Stem-loop mmu-mir-92a-2

Accession

MI0000580

Description

Mus musculus mmu-mir-92a-2 precursor miRNA

Literature search

131 open access papers mention mmu-mir-92a-2
(834 sentences)

Sequence

3764367 reads, 9532 reads per million, 107 experiments

ugcccauucauccacAGGUGGGGAUUGGUGGCAUUACuuguguuagauauaaagUAUUGCACUUGUCCCGGCCUGaggaagaaagaggguu
.((((.(((.(((.(((((.(((((.((((.((.(((((((((...)))).))))).)))))).))))).))))).))).)))...)))).

Structure

u    --a   a   a     G     U    G  U     -    u 
 gccc   uuc ucc cAGGU GGGAU GGUG CA UACuu gugu  
 ||||   ||| ||| ||||| ||||| |||| || ||||| |||| a
 uggg   aag agg GUCCG CCCUG UCAC GU AUgaa uaua  
u    aga   a   a     G     U    -  U     a    g 

Annotation confidence High

Genome context

chrX: 52741838-52741928 [-]

Clustered miRNAs

5 other miRNAs are < 10 kb from mmu-mir-92a-2

Mature mmu-miR-92a-2-5p

• Accession: MIMAT0004635
• Description: Mus musculus mmu-miR-92a-2-5p mature miRNA
• Sequence: 16 - AGGUGGGGAUUGGUGGCAUUAC - 37
• Evidence: experimental ; cloned [4], Illumina [5-6]

Mature mmu-miR-92a-3p

• Accession: MIMAT0000539
• Description: Mus musculus mmu-miR-92a-3p mature miRNA
• Sequence: 55 - UAUUGCACUUGUCCCGGCCUG - 75
• Evidence: experimental ; cloned [1,3-4], Northern [1], Illumina [5,7]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12919684
   Embryonic stem cell-specific MicroRNAs
   "Houbaviy HB, Murray MF, Sharp PA"
   "Dev Cell (2003) 5:351-358


3. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


4. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


5. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


6. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73