sort by

131 publications mentioning mmu-mir-92a-2 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-92a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 334
Comparison of cell line with high expression of miR-92a (Karpas hsa-miR-92a-1 and Karpas wt) and of cell line with low expression of miR-92a (Karpas miRZip-92a and SU-DHL-5 wt) enabled us to identify 16 down-regulated and 3 up-regulated putative targets of miR-92a, with a FDR<0.05 and a fold change > 2. When patient samples and cell line results were analyzed, they had in common four down-regulated miR-92a associated mRNA, which were putative targets: CIC, FOXP1, INADL, and SMG1 (Supplementary figures 4 and 5). [score:18]
Comparison of cell line with high expression of miR-92a (Karpas hsa-miR-92a-1 and Karpas wt) and of cell line with low expression of miR-92a (Karpas miRZip-92a and SU-DHL-5 wt) enabled us to identify 16 down-regulated and 3 up-regulated putative targets of miR-92a, with a FDR<0.05 and a fold change > 2. When patient samples and cell line results were analyzed, they had in common four down-regulated miR-92a associated mRNA, which were putative targets: CIC, FOXP1, INADL, and SMG1 (Supplementary figures 4 and 5). [score:18]
Comparison of cell line with high expression of miR-92a (Karpas hsa-miR-92a-1 and Karpas wt) and of cell line with low expression of miR-92a (Karpas miRZip-92a and SU-DHL-5 wt) enabled us to identify 16 down-regulated and 3 up-regulated putative targets of miR-92a, with a FDR<0.05 and a fold change > 2. When patient sample and cell line results were analyzed, they had in common four down-regulated putative targets of miR-92a: CIC, FOXP1, INADL, and SMG1. [score:18]
A higher expression of miR-92a and the down-regulation of FOXP1 mRNA and protein expression were also found in human samples of PMBL, while miR-92a expression was low and FOXP1 was high in DLBCL. [score:10]
Comparison of the filtered gene lists from PMBL and DLBCL patients enabled us to identify 32 down-regulated and 1 up-regulated putative targets of miR-92a, with a FDR<0.05 and a fold change > 2 (q-value < 0.05). [score:9]
Comparison of the filtered gene lists from PMBL and DLBCL patients enabled us to identify 32 down-regulated and 17 up-regulated putative targets of miR-92a, with a FDR<0.05 and a fold change > 2 (q-value < 0.05). [score:9]
Karpas wt has the same proliferation rates as Karpas hsa-miR-92a-1. FOXP1 overexpression induced by miR-92a downregulation was rescued using a siRNA targeting FOXP1 on Karpas miZip-92a cells. [score:8]
Figure 3 A. For the 8 PMBL and 9 DLBCL patients with available cryopreserved samples, the bioinformatics approach identified 4 genes, CIC, FOXP1, INADL and SMG1, as putative targets of miR-92a, down-regulated in PMBL and cell lines overexpressing miR-92a. [score:8]
A. For the 8 PMBL and 9 DLBCL patients with available cryopreserved samples, the bioinformatics approach identified 4 genes, CIC, FOXP1, INADL and SMG1, as putative targets of miR-92a, down-regulated in PMBL and cell lines overexpressing miR-92a. [score:8]
Karpas wt has the same proliferation rates as Karpas hsa-miR-92a-1. FOXP1 overexpression induced by miR-92a downregulation was rescued using a siRNA targeting FOXP1 on Karpas miZip-92a cells. [score:8]
In this study, when we compared expression level of miR-17∼92 in PMBL and DLBCL, we showed a down-regulation of every miRs in PMBL except for miR-92a, that was significantly overexpressed. [score:7]
To identify miR-92a targets in PMBL, we combined in silico miR-92a target prediction and gene expression profile in PMBL and DLBCL patient samples, and in the four cell lines (Figure 2). [score:7]
In silico target prediction for miR-92a was carried out using the CoMeTa tool (Co -expression Meta-analysis of miRNA Targets, http://cometa. [score:7]
The only gene whose expression is significantly different between transduced Karpas cells underexpressing and those overexpressing miR-92a is FOXP1 * p =< 0.001. [score:7]
To demonstrate that FOXP1 was a direct target of miR-92a, we performed a luciferase reporter activity test using 293T-cells expressing a GLuc-3′UTR [FOXP1] fusion mRNA, which were transfected with a miR-92a mimic. [score:6]
Western blot of FOXP1 on the four cell lines studied showed an overexpression of FOXP1 when miR-92a was down-regulated. [score:6]
Analyses of FOXP1 expressionQuantification of mRNA expression of putative miR-92a targets was performed from available snap-frozen samples from 8 patients with PMBL and 9 with DLBCL, and from the wild type and the two transfected Karpas cell lines, with Q-RT-PCR using GoScript™-Reverse-Transcription System (Promega, France), GoTaq [®] qPCR Master Mix (Promega, France), and taqman primers and probes for FOXP1 (Hs00544877_m1), CIC (Hs00943425_g1), SMG1 (Hs00247891_m1), and INADL (Hs00195106_m1). [score:6]
Using combined in silico prediction and transcriptomic analyses, we identified four possible down-regulated targets for miR-92a. [score:6]
NF-κB is also activated in PMBL [2, 8, 52], but FOXP1, which we identified as the target of miR-92a, is down-regulated in PMBL, and cannot be involved in the same way as in DLBCL. [score:6]
In situ analyses in PMBL and DLBCL human samples confirmed that FOXP1 RNA and protein expressions were significantly lower in PMBL than in DLBCL, in accordance with the higher miR-92a expression found in PMBL than in DLBCL. [score:5]
Figure 2Analysis of the CoMeTa database, chosen to limit the number of false positive targets by a ranking method, provided a list of 1815 putative in silico target-genes of miR-92a. [score:5]
To study the function of miR-92a in human PMBL, we transduced human Karpas cells to let them overexpress or underexpress miR-92a. [score:5]
Analysis of the CoMeTa database, chosen to limit the number of false positive targets likely to result from a ranking method, provided a list of 1815 putative in silico target-genes of miR-92a. [score:5]
B. The expression level of each putative target of miR-92a was assessed using Q-RT-PCR in the three Karpas cell lines. [score:5]
Analysis of the CoMeTa database, chosen to limit the number of false positive targets by a ranking method, provided a list of 1815 putative in silico target-genes of miR-92a. [score:5]
The same comparisons were carried out for human cell lines with low expression of miR-92a (Karpas miRZip-92a and SU-DHL-5 wt) versus human cell lines with high expression of miR-92a (Karpas hsa-miR-92a-1 and Karpas wt). [score:5]
Figure 4 FOXP1 as target of miR-92a in PMBL A. Western blot shows a FOXP1 protein expression in Karpas miRZip-92a that was 4.4 times higher than in Karpas hsa-miR-92a-1 * p =< 0.05. [score:5]
We used the miRNA target prediction database TargetScan to identify a 7mer-A1 miR-92a-3p binding site on the FOXP1 3′UTR, which is conserved across vertebrates (Supplementary figure 6). [score:5]
There was no up-regulated miR-92a associated mRNA. [score:4]
Transcriptomic analyses showed that the down-regulated transcripts of miR-92a associated genes CIC, FOXP1, INADL, and SMG1 were highly discriminant between PMBL and DLBCL patient samples (q-val < 0.001)(Figure 3A). [score:4]
Quantification of mRNA expression of putative miR-92a targets was performed from available snap-frozen samples from 8 patients with PMBL and 9 with DLBCL, and from the wild type and the two transfected Karpas cell lines, with Q-RT-PCR using GoScript™-Reverse-Transcription System (Promega, France), GoTaq [®] qPCR Master Mix (Promega, France), and taqman primers and probes for FOXP1 (Hs00544877_m1), CIC (Hs00943425_g1), SMG1 (Hs00247891_m1), and INADL (Hs00195106_m1). [score:4]
We identified here an overexpression of miR-92a in a series of PMBL compared to DLBCL human samples, and, using a combined bioinformatics and transcriptomic approach, we showed that FOXP1 was the main target of miR-92a in PMBL. [score:4]
3′UTR assay together with protein expression analysis in transfected cell lines, enabled us to identify FOXP1 as the target of miR-92a in PMBL, a result not previously established. [score:4]
In conclusion, we demonstrated the post-transcription regulation by miR-92a through FOXP1 targeting in PMBL. [score:4]
Karpas wt cells (25×10 [4] per milliliter) were transduced with VSV-G pseudotype viral particles (Ozyme, France) (MOI [(Karpas)]=90) that included miRZip-92a anti miR-92a construct (Ozyme, France) on RetroNectin precoated dishes (Takara, Ozyme, France) to induce a low expression of miR-92a. [score:3]
D. Luciferase reporter activity test using 293T-cells expressing a GLuc-3′UTR [FOXP1] fusion mRNA, transfected with a miR-92a mimic (hsa-miR-92a-3p mimic) or a negative control (cel-miR-39-3p mimic) shows a significantly lower luciferase activity in Gluc-FOXP1-3′UTR-2 transfected cells. [score:3]
In the wild-type cell lines studied, we found that, as in human samples, miR-92a expression was significantly higher in Karpas than in SU-DHL-5 (Karpas 9.09 (Q1-Q3, 9-9.25); SU-DHL-5 3.3 (Q1-Q3, 3.16-3.31); P =< 0.002) and miR-18a significantly lower (Karpas 0.57 (Q1-Q3, 0.56-0.62); SU-DHL-5 1.17 (Q1-Q3, 0.98-1.37); P =< 0.02). [score:3]
Overall these results were in favor of FOXP1 as a target of miR-92a. [score:3]
We obtained a list of putative miR-92a targets. [score:3]
miR-92a target identification in PMBL. [score:3]
Overall, these results demonstrated a strong association between miR-92a expression level and FOXP1. [score:3]
In addition, Kendall statistic test on Q-RT-PCR results gave a negative correlation between FOXP1 and miR-92a expression levels (tau=-0.59; p-val < 0.05)(Figure 3C). [score:3]
A high expression of miR-92a was induced by the inclusion of hsa-miR-92a-1 pre-miRNA construct (Ozyme, France) on RetroNectin precoated dishes. [score:3]
In addition, when these transduced cells were injected into NOD-SCID mice, a significantly higher overall survival, together with a less-severe mediastinal involvement, was observed in mice injected with Karpas cells overexpressing miR-92a. [score:3]
We found a significantly higher rate of apoptosis and lower rate of proliferation in cells overexpressing miR-92a. [score:3]
FOXP1 as target of miR-92a in PMBL. [score:3]
FOXP1 as a target of miR-92a in PMBL. [score:3]
The tree Karpas cell lines were cultured for 7 days A. Flow cytometry analyses of the two transduced Karpas cell lines show a significantly higher apoptosis rate, using Annexin V test, in Karpas hsa-miR-92a-1 (overexpressing miR-92a) than in Karpas miRZip-92a, at 48h, 72h and 96h. [score:3]
Functional analyses of miR-92a expression in PMBL cell lines. [score:3]
Figure 5The tree Karpas cell lines were cultured for 7 days A. Flow cytometry analyses of the two transduced Karpas cell lines show a significantly higher apoptosis rate, using Annexin V test, in Karpas hsa-miR-92a-1 (overexpressing miR-92a) than in Karpas miRZip-92a, at 48h, 72h and 96h. [score:3]
A combination of in silico prediction and transcriptomic analyses enabled us to identify FOXP1 as a main miR-92a target gene in PMBL, a result so far not established. [score:3]
B. Flow cytometry analyses of the two transduced Karpas cell lines show a significantly lower proliferative rate in Karpas hsa-miR-92a-1 (overexpressing miR-92a) than in Karpas miRZip-92a, at 24h, 48h, 72h and 96h. [score:3]
In the 20 DBLCL studied, there was no significant difference for miR-92a expression in GCB versus ABC subtypes (Supplementary Figure 2). [score:3]
Bioinformatic approach for miR-92a target identification. [score:3]
The normalized datasets were filtered through the CoMeTa miR-92a putative target-gene list. [score:3]
Microarray analyses and miR-92a target prediction. [score:3]
These results showed the presence of a functional miR-92a binding site on the 3′ extremity of the FOXP1 3′UTR, and thus demonstrated that FOXP1 was a target of miR-92a. [score:3]
In vivo studies using the transduced cell lines in mice enabled us to demonstrate a tumor suppressor effect of miR-92a and an oncogenic effect of FOXP1. [score:3]
Overall, these results indicated a tumor-suppressor role of miR-92a in PMBL. [score:3]
miR-92a was overexpressed in PMBL compared to DLBCL, but not to cHL. [score:2]
C. When the expression levels of FOXP1 and miR-92a were compared in PMBL and DLBCL samples, there were significantly lower levels of FOXP1 and higher levels of miR-92a in PMBL samples. [score:2]
We concluded to a post-transcriptional regulation by miR-92a through FOXP1 targeting in PMBL, with a clinico-pathological relevance for better characterisation of PMBL. [score:2]
MiR-92a, overexpressed in our series of PMBL human samples and Karpas cell line, can exert antagonist biological functions in experimental conditions: in the Eμ-myc Burkitt’s lymphoma mo del, it promotes c-Myc -induced apoptosis [19, 38]; in mouse embryonic fibroblasts, and in primary B-cells, it enhances c-Myc -induced cell proliferation [38]. [score:2]
Mir-92a can be tested using a simple PCR performed on small RNA fragments extracted from formalin-fixed, paraffin-embedded tissues, and FOXP1 expression can be assessed using common immunohistochemistry on paraffin sections. [score:2]
When DLBCL and cHL were compared, five miRNAs of the miR-17-92a cluster, but not miR-92a, and the miR-106a and miR-106b of the paralog clusters, were significantly overexpressed in DLBCL. [score:2]
When we compared PMBL and DLBCL results for the miR-17∼92 cluster, we found that only miR-92a had a significantly higher level of expression in PMBL compared to DLBCL (PMBL median 4.64 (interquartile range (Q1-Q3), 2.47-10.75); DLBCL 1.92 (Q1-Q3, 1.08-2.87); P =< 0.001). [score:1]
We found a higher level of miR-92a in PMBL than in DLBCL, but not in cHL. [score:1]
miR-92a, FOXP1, and apoptosis, proliferation and tumorigenicity. [score:1]
To perform this, we chose the 293T-cell line because it had already been efficiently transfected with miR-92a [30]. [score:1]
miR-92a expression levels were measured using RT-qPCR (Supplementary figure 1) Laser-microdissection was performed on each tissue sample using a PALM-Microbeam/Zeiss system (Zeiss, Wetzlar, Germany). [score:1]
The same cells were in a second step transfected with 50nM of hsa-miR-92a-3p mimic (Exiqon, France) using lipofection. [score:1]
[1 to 20 of 71 sentences]
2
[+] score: 334
Inhibition of miR-92a in vitro upregulates the expression of its direct target the CDK inhibitor p57 [Kip2] that regulates the podocyte cell cycle, and results in impairment of cell proliferation. [score:14]
miR-92a inhibition preserves p57 [Kip2] expression and limits podocyte proliferationTo decipher the role of miR-92a in podocyte function, we inhibited miR-92a expression in primary cultures of podocytes (Fig.   2a). [score:9]
Fig. 2Inhibition of miR-92a in podocytes upregulates its target p57 and impairs proliferation. [score:8]
Lin HY Chiang CH Hung WC STAT3 upregulates miR-92a to inhibit RECK expression and to promote invasiveness of lung cancer cellsBr. [score:8]
Anti-miR-92a injections to mice inhibited miR-92a expression in glomeruli during NTN (Fig.   5a, b) without modifying the expression of other miRNAs from the 17–92 cluster (not shown). [score:7]
The eGFR is calculated according to the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) equation MCD minimal change disease; MN membranous nephropathy; MPA microscopic polyangiitis; GPA granulomatosis with polyangiitis (GPA); ANCA anti-neutrophil cytoplasmic antibodies; MPO myeloperoxidase; PR3 proteinase 3; LN class III and class IV lupus nephritis, control for non-crescentic glomerular disease and RPGN for crescentic RPGN This prominent induction of miR-92a was further demonstrated in WT1 -expressing podocytes in kidney biopsies from individuals diagnosed with crescentic RPGN but not in those patients with non-proliferative glomerulopathies such as membranous nephropathy (Fig.   1f). [score:7]
control podocytes (control) We next studied whether the p57 [Kip2] expression pattern in podocytes during RPGN corresponded to the loss of expression observed in proliferating cultured podocytes with high miR-92a expression. [score:7]
Moreover, utilizing RT-qPCR analysis of miRNA in whole kidney biopsy sections (a more practical alternative to laser capture microdissection of glomeruli or in situ hybridization), we showed that the expression of miR-92a was 2- to 7.5-fold higher in samples from patients with RPGN than in those from patients with other chronic proteinuric glomerular diseases (minimal change disease (MCD) and membranous nephropathy (MN)) (Supplementary Fig.   1b) with no overlap of relative miR-92a levels between the RPGN and non-RPGN groups. [score:7]
control podocytes (control) We next studied whether the p57 [Kip2] expression pattern in podocytes during RPGN corresponded to the loss of expression observed in proliferating cultured podocytes with high miR-92a expression. [score:7]
We next searched for potential targets of miR-92a using the target prediction algorithms miRWalk and TargetScan 37, 38. [score:7]
The eGFR is calculated according to the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) equation MCD minimal change disease; MN membranous nephropathy; MPA microscopic polyangiitis; GPA granulomatosis with polyangiitis (GPA); ANCA anti-neutrophil cytoplasmic antibodies; MPO myeloperoxidase; PR3 proteinase 3; LN class III and class IV lupus nephritis, control for non-crescentic glomerular disease and RPGN for crescentic RPGN This prominent induction of miR-92a was further demonstrated in WT1 -expressing podocytes in kidney biopsies from individuals diagnosed with crescentic RPGN but not in those patients with non-proliferative glomerulopathies such as membranous nephropathy (Fig.   1f). [score:7]
Whereas miR-92a labeling was weak and restricted to the endothelium in control human kidneys (non-crescentic glomerular diseases) (Fig.   1d), miR-92a was significantly upregulated in kidney biopsies from patients with RPGN, regardless of etiology. [score:6]
MicroRNA-92a inhibition was achieved in vitro by transfecting primary culture podocytes with anti-miR-92a inhibitor using Hiperfect transfection reagent (Qiagen). [score:5]
iPod- miR-92a WT mice Our data suggest that RPGN is associated with increased miR-92a expression and activity in podocytes and that this may be pathogenic in disease progression. [score:5]
For validation of p57 as a target of miR-92a, 3′UTR or mutated 3′UTR of mouse p57 [Kip2] were cloned into a mammalian expression vector with dual luciferase reporter system (GeneCopoeia). [score:5]
To further confirm the mechanisms whereby miR-92a is induced in vivo, we went on to abolish STAT3 expression specifically in podocytes by generating mice with floxed Stat3 and podocyte-specific expression of Cre (Pod). [score:5]
Furhermore, an anti-mIL-6 monoclonal antibody and a specific inhibitor of EGFR kinase, AG1478 impaired STAT3 phosphorylation, miR-92a expression, and Ki67 levels (Supplementary Fig.   3f, h, i). [score:5]
miR-92a inhibition preserves p57 [Kip2] expression and limits podocyte proliferation. [score:5]
To decipher the role of miR-92a in podocyte function, we inhibited miR-92a expression in primary cultures of podocytes (Fig.   2a). [score:5]
MiRNA profiling in isolated glomeruli from mice with nephrotoxic serum -induced crescentic nephritis (NTN) and control mice unraveled upregulation of miR92a. [score:4]
Sengul A Santisuk R Xing W Kesavan C Systemic administration of an antagomir designed to inhibit miR-92, a regulator of angiogenesis, failed to modulate skeletal anabolic response to mechanical loadingPhysiol. [score:4]
The combination of our results from in vitro experiments, mouse mo dels, and human tissues indicate that the high abundance of miR-92a can initiate a cascade of podocyte-destabilizing molecular events, starting with the downregulation of p57 [Kip2] and proliferation. [score:4]
Our investigation further identified a key miR-92a target, the p57/Kip2/Cyclin -dependent kinase inhibitor 1C, which is involved in cell cycle regulation and control of the quiescent state of podocytes. [score:4]
Mechanistically, binding of miR-92a to the target region of p57 [Kip2] acts as negative regulator and causes a lack in the p57 [Kip2] that is available for podocyte cell cycle resistance to ambient mitogenic stimuli. [score:4]
p57 [Kip2] 3′UTR luciferase assayFor validation of p57 as a target of miR-92a, 3′UTR or mutated 3′UTR of mouse p57 [Kip2] were cloned into a mammalian expression vector with dual luciferase reporter system (GeneCopoeia). [score:4]
MiR-92a upregulation was confirmed in vivo by miR-92a RT-qPCR in isolated glomeruli (Supplementary Fig.   4f) and by in situ hybridization (Supplementary Fig.   4f, g) that showed a widespread high abundance of miR-92a throughout glomerular sections from NTS-challenged nephritic Pod -Stat3 WT mice, particularly in glomerular epithelial cells. [score:4]
Two independent target prediction algorithms and luciferase assay identified p57 [Kip2] as a relevant miR-92a target. [score:4]
Aberrant expression of miR-92a family was detected in multiple cancers, and the disturbance of miR-92a family was related with tumorigenesis and tumor development [22]. [score:4]
However, miR-92a expression level did not correlate with histological variant of crescent (cellular vs. [score:3]
Utilizing a 3′UTR luciferase assay, we confirmed that miR-92a directly targets p57 [Kip2] (Fig.   2e and Supplementary Fig.   6a, b, c). [score:3]
As miR-92a is part of the miR-17–92 cluster that encodes a polycistronic transcript that produces six individual mature miRNAs [24], we expected increased glomerular expression of all members of the cluster. [score:3]
MiR-92a was the most differentially upregulated candidate fulfilling these criteria. [score:3]
miR-92a expression is modulated downstream of the STAT3 cascade in podocytes. [score:3]
High expression of miR-92a in human kidneys with RPGN. [score:3]
For example, we observed intense miR92a expression in fully constitued crescents and less in pseudo-crescents (when a paucity of cells are proliferating) and fibrocellular cellular crescents (when many epithelial cells have already disappeared). [score:3]
We used a conditional expression mo del (Tet-On system) to achieve temporal podocyte-specific deletion of the miR-92a gene in mice. [score:3]
To translate our findings to a potentially novel therapy for RPGN, we find that specific blockade of miR-92a in vivo markedly prevents albuminuria, crescent formation, and renal failure even when this strategy is initiated in a therapeutic manner after the onset of NTN. [score:3]
Interestingly, a similar pattern of miR-92a expression was observed in all kidney samples from patients with RPGN regardless of etiology. [score:3]
b Relative miR-92a expression in dynabeads-isolated glomeruli from normal mice (control), NTS-challenged mice (NTN), NTS-challenged mice treated with anti-miR-control (NTN + anti-miR-ctrl), and NTS-challenged mice treated with anti-miR-92a (NTN + anti-miR-92a) after 10 days. [score:3]
Daniel JM Inhibition of miR-92a improves re-endothelialization and prevents neointima formation following vascular injuryCardiovasc. [score:3]
Genetic Stat3 allele deletion limited miR-92a expression in primary culture of podocytes (Supplementary Fig.   4e). [score:3]
We do not exclude that there are other potential miR-92a targets involved in the proliferative response of podocyte. [score:3]
MiR-92a was significantly overexpressed in human glomeruli from patients with RPGN compared to those with other non-proliferative glomerular diseases. [score:3]
Together, these findings indicate that miR-92a control of podocyte phenotype may be a general paradigm for proliferative extracapillary diseases. [score:3]
Furthermore, although most of the pathophysiological actions of miR-92a were found in podocytes, it is important to note that anti-miR-92a strategies would be expected to alleviate endothelial inflammation, cardiac ischemia, and atherosclerosis [45], potentially important given the high risk of cardiovascular disease in individuals with RPGN 56– 59. [score:3]
Given the promoter region of the miR-17/92 gene contains a highly conserved functional STAT3 -binding site [23], we examined miR-92a expression dependency on STAT3 in podocytes and in the context of severe extracapillary glomerulonephritis. [score:3]
In situ hybridization revealed the expression of miR-92a in glomerular epithelial cells of patients with RPGN, particularly in podocytes and crescents, and to a lesser extent in parietal epithelial cells (Fig.   1d). [score:3]
Another notable finding of our study is that STAT3 activation is required to trigger miR-92a pathogenic expression. [score:3]
Hence, we went on to test whether pharmacological inhibition of the miR-92a–p57 [Kip2] pathway protected from renal injury by using chemically engineered oligonucleotides, termed “antagomirs” (anti-miRs), efficient and specific silencers of endogenous miRNAs in mice. [score:3]
We identified a miR-92a target relevant to podocyte proliferation. [score:3]
Fig. 1Increased miR-92a expression in crescents and podocytes during nephrotoxic nephritis and human crescentic glomerulonephritis. [score:3]
To determine if miR-92a expression in podocytes in vivo is necessary for crescent formation and renal failure, we selectively deleted miR-92a from podocytes. [score:3]
Given we had found STAT3 to be a strong modulator of miR-92a in cultured podocytes, we studied the expression of miR-17/92 in experimental NTN on Pod-Stat3 lox mice. [score:3]
Overall, a ~50% reduction in relative miR-92a expression was achieved in glomeruli (Fig.   4b). [score:3]
Li M miR-92a family and their target genes in tumorigenesis and metastasisExp. [score:3]
White arrows show colocalization of WT1 -positive cells and miR-92a expression. [score:3]
For instance, the integrin subunit alpha5 is a target of miR-92a in ischemic tissues [20]. [score:3]
In vivo miR-92a inhibition in mice. [score:3]
Anti-miR-92a given after NTS still effectively inhibited glomerular miR-92a levels at day 10 (Fig.   6b) and these mice displayed a marked reduction in albuminuria (Fig.   6c). [score:3]
We found that both addition of exogenous recombinant IL-6 or HB-EGF-stimulated STAT3 phosphorylation and miR-92a expression (Supplementary Fig.   3g, h). [score:3]
Loyer X Inhibition of microRNA-92a prevents endothelial dysfunction and atherosclerosis in miceCirc. [score:3]
To generate a time-specific and podocyte-specific knockout of miR-92a, we crossed mice carrying reverse tetracycline transactivator protein under control of the podocin promoter (iPod) with mice carrying the Tet-O-Cre transgene as previously described 13, 63 and with mice carrying a loxP-flanked miR-92a allele [64]. [score:2]
MiR-92a glomerular expression was not induced in Pod-Stat3 lox mice despite NTS challenge. [score:2]
Surprisingly, miR-92a was the only member to be dysregulated in human (Supplementary Fig.   1c) and murine RPGN (Supplementary Fig.   1d). [score:2]
Therefore, miR-92a is involved in the regulation of podocyte proliferation. [score:2]
MiR-92a was selectively induced in glomerular epithelial cells in nephritic mice as demonstrated both by in situ hybridization in WT1 -expressing cells in kidney sections (Fig.   1b) and by RT-qPCR in freshly sorted podocytes from NPHS2-Cre x mT/mG mice (Fig.   1c). [score:2]
Surprisingly, miR-92a was the only member to be dysregulated in human and murine RPGN. [score:2]
These results were independently confirmed by RT-qPCR analysis in laser capture microdissected glomeruli showing a 3.5- to 4-fold increase of miR-92a to U6snRNA ratio in RPGN cases compared to cases diagnosed with non-proliferative glomerular diseases (Fig.   1e). [score:2]
miRNA probes (miR-92a probe double-DIG labeled LNA probes, Exiqon, final concentration 20 nM) were mixed with denaturation buffer and added to the sections and were incubated over night at 56 °C. [score:1]
Our data demonstrate the involvement of miR-92a in the deleterious response to immune injury that leads to glomerular destruction and functional demise. [score:1]
We have discovered that the STAT3−miR-92a activation governs a dedifferentiation program in podocytes with acquisition of proliferative capability. [score:1]
MiR-92a is part of the miR-17–92 cluster, which contains six miRNAs [24]. [score:1]
b RT-qPCR analysis of the relative abundance of miR-92a in freshly isolated glomeruli from NTS-challenged iPod- miR92a WT mice and NTS-challenged iPod- miR92a lox mice. [score:1]
a RT-qPCR analysis of the relative abundance of miR-92a in podocytes transfected with an anti-miR-control (anti-miR-ctrl) or an anti-miR-92a. [score:1]
Importantly, NTS -induced glomerular injury was less severe in mice that received anti-miR92a (NTN+anti-miR92a) than in mice that received a control anti-miR (NTN+anti-miR-ctrl) or in mice that received vehicle alone (NTN). [score:1]
iPod- miR92a lox males and Podocin-rtTA-Tet-O-Cre miR-92a wt/wt (iPod- miR92a wt) gender-matched littermates were subjected to severe, life-threatening NTN with high-dose NTS. [score:1]
Ten weeks after doxycycline administration, marked reduction of miR-92a abundance in podocytes was achieved (Fig.   4a), with most of residual signal being in endothelial cells. [score:1]
These studies show that miR-92a is highly abundant in conditions associated with glomerular epithelial cell proliferation and crescent formation. [score:1]
f Blood urea nitrogen concentration at day 10 after NTS injection in iPod- miR92a WT and iPod- miR92a lox mice. [score:1]
The sequences (AntagomiR-Control (anti-miR-ctrl): 5′-AAGGCAAGCUGACCCUGAAGUU-3′ and antagomiR-92a (anti-miR-92a): 5′-CAGGCCGGGACAAGUGCAAUA-3′) were obtained from a previously published study [20]. [score:1]
The miR-92a family is related to the formation of vascular endothelial cells 20, 21. [score:1]
In the miR-92 antagomir and control antagomir, the 2′O RNA base are methylated and the first two bases and the last three bases are phosphorothiated to increase the stability of antagomir and hence protect it from degradation. [score:1]
e RT-qPCR analysis of the relative abundance of miR-92a in microdissected glomeruli from four patients with non-crescentic glomerulopathies (black bars) and six patients with crescentic RPGN (white bars). [score:1]
Indeed, the proportion of glomerular crescents was ~70% lower in NTN+anti-miR92a mice than in either control condition (Fig.   5c, e). [score:1]
This functional protection conferred by anti-miR-92a administration was associated with marked alleviation of histologic damage as measured using silver staining of renal cortex (Fig.   6e, f) and significantly preserved p57 [Kip2] expression in podocytes (Fig.   6g, h and Supplementary Fig.   8b). [score:1]
b Relative abundance of miR-92a assessed by RT-qPCR in sorted podocytes from normal healthy mice (control) and NTS-challenged mice (NTN). [score:1]
Statistical analysis: Kruskal–Wallis one-way analysis of variance followed by Dunn’s multiple comparaison test We next administered anti-miR-92a, on day 4 after infusion of NTS (Fig.   6a). [score:1]
Podocin-rtTA-Tet-O-Cre miR-92a loxP/loxP (iPod- miR92a lox) mice had normal kidney histology (Supplementary Fig.   7) and albuminuria that was within the physiological range (Fig.   4c). [score:1]
These improved structural parameters corresponded to improved functional parameters: urinary albumin excretion was lower (Fig.   5f), and kidney dysfunction minimal (Fig.   5g) in anti-miR-92a -treated mice. [score:1]
This may lead one to consider anti-STAT3 strategies as anti-miR-92a options. [score:1]
f Fluorescent in situ hybridization of miR-92a (red) and WT1 (green) on patients biopsies described in d. Bottom panel shows higher magnification of top panel (white box). [score:1]
Statistical analysis: Mann–Whitney test to compare two groups To evaluate the clinical relevance of our findings, we analyzed miR-92a expression in kidney biopsies from patients with RPGN and control patients with non-proliferative glomerulopathies (Table  1). [score:1]
Induction of NTN was associated with a low abundance of p57 [Kip2] in podocytes that was partially but significantly rescued by delivery of anti-miR-92a (Fig.   5c, d and Supplementary Fig.   8a). [score:1]
Transfections were performed using 1 μg dual luciferase reporter plasmids and a final concentration of 100 nM synthetic miR-92a mimic, or miR-126 as an irrelevant miRNA mimic (Applied Biosystems). [score:1]
Furthermore, whereas vehicle-only -treated mice (NTN) or anti-miR-ctrl -treated mice (NTN+anti-miR-ctrl) developed rapid and life-threatening kidney failure, mice treated therapeutically with anti-miR-92a had BUN levels within the normal range (Fig.   6d). [score:1]
Both podocyte outgrowth area and the abundance of Ki67 mRNA were lower in podocytes transfected with anti-miR-92a than in control cells transfected with an anti-miR control (Fig.   2b, c, d). [score:1]
Black stars (*) show miR-92a -positive cells. [score:1]
miR-92a deletion prevents crescentic glomerulonephritis and renal failure. [score:1]
Fig. 5Silencing miR-92a prevents kidney injury in a mouse mo del of nephrotoxic nephritis. [score:1]
miR-92a in vitro modulation. [score:1]
e Proportion of crescentic glomeruli in NTS-challenged iPod- miR92a WT and iPod- miR92a lox mice at day 10 after NTS injection. [score:1]
We first administered an anti-miR-92a strategy in a preventative fashion. [score:1]
This improvement in kidney structure was also reflected by less severe damage to the podocyte ultrastructure in anti-miR-92a -injected mice relative to untreated and anti-miR-ctrl injected littermate controls (Fig.   5c). [score:1]
Here we report that the abundance of miR-92a is high in kidney biopsies from patients diagnosed with crescentic RPGN, especially within podocytes, as well as in mice exposed to NTN. [score:1]
Finally, we also provide proof of principle that delayed anti-miR-92a strategy could display therapeutic actions on glomerular function and structure in a severe mo del of RPGN. [score:1]
Anti-miR92a protects from crescentic glomerulonephritis and kidney failure. [score:1]
Taken together, these findings suggest that both EGFR and IL-6R stimulate the STAT3-miR-92a cascade in activated proliferating podocytes. [score:1]
d RT-PCR analysis of Ki67 mRNA abundance in intact and anti-miR-ctrl primary podocytes or in anti-miR-92a primary podocytes. [score:1]
To assess whether miR-92a was localized specifically in glomerulus, sections were processed for double fluorescence staining to visualize the simultaneous localization of miR-92a (red; Cy3) and a primary antibody for WT1 (green; AF488), a podocyte-specific marker. [score:1]
Furthermore, we showed by western blot and immunofluorescence that the abundance of p57 [Kip2] was higher in anti-miR-92a -transfected podocytes and correlated with a lower rate of podocyte proliferation (Fig.   2f, g, h). [score:1]
a Fluorescent in situ hybridization of miR-92a (red) and WT1 (green) on kidney sections from NTS-challenged iPod- miR92a WT mice and iPod- miR92a lox mice. [score:1]
miR-92a in situ hybridization. [score:1]
p57 3′UTR miR-92a -binding sequence binding site is indicated in bold and mutated sequence is labeled in red. [score:1]
We went on to examine the involvement miR-92a activation in the glomerular injurious process. [score:1]
d Masson trichrome- and silver-stained kidney sections of glomeruli from NTS-challenged iPod- miR92a WT mice and iPod- miR92a lox mice at day 10 after NTS injection. [score:1]
Moreover, specific blockade of miR-92a in vivo by an antagomir markedly prevented proteinuria, crescent formation, and renal failure. [score:1]
b RT-qPCR analysis of the relative abundance of miR-92ain freshly isolated glomeruli from normal mice (control), NTS-challenged mice (NTN), NTS-challenged mice treated with anti-miR-control (NTN + anti-miR-ctrl) and NTS-challenged mice treated with anti-miR-92a (NTN + anti-miR-92a) after 10 days. [score:1]
Conditional podocyte-specific miR-92a deletion reduces albuminuria and glomerular injury and fully prevents renal failure after NTN. [score:1]
Podocyte-specific deletion of miR-92a-alleviated albuminuria (Fig.   4c), crescent formation (Fig.   4d, e), the rise in BUN (Fig.   4f), and significantly protected mice from p57 [Kip2] loss in podocytes (Fig.   4g–i). [score:1]
p57 [Kip2] displays a 3′UTR miR-92a -binding sequence. [score:1]
in anti-miR-92a primary podocytes. [score:1]
Statistical analysis: Kruskal–Wallis one-way analysis of variance followed by Dunn’s multiple comparaison test We next administered anti-miR-92a, on day 4 after infusion of NTS (Fig.   6a). [score:1]
MicroRNA probes (miR-92a, 5′-3′–Digoxigenin-labeled Locked Nucleic Acid probe, Exiqon, 100 nmol/L; U6snRNA, 3′-Digoxigenin-labeled Locked Nucleic Acid probe, 2 nmol/L) were mixed with denaturation buffer and then incubated with the sections over night at 56 °C. [score:1]
Glomerular miR-92a induction in mouse nephrotoxic nephritis. [score:1]
[1 to 20 of 124 sentences]
3
[+] score: 285
We found wide variation of miR-92a expression in fresh AML cells (Figure 1B): miR-92a expression ranged from 0.1199 to 4.724 (mean ± SD, 1.131 ± 1.112), and there was no significant difference in miR-92a expression between AML cells and PBMNC; however, miR-92a expression varied among FAB subtypes. [score:9]
In contrast to expression in AML cells, miR-92 expression in ALL cells was higher than in PBMNC (P = 0.0272), and miR-92a expression was significantly higher in ALL cells than in AML cells (P = 0.0021) (Figure 1D). [score:7]
Although miR-92a expression in fresh leukemia cells was highly variable, miR-92a expression was significantly increased in a subset of ALL cells, and ALL patients with overexpressed miR-92a had poor outcomes. [score:7]
Cellular miR-92a expression was expressed as ratios based on the average from normal PBMNC controls (ratios to controls in the Figure 1A), and we found miR-92a expression to be 5- to 10-fold higher in CD34 -positive cells. [score:7]
Although the anti-miR-92a inhibitor did not inhibit growth in the cell lines (data not shown), we found an increase in annexin -positive cells in the anti-miR-92a inhibitor -treated Raji and OM9;22 cells compared with the anti-miR negative control -treated cells (Figure 2B). [score:6]
Although the knock-down of miR-92a did not show growth inhibition, an increase in apoptotic cells may indicate that miR-92a possibly inhibits apoptosis in a subset of ALL cells. [score:6]
The miR-92a expression in AML-M3 was significantly lower than in AML-M1 (P = 0.0325) (Additional file 1), indicating that miR-92a expression may be linked to cellular differentiation in AML cells. [score:5]
We then reanalyzed previously published data on plasma miR-92a expression [8] with respect to the expression in leukemia cells. [score:5]
First, miR-92a expression was increased in a subset of ALL cells, and the expression pattern may be linked to clinical behavior in ALL patients. [score:5]
We then reanalyzed previously published data on plasma miR-92a expression [8] with respect to its expression in leukemia cells. [score:5]
Similar to expression in AML cells, miR-92a expression in ALL cells varied from 0.2109 to 9.987 (mean ± SD, 1.257 ± 0.2261) (Figure 1C) and was significantly lower than in CD34 -positive control cells (P = 0.0014) (Figure 1D). [score:5]
We used total RNA obtained from either plasma or PBMNC of healthy volunteers as controls, and the miR-92a expression levels in acute leukemia specimens were expressed as "ratios to controls". [score:5]
MiR-92a expression level was decreased only when cells were treated with anti-miR-92a inhibitor. [score:5]
More specifically, cellular miR-92a expression was significantly increased in a subset of ALL cells, and ALL patients with overexpressed miR-92a had poor prognoses. [score:5]
We arbitrarily divided ALL patients into two groups; group 1 was composed of ALL patients whose miR-92a expression levels were greater than three times the average level of normal PBMNC controls (n = 9), and the remaining ALL patients, whose miR-92a expression levels were lower than threefold normal PBMNC controls, were assigned to group 2 (n = 34). [score:5]
We compared miR-92a expression in plasma with its expression in leukemia cells. [score:4]
This is the first report to circumstantiate the dysregulation of miRNA in patients with acute leukemia by analyzing miR-92a expression in both cells and plasma. [score:4]
The question has thus arisen regarding why the level of miR-92a is down-regulated in acute leukemia cells. [score:4]
Unlike leukemia cell lines, the miR-92a expression levels in fresh leukemia cells were generally low. [score:3]
The expression levels of miR-92a in the supernatant are shown in closed boxes, and those in cells are show in open boxes. [score:3]
We found that miR-92a was strongly expressed in tumors, while tumor tissue was negative for the scramble probe (negative controls) (Figure 4A). [score:3]
We found high miR-92a expression in leukemia cell lines as well as in CD34 -positive cells obtained from healthy volunteers. [score:3]
To determine the expression levels of miR-92a in xenotransplanted tumor tissues, we performed in situ hybridization using LNA -modified probes labeled with digoxigenin. [score:3]
In keeping with our previous observation using in situ hybridization of miR-92a in AML cells [8], leukemia cells possessed high levels of miR-92a expression. [score:3]
We found various levels of miR-92a expression in the supernatant (Figure 3D). [score:3]
Cells (5 × 10 [5 ]cells/ml) were cultured in a serum-free medium for 24 hours, and miR-92a expression in both cells and supernatant was analyzed. [score:3]
The miR-92a expression in plasma and cells from tumor-bearing mice. [score:3]
We therefore set out to determine miR-92a expression levels in acute leukemia cell lines and fresh acute leukemia cells. [score:3]
CD34 -positive cells from five healthy volunteers and PBMNC from 20 healthy volunteers were used as controls for cellular miR-92a expression. [score:3]
On the basis of the results obtained from cellular miR-92a expression, miR-92a appears to play some role in ALL cells but not AML cells. [score:3]
Annexin -positive cells were more frequent in anti-miR-92a inhibitor -treated Raji and OM9;22 cells than in anti-miR negative control -treated cells. [score:3]
Cell to plasma ratio of miR-92a expression is elevated in acute leukemia. [score:3]
These findings indicate that miR-92a expression may be linked to constant cell growth such as in immortalized leukemia cell lines and hemopoietic stem cells. [score:3]
We also noticed that miR-92a was preferentially expressed in acute lymphoblastic leukemia (ALL) cells in comparison with acute myeloid leukemia (AML) cells. [score:3]
A: ALL-group 1; miR-92a expression level is three times greater than that of normal controls (n = 9). [score:3]
Locked nucleic acid (LNA) -modified probes for miR-92a and negative control (miRCURY-LNA detection probe; Exiqon, Vedbaek, Denmark) were used to detect miR-92a expression in spleen and tumor, as reported previously [8]. [score:3]
However, our results highlight the biological and clinical properties of miR-92a in ALL cells in that patients with higher expression of miR-92a had significantly shorter survival. [score:3]
The miR-92a expression levels in immortalized leukemia cell lines and CD34 -positive cells from healthy volunteers. [score:3]
Similarly, in ALL cell lines, miR-92a expression ranged from 9.361 to 22.19 (mean ± SD, 12.52 ± 5.433) and tended to be higher than in CD34 -positive cells (P = 0.0538). [score:3]
The inverse correlation of miR-92a expression between cells and plasma and the cell to plasma ratio may be important to understanding the clinical and biological relevance of miR-92a in acute leukemia. [score:3]
To further elucidate the potential role of miR-92a in ALL cells, we used antisense oligonucleotides to examine the effects of reducing miR-92a expression in Raji and OM9;22 cells. [score:3]
Antisense oligonucleotides and their respective scrambled control oligonucleotides were purchased from Applied Biosystems: an anti-miR-92a inhibitor (AM10916) and anti-miR negative control #1 (AM17011). [score:3]
A: Plasma miR-92a expression levels in acute leukemia patients and normal controls. [score:3]
The miR-92a expression in leukemia cells could be a prognostic factor in ALL patients. [score:3]
In the five myeloid leukemia cell lines, miR-92a expression ranged from 10.2 to 25 (mean ± SD, 15.1 ± 6.665) and was significantly higher than in CD34 -positive cells (mean ± SD, 7.814 ± 2.360; P = 0.0251). [score:3]
D: Comparison of miR-92a expression in acute leukemia cells as well as CD34 -positive cells and PBMNC obtained from healthy volunteers. [score:3]
B: Cell to plasma ratio of miR-92a expression. [score:3]
We also determined miR-92a expression levels in peripheral blood mononuclear cells (PBMNC) from normal controls. [score:3]
Since overexpression of the miR-17-92 cluster has been demonstrated in various neoplasias, including lymphoma and lung cancer [9- 13], miR-92a is categorized as a possible oncomiR. [score:3]
D: The miR-92a expression in cells and supernatant. [score:3]
We quantified the expression level of miR-92a in both cells and plasma by reverse transcription polymerase chain reaction in 91 patients with acute leukemia. [score:3]
Click here for file There was no significant difference in miR-92a expression levels among ALL cytogenetic groups. [score:3]
The anti-miR-92a inhibitor -treated Raji and OM9;22 cells revealed an increase of apoptotic cells. [score:3]
Figure 4 The miR-92a expression in tumor-bearing mouse. [score:3]
We first examined miR-92a expression levels in leukemia cell lines as well as CD34 -positive cells obtained from healthy volunteers (Figure 1A). [score:3]
Figure 2 Role of miR-92a expression in ALL cells. [score:3]
Low plasma miR-92a expression in tumor-bearing mice. [score:3]
Synthetic anti-miR-92a inhibitor was transfected into Raji and OM9;22 cells, and apoptosis was assessed. [score:3]
A: Cellular miR-92a expression levels in CD34 -positive cells obtained from normal individuals, AML cell lines, and ALL cell lines. [score:3]
ALL-group 2; miR-92a expression level is a third or less than normal controls (n = 34). [score:3]
There was no significant difference in miR-92a expression levels among ALL cytogenetic groups. [score:3]
There was no significant difference in miR-92a expression levels among cytogenetic ALL groups (Additional file 2). [score:3]
C: MiR-92a expression in ALL cells and control cells. [score:2]
We found that the miR-92a plasma expression level was significantly lower--approximately only 1/100th--in both acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL) compared with normal controls. [score:2]
B: MiR-92a expression in AML cells and control cells. [score:2]
MiR-92a expression levels in M1 were significantly higher than those in M2 (P = 0.0033) and M3 (P = 0.0325). [score:2]
Notably, the cell to plasma ratio of miR-92a expression was significantly higher in both AML and ALL cells compared with PBMNC from healthy volunteers. [score:2]
Figure 1 MiR-92a expression in leukemia cells and in CD34 -positive cells obtained from healthy volunteers. [score:2]
Most of the immortalized cell lines showed more than 10-fold higher miR-92a expression compared with controls. [score:2]
MiR-92a expression levels and FAB subtypes in AML. [score:2]
More recently, plasma miR-29a and miR-92a have been found to be significantly overexpressed in colorectal cancers compared with normal controls [21]. [score:2]
We now show that the cell to plasma ratio of miR-92a expression is significantly higher for both AML and ALL compared with the ratio based on PBMNC from healthy volunteers. [score:2]
Click here for file MiR-92a expression levels and FAB subtypes in AML. [score:2]
MiR-92a expression in fresh leukemia cells. [score:2]
It is also possible that release of miR-92a is impaired in acute leukemia cells. [score:1]
The right panel shows the anti-apoptotic effect of miR-92a in Raji and OM9;22 cells. [score:1]
For this reason, the cell to plasma ratio may be important in understanding the biological relevance of miR-92a in acute leukemia. [score:1]
The tumor tissue was positive for miR-92a. [score:1]
The level of miR-92a expression in fresh leukemia cells was highly variable compared with PBMNC, but significantly lower compared with CD34 -positive cells obtained from healthy volunteers. [score:1]
Blue signals represent positive results for miR-92a. [score:1]
B: Plasma miR-92a levels were significantly decreased in accordance with tumor growth (P = 0.0142). [score:1]
This suggests that cellular miR-92a levels may be linked to poor outcome in ALL patients. [score:1]
In situ hybridization was performed using LNA probes for miR-92a. [score:1]
The quantification of miR-92a in leukemia cells and plasma may be used for monitoring leukemia in both ALL and AML patients. [score:1]
Obviously, the signal network mediated by miR-92a needs to be clarified. [score:1]
Although we could not rule out the possibility that mouse miR-92a affects the level of miR-92a in mice plasma, plasma miR-92a levels were significantly decreased in accordance with tumor growth (P = 0.0142)(Figure 4B). [score:1]
For the in vivo assessment of miR-92a, 6-week-old female nude mice were injected with U937 cells. [score:1]
For in vivo assessment, 6-week-old female nude mice were injected with U937 cells, and miR-92a expression in plasma and tumors was measured. [score:1]
In contrast, we found cellular miR-92a appears to play some role in a subset of ALL patients. [score:1]
We have shown a possible role of miR-92a in ALL cells. [score:1]
We previously identified miR-92a as a plasma biomarker in human leukemia [8]. [score:1]
We could not find any obvious correlation between plasma miR-92a and cellular miR-92a in any case since plasma miR-92a levels were extremely low in most of the samples (Figure 3A). [score:1]
Taking the information as a whole, we could not rule out the possibility that the miR-92a in plasma may transfer to other cells in acute leukemia. [score:1]
The expression of miR-92a was calculated using 2- ΔΔC [t ]methods, and mean cycle threshold (C [t]) values for all miRNAs were quantified using sequence detection system software (SDS, version 1.02; Applied Biosystems). [score:1]
Potential role of miR-92a in ALL cells. [score:1]
Indeed, we could not determine the clinical relevance of miR-92a when analyzing only a cell fraction of AML. [score:1]
Figure 3 Implication of plasma miR-92a. [score:1]
The miR-92a expression in plasma and tumor was measured on day 7 and day 18. [score:1]
These findings suggest that miR-92a may act as oncomiRs in fresh ALL cells. [score:1]
Second, the cell to plasma ratio was low in both AML and ALL, indicating the possibility that leukemia cells retain miR-92a. [score:1]
Although questions still remain about the underlying mechanism of miR-92a dynamics in patients with acute leukemia, our results highlight the impact of the cell to plasma ratio of miR-92a in patients with acute leukemia. [score:1]
It is likely that the in vitro dynamics of miR-92a are not reflected in living cells. [score:1]
To further elucidate the mechanism of release and reuptake of miR-92a by leukemia cells, we measured miR-92a expression in both cells and supernatant in vitro. [score:1]
In tumor-bearing mice, the plasma miR-92a level was significantly decreased in accordance with tumor growth, while tumor tissue was strongly positive for miR-92a. [score:1]
[1 to 20 of 104 sentences]
4
[+] score: 175
Consistently with the up-regulation of the miR-17∼92 cluster in tumors, miR-92a is highly expressed in colon cancer tissues and targets the anti-apoptotic molecule BCL-2-interacting mediator of cell death (BIM) and the tumor suppressor PTEN [9], [10]. [score:10]
MiR-92a was shown to be down-regulated in endothelial cells by shear stress and its inhibition increased the expression of anti-atherosclerotic factors such as Krüpple-like factor 2 (KLF2) and the deacetylase SIRT1 leading to an improved vascular healing and inhibition of atherosclerosis [13]– [16]. [score:9]
Such targets may include BMP7 and Smad7, which are predicted targets of miR-92a, and p63, which is a validated target of miR-92a [21]. [score:7]
Analysis of the phenotype of mice overexpressing miR-92a targets revealed that mice overexpressing PTEN also showed a dwarfism [25]. [score:7]
For the generation of conditional endothelial, cardiomyocyte- or hematopoietic-miR-92a knock-out mice (miR-92a [fl/fl]Tie2-Cre, miR-92 [fl/fl]αMHC-Cre and miR-92 [fl/fl]Vav-Cre), the miR-92a recombined chimeric mice were first bred with C57BL/6J wild type and Flp recombinase expressing deleter mice to excise the neomycin selection cassette and then mated with the respective Cre deleter lines expressing Cre recombinase under the control of Tie2, αMHC or Vav promoter. [score:6]
To determine whether the deletion of miR-92a might have affected the expression of other cluster members, we additionally detected all other mature members of the family and paralog miRNAs that might have been compensatory up-regulated. [score:6]
The polycistronic miR-17∼92 cluster, which comprises the mature miRNAs miR-17, -18a, -19a/b, -20a, and miR-92a, contributes to the pathogenesis of a variety of human diseases, including cancer, cardiovascular disease and congenital developmental defects [2], [4], [5]. [score:6]
MiR-92a has several predicted or validated additional targets that were shown to regulate skeletal development and likely a combination of derepressed targets contributes to the observed phenotype. [score:6]
In the cardiovascular system, inhibition of miR-92a enhances neovascularization after hind limb or myocardial ischemia [11] and a pro-angiogenic effect after miR-92a inhibition contributed to fracture healing [12]. [score:5]
The molecular targets, through which miR-92a regulates skeletal development, are unclear. [score:5]
The miR-92a [−/−] phenotype partially copies the previously reported skeletal development defects of miR-17∼92 cluster knock-out mice [6] and of humans with a reduced expression of the cluster [7]. [score:5]
Moreover, inactivation of miR-92a in zebrafish increased noggin3 expression leading to an inhibition of Bmp signaling and abnormal behavior of chondrogenic progenitors during pharyngeal cartilage formation [24]. [score:5]
These findings identify a regulatory function for miR-92a in growth and skeletal development, whereas miR-92a is not responsible for other defects in heart or B cell development that were observed in miR-17∼92 cluster mutants. [score:4]
Since PTEN is a known target of miR-92a [10], one may speculate that a de-repression of PTEN during embryonic development may have contributed to the observed organ size reduction of miR-92a [−/−] mice. [score:4]
Here, we demonstrate that genetic deletion of miR-92a does not affect heart and lung development or B cell survival, but reflects the skeletal development defects observed in full cluster knock-outs. [score:4]
MiR-92a [−/−] mice, generated as described above, lack miR-92a expression in various tissues (Figure 1A/B, Figure S1A/B). [score:3]
Expression levels of miR-92a paralog miRNAs miR-25 (C) and miR-363 (D) in heart of WT and miR-92a [−/−] mice. [score:3]
These findings are in agreement with studies showing that pharmacological inhibition of miR-92a does not influence skeletal anabolic responses to mechanical loading [18]. [score:3]
Moreover, we did not observe effects of miR-92a inhibition on osteoblast or chondrocytes proliferation or apoptosis in vitro (data not shown). [score:3]
Moreover, pharmacological inhibition of miR-92a even promoted fracture healing [12]. [score:3]
Expression of miR-92a and other cluster members. [score:3]
This may be explained by the fact that miR-92a is profoundly induced in ischemic tissue and inhibition of miR-92a may preferentially block this response. [score:3]
One limitation of the present study, however, is that the deletion of miR-92a moderately affected the expression of miR-20a and miR-19b in heart and muscle tissue, and miR-18a was moderately but significantly reduced in skeletal tissue. [score:3]
A defect in vascular or heart development was further excluded by demonstrating that mice lacking miR-92a in endothelial cells or cardiomyocytes showed no embryonic or postnatal developmental defect (Figure S3G/H). [score:3]
MiR-92a [−/−] show growth and skeletal development defectClose examination of miR-92a [−/−] mice revealed that the body weight was reduced in miR-92a [−/−] mice during postnatal development and adulthood in both males and females (Figure 3A/B, Figure S5). [score:3]
The current study additionally documents that miR-92a regulates skeletal development. [score:3]
This is consistent with our previous findings showing that pharmacological miR-92a inhibition only increased angiogenesis after induction of ischemia, whereas no change of capillary density occurred in non-ischemic control tissue [11]. [score:3]
For the generation of constitutive miR-92a deficient mice (miR-92a [−/−]), the miR-92a recombined chimeric mice were bred with a deleter line constitutively expressing the Cre recombinase. [score:3]
Expression levels of the miR-17∼92 cluster members in lower leg muscles of the hind limbs (A) and femurs (B) of WT, miR-92a [+/−] and miR-92a [−/−] mice. [score:3]
However, the present study suggests that miR-92a predominantly contributes to developmental defects but seems not to interfere with bone metabolism. [score:2]
The lack of defects in the hematopoietic system is further supported by the findings that miR-92a [fl/fl]Vav-Cre mice lacking miR-92a in hematopoietic cells do not show any phenotype during embryonic or postnatal development (Figure S4I). [score:2]
As shown in Figure 3D, miR-92a [−/−] embryos showed a reduced weight at embryonic day E15.5 indicating that the growth retardation occurs during embryonic development. [score:2]
Close examination of miR-92a [−/−] mice revealed that the body weight was reduced in miR-92a [−/−] mice during postnatal development and adulthood in both males and females (Figure 3A/B, Figure S5). [score:2]
Representative pictures (E) and quantification (F) of the vascularization of the lower leg muscles of the hind limb of adult female WT and miR-92a [−/−] mice determined as ratio of laminin stained capillaries (white) and isolectin stained capillaries (green). [score:1]
At both time points, the number of miR-92a [−/−] mice reflected the expected Men delian ratio (Figure S2). [score:1]
Although miR-92a was shown to profoundly affect endothelial cell functions in vitro and in vivo [11], [13], we did not observe a change in capillary density in uninjured miR-92a [−/−] mice. [score:1]
Thus, miR-92a [−/−] mice were smaller than their littermates, showed reduced skull size and tibia length and exhibit the typical shortening of the 5 [th] mesophalanx bone as it has been reported for miR-17∼92 [Δ/+] mice [7]. [score:1]
miR-92a flox forw: AATGTGTGTCTTAGAGGCCTAGTAGTGAAGAGG. [score:1]
Moreover, in skeletal tissue only miR-18a was slightly reduced in miR-92a [−/−] mice. [score:1]
MiR-92a [−/−] show growth and skeletal development defect. [score:1]
Constitutive deletion of miR-92a in mice causes skeletal defects. [score:1]
However, none of the cell populations differed in WT versus miR-92a [−/−] mice (Figure 2). [score:1]
Observed as well as by Men delian ratios predicted percentage of E9.5 (A) and E15.5 (B) WT, miR-92a [+/−] and miR-92a [−/−] embryos derived from mating miR-92a [+/−] mice. [score:1]
miR-92a KO rev: AAGACATTAGTAACCCACCCCCATTCC. [score:1]
Observed as well as by Men delian ratios predicted percentage of miR-92a [fl/fl] and miR-92a [fl/fl]Tie2Cre [+/−] mice (endothelial cell and progenitor-specific miR-92a deletion) (G) and miR-92a [fl/fl]αMHC-Cre [+/−] mice (cardiomyocyte-specific miR-92a deletion) (H) derived from mating miR-92a [fl/fl] with either miR-92a [fl/fl]Tie2Cre [+/−] or miR-92a [fl/fl]αMHC-Cre [+/−] mice. [score:1]
miR-92a flox rev: CACCCCCATTCCTGAAAGCTTATAGC. [score:1]
To determine at which time point miR-92a [−/−] mice are dying, we harvested embryos at E9.5 and E15.5. [score:1]
Body weight of female juvenile (A) and adult (B) WT, miR-92a [+/−] and miR-92a [−/−] mice. [score:1]
However, the contribution of miR-92a for the observed defects in miR-17∼92 cluster deficient mice has not been elucidated. [score:1]
Bone density was not affected in adult miR-92a [−/−] mice, suggesting that deletion of miR-92a at least under baseline conditions does not significantly affect bone metabolism. [score:1]
Figure S2Proportion of miR-92a [−/−] embryos is in accordance with the expected Men delian ratio. [score:1]
Generation of constitutive and conditional miR-92a deficient mice. [score:1]
A SkyScan 1176 micro-CT system (RJL Micro & Analytic GmbH, Karlsdorf-Neuthard, Germany) was used to perform oversize scans of WT and miR-92a [−/−] mice with the following settings: 180°C scan; rotation step = 2.5 deg. [score:1]
All other cluster members and the paralog microRNAs miR-25 and miR-363 were not changed in miR-92a [−/−] mice (Figure S1C/D). [score:1]
However, the bone density was not different between miR-92a [−/−] mice and wild type littermates (Figure 4H). [score:1]
Indeed, recent studies confirmed that a genetic deletion of miR-92a in endothelial cells improves re-endothelialization after denudation [26]. [score:1]
Since miR-17∼92 cluster knock-out mice revealed defects in hematopoietic cell development, we characterized the hematopoietic phenotype of miR-92a [−/−] mice. [score:1]
Beside skeletal defects, miR-92a [−/−] mice revealed an overall reduction of organ sizes. [score:1]
However, the reduction of miR-19b and miR-20a in muscle tissue of miR-92a [−/−] mice was less than 50%. [score:1]
miR-92a KO forw: CTGTCCTGTTATTGAGCACTGGTCTATGG. [score:1]
MiR-92a [−/−] mice showed a moderate, but significant decrease in miR-19a, miR-19b, and miR-20a in the heart, whereas only miR-19b and miR-20a were significantly decreased in muscle and miR-18a was significantly reduced in skeletal tissue (Figure 1C, Figure S1A/B). [score:1]
Body weight of male juvenile (A) and adult (B) WT, miR-92a [+/−] and miR-92a [−/−] mice. [score:1]
Interestingly, the weight of all organs was significantly reduced in adult miR-92a [−/−] mice, however, no significant differences were observed if organ weight was normalized to total body weight suggesting that miR-92a [−/−] mice are overall simply smaller in size (Figure 3C (right panel)). [score:1]
MiR-92a [−/−] mice are viable and fertile, but a reduced Men delian ratio was observed suggesting that some mice die during embryonic or early neonatal development (Figure 1D). [score:1]
If chi-square test was statistically significant, following further analysis were performed: To test whether the number of observations in each group, say k among n trials, could still plausibly explained by the assumed probabilities, 95%-confidence intervals [p [1], p [2]] for binomial proportions have been calculated, using the Software R. The edges, defined by P [p1](X≥k) = 0.025 and P [p2](X≤k) = 0.025, are computable as quantiles for Beta distributions, according to Clopper-Pearson: p [1] = F [−1](0.025; k, n−k+1) and p [2] = F [−1](0.025; k+1, n−k); where F(q; a, b) denotes the distribution function for a Beta distribution with shape parameters a, b. MiR-92a [−/−] mice, generated as described above, lack miR-92a expression in various tissues (Figure 1A/B, Figure S1A/B). [score:1]
Figure S3Under basal conditions, miR-92a [−/−] mice do not show obvious defects of the cardiovascular system. [score:1]
In conclusion, the findings of the present study provide insights into the function of miR-92a. [score:1]
MiR-92a [−/−] mice have no hematopoietic defectsSince miR-17∼92 cluster knock-out mice revealed defects in hematopoietic cell development, we characterized the hematopoietic phenotype of miR-92a [−/−] mice. [score:1]
MiR-92a [−/−] mice showed a partial postnatal lethalityMiR-92a [−/−] mice are viable and fertile, but a reduced Men delian ratio was observed suggesting that some mice die during embryonic or early neonatal development (Figure 1D). [score:1]
[1 to 20 of 69 sentences]
5
[+] score: 167
Other miRNAs from this paper: mmu-mir-10b, mmu-mir-205, mmu-mir-122, mmu-mir-221, mmu-mir-92a-1
Fig. 1MiR–92a-3p expression in EC cell lines in comparison to normal endometrium (NE) tissues (n = 31); significant increase was observed in case of HEC-1-B (p = 0.013), Ishikawa (p = 0.008), AN3CA (p = 0.042) In order to assess LNA-i-miR-92a activity in studied cell lines and verify its potential to knock-down miR-92a-3p pLightSwitch_3′UTR reporter vector containing optimized target sequence complementary to the miR-92a-3p was co -transfected with either miR-92a-LNA -inhibitor or scramble control. [score:8]
Deregulation of miR-92a was observed in various malignant tumors and its aberrant expression was related to promotion of tumor proliferation, invasion and metastasis as well as inhibition of cancer cells apoptosis [7]. [score:6]
Aiming at evaluation of translational potential of miR-92a inhibition we chose Locked Nucleic Acid (LNA)–inhibitor to induce the knock–down of miR-92a. [score:6]
Significant inhibition of tumor growth as compared to LNA-i-miR-NC was observed after second injection of miR-92a-LNA -inhibitor and it was observed until the 12th experimental day (after six dosages of miR-92a-LNA -inhibitor) (Fig.   4a). [score:6]
LNA -modified-oligonucleotides used in the presented study to knock-down miR-92a inactivate their target microRNAs by forming stable complexes with the targets, which are then sequestered within the cell [10]. [score:6]
After treatment with miR-92a-LNA -inhibitor expression of miR-92a-3p was significantly decreased in liver (p < 0.0001), and kidneys (p < 0.0001), and close to significant decrease was noted in heart (p = 0.063). [score:5]
Extended observation of the animals after discontinuation of treatment revealed marked acceleration of tumor growth in LNA-i-miR-92a treated animals, suggesting that the inhibitory effect of LNA-i-miR-92a needs to be sustained by regular administration of the inhibitor. [score:5]
Fig. 5Histological changes encountered after treatment with miR-92a-LNA -inhibitor in mice liver; a PBS group - liver architecture within normal limits; b LNA-i-miR-NC group - liver architecture within normal limits; c LNA-i-miR-92a group - intralobular necrosis of hepatocytes with scattered mononuclear inflammatory cells and signs of hepatocytes regeneration with binucleated cells present; slides stained with H + E × 400 Expression of miR–92a was significantly increased in HEC-1-B (p = 0.013), Ishikawa (p = 0.008) and AN3CA (p = 0.042) cells in comparison to normal endometrial samples (Fig.   1). [score:5]
Inhibition of miR-92a activity was obtained in endometrial cancer cell lines by a transient transfection of a custom designed Locked Nucleic Acid (LNA)-Inhibitor, developed to work both in vitro and in vivo. [score:5]
Taken together, these results indicate that intraperitoneal delivery of miR-92a-LNA -modified -inhibitor is feasible, devoid of significant toxicity and moderately inhibits endometrial cancer growth in vivo, and therefore warrants further studies investigating other routes of inhibitor delivery possibly in other animal mo dels. [score:5]
It was also demonstrated that systemic administration of LNA-i-miR-92a was feasible and exerted inhibitory effect on endometrial cancer xenograft growth in vivo with only mild toxic effects in treated animals, however the effect was observed until 12 [th] experimental day and the last three dosages did not maintain the attenuating effect with the acceleration of tumor growth observed at the end and after cessation of the intraperitoneal therapy. [score:3]
Based on our previous studies we speculated that miR-92a exhibited pro-oncogenic properties in endometrial cancer, and therefore its inhibition could be used as a therapeutic measure in this disease. [score:3]
Based on those results we hypothesized that miR-92a exhibited pro-oncogenic properties in EC, and it could be a targeted in a gene–specific therapy. [score:3]
Effects of intraperitoneal administration of miR-92a-LNA -inhibitor were observed in experimental animals for 32 days. [score:3]
miR-92a-3p-LNA -inhibitor (LNA-i-miR-92a) and scramble control (LNA-i-miR-NC) had full phosphorothioate (PS) backbones, were designed and purchased from Exiqon (Vedbaek, Denmark). [score:3]
Complete blood counts were performed at the end of the experiment and no significant differences were observed in miR-92a-LNA -inhibitor treated animals in comparison to PBS or scramble control. [score:3]
Toxicity assessment of systemic administration of miR-92a-LNA -inhibitor. [score:3]
revealed increased expression of miR-92a in HEC-1-B, Ishikawa and AN3CA cells. [score:3]
The biological effect following transfection of miR-92a-LNA -inhibitor was confirmed in studied cell lines and efficient transfection conditions were verified by increased luciferase activity. [score:3]
Fig. 5Histological changes encountered after treatment with miR-92a-LNA -inhibitor in mice liver; a PBS group - liver architecture within normal limits; b LNA-i-miR-NC group - liver architecture within normal limits; c LNA-i-miR-92a group - intralobular necrosis of hepatocytes with scattered mononuclear inflammatory cells and signs of hepatocytes regeneration with binucleated cells present; slides stained with H + E × 400 MiR-92a belongs to a highly conserved family, which arises from three paralog clusters miR-17-92, miR-106a-363, and miR-106b-25. [score:3]
We suspect that such phenomenon could result from a rebound effect of increased miR-92a synthesis after the period of decreased availability during inhibitor treatment. [score:3]
miR-92a LNA -inhibitor Endometrial cancer Mice xenograft Proliferation In vivo Endometrial cancer (EC) is a common and histologically heterogeneous malignancy and although several molecular pathways were connected with its molecular basis the pathogenesis of this malignancy has not been fully elucidated [1]. [score:3]
The microscopic examination of the liver samples from three miR-92a-LNA -inhibitor treated animals revealed changes in comparison to PBS and scramble control. [score:3]
In conclusion, our study showed that LNA-i-miR-92a was a potent inhibitor of EC growth in vitro. [score:3]
In vivo effects of systemic administration of miR-92a-LNA -inhibitor. [score:3]
Functional impact of miR-92a-LNA -inhibitor within studied cell lines. [score:3]
Fig. 4In vivo effects of systemic administration of miR-92a-LNA -inhibitor. [score:3]
Conversely, increase of miR-92a-3p expression was found in tumor tissues (p = 0.014). [score:3]
Taken together, these results indicate that systemic delivery of miR-92a-LNA -modified -inhibitor could be a promising treatment strategy for endometrial cancer and warrants further studies investigating other routes of inhibitor delivery, possibly in other animal mo dels. [score:3]
It also demonstrated that systemic administration of LNA-i-miR-92a was feasible and exerted moderate inhibitory effect on endometrial cancer xenograft growth in vivo with minimal toxic effects in treated animals. [score:3]
LNA-i-miR-92a inhibited endometrial cancer growth in vitro. [score:3]
The miR-92a-LNA -inhibitor used in the presented study was custom designed to work both in vitro and in vivo with the similar efficiency. [score:3]
Based on the in vitro results we speculated that systemic delivery of LNA-i-miR-92a could inhibit EC xenograft tumor growth in vivo. [score:3]
That observation was recently supported by the deep sequencing study of Lu et al., who found that miR-92a expression differed between Ishikawa and HEC-1-B lines, being increased in the latter. [score:3]
miR-92a-LNA -inhibitor and scramble control. [score:3]
Biological effect of miR-92a knock-down was inspected by proliferation studies, using, which allowed monitoring of time-resolved changes in EC proliferation. [score:2]
MiR-92a-LNA -inhibitor and scramble control were administered intraperitoneally in the dose of 25 mg/kg three times per week. [score:2]
MiR-92a inhibits proliferation of EC cells in vitro. [score:2]
Soon after transfection the proliferation rate of Ishikawa cells treated with LNA-i-miR-92a was lower when compared to LNA-i-miR-NC, however scramble control seemed to have more inhibitive effect during subsequent time points. [score:2]
LNA-i-miR-92a inhibited proliferation of HEC-1-B and KLE cell lines as compared to LNA-i-miR-NC, and the effect occurred earlier in KLE cells. [score:2]
Increased expression of miR-92a in EC cell lines, as compared to healthy endometrial tissues was observed, what confirmed our previous results in human tissues [3]. [score:2]
MiR-92a, a member of miR-17-92 cluster, was reported deregulated in several cancers being most commonly linked with gastrointestinal malignancies and with colorectal carcinoma in particular [6, 7]. [score:2]
MiR-92a-3p expression in mice tissues. [score:2]
The proliferation rate of Ishikawa cells treated with LNA-i-miR-92a was lower, when compared to LNA-i-miR-NC at 12 h., however scramble control seemed to have more inhibitive effect during subsequent time points. [score:2]
2011.305 22116552 9. Ren P, Gong F, Zhang Y, Jiang J, Zhang H. MicroRNA-92a promotes growth, metastasis, and chemoresistance in non-small cell lung cancer cells by targeting PTEN. [score:2]
The difference was statistically significant p-value = 0.023 To assess anti-proliferative activity induced by LNA-i-miR-92a, we transfected HEC-1-B, Ishikawa and KLE cells and monitored cells proliferation for 72 h using xCELLigence technology. [score:1]
Therefore in the present study we aimed to investigate both in vitro and in vivo if inhibition of miR-92a in endometrial cancer would limit cancer cells proliferation. [score:1]
After intraperitoneal injection of 25 mg/kg LNA-i-miR-92a three times per week a significant decrease in tumor growth was observed until the 12 [th] experimental day. [score:1]
To our knowledge this is the first report to investigate in vitro and in vivo effects of miR-92a inhibition in EC. [score:1]
Mature miR-92a can arise from an intronic miR-92a-1 located at chromosome 13q31-q32 and from miR-92a-2 encoded on chromosome Xq26.2. [score:1]
The systemic effects of miR-92a-LNA -inhibitor could be reliably evaluated in vivo, as sequences of human and murine miR-92a-3p are identical. [score:1]
Fig. 2Specificity of LNA-i-miR-92a activity in HEC-1-B cells. [score:1]
Consistent with the final tumors measurements were miR-92a expression studies in mice tissues, which revealed its significantly higher levels in the tumor tissues from LNA-i-miR-92a treated animals. [score:1]
11–15 LNA-i-miR-92a treated mice. [score:1]
Therefore in this study we aimed to investigate both in vitro and in vivo if inhibition of miR-92a in EC would limit cancer cells proliferation. [score:1]
Tumors retrieved from the animals at the end of the experiment were presented in the Additional file 2. At the end of the experiment miR-92a-3p expression was measured in tumors and as well as in vital organs. [score:1]
Measurements of organs retrieved from animals revealed significant increase of spleen and lungs in miR-92a-LNA -inhibitor group in comparison to PBS and scramble control. [score:1]
a Subsequent measurements of tumor volume showed significant differences between miR-92a-LNA -inhibitor, scramble control (LNA-i-miR-NC) and not treated animals (PBS), * vs. [score:1]
LNA-i-miR-92a was custom designed to work effectively in human cells in vitro and in mice xenograft of human EC and had a following sequence: CGGGACAAGTGCAAT. [score:1]
miR-92a expression was evaluated in four endometrial cancer cell lines using. [score:1]
[1 to 20 of 60 sentences]
6
[+] score: 86
Other miRNAs from this paper: mmu-mir-92a-1, mmu-mir-92b
While for Itga5 only during the early healing response an upregulation is detected (Fig. 3e,f), Sirt1 expression is significantly induced upon effective miR-92a inhibition at days 6 and 11 post injury, generally highlighting the functional inhibition of miR-92a upon caged antimiR-92a treatment following light activation (Fig. 3g,h). [score:10]
In line, a strong upregulation of Sirt1 upon miR-92a inhibition in the epithelium covering the wound area is observed (Fig. 3h), probably leading to the thick and hyperproliferative epithelium in miR-92a -inhibited wounds and thereby promoting an accelerated healing response (Fig. 2). [score:8]
A caged control antimiR with no target-specific sequences, which is used as negative control, does not inhibit miR-92a expression neither in the presence nor absence of light (Fig. 1a). [score:7]
These analysis revealed that miR-92a is strongly upregulated in chronic wounds in comparison to acute wounds, indicating that miR-92a may represent a therapeutic target to rescue impaired chronic wound healing (Fig. 2a). [score:6]
In line, we observe an upregulation of Itga5 during the early wound-healing phase in miR-92a -inhibited wounds probably mediating an improved keratinocyte migration and finally forcing the observed improved wound-closure kinetics at day 6 post injury (Fig. 3e,f). [score:6]
Efficient miR-92a downregulation in the skin upon treatment with caged antimiR-92a. [score:4]
In comparison to the samples treated with non-irradiated caged antimiR-92a, miR-92a levels are significantly downregulated upon light induction (Fig. 1a). [score:4]
Light-activated caged antimiR-92a therapy leads to a marked downregulation of miR-92a levels whereas no effect is seen in control groups (Supplementary Fig. 4). [score:4]
14) and Sirt1 (refs 24, 25) that might explain the healing-supportive effects of miR-92a inhibition, both proteins are also shown to control re-epithelialization. [score:3]
Quantification of positive stained cells unveils that upon inhibition of miR-92a proliferation is improved within the epithelial and the dermal compartment at day 6 post injury (Fig. 3c,d). [score:3]
However, for both, we excluded an influence of miR-92a inhibition estimated by staining for the myofibroblast marker α-smooth muscle actin (αSMA; Supplementary Fig. 7a,b) and the pan inflammatory cell marker CD45 (Supplementary Fig. 7c,d). [score:3]
miR-92a inhibition improves wound healing in diabetic mice. [score:3]
Together, we find that antimiR-92a -treated wounds reveal faster healing kinetics based on a stronger angiogenic response and increased wound cell proliferation mediated by the derepression of the miR-92a targets Itga5 and Sirt1. [score:3]
Inhibiting miR-92a by light-activatable antimiRs may harbour great therapeutic potential to treat chronic skin repair in healing impaired diabetic patients avoiding unwanted adverse effects in other tissues that might be expected by systemic delivery. [score:3]
However, given the low potential of cytotoxicity of systemic miR-92a treatment, our study can be rather seen as ‘poof-of-concept' experiment paving the way to testing cytotoxic antimiRs for treating malignant diseases or antimiRs that could be valuable for inducting regeneration, which often have the risk for promoting tumor growth. [score:3]
The second miR-92a target Sirt1 was shown to promote corneal epithelialization 26 and improved keratinocyte proliferation during skin repair 27. [score:3]
Inducible miR-92a inhibition increases angiogenesis and proliferation. [score:3]
To study skin repair with or without functional miR-92a in diabetic mice, 13-week-old mice were wounded by using 6 mm punch biopsies and wounds were treated with caged antimiRs (2 μg diluted in 25 μl PBS) at days 0, 4 and 7. Knockdown efficiency was quantified via qPCR 6 and 11 days post injury. [score:2]
The efficiency of miR-92a inhibition by light -induced caged antimiRs is similar as compared to conventional constitutively active antimiRs, which are used as positive control (Fig. 1a). [score:2]
qPCR analysis for miR-92a levels in the skin (b), liver (c) and kidney (d) upon i. d. injection of different antimiRs as indicated±light activation in vivo. [score:1]
After irradiation for 10 min (385 nm, 300 mA) and subsequent cultivation for 48 h, levels of miR-92a were analysed by quantitative real-time PCR. [score:1]
Additionally, we synthesized a non-caged antimiR-92a as a positive control and a caged antimiR as a negative control that does not affect miR-92a levels (Supplementary Fig. 2). [score:1]
Although almost all wounds are closed at day 11 postwounding, miR-92a inhibitor -treated wounds reveal faster wound closure kinetics, estimated by a shorter distance between epithelial tips measured at day 6 postwounding (Fig. 2d). [score:1]
Finally, wound contraction, estimated by measuring the distance between the edges of the panniculus carnosus, are significantly stronger upon miR-92a inhibition at day 11 post injury (Fig. 2f), indicating that caged antimiR-92a harbour great therapeutic potential to improve wound healing in diabetic mice. [score:1]
The in vivo activation of caged antimiR-92a leads to a significant reduction of miR-92a levels in the murine skin with an efficiency that is comparable to constitutively active antimiR-92a, while the controls have no effects (Fig. 1b). [score:1]
[1 to 20 of 25 sentences]
7
[+] score: 82
Considering the signaling pathway which induces the miRNA transcription directly upon LPS stimulation and suitable number of miRNA targets for biomarkers, expression of miRNAs in whole blood following LPS injection was quantified using real-time RT-PCR to verify selected up-regulated, but not down-regulated, miRNA targets with at least 4-fold increase in expression (let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107, and miR-451). [score:16]
Upregulated expression of the miRNA targets (let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107 and miR-451) following LPS injection on real-time RT-PCR was dose- and time -dependent. [score:8]
With a dose- and time -dependentupregulated expression of the miRNA targets (let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107 and miR-451) following LPS injection, these whole blood-derived miRNAs are promising as biomarkers for LPS exposure. [score:8]
Overexpression of miR-92a decreased the expression of the transcription factor Krüppel-like factor 2 (KLF2), which is crucial for maintaining endothelial function, and the KLF2-regulated endothelial nitric oxide synthase and thrombomodulin [31]. [score:6]
Expression of representative up-regulated miRNAs (let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107, and miR-451) identified using miRNA microarray of whole blood using real-time RT-PCR. [score:6]
In TLR4 receptor knockout mice, significantly lower expression of let-7d, miR-25, miR-92a, miR-103 and miR-107 was observed following LPS treatment (Figure 4). [score:4]
Additionally, following exposure to LPS, expression of only 5 miRNAs (let-7d, miR-25, miR-92a, miR-103, and miR-107) was significantly lower in TLR4 receptor knockout mice. [score:4]
Figure 4 Expression of let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107, and miR-451 of whole blood from C57BL/6 and Tlr4 [−/−] (C57BL/10ScNJ) mice from real-time RT-PCR experiments 6 h after exposure to 100 μg LPS; **, P  < 0.01 vs. [score:3]
At 24 h, only miR-25 and miR-92a continued to be significantly expressed in the blood. [score:3]
Figure 3 Expression of let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107, and miR-451 from whole blood of C57BL/6 mice based on real-time RT-PCR experiments 6 h after exposure to 100 μg LPS originating from different bacteria, including Escherichia coli serotype 026:B6, Klebsiella pneumonia, Pseudomonas aeruginosa, Salmonella enterica, serotype Enteritidis, and Serratia marcescens. [score:3]
To investigate the role of the TLR4 receptor in inducing expression of the miRNA targets, expression of let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107, and miR-451 in the whole blood of Tlr4 [−/−] mice 6 h after intraperitoneal injection of 100 μg LPS (L3755) was measured against that from the whole blood of Tlr4 [−/−] mice injected with PBS. [score:3]
In a maternal and fetal liver of hepatitis B virus (HBV) transgenic mouse mo del, expression of miR-92a increased by more than 6-fold in the fetal livers and implicated in HBV intrauterine infection [32]. [score:3]
Additionally, significantly lower expression levels of let-7d, miR-25, miR-92a, miR-103, and miR-107 were observed in whole blood of Tlr4 [−/−] mice. [score:3]
Figure 5 Expression of let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107, and miR-451 of whole blood from C57BL/6 mice using real-time RT-PCR experiment 6 h after exposure to 10, 100, and 1000 μg LTA originating from Staphylococcus aureus ; *, P  < 0.05 vs. [score:3]
In contrast, upon 100 ug and 1000 ug of LPS injection, all these 8 miRNAs (let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107, and miR-451) had a significant expression than the control (Figure 2A). [score:3]
In this study, we demonstrated that expression of multiple miRNAs (let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107, and miR-451) is significantly altered in the whole blood of mice after exposure to LPS in a dose- and time -dependent fashion. [score:3]
MiR-92a appears to target mRNAs corresponding to several proangiogenic proteins and controls angiogenesis and functional recovery of ischemic tissues [31]. [score:2]
To investigate that whether lipoteichoic acid (LTA) originating from gram -positive bacteria induces expression of let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107, and miR-451, whole blood was drawn at 6 h following intraperitoneal injections of 10, 100, or 1000 μg LTA from S. aureus for real-time PCR. [score:1]
[1 to 20 of 18 sentences]
8
[+] score: 80
org) for target gene prediction, EZH2 was identified as one of the potential targets of miR-92a. [score:5]
Bioinformatics software TargetScan found that EZH2 was one of the potential targets of miR-92a. [score:5]
Through TargetScan, a bioinformatics prediction program that can identify hypothetical mRNA -binding-specific miRNA, we identified EZH2 as a potential target of miR-92a. [score:5]
In vitro experiments showed that exogenous miR-92a affected EZH2 expression both at the transcriptional and translational levels. [score:5]
Moreover, the results from the western blot analysis and 3’UTR of the EZH2 luciferase assay confirmed that miR-92a might suppress EZH2 expression by binding to the 3’UTR of EZH2 mRNA. [score:4]
3’-UTR of EZH2 transcript is a direct target for miR-92a. [score:4]
Fang et al. demonstrated that endothelial miRNAs, namely miR-92a are differentially expressed between athero-susceptible aortic arch and nearby athero-protected descending thoracic aorta in normal swine [9]. [score:3]
We tested the mRNA expression of miR-92a by qRT-PCR. [score:3]
A control reporter plasmid with a mutation of 6 nucleotides corresponding to miR-92a seed sequence (ACGUUAU) was constructed by site-directed mutagenesis. [score:3]
The expression of miR-92a in the HHcy+FA+VB group was higher than the HHcy group (Fig 5A). [score:3]
miR-92a was involved in the atherosclerosis process and targeted the 3’-UTR of EZH2. [score:3]
Treatment of the foam cells with folate and Vitamin B12 for 48 h induced the expression of miR-92a (Fig 5B). [score:3]
miR-92a is a member of miR-17-92 cluster located on chromosome 13q31.3, and is reduced profoundly in stable coronary artery disease. [score:3]
0167744.g005 Fig 5(A, B) Total RNA was isolated from the artery of mice and macrophage foam cells, and miR-92a expression was assessed by qRT-PCR. [score:3]
To further confirm the direct interaction of miR-92a with EZH2, we first transfected LV-miR-92a and Lv-miR92a-siRNA into the foam cells, and evaluated EZH2 mRNA and protein expression. [score:2]
Increased levels of H3K27me3 were accompanied by alterations in the corresponding histone methyltransferase EZH2, which was regulated by miR-92a. [score:2]
Based on these findings, we hypothesize that miR-92a directly interacted with the 3’-UTR of EZH2 in foam cells. [score:2]
The miR-92a binding site within the EZH2 3’UTR was mutated using PCR -based site-directed mutagenesis. [score:2]
As shown in Fig 5C, the relative expression levels of miR-92a in Lv-miR-92a group increased significantly compared with the control group. [score:2]
Site-specific microRNA-92a regulation of Kruppel-like factors 4 and 2 in atherosusceptible endothelium. [score:2]
The data suggest that miR-92a may be involved in the development of HHcy. [score:2]
As expected, Lv-miR-92a significantly reduced both EZH2 mRNA and protein levels, whereas Lv-miR92a-siRNA accelerated the production of EZH2 mRNA and protein (P < 0.05, Fig 5E and 5F). [score:1]
Design the antagonism of miR-92a and cloned the sequences into lentiviral vector (LV-miR-92a-antago). [score:1]
Vector construction of Lv-miR-92a. [score:1]
Moreover, luciferase reporter assay further proved that miR-92a directly interacted with the 3’-UTR of EZH2 in foam cells. [score:1]
The results showed that there were no significant differences in the levels of miR-92a between the control and HLP groups. [score:1]
However, there was a significant reduction in the level of miR-92a in Lv-miR92a-siRNA group. [score:1]
Fig 5D illustrates the predicted binding site of miR-92a with EZH2 3’UTR. [score:1]
Genomic DNA extracted from THP-1 cells was used as a template to amplify a fragment of the 3’-UTR of EZH2, which contains the putative miR-92a -binding sequence. [score:1]
miR-92a pri-miR sequences were amplified and the amplified PCR product was cloned into hU6-MCS-PGK-EGFP vector (LV-miR-92a)(Hanbio, Shanghai, China). [score:1]
Consistent with the results from the animal experiments, exposure of foam cells to Hcy resulted in decreased miR-92a levels (Fig 5B). [score:1]
These findings help us understand the molecular mechanisms in Hcy -induced atherosclerosis, and also give us a strong rationale to further investigate miR-92a and EZH2 as potential diagnostic or therapeutic targets for atherosclerosis. [score:1]
Liu and colleagues found that miR-92a was positively related to high-density lipoprotein cholesterol, but negatively related to lipoprotein-a. In our results, miR-92a levels were significantly decreased in ApoE-/- mice fed a high methionine diet as well as in Hcy treated foam cells, suggesting that miR-92a was involved in Hcy induced atherosclerosis. [score:1]
LV-miR-92a and LV-miR-92a-antago were transfected into THP-1 cells to screen stable cell lines by puromycin. [score:1]
Mutant-type pMIR vector was inserted with mutated seed sequence (from TGCAATA to GTAATAC) for miR-92a. [score:1]
[1 to 20 of 35 sentences]
9
[+] score: 56
Although miR-92a and miR-133a expression levels showed considerable inter-individual variation in cohort 1, their expression was not different between males and females and was not related to any other parameter such as age, or BMI. [score:5]
Quantitative real-time PCR (qPCR) revealed that miR-34c* and miR-92a were significantly up- and downregulated, respectively, in the exosomes from cAMP -treated brown adipocytes and from serum of mice with active BAT (Fig. 2b,c). [score:4]
The miR-17-92 (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a) cluster was previously described to be regulated by cell cycle via E2F3 binding and by a negative feedback loop through miR-17 that targets E2F2 (ref. [score:4]
Cold-exposure induced a significant downregulation of exosomal miR-92a in BAT (to 6% of the control) and WATi (to 18%), but not in exosomes derived from other tissues (Fig. 2d). [score:4]
Comparison of the abundance of these miRNAs in exosomes and in brown adipocytes revealed that miR-92a and miR-34c* were differentially expressed after cAMP treatment in the exosomes but not in BA (Supplementary Fig. 2a,b). [score:3]
Human serum miR-92a and miR-133a expression levels were not normally distributed in cohort 1 according to Shapiro–Wilk test (P=0.000 and P=0.001, respectively). [score:3]
First in vivo investigations associate genetic knockout and pharmacological inhibition of miR-92a with a HFD-resistant, more healthy phenotype in mice 63. [score:2]
The correlation analysis of Log [10] miR-92a as a dependent variable, and age, sex, BMI, fat mass and glucose uptake rate as independent variables identified glucose uptake rate as only significant predictor of Log [10] miR-92a (Supplementary Table 7). [score:1]
The exosomal samples used for qPCR and ELISA were adjusted to 1.65 mg and 16.5 mg tissue, respectively, to compare exosome/miR-92a release from various tissues. [score:1]
Similar to cohort 1, we observed a correlation between Log [10] miR-92a and BAT activity (glucose uptake rate) (Pearson's correlation, R [2]=0.40, P=0.004, n=19) (Fig. 3h). [score:1]
Whitening of BAT was accompanied with an increased release of miR-92a from BAT (2.75±0.65-fold) and increased exosomal miR-92a levels in serum (2.66±0.19-fold) (Supplementary Fig. 2h). [score:1]
Furthermore, to rule out that single axis logarithmic transformation resulted in such linear correlations, we performed similar analysis for the Log [10] BAT SUVmean−Log [10] miR92a (Pearson's correlation, R [2]=0.18, P<0.05, n=22), as well as the Log [10] BAT SUVmax−Log [10] miR92a (Pearson's correlation, R [2]=0.25, P<0.05, n=22), which resulted in similar correlations (Supplementary Fig. 3c,d, respectively). [score:1]
One individual participating in the cold acclimation study showed a large decrease in miR-92a after cold-exposure along with high increase in BAT activity (ΔBAT SUVmean=1.59, Supplementary Table 3). [score:1]
Interestingly, miR-92a abundance tended to be lower after this cold acclimation period (19.5±12.9 versus 13.6±12.7) and the change in miR-92a levels tended to be negatively related to changes in BAT activity (Pearson's correlation, R [2]=0.29, P=0.11, Fig. 3f) on this cold acclimation period. [score:1]
In total, 22 blood samples were withdrawn at thermoneutrality (Fig. 3b–e) and 15 after mild cold activation for 1–1.5 h (Supplementary Fig. 3e) were used to access exosomal miR-92a levels (Supplementary Tables 3 and 4). [score:1]
Exosomal miR-92a in serum reflects brown fat activity. [score:1]
The highest abundance of miR-92a per exosome was released by WATi followed by WATg, BAT, liver brain and muscle (Fig. 2d). [score:1]
Levels of miR-92a in exosomes released from cAMP-stimulated brown adipocytes were reduced after 4 h and a significant reduction was observed after 24 h (Supplementary Fig. 2c). [score:1]
For the analysis of human exosomal miRNAs, we focused on miR-92a and miR-133a, whereas miR-34c* was not detectable in human serum exosomes. [score:1]
To identify the source of miR-92a in mice, we quantified the amount of miR-92a in exosomes isolated from BAT, WATi, WATg, skeletal muscle, liver and brain. [score:1]
In both cases, we observed a significant correlation between these values and the Log [10] miR-92a value (SUVmax: Pearson's correlation, R [2]=0.28, P=0.011, glucose uptake rate: Pearson's correlation, R [2]=0.26, P=0.016, n=22), (Fig. 3d,e, respectively). [score:1]
In this regard, the relation between exosomal miR-92a abundance in human blood samples and cold -induced BAT activity is highly promising. [score:1]
miR-92a was detectable in all tested samples (Fig. 2d). [score:1]
In addition, individual univariate analyses showed no relations between other parameters and Log [10] miR-92a. [score:1]
Yet, we are the first to relate exosomal miR-92a serum levels with BAT activity in humans. [score:1]
In mice, the increase in BAT mass on prolonged cold-exposure significantly correlated with the reduction of miR-92a abundance in serum (Supplementary Fig. 2d,e). [score:1]
Although miR-92 has been shown to impair angiogenesis 58 and to promote atherosclerosis 59 60, ablation of this miRNA in mice resulted only in bone defects 61. [score:1]
In addition, when considering the group as a whole, we observed a significant negative correlation between Log [10] miR-92a and the BAT SUVmean value (Fig. 3c). [score:1]
In a stepwise multivariable linear regression analysis with Log [10] miR-92a as a dependent variable, and age, sex, BMI, fat mass and BAT SUVmean, SUVmax and glucose uptake rate as independent variables, all three BAT parameters were significant predictors of Log [10] miR-92a (Supplementary Table 6). [score:1]
How to cite this article: Chen, Y. et al. Exosomal microRNA miR-92a concentration in serum reflects human brown fat activity. [score:1]
000430, Life Technologies) was used to quantify miR-92a located on chromosome 14: 115044427-115044506 [+] with the following sequence: 3′- UAUUGCACUUGUCCCGGCCUG -5′. [score:1]
Moreover, we studied miR-92a release in murine obesity. [score:1]
Serum Log [10] miR-92a levels of these acute cold-exposed subjects also tended to inversely correlate with BAT SUVmean (Pearson's correlation, R [2]=0.21, P=0.08, n=15, Supplementary Fig. 3e). [score:1]
Moreover, we analysed miR-92a levels in serum exosomes in subjects (in 15 out of the 22 subjects blood samples were available; Supplementary Tables 3 and 4) that were acutely exposed to cold (ca. [score:1]
In addition, the regression equation obtained in Fig. 3d correctly predicted whether subjects would either show a large increase (>change in median SUVmean [+0.43]) or a small increase/decrease (< change in median SUVmean) in BAT activity on cold acclimation, based on changes in miR-92a (Supplementary Table 3). [score:1]
Therefore, we focused in the current study on miR-92a. [score:1]
The obtained correlation equation is: BAT SUVmean (predicted)=−0.8749 × Log [10] miR-92a+3.5227, (Pearson's correlation, R [2]=0.26, P=0.015, n=22). [score:1]
Interestingly, two patients in this cohort did not show BAT activity (BAT SUVmean was 0.37 or 0.45 in these subjects, respectively) along with high serum level of miR-92a (Fig. 3f, Supplementary Tables 3 and 4). [score:1]
[1 to 20 of 38 sentences]
10
[+] score: 53
Oscillatory flow also induces the expression of miR-92a in human cells, while atheroprotective laminar flow down-regulates its expression (Wu et al., 2011). [score:8]
Such approaches have been used to inhibit miR-92a expression to promote functional recovery following ischemia/reperfusion injury in large animal (i. e., porcine) studies (Hinkel et al., 2013) or to inhibit atherogenesis in mouse mo dels (Loyer et al., 2014). [score:7]
In contrast, oscillatory flow induces - while laminar flow suppresses - the expression of miR-92a, which targets KLF2 and KLF4, leading to increased inflammation. [score:7]
Other microRNAs, such as miR-10a (Fang et al., 2010) and miR-92a (Wu et al., 2011; Fang and Davies, 2012; Loyer et al., 2014), are regulated by laminar flow, a potent inhibitor of EC inflammatory pathways. [score:4]
Using miR-92a inhibitors, they observed an increase in KLF2 and KLF4 levels as well as a decrease in total and phosphorylated p65 in the aortas of atherosclerotic mice, which was accompanied by diminished atherosclerotic plaque formation (Loyer et al., 2014). [score:3]
Interestingly, KLF2 and KLF4 have been shown to be miR-92a target genes (Wu et al., 2011; Fang and Davies, 2012). [score:3]
Inhibition of microRNA-92a prevents endothelial dysfunction and atherosclerosis in mice. [score:3]
Loyer et al. (2014) found that endothelial miR-92a expression is induced by a combination of low shear stress and oxidized LDL, two key factors that drive EC activation, and they observed that miR-92a levels are enhanced during atherogenesis in mouse mo dels. [score:3]
Inhibition of microRNA-92a protects against ischemia reperfusion injury in a large-animal mo del. [score:3]
Collectively, these studies underscore the pro-inflammatory and pro-atherogenic function of miR-92a in the endothelium, and link this microRNA with regulation of flow -dependent transcriptional programs. [score:2]
MiR-10a AND miR-92a CONTRIBUTE TO THE REGULATION OF NF-κB IN RESPONSE TO BLOOD FLOW. [score:2]
Flow -dependent regulation of kruppel-like factor 2 is mediated by microRNA-92a. [score:2]
Site-specific microRNA-92a regulation of Kruppel-like factors 4 and 2 in atherosusceptible endothelium. [score:2]
Furthermore, a role for miR-92a -dependent regulation of KLF2/KLF4 in the pathogenesis of atherosclerosis was recently demonstrated. [score:2]
Thus, miR-92a appears to enhance NF-κB signaling at two levels: by repressing KLF2/KLF4, antagonists of NF-κB -dependent transcription, and by promoting the activation of p65. [score:1]
MiR-155 has been intensely studied for its role in controlling inflammation, but in contrast to miR-146a, miR-10a, miR-92a, and miR-181b, which appear to have predominantly pro- or anti-inflammatory roles, studies on miR-155 have often revealed conflicting roles for this microRNA. [score:1]
[1 to 20 of 16 sentences]
11
[+] score: 34
It was also of interest that the expression of several miR-92 cluster members (17, 18a, 19a, 20a, 20b and 106a) was inversely correlated with TIMP2 expression in a panel of primary neuroblastoma tumors, and that low expression of TIMP2 in tumors is associated with poor overall and event free patient survival (Figure S9). [score:7]
Overall, members of the miR-92 clusters mapping to chromosome 13 and X had significantly lower expression in the miR-34a treated tumors relative to negative control, presumably due to the substantial decrease in MYCN levels resulting from miR-34a targeting (Figure 6D and E). [score:5]
Treatment of these cells with doxycycline repressed both MYCN expression (∼50 fold; Figure 6F) and the expression of miR-92 cluster members (5 to 10 fold; Figure 6G), resulting in an approximate 4 fold increase in TIMP2 mRNA (Figure 6F). [score:5]
Co-transfection of this construct with miR-20b mimics into NB1691 cells significantly reduced luciferase activity relative to a negative control oligonucleotide (Figure 6H), while mutation of the seed site abrogated the effect of miR-20b on luciferase activity, thus we conclude that miR-20b, and potentially other miR-92 family members directly target TIMP2. [score:5]
Intriguingly, several members of the oncogenic miR-92 polycistronic clusters mapping to chromosomes 13 and X, which are positively regulated by MYCN binding to their promoter regions [55], [56], are computationally predicted to target the TIMP2 3′ UTR (Figure 6C). [score:4]
In order to confirm that TIMP2 was a direct target of miR-92 cluster members, a segment of the TIMP2 3′ UTR containing the miR-20b, miR-17-5p, miR-106a and miR-20a seed site (all the same sequence, Figure 6C) was cloned into a luciferase reporter plasmid. [score:4]
In order to experimentally confirm that MYCN was repressing TIMP2 through the up-regulation of miR-92 cluster members, we used the well characterized SHEP-TET21N cell line containing a repressible MYCN transgene to determine if TIMP2 levels increased when MYCN levels were repressed. [score:2]
As demonstrated in this report, the decline in MYCN corresponded with a decrease in the levels of miR-92 polycistronic cluster members in NB1691 tumors, which are positively regulated by this transcription factor. [score:2]
[1 to 20 of 8 sentences]
12
[+] score: 22
Evidently, TA-p73/p63 appears to increase E-cadherin expression (a negative regulator of EMT), by suppressing ZEB1/2 through its target miRs, such as miR-192, miR-215, miR-145, miR-203, miR-200b, miR-200c, miR-183, miR-92a/b, miR-132, and miR-30a-e [45]. [score:8]
p53 expression is inhibited by miR-125b [2], while p63 is inhibited by miR-302, miR-21, and miR-92 [3], [4], [5]. [score:7]
MiRNAs have been shown to inhibit the expression of the tumor suppressor p53 (miR-125a/b) and p63 (miR-92, miR-21, 302 and miR-203) [Table 3], indicating that Dicer function may be required to generate mature miRNAs. [score:7]
[1 to 20 of 3 sentences]
13
[+] score: 22
To validate this correlation, we transfected five EVs miRNAs (miR-27b-3p, miR-10a-5p, miR-21-5p, miR-181a-5p and miR92a-3p) in UCB-CD34+ cells (Figure 3B) confirming the down-regulation of their predicted target genes (miR-27b-3p/MPL and ZFP36, miR-10a-5p/MPL, miR-21-5p/ANXA1, miR-181a-5p/CEBPA and EGR2, miR92a-3p/ CEBPA and EGR2) (Figure 3C). [score:6]
Interestingly, we found a correlation between BM-MSC-EVs miRNAs/piRNAs and down-regulated genes, indicating at least one target for each EVs miRNAs/piRNAs (e. g., CEBPA/miR-182, EGR2/miR-150 and miR-92, MPO/ hsa_piR_020814_DQ598650). [score:6]
Moreover, another down-regulated gene, Early Growth Response 2 (EGR2), also involved in apoptosis [61] and differentiation [62], is regulated by two different microRNAs, identified in our sequencing data, miR-150 [63] and miR-92 [64]. [score:5]
In fact, UCB-CD34+ cells, after overexpression of miR-21-5p, miR-181a-5p and miR92a-3p showed a significant decrease of apoptosis pathway and of caspase 3/7 activity. [score:3]
UCB-CD34+ were transfected with 60 nM of miRNA precursor molecules (miR-27b-3p mimic, miR-10a-5p mimic, miR-21-5p mimic, miR-181a-5p mimic and miR92a-3p mimic) (Life Technologies) or negative control (Life Technologies) using Lipofectamine 2000 (Life Technologies), according to the manifacturer's instructions. [score:1]
To further confirm apoptosis process reduction due to BM-MSC-derived EVs miRNAs, we transfected together miR-21-5p, miR-181a-5p and miR92a-3p (Figure 4E) in UCB-CD34+. [score:1]
[1 to 20 of 6 sentences]
14
[+] score: 22
The miRNA content of these vesicles displayed overlap with their cellular expression, as miRNA-21 was stable, miRNA-192 was significantly down-regulated, and miRNA-92a, and -200b show clear trends of being down-regulated during HSC activation (Figure 4E). [score:9]
Change of expression in human aHSC (Fold Change) Expression in plasma of liver disease-compared to healthy individuals Source Expression trend Etiology miRNA-150-5p ↓ (870) ↑ HBV Li et al., 2010; Venugopal et al., 2010 miRNA-192-5p ↓ (8.53) ↑ HBV, NASH, NAFLD Tryndyak et al., 2012; Winther et al., 2013; Becker et al., 2015; Pirola et al., 2015 miRNA-200b-3p ↑ (22.55) ↑ NAFLD, HBV/HCV -associated HCC Murakami et al., 2011; Tryndyak et al., 2012 miRNA-122-5p N. D. ↑ HCV, HBV, NASH, NAFLD Arataki et al., 2013; Shrivastava et al., 2013; Tan et al., 2014; Pirola et al., 2015 miRNA-21-5p N. D. = /↑ HBV, NAFLD Yamada et al., 2006; Cermelli et al., 2011; Becker et al., 2015 miRNA-92a-3p N. D. ↑ HBV -associated HCC, HCV Li et al., 2010; Ji et al., 2011; Shrivastava et al., 2013 N. D., non-determined. [score:8]
MiRNA-92a and miRNA-21 were selected for their known presence in circulating vesicles from patients with various pathologies (Skog et al., 2008; Taylor and Gercel-Taylor, 2008; Rabinowits et al., 2009; Chen et al., 2016), and their potential implication in liver disease. [score:3]
miRNA Mature miRNA primer miR-92a-3p TATTGCACTTGTCCCGGCCTGT miR-122-5p TGGAGTGTGACAATGGTGTTTG miR-150-5p TCTCCCAACCCTTGTACCAGTG miR-192-5p CTGACCTATGAATTGACAGCC miR-200b-3p TAATACTGCCTGGTAATGATGA miR-21-5p TAGCTTATCAGACTGATGTTGA cel-miR-39-3p AGCTGATTTCGTCTTGGTAATA All primers were ordered from Integrated DNA Technologies (IDT, Leuven, Belgium), and are specific for detection of both human and murine miRNA -expression. [score:1]
Exosomal microRNA miR-92a concentration in serum reflects human brown fat activity. [score:1]
[1 to 20 of 5 sentences]
15
[+] score: 22
Further, seven miRNAs were predicted to be related to the regulation of RNA expression, with the putative functions of mRNA process regulation (mmu-let-7a-2-3p, mmu-let-7b-3p, and mmu-let-7c-1-3p) and regulation of gene expression (mmu-miR-92a-2-5p, mmu-miR-125b-1-3p, mmu-let-7a-2-3p, mmu-miR-134-5p, and mmu-miR-27a-5p). [score:8]
Among them, seven miRNAs including three that were down-regulated (mmu-miR-708-5p, mmu-miR-92a-2-5p, and mmu-miR-711) and four that were up-regulated (mmu-miR-714, mmu-miR-134-5p, mmu-let-7a-2-3p, and mmu-miR-27a-5p) were predicted to be involved in cellular response to stimulus. [score:7]
Different types of cancer cells express either high or low levels of miR-92 [44- 46] and the high levels of circulating miR-134 was proposed as a diagnostic and prognostic biomarker for certain diseases [47, 48]. [score:5]
Cancer progression is associated with miR-92a and miR-134 that acts as oncomirs to promote cell proliferation, migration, and invasion [42, 43]. [score:1]
Eight altered levels of miRNAs (let-7b-3p, miR-1194, miR-134-5p, miR-1981-3p, miR-210-5p, miR-542-3p, miR-706, and miR-92a-2-5p) were selected for qRT-PCR analysis. [score:1]
[1 to 20 of 5 sentences]
16
[+] score: 20
This analysis (Figure 3A) revealed that genes belonging to the predicted targets lists of miR-17, miR-20a, miR-19a and miR19b but not to those of miR-18a or miR-92a were significantly over-represented among genes up-regulated in response to HMBA and Dox (resulting in down regulation of miR-17-92 cluster). [score:7]
In summary, these analyses indicated that miR-17-92 cluster in 745A#44 cells is mainly involved in the down-regulation of predicted targets of miR-17/miR-20a and miR-19a/miR-19b rather than miR-18a or miR-92a. [score:6]
Except for miR-18, the oncogenic contributions of miR-17/20a, miR-19a/b and miR-92 have all been demonstrated and several functional targets identified, including E2F1, PTEN and BIM1 [26]. [score:3]
B: Equal numbers of NN10#5 or #17-92a cells were transfected with control, anti-miR-92a or a mixture of anti-miR-17 and anti-miR-20a and cultured in the presence or absence of Dox. [score:1]
This miR-17-92 cluster comprises six miRNAs that can be grouped into four sub-families based on their seed sequence (miR-17 and miR-20a, miR-18a, miR-19a and b and miR-92a) [19]. [score:1]
Figure S4 Comparison of miR-17, miR18, miR-19a, miR19b and miR92 levels between NN10#5, 745A#44 and K16 erythroleukemic cells. [score:1]
Transfection of either miR-92 or control anti-miRs did not affect the partial proliferation rescue in #17-92 cells in presence of Dox (Figure 6B). [score:1]
[1 to 20 of 7 sentences]
17
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
MiR-92a was down-regulated in IPF samples, while WISP1 was upregulated, and Berschneider et al. [28] provide evidence for WISP1 regulation by miR-92a in pulmonary fibrosis. [score:8]
Lai et al. [30], demonstrated that stimulation of TLR production in macrophages down-regulates miR-92a. [score:4]
Berschneider et al. [28], using human tissue from idiopathic pulmonary fibrosis (IPF) patients, determined that this condition is mediated by the WNT1-inducible signaling pathway protein-1 (WISP1), which is a target of miR-92a. [score:3]
Bta-miR-92a was down-regulated in the positive, compared to the negative group for the study herein. [score:3]
Serum antibody to M. bovis microRNA Negative Positive SE P-value bta-let-7b 11,691 15,421 1,200 0.0336 bta-miR-24-3p 15,908 24,390 1,495 0.0002 bta-miR-92a 83,405 64,330 4,156 0.0023 bta-miR-423-5p 124,920 101,818 6,315 0.0133 A total of 21 microRNAs were associated with season (Table 3). [score:1]
Bta-miR-92a is a candidate to be used as a diagnostic tool in animals exposed to the pathogen. [score:1]
[1 to 20 of 6 sentences]
18
[+] score: 19
Other miRNAs from this paper: mmu-mir-98, mmu-mir-92a-1
To test if non-specific miRs could interfere with the expression of IL-10 in B cells, we knocked down the expression of miR-92a, in line with other's reports [18], which did not affect the IL-10 expression in B cells (Figure 4). [score:8]
The mice were also received intraperitoneal injection with anti-miR-98 liposomes (or control liposomes; or anti-miR-92a liposomes) (Figure 5A), or adoptive transfer with B10 cells (or naïve B cells) (Figure 5B), or 33851 (An 11β-HSD1 inhibitor used as a cortisol inhibitor, or BSA) (Figure 5C). [score:5]
Briefly, cells were transduced with miR-98-shRNA or miR-92a-shRNA or control shRNA lentivector-containing media (2.0 × 10 [6] viral particles/ml). [score:1]
One day prior to surgery, mice were treated with one of the following procedures: (A) Intraperitoneal injection with anti-miR-98 liposome (0.1 mg/mouse; or control liposomes; or anti-miR-92a liposomes. [score:1]
Preparation of miR-98- or miR-92a -deficient B cells. [score:1]
Anti-miR-98 (anti-miR-92a, or control miR): Mice were also anti-miR-98 liposomes (or anti-miR-92a liposomes, or control liposomes). [score:1]
Following published procedures [31], anti-miR-98 or anti-miR-92a oligonucleotides (0.086 μmol; Enke Biotech, Shenzhen, China) were mixed with a lipid mixture (Sigma Aldrich) in 200 μL of 100% ethanol and 300 μl of 20 mM citrate buffer (pH 4) at 60°C. [score:1]
B cells were transduced with miR-98 shRNA or miR-92a shRNA carried by lentivector or control lentivector (Enke Biotech, Shenzhen, China) following the manufacturer's instructions. [score:1]
[1 to 20 of 8 sentences]
19
[+] score: 19
miR-92a are ubiquitously expressed in majority of cell types and target genes involved in cell cycle regulation and cell signaling and thus are necessary during all stages of mammalian development and essential for the proliferation of cells [53]. [score:7]
The expression of a few iPSC/ESC markers (gene/miRNAs) either did not change significantly (IFITM2, IFITM1, DIAPH2, NUMB, REST, BRIX1, TFCP2L1, FGF5, and miR-92a) or was significantly (FC ≤ −2.0, FDR ≤ 0.05) downregulated (PTEN and IL6ST) in our reprogrammed iPSCs. [score:6]
The genes and miRNAs expected to be enriched in iPSCs/ESCs, from the literature [18, 21, 38– 42], include transcription factors involved in maintaining “stemness” (FOXD3, GATA6, NANOG, NR6A1, POU5F1, SOX2, UTF1, TFCP2L1, and ZFP42), signaling molecules involved in pluripotency and self-renewal (CRABP2, EDNRB, FGF4, FGF5, GABRB3, GAL, GRB7, IFITM1, IL6ST, KIT, LEFTY1, LEFTY2, LIFR, NODAL, NOG, NUMB, PTEN, SFRP2, and TDGF1), cytokines and growth factors (FGF4, FGF5, LEFTY1, LEFTY2, NODAL, and TDGF1), other ESC-specific genes (BRIX1, CD9, DIAPH2, DNMT3B, IFITM2, IGF2BP2, LIN28A, PODXL, REST, SEMA3A, TERT, ESRG, and GJA1), and miRNAs (miR-302a, miR-302c, miR-371a, miR-302b, miR-302d, miR-372, miR-373, miR-92a-1, miR-92a-2, miR-92b, miR-17, miR-20a, and miR-18a) that were highly enriched in genes and miRNAs that were expressed (NRC ≥ 20) in our reprogrammed iPSCs and the majority of them showed significant upregulation (FC ≥ 2.0, FDR ≤ 0.05) during iPSC reprogramming (Figure 4(c)). [score:6]
[1 to 20 of 3 sentences]
20
[+] score: 17
This experiment showed for the first time that hsa-miR-92 targets the 3′UTR of the RFX1 transcript, which is in turn known to inhibit PCNA expression. [score:7]
To explain the positive correlation between PCNA and the two miRNAs, we hypothesized that one or many other genes could be inhibited by miR-92 and miR-32 and that these genes could be negative regulators of PCNA (Figure 3A). [score:4]
This results in a positive correlation in expression between hsa-miR-32, hsa-miR-92 and PCNA. [score:3]
A. hsa-miR-32 and hsa-miR-92 (Figure 2B) repress RFX1 via a 3′UTR sequence. [score:1]
To further explore this substantial family of CPC pairs, we focused on the PCNA gene (proliferating cell nuclear antigen) involved in cell replication and DNA repair because it was highly positively correlated with both hsa-miR-92 and hsa-miR-32. [score:1]
This relationship explains the positive correlation found between hsa-miR-92 and the PCNA gene. [score:1]
[1 to 20 of 6 sentences]
21
[+] score: 16
Treg-specific miR-17–miR-92 deletion increased Treg apoptosis and reduced proliferation, causing loss of Foxp3 expressing Treg in aged mice (63). [score:3]
It has been proposed that strong CD28 signals inhibit Foxp3 induction, which may be influenced by costimulatory signaling pathways that induce miR-17–miR-92 (41). [score:3]
miR-31 represses human Treg Foxp3 expression (36) while the miR-17–miR-92 cluster represses iTreg formation (37– 40). [score:3]
By contrast, elevated miR-17–miR-92 in murine lymphocytes increased proliferation and reduced cell death (64), resulting in favored Treg accumulation in lymph nodes and non-lymphoid target tissues (63). [score:3]
miR-31 and the miR-17–miR-92 cluster function as negative regulators of iTreg differentiation (29). [score:2]
Moreover, miRNA (miR-31, miR-17–miR-92, and miR-23–miR-27–miR-24) antagomir treatment of T cells in vitro may be exploited to support iTreg generation, while in vivo treatment may foster pTreg generation. [score:1]
miR-17–miR-92 also assists in maintaining Treg fitness (62). [score:1]
[1 to 20 of 7 sentences]
22
[+] score: 16
The well expressed miR-21, miR-155 and miR-146a clustered together as consistently upregulated, while the abundant microRNAs of the miR17~92 clusters (miR-19b, miR-20a and miR-92) showed a clear trend towards decreased expression in differentiated cells, as did miR-26a (Figure 2A). [score:8]
In addition, 7 microRNAs of the 17~92 and paralog 106b~25 clusters (namely miR-19a, miR-19b, miR-20a, miR-25, miR-92, miR-93 and miR-106b) were identified among the 53 most expressed microRNAs (groups A and B, see Table 1). [score:3]
There were also non significant trends towards preferential expression of miR-19b and miR-92 in the central memory cells. [score:3]
Expression levels of miR-17-3p, miR-17-5p, miR-19b, miR-20a and miR-92 were therefore determined by single specific qPCR in differentiated CD8 [+ ]T cell subsets, and compared to the levels found in naïve cells. [score:2]
[1 to 20 of 4 sentences]
23
[+] score: 15
The circulating miRNA targets that were up-regulated following CLP belong not only to the miR-17∼92 cluster but also to its evolutionary paralogs, miR-106a∼363 (miR-106a, miR-18b, miR-20b, miR-19b-2, miR-92a-2, and miR-363) and miR-106b∼93 (miR-106b, miR-93, miR-25). [score:6]
Previously, we had demonstrated a dose- and time -dependent up-regulation of 8 (let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107, and miR-451) and 4 (miR-451, miR-668, miR-1902, and miR-1904) circulating miRNA targets in mice following injection of LPS [11] and LTA [12], respectively. [score:6]
miR-17 and miR-20a belong to a group of commonly overexpressed miRNAs, the miR-17∼92 cluster, which is located on mouse chromosome 14 (13 in humans) and comprises 7 mature miRNAs (miR-17-5p and, miR-18a, miR-19a and b, miR-20a, and miR-92a). [score:3]
[1 to 20 of 3 sentences]
24
[+] score: 15
The key reasons are as follows: Bim and Stat3 genes harbor miR-20a binding sites, and c-Kit and Socs3 genes harbor miR-19 binding sites, which are conserved across different phyla (ie, human, monkey, mouse, and rat) (Figures 8A, B and S7A, B); Bim is identified as direct targets of miR-17, 43, 44 miR-20a, [44] and miR-92a; [44] Stat3 is identified as direct targets of miR-17 45, 46 and miR-20a; 45, 46 Socs3 is identified as a direct target of miR-19a; [47] and Bim, Stat3, c-Kit, and Socs3 have been demonstrated to be implicated in the process of spermatogenesis. [score:10]
The miR-17-92 cluster and its 6 different mature microRNAs, including miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92a, play important roles in embryo development, immune system, kidney and heart development, adipose differentiation, aging, and tumorigenicity. [score:3]
[4] The miR-17-92 gene cluster encodes 6 miRNAs of 4 miRNA families: the miR-17 family including miR-17 and miR-20a, the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and the miR-92 family. [score:1]
The miR-17-92 gene cluster encodes 6 miRNAs of 4 miRNA families: the miR-17 family including miR-17-5p and miR-20a, the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and the miR-92 family. [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 14
When transfected into HeLa cells at individual concentrations of 16.7 nM, they achieved a 10-20-fold (miR-92) or 200–400-fold (miR-17/20a, 18a, 19a/19b) overexpression (Figure 3), far exceeding the 3–5-fold increase that was sufficient to drive B cell lymphoma development in mice (Jin et al., 2013), as well as the 2–36-fold increase found in biopsies of human Burkitt's lymphomas, which consistently exhibit activation of the c-Myc-miR-17~92 axis (Schmitz et al., 2012). [score:4]
Importantly, transient transfection of cel-mir-67 did not alter the expression level and size of endogenous miRNAs, including miR-17, miR-18a, miR-19b, miR-92a, and miR-16 (Figure 2B). [score:3]
The following synthetic miRNA mimics were used in this study: Mimic Transfection Control with Dy547 (cel-mir-67 conjugated with Dy547), Dharmacon CP-004500-01-10 miRIDIAN microRNA Mimic Negative Control #1 (cel-mir-67), Dharmacon CN-001000-01-10 miRIDIAN Mimic hsa-miR-17, Dharmacon C-300485-05-0005 miRIDIAN Mimic hsa-miR-18a, Dharmacon C-300487-05-0005 miRIDIAN Mimic hsa-miR-19a, Dharmacon C-300488-03-0005 miRIDIAN Mimic hsa-miR-20a, Dharmacon C-300491-03-0005 miRIDIAN Mimic hsa-miR-19b, Dharmacon C-300489-03-0005 hsa-miR-92a, custom synthesized by Shanghai GenePharma miRIDIAN Mimic hsa-miR-155, Dharmacon C-300647-05-0010 Generation of miR-17~92 -expressing lentivirus was previously described (Hong et al., 2010). [score:3]
The following synthetic miRNA mimics were used in this study: Mimic Transfection Control with Dy547 (cel-mir-67 conjugated with Dy547), Dharmacon CP-004500-01-10 miRIDIAN microRNA Mimic Negative Control #1 (cel-mir-67), Dharmacon CN-001000-01-10 miRIDIAN Mimic hsa-miR-17, Dharmacon C-300485-05-0005 miRIDIAN Mimic hsa-miR-18a, Dharmacon C-300487-05-0005 miRIDIAN Mimic hsa-miR-19a, Dharmacon C-300488-03-0005 miRIDIAN Mimic hsa-miR-20a, Dharmacon C-300491-03-0005 miRIDIAN Mimic hsa-miR-19b, Dharmacon C-300489-03-0005 hsa-miR-92a, custom synthesized by Shanghai GenePharma miRIDIAN Mimic hsa-miR-155, Dharmacon C-300647-05-0010 Transfection of miR-17~92-expresing plasmid was previously described (Xiao et al., 2008). [score:1]
HeLa cells were transfected with 100 nM unconjugated cel-mir-67 and analyzed by to detect cel-mir-67 (A) and endogenous miR-17, miR-18a, miR-19b, miR-92a, and miR-16 (B). [score:1]
For example, the probe mixture for the miR-17 subfamily contains probes for miR-17, miR-20a, miR-106a, miR-20b, miR-106b, and miR-93, the probe mixture for the miR-18 subfamily contains probes for miR-18a and miR-18b, the probe mixture for the miR-19 subfamily contains probes for miR-19a and miR-19b, and the probe mixture for the miR-92 subfamily contains probes for miR-92, miR-363, and miR-25. [score:1]
Since cel-mir-67 is a C. elegans miRNA that has no homolog in mammalian species, we decided to perform the same experiments using microRNA-17~92 (miR-17~92), a miRNA cluster encoding six mature miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92). [score:1]
[1 to 20 of 7 sentences]
26
[+] score: 14
Recent analysis of miRNA expression in developing human, chimp and macaque brains showed rapid changes in developmental expression profiles of a number of conserved miRNAs, including miR-92, in the primate lineage and proposed that miRNAs contributed to the brain's evolutionary expansion (Somel et al., 2011). [score:6]
Recent studies implicated miR-92a/b in the regulation of intermediate progenitor cell specification in the mouse SVZ by regulating the expression of Tbr2 transcription factor (Bian et al., 2013; Nowakowski et al., 2013). [score:5]
It is possible that over -expression of Tbr2 due to the loss of miR-92a/b could to some extent account for the persistence of abnormally large numbers of progenitors that we observed postnatally. [score:3]
[1 to 20 of 3 sentences]
27
[+] score: 13
miR-92a-3p inhibition also reduced TNF-α production by ∼50%, suggesting its involvement in regulating TLR7 -mediated immune induction, while miR-18a-5p and miR-17-5p inhibition only had a modest effect on RNA sensing (Figure 1A). [score:6]
To distinguish the direct contribution of miR-19 and -92 in TLR7 sensing from a potential off-target effect of the 2′OMe AMOs used, experiments were replicated in BMMs from miR-17∼92 [flox/ flox] × LysMCre mice—where levels of mature miR-17-5p, miR-19a-3p and miR-92a-3p were decreased by ∼70% (Figure 1B). [score:4]
miR-17∼92 [flox/ flox] mice (Jax mice stock 8458 – on a mixed C57BL/6 and 129S4 background) harbouring loxP sites on each side of the miR-17∼92 cluster (Mir17, Mir18, Mir19a, Mir20a, Mir19b-1, Mir92–1) (23), were bred to LysMCre mice (kind gift from Dr. [score:1]
In this work, we originally set out to study the role of the individual members of the miR-17∼92 cluster of miRNAs (miR-17/20a, miR-19a/b, miR-18a and miR-92a) on TLR7 -driven NF-κB signalling in mouse primary macrophages. [score:1]
To investigate the specific impact of miR-19 inhibition, relative to that of other members of the same cluster of miRNAs (miR-17-5p, miR-18a-5p and miR-92a-3p), we measured the inhibition of TLR7 signalling in primary mouse BMMs treated with specific 2′OMe AMOs. [score:1]
[1 to 20 of 5 sentences]
28
[+] score: 13
The 50 highest expressed miRNAs in the mice ovaries are represented in a heatmap in Fig 1 and for miRNA expression levels in Fig 2. The top five most expressed miRNAs in the ovary (all samples combined) were mmu-miR-92a-3p (miR-25 family), mmu-let-7c-5p (let-7 family), mmu-miR-143-3p (miR-143 family), mmu-miR-26a-5p (miR-26 family) and mmu-miR-145a-5p (miR-145 family). [score:7]
The miR-17 gene family is located at the same cluster (< 10 kb spaced on mouse chromosome 14) with mmu-miR-92a, the highest expressed ovarian miRNA in our samples, which was up-regulated in young df/df in comparison to young N mice. [score:6]
[1 to 20 of 2 sentences]
29
[+] score: 13
The miRNA expression profile in ECs exposed to disturbed blood flow at arterial bifurcations differs substantially from that in ECs at unbranched arterial segments 42 and is characterized by downregulation of atheroprotective (such as miR-126-5p) 52 and upregulation of pro-atherogenic miRNAs (such as miR-92a) 41. [score:7]
The expression of KLF2 and KLF4 is transcriptionally upregulated by the MEK5/Erk5/MEF2 signalling pathway and posttranscriptionally silenced by disturbed flow -induced miR-92a 3 65. [score:6]
[1 to 20 of 2 sentences]
30
[+] score: 13
Previously, we had identified a specific whole blood–derived miRNA signature in mice exposed to LPS as there was a dose- and time -dependent upregulated expression of the miRNA targets (let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107 and miR-451) follo-wing in vivo LPS injection [14]. [score:8]
In previous study, we had demonstrated that expression of multiple miRNAs (let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107, and miR-451) is significantly altered in the whole blood of mice after exposure to LPS in a dose- and time -dependent fashion [14]. [score:3]
In our previous work, in TLR4 receptor knockout mice, five of eight miRNAs (i. e. let-7d, miR-25, miR-92a, miR-103, and miR-107) was significantly lower following exposure to LPS, with unchanged levels of the other three miRNAs [14]. [score:2]
[1 to 20 of 3 sentences]
31
[+] score: 12
The expression correlation between miR-92a and miR-92b is 0.2, and the expression correlation between miR-25 and miR-92b is 0.172. [score:5]
MiR-25 and miR-92a show a high expression correlation (PCC = 0.798), whereas miR-92b has distinct expression patterns with miR-25 and miR-92a. [score:5]
For example, three miRNAs including miR-25, miR-92a and miR-92b are from the miR-25 family. [score:1]
Both miR-25 and miR-92a were found to play roles in cell proliferation [31], [47]. [score:1]
[1 to 20 of 4 sentences]
32
[+] score: 11
Upon activation, both miR-17~92 miRNAs and their target mRNAs are up-regulated (Fig 3C and 3D), but the fold increase of the latter outpaces the former, thereby increasing the ratios between conserved binding sites and miRNA molecules to 2.8 (miR-92 family) and 8.7 (miR-18 family) in 25.5h activated B cells (Fig 3E). [score:6]
They fall into four miRNA subfamilies (miR-17, miR-18, miR-19, and miR-92 subfamilies), with members in each subfamily sharing the same seed sequence. [score:1]
Indicated amounts of synthetic miR-17, miR-18a, miR-19b and miR-92 were added to naïve and activated T KO B cells before RNA extraction. [score:1]
The wild type CD69 3’UTR (wt) contains three binding sites for miR-17~92 miRNAs (one for miR-17 subfamily and two for miR-92 subfamily). [score:1]
The ratios between conserved miR-17~92 binding sites and miRNA molecules range from 0.5 (miR-92 subfamily) to 4.6 (miR-18 subfamily) in naïve B cells (Fig 3E). [score:1]
Our calculation showed that each naïve B cell expresses 900–1,800 molecules of miR-17, miR-19, and miR-92 subfamily miRNAs, and 80 molecules of miR-18 subfamily miRNAs (Fig 3B and 3C and S7 Table). [score:1]
[1 to 20 of 6 sentences]
33
[+] score: 11
Furthermore, significantly increased aortic expression of miR-26a, miR-21, miR-126a, miR-132, miR-146 and miR-155 and decreased expression of miR-20a and miR-92a were observed in the vehicle -treated ApoE [−/−] mice. [score:5]
Significantly increased aortic expression of miR-146a, miR-26a, miR-21a, miR-155, miR-126a and miR-132, decreased expression of miR-20a and miR-92a was observed in vehicle -treated ApoE [−/−] mice. [score:5]
Proangiogenic miR-126a [33] and miR-132 [34] and anti-angiogenic miR-92a [35] could be implicated in plaque angiogenesis, which contributes to destabilization and rupture of atherosclerotic lesions and may also lead to increased accumulation of inflammatory cells. [score:1]
[1 to 20 of 3 sentences]
34
[+] score: 11
The increased proportion of cells expressing Tbr2 is in line with a previous prediction based on miRNA profiling of neural progenitor cells in rat dorsal telencephalon which proposed that the expression of miR-92 is down-regulated around the onset of neurogenesis and that it could be directly targeting Tbr2 for post-transcriptional repression [80]. [score:11]
[1 to 20 of 1 sentences]
35
[+] score: 10
The proapoptotic gene BIM is also a direct target of miR-92a [55, 56]. [score:4]
miR-17, miR-20a, and miR-92 also illustrated the importance of collaboration in the regulation of Isl1 and Tbx1 during cardiac development [69]. [score:3]
The six miRNAs can be grouped into four miRNA families based on their seed-sequence: the miR-17 family (miR-17 and miR-20a), the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and miR-92 family (miR-92a-1) [31, 34, 39]. [score:1]
Both the evolutionary sequence analysis and the seed-sequence -based grouping partition these miRNAs into four families: the miR-106 family (miR-17, miR-20a/b, miR-106a/b, and miR-93), the miR-18 family (miR-18a/b), the miR-19 family (miR-19a/b-1/2), and the miR-92 family (miR-25, miR-92a-1/2, and miR-363). [score:1]
This cluster encodes six miRNAs: miR-106a, miR-18b, miR-19b-2, miR-20b, miR-92a-2, and miR-363 [42]. [score:1]
[1 to 20 of 5 sentences]
36
[+] score: 10
Upregulation of miR-709 from promyelocytes to granulocytes correlated with the downregulation of mature miR-20b and miR-92a (Figure 6A); putative binding sites of both pri-miRNA-20b and 92a demonstrated near perfect complementarity to mature miR-709 (Figure 6B). [score:7]
Several members of the polycistronic miR-17-92 cluster and the homologous miR-106a-92 cluster (miR-17, miR-19a, miR-20a, miR-92a and miR-106a) were expressed at the highest levels in promyelocytes (Figure 3B). [score:3]
[1 to 20 of 2 sentences]
37
[+] score: 10
Other miRNAs from this paper: mmu-mir-92a-1, mmu-mir-92b
Interestingly, miR-92 and miR-92b are specifically expressed in aRG undergoing neurogenic divisions, where the Eomes mRNA is highly expressed (Florio et al., 2015). [score:5]
3' UTR -dependent, miR-92 -mediated restriction of Tis21 expression maintains asymmetric neural stem cell division to ensure proper neocortex size. [score:3]
The Tbr2 protein has been shown to be repressed by the microRNAs (miRNAs) miR-92 and miR-92b, and both miRNAs regulate bIP specification in the developing neocortex (Bian et al., 2013; Nowakowski et al., 2013). [score:2]
[1 to 20 of 3 sentences]
38
[+] score: 10
Based on the partial residual expression of the miR-17 and miR-92 families (Figure 7B, 7C), and the generally very low expression of the miR-18 family (Figure 7D, note y axis units), we hypothesized that loss of the miR-19 family was responsible for the defective invasion of 17KPC cell lines. [score:5]
In fact, the mir-106b~25 locus is sufficient to drive expression of miRNAs for the miR-17 and miR-92 families to levels close to those observed in KPC lines, suggesting that loss of the miR-17 and -92 families may not be primarily responsible for the invasive defect of 17KPC cell lines. [score:3]
Interestingly, a recent publication linked miR-92 and DUSP10 to PDAC cell proliferation in vitro, suggesting that there may indeed be an important role for this regulatory axis in pancreatic tumorigenesis [61]. [score:2]
[1 to 20 of 3 sentences]
39
[+] score: 9
0130658.g006 Fig 6 (A) qPCR validation of selected miRs from the microRNA array showing significant down-regulation of miR-21 and miR-92a and significant up-regulation of miR-27, miR-29, miR-208 and miR-214 in CR compared to Ad lib. [score:6]
As shown in Fig 6A, the levels of miR-21 and miR-92a were down-regulated in CR as compared to AL mice (-1.085±0.2465, P<0.01; and -1.798±0.6679, P<0.02; fold change respectively, N = 3). [score:3]
[1 to 20 of 2 sentences]
40
[+] score: 9
We evaluated the expression of PTEN and these miRs by real-time PCR, and we noticed that PTEN was lower-expressed (Fig. 1c), while miR-32-5p, miR-21-5p, miR-19a-3p, miR-92a-3p, and miR-486-5p were all highly-expressed in Bel/5-FU cells (Fig. 1d). [score:5]
Increasing evidence shows that PTEN -regulating miRs, such as miR-141-3p [10], miR-29a [11], miR-21 [12– 16], miR-19a [17], miR-92a [18], and miR-486 [19] contribute to anti-tumor treatment resistance. [score:2]
The relative expression of miR-32-5p, miR-21-5p, miR-19a-3p, miR-92a-3p, miR-486-5p and U6, PTEN, Twist, Snail, and GAPDH mRNA was measured with SYBR® Premix Ex Taq™ II (Perfect Real Time, Takara, Shiga, Japan) as previously described [8]. [score:1]
org databases) and literature review, we found that miR-32-5p, miR-19a-3p, miR-92a-3p, and miR-486-5p have complementary binding sites to the 3’-UTR of PTEN (Fig. 1b and Additional file 3). [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 9
To address this issue, we first screened the miRNAs whose expressions are modulated in 4T1 cells by miRNA microarray analysis using both total cellular miRNA and exosomal miRNA after treatment with 100 μM of EGCG for 24 h. In brief, a set of miRNAs including let-7, miR-16, miR-18b, miR-20a, miR-25, miR-92, miR-93, miR-221, and miR-320 were up-regulated, and dozens of miRNAs including miR-10a, miR-18a, miR-19a, miR-26b, miR-29b, miR-34b, miR-98, miR-129, miR-181d were down-regulated in both total cellular and exosomal fraction by EGCG treatment (data not shown). [score:9]
[1 to 20 of 1 sentences]
42
[+] score: 9
As miR-92a expression was unchanged between BCR-ABL -positive and -negative ALL cells (Figure 1), we transduced TonB cells to overexpress miR-17∼19b, a derivative of miR-17∼92 suitable for transgenic expression. [score:7]
Furthermore, BCR-ABL -positive ALL samples exhibited a 9- to 32-fold reduction in miRNA expression compared to BCR-ABL -negative ALL cells, with the exception of miR-92 which was therefore not further analysed. [score:2]
[1 to 20 of 2 sentences]
43
[+] score: 9
The decreased miR-92a expression level of was observed in atretic porcine follicles and transfection of GCs with miR-92a mimics significantly attenuated porcine GC apoptosis by targeting Smad7 gene (Liu et al., 2014). [score:5]
MiR-92a inhibits porcine ovarian granulosa cell apoptosis by targeting Smad7 gene. [score:4]
[1 to 20 of 2 sentences]
44
[+] score: 9
In addition, the results seemed to contrast to our previous report that LPS injection induced up-regulation of the miRNAs (let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107 and miR-451) of the whole blood in a dose- and time -dependent manner [19]. [score:4]
With more than 6000 reads, 3 miRNAs (mir-486-5p, mir-3107-5p, and mir-92a-3p) were dominantly expressed in all these 12 libraries (Additional file 1: Table S6). [score:3]
In addition to mir-486-5p and mir-3107-5p, which have more than 200000 sequence reads in all 12 libraries, mir-92a-3p was the third most abundant miRNA with sequence reads ranging from 6659 to 16734 (Additional file 1: Table S6). [score:1]
Among them, there were 52 mature miRNAs with sequence reads ≥ 400 (Additional file 1: Table S4) and 10 mature miRNAs (mir-10b-5p, mir-133a-1-3p, mir-133a-2-3p, mir-191-5p, mir-22-3p, mir-25-3p, mir-3107-5p, mir-486-5p, mir-92a-1-3p, mir-92a-2-3p) with sequence reads ≧ 4000 in at least 1 of the 12 twelve libraries (Additional file 1: Table S5). [score:1]
[1 to 20 of 4 sentences]
45
[+] score: 9
Hypermethylation of the human Dkk3 promoter [26] may be the mechanism for the downregulation in various tumour types, as is repression of Dkk3 by the MYCN regulated miRNA-92 [27], [28]. [score:5]
In addition there are two recent studies showing that Dkk3 expression is regulated by miRNA-92 in neuroblastoma cell lines [27], [28]. [score:4]
[1 to 20 of 2 sentences]
46
[+] score: 8
Mao G MicroRNA-92a-3p regulates the expression of cartilage-specific genes by directly targeting histone deacetylase 2 in chondrogenesis and degradationOsteoarthr. [score:6]
We also identified eight miRNAs with over twofold increases in regulation during chondrogenic differentiation of hADSCs, such as miR-320c, miR-92a-3p, and miR-455-3p [13]. [score:2]
[1 to 20 of 2 sentences]
47
[+] score: 8
With the remission of disease, the plasma miR-92a level became normalized. [score:3]
In patients with multiple myeloma, the miR-92a level in CD8+ T cells was significantly down-regulated compared with normal subjects [21]. [score:3]
In contrast, both miR-17 and miR-92a promote immune cell mediated anti-tumor response. [score:1]
Given the fact that miR-92a and miR-17 belong to a same microRNA cluster, their roles in immune mediation could be alike. [score:1]
[1 to 20 of 4 sentences]
48
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-23b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-24-1, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, hsa-mir-18b, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-92b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
Targeted knockouts of Mir17 and Mir92 in mice results in hypoplasia of most skull bones, including reduced ossification and cleft palate, similar to human patients (Ventura et al., 2008; de Pontual et al., 2011; Li et al., 2012; Wang et al., 2013). [score:3]
Another miRNA family involved in craniofacial development is the MIR17 and MIR92 family, which has been linked to Feingold syndrome in human patients (Kannu et al., 2013; Tassano et al., 2013). [score:2]
MicroRNA-92a upholds Bmp signaling by targeting noggin3 during pharyngeal cartilage formation. [score:2]
Similarly, Mir92a which is in the Mirc1 cluster on mouse chromosome 14 containing Mir17, Mir18, Mir19a, Mir20a, Mir19b-1, and Mir92a-1, is required to promote proliferation of orofacial development (Ning et al., 2013). [score:1]
[1 to 20 of 4 sentences]
49
[+] score: 7
Only five miRNAs (mmu-miR-451, mmu-miR-223, mmu-miR-92a, mmu-miR-200c, and mmu-miR-873) were differentially expressed, implying that the majority of miRNA downregulation associated with obesity could be reversed by LFD treatment. [score:6]
Some of the circulating miRNAs identified in this study have also been reported in the adipose tissue of DIO mice or implicated in adipogenic processes [11– 13], including Let-7, miR-103, miR-15, the miR-17-92 cluster (miR-17, miR-20a, and miR-92a), miR-21, miR-221, and miR-30b. [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 7
Although the evidence suggests that cell type-specific responses are possible in response to miR-17-92, downregulation of miR-92a specifically triggers macrophage infiltration of the tumor stroma, promotes cell migration and decreases survival in breast cancer patients [48]. [score:4]
Other miRs which were more abundant in CDC-EVs vs MSC-EVs included miR-124, miR-210, miR-92 and miR-320. [score:1]
Another miR similarly abundant in human- and rat-CDC-EVs, and significantly higher compared with MSC-EVs, was miR-92, a member of the miR-17-92 cluster, and an important regulator of cancer and aging [46]. [score:1]
Next, in comparing EV miRs (Figure 6B), we observed that miR-146a was exclusive for human CDC-EVs and miR-92a was exclusive for human and rat CDC-EVs among the most abundant miRs. [score:1]
[1 to 20 of 4 sentences]
51
[+] score: 7
The levels of six miRNAs were increased by more than 1.5-fold; the only downregulated miRNAs were miR-92a (1.3-fold) and miR-223 (1.4-fold)). [score:4]
Analysis by qRT-PCR confirmed the higher levels of miR-449a (fold six), miR-1 (2.6-fold), and miR-135b (60-fold) in this study (Fig. 1B) but not the suppression of miR-223 and miR-92a. [score:3]
[1 to 20 of 2 sentences]
52
[+] score: 7
The top 8 downregulated (hsa-miR-200c, hsa-miR-212, hsa-miR-29a, hsa-miR-532, hsa-miR-141, hsa-miR-1, hsa-miR-363, hsa-miR-187) and 8 upregulated (hsa-miR-487, hsa-miR-452, hsa-miR-1233, hsa-miR-92a, hsa-miR-106b, hsa-miR-1290, hsa-miR-320, hsa-miR-26a) miRNAs were presented in Figure 1A. [score:7]
[1 to 20 of 1 sentences]
53
[+] score: 7
Of these, eight (miR-193b, miR-199a-3p/hsa-miR-199b-3p, miR-455-3p, miR-210, miR-381 (also known as miR-381-3p), miR-92a, miR-320c, and miR-136) were upregulated, while the other four (miR-490-5p, miR-4287, miR-BART8*, and miR-US25-1*) were downregulated during this process [22]. [score:7]
[1 to 20 of 1 sentences]
54
[+] score: 7
MiR-92, another member of the cluster, has been shown to regulate myocardial angiogenesis through targets distinct from those of miR20a, including integrin subunit alpha5 [14]. [score:4]
Note relatively higher expression of 3′ members of the cluster, miR-20a, miR-19b, and miR-92. [score:3]
[1 to 20 of 2 sentences]
55
[+] score: 6
VSELs also express several miRNAs that attenuate Igf-1/Igf-2 signaling in these cells (mir681, mir470, mir669b) as well as up regulate expression of p57 (mir25.1, mir19b, mir92). [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
Cofilin 2 is a target of miR-25, miR-363, miR-92a, and miR-92b. [score:3]
Cdc42 is a target of miR-92a and miR-92b and miR-25 and miR-363. [score:3]
[1 to 20 of 2 sentences]
57
[+] score: 6
Nine miRNAs (miR-148a-3p, miR-183a-5p, miR-214-3p, miR-27a-3p, miR-92a-3p, miR-378a-3p, miR-23a-3p, miR-21a-5p and miR-16-5p) were upregulated, and four (miR-155-5p, miR-199a-3p, miR-320-3p and miR-125a-5p) were downregulated in exosomes from RANKL -induced RAW 264.7 cells compared with RAW 264.7 cells (Figure 1f and Supplementary Figure S1d). [score:6]
[1 to 20 of 1 sentences]
58
[+] score: 6
The blockade of IL-4 up-regulated miR-17-5p and miR-92 significantly with p <. [score:4]
The miR-17-92 transcript encoded by mouse chromosome14 (and human chromosome 13) is the precursor for 7 mature miRs (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-19b and miR-92) [24, 25]. [score:1]
01 for miR-92 and p <. [score:1]
[1 to 20 of 3 sentences]
59
[+] score: 6
All the members of the cluster were cloned from purified P6 SCs [14], in situ hybridization with LNA (Locked Nucleic Acid) on adult testes showed miR-17 and miR-20a expression in SCs [12], and ulterior analysis of the small RNA transcriptome of SCs purified from mice at postnatal day 6 revealed high levels of expression for miR-19a and miR-19b, intermediated levels for miR-17 and miR-20a and low levels for miR-18a and miR-92a [16]. [score:5]
In human and mouse, two paralog clusters exist, i. e. the miR-106a-363 cluster comprising 6 miRNAS (miR-106a, miR-18b, miR-20b, miR-19b-2, miR-92a-2 and miR-363) and the miR-106b-25 one with 3 members (miR-106b, miR-93 and miR-25). [score:1]
[1 to 20 of 2 sentences]
60
[+] score: 6
Among which we found that three miRNAs (miR-363, miR-367, miR-25) were commonly upregulated while six (miR-33a, miR-33b, miR-92a, miR-92b, miR-137, miR-32) were downregulated in IL-6 -treated GBC-SD cell line samples compared to the representative controls (Figure 4A and Figure 4B). [score:6]
[1 to 20 of 1 sentences]
61
[+] score: 5
In addition, we found that miR-101a, miR-146a and miR-17-92 cluster (except miR-92) were upregulated in splenic T cells from MRL-lpr mice. [score:4]
However, miR-92, another member of the miR-17-92 cluster was not changed in either splenic B or T cells. [score:1]
[1 to 20 of 2 sentences]
62
[+] score: 5
Expression levels were normalized against three stably expressed reference miRNAs (hsa-miR-125a, hsa-miR-423 and hsa-miR-92) validated with GeNorm [46] and analyzed using qbase+ software version 2.6 (http://www. [score:5]
[1 to 20 of 1 sentences]
63
[+] score: 5
Other miRNAs from this paper: mmu-mir-92a-1
An in vivo method to identify microRNA targets not predicted by computation algorithms: p21 targeting by miR-92a in cancer. [score:5]
[1 to 20 of 1 sentences]
64
[+] score: 5
Four differentially expressed miRNAs (miR-15a-5p, miR-92a-3p, miR-107, and miR-194-5p) were selected for verification by QPCR. [score:3]
The miRNAs miR-15a-5p (r = 0.92), miR-107 (r = 0.91), and miR-194-5p (r = 0.72) showed a strong correlation whereas the miR-92a-3p (r = −0.11) revealed no correlation. [score:1]
No correlation was found for the miR-92a-3p, indicating the importance of the verification of microarray results. [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 5
34, 45 A recent study of the miR-17/92 cluster and miR-106a/b has shown that miR-19 and miR-92a repress PTEN and TBR2, and suppress the transition from radial glial cells to intermediate progenitors, [46] and that miR-17 and 106a/b repress p38α (MAPK14), leading to increased neurogenic and suppressed gliogenic competences in mice. [score:5]
[1 to 20 of 1 sentences]
66
[+] score: 5
Sharifi et al (23) found that inhibition of miR-92a inhibited cell proliferation in human acute promyelocytic leukemia. [score:5]
[1 to 20 of 1 sentences]
67
[+] score: 5
A TEPA-PCL polycation liposome delivery system was used to deliver miR-92a into the angiogenic endothelial cells to inhibit tumor angiogenesis [32]. [score:3]
Ando H Development of a miR-92a delivery system for anti-angiogenesis -based cancer therapyJ. [score:2]
[1 to 20 of 2 sentences]
68
[+] score: 4
Subsequently, we analyzed miRNA content and found a number of immune-related miRNAs expressed in these vesicles, including miR-21, miR-30a, miR-92a, miR-99a and miR-223 (Fig 1e). [score:3]
Sequence bta-miR-21 MI0004742 AUGCUUAUCAGACUGAUGUUGACU bta-miR-30a MI0005054 UGUAAACAUCCUCGACUGGAAGC bta-miR-92a MI0009905 UAUUGCACUUCUGGGCCGGUCU bta-miR-99a MI0004751 AACCCGUAGAUCCGAUCUUGU bta-miR-223 MI0009782 UGUCAGUUUGUCAAAUACCCCA Bovine milk-derived EVs were isolated as described above. [score:1]
[1 to 20 of 2 sentences]
69
[+] score: 4
In addition, there were significant correlations between miR-92 expression, regional lymph node involvement and clinical stage of the tumor. [score:3]
In 2013, Guo et al. analyzed 50 serum samples from OvCa patients and 50 from healthy controls, and found that miR-92 levels were significantly higher in cancer patients [38]. [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 4
With ≥5,000 reads, the following four miRNAs were dominantly expressed in all these six libraries: miR-25-3p, miR-486-5p, miR-3107-5p, and miR-92a-3p (Supplementary File 1: Table S5). [score:3]
In addition to miR-486-5p and miR-3107-5p, which have ≥200000 sequence reads in all six libraries, miR-92a-3p and miR-25-3p were the third and fourth most abundant miRNA in (F)7d (22068 and 13644 reads, resp. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 4
Several miRNAs are upregulated and associated with tumorigenesis in ESCC, such as miR-21, miR-138, miR-223, miR-92a, miR-9, and mir-208. [score:4]
[1 to 20 of 1 sentences]
72
[+] score: 4
Atheroprotective flow causes a down-regulation of miR-92a in endothelial cells, which in turn elevates KLF2 mRNA [21]. [score:4]
[1 to 20 of 1 sentences]
73
[+] score: 4
For example, miR17|miR-92 cluster is overexpressed in Myc -induced tumor and regulates two genes involved in angiogenesis, TSP1 and CTGF [39]. [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 4
We previously reported a seven miR signature (miR-103, miR-494, miR-99b, miR-21, miR-224, miR-92a, and let-7a) specifically upregulated in ECs after radiation, hydrogen peroxide, and cisplatin treatment [7]. [score:4]
[1 to 20 of 1 sentences]
75
[+] score: 4
Down regulated expression of has-mir-16, and has-mir-92 and increased levels of has-mir-765 correlated with the severe TBI, however, their utility in diagnosing mTBI was limited [24]. [score:4]
[1 to 20 of 1 sentences]
76
[+] score: 4
Some of them, such as miR-30b, miR-92a, and miR-125b, have been reported to undergo intergender differences in expression during lung development [34]. [score:4]
[1 to 20 of 1 sentences]
77
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Similarly, within the differentially expressed pool of miRNAs, 10 were identified that are intimately involved in regulating intracellular trafficking pathways, including: miR-7b-5p, miR-9-5p, miR-31-5p, miR-92a-3p, miR-106-5p, miR-126-3p, miR-150-5p, miR-204-5p, miR-222-3p, and miR-322-5p (S2 Fig). [score:4]
[1 to 20 of 1 sentences]
78
[+] score: 4
The Molecule Activity Predictor (MAP), based on significantly deregulated miRNAs, suggests the inhibition of senescence (blue) and a concurrent increase of cell survival and viability (light orange) and DNA damage (dark orange), mainly due to the miRNAs let-7a, mir-17, mir-21, mir-34a, mir-92, mir-133a, mir-181a and mir-486 (Figure 6). [score:4]
[1 to 20 of 1 sentences]
79
[+] score: 3
However, exosomes derived from pleural fluid expressed much higher levels of the miR-17-92 and miR-106b-25 cluster members, with the exception of miR-25 and miR-92a (Figure 5B). [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
Other highly-expressed miRNAs include those of the miR-17∼92 cluster (miR-17, miR-20a, miR-19b, miR-92a) (Table 1 ). [score:3]
[1 to 20 of 1 sentences]
81
[+] score: 3
Other miRNAs from this paper: mmu-mir-92a-1, mmu-mir-92b
Furthermore, it was suggested that a positive correlation exists among human liver cancer stage, 8-OHdG levels, Ogg1 polymorphisms, ALT/GGT levels, telomerase activity, and overexpression of miR-92, a microRNA that plays a role in both the apoptotic process and the cellular proliferation pathways [39]. [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
Real-time PCR analyses showed a significant decrease of miR-17, miR-18a, miR-20a and miR-92a in bone tissues, reduction of all family members in bone marrow and reduced expression of miR-17, miR-18a, miR-19a, miR-20a and miR-92a could be observed in BMMSCs (Fig. 4A-C). [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
Elshafei A, Shaker O, Abd El-Motaal O, Salman T. The expression profiling of serum miR-92a, miR-375, and miR-760 in colorectal cancer: an Egyptian study. [score:3]
[1 to 20 of 1 sentences]
84
[+] score: 3
mmu-miR-92 was used as endogenous control. [score:1]
000412[miR-29a], 000413[miR-29b], 000430[miR-92]) specific for mature mmu-miR-29a, mmu-miR-29b and mmu-miR-92 was used. [score:1]
STAT1 (b) and miR-29a/b (c-d) levels were monitored using qRT-PCR and normalized to Gapdh (b) and miR-92a (c-d). [score:1]
[1 to 20 of 3 sentences]
85
[+] score: 3
Other miRNAs from this paper: mmu-mir-92a-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, mmu-mir-92b
3' UTR -dependent, miR-92 -mediated restriction of Tis21 expression maintains asymmetric neural stem cell division to ensure proper neocortex size. [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 3
Figure 1 MicroRNAs targeting p53: miR-125b, miR-504, miR-1285, miR-92, miR-141, miR-380-5p, miR-15a, miR-16, miR-25, miR-30d, miR-200a [reviewed in Ref. [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
Here, by sequence matching using bioinformatics analyses, we found quite a few of candidate miRNAs that target Bcl-2, including miR-429, miR-30, miR-22, miR-25, miR-32, miR-92, miR-363, miR-367, miR-99, miR-27, miR-128, etc. [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
Also, miR-92a, miR-15a, miR-126 were identified to target mRNAs corresponding to several proangiogenic proteins, such as FGF2 and VEGF [22, 24- 28]. [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Our results are also mostly in agreement with those of Esau et al. [25] who identified a similar expression pattern regarding miR-130b, miR-30c, miR-30a*, miR-191, miR-30d, miR-196, miR-30b, miR-19b, miR-92, miR-138 and miR-100 during differentiation of cultured human adipocytes. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
MicroRNA-92a upholds Bmp signaling by targeting noggin3 during pharyngeal cartilage formation. [score:2]
Interestingly, miR-92a also maintains BMP signaling during pharyngeal cartilage formation (Ning et al., 2013), suggesting a positive feedback loop between the miR-17-92 cluster and BMP signaling. [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 3
By contrast, the expressions of the malaria-responsive miR-92-3p and miR-126-3p are not significantly affected by infections, as it was also found by microarrays. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
Bma-let-7, bma-miR-1, bma-miR-9, bma-miR-92, and bma-miR-100b (white asterisks) share 100% identity with a host miRNA, while bma-miR-34 shows high identity with a host miRNA (21/23 nucleotides). [score:1]
Bma-let-7, along with four other B. malayi mature miRNAs found in ELVs (bma-miR-1, bma-miR-9, bma-miR-92, and bma-miR-100b), share perfect sequence identity with host (Homo sapiens) mature miRNAs, as shown in Fig 5B. [score:1]
Common markers include let-7, lin-4, miR-34, miR-71, miR-92, and miR-100c (Fig 7A and 7B). [score:1]
[1 to 20 of 3 sentences]
93
[+] score: 3
7 inhibited miR-19a at 95% and miR-92a at ~65% (Figure 10b). [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Murata K. Ito H. Yoshitomi H. Yamamoto K. Fukuda A. Yoshikawa J. Furu M. Ishikawa M. Shibuya H. Matsuda S. Inhibition of miR-92a enhances fracture healing via promoting angiogenesis in a mo del of stabilized fracture in young mice J. Bone Miner. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
A comparison of effects of ACTH and DEX shows that both hormones increased the expression miRNA-181b, miRNA-672, and miRNA-100, and significantly decreased the levels of miRNA-92a, and miRNA-466b. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
Recently published data indicates that miRs, such as miR-1/106, miR-125b, miR-146a, miR-223, miR-21, miR-144/145, miR-320, miR-494, and miR-92a, are involved in ischemic heart disease [1– 8]. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
Murakami et al. [48] showed a correlation between miR-222, miR-106a, miR-92, miR-17-5p, miR-20 and miR-18 and the degree of differentiation suggesting an involvement of specific miRNAs in the progression of the disease. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
Moreover, Li et al. showed that the miR-92a -induced erythroleukemia cell line, when overexpressing miR-17, displayed a significantly reduced proliferation rate, exhibited morphological features of apoptosis, and ultimately died 2 weeks post-transduction [16]. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
Out of the genes significantly downregulated at S2 in Jaki-treatment compared with the Ctl, we identified some key pluripotent genes, such as Nanog, Prdm14, Sall4, Tbx3, Tet1, Tfcp2l1, and miR92–2, which belongs to the pluripotent miRNA cluster 106a-363 [59– 61] (Fig. 4c, Additional file 4). [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
Several miRNAs from the MYCN -induced miR-17–92 cluster (miR-17-5p, miR-18-5p, miR-20a-5p and miR-92a-3p) were significantly upregulated in LSL- MYCN;Dbh-iCre tumors compared with normal adrenals from wild-type mice (Supplementary Figure 8b). [score:3]
[1 to 20 of 1 sentences]