and +2.003±0.5865, P<0.02; fold change respectively, N = 3) (Fig 6A). [score:3]
Most importantly we show that both miR-27 and miR-29 have overlapping targets associated with ECM organization, angiogenesis, cell migration, cell adhesion and cytoskeletal organization. [score:3]
Both miR-27 and miR-29 showed overlapping targets in pathways associated with ECM organization, angiogenesis, cell migration, adhesion and cytoskeletal organization. [score:3]
The enrichment map was further annotated using a post analysis using mir-29 and mir-27 gene sets to highlight enriched pathways (blue or red nodes) that contain a statistically significant amount of B) miR-27 or C) mir-29 targets (as calculated using the hypergeometric distribution, p-value < 0.05). [score:1]
[1 to 20 of 8 sentences]
22
[+] score: 34
This suggests that the down-regulation of miR-27a & b and miR-93 leads to activation of ubiquitin-conjugating enzyme leading to up-regulation of ubiquitin-proteasome pathway and NIK in alternative NF-κB signaling pathway thereby inducing muscle atrophy (Figure 6). [score:7]
Some of the important miRs with known/putative targets and differentially regulated by TWEAK are presented in Figure 3. Our results showed that TWEAK reduced the expression of muscle-specific miR-1, miR-133a, miR-133b and miR-206 in addition to several other miRs including miR-27, miR-23, miR-93, miR-199, miR-107, and miR-192 (Figure 3A). [score:6]
From the miRNA database, we identified that miR-27a and b targets ubiquitin-conjugating enzyme E2N with target score above 90. [score:5]
Low-density miRNA array of TWEAK -treated C2C12 myotubes showed down-regulation of miR-1, miR-133a, miR-133b, miR-206, miR-27, miR-23, miR-93, miR-199, miR-107, and miR-192. [score:4]
In addition to MyomiRs, TWEAK also down-regulated a few more miRNAs such as miR-27a and b, miR-93, miR-199a-3p, miR-107, miR-192, and miR-23b (Fig. 5A). [score:4]
miR-148b −2.6183 decrease apoptosis miR-152 −2.3341 Increase cell growth miR-17 −6.2545 Bcl2, N-myc miR-181c −3.5756 proliferation and remo deling of muscles miR-190b −2.2 Binds to Ubiquitin-specific protease 46, increase cell growth miR-192 −2.4871 Increase cell growth miR-199a-3p −1.9 Activin receptor IIA, Map3k4 miR-218-1 −2.2887 Increase cell growth miR-23b −2.1623 Increase Cell growth, proliferation miR-26a −2.4565 decrease proapoptotic signaling miR-27a −2.7 Ubiquitin-conjugating enzyme E2N miR-27b −3 Ubiquitin-conjugating enzyme E2N miR-296-3p −7.3378 Increase cell growth, decrease apoptosis miR-322 8.7 Hydroxysteroid (17-beta) dehydrogenase 7 miR-455 129.249 Up-regulated brown adipocyte differentiation miR-470 3.2 TGFB -induced factor homeobox 1 miR-715 18.25 Fucosyltransferase 1 miR-7a −6.2174 Increase cell growth, decrease apoptosis miR-93 −48.423 Map3k14 (NIK) miR-98 1.8 Tripartite motif-containing 6, insulin-like growth factor 2 mRNA binding protein 1 In order to understand the interaction between different genes, we generated common networks using Ingenuity Pathway Analysis (IPA) software. [score:4]
miR-148b −2.6183 decrease apoptosis miR-152 −2.3341 Increase cell growth miR-17 −6.2545 Bcl2, N-myc miR-181c −3.5756 proliferation and remo deling of muscles miR-190b −2.2 Binds to Ubiquitin-specific protease 46, increase cell growth miR-192 −2.4871 Increase cell growth miR-199a-3p −1.9 Activin receptor IIA, Map3k4 miR-218-1 −2.2887 Increase cell growth miR-23b −2.1623 Increase Cell growth, proliferation miR-26a −2.4565 decrease proapoptotic signaling miR-27a −2.7 Ubiquitin-conjugating enzyme E2N miR-27b −3 Ubiquitin-conjugating enzyme E2N miR-296-3p −7.3378 Increase cell growth, decrease apoptosis miR-322 8.7 Hydroxysteroid (17-beta) dehydrogenase 7 miR-455 129.249 Up-regulated brown adipocyte differentiation miR-470 3.2 TGFB -induced factor homeobox 1 miR-715 18.25 Fucosyltransferase 1 miR-7a −6.2174 Increase cell growth, decrease apoptosis miR-93 −48.423 Map3k14 (NIK) miR-98 1.8 Tripartite motif-containing 6, insulin-like growth factor 2 mRNA binding protein 1 A) C2C12 myotubes were treated with 10ng/ml of TWEAK for 18h following isolation of total RNA enriched with small RNAs. [score:4]
[1 to 20 of 7 sentences]
23
[+] score: 26
Other miRNAs from this paper: mmu-mir-23b, mmu-mir-27b, mmu-mir-24-1, mmu-mir-23a, mmu-mir-24-2
Mirn23a downregulates the BMP/Smad pathway through the targeting of the common Smad4 (mir-27a, miR-24), which is an obligate heterodimer partner for activated Smad1 and 5[57, 58]. [score:6]
Knockdown of EBF1 resulted in significantly increased expression of miR-23a, miR-24, and miR-27a, consistent with EBF1 negatively regulating mirn23a (Fig 8B). [score:5]
Cells overexpressing EBF1 showed a significant decrease in miR-23a, miR-27a, and miR-24 expression (Fig 8D). [score:5]
Genes significantly changed in miR-27a overexpressing 70Z/3 Pre-B Cells. [score:3]
C) Heat map showing the individual components of the IL2/Stat5 signaling pathways affected by miR-23a, miR-24, or miR-27a expression. [score:3]
MiR-27a synergizes with Akt by targeting transcription factors FoxO1 (miR-27) that is repressed by Akt phosphorylation[55, 56]. [score:3]
The mirn23a gene is located on murine chromosome 8 and codes for 3 pre-miRNAs: miR-23a, miR-24-2, and miR-27a. [score:1]
[1 to 20 of 7 sentences]
24
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
The study revealed downregulation of miR-205, miR-27, miR-31, and miR-29 in the cbs [+/–] retinas, these miRNAs were also reported to be downregulated in vitreous [68] and plasma of AMD patients [69]. [score:7]
A recent study also demonstrated that knockdown of miR-27, which downregulates the antiangiogenic factors Sprouty2 and semaphorin 6A (Sema6A), is protective against laser -induced choroidal neovascularization [70]. [score:5]
The study revealed downregulation of miR-205, miR-27, miR-31, and miR-29 in the cbs [+/–] retinas. [score:4]
Consistently with the microarray results, miR-205 (p value = 0.001), miR-206 (p value = 0.01) and miR-27 (p value = 0.04) were significantly downregulated in cbs [+/–] compared to control cbs [+/+] (p value < 0.05). [score:3]
Furthermore, the pathway analysis links a group of miRNAs that were differentially expressed in cbs [+/–] retina to oxidative stress pathway such as miR-205, miR-206, miR-217, miR-30, miR-27, miR-214 and miR-3473. [score:3]
miR-205, miR-27, miR-29 and miR-31 were significantly changed in our cbs [+/–] retina microarray and were also reported to be involved in AMD. [score:1]
Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31. [score:1]
[1 to 20 of 7 sentences]
25
[+] score: 21
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
The downregulated expression of the following miRs (miR-27a, -28, -29, -182, -203, and 290) in fetal thymi post- TCDD exposure indicated that these miRs may regulate expression of genes modulated by TCDD. [score:9]
There were 6 downregulated (>1.5-fold) miRs (miR-27a, -28, -29a, -182, -203, and -290) in TCDD -treated thymocytes (Table 1) and these miRs showed highly complementary sequence with 3′-UTR of AhR gene indicating that these miRs may be involved in AhR expression in thymocytes. [score:6]
Thus, downregulated expression of these miRs (miR-27a, -28, -29, -182, -203, and 290) post-TCDD exposure suggests that they may be involved in further inducing the AhR in fetal thymi. [score:6]
[1 to 20 of 3 sentences]
26
[+] score: 19
In the non-alcoholic fatty liver disease mo del, the treatment with a dietetic regimen, which caused various liver injuries, demonstrated that there was significant downregulation of miR-451 and miR-27 in the livers of these rats 45. [score:6]
In addition, the treatment of the cells with hydrogen peroxide led to a reduction of the miR-27a expression 39. [score:3]
Furthermore, the expression of miR-23a and miR-27a/b was significantly lower in the mouse livers damaged by carbon tetrachloride administration than in the normal liver 40. [score:3]
In an in vitro experiment using RAW264 macrophages, the inflammatory response to LPS stimulation showed that the expression of miR-27a was lower in treated cells than in the untreated control cells 38. [score:3]
These previous reports suggested that miR-27a might play a role in inhibiting inflammation. [score:3]
MiR-27a and miR-23a belong to the same cluster. [score:1]
[1 to 20 of 6 sentences]
27
[+] score: 19
From the target predictions of TargetScan Mouse and our in silico based analysis, we know that miR-27a exhibits binding sites for Pdgfra, a receptor tyrosine kinase that is a known suppressor of adipogenesis and Pparγ activity [70], [71]. [score:7]
Down-regulation of miR-27a by ATRA may cause the induction of Pdgfra and the activation of the anti-adipogenetic signal cascade. [score:4]
Furthermore, we were able to demonstrate that miR-27a and/or miR-96 are very important regulators and gap junction signalling, the rearrangement of the actin cytoskeleton as well as the citric acid cycle are the most affected pathways with regard to inhibitory effects of ATRA in 3T3-L1 preadipocytes. [score:4]
2) MiR-27a and miR-96 are probably the most important co-actors in these pathways, in which miR-27a is inhibited by ATRA and miR-96 is induced by ATRA. [score:3]
Therefore, in silico, we could visualise the predicted interactions of miR-27a and the corresponding transcripts such as the platelet-derived growth factor receptor, alpha polypeptide (Pdgfra), son of sevenless 1 (Sos1), vav 3 oncogene (Vav3) and LIM kinase 2 (Limk2). [score:1]
[1 to 20 of 5 sentences]
28
[+] score: 19
Given that microRNAs (miRNAs) modulate pathophysiology of cardiovascular diseases through regulation of gene expression [7], [8], [9], [47], we determined whether BMPCs administration after MI regulates miRNAs (like miR-21, miR-27, miR-29, miR-155, miR-30a and miR-133a) that have been shown to play a role in fibrosis in various tissues/organs [8], [11], [12]. [score:7]
To determine whether BMPCs regulate fibrosis-related miRNAs in infarcted heart, we injected mouse BMPCs in infarcted hearts of C57BLKS/J mice and determined (at 3 days post-MI) the expression of miRNAs (miR-21, miR-27, miR-29, miR-155, miR-30a and miR-133a, which have been shown to play a role in fibrosis [9], [10], [11], [24], [25]). [score:4]
Figure 1 depicts that saline -treated MI mice showed a significant increase in expression of miR-21 and miR-155 (P<0.01; Figures 1A and 1B) and decrease in miR-29 and miR-133a (P<0.01; Figures 1C and 1D) levels with non-significant reducing trend of miR-27 and miR-30a (Figures S4. [score:3]
In contrast, the expression of miR-27 and 30a was not affected by BMPC therapy (Figure S4. [score:3]
BMPC therapy did not affect miR-27 (A) and miR-30a (B) in comparison with saline -treated group. [score:1]
Although the role miR-27 and miR-30a in fibrosis has been established in other organs systems [12], [48], their levels remained unchanged in the present study. [score:1]
[1 to 20 of 6 sentences]
29
[+] score: 19
The high expression of miR-122 and miR-705 combined with the downregulation of miR-193 and miR-27a might decrease the levels of fatty acid synthesis and lipid metabolism, which might be important in inhibiting the growth and development of S. japonicum in the host environment. [score:9]
Some differentially expressed miRNAs in liver had important functions, such as involvement in nutrient metabolism, including a cholesterol metabolism regulator (miR-122), a lipid metabolism regulator (miR-705), an adipocyte differentiation and regulation factor (miR-27a and miR-193), and erythrocyte differentiation (miR-223 and miR-451). [score:6]
miR-193 is a key regulator in adipogenesis [35], and miR-27a is known as an important negative regulator of adipocyte differentiation [36]. [score:3]
Among them, miR-122, miR-705, miR-193 and miR-27a were related to nutrient metabolism. [score:1]
[1 to 20 of 4 sentences]
30
[+] score: 19
Up-regulation of miR-27a can suppress RKIP (Raf kinase inhibitory protein) expression and in turn contribute to chemoresistance of lung adenocarcinoma cells to cisplatin [16]. [score:10]
Moreover, it has been reported that downregulation of miRNA-27a is responsible for EMT and cisplatin resistance in A549 cells by directly targeting Raf Kinase Inhibitory Protein (RKIP) [41]. [score:9]
[1 to 20 of 2 sentences]
31
[+] score: 17
Other miRNAs from this paper: mmu-mir-27b, mmu-mir-24-1, mmu-mir-23a, mmu-mir-24-2
The vector pLVX-miR23a, pLVX-miR27a and pLVX-miR24 group mice separately received 2×10 [6] pLVX-vector, pLVX-miR23a, pLVX-miR27a or pLVX-miR24 overexpressing FBL-3 cells through intravenous lateral tail vein injection. [score:3]
G (an envelope plasmid) and pLVX-miR23a, pLVX-miR27a and pLVX-miR24 over -expression plasmids were separately co -transfected into HEK293T cells using X-treme GENE (Roche). [score:3]
Stable overexpression of miR-23a, miR-27a and miR-24 promoted mouse erythroleukemia progression. [score:3]
For the miRNA overexpression mo del C57BL/6 mice (6-8 weeks) were randomly divided into FBL-3 control, pLVX-vector, pLVX-miR23a, pLVX-miR27a and pLVX-miR24 groups (n = 7 per group). [score:3]
Meanwhile, more metastatic lesions in livers from miR-23a- and miR-27a -overexpressing mice were observed as compared with control mice (Figure 9D–9F). [score:2]
A. The expression levels of miR-23a, miR-27a or miR-24 in FBL-3 cells were measured by real-time PCR. [score:1]
The pLVX-miR-23a, pLVX-miR-27a and pLVX-miR-24 lentiviral vectors contained miR-23a, miR-27a and miR-24, respectively. [score:1]
MiR-23a and miR-27a promote the progression of leukemia in mice. [score:1]
[1 to 20 of 8 sentences]
32
[+] score: 17
IPost up-regulated miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499, while down-regulated miR-23a and miR-9 as compared with Sham group. [score:6]
Compared with sham group, the expressions of miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499 were increased in IPost hearts, while miR-9 and miR-23a were down-regulated in IPost mo dels. [score:5]
Then real-time quantitative PCR was performed to quantify the expression level of miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 with SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions. [score:3]
As previously reported, a collection of miRNAs were abnormally expressed in ischemic mouse hearts in response to I/R injury, such as miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 [20, 21, 28]. [score:3]
[1 to 20 of 4 sentences]
33
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Cai et al. (2014) found that 18 miRNAs were differentially expressed between intact and castrated male pigs, including miR-15a, miR-21, miR-27, miR-30, and so on [23]; Bai et al. (2014) reported that 177 miRNAs had more than 2-fold differential expression between castrated and intact male pigs, including miR-21, miR-30, miR-27, miR-103, and so on [22]. [score:5]
These indicated that miR-21, miR-30, and miR-27 and their target lncRNAs may play an important role in the androgen deficiency-related fat deposition, as it is wi dely known that miR-30a targets the androgen receptor (AR) gene [22]. [score:5]
Five depressing-adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326) target 217 lncRNAs. [score:3]
Our results were consisted with these reports, it was predicted that there were lncRNAs were the target genes for miR-21, miR-30, and miR-27. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 5 sentences]
34
[+] score: 17
Previously, we have found that miR-27a expression is downregulated and that hsa-let-7c-5p expression is upregulated in RD cells during. [score:11]
Further, we have reported that miR-27a overexpression suppresses viral replication through the regulation of EGFR -mediated pathways [16]. [score:6]
[1 to 20 of 2 sentences]
35
[+] score: 15
Of the miRNAs selected for comparison, two miRNAs (miR-206 and let-7e) were up-regulated whereas two miRNAs (miR-200c and miR-27a) were down-regulated based on the results of microarray analysis. [score:7]
In contrast, another seven miRNAs (miR-126-3p, miR-23b, miR-27a, miR-29a, miR-29c, miR-451, and miR-690) were significantly up-regulated in the liver but down-regulated in the brain. [score:7]
To validate the microarray data, we assayed expression levels of four miRNAs (miR-206, miR-200c, miR-27a, and let-7e) by qRT-PCR and compared the results from the microarray and qRT-PCR. [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 15
Stable ectopic expression of RUNX1-MTG8, CBFB-MYH11, or miR-17 in U937 cells (a representative U937 clone is shown for each construct) leads to downregulation of miR-193a, a RUNX1-regulated miRNA targeting KIT (left), and miR-27a, a RUNX1-regulated miRNA involved in myeloid differentiation (right). [score:10]
Consistently, the U937 [miR-17], U937 [RUNX1-MTG8] and U937 [CBFB-MYH11] clones also displayed significant downregulation of RUNX1-regulated miRNAs involved in myeloid differentiation, such as miR-223 (Figure  3C) and miR-27a (Additional file 1: Figure S2, right) [13, 26]. [score:5]
[1 to 20 of 2 sentences]
37
[+] score: 15
Further, seven miRNAs were predicted to be related to the regulation of RNA expression, with the putative functions of mRNA process regulation (mmu-let-7a-2-3p, mmu-let-7b-3p, and mmu-let-7c-1-3p) and regulation of gene expression (mmu-miR-92a-2-5p, mmu-miR-125b-1-3p, mmu-let-7a-2-3p, mmu-miR-134-5p, and mmu-miR-27a-5p). [score:8]
Among them, seven miRNAs including three that were down-regulated (mmu-miR-708-5p, mmu-miR-92a-2-5p, and mmu-miR-711) and four that were up-regulated (mmu-miR-714, mmu-miR-134-5p, mmu-let-7a-2-3p, and mmu-miR-27a-5p) were predicted to be involved in cellular response to stimulus. [score:7]
[1 to 20 of 2 sentences]
38
[+] score: 15
When identifying miRNA changes with age specifically related to Smurf2 [T/T] that differ from the wild-type, miR-27a was the only miRNA which was being suppressed in Smurf2 [T/T] with age, while increasing with age in wild-type age (Fig 4). [score:3]
The suppression of miR-27a in Smurf2 [T/T] mice with age correlates with the formation of DLBCL and the overall survival of the mice due to the tumor. [score:3]
In addition to miR-27a and let-7b, the following miRNAs from the miRNA signature were considered to be tumor suppressors for DLBCL: miR-15a [29, 32, 43, 44], let-7c [20, 23], miR-24 [12], and miR-497 [9, 45]. [score:2]
Since miRNAs can have different aliases, the 10 miRNAs (Fig 1) are identified as the following for the rest of this manuscript: let-7 = let-7b, let-7a-5p = let-7c, miR-10 = miR-10b, miR-130 = miR-130a, miR-155 = miR-155, miR-27 = miR27a, miR-24-3p = miR-24, miR-17 = miR-18a, miR-15 = miR-15a, and miR-16-5p = miR-497. [score:1]
This miRNA signature consists of 10 miRNAs: miR-130, miR-27, miR-17, miR-10, miR-155, let-7a-5p, let-7, miR-24-3p, miR-15, and miR-16-5p. [score:1]
In the literature, increases in miR-27a have been associated with increased survival for DLBCL patients [12]. [score:1]
Since then, it has been discovered that a number of other miRNAs, including miR-17 [13, 19], miR-27 [19, 20, 41], miR-24 [19], miR-10 [19, 20], and let-7 [12, 19, 20], play an important role in lymphoma biology. [score:1]
This key circulating miRNA signature consists of ten miRNAs (let-7c, let-7b, miR-15a, miR-18a, miR-27a, miR-155, miR-24, miR-130a, miR-10b, and miR-497), which were responsible for DLBCL initiation and was present prior to the formation of visible tumor. [score:1]
For example, miR-27a for DLBCL has been shown to have overall improved survival for DLBCL patients [12], while in breast cancer, it has been associated as an oncomiR and with poor patient survival [41]. [score:1]
Specifically, let-7c, miR-27a, miR-155, and miR-24 were significantly increased, while the rest of the miRNAs had an increased trend. [score:1]
[1 to 20 of 10 sentences]
39
[+] score: 14
miR-31 down-regulates cell adhesion molecules [29] and miR-27a* reduces the cytotoxicity of NK cells by down -regulating perforin1 and granzyme B expression [30]. [score:7]
miRNAs with significant changes in expression were identified (Table 2) including miRNA146, and miRNA155 whose levels were lower in TM [+] DCs and miRNA27a* whose level was increased. [score:3]
miRNA p-value Fold-Change miR-146a 1.15E-09 −4.82 miR-31 9.66E-08 −4.95 miR-155 1.97E-07 −3.82 miR-2134 2.13E-07 −2.05 miR-711 1.63E-06 −4.10 miR-3473 1.95E-06 −5.62 miR-574-3p 3.32E-06 −2.55 miR-1195 6.59E-06 2.26 miR-27a* 6.89E-06 14.92 miR-27b* 7.35E-06 2.92 miR-34c 1.80E-05 −3.43 miR-1931 3.34E-05 −2.30 miR-874 4.07E-05 −2.01 miR-196b 7.99E-05 2.59 miR-181a-1* 8.02E-05 4.15 miR-187 8.11E-05 2. 02List of miRs whose expression is altered, identified from microarray analysis by comparison of levels in TM [+] and TM [−] DCs which change >2 fold with p<0.0001. [score:3]
Levels of several miRNAs such as miR-27a*, miR-31, miR-146a and miR-155 were found to be significantly altered. [score:1]
[1 to 20 of 4 sentences]
40
[+] score: 14
Several expression patterns are evident: miR-146 is highest in Th1 cells and low in naïve T cells and Th2 cells; miRNAs 142s and 26a are expressed at higher levels in the precursor naïve T cells; miR-27a is equivalently expressed in both the precursor naïve T cells and the differentiated Th1 and Th2 cells; and miR-223 is very poorly expressed in all these T cell types. [score:9]
miR-27a was expressed at equivalent levels in naïve and differentiated T cells. [score:3]
This was because RNA isolated from naïve T cells yielded much lower overall array hybridization signals compared with RNA from the other cell types examined, causing the signal for a handful of expressed miRNAs to fall below the limit of detection for the microarrays (for example, miR-27a, see Figure 4 and Table 1), and making it impossible to accurately normalize the array data for naïve T cells relative to the signal obtained from other cell types. [score:2]
[1 to 20 of 3 sentences]
41
[+] score: 14
However, the mechanism by which the miRNA expression is regulated in neurons remains unknown, and the pathway by which hypoxia downregulates the expression of miR-23a/b and miR-27a/b is also unknown. [score:9]
Previous studies have shown that c-Myc differentially regulates miR-23 and miR-27 expression at the transcriptional level in different cell types [24, 25]. [score:4]
In our previous study, we showed that the levels of miR-23a/b and miR-27a/b in the cortices of E19.5 mice were decreased during hypoxia [10]. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 13
Regarding the comparison between HF and LF-HC non tumor hepatic tissues (Figure 4A), miR-27a expression increase (close to 3 fold), with consequent switch from hypo- to hyper -expression, was detected in 18 months HF livers. [score:5]
MiR-27a seems to act as a tumor promoter [44] or suppressor, with low expression associated to early metastasis in HCC [45]. [score:4]
Fluctuations were evidenced in tumors with respect to non-tumor liver tissues: after 18 months, miR-27a, 31, 99b, 484, 125a-5p switched from over- to hypo -expression in tumors. [score:3]
Others (e. g. miR-27a, 31, 99b, 484, 125a-5p) showed more pronounced fluctuations: for this reason, they could provide new interesting elements to be further investigated to examine in depth molecular mechanisms involved in liver disease induced by specific diets. [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 12
Of these miRNAs, the relatively prominent upregulated miRNAs were hsa-miR-3656, hsa-miR-139-5p, hsa-miR-4796-5p, hsa-miR-330-5p, hsa-miR-4698, hsa-miR-3124-5p, hsv2-miR-H10, hsa-miR-133b, hsa-miR-515-3p, hsa-miR-516a-5p, hsa-miR-4762-5p, hsa-miR-4508, hsa-miR-27a-5p, hsa-miR-3120-5p, hsa-miR-133a, and hsa-miR-205-5p (>15-fold), and the relatively prominent downregulated miRNAs were hsa-miR-411-3p, hsa-miR-19b-3p, hsa-miR-152, and hsa-miR-142-5p (>15-fold). [score:7]
According to the miRNA profiles, mmu-let-7b, mmu-let-7c, mmu-miR-27a and mmu-miR-322 were significantly downregulated in the granulosa cells of mouse MII oocytes compared with those of MI oocytes. [score:3]
Oocytes matured more slowly by injecting mmu-miR-27a mimic into granulosa cells, but faster by injecting mmu-let-7c-, mmu-miR-27a- and mmu-miR-322 -inhibitor, compared with the negative control group. [score:2]
[1 to 20 of 3 sentences]
44
[+] score: 12
Similar courses of miRNA expression levels are here found for miR-30a known to be involved in manifestation and resolution of liver fibrosis (Roy et al., 2015), for miR-27a described to be involved in fibrosis (Cui et al., 2016), and for mir-29b known to suppress transcription of genes encoding for extracellular matrix proteins (cf. [score:5]
However, the up-regulated levels of mir-122-5p, miR-30a, mir-27a, and miR-29, observed in vaccination-protected mice during crisis, may contribute to the accelerated liver regeneration suggested to occur in these mice. [score:4]
MicroRNA-27a-3p is a negative regulator of lung fibrosis by targeting myofibroblast differentiation. [score:3]
[1 to 20 of 3 sentences]
45
[+] score: 11
An interaction between genotype and diet on miRNA expression was found in three cases: miR-7b, miR-27a and miR-34a were up-regulated in wt animals receiving high fat diet but not upregulated in P465L DN mice receiving HFD (“c” in Fig. 5C). [score:9]
According to our statistical analysis, the regulation of miR-7b, miR27a and miR-34a is influenced by diet and genotype of the animals together. [score:2]
[1 to 20 of 2 sentences]
46
[+] score: 11
Interestingly, both Drosha and DGCR8 appear to be targeted by p53-miR, miR-27, while both Dicer and TARBP2 appear to be targeted by p53-miRs, such as let-7, miR-103/107, and miR-15/16/195, suggesting a co-ordinated regulation of miRNA processing mediated by the p53-miRs. [score:6]
Among the p53-miRs that target the components of the miRNA processing complexes, miR-15/16/195, miR-103, miR-107, let-7, miR-124, miR-181, miR-148a/b, miR-30a/c, miR-27, miR-17, and miR-20 appear to target more than five components of the miRNA-processing pathway [Table 4, Table S3], suggesting the conserved nature of p53-miRs. [score:5]
[1 to 20 of 2 sentences]
47
[+] score: 11
miR-27a and miR-130 suppress adipogenesis by inhibiting PPARγ (Kajimoto et al, 2006), whereas miR-143 induces adipogenesis by downregulating ERK5 (Esau et al, 2004). [score:8]
Several miRNAs, including miR-27a, miR-130 and miR-143, were previously shown to regulate adipogenesis. [score:2]
Recently, miRNAs in adipocytes have been shown to alter cell proliferation (the miR-24-1, miR-31 and miR-17-92 cluster) (Sun et al, 2009; Wang et al, 2008), repress Wnt signalling (miR-8) (Kennell et al, 2008), or repress peroxisome proliferator-activated receptor γ (PPARγ; miR-27a, miR-27b and miR-130) (Karbiener et al, 2009; Kim et al, 2010; Lin et al, 2009). [score:1]
[1 to 20 of 3 sentences]
48
[+] score: 11
All of them were downregulated: mmu-miR-1 and -805 at ST, mmu-miR-199a-3p, -200a and -429 at IT and mmu-miR-27a and -200b at LT, except mmu-miR-206 which was upregulated at LT. [score:7]
This may be due to transcriptional regulation [98] but possibly also to the repression of miRNAs (mmu-miR-1 at ST; mmu-miR-450a-5p at IT; mmu-miR-27a and -92a at LT) that target IGF1 mRNA. [score:4]
[1 to 20 of 2 sentences]
49
[+] score: 11
Silencing PRDM14 reduced the expression of miRNAs upregulated in breast cancer tissues (e. g. miR-106a, miR-149, miR-18a, miR-221, miR-222, miR-224, miR-23a, miR-24, miR-27a/b, and miR-493) and increased expression of those that were downregulated (e. g. miR-15a, miR-150, miR-183, and miR-203). [score:11]
[1 to 20 of 1 sentences]
50
[+] score: 10
Other miRNAs from this paper: hsa-mir-27a, mmu-mir-27b, hsa-mir-27b
Reduced miR-27 was shown to directly target key components of brown adipose transcription, such as Pparα and Creb1 [46]. [score:4]
Possibly, since miR-27 is downregulated following prolonged cold exposure, and HD mice show progressive hypothermia [38], altered levels of miR-27 in HD mice could be involved in browning of their WAT. [score:4]
A recent study highlighted miR-27 as a transcriptional regulator of brown adipogenesis [46]. [score:2]
[1 to 20 of 3 sentences]
51
[+] score: 10
The latter includes the well-characterized miR-17_92 cluster, which targets several tumor suppressors and is enriched in many types of cancer (for a review, see [29]), but also members of the miR-27 family, which suppresses expression of the breast cancer marker CYP1B1 [30]. [score:7]
This analysis also reveals for the first time that miRNA temporal expression patterns can be extremely narrow, as illustrated with members of PAM class C, epitomized here by miR-182 and miR-27a (Figure 1A–1B and Figure S8). [score:3]
[1 to 20 of 2 sentences]
52
[+] score: 10
Other miRNAs from this paper: mmu-mir-186, mmu-mir-32, mmu-mir-20b, mmu-mir-590
Three target prediction algorithms, TargetScan 14, miRanda 15 and PicTar 16, identified the downregulation of five BTG2 -targeting miRNAs, miR-590-5p, miR-27a, miR-186, miR-20b and miR-32, in SETD1A -depleted cells. [score:10]
[1 to 20 of 1 sentences]
53
[+] score: 10
In our data, VEGF, ECAM1 and numerous genes involved in angiogenesis were down-regulated, as well as angiogenic signaling mediators PI3K, p85 and Akt-1. Among these genes, our data suggest that the expression of PECAM1 was regulated by let-7i, miR-322 and miR-497, and the expression of VE-cadherin and β-cadherin regulated by miR-27a. [score:10]
[1 to 20 of 1 sentences]
54
[+] score: 10
MiR-27a and miR-27b regulate autophagic clearance of damaged mitochondria by targeting PINK1 (Kim et al., 2016). [score:4]
miR-27a and miR-27b regulate autophagic clearance of damaged mitochondria by targeting PTEN -induced putative kinase 1 (PINK1). [score:4]
miR-24-3p and miR-27a-3p promote cell proliferation in glioma cells via cooperative regulation of MXI1. [score:2]
[1 to 20 of 3 sentences]
55
[+] score: 10
Target analysis of miRNA expression revealed that Curcumin down-regulates the expression of pro-oncogenic miR-17-5p, miR-20a, miR-21, and miR-27a in human colo-rectal carcinoma cell lines. [score:10]
[1 to 20 of 1 sentences]
56
[+] score: 10
Other miRNAs tested, miR-27 and miR-25/32/92/363/367 have highly conserved binding sites but did not have an effect on reporter gene expression in HEK293 or 501mel cells. [score:3]
The other miRNAs tested, miR-27, miR-32 and miR-101 did not show significant effects on luciferase expression in this assay (Fig. 2B). [score:2]
All Mitf 3′UTR sequences in 11 vertebrate species analysed contain the miR-27, miR-25/32/92/363/367 and the miR-101/144 binding sites (Fig. 1B). [score:1]
Black bars: miR-124/506 binding sites, dark grey bars: binding sites, light grey bars: miR-148/152 binding sites, white bars: miR-27, miR-25/32/92/363/367 and miR-101/144. [score:1]
We tested the effects of microRNAs which have conserved binding sites in the 3′UTR region of Mitf, including miR-27a (located at 229–235 in the mouse Mitf 3′UTR sequence), miR-25/32/92/363/367 (1491–1497), miR-101/144 (3023–3029), miR-124/506 (1639–1646) and miR-148/152 (1674–1680 and 2931–2937) (Fig. 1A and 1B). [score:1]
A. The line indicates the 3′ UTR region of the mouse Mitf gene, including the coding region of exon 9. Potential binding sites for miR-27, miR-124/506, miR-25/32/92/363/367, miR-148/152, and miR-101/144 in the mMitf 3′UTR sequence are indicated below the line and potential PAS sites above. [score:1]
and are the following: hsa-miR-27a (Product ID:PM10939), hsa-miR-32 (Product ID:PM10124), hsa -miR-101 (Product ID:PM10537), mmu-miR-124a (Product ID:PM10691), mmu-miR-137 (Product ID: PM10513), hsa-miR-148a (Product ID:PM10263), hsa-miR-182. [score:1]
[1 to 20 of 7 sentences]
57
[+] score: 10
Dysregulated miR-27a-3p promotes nasopharyngeal carcinoma cell proliferation and migration by targeting Mapk10. [score:4]
Mapk10, a target of miR-27a-3p, is envolved in nasopharyngeal carcinoma cell proliferation and migration (Phillips et al., 2011). [score:3]
MiR-27a regulates Wnt/beta-catenin signaling through targeting SFRP1 in glioma. [score:3]
[1 to 20 of 3 sentences]
58
[+] score: 10
Other miRNAs from this paper: hsa-mir-27a
It is not known which, if any, of these pathways may mediate the increase in circulating myostatin in obese patients, but it is tempting to speculate that elevated glucocorticoids commonly observed in metabolic syndrome and obesity (Anagnostis et al., 2009) could stimulate myostatin expression by promoter regulation (Allen et al., 2010) and modulation of miR-27a/b (Allen and Loh, 2011). [score:4]
Expression of the myostatin gene is stimulated in myocytes by several pathways including glucocorticoid signaling (Salehian et al., 2006) possibly via C/EBP-δ (Allen et al., 2010) or repression of miR-27a/b (Allen and Loh, 2011). [score:3]
Posttranscriptional mechanisms involving microRNA-27a and b contribute to fast-specific and glucocorticoid -mediated myostatin expression in skeletal muscle. [score:3]
[1 to 20 of 3 sentences]
59
[+] score: 10
Natural compounds such as persimmon tannin have been shown to inhibit the differentiation of 3T3-L1 cells through upregulation of miR-27a and miR-27b [24]. [score:6]
Among them, miR-27a and miR-27b have been reported as negative regulators of adipocyte differentiation through peroxisome proliferator-activated receptor gamma (PPARγ) inhibition [23]. [score:4]
[1 to 20 of 2 sentences]
60
[+] score: 9
Overexpression of miR-27b causes premature differentiation of muscle satellite cells: once myoblasts exit the cell cycle, miR-27 indeed targets the 3'UTR of Pax3 (Crist et al., 2009). [score:5]
Muscle stem cell behavior is modified by microRNA-27 regulation of Pax3 expression. [score:4]
[1 to 20 of 2 sentences]
61
[+] score: 9
As shown in this study, miR-27a was up-regulated in the spleens of infected Wistar rats, which indicates a lower level of regulation of adipocyte differentiation in the host [35]. [score:5]
Another differentially expressed miRNA this time in the host spleen had clear functions in regulation of adipocyte differentiation (miR-27a). [score:4]
[1 to 20 of 2 sentences]
62
[+] score: 9
The 6 upregulated miRNAs (mmu-miR-5132-5p, mmu-miR-3104-5p, mmu-miR-669c-5p, mmu-miR-705, mmu-miR-760-3p, mmu-miR-1962) and the 9 downregulated miRNAs (mmu-miR-146a, mmu-miR-138, mmu-miR-5123, mmu-miR-196b, mmu-miR-5099, mmu-miR-150, mmu-miR-145, mmu-miR-27a, mmu-miR-23a) chosen for validation were also based on their target genes predicted, whose functions are well relevant to inflammation and cancer. [score:9]
[1 to 20 of 1 sentences]
63
[+] score: 9
0034688.g009 Figure 9 The mature form of miRNAs: miR-17, miR-21, miR-27 and miR-93 were up-regulated, as were their underlying pri-miRNAs in the old (O) vs. [score:4]
0034688.g010 Figure 10 The mature form of miRNAs: miR-17, miR-21, miR-27 and miR-93 were up-regulated, as were their underlying pri-miRNAs in the old (O) vs. [score:4]
As shown in Figure 9, the miRNA guide strand miR-17, miR-21, miR-27a and miR-93 had an age-related increase accordingly with their corresponding primary transcripts pri-mir-17, pri-mir-21, pri-mir-27 and pri-mir-93. [score:1]
[1 to 20 of 3 sentences]
64
[+] score: 9
For example, miR-106b, miR-21, miR- 22, miR-19b and miR-25 are known to regulate PTEN and miR-27 and miR-139 repress FoxO1 translation through direct binding to the 3′-UTR [31], [32], [33], [34], [35], [36], [37], [38]. [score:5]
Among the up-regulated miRNAs, miR-106b, miR-25 and miR-19b share the same primary transcripts, and miR-24 and miR-27 share primary transcripts. [score:4]
[1 to 20 of 2 sentences]
65
[+] score: 9
For example, we found a significant downregulation of miR-27a, miR-411 and miR-497 in bladder cancer patient B09 and a significant upregulation of miR-379, miR-381 and miR-411 in kidney cancer patient K44 (Figure  5B). [score:7]
Several editing events within the seed were found to be much more ancient than previously recognized: editing of miR-27a was found in placental mammals and platypus, thus presumably dating back at least 220 million years, while editing of miR-187*, miR-497 and miR-1251 was shared between placental mammals and marsupials, whose last common ancestor lived 180 million years ago [20]. [score:1]
Our results hint at an even earlier emergence of miR-27a and miR-301a editing, which might also be shared with sharks and lampreys, respectively, although the signal is too weak for us to exclude completely that it stems from sequencing errors. [score:1]
[1 to 20 of 3 sentences]
66
[+] score: 9
Other miRNAs from this paper: mmu-mir-23b, mmu-mir-27b, mmu-mir-23a
miR-27 effects in the heart are context -dependent: although it is necessary for ventricular maturation, targeted overexpression in cardiomyocytes causes hypertrophy and dysfunction during development. [score:6]
These findings suggest that miR-27 inhibitors may have beneficial effects in cancer setting by blocking the recruitment and activation of tumor -associated macrophages. [score:3]
[1 to 20 of 2 sentences]
67
[+] score: 8
For example, microRNA-375, miR-29c, miR-195, miR-625, miR-203, miR-302b, miR-133a, miR-101, miR-27a, miR-655 and miR-200b can suppress the growth of ESCC cells by regulating the expression of a variety of molecules, including IGF1R (insulin-like growth factor 1 receptor), cyclin E, Cdc42, Sox2, Ran, ErbB4, FSCN1 and MMP14, enhancer of zeste homolog 2 (EZH2), KRAS, ZEB1, TGFBR2 and Kindlin-2. In this study, we revealed the inhibitory effects of both miR-26a and miR-144 on proliferation and metastasis of ESCC. [score:8]
[1 to 20 of 1 sentences]
68
[+] score: 8
Increased expression of miR-27a/b was correlated with decreased expression of MSTN and vice versa both in vitro and in vivo mouse mo del. [score:5]
A recent study further confirmed that MSTN regulates miR-27a/b via SMAD3 in feedback autoregulation manner. [score:3]
[1 to 20 of 2 sentences]
69
[+] score: 8
Furthermore, we have previously reported that human miR-27a* acts as a negative regulator of NK cell cytotoxicity by silencing Prf1 and GzmB expression. [score:4]
Moreover, miR-27a* has been shown to negatively regulate NK cell cytotoxicity by silencing the expression of Prf1 and GzmB, which are essential effector molecules for human NK cell cytotoxicity [28]. [score:4]
[1 to 20 of 2 sentences]
70
[+] score: 8
Although we did find miR-27a-3p to significantly inhibit TLR8 in human PBMCs, our experimental evidence does not support a strong inhibitory activity for miR-301a-3p in either mouse or human mo dels. [score:5]
Interestingly, miR-27a-3p and miR-301a-3p AMOs belong to this list of potential inhibitors. [score:3]
[1 to 20 of 2 sentences]
71
[+] score: 8
Apart from global modulation of miRNA biogenesis, mutant p53 also affects expression of miRNAs, principally by downregulating tumor-suppressive miRNAs – miR-130b in endometrial cancer (24), miR-27a in breast cancer cells (MDA-MB-468) (25), miR-223 in breast and colon cells (26), let-7i in breast cancer and DLD1 cells (colorectal cancer) (27), and miR-205 (28), and elevating oncogenic miRNAs: miR-128-2 (29) and miR-155 in breast cancer cells (30) to mediate its oncogenic functions. [score:8]
[1 to 20 of 1 sentences]
72
[+] score: 8
Similarly, miR-27 inhibits the gene expression of adenomatous polyposis coli leading β-catenin accumulation and thus Wnt activation to promote osteoblast differentiation [44]. [score:5]
It has been recently reported that miR-24 and miR-27a are suppressors of embryonic stem cell differentiation [36]. [score:3]
[1 to 20 of 2 sentences]
73
[+] score: 8
As a consequence, several of the miR-27 target genes, including Prdm16, peroxisome proliferator-activated receptor alpha (Pparα), cAMP response element -binding protein (Creb) and peroxisome proliferator-activated receptor gamma coactivator 1-beta (Pgc1β) are upregulated, and enhance brown adipogenesis. [score:6]
Several miRNAs controlling mouse brown adipocyte development and function have been identified in mice, including miR-27, −34a, −133, −155, −182, −193b-365, −196, −203 and miR-378 [14, 16– 23]. [score:2]
[1 to 20 of 2 sentences]
74
[+] score: 8
As such affector miRNAs, that act independently from the interaction of Nrf2 with Keap1, miRNAs miR-153, miR-27-a, miR-142-5p, and miR-144 regulated the Nrf2 expression in neuroblastoma cells [179], and miR-28 targeted the 3’UTR of Nrf2 mRNA decreasing Nrf2 expression in human breast cancer cells [180]. [score:8]
[1 to 20 of 1 sentences]
75
[+] score: 8
Chen S Sun Y Zhang Z Li Y Xu Z Fu W Transcriptional suppression of microRNA-27a contributes to laryngeal cancer differentiation via GSK-3β-involved Wnt/β-catenin pathwayOncotarget. [score:5]
RARα -mediated miR-27a transcriptional inactivation released the suppression of miR-27a on GSK-3β leading to LSCC differentiation through GSK-3β-involved Wnt/β-catenin pathway [26]. [score:3]
[1 to 20 of 2 sentences]
76
[+] score: 8
Herein, we found an upregulation of the miR-23b~27b~24 cluster, thus at variance with the findings observed in primary macrophages, which exhibit rapid decrease miR-27a and miR-27b expression upon murine cytomegalovirus infection (37). [score:6]
Among miRNAs significantly modulated due infection, miR-27a and miR-27b, also exhibited dependence whether TEC sorted out from the thymus exhibited cortical or medullary phenotype. [score:1]
Mature miR-27a and miR-27b differ from each other by just one nucleotide and are transcribed from paralog clusters, the intergenic miR-23a~27a~24 cluster (localized in chromosome 9q22) and the intronic miR-23b~27b~24 cluster (localized in chromosome 19p13) (35, 36). [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 7
Sun Q. Cong R. Yan H. Gu H. Zeng Y. Liu N. Chen J. Wang B. Genistein inhibits growth of human uveal melanoma cells and affects microRNA-27a and target gene expression Oncol. [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 7
In mice, tumor -associated miRNAs were found to modulate the survival and longevity of DC (44), miR-223 was described to negatively regulate and miR-150 to positively regulate the cross-presenting abilities of LC (45, 46), the TGF-β associated miR-27a was reported to inhibit DC -mediated differentiation of Th1 and Th17 cells (47) and in an allergy setting miR-23b was shown to induce tolerogenic DC through inhibition of the Notch1/NF-κB pathway (48). [score:7]
[1 to 20 of 1 sentences]
79
[+] score: 7
Other miRNAs from this paper: hsa-mir-27a
The NO-NSAID GT-094 also decreased expression of Sp proteins and Sp-regulated genes in R KO and SW480 cells and this was due to induction of ROS and ROS -dependent downregulation of miR-27a and induction of the Sp transcriptional repressor ZBTB10 [17]. [score:7]
[1 to 20 of 1 sentences]
80
[+] score: 7
Most recently, Zheng et al. constructed “Sponge” transgenic mice against miR-27a expression and found that Siglec1 and TRIM27 expression, target molecules of miR-27a, were elevated in vivo in antiviral innate response (43). [score:7]
[1 to 20 of 1 sentences]
81
[+] score: 7
Infection with ma81 but not w81 resulted in the unique upregulation of miR-139-5p, miR-27a-5p, miR-29b-1-5p, and miR-877-3p and the downregulation of miR-449a-5p at both 1 and 3 dpi (Tables  1 and 2). [score:7]
[1 to 20 of 1 sentences]
82
[+] score: 7
Additionally, we included miR-1 and miR-27a in this analysis as we have previously found miR-1 to be upregulated in the sinus node of the trained mouse and rat, [5] and all computational tools used indicated the presence of a highly conserved binding site for miR-27a. [score:4]
Surprisingly, miR-27a only produced a small suppression of luciferase activity (Figure 3A). [score:3]
[1 to 20 of 2 sentences]
83
[+] score: 7
Figure 2B displays discrepancies between the miRNA array and RT-qPCR data, showing that only 3 down-regulated miRNAs (miR-150, miR-28 and miR-151-5p) and 8 upregulated miRNAs (miR-let-7e, miR-103, miR-107, miR-27a, miR-23a, miR-21, miR-155 and miR-146a) showed similar trends in altered miRNA levels. [score:7]
[1 to 20 of 1 sentences]
84
[+] score: 6
miR-27a was found to be expressed in human OA chondrocytes and to indirectly affect expression of IGFBP-5 and MMP-13 [84]. [score:6]
[1 to 20 of 1 sentences]
85
[+] score: 6
Both miR-302a and miR-27a are reported to inhibit adipogenic differentiation and lipid accumulation in 3T3-L1 mouse adipocytes [15] and human multipotent adipose-derived stem cells [16] by down -regulating PPAR-γ expression. [score:6]
[1 to 20 of 1 sentences]
86
[+] score: 6
FBXW7 was regulated by miR-223 and miR-27a and served as a tumor suppressor to inhibit tumor growth and progression [32- 36]. [score:6]
[1 to 20 of 1 sentences]
87
[+] score: 6
Other miRNAs, such as miR-27a, miR-29b, miR-125a, miR-146a, miR-122, miR-181a, miR-204-5p and miR-451 are differentially up-regulated in M1 and M2 spectrum macrophages [45, 46]. [score:4]
miRNA expression was determined by Taqman Real-Time PCR using miR-27, miR-29b, miR-155, miR-223, miR-124 and sno-202 primer and probe sets (Life Technologies), according to manufacturer’s instructions. [score:2]
[1 to 20 of 2 sentences]
88
[+] score: 6
Nine miRNAs (miR-148a-3p, miR-183a-5p, miR-214-3p, miR-27a-3p, miR-92a-3p, miR-378a-3p, miR-23a-3p, miR-21a-5p and miR-16-5p) were upregulated, and four (miR-155-5p, miR-199a-3p, miR-320-3p and miR-125a-5p) were downregulated in exosomes from RANKL -induced RAW 264.7 cells compared with RAW 264.7 cells (Figure 1f and Supplementary Figure S1d). [score:6]
[1 to 20 of 1 sentences]
89
[+] score: 6
Other miRNAs from this paper: mmu-mir-21a, mmu-mir-23a, mmu-mir-592, mmu-mir-21b, mmu-mir-21c
A transduction of antagomiR-27a (miR-27a inhibitor) showed an ability to significantly inhibit the invasion and proliferation of U87 glioblastoma cells, and reduce the growth of glioblastoma xenograft in SCID mice [41]. [score:5]
As aberrant miR-21 and miR-592 seen in CRC, more abundant miR-27a transcript was detected in specimens from glioblastoma comparing with normal human brain tissues. [score:1]
[1 to 20 of 2 sentences]
90
[+] score: 6
For example, the expression of miR-27, -335, and -519d is up-regulated in liver and/or adipose tissue of obese mice or humans [32], [33], [34], [35], [36]. [score:6]
[1 to 20 of 1 sentences]
91
[+] score: 6
Sun Q. Gu H. Zeng Y. Xia Y. Wang Y. Jing Y. Yang L. Wang B. Hsa-miR-27a genetic variant contributes to gastric cancer susceptibility through affecting miR-27a and target gene expressionCancer Sci. [score:5]
Yang R. Schlehe B. Hemminki K. Sutter C. Bugert P. Wappenschmidt B. Volkmann J. Varon R. Weber B. H. F. Niederacher D. A genetic variant in the pre-miR-27a oncogene is associated with a reduced familial breast cancer riskBreast Cancer Res. [score:1]
[1 to 20 of 2 sentences]
92
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-20b, hsa-mir-520c, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The overexpression of certain oncogenic miRNAs (miR-21, miR-27a, miR-155, miR-9, miR-10b, miR-373/miR-520c, miR-206, miR-18a/b, miR-221/222) and the loss of several tumor suppressor miRNAs (miR-205/200, miR-125a, miR-125b, miR-126, miR-17-5p, miR-145, miR-200c, let-7, miR-20b, miR-34a, miR-31, miR-30) lead to loss of regulation of vital cellular functions that are involved in breast cancer pathogenesis [127, 128]. [score:6]
[1 to 20 of 1 sentences]
93
[+] score: 6
Human microRNA-27a* targets Prf1 and GzmB expression to regulate NK-cell cytotoxicity. [score:6]
[1 to 20 of 1 sentences]
94
[+] score: 5
Surprisingly, a recent study showed that miR-27a, which represses the translation of MAP2K4 and functions in the cell cycle, has activity in porcine oocytes, indicating that miRNA activity was not globally suppressed in porcine oocytes [30]. [score:5]
[1 to 20 of 1 sentences]
95
[+] score: 5
As with miR-29 and miR-145, computational analysis of the target gene profile for miR-27 and miR-24 showed a significant shift in the aortic samples from six-week old mice (Fig. 2), suggesting that these miRNAs also contribute to the mRNA expression profile in the adult aorta. [score:5]
[1 to 20 of 1 sentences]
96
[+] score: 5
miR-27a has been reported to be a oncogenic miRNA regulated by genistein and regulates VEGF signaling by targeting ZBTB10 [15], [16]. [score:5]
[1 to 20 of 1 sentences]
97
[+] score: 5
NFATs may also control genes encoding signaling molecules as variate as Ca [2+] regulators [inositol 1,4,5-trisphosphate (IP [3]) receptor (IP [3]R), regulator of calcineurin 1 (RCAN1)], growth factors (VEGF, neurotrophins), myelination genes (P0 and Krox-20), glucose regulation genes (insulin, HNF1, PDX, and GLUT2), cell cycle and death regulator/activators [p21 [Waf1], c-Myc, cyclin -dependent kinase 4 (CDK4), B-cell lymphoma 2 (Bcl-2), and cyclins A2, D1, and D2], oncogenes (Wnt, β-catenin), microRNAs (miR-21, miR-23, miR-24, miR-27, miR-125, miR-195, miR-199, and miR-224), and surfactants (sftpa, sftpb, sftpc, and abca3) [9, 65– 74]. [score:5]
[1 to 20 of 1 sentences]
98
[+] score: 5
miR27 inhibits the gene expression of adenomatous polyposis coli leading β-catenin accumulation and thus Wnt signaling pathways activation to promote osteoblast differentiation[26]. [score:5]
[1 to 20 of 1 sentences]
99
[+] score: 4
VEGF is modulated by miR-20b through HIF1α in cardiomycytes whereas FOXO1 is regulated by miR-27a in cancer cells [26], [27]. [score:2]
1 up 3.7 down 12 down 1.1 miR-10a up 6.4 up 5.2 up 3.5 down 116 down 1.6 snoRNA202 up 3.8 up 4.7 up 3.2 down 6 down 3 miR-27b down 1.4 up 1.9 up 3.2 up 1 up 1 miR-29c up 5.4 up 4.5 up 3.1 up 1.5 down 1.5 miR-345-5p up 14.3 up 31.7 up 2.4 down 4.7 up 1.1 rno-miR-24-1 down 25.3 up 1.2 up 2.1 down 1.2 down 1.9 miR-687 up 3.8 up 1.8 up 2 down 1.7 down 11.5 miR-27a up 34 up 12. [score:1]
Similar observation were also found in miR-27a, miR-101, miR-9, miR-667. [score:1]
[1 to 20 of 3 sentences]
100
[+] score: 4
Biochem Biophys Res Commun 12 Ji J Zhang J Huang G Qian J Wang X 2009 Over-expressed microRNA-27a and 27b influence fat accumulation and cell proliferation during rat hepatic stellate cell activation. [score:3]
miR-27a and 27b allowed culture-activated rat HSCs to switch to a more quiescent HSC phenotype, with restored cytoplasmic lipid droplets and decreased cell proliferation [12]. [score:1]
[1 to 20 of 2 sentences]