sort by

729 publications mentioning hsa-mir-200c (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-200c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 445
Overexpression of miR-200b reduced ZEB2 expression while overexpression of miR-200c reduced vimentin (VIM) expression (Fig. 6A). [score:9]
To determine if the observed changes in morphology of LY2 cells were due to reduced expression of ZEB1, ZEB2, and mesenchymal markers and increased expression of epithelial marker, ZEB1/2, E-cadherin, and vimentin mRNA expression was examined in LY2 cells overexpressing miR-200b or miR-200c (Fig. 6A). [score:9]
Knockdown of ZEB1 in LY2 cells recapitulated the effect of miR-200b and miR-200c overexpression resulting in inhibition of LY2 cell proliferation by TAM and fulvestrant, but not the aromatase inhibitor exemestane. [score:8]
Since miR-200 family members repress ZEB1 expression [27], [30] and ZEB1 is expressed in LY2 cells (Fig. 2), we used siRNA to knockdown ZEB1 expression in LY2 cells and examined cell proliferation by BrdU incorporation. [score:8]
B, In endocrine-resistant cells that have undergone EMT, miR-200 family expression is low, resulting in increased ZEB1 protein which inhibits E-cadherin expression. [score:7]
Overexpression of miR-200b and miR-200c inhibits expression of mesenchymal markers and increases E-cadherin in LY2 cells. [score:7]
miR-200 family members regulate EMT by suppressing expression of transcriptional repressors ZEB1/2. [score:6]
Overexpression of miR-200c reduced basal LY2 viability and fulvestrant, but not 4-OHT, further inhibited LY2 viability (Fig. 3). [score:5]
Treatment of MDA-MB-231 and BT549 breast and PC3 prostate cancer cells with 5-aza-dC, an inhibitor of DNA methylation, increased miR-200c and miR-141 expression [49]. [score:5]
Inhibitors of Deacetylation and Methylation Increase miR-200 Family Expression in LY2 Cells. [score:5]
Concomitant with the increase in miR-200b and miR-200c, ZEB1 expression was decreased and cells appeared more epithelial in morphology and were sensitized to TAM and fulvestrant inhibition. [score:5]
Notably, these cells exhibited higher expression of miR-221/222 and reduced expression of miR-200c, miR-203, and miR-205 [23]. [score:5]
Many studies have identified an inverse relationship between the expression of the miR-200 family and its targets ZEB1/2 in cells [27], [28], [29], [30], [31]. [score:5]
However, there was no further increase in the sensitivity of cells to inhibition by 4-OHT or fulvestrant after knockdown of miR-200b or miR-200c in MCF-7 cells as compared to the effect of 4-OHT and fulvestrant on control -transfected MCF-7 cells (Fig. 4B), indicating that other factors also contribute to the sensitivity of these cells to growth inhibition by antiestrogens. [score:5]
We report that transient overexpression of miR-200b and miR-200c in LY2 cells sensitized the cells to inhibition by antiestrogens TAM and fulvestrant (ICI 182,780). [score:5]
Converse experiments were performed using anti-miR miRNA inhibitors to bind and inhibit endogenous miR-200b or miR-200c activity in MCF-7 cells. [score:5]
To determine if decreased expression of miR-200 family members in LY2 cells is due to methylation and histone deacetylation, LY2 cells were treated with 2.5 µM 5-aza-dC alone or in combination with 100 ng/µl TSA, a histone deacetylase (HDAC) inhibitor, for 72 h. TSA was added in the last 16 h of the treatment period [52]. [score:5]
Overexpression of miR-200b or miR-200c partially restores antiestrogen sensitivity to LY2 cells, but other molecules and/or pathways known to be involved in antiestrogen-resistance such as coregulators [40], [41], [42], altered growth factor signaling [43], [44], [45], NFκB activation [46], [47], or other dysregulated microRNAs in addition to the miR-200 family [32] may also be involved in the phenotype of these cells. [score:5]
Further, miR-200b and miR-200c overexpression sensitized LY2 cells to growth inhibition by estrogen receptor (ER) antagonists TAM and fulvestrant. [score:5]
A, In endocrine-sensitive breast cancer cells, e. g., MCF-7, miR-200b and miR-200c are expressed, resulting in low ZEB1 protein expression. [score:5]
0062334.g009 Figure 9A, In endocrine-sensitive breast cancer cells, e. g., MCF-7, miR-200b and miR-200c are expressed, resulting in low ZEB1 protein expression. [score:5]
Overexpression of miR-200b and miR-200c reduced ZEB1 and increased E-cadherin (CDH1) expression. [score:5]
Further, miR-200 had pro-metastatic activity in a mouse mo del of breast cancer metastasis by targeting Sec23a, a suppressor of metastasis [68]. [score:5]
Further, overexpression of miR-200b and miR-200c also altered morphology of cells from a mesenchymal to an epithelial phenotype and reduced ZEB1/2 mRNA expression. [score:5]
Concomitant with the increased expression of miR-200b and miR-200c, there was a decrease in expression of ZEB1 mRNA with 5-aza-dC and TSA treatment (Fig. 8C). [score:5]
Our data indicate that reduced miRNA-200b and miR-200c expression contributes to endocrine resistance in breast cancer cells and that the reduced expression of these miR-200 family members in endocrine-resistant cells can be reversed by 5-aza-dC+TSA. [score:5]
Overexpression of miR-200b or miR-200c in LY2 Cells Enhances Inhibition by 4-OHT or Fulvestrant. [score:5]
Overexpression of miR-200b or miR-200c in LY2 cells altered cell morphology to a more epithelial appearance and inhibited cell migration. [score:5]
Overexpression of miR-200b and miR-200c enhanced the sensitivity of LY2 breast cancer cells to growth inhibition by antiestrogens 4-OHT and fulvestrant. [score:5]
Future experiments are needed to identify targets of miR-200b and miR-200c in antiestrogen sensitivity for targeted therapy. [score:5]
10 nM E [2] and 100 nM 4-OHT significantly decreased miR-200a and miR-200b expression in MCF-7 cells, but had no effect on miR-200c expression. [score:5]
In endocrine-sensitive luminal breast cancer cells, expression of miR-200 family members represses ZEB1, thus E-cadherin is expressed and vimentin is repressed and cells have an epithelial phenotype. [score:5]
Although studies have identified a role for miR-200 as a suppressor of EMT, there is little evidence for a role of miR-200 as a suppressor of endocrine resistance in breast cancer cells, hence the novelty of these data. [score:5]
Likewise, ectopic expression of miR-200c restored E-cadherin expression and reversed the mesenchymal phenotype in NMuMG (normal murine mammary epithelial cells) and 4TD7 breast carcinoma cells [29]. [score:5]
Our results show that there is an inverse relationship between the expression of miR-200 family expression and ZEB1 mRNA in LY2 cells. [score:5]
Values are the mean ± SEM of 3 experiments and are expressed as fold relative to EtOH -treated MCF-7. *p<0.05 versus EtOH -treated MCF-7. To examine if expression of miR-200 family members affects sensitivity of endocrine-resistant LY2 cells to antiestrogens, cells were transiently transfected with precursors for miR-200a, miR-200b, and miR-200c and MTT cell viability assays were performed in cells treated with vehicle control, 4-OHT, or fulvestrant for 6 days (Fig. 3A). [score:4]
As miR-200b and miR-200c share the same seed sequence [25], we suggest that the similarity in effects of miR-200b and miR-200c in enhancing antiestrogen-sensitivity and promoting a more epithelial cell morphology may be attributed to common target mRNAs involved in regulating cell morphology, such as genes encoding the actin cytoskeleton associated proteins WAVE3 and MSN (reviewed in [60]), but this speculation will require further research. [score:4]
Here we examined the expression of miR-200a, miR-200b, and miR-200c and their regulation by estradiol (E [2]) and 4-hydroxytamoxifen (4-OHT), an active TAM metabolite, in a panel of ERα -positive breast cancer cell lines derived from MCF-7 endocrine-sensitive cells representing a cellular mo del of progression towards endocrine/TAM-resistance. [score:4]
Microarray analysis of miRNA expression revealed low expression of miR-200a, miR-200b, and miR-200c in LY2 endocrine-resistant breast cancer cells compared to MCF-7 endocrine-sensitive breast cancer cells [32]. [score:4]
After 1, 5, or 11 d, RNA was isolated (as described above) to confirm knockdown or overexpression of miR-200b or miR-200c. [score:4]
This is the first report of 4-OHT regulation of miR-200 family expression in LCC1, LCC2, LCC9 and LY2 cells. [score:4]
Overexpression of miR-200b or miR-200c or knockdown of ZEB1 enhances sensitivity of LY2 cells to antiestrogens. [score:4]
Figure S1 Effect of E [2] and 4-OHT on the expression of miR-200 family members in MCF-7, LCC1, LCC2, LCC9, and LY2 cells. [score:3]
Expression of miR-200 Family in MCF-7, LCC1, LCC2, LCC9 and LY2 Human Breast Cancer Cells. [score:3]
However, there was no effect of E [2] and 4-OHT on the expression of miR-200 family in LCC2, LCC9 and LY2, reflecting their endocrine resistance. [score:3]
We suggest that in addition to being a biomarker for EMT, reduced miR-200 expression may serve as a prognostic marker in acquired endocrine resistance. [score:3]
Specific reduction of miR-200b and miR-200c expression was confirmed (Fig. 4A, Fig. S4). [score:3]
We report a progressive decrease in the expression of miR-200a, miR-200b, and miR-200c in an MCF-7-derived cell line mo del of TAM/endocrine resistance, i. e., decreasing from MCF-7, LCC1, LCC2, LCC9, to LY2, respectively. [score:3]
5-aza-dC and TSA increase miR-200b and miR-200c expression in LY2 cells. [score:3]
Increased miR-200a, miR-200b and miR-200c expression was confirmed by qPCR even 11 days after transfection, as well as earlier time points (Fig. S2 and data not shown). [score:3]
Resistance of pancreatic cancer cells to gemcitabine was reduced by treatment with natural compounds such curcumin, which increased miR-200 expression [56], [57], [58], [59]. [score:3]
Figure S5 Overexpression of miR-200 in transfected cells. [score:3]
Expression of miR-200 family members in MCF-7, LCC1, LCC2, LCC9 and LY2 cells. [score:3]
Previous studies reported the reversal of EMT in mesenchymal, triple -negative MDA-MB-231 breast cancer cells with miR-200c overexpression [31]. [score:3]
Cells were serum-starved for 48 h and then treated with vehicle control EtOH, 10 nM E [2], or 100 nM 4-OHT for 6 h. miR-200 expression was quantified by qPCR. [score:3]
Inhibition of miR-200b and miR-200c Activity does not Promote Resistance of MCF-7 Cells to Antiestrogens. [score:3]
Contrary to the expected decrease in miR-200 expression in metastatic cells, high levels of miR-200b and miR-200c were detected in 4T1 metastatic mouse mammary tumor cells [67]. [score:3]
LY2 cells were transfected with pre-miR-200a, pre-miR-200b, or pre-miR-200c for 3 d. RNA was harvested at 3 days and qPCR was used to confirm overexpression of miR-200. [score:3]
Overexpression of miR-200b or miR-200c in LY2 Reduces ZEB1 and Mesenchymal Markers and Increases E-cadherin. [score:3]
LY2 cells had undetectable levels of miR-200 family expression. [score:3]
RNA was harvested at 11 days and qPCR performed to confirm overexpression of miR-200b or miR-200c. [score:3]
LY2 cells overexpressing miR-200b or miR-200c displayed a change in morphology from a spindle-shaped or mesenchymal phenotype to a ‘cobblestone’ or epithelial phenotype (Fig. 5). [score:3]
Overexpression of miR-200b and miR-200c decreased wound healing, a result in agreement with findings in other cell types, e. g., miR-200c transfection of BT549 breast cancer and Hec50 endometrial cancer cells [48]. [score:3]
qPCR performed to confirm overexpression of miR-200a, miR-200b or miR-200c. [score:3]
miR-200 family members repress ZEB1 expression at the mRNA and protein levels [14], [26], [27], [28]. [score:3]
The expression of miR-200b, miR-200c or ZEB1 mRNA was determined by qPCR. [score:3]
These data suggest that methylation and deacetylation play a role in the reduced expression of miR-200b and miR-200c in LY2 cells. [score:3]
We and others previously reported that E [2] reduces miR-200 family expression in MCF-7 cells [32], [39]. [score:3]
For example, miR-200 family expression is a marker of poor prognosis and chemoresistance in ovarian cancer [64], [65], [66]. [score:3]
Overexpression of miR-200b and miR-200c, (Fig. S5, Fig. S6), altered LY2 cell morphology (Fig. 5, Fig. S7). [score:3]
miR-200 family expression was progressively reduced in a breast cancer cell line mo del of advancing endocrine/tamoxifen (TAM) resistance. [score:3]
Decreased miR-200 family expression in LY2 cells could be due to epigenetic changes in the promoter, e. g., DNA methylation and histone deacetylation. [score:3]
Our data showing a change in morphology and the decrease in N-cadherin, and to a lesser extent vimentin and Slug, of LY2 cells overexpressing miR-200b and miR-200c are in agreement with these observations, and are concordant with decreased ZEB1 and increased E-cadherin in these cells. [score:3]
Notably, there is an inverse relationship between the expression of miR-200 family and ZEB1 in LY2 cells (compare Fig. 1 and 2). [score:3]
Basal miR-200 and the effect of E [2] and 4-OHT on miR-200 expression was examined by qPCR in the cell lines described above (Fig. 1 and Fig. S1). [score:3]
Since overexpression of miR-200b and miR-200c enhanced antiestrogen-sensitivity of LY2 cells (Fig. 3A), we examined if these miRNAs affected cell morphology. [score:3]
Similarly, gemcitabine-resistant pancreatic cancer is associated with decreased miR-200 expression [55]. [score:3]
MCF-7 or LY2 cells were transfected with either miRNA inhibitors (Anti-miR [TM]s, Ambion, Austin, TX) or microRNA precursors (Pre-miR [TM]s, Ambion) for miR-200b or miR-200c using Lipofectamine RNAiMAX reagent (Invitrogen). [score:3]
The decreased miR-200b and miR-200c in endocrine-resistant LY2 cells, caused at least in part by gene methylation and histone deacetylation, results in increased ZEB1 which represses E-cadherin expression, resulting in EMT. [score:3]
For example, overexpression of miR-200b and miR-200c caused MET in mesenchymal breast cancer cell lines MDA-MB-231 and BT549 by repressing ZEB1 and ZEB2 [27], [30]. [score:3]
LY2 Cells Overexpressing miR-200b or miR-200c Exhibit Decreased Cell Motility. [score:3]
Concomitant with miR-200 decrease, there was an increase in ZEB1 mRNA expression. [score:3]
Figure S6 Overexpression of miR-200 family after 3d of transfection. [score:3]
Epigenetic changes in chromatin structure may be responsible for reduced expression of miR-200 family members in LY2 cells. [score:3]
Our study agrees with these reports of epigenetic silencing of the miR-200 family, because we demonstrated that treatment of LY2 cells with 5-aza-dC+TSA increased miR-200b and miR-200c expression. [score:3]
Overexpression of miR-200 family changes LY2 cell morphology from a mesenchymal to an epithelial appearance. [score:3]
There was no difference in basal miR-200a, miR-200b, or miR-200c expression between MCF-7 and LCC1 cells. [score:3]
In this study we report novel roles for miR-200b and miR-200c in inhibiting the sensitivity of endocrine-resistant LY2 breast cancer cells to 4-OHT and fulvestrant. [score:3]
At the protein level, miR-200b and miR-200c transfection had the greatest impact on N-cadherin (∼50% reduced expression), while vimentin and Slug were reduced to a lesser extent (Fig. 6B). [score:3]
Figure S2 Overexpression of miR-200b or miR-200c 11d after transfection of LY2 cells. [score:3]
Combined treatment with 5-aza-dC and TSA increased miR-200b and miR-200c (Fig. 8D, E), but did not alter the expression of ZEB1 in MCF-7 cells (Fig. 8F). [score:3]
0062334.g001 Figure 1Cells were serum-starved for 48 h and then treated with vehicle control EtOH, 10 nM E [2], or 100 nM 4-OHT for 6 h. miR-200 expression was quantified by qPCR. [score:3]
The combined treatment of LY2 cells with 5-aza-dC and TSA increased the expression of miR-200b and miR-200c (Fig. 8A and 8B). [score:3]
Reduced expression of the miR-200 family has been observed in breast, ovarian, endometrial, lung and gastric cancer [26]. [score:3]
Overexpression of miR-200b or miR-200c Changes LY2 Cell Morphology. [score:3]
These data are in agreement with other reports showing an inverse correlation between miR-200 family and ZEB1 expression in basal-like, triple negative breast cancer (TNBC) cells such as MDA-MB-231 and BT549 [14], [28], [30], [31]. [score:3]
Similarly, E [2] significantly decreased the expression of miR-200a, miR-200b, and miR-200c in estrogen-independent, but TAM-sensitive LCC1 cells. [score:3]
Demethylating agent 5-aza-2′-deoxycytidine (5-aza-dC) in combination with histone deacetylase inhibitor trichostatin A (TSA) increased miR-200b and miR-200c in LY2 cells. [score:3]
To determine if the loss of expression of miR-200b or miR-200c in LY2 affects cell motility, LY2 cells were transiently transfected with a negative control or with pre-miR-200b or pre-miR-200c and cell motility was examined by a wound healing assay (Fig. 7). [score:2]
Although miR-200 is considered a tumor suppressor miRNA, there are some reports of its role as an oncogene or oncomiR. [score:2]
Knockdown of miR-200b or miR-200c does not promote resistance of MCF-7 to 4-OHT or fulvestrant. [score:2]
Previously we reported that the expression of miR-200a, miR-200b, and miR-200c was lower in LY2 endocrine-resistant, mesenchymal breast cancer cells compared to parental, endocrine sensitive, epithelial MCF-7 breast cancer cells. [score:2]
Figure S4 Knockdown of miR-200b or miR-200c in MCF-7 cells. [score:2]
Surprisingly, knockdown of miR-200b and miR-200c reduced basal MCF-7 cell viability by ∼15–20% (Fig. 4B). [score:2]
However, LCC2 and LCC9 cells had lower miR-200 family member expression compared to MCF-7 cells. [score:2]
Commensurate with reports that miR-200b has a higher percentage of CpG methylation than miR-200c [12], we detected a lower increase in relative miR-200b compared to miR-200c expression in LY2 cells. [score:2]
miR-200b and miR-200c inhibit LY2 cell migration in a wound healing assay. [score:2]
A, CT values for miR-200b and miR-200c in the cells transfected as indicated for 1 or 5 d. Values are the mean ± SEM of 3 determinations. [score:1]
0062334.g006 Figure 6(A–C) LY2 cells were not transfected (Non-TF), Mock -transfected (RNAiMAX), or transfected with negative control, pre-miR-200b, or pre-miR-200c for 24 h before preparing RNA or WCE for subsequent analysis. [score:1]
The appearance of LY2 cells changed from an elongated/fibroblastic-appearance to a more epithelial or ‘cobble-stone’ shaped appearance with miR-200b and miR-200c transfection (Fig. 5C and D). [score:1]
Figure S7 LY2 cells were transfected with control Pre-miR miRNA negative control #1 (Ambion), pre-miR-200a, pre-miR-200b, or pre-miR-200c for 3 d. A–D. [score:1]
0062334.g003 Figure 3 A, LY2 cells were either untransfected (No TF) or transfected with negative control (Neg control) or pre-miR-200a, miR-200b or miR-200c. [score:1]
Members of the miR-200 family and miR-221/222 are implicated in EMT and metastasis [9]. [score:1]
Reduction in miR-200c abrogated the ability of E [2] to increase cell viability (Fig. 4B). [score:1]
These studies demonstrate that loss of miR-200 has roles in multiple types of drug resistance. [score:1]
0062334.g004 Figure 4MCF-7 cells were transfected with a negative control, anti-miR-200b, or anti-miR-200c. [score:1]
LY2 cells were transfected either with pre-miR-200a, pre-miR-200b or pre-miR-200c. [score:1]
Our results are in agreement with these data and indicate that LY2 cells assume a more epithelial-like morphology with miR-200b or miR-200c transfection. [score:1]
LY2 cells were plated in six-well plates in phenol red-free IMEM +5% DCC-FBS for 24 h. Cells were transfected with a negative control or with pre-miR-200b or pre-miR-200c (see above) for 24 h. Cells were wounded by scratching with a p200 pipette tip and then washed with medium to remove displaced cells. [score:1]
CT values for miR-200b and miR-200c in the cells transfected as indicated for 1 or 5 d. Values are the mean ± SEM of 3 determinations. [score:1]
There were no statistical differences between cells transfected with pre-miR-200b versus pre-miR-200c. [score:1]
LY2 cells were transfected with negative control, pre-miR-200a, pre-miR-200b, or pre-miR-200c. [score:1]
The miR-200 family of miRNAs are transcribed from two chromosomal locations: miR-200b, miR-200a, and miR-429 are located on chromosome 1p36; while miR-200c and miR-141 are located on chromosome 12p13 [14]. [score:1]
CpG island methylation of miR-200c/miR-141 promoter was reported in breast and prostate cancer cells [49], [50], [61]. [score:1]
MCF-7 cells were transfected with a negative control, anti-miR-200b, or anti-miR-200c and RNA was harvested 1 or 5 d after transfection. [score:1]
The decrease in miR-200b and miR-200c also results in increased N-cadherin, vimentin, and Slug, hallmarks of the mesenchymal phenotype. [score:1]
A, LY2 cells were either untransfected (No TF) or transfected with negative control (Neg control) or pre-miR-200a, miR-200b or miR-200c. [score:1]
Our results reveal novel roles for miR-200b and miR-200c in conferring antiestrogen sensitivity to endocrine-resistant breast cancer cells (summarized in Fig. 9). [score:1]
We observed greatly reduced ZEB1 protein and a concomitant increase in E-cadherin protein in LY2 cells transfected with pre-miR-200b or pre-miR-200c (Fig. 6C). [score:1]
To follow up on this initial observation, the expression of miR-200a, miR-200b and miR-200c was measured by qPCR in a panel of human breast cancer cell lines, i. e., LCC1, LCC2 and LCC9 cells that were derived from the parental MCF-7 cell line by propagation first as a xenograft in ovariectomized, athymic nude mice (LCC1), and then in long-term culture with tamoxifen (LCC2) or fulvestrant (LCC9) [33]. [score:1]
MCF-7 cells were transfected with a negative control, anti-miR-200b, or anti-miR-200c. [score:1]
Mo del of function of miR-200 family members in endocrine resistance in breast cancer cells. [score:1]
LY2 cells were either non -transfected (A), or transfected with control Pre-miR miRNA negative control #1 (Ambion) (B), pre-miR-200b (C), or pre-miR-200c (D) for 72 h. Images of LY2 cells captured using a light microscope (20× magnification, bar = 200 µm). [score:1]
A previous report showed that transfection of MDA-MB-231 cells with pre-miR-200b or pre-miR-200c enhanced their sensitivity to doxorubicin [53], but the data summarized here are the first to indicate roles for miR-200b and miR-200c in antiestrogen sensitivity. [score:1]
These studies reflect cell context-specific roles for miR-200 family members that require further study. [score:1]
0062334.g005 Figure 5 LY2 cells were either non -transfected (A), or transfected with control Pre-miR miRNA negative control #1 (Ambion) (B), pre-miR-200b (C), or pre-miR-200c (D) for 72 h. Images of LY2 cells captured using a light microscope (20× magnification, bar = 200 µm). [score:1]
A role for miR-200 family in drug resistance, i. e., paclitaxel, was reported in ovarian cancer [54]. [score:1]
Other studies reported a reversal of EMT in aggressive breast cancer cell lines transfected with miR-200c or miR-141 [14], [29], [30], [31]. [score:1]
0062334.g007 Figure 7 LY2 cells were plated in a 6-well plate (3000 cells/well), transfected with negative control, pre-miR-200b, or pre-miR-200c for 24 h. Cells were wounded by scratching using a p200 pipette tip at time zero (0 h). [score:1]
Taken together, these results indicate that reduction of miR-200b and miR-200c contributes to the increase in ZEB1, N-cadherin, vimentin, and Slug and the reduction in E-cadherin in LY2 cells. [score:1]
Previous studies reported that the CpG island near the miR-200c/miR-141 transcription start site is methylated in fibroblasts and tumors cells that are miR-200c or miR-141 -negative [12], [49], [50]. [score:1]
LY2 cells were plated in a 6-well plate (3000 cells/well), transfected with negative control, pre-miR-200b, or pre-miR-200c for 24 h. Cells were wounded by scratching using a p200 pipette tip at time zero (0 h). [score:1]
LY2 cells were untransfected or transfected with a negative control, pre-miR-200b, or pre-miR-200c for 48 h (see above). [score:1]
Our results indicate a role for loss of miR-200 family members and increased ZEB1 in conferring resistance to antiestrogens in breast cancer. [score:1]
[1 to 20 of 144 sentences]
2
[+] score: 369
Up-regulated miR-200c expression levels enhanced E-cadherin protein expression, but inhibited N-cadherin protein expression, and that down-regulated miR-200c expression levels inhibited E-cadherin protein expression, but enhanced N-cadherin protein expression (Figure 3B). [score:23]
Figure 4 USP25 expression is downregulated by miR-200c directly targeting of the 3’-UTR of USP25. [score:9]
For the experimental metastasis mouse xenograft mo del, SPC-A-1 cells transfected with miR-control,miR-200c inhibitor lentiviral vector, SPC-A-1sci cells stably expressing miR-control, miR-200c lentiviral vector, knocked-down USP25 expression, the negative control were inoculated into the tail vein of five-week-old BALB/C-nu/nu nude mice(N = 12). [score:8]
The potential regulatory targets of miR-200c were determined by prediction tools, correlation with target protein expression, and luciferase reporter assay. [score:7]
These findings indicate that miR-200c exerts tumor-suppressive effects for NSCLC through the suppression of USP25 expression and suggests a new therapeutic application of miR-200c in the treatment of NSCLC. [score:7]
The down-regulation of only three of these genes: USP25, PKIA, and SMURF2, following ectopic miR-200c up-regulation in SPC-A-1sci, could be confirmed by real-time PCR analysis (Figure 4B and Additional file 4: Figure S4A). [score:7]
We searched for the potential regulatory targets of miR-200c by considering the up-regulated genes from the gene chip and using prediction tools, including miRNAMap, miRanda, and PicTar (Figure 4A). [score:7]
On the basis of the results showing the suppression of miR-200c expression in high metastatic NSCLC cells, loss- and gain-of-function studies of miR-200c were conducted using a transient transfection strategy with miR-200c mimics or inhibitors (Additional file 1: Figure S1A and B). [score:7]
For spontaneous metastasis mouse mo del,SPC-A-1sci cells stably expressing miR-control, miR-200c lentiviral vector, knocked-down USP25 expression, the negative control were injected subcutaneously into the right upper flank region of five-week-old NOD/SCID mice(N = 10). [score:6]
We analyzed the expression of ZEB1 by qRT-PCR and western blotting, the results showed that a corresponding reduction in mRNA and protein levels were also detectable for ZEB1 in response to miR-200c up-regulation in SPC-A-1sci cells. [score:6]
Taken together, these results showed that miR-200c could suppress EMT by directly targeting ZEB1. [score:6]
To test this assumption, we investigated whether miR-200c inhibited USP25 mRNA and protein levels, then found that up-regulation of miR-200c led to a significant decrease in USP25 mRNA and protein levels, thereby suggested that USP25 was a functional target of miR-200c. [score:6]
Further studies revealed that USP25 was a downstream target of miR-200c in NSCLC cells as miR-200c bound directly to the 3’-untranslated region of USP25, thus reducing both the messenger RNA and protein levels of USP25. [score:6]
Evidence has emerged that miR-200c directly targets one of the major EMT transcription factor ZEB1 and in turn suppresses EMT. [score:6]
As part of our research on how the miR-200c affects NSCLC metastasis, several bioinformatics tools for screening putative miRNA target genes were used, including miRNAMap, PicTar and miRanda and up-regulated genes in gene chip. [score:6]
To determine whether USP25 was critical mediators of miR-200c’s role in cellular invasion, we confirmed that the knock-down of USP25 expression levels by siRNA in A549, H1299 and SPC-A-1sci cells, siRNA remarkably reduced the expression of USP25 levels protein (Figure 5A). [score:6]
Lastly, we found a low level of miR-200c tended to express high levels of USP25, whereas tumors with a high level of miR-200c tended to express low levels of USP25. [score:5]
To determine if miR-200c directly targets the 3’UTRs of USP25, PKIA, and SMURF2, we constructed vectors containing the full-length wild-type or mutant 3’-UTR of USP25, PKIA, SMURF2 directly fused to the downstream of the firefly luciferase gene (Figure 4C and Additional file 4: Figure S4B). [score:5]
The miR-200c was determined by real-time PCR analysis after SPC-A-1 transfected with miR-control inhibitor or miR-200c inhibitor lentiviral vector, and SPC-A-1sci cells were transfected with the miR-control or miR-200c lentiviral vector. [score:5]
These findings indicated that the invasion suppression effect of miR-200c was at least partly mediated through a decrease in USP25 expression. [score:5]
We demonstrated that over -expression of miR-200c inhibited NSCLC cells migration, invasion, epithelial-mesenchymal transition (EMT) in vitro and lung metastasis formation in vivo. [score:5]
To determine how the low level of miR-200c expression contributes to the invasion and metastasis of NSCLC cells, we examined the global mRNA expression profile of SPC-A-1sci and SPC-A-1 cells. [score:5]
Conversely, increased mRNA and protein expressions for USP25 and SMURF2 were also demonstrated following transfection with the miR-200c inhibitor in SPC-A-1 cells (Figure 4E and Additional file 4: Figure S4E). [score:5]
Figure 2 Overexpression of miR-200c suppress NSCLC cells metastases in vivo. [score:5]
Conversely, increased mRNA and protein expressions for ZEB1 were also demonstrated following transfection with the miR-200c inhibitor in SPC-A-1 cells (Additional file 3: Figure S3A and B). [score:5]
The result revealed tumors with a low level of miR-200c tended to express high levels of USP25, whereas, tumors with a high level of miR-200c tended to express low levels of USP25 (Figure 7I). [score:5]
To address this possibility, SPC-A-1 transfected with miR-200c inhibitor or miR-control inhibitor lentiviral vector, SPC-A-1sci with miR-200c or miR-control lentiviral vector were inoculated into nude mice through the lateral tail vein (Additional file 2: Figure S2). [score:5]
Statistically significant associations between the miR-200c expression level and clinical stage and between the miR-200c expression level and NSCLC metastasis were observed in this study. [score:5]
These observations suggest that miR-200c directly suppresses USP25 -mediated cell invasion. [score:4]
Click here for file Over -expression of miR-200c in USP25 knockdown SPC-A-1sci cells decreased the invasion and migration ability. [score:4]
Over -expression of miR-200c in USP25 knockdown SPC-A-1sci cells decreased the invasion and migration ability. [score:4]
Knockdown of USP25 by siRNA in A549, H1299, and SPC-A-1sci cells inhibited cell migration and invasion in vitro, which fell to levels similar to those observed after transfection with the miR-200c mimics (Figure 5B-D). [score:4]
Moreover, over -expression of miR-200c in USP25 knockdown SPC-A-1sci cells were conducted using a transient transfection strategy with miR-200c mimics (Additional file 6: Figure S6A). [score:4]
In this study, we provided first-time evidence that when significantly down-regulated miR-200c promoted NSCLC cell invasion and migration, at least partly through the induction of USP25, which was a potential metastasis promoter in NSCLC. [score:4]
Hence, it appears that miR-200c negatively regulates tumor metastasis in NSCLC patients by targeting USP25. [score:4]
USP25 is a direct target of miR-200c during NSCLC metastasis. [score:4]
In the current study, we found that knockdown of USP25 expression reduced NSCLC cell metastasis similar to that of the restoration of miR-200c. [score:4]
The finding that miR-200c was downregulated in metastatic SPC-A-1sci cells was intriguing, because decreased miR-200c levels have been reported in several other types of tumor [21, 23- 25], thus indicating that decreased miR-200c may be a common event in the tumorigenesis. [score:4]
These findings have implications for new mechanisms of miR-200c mediated regulation of lung cancer, and suggest that miR-200c may be a potential therapeutic target for human NSCLC. [score:4]
A corresponding reduction at the protein levels was also detectable by for USP25 and SMURF2 in response to miR-200c up-regulation. [score:4]
In contrast, more rounded cells became spindle-shaped in SPC-A-1 cells transfected with miR-200c inhibitor lentiviral vector (Figure 3A). [score:3]
miR-200c, and USP25 expression in NSCLC. [score:3]
These data supported decreased miR-200c expression in NSCLC was associated with advanced clinical stage, lymph node metastasis. [score:3]
On the other hand, silencing of miR-200c by transfecting the miR-200c inhibitor into the SPC-A-1 cells increased cell invasion and migration ability (Figure 1G). [score:3]
Figure 1 Correlation analysis of miR-200c expression and invasion capacity. [score:3]
Other target genes of miR-200c. [score:3]
We asked whether expression of miR-200c would also affect metastatic behaviors in vivo. [score:3]
However, for miR-200c, the potential roles and related target genes in NSCLC metastasis are still not well elucidated. [score:3]
A typical morphological change of SPC-A-1sci, SPC-A-1 was noted after treatment with miR-200c lentiviral vector or miR-200c inhibitor lentiviral vector. [score:3]
Based on the similar results of experiments using NSCLC cell lines and xenograft mo dels, it appears that the decreased expression of miR-200c would promote NSCLC invasion and metastasis through USP25. [score:3]
The expression levels of miR-200c were higher in the SPC-A-1, XL-2, H460, and H358 cell lines than in the A549, H1299, and SPC-A-1sci cell lines (Figure 1A). [score:3]
In H1299 cells miR-200c targets multiple non-small cell lung cancer prognostic markers DLC1, ATRX, and HFE [33]. [score:3]
The results verified that the miR-200c expression level in NSCLC tissues was lower than that in non-tumor tissues (Figure 7A). [score:3]
We demonstrated that USP25 was a critical downstream target of miR-200c. [score:3]
Moreover, our results suggest that decreased miR-200c levels promoted, increased miR-200c levels inhibited NSCLC cell migration and invasion in vitro and metastasis in vivo. [score:3]
To demonstrate the contribution of USP25 to the biological function of miR-200c, we examined whether the co-transfection of si-USP25 had an effect on miR-200c -inhibitor -induced cell migration and invasion in SPC-A-1 cells (Figure 5E). [score:3]
The miR-200c mimics, and miR-200c inhibitors that were used in this study were synthesized by Ribobio (Guangzhou, China). [score:3]
The mRNA expression levels of miR-200c and USP25 were examined in NSCLC cell lines and patient specimens using quantitative reverse transcription-PCR. [score:3]
The miR-200c lentiviral vector, miR-200c inhibitor lentiviral vector and miR-control lentiviral vector were synthesized by Genepharma. [score:3]
After twelve weeks, the results showed that increased expression of miR-200c impaired NSCLC cells the formation of metastases (Figure 2). [score:3]
Silencing of the USP25 gene recapitulated the effects of miR-200c over -expression. [score:3]
Therefore, the expression of miR-200c may affect the invasion and migration of human NSCLC cells in vitro. [score:3]
The expression of miR-200c was negatively correlated with the invasion and migration of NSCLC cell lines in vitro. [score:3]
We focused on the effect of miR-200c on NSCLC metastasis and showed that miR-200c acted as a tumor suppressor during NSCLC metastasis. [score:3]
Click here for file Other target genes of miR-200c. [score:3]
To determine the potential clinicopathological implications of altered miR-200c expression, we investigated the expression levels of miR-200c in 73 NSCLC tissues and non-tumor tissues by qRT–PCR. [score:3]
Moreover, SPC-A-1sci cells stably expressing miR-control or miR-200c lentiviral vector were injected subcutaneously into the right upper flank region of five-week-old NOD/SCID mice. [score:3]
Over -expression of miR-200c impairs the formation of metastases of NSCLC cells in vivo. [score:3]
In contrast, E-cadherin and N-cadherin were decreased and increased, respectively, in miR-200c -inhibitor -treated SPC-A-1 cells (Figure 3C). [score:3]
The results showed that the miR-200c expression level in NSCLC tissues was lower than that in non-tumor tissues, and negatively associated with advanced clinical stage, lymph node metastasis. [score:3]
All cell lines higher -expressing miR-200c (SPC-A-1, XL-2, H460, and H358) showed fewer cells than the cell lines with low levels of miR-200c (A549, H1299, and SPC-A-1sci) (Figure 1B,C). [score:3]
The expression of miR-200c was lower in NSCLC patients with lymphatic metastasis, distant metastasis than in those without lymphatic metastasis (Figure 7B). [score:3]
These observations reveal that miR-200c can inhibit the EMT of NSCLC cells. [score:3]
MiR-200c suppresses the migration and invasion of NSCLC cells in vitro. [score:2]
Lastly, the dual-luciferase reporter assays suggested that USP25 was one of the functional downstream targets of miR-200c. [score:2]
Next, we investigated which, if any, miR-200c direct targeted mediate the capacity for cellular invasion. [score:2]
We compared the global miRNA profiles of SPC-A-1sci and SPC-A-1 cell, and revealed low expression levels of miR-200c had influence on the invasion and migration ability of NSCLC cell lines [19]. [score:2]
Taken together, our results suggest that miR-200c is a negative regulator for NSCLC metastasis. [score:2]
Figure 3 miR-200c regulated the epithelial-mesenchymal transition (EMT). [score:2]
MiR-200c expression modulates the epithelial-mesenchymal transition (EMT). [score:2]
After twelve weeks, lung metastasis was apparent in mice injected SPC-A-1 transfected with miR-200c inhibitor lentiviral vector compared with negative control cells. [score:2]
The numbers of lung metastasis nodules were significantly increased in miR-200c inhibitor lentiviral vector group, decreased in miR-200c lentiviral vector group, respectively, when compared with control group (Figure 2C). [score:2]
The activity of miR-200c in relation to EMT- associated phenotypes has been extensively studied [34]. [score:1]
The invasion and migration ability of USP25 knockdown SPC-A-1sci cells transfected with miR-200c mimics were significantly decreased when compared with the invasion and migration ability of the control cells (Additional file 6: Figure S6B). [score:1]
The results shown miR-200c significantly decreased the relative luciferase activity of wild-type USP25 and SMURF2 3’-UTR, whereas the reduction of the luciferase activity with mutant USP25, SMURF2 of 3’-UTR was not as sharp as that observed in the wild-type counterpart. [score:1]
E-cadherin and N-cadherin were increased and decreased, respectively, in miR-200c-transduced SPC-A-1sci cells. [score:1]
Given their described roles, USP25 and SMURF2 seemed plausible candidates to shape the miR-200c -mediated invasion and migration of NSCLC cells. [score:1]
Other reports showed serum miR-200c associated with poor prognosis in patients with lung cancer [32]. [score:1]
For example, miR-155, miR-222, miR-210, miR-107, and miR-10a have a role in pancreatic cancer [7- 9], miR-148a, miR-23a, and miR-193a in hepatocellular carcinoma [10- 12], and miR-200, miR-218 in gastric cancer [13, 14]. [score:1]
To clarify the significance of miR-200c in human NSCLC metastasis, we investigated the expression of miR-200c in7 human NSCLC cell lines by qRT-PCR. [score:1]
Click here for file Real-time PCR demonstrated miR-200c levels. [score:1]
In the current study, we also found miR-200c was associated with EMT. [score:1]
These findings indicate that miR-200c may function importantly in human carcinogenesis. [score:1]
Together, these findings suggest that miR-200c functions as a key mediator of metastasis in NSCLC. [score:1]
Clinical analysis indicated that miR-200c was negatively correlated with clinical stage, lymph node metastasis in NSCLC patients. [score:1]
Growing evidence indicates that miR-200c is involved in carcinogenesis and tumor progression in non-small-cell lung cancer (NSCLC). [score:1]
Recently, miR-200c has been reported in several tumors, including breast cancer, lung cancer, esophageal cancers, colorectal cancer, and pancreatic cancer [21- 25]. [score:1]
Real-time PCR demonstrated miR-200c levels. [score:1]
Further analysis showed that miR-200c levels were significantly lower in the NSCLC patients with clinical advanced stage (3/4AB) than early-stage (1/2AB) (Figure 7C), but did not correlate with tumor size (Figure 7D). [score:1]
To determine whether any of them were critical mediators of miR-200c’s role in cellular invasion, we silenced SMURF2 using RNA interference (RNAi) in SPC-A-1sci cell lines (Additional file 5: Figure S5A, B). [score:1]
The wild-type or mutant vector was co -transfected into HEK-293T cells with miR-200c mimics or miR-control. [score:1]
Figure 7 Clinical validation of miR-200c and USP25. [score:1]
USP25 has a critical role in miR-200c -mediated invasion and migration of NSCLC cells. [score:1]
[1 to 20 of 103 sentences]
3
[+] score: 333
Other miRNAs from this paper: hsa-mir-17, hsa-mir-21, hsa-mir-200b, hsa-mir-200a
The miR-200c inhibitor restore the activity of miR-200c to IL-6, IL-8, and CCL-5To further confirm if miR-200c directly targets 3’UTR of these mediators, the luciferase activity inhibited by miR-200c was determined after treatment with a plasmid-base miR inhibitor system (PMIS) designed to bind miR-200c (PMIS-200c). [score:10]
We have previously reported that miR-200c targets Noggin 3’UTR and down-regulates Noggin expression in dental epithelial cells [28]. [score:8]
To further confirm if miR-200c directly targets 3’UTR of these mediators, the luciferase activity inhibited by miR-200c was determined after treatment with a plasmid-base miR inhibitor system (PMIS) designed to bind miR-200c (PMIS-200c). [score:8]
miR-200c directly targets the 3’UTR of IL-6, IL-8, and CCL-5. miR-200c directly targets the 3’UTR of IL-6, IL-8, and CCL-5.. [score:7]
We found that overexpression of miR-200c in the human preosteoblast cell line effectively suppresses multiple proinflammatory mediators, including IL-6, IL-8, and CCL-5, and increases OPG (an osteoclastogenesis inhibitor) and osteocalcin (OCN) and calcium content. [score:7]
miR-200c directly targets the 3’UTR of IL-6, IL-8, and CCL-5To test if miR-200c directly targets these mediators the 3’UTR sequence was cloned after the luciferase gene and luciferase activity was determined with and without miR-200c present. [score:7]
While miR-200c is downregulated in gingival tissues of periodontitis patient, its function and underlying mechanism(s) in this chronic inflammatory disease are less understood. [score:6]
In addition, we observed that the up-regulated content of miR-200c expression is dose -dependent according to PEI- miR-200c nanoplex treatment. [score:6]
In addition, miR-200c has been found to effectively inhibit Noggin, an antagonist of BMP signals, by directly targeting the 3’UTR of Noggin [28]. [score:6]
miR-200c is significantly downregulated in gingival tissues of periodontitis patients [24] and has been demonstrated to participate in signal pathways mediated by multiple proinflammatory factors and repress the expression and activity of NF-kB [24– 27]. [score:6]
Another report indicated that miR-200c may target an NF-κB up-regulated TrkB/NTF3 autocrine signaling loop in breast tumors [27]. [score:6]
miR-200c targets a NF-κB up-regulated TrkB/NTF3 autocrine signaling loop to enhance anoikis sensitivity in triple negative breast cancer. [score:6]
We observed that overexpression of miR-200c upregulated OCN and calcium content in human preosteoblast cells. [score:6]
In this study, although the effect mediated by miR-200c on the regulation of the p65/p50 subunits of NF-kB was not observed (data not shown), we have shown that, miR-200c effectively inhibits IL-8 expression in human preosteoblasts and periodontal ligament fibroblast under the stimulation of a bacterial endotoxin by binding to the IL-8 3’UTR. [score:6]
In this study, we also observed miR-200c inhibition of Noggin expression in human bone marrow MSCs (data not shown). [score:5]
miR-200c may also reduce IL-8 expression by targeting IKBKB in NF-kB signal pathway [32]. [score:5]
Thus, the inhibitory effects mediated by miR-200c indicate that this miR may be potentially developed into a therapeutic tool for these diseases. [score:5]
To construct the miR inhibitor clone vector, we replaced the miR-200c binding site with two BsmBI sites in the most effective inhibitor design. [score:5]
These results further indicated the inhibitory effects of IL-6, IL-8 and CCL-5 mediated by miR-200c by targeting their 3’ UTRs. [score:5]
0160915.g006 Fig 6 miR-200c directly targets the 3’UTR of IL-6, IL-8, and CCL-5. A: The sequence and miR-200c binding region located in the 3’UTR and mutated 3’UTR of IL-6, IL-8, and CCL-5. B-D: Normalized luciferase activities of the 3’ UTR IL-6, IL-8, and CCL-5-luciferase reporters and their 3’UTR-mutated-luciferase reporters treated with empty vector or miR-200c. [score:4]
IL6 -mediated suppression of miR-200c directs constitutive activation of inflammatory signaling circuit driving transformation and tumorigenesis. [score:4]
Rokavec et al. reported that miR-200c suppression may direct the constitutive activation of inflammatory signaling circuit in transformation and tumorigenesis [25]. [score:4]
Our Gene analysis indicated that miR-200c may directly target the 3’UTR of these mediators. [score:4]
To test if miR-200c directly targets these mediators the 3’UTR sequence was cloned after the luciferase gene and luciferase activity was determined with and without miR-200c present. [score:4]
We reported that miR-200c directly targets the 3’UTR of IL-6, IL-8 and CCL-5. These data indicate the usefulness of miR-200c in prevention and restoration for periodontitis -induced bone loss, with the ability to modulate inflammation and bone formation. [score:4]
The reporter gene analysis also demonstrated that miR-200c effectively targets the 3’UTR of IL-6 and CCL-5. As IL-6, IL-8 and CCL-5 major proinflammatory mediators having critical roles in inflammation, these results strongly suggest that miR-200c possesses a powerful capacity to reduce inflammation via post-transcriptional regulation of these proinflammatory mediators. [score:4]
Therefore, comparison between HEPM cells transfected with miR-200c to the cells with scrambled miRs would be more reliable and accurate to determine the function of miR-200c overexpression in HEPM cells. [score:3]
miR-200c delivered using PEI nanoparticles inhibits IL-6, IL-8, and CCL-5 in periodontal ligament cellsAfter primary human periodontal ligament fibroblasts were treated with PEI- miR-200c at different concentrations, the cells were cultured using DMEM with LPS supplement (1μg/ml) for up to 32 hours. [score:3]
After 2 days miR-200c expression was detected using real-time PCR in periodontal ligament fibroblasts (Fig 4B). [score:3]
In this study we observed that, for the first time, overexpression of miR-200c effectively represses multiple proinflammatory mediators, including IL-6, IL-8 and CCL-5, in a human preosteoblast cell line. [score:3]
Briefly, to construct different designs of miR inhibitors for miR-200c and miR-17-18, we annealed and ligated the miR-200c or miR-17-18 binding sites with a central bulge flanked by different sequences into pLL3.7 vector (Addgene) digested with HpaI and XhoI. [score:3]
Overexpression of miR-200c may also promote OPG and improve osteogenic differentiation in this cell line. [score:3]
Thus, we can maximize the effects of miR-200c by optimizing the PEI- miR-200c nanoplex concentration and its expression level. [score:3]
The miR-200c inhibitor restore the activity of miR-200c to IL-6, IL-8, and CCL-5. PMIS-200c reduces binding activity of miR-200c to the 3’UTR of IL-6, IL-8, and CCL-5 and the function of miR-200c. [score:3]
In this study, we observed that the secreted amounts of IL-6, IL-8, and CCL-5 increased with the dose of transfection of plasmid DNA, which indicates that the cellular inflammation response and inhibitory effects can be mediated by miR-200c in response to the stimulation by bacterial endotoxin. [score:3]
The level of miR-200c expression measured using real-time PCR was approximately 2x10 [4]-fold higher in HEPM cells infected with miR-200c than in non -treated control cells and the cells transfected with scrambled miRs, while there was limited miR-200c expression in non -treated HEPM cells and the cells with scrambled miRs (Fig 1B). [score:3]
The amounts of IL-8 in the culture medium of the cells with miR-200c overexpression were significantly lower than cells with scrambled miRs at each time point (Fig 2C). [score:3]
Similarly, the amount of IL-6 secreted by the cells with miR-200c overexpression in culture medium was lower (3–4 fold) than that of cells with scrambled miRs after 24 hours (Fig 2D). [score:3]
In addition, although LPS treatment didn’t effectively increase CCL-5 production in HEPM cells, the cells with overexpression of miR-200c produced significantly lower CCL-5 (approximately 20-fold) than the cells with scrambled miRs (Fig 2E). [score:3]
miR-200c delivered using PEI nanoparticles inhibits IL-6, IL-8, and CCL-5 in periodontal ligament cells. [score:3]
0160915.g008 Fig 8Enhancement of osteogenic differentiation of human bone marrow MSCs with overexpression of miR-200c using PEI nanoparticles. [score:3]
A: Images of ALP and von-Kossa staining in MSCs overexpressing miR-200c, one and two weeks after treatment with osteogenic medium. [score:3]
The osteogenic differentiation biomarkers and proinflammatory mediators in HEPM cells, human periodontal ligament fibroblasts, and MSCs with overexpressing miR-200c were analyzed by one-way ANOVA with Fisher's LSD post hoc test, using commercially available statistics software (SPSS Inc. [score:3]
miR-200c delivered using PEI effectively inhibited IL-6, IL-8, and CCL-5 in periodontal ligament fibroblasts and enhanced osteogenic differentiation of human bone marrow MSCs in vitro. [score:3]
miR-200c delivered using PEI nanoparticles inhibits IL-6, IL-8, and CCL-5 in primary human periodontal ligament fibroblasts. [score:3]
Enhancement of osteogenic differentiation of human bone marrow MSCs with overexpression of miR-200c using PEI nanoparticles. [score:3]
The expressions of miR-200c in non -treated periodontal ligament fibroblasts and bone marrow MSCs were similar to that of the cells treated with empty vector. [score:3]
miR-200c expression doesn’t affect cell morphology and proliferation. [score:3]
miR-200c overexpression in HEPM cells and the effects on their proliferation. [score:3]
miR-200c delivered using PEI nanoparticles inhibited IL-6, IL-8, and CCL-5 in primary human periodontal ligament fibroblasts and improved osteogenic differentiation of primary human bone marrow MSCs. [score:3]
Moreover, we demonstrated that miR-200c effectively reduces IL-6 and CCL-5 expression in human preosteoblasts and periodontal ligament fibroblasts. [score:3]
0160915.g005 Fig 5 miR-200c delivered using PEI nanoparticles inhibits IL-6, IL-8, and CCL-5 in primary human periodontal ligament fibroblasts. [score:3]
B: Fold change of miR-200c expression in non -treated HEPM cells and the cells with miR-200c and scrambled miRs. [score:3]
miR-200c dose -dependent expression was also observed in human bone marrow MSCs (Fig 4C). [score:3]
The amount of OPG secreted by the cells with miR-200c overexpression with or without LPS supplement were higher (6–8 folds) than that of cells with scrambled miRs after 32 hours (Fig 2F). [score:3]
Inhibition of proinflammatory mediators also partially explains the function of miR-200c on enhancing bone formation. [score:3]
B and C: the transcripts of ALP (B) and Runx2 (C) in MSCs overexpressing miR-200c, one week after treatment with osteogenic medium. [score:3]
miR-200c expression doesn’t affect cell morphology and proliferationLentiviral vectors were used to transfect miR-200c into HEPM cells. [score:3]
0160915.g001 Fig 1 miR-200c overexpression in HEPM cells and the effects on their proliferation. [score:3]
Normalized luciferase activity of the luciferase reporter with 3’ UTR of IL-6, IL-8, and CCL-5 showed significantly lower with expression of miR-200c compared with the empty plasmid vector. [score:2]
These data strongly suggest that miR-200c may potentially be used to repress periodontitis -associated bone resorption and restore the periodontal bone defects by improving bone formation and modulating imbalance and dysregulation of proinflammatory mediators. [score:2]
miR-200c, a member of the miR-200 family, regulates the mesenchymal-to-epithelial transition (MET) [22] and stem cell proliferation and differentiation [23]. [score:2]
The HEPM cells overexpressing miR-200c maintained a fibroblastic morphology compared to the non -treated cells and the cells with scrambled miRs (Fig 1A). [score:2]
In addition, PMIS-200c also significantly increased the transcripts of IL-6, IL-8 and CCL-5 in human periodontal ligament fibroblasts with overexpression of miR-200c after LPS stimulation compared to PMIS-EV. [score:2]
Several publications have suggested that miR-200c may participate in the regulation of inflammation. [score:2]
Briefly, 1.8 μg of psPAX2, 1.2 μg of pMD2G, and 4.2 μg of plasmid miR-200c or scrambled miRs were mixed with 14 μl of 2M CaCl [2], and 2 μl of 10mg/ml polybrene in HBS buffer (pH 7.05) to constitute the transfection solution. [score:1]
Wendlandt et al. demonstrated that miR-200c may reduce NF-kB activation by modifying TLR-4 signaling through the MyD88 -dependent pathway [26]. [score:1]
The HEPM cells with miR-200c or scrambled miRs were placed in DMEM medium at 10 [6] cells/per 25cm [2] tissue culture flask. [score:1]
The von-Kossa staining was darker in the MSCs transfected with miR-200c. [score:1]
Supernatant containing the miR-200c lentivirus was then harvested after 72 hours and filtered through a 0.45-μm sterile syringe. [score:1]
The role of microRNAs miR-200b and miR-200c in TLR4 signaling and NF-κB activation. [score:1]
However, there was no loss of luciferase activity when the miR-200c binding sequence was mutated in the 3’UTR of IL-6, IL-8 and CCL-5 (Fig 6). [score:1]
The transcripts levels of IL-8, IL-6 with PEI- miR-200c nanoplex treatment at 5 and 10μg/per well, and CCL-5 at all concentrations in human periodontal ligament cells were lower than that of controls with treatment using the empty vectors at the same concentrations after 24 hours (Fig 5A, 5B and 5C). [score:1]
Also, the miR-200c cells had lower levels of IL-6 and IL-8 than control cells without transfection after 32 hours. [score:1]
A and B: the transcripts of IL-6 (A) and IL-8 (B) in non -treated HEPM cells and the cells with miR-200c or scrambled miRs cultured in DMEM supplemented with LPS at 0, 1, 5 and 10 μg/mL after 24 hours; *:p<0.05 vs non -treated; C: the amounts of IL-8 secreted by HEPM cells with miR-200c or scrambled miRs cultured in DMEM supplemented with or without LPS at different time points; *: p<0.05 vs cells with scrambled miRs; D and E: the amounts of IL-6 (D) and CCL-5 (E) secreted by HEPM cells with miR-200c or scrambled miRs cultured in DMEM supplemented with or without LPS after 24 hrs; F: the amounts of OPG secreted by HEPM cells with different miRs cultured in DMEM supplemented with or without LPS after 32 hours. [score:1]
A: Microphotographs of HEPM cells and the cells with miR-200c or scrambled miRs under phase-contrast. [score:1]
PEI nanoparticles deliver miR-200c to primary human bone marrow MSCs and periodontal ligament fibroblastsPlasmid miR-200c was incorporated into PEI to form nanoplexes at an N/P ratio of 10:1. PEI- miR-200c nanoplexes were visualized using transmission electron microscope (TEM) (Fig 4A). [score:1]
In order to transduce HEPM cells with plasmid miR-200c or scrambled miRs, the lentiviral vector carrying miR-200c (about 10 [8] TU/ml) was added to a suspension of HEPM cells in a 6-well plate and incubated overnight. [score:1]
Non -treated HEPM cells and the cells with scrambled miRs or miR-200c were treated with DMEM medium supplemented with LPS at 0, 1, 5, and 10 μg/mL. [score:1]
miR-200c was cloned into pSilenser 4. 1(Life Technologies). [score:1]
The medium was replaced each day for 3 days with fresh medium containing the same amount of lentivirus carrying miR-200c or scrambled miRs. [score:1]
Transduction of HEPM cells with miR-200c using lentivirus. [score:1]
PEI- miR-200c transfected cells showed stronger ALP staining than that in controls. [score:1]
PEI- miR-200c nanoplexes at different doses (1, 2, 5, and 10μg/per well) were added into the medium of cultured cells. [score:1]
With LPS treatment, IL-6 concentrations in the media are significantly increased, the IL-6 concentration of cells with miR-200c were significantly lower (2–3 fold) than that of cells with scrambled miRs (Fig 2D). [score:1]
Therefore, in order to develop a plasmid miR-200c based approach for anti-inflammation, an optimal transfection of miR-200c to limit plasmid DNA -induced innate immune response is necessary. [score:1]
A-C: Normalized luciferase activities of the 3’ UTR IL-6, IL-8, and CCL-5-luciferase reporters and their 3’UTR-mutated-luciferase reporters co -treated with miR-200c and PMIS-EV or PMIS-200c at different ratios of concentration. [score:1]
Preparation of lentiviral vectors carrying miR-200c. [score:1]
PEI nanoparticles deliver miR-200c to primary human bone marrow MSCs and periodontal ligament fibroblasts. [score:1]
miR-200c increases osteogenic biomarkers in human preosteoblasts. [score:1]
The sequence and miR-200c binding region located in the 3’UTR of each mediator is shown in Fig 6A. [score:1]
Furthermore, we demonstrated that miR-200c delivered using PEI nanoparticles promotes increased ALP, Runx2, and calcium content in primary human MSCs. [score:1]
In addition, the ALP concentration (Fig 8D) and calcium content (Fig 8E) in the MSCs transfected with miR-200c were increased after 2 weeks in culture. [score:1]
Briefly, the complexes were prepared by adding 50μl PEI solution to 50μl miR-200c (10μg) solution and mixed for 30 seconds. [score:1]
A: TEM image of PEI- miR-200c nanoplexes. [score:1]
The calcium content in miR-200c cells was 3 times higher than that of non -treated cells and the cells with scrambled miRs after two weeks (Fig 3B). [score:1]
Plasmid miR-200c was incorporated into PEI to form nanoplexes at an N/P ratio of 10:1. PEI- miR-200c nanoplexes were visualized using transmission electron microscope (TEM) (Fig 4A). [score:1]
miR-200c modulates proinflammatory mediators and osteogenic differentiation in preosteoblasts. [score:1]
Plasmids, including psPAX2, pMD2G, and those carrying miR-200c, scrambled miRs, or the empty vector were purchased from Addgene (Cambridge, MA, USA). [score:1]
Human bone marrow MSCs were transfected using PEI- miR-200c or PEI-empty vector at 1.0 μg/per well, then the cells were subsequently cultured using DMEM supplemented with ascorbic acid and β-glycerophosphate for up to 2 weeks. [score:1]
In this study, we investigated the molecular effects of overexpressed miR-200c using lentiviral vectors on periodontitis -associated proinflammatory factors and the biomarkers of osteogenic differentiation in human embryonic palatal mesenchyme (HEPM) cells, a cell line of preosteoblasts. [score:1]
After primary human periodontal ligament fibroblasts were treated with PEI- miR-200c at different concentrations, the cells were cultured using DMEM with LPS supplement (1μg/ml) for up to 32 hours. [score:1]
A-C: The transcripts of IL-6 (A), IL-8 (B), and CCL-5 (C) in the cells with miR-200c or empty vector cultured in DMEM supplemented with LPS after 24 hours; D and E: the amounts of IL-6 (D), IL-8 (E), and CCL-5 (F) secreted by the cells with miR-200c or empty vector cultured in DMEM supplemented with LPS after 12 and 32 hrs, respectively. [score:1]
The encapsulation efficiency and plasmid miR-200c condensation within the complex were elucidated using spectrophotometry and gel electrophoresis, respectively as in our previous studies [30]. [score:1]
miR-200c delivered using PEI improves osteogenic differentiation of human MSCs. [score:1]
A: The sequence and miR-200c binding region located in the 3’UTR and mutated 3’UTR of IL-6, IL-8, and CCL-5. B-D: Normalized luciferase activities of the 3’ UTR IL-6, IL-8, and CCL-5-luciferase reporters and their 3’UTR-mutated-luciferase reporters treated with empty vector or miR-200c. [score:1]
A and B: the amounts of the transcript of OCN (A) and calcium content (B) in non -treated HEPM cells and the cells with miR-200c or scrambled miRs cultured in DMEM supplemented β-glycerophosphate and ascorbic acid after 1 and 2 weeks, respectively. [score:1]
D-F: the transcripts of IL-6 (D), IL-8 (E), and CCL-5 (F) in the cells co -treated with miR-200c and PMIS-EV or PMIS-200c cultured in DMEM supplemented with LPS after 24 hours; *: p<0.05. [score:1]
Preparation of lentiviral vectors carrying miR-200cLentiviral vectors carrying plasmid miR-200c or scrambled miRs were produced by transfecting psPAX2, pMD2G, and plasmid carrying miR-200c or scrambled miRs into HEK 293T cells using a standard CaCl [2] method. [score:1]
Human bone marrow MSCs were placed in DMEM medium at 10 [5] cells/per well in 6-well plates and subsequently treated with PEI- miR-200c at 1μg/per well for 4 hours. [score:1]
0160915.g004 Fig 4Intracellular delivery of miR-200c using PEI nanoparticles to human primary periodontal ligament fibroblasts and bone marrow MSCs. [score:1]
Transduction of HEPM cells with miR-200c using lentivirusIn order to transduce HEPM cells with plasmid miR-200c or scrambled miRs, the lentiviral vector carrying miR-200c (about 10 [8] TU/ml) was added to a suspension of HEPM cells in a 6-well plate and incubated overnight. [score:1]
0160915.g003 Fig 3 miR-200c increases osteogenic biomarkers in human preosteoblasts. [score:1]
Additionally, we used polyethylenimine (PEI), a non-viral nanoparticle delivery system, to successfully deliver plasmid DNA containing miR-200c into primary human periodontal ligament fibroblasts and bone marrow MSCs. [score:1]
B and C: Fold change of the transcript of miR-200c in non -treated human periodontal ligament fibroblasts (B) and bone marrow MSCs (C) and the cells transfected with empty vector (EV) (10μg/per well) and miR-200c (1, 5, 10μg/per well). [score:1]
HEPM cells infected with miR-200c or scrambled miRs were cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS). [score:1]
Intracellular delivery of miR-200c using PEI nanoparticles to human primary periodontal ligament fibroblasts and bone marrow MSCs. [score:1]
However, the cells with miR-200c produced much less IL-8 than that of controls even after they were exposed to LPS (Fig 2C). [score:1]
However, the protein levels of these mediators in cells treated with PEI- miR-200c were significantly lower than that of cells treated with same concentration of empty vectors. [score:1]
Lentiviral vectors were used to transfect miR-200c into HEPM cells. [score:1]
0160915.g002 Fig 2 miR-200c modulates proinflammatory mediators in human preosteoblasts. [score:1]
For periodontal ligament fibroblasts, the cells were placed in DMEM medium at 10 [5] cells/per well and cultured in 6-well plates and subsequently treated with PEI- miR-200c at different concentrations for 4 hours. [score:1]
miR-200c modulates proinflammatory mediators in human preosteoblasts. [score:1]
miR-200c delivered using PEI improves osteogenic differentiation of human MSCsHuman bone marrow MSCs were transfected using PEI- miR-200c or PEI-empty vector at 1.0 μg/per well, then the cells were subsequently cultured using DMEM supplemented with ascorbic acid and β-glycerophosphate for up to 2 weeks. [score:1]
Plasmid DNA containing miR-200c was incorporated into PEI to form nanoplexes at an N/P ratio of 10:1 {ratio of the total number of end amine groups (N) of PEI and the total number of DNA phosphate groups (P)} according to our previous studies [30]. [score:1]
PEI- miR-200c nanoplexes at 1, 2, 5, and 10 μg/per well were added to the medium of cultured primary human bone marrow MSCs and periodontal ligament fibroblasts in 6-well plates. [score:1]
Transfection of miR-200c using PEI into primary human cells. [score:1]
In this study we showed that PEI can effectively deliver miR-200c into primary human periodontal ligament fibroblasts and bone marrow MSCs, demonstrating the feasibility of transfecting miR-200c using PEI nanoparticles. [score:1]
These results, along with our previous in vivo studies, strongly suggest that PEI nanoparticles may potentially be used as a delivery system to transfect miR-200c for clinical application purposes. [score:1]
This evidence strongly suggests that miR-200c may possess the molecular function to both improve osteogenic differentiation and repress periodontitis -associated proinflammatory cytokines. [score:1]
Transfection of miR-200c using PEI into primary human cellsPlasmid DNA containing miR-200c was incorporated into PEI to form nanoplexes at an N/P ratio of 10:1 {ratio of the total number of end amine groups (N) of PEI and the total number of DNA phosphate groups (P)} according to our previous studies [30]. [score:1]
D and E: Quantitative measurement of ALP levels (D) and calcium content (E) in MSCs overexpressing miR-200c, one and two week after treatment with osteogenic medium. [score:1]
Furthermore, our studies demonstrated that plasmid DNA containing miR-200c can be effectively delivered using a non-viral delivery system. [score:1]
While miR-200c can participate in stem cell proliferation and differentiation [24], this is the first study that demonstrates the potential function of miR-200c to improve osteogenic differentiation and bone regeneration. [score:1]
0160915.g007 Fig 7 PMIS-200c reduces binding activity of miR-200c to the 3’UTR of IL-6, IL-8, and CCL-5 and the function of miR-200c. [score:1]
Lentiviral vectors carrying plasmid miR-200c or scrambled miRs were produced by transfecting psPAX2, pMD2G, and plasmid carrying miR-200c or scrambled miRs into HEK 293T cells using a standard CaCl [2] method. [score:1]
The doubling time for the cells with scrambled miRs was similar to non -treated HEPM cells, and miR-200c-infected HEPM cells did not differ significantly from that in either untreated cells or cells infected with scrambled miRs (Fig 1C). [score:1]
miR-200c transcripts were detected using real-time PCR. [score:1]
miR-200c repressed luciferase activity from the IL-6, IL-8 and CCL-5 reporter constructs co -transfected in cells (Fig 6B, 6C and 6D). [score:1]
[1 to 20 of 139 sentences]
4
[+] score: 325
KRAS is a predicted target of miR-200c and its protein expression inversely correlates with miR-200c expression in breast cancer cellsIn order to examine whether miR-200c has a putative target site in the 3'UTR of the KRAS gene, online prediction tools were utilized, which were based on the three different algorithms TargetScan [34], miRanda [35] and DIANA microT [36, 37]. [score:11]
Moreover, in the murine breast cancer cell line 4T1, which endogenously displayed a medium expression of miR-200c (Supplement Figure S1), it was demonstrated that K-ras protein levels were both down-and up-regulated after miR-200c overexpression and inhibition (Supplement Figure S2). [score:10]
Although it has been reported that miRNAs can also down-regulate target mRNAs by affecting their stabilities [38], miR-200c primarily inhibits the translation of KRAS, whereas siRas causes the expected mRNA cleavage. [score:10]
To further prove the inhibition of KRAS expression by miR-200c, protein and mRNA levels were determined after either miR-200c inhibition or overexpression. [score:9]
The following oligonucleotides were used: miRCURY LNA miRNA Inhibitor for hsa-miR-200c (inh) (Exiqon), miRCURY LNA miRNA Inhibitor Control Negative Control A (ctr) (Exiqon), Pre-miR miRNA Precursor of hsa-miR-200c (pre) (Ambion), Pre-miR miRNA Negative Control (ctr) (Ambion), ON-TARGETplus SMARTpool siRNA against human KRAS consisting of four different siRNAs (Dharmacon) (siRas) and the non -targeting control siRNA (siCtr), which was previously described [54]. [score:9]
Figure 1 KRAS is a predicted target of miR-200c and its protein expression inversely correlates with miR-200c expression in breast cancer cellsA) Target site prediction of miR-200c in the 3'UTR of the KRAS gene. [score:9]
Moreover, KEGG-pathway analysis of all potential miR-200c targets predicted by TargetScan [34] revealed that miR-200c might strongly interact with the MAPK and ERBB signaling pathway by regulating a multitude of target genes, such as central adaptor proteins like Shc and Sos, kinases like MEKK1 and PKC or transcription factors like SRF and JUN (Supplement Figure S3). [score:8]
KRAS is a predicted target of miR-200c and its protein expression inversely correlates with miR-200c expression in breast cancer cells. [score:7]
In contrast to these tumor suppressor miRNAs, which generally display a low expression level in cancer cells, miR-200c is differentially expressed among cancer cells and acts as important molecular switch by modulating a multitude of cellular processes. [score:7]
The expression of miR-200c was found to inversely correlate with the K-ras protein expression (Figure 1D); i. e. breast cancer cells, which displayed a high miR-200c expression, had low protein levels of K-ras (Pearson r = -0.80). [score:7]
C) miR-200c inhibition in the miR-200c [high] cell lines BT-474 and MCF-7. Indicated cell lines were transfected with either miR-200c inhibitor (inh) or scrambled control inhibitor (ctr) and at 72h post transfection subjected to Western blot analysis (upper panel) or quantitative RT-PCR (lower panel). [score:7]
These results indicate that in MDA-MB-231 cells, which harbor the activating KRAS mutation G13D, miR-200c inhibits proliferation and cell cycle progression more likely via a down-regulation of KRAS. [score:7]
miR-200c inhibits K-ras protein expression without affecting KRAS mRNA levelsFor the validation of KRAS as a novel target of miR-200c, a luciferase reporter assay was performed using a vector encoding for renilla luciferase and almost the entire 3'UTR of the KRAS gene including the predicted miR- 200c binding site. [score:6]
A) MDA-MB-231 cells which harbor an activating (G13D) KRAS mutation and B) MDA-MB-436 cells which express wild-type KRAS were transfected with pre-miR-200c (pre), scrambled pre-miR-control (ctr), siRNA against KRAS (siRas) or non -targeting control siRNA (siCtr). [score:6]
Although the direct regulation of these targets needs to be proven, these findings indicate that miR-200c may have additional regulating functions as a kind of gatekeeper of tumor progression and therapy resistance by controlling a complex network of oncogenic pathways including the RAS/MAPK pathway. [score:6]
While it has been reported that KRAS is regulated by several tumor suppressor miRNAs, this is the first report on the direct regulation of KRAS by miR-200c. [score:6]
Next, it was examined whether miR-200c was able to regulate the luciferase reporter when overexpressed or inhibited. [score:6]
In order to examine whether miR-200c has a putative target site in the 3'UTR of the KRAS gene, online prediction tools were utilized, which were based on the three different algorithms TargetScan [34], miRanda [35] and DIANA microT [36, 37]. [score:5]
BT-474 cells were transfected with either miR-200c inhibitor (inh) or scrambled control inhibitor (ctr). [score:5]
However, they ascribed the physiological effects to a miR-200c -induced down-regulation of PLC gamma 1, regardless of the KRAS mutation status. [score:5]
As miR-200c is well established and known to be differentially expressed in breast tumors, miR-200c (Figure 1B) and K-ras protein (Figure 1C) expression levels were analyzed in a panel of different breast cancer cell lines (a numerical table is given in Table 1). [score:5]
miR-200c inhibits K-ras protein expression without affecting KRAS mRNA levels. [score:5]
As expected, overexpression of miR-200c led to a decreased luciferase activity, whereas its inhibition resulted in an enhanced bioluminescence (Figure 2B). [score:5]
BT-474 cells were transfected with either the LNA miR-200c inhibitor (inh) or the LNA control inhibitor (ctr) (Exiqon) together with the reporter plasmid RLuc and the control plasmid FLuc for normalization. [score:5]
Figure 4miR-200c and siRas also affect the cell cycle of lung cancer cells by inhibiting KRASA) miR-200c expression and B) K-ras protein levels of the two KRAS mutated lung cancer cell lines A549 (G12S) and Calu-1 (G12D) in comparison to the breast cancer cell line BT-474. [score:5]
Inhibition of miR-200c in BT-474 and MCF-7 cells led to an elevated K-ras protein expression, while KRAS mRNA levels were not changed (Figure 2C). [score:5]
It has also been shown that miR-200c links breast cancer stem cells with normal stem cells and that downregulation of miR-200 is required for the formation and maintenance of cancer stem cells [26, 27]. [score:4]
This correlation indicates a direct inhibition of the luciferase reporter via the KRAS 3'UTR by miR-200c. [score:4]
Figure 5While siRas can only specifically target KRAS mRNA, miR-200c regulates a variety of genes involved in tumor progression, metastasis and therapy resistance. [score:4]
For statistical analysis a student's t-test was performed (****p<0.0001) miR-200c and siRas also affect the cell cycle of lung cancer cells by inhibiting KRASAs the relevance of KRAS mutations in breast cancer remains elusive, the physiological effects of miR-200c -dependent KRAS silencing were explored in a more relevant cancer type. [score:4]
miR-200c regulates epithelial-mesenchymal transition (EMT) by inhibiting ZEB1 and ZEB2, the transcriptional repressors of the epithelial marker E-cadherin [18- 20]. [score:4]
While siRas can only specifically target KRAS mRNA, miR-200c regulates a variety of genes involved in tumor progression, metastasis and therapy resistance. [score:4]
These data suggest that miR-200c can generally interfere with cell proliferation and cell cycle by directly targeting oncogenic KRAS independent of the respective cancer type. [score:4]
Specific knockdown experiments using siRNA against KRAS dissected the particular role of KRAS from the role of the other miR-200c targets. [score:4]
By the inhibition of EMT and the regulation of several other genes important for cell motility, miR-200c reduces the migration and invasion of cancer cells, preventing tumor dissemination and metastases [21- 25]. [score:4]
The values of the relative K-ras protein and miR-200c expression are listed in Table 1. The graph shows the Pearson correlation scatter plot of the relative K-ras and miR-200c levels in the different breast cancer cell lines (*p<0.05). [score:3]
Uhlmann et al. [49] have shown that in MDA-MB-231 cells the miR-200bc/429 seed-cluster, in particular miR-200c, inhibits EGF -driven invasion as well as proliferation and cell cycle progression, the latter by decreasing the G1-population. [score:3]
KRAS silencing by miR-200c and siRas leads to reduced proliferation and changed cell cycle of breast cancer cells dependent on the KRAS mutation statusThe significance of the oncogene KRAS is underlined by frequently occurring activating mutations in numerous tumors and cancer cell lines. [score:3]
D) miR-200c overexpression in the miR-200c [low] cell lines MDA-MB-231 and MDA-MB-436. [score:3]
Ectopic expression of this reporter in two miR-200c [low] (MDA-MB-231 and MDA-MB-436) and two miR-200c [high] (BT-474 and MCF-7) breast cancer cell lines showed high and low luciferase activities, respectively (Figure 2A). [score:3]
Therefore, miR-200c targeting KRAS is of great interest in order to understand and predict tumor progression and therapy susceptibility of cancer patients. [score:3]
The renilla luciferase reporter containing the 3'UTR of KRAS including the predicted target site of miR-200c (RLuc) or the firefy luciferase control plasmid pGL3 (FLuc) were transfected into the indicated cell lines. [score:3]
On the other hand, overexpression of miR-200c resulted in decreased K-ras protein and unaltered KRAS mRNA levels in MDA-MB-231 and MDA-MB-436 cells (Figure 2D). [score:3]
A) miR-200c expression and B) K-ras protein levels of the two KRAS mutated lung cancer cell lines A549 (G12S) and Calu-1 (G12D) in comparison to the breast cancer cell line BT-474. [score:3]
B) miR-200c expression in a panel of breast cancer cell lines. [score:3]
D) Correlation of K-ras protein and miR-200c expression. [score:3]
Furthermore, in different breast and lung cancer cell lines an inhibitory effect of miR-200c -dependent KRAS silencing on proliferation and cell cycle was demonstrated. [score:3]
By using pre-miR-200c as well as siRas for the silencing of KRAS, the particular role of KRAS should be dissected from the role of all the other targets of miR-200c. [score:3]
The luciferase reporter was therefore transfected together with pre-miR-200c in MDA-MB-436 cells or miR-200c inhibitor in BT-474 cells. [score:3]
miR-200c expression was normalized to miR-191 and values are stated as mean ± SD (n=3). [score:3]
miR-200c and siRas also affect the cell cycle of lung cancer cells by inhibiting KRAS. [score:3]
Here, we report that KRAS is targeted by miR-200c, which results in a slower proliferation and in an altered cell cycle of cancer cells. [score:3]
Relative miR-200c and K-ras protein expression in the panel of breast cancer cell lines. [score:3]
Hence, miR-200c shows a broader efficacy than siRas against cancer cells by targeting multiple genes and pathways. [score:3]
On the contrary, in cells harboring wild-type KRAS, only miR-200c is able to alter proliferation and cell cycle presumably via other targets than KRAS, for instance BMI1. [score:3]
C) A549 cells and D) Calu-1 cells were subjected to flowcytometry at 72h after transfection with pre-miR-200c (pre), scrambled pre-miR-control (ctr), siRNA against KRAS (siRas) or non -targeting control siRNA (siCtr). [score:3]
A) Target site prediction of miR-200c in the 3'UTR of the KRAS gene. [score:3]
After each cycle cells were harvested for RNA isolation and protein lysates to determine E) the relative miR-200c expression and F) the K-ras protein levels of the indicated round. [score:3]
Figure 3 KRAS silencing by miR-200c and siRas leads to reduced proliferation and changed cell cycle of breast cancer cells dependent on the KRAS mutation statusProliferation of different breast cancer cell lines upon KRAS knockdown. [score:3]
Regulatory network of miR-200c. [score:2]
Thereby, KRAS was experimentally validated as a target of miR-200c by Western blot analyses and luciferase reporter assays. [score:2]
miR-200c as well as the siRNA against KRAS similarly affected the cell cycle of MDA-MB-231, A549 and Calu-1 cells, which harbor an activating KRAS mutation. [score:2]
Furthermore, these results highlight the prominent role of the miR-200c -dependent regulation of KRAS, especially when applied to cell lines which are driven by oncogenic KRAS. [score:2]
Both lung cancer cell lines displayed low miR-200c levels (Figure 4A) but a considerable K-ras protein expression (Figure 4B) as compared to the miR-200c [high] breast cancer cell line BT-474. [score:2]
Since miR-200c as well as particularly mutated K-ras have both been implicated in resistance to classical chemotherapy and targeted therapies [4, 5, 28- 33], we investigated whether a reduction of miR-200c increases K-ras protein expression in an assay for induced chemoresistance [32]. [score:2]
Here, it was shown that the effects on proliferation and cell cycle are coinciding for miR-200c and siRas if an activating KRAS mutation is present. [score:2]
The miR-200c -positive breast cancer cell line BT-474 was treated with doxorubicin for three rounds, which resulted in reduced miR-200c (Figure 1E) and elevated K-ras protein levels (Figure 1F) suggesting a miR-200c -dependent regulation of KRAS. [score:2]
KRAS silencing by miR-200c and siRas leads to reduced proliferation and changed cell cycle of breast cancer cells dependent on the KRAS mutation status. [score:2]
For statistical analysis a student's t-test was performed (****p<0.0001) As the relevance of KRAS mutations in breast cancer remains elusive, the physiological effects of miR-200c -dependent KRAS silencing were explored in a more relevant cancer type. [score:2]
Interestingly, upon molecular evolution, an assay for acquired chemoresistance in which cancer cells were sequentially treated with doxorubicin, BT-474 cells displayed a significantly reduced miR-200c and a remarkably enhanced K-ras protein expression. [score:2]
For the validation of KRAS as a novel target of miR-200c, a luciferase reporter assay was performed using a vector encoding for renilla luciferase and almost the entire 3'UTR of the KRAS gene including the predicted miR- 200c binding site. [score:2]
By controlling a multitude of cellular processes, miR-200c causes stronger effects against various cancer cells independent of the mutational status of KRAS. [score:2]
Chemotherapeutic treatment of the miR-200c [high] cell line BT-474. [score:1]
Quantification of the cell cycle phases revealed that in MDA-MB-231 cells pre-miR-200c as well as siRas led to a decrease of the G1-phase and an increase of the S-phase (Figure 3E). [score:1]
In the KRAS mutated cell line MDA-MB-231 the proliferation of pre-miR-200c- and siRas -transfected cells was similarly decreased (Figure 3A), whereas in the KRAS wild-type cell line MDA-MB-436 only pre-miR-200c was able to significantly reduce proliferation (Figure 3B). [score:1]
Similarly, a pivotal role in tumorigenesis as a molecular switch between an epithelial, non-migratory, chemosensitive and a mesenchymal, migratory, chemoresistant state has been attributed to miR-200c. [score:1]
Therefore, the proliferation of the two breast cancer cell lines was analyzed upon transfection with pre-miR-200c or siRas. [score:1]
Of note, the cell cycle of pre-miR-200c- as well as siRas -transfected A549 (Figure 4C) and Calu-1 (Figure 4D) cells was similarly changed. [score:1]
Consistent with the proliferation, the cell cycle of MDA-MB-231 cells was considerably changed upon both pre-miR-200c and siRas transfection (Figure 3C), whereas only pre-miR-200c changed the cell cycle of MDA-MB-436 cells (Figure 3D). [score:1]
In order to assess the silencing efficiency and the mechanism of the miR-200c -induced KRAS knockdown, the effects of miR-200c were compared with those of a siRNA-pool against KRAS (siRas). [score:1]
However, in the KRAS wild-type cell line MDA-MB-436 only miR-200c was able to change proliferation and cell cycle. [score:1]
MDA-MB-436 cells were transfected with either pre-miR-200c (pre) or scrambled pre-miR-control (ctr). [score:1]
Indicated cell lines were transfected with either pre-miR-200c (pre) or scrambled pre-miR-control (ctr) and at 72h after transfection subjected to Western blot analysis (upper panel) or quantitative RT-PCR (lower panel). [score:1]
Additionally, MDA-MB-436 cells were transfected with either pre-miR-200c (pre) or pre-miR-control (ctr) (Ambion) together with the reporter plasmid RLuc and the control plasmid FLuc for normalization. [score:1]
Therefore, usage of miR-200c in a therapeutic approach may be superior to that of a siRNA against KRAS. [score:1]
Moreover, in resistant cancer cells miR-200c is able to restore sensitivity to anti-EGFR therapy [28, 29] and to classical chemotherapeutics such as paclitaxel or doxorubicin [30- 33]. [score:1]
In MDA-MB-436 cells, however, only pre-miR-200c achieved a reduction of the G1-phase and an increase of the S-phase, whereas siRas did not affect the cell cycle (Figure 3F). [score:1]
[1 to 20 of 87 sentences]
5
[+] score: 316
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200a, hsa-mir-423
In contrast, miR-200c inhibition upregulated the expression of the above proteins and decreased radiation -induced cell killing. [score:8]
Overexpression of miR-200c led to discernible inhibition of vasculogenic mimicry and was associated with downregulation of VEGF, HIF-1α, and MMP2. [score:8]
Anti-miR-200c also enhanced EphA2 expression whereas U251 and A549 cells incubated with anti-miR-200c exhibited a significant upregulation of EphA2 expression (C). [score:8]
Figure 4Overexpression of miR-200c led to a discernible inhibition of vasculogenic mimicry and was associated with downregulation of VEGF, HIF-1α, and MMP2. [score:8]
Overexpression of miR-200c led to a discernible inhibition of vasculogenic mimicry and was associated with downregulation of VEGF, HIF-1α, and MMP2. [score:8]
Figure 1Ectopic overexpression of miR-200c inhibited expression of p-EGFR and downstream signaling molecules PI3K 110а, p-AKT, and p-ERK, and increased the radiosensitivity of U251 (A), T98G (B), A549 (C), and MDA-MB-468 (D) cells. [score:7]
EGFR wild-type non-small cell lung cancer (NSCLC) cell lines regained sensitivity to EGFR tyrosine kinase inhibitors when EMT was inhibited by miR-200c overexpression [5]. [score:7]
Overexpressing miR-200c increased E-cadherin expression while treatment with anti-miR-200c decreased E-cadherin expression. [score:7]
Ectopic overexpression of miR-200c inhibited expression of p-EGFR and downstream signaling molecules PI3K 110а, p-AKT, and p-ERK, and increased the radiosensitivity of U251 (A), T98G (B), A549 (C), and MDA-MB-468 (D) cells. [score:7]
As shown in Figure 5C, U251 and A549 cells treated with miR-200c exhibited downregulated E-cadherin and upregulated N-cadherin. [score:7]
GBM samples with high EGFR amplification exhibit ZEB1 upregulation and miR-200c downregulation [4]. [score:7]
Expression of the autophagosome marker LC3 was upregulated after miR-200c treatment, whereas it was reduced after anti-miR-200c treatment. [score:6]
We also examined the expression of caspase-3, a key apoptosis-triggering factor, and confirmed that caspase-3 was upregulated when U251 and A549 cells were treated with both miR-200c and radiotherapy (Figure 3A). [score:6]
Overexpression of miR-200c led to prolonged γH2AX focus formation and p-DNA-PKcs downregulation. [score:6]
Overexpression of miR-200c caused a marked prolongation of γH2AX focus formation at 4 hours after irradiation with 6 Gy (right panels) and was associated with discernible downregulation of p-DNA-PKcs (left panels) in U251 (A), T98G (B), A549 (C), and MDA-MB-468 (D) cells. [score:6]
However, treatment with miR-200c upregulated LC3-II expression in 24 hours (Figure 3B). [score:6]
Recent observations have strengthened the role of the ZEB1/miR-200c regulatory loop during EMT; on the one hand, miR-200c regulates ZEB1 expression; on the other hand, ZEB1 regulates miR-200c transcription [38, 39]. [score:6]
Figure 2Overexpression of miR-200c caused a marked prolongation of γH2AX focus formation at 4 hours after irradiation with 6 Gy (right panels) and was associated with discernible downregulation of p-DNA-PKcs (left panels) in U251 (A), T98G (B), A549 (C), and MDA-MB-468 (D) cells. [score:6]
miR-200c overexpression induces prolongation of γH2AX focus formation and down-regulates p-DNA-PKcs. [score:6]
In this study, we found that miR-200c significantly suppressed EphA2 expression in GBM and NSCLC cells. [score:5]
In breast cancer cells, miR-200c suppressed ubiquilin-1 expression and enhanced radiation -induced autophagy [16]. [score:5]
Expression of EphA2 also was significantly reduced after treatment with miR-200c, whereas cells treated with anti-miR-200c had dramatically increased EphA2 expression. [score:5]
A member of the miRNA-200 family, miRNA-200c (miR-200c), recently was found to have tumor-suppressive properties by inhibiting the epithelial-mesenchymal transition (EMT) process in several cancers. [score:5]
We used multiple target prediction algorithms to establish target gene candidates of miR-200c as previously reported [12], since the computational results often have inconsistencies [14]. [score:5]
Figure 5(A) Overexpression of miR-200c significantly inhibited the invasion potential of U251 and A549 cells. [score:5]
Ectopic expression of miR-200c inhibits angiogenesis, invasion, and migration. [score:5]
confirmed that miR-200c overexpression decreased the expression of p-EGFR (Figure 1). [score:5]
Overexpressing miR-200c significantly inhibited the invasion potential of U251 and A549 cells (Figure 5A). [score:5]
We observed a significant loss of E-cadherin expression upon miR-200c inhibition in GBM and NSCLC cell lines. [score:5]
Similar to methods used in a previous study [12], several miRNA target databases were used to predict target gene candidates for miR-200c. [score:5]
In a study using doxorubicin-resistant MCF-7 breast cancer cells, loss of miRNA-200c was associated with decreased E-cadherin and PTEN expression, and increased ZEB1 and p-Akt expression, which ultimately caused chemoresistance [19]. [score:5]
The SER was defined as the ratio of the isoeffective dose at a surviving fraction (SF) of 0.5 and 0.05 in the overexpression of control miRNA to the overexpression of miR-200c. [score:5]
Tank -binding kinase-1 (TBK1), also a reported target of miR-200c, inhibits radiation -induced apoptosis in breast cancer and NSCLC cells [17, 18]. [score:5]
Taken together, our data suggest that miR-200c is an attractive target for improving the efficacy of radiotherapy via its unique modulation of the complex regulatory network controlling cancer pro-survival signaling and EMT. [score:4]
In primary glioblastoma multiforme (GBM) tissues, miR-200c and E-cadherin were found to be downregulated when epidermal growth factor receptor (EGFR) was highly amplified [4]. [score:4]
VEGF antibody staining also confirmed the downregulation of VEGF in cell lines U251 and A549 upon treatment with miR-200c (A and B). [score:4]
Ectopic overexpression of miR-200c increased the radiosensitivity of GBM (U251 and T98G), NSCLC (A549), and breast cancer (MDA-MB-468) cells. [score:3]
Angiogenesis and EMT -associated genes such as VEGFA, HIF1AN, and CDH1, were predicted as target genes of miR-200c. [score:3]
Adam et al. [33] observed that the expression of miR-200c reversed the EMT transition in bladder cancer through the EGFR signaling pathway. [score:3]
Ectopic overexpression of miR-200c did not alter the radiosensitivity of normal human astrocytes (A) or normal human fibroblasts (B). [score:3]
Figure 6Ectopic overexpression of miR-200c did not alter the radiosensitivity of normal human astrocytes (A) or normal human fibroblasts (B). [score:3]
also suggested PI3K, AKT, and ERK1/2 as putative targets of miR-200c. [score:3]
Effects of miR-200c on invasion and migration potential and E-cadherin, N-cadherin, and EphA2 expression. [score:3]
In NSCLC cells (A549), miR-200c was reported to have a radiosensitizing effect by targeting the VEGF-VEGFR2 pathway [44]. [score:3]
Ectopic overexpression of miR-200c increases the radiosensitivity of human cancer cells with activated EGFR signaling. [score:3]
We also confirmed that miR-200c inhibited the invasion and migration potential of GBM and NSCLC cell lines with activated EGFR pathways. [score:3]
We further confirmed another post-transcriptional role of miR-200c: inhibiting vascular formation. [score:3]
Upon miR-200c overexpression, U251 and A549 cell lines showed a significantly higher degree of accumulation of acidic compartments, as demonstrated by labeling cells with LysoTracker and subsequent analysis by fluorescence microscopy. [score:3]
As presented in Figure 1, the ectopic overexpression of miR-200c led to attenuated formation of PI3K 110α, p-AKT, and p-ERK. [score:3]
miR-200c particularly suppresses the Zinc finger E-box -binding homeobox 1 (ZEB1)/E-cadherin axis, an activator of EMT and a key promoter of metastasis [38]. [score:3]
Therefore, miR-200c could be a viable target to increase radiation -induced cell killing of human tumor cells. [score:3]
Target prediction and confirmation for miR-200c. [score:3]
Overexpression of miR-200c caused a marked prolongation of γH2AX focus formation 4 hours after irradiation with 6 Gy. [score:3]
The ectopic expression of miR-200c resulted in no observable cytotoxic effect on normal human fibroblasts or normal human astrocytes (Figure 6). [score:3]
However, treating these cell lines with miR-200c resulted in significantly lower VEGF expression (Figure 4A and 4B). [score:3]
Here we also report that overexpressing miR-200c resulted in findings indicating impaired DNA damage repair. [score:3]
predicted that EGFR had the high probability of being a miR-200c target (Supplementary Data 3). [score:3]
Clinically, analysis of patient data using The Cancer Genome Atlas (TCGA) datasets showed that decreased miR-200 family expression was associated with poor overall survival in ovarian, renal, lung, and basal-like breast cancers [8]. [score:3]
These results demonstrated the critical regulatory role of miR-200c on EMT-related signaling pathways through one of the most important cell signaling pathways in cancer, EGFR signaling. [score:2]
miR-200c also interacts with various cellular signaling molecules and regulates many important signaling pathways, such as STAT3, PI3K/Akt [6], and ERK [7]. [score:2]
PI-1251; anti-miR-200c sequence: RRRQRRKKR-OO TTACCCGGCAGTATT) in the absence of a transfection reagent, anti-miR-200c was mixed with Opti-MEM (Invitrogen, Grand Island, NY, USA), incubated for 15 minutes at room temperature, and added directly to cells according to the manufacturer’s protocol. [score:2]
miR-200c also significantly compromised migration in U251 and A549 cells as determined by wound healing assay, while a miR-200c inhibitor restored the migration potential (Figure 5B). [score:2]
Treatment of U251 and A549 cells with anti-miR-200c before irradiation significantly reduced apoptotic or necrotic cell death compared to expression of miR-200c (Figure 3A). [score:2]
Notch signaling activation was also reported to be regulated by miR-200c in human cancer cell lines [22, 23]. [score:2]
The additional regulatory roles of miR-200c in important cellular signaling pathways other than PI3K-Akt or ERK have been reported. [score:2]
Treatment with anti-miR-200c dramatically reduced apoptosis in U251 and A549 cells. [score:1]
We performed western blots and validated the effect of miR-200c on VEGF, E-cadherin, and N-cadherin. [score:1]
Effects of miR-200c on vascular tube formation. [score:1]
To deliver anti-miR-200c (Panagene Inc. [score:1]
Cells were transfected with pre-miR-200c (mature miR-200c sequence: 5′-CGU CUU ACC CAG CAG UGU UUG GGU GCG GUUGGG AGU CUC UAA UAC UGC CGG GUA AUG AUG GA-3′) or control pre-miRNA using siPORTNeoFX transfection reagent (Ambion, Austin, TX, USA) according to the manufacturer’s protocol. [score:1]
Enhanced chemosensitivity by miR-200c was also reported to occur through the Akt [19, 20] and JNK2/c-Jun [21] signaling pathways. [score:1]
Our results suggested that miR-200c is an important modulator of the EGFR pro-survival cell signaling network implicated in the radiation response of human cancer cells. [score:1]
Tissue microarrays of 30 primary GBM samples reported an inverse correlation between miRNA-200c and ZEB1. [score:1]
To our knowledge, this is the first study to report a correlation between miR-200c and EphA2 in GBM and NSCLC cells. [score:1]
The effect of miR-200c on apoptosis was confirmed using Annexin V/Propidium Iodide (PI) double staining [9]. [score:1]
According to these results, miR-200c and radiation synergistically induced autophagic cell death in GBM and NSCLC cells. [score:1]
Effects of miR-200c on apoptosis, autophagy, and senescence. [score:1]
In contrast, radiation -induced cell killing was decreased by anti-miR-200c (Figure 1A–1D). [score:1]
These results showed that miR-200c and radiotherapy synergistically induced apoptotic cell death in human GBM and NSCLC cells. [score:1]
Effects of miR-200c on radiation response and EGFR -associated signaling. [score:1]
However, the effects of miR-200c on cellular senescence as determined by β-galactosidase staining indicated no significant difference from normal controls or cells treated with anti-miR-200c (Figure 3C). [score:1]
In both cell lines, treatment with miR-200c and irradiation (6 Gy) resulted in lysosomal localization of LysoTracker within 24 hours of treatment (Figure 3B). [score:1]
Testing toxicity of miR-200c in normal cells. [score:1]
However, at this time, it is not clear whether miR-200c has a radiosensitizing effect in human cancer cells. [score:1]
miR-200c also mitigated EMT-related processes such as vascular formation, invasion, and migration. [score:1]
Having demonstrated that miR-200c increased radiosensitivity in cancer cells with activated EGFR signaling, we next planned to confirm the mechanism of radiosensitization. [score:1]
On the other hand, anti-miR-200c treatment rendered both cell lines more resistant to autophagic cell death. [score:1]
Cells were transfected with pre-miR-200c or control 1 day before seeding onto coated plates. [score:1]
In conclusion, we confirmed that miR-200c significantly enhanced the cytotoxic effect of radiotherapy in a panel of human cancer cell lines. [score:1]
[1 to 20 of 89 sentences]
6
[+] score: 311
Similarly, MALAT1-silencing led to the upregulation of E-cadherin and the downregulation of ZEB1, ZEB2, and N-cadherin in HESCs; however, the cotransfection of these cells with the miR-200c inhibitor abolished E-cadherin upregulation and ZEB1, ZEB2, and N-cadherin downregulation. [score:15]
Functional studies showed that MALAT1 knockdown inhibits the proliferation and migration of HESCs, while downregulation of miR-200c expression restores these abilities in HESCs. [score:9]
We identified miR-200c as an EMT-suppressive miRNA in endometriosis that acts, at least in part, by downregulating the RNA level of MALAT1, which in turn functions as a ceRNA to upregulate ZEB1 and ZEB2 by sequestering miR-200c. [score:9]
EC ectopic endometrial, EN normal endometrial To better understand the biological function of miR-200c in endometriosis, primary endometrial stromal cells (HESCs) derived from human endometrial biopsies were transfected with the miR-200c mimic or inhibitor to overexpress or suppress miR-200c expression, respectively. [score:9]
EdU 5-ethynyl-2′-deoxyuridine, MALAT1 metastasis -associated lung adenocarcinoma transcript 1, Mimic NC negative control miRNA mimic, Inhibitor NC negative control miRNA inhibitor, siRNA small interfering RNA, siRNA NC negative control siRNA To investigate whether miR-200c is crucial for the progression of endometriosis in vivo, we established a rat endometriosis mo del to determine the effect of upregulation and downregulation of miR-200c. [score:9]
EdU 5-ethynyl-2′-deoxyuridine, Mimic NC negative control miRNA mimic, Inhibitor NC negative control miRNA inhibitor To gain insight into the mechanisms underlying the suppressive function of miR-200c in endometrial stromal cells, we next identified its target genes. [score:9]
In the current study, we found that miR-200c suppresses the proliferation and migration of endometrial stromal cells by downregulating metastasis -associated lung adenocarcinoma transcript 1 (MALAT1), a lncRNA which in turn functions as a miR-200c decoy and abolishes the suppressive effect of miR-200c. [score:8]
Further, western blot analysis confirmed the effect of the miR-200c inhibitor on expression of ZEB1, ZEB2, E-cadherin, and N-cadherin, and these changes in gene expression were reversed by MALAT1 knockdown (Fig.   4g). [score:8]
miR-200c suppresses expression of mesenchymal marker genes by downregulating MALAT1. [score:8]
g of ZEB1, ZEB2, N-cadherin, and E-cadherin expression after transfection of HESCs with the miR-200c inhibitor (100 nM), NC inhibitor, siMALAT1 (50 nM), or siNC for 48 hours. [score:7]
ZEB1 and ZEB2 mRNAs are well-described targets of the miR-200 family, and many reports have suggested that miR-200 family members block EMT by inhibiting ZEB1 and ZEB2 expression [15]. [score:7]
EC ectopic endometrial, EN normal endometrial, MALAT1 metastasis -associated lung adenocarcinoma transcript 1, Mimic NC negative control miRNA mimic, Inhibitor NC negative control miRNA inhibitor, siRNA small interfering RNA, siRNA NC negative control siRNA To define the role of miR-200c in the development and progression of endometriosis, we examined its effects on EMT regulation. [score:7]
g qRT-PCR analysis of MALAT1 expression in HESCs after transfection with the miR-200c mimic (50 nM), mimic NC, miR-200c inhibitor (100 nM), or inhibitor NC for 24 hours. [score:7]
Indeed, the overexpression of miR-200c increased the level of E-cadherin and decreased the levels of ZEB1, ZEB2, and N-cadherin proteins, whereas an opposite effect was observed when miR-200c was suppressed using the miR-200c inhibitor in HESCs. [score:7]
a of ZEB1, ZEB2, N-cadherin, and E-cadherin expression after transfection of HESCs with the miR-200c mimic (50 nM), NC mimic, miR-200c inhibitor (100 nM), or NC inhibitor for 48 hours. [score:7]
In addition, functional studies showed that overexpression of miR-200c inhibited the proliferation of HESCs, while the inhibition of miR-200c promoted cellular proliferation. [score:7]
Exogenous overexpression of miR-200c inhibited the proliferation and migration of HESCs, which were mainly regulated by metastasis -associated lung adenocarcinoma transcript 1 (MALAT1). [score:6]
As shown in Fig.   2a, b, Transwell assays revealed that miR-200c overexpression suppressed the migration of HESCs, whereas the opposite effect was observed when this miRNA was inhibited. [score:6]
The suppression of proliferation and migration by miR-200c therefore depends, to a certain extent, on the downregulation of MALAT1. [score:6]
To further investigate the correlation between miR-200c and MALAT1 expression in endometrial stromal cells, MALAT1 expression was knocked down in HESCs, which resulted in a significant increase in expression of miR-200c (Fig.   3h, i). [score:6]
In contrast, inhibition of miR-200c promoted the proliferation and migration of HESCs, while the simultaneous silencing of MALAT1 expression exerted the opposite effects. [score:5]
Moreover, functional studies showed that HESCs transfected with the miR-200c inhibitor demonstrated a significant increase in proliferation and migration; however, silencing of MALAT1 resulted in a significant reduction in proliferation and migration and abolished the effect of the miR-200c inhibitor on HESCs (Fig.   4c–f). [score:5]
e, f Relative luciferase activities in HESCs corresponding to binding site 1 (e) and binding site 2 (f) after cotransfection with the pMIR-REPORT-MALAT1 reporter and the miR-200c mimic (50 nM), mimic NC, miR-200c inhibitor (100 nM), or inhibitor NC for 48 hours. [score:5]
Therefore, miR-200c suppresses EMT by targeting MALAT1 in endometriosis. [score:5]
miR-200c overexpression resulted in a significant decrease in luciferase activity, whereas the opposite effect was observed when this miRNA was inhibited (Fig.   3e, f). [score:5]
Restoration of miR-200c expression in endometrial stromal cells suppresses cellular migration and proliferation. [score:5]
The mimic NC group and the miR-200c mimic group received 1 nmol RNA; the inhibitor NC group and the miR-200c inhibitor group received 2.5 nmol of RNA. [score:5]
We demonstrated that expression of MALAT1 in ectopic endometrial specimens was negatively correlated with that of miR-200c and that MALAT1 knockdown increased the level of miR-200c in HESCs. [score:4]
miR-200c directly targets the lncRNA MALAT1. [score:4]
Further, we conducted luciferase reporter assays and transfected cells with the miR-200c mimic or inhibitor to demonstrate that MALAT1 is a target of miR-200c in HESCs. [score:4]
miR-200c is frequently downregulated in endometriosis. [score:4]
Mechanistically, the MALAT1/miR-200c sponge acts, at least in part, by regulating expression of ZEB1 and ZEB2 in endometrial stromal cells. [score:4]
Near-infrared imaging showed that the intensity of fluorescence was significantly reduced in the miR-200c mimic treatment group compared with that in the mimic NC treatment group, while the intensity of fluorescence was significantly increased in the miR-200c inhibitor treatment group compared with that in the inhibitor NC treatment group (Fig.   5a, b). [score:3]
miR-200c has also been shown to be involved in the EMT through targeting ZEB1 and ZEB2, the transcriptional repressors of E-cadherin [15]. [score:3]
Therefore, miR-200c suppresses the migration and proliferation of endometrial stromal cells in vitro. [score:3]
Based on these findings, we used an miRNA–lncRNA interaction analysis program, starBase v2.0 [20], to screen for potential lncRNAs targeted by miR-200c. [score:3]
In contrast, the miR-200c inhibitor significantly promoted cell proliferation (Fig.   2c, d). [score:3]
In the present study, we found that miR-200c was significantly downregulated in EC compared with in EN tissues. [score:3]
The MALAT1/miR-200c sponge may be a potential therapeutic target for endometriosis. [score:3]
For in-vivo therapeutic interventions, polymeric nanoparticles of polyethylenimine–polyethylene glycol–arginine–glycine–aspartic acid were used for delivery of miR-200c mimic and inhibitor to determine the therapeutic effect of miR-200c in a rat mo del of endometriosis. [score:3]
b– d qPCR analysis of miR-200c (b), miR-638 (c), and let-7i (d) expression in 27 EC and 12 EN tissues. [score:3]
Furthermore, miR-200c mimic treatment reduced the volume of ectopic endometrial cysts, whereas miR-200c inhibitor treatment increased the volume of ectopic endometrial cysts in a rat endometriosis mo del. [score:3]
Therefore, MALAT1 is a target of miR-200c. [score:3]
In contrast, the miR-200c inhibitor significantly restored the MALAT1 RNA level in HESCs (Fig.   3g). [score:3]
In contrast, the miR-200c inhibitor significantly increased the protein levels of ZEB1 and ZEB2 in HESCs (Fig.   4a). [score:3]
Compared with those in EN tissues, three miRNAs (miR-200c, miR-638, and let-7i) were significantly downregulated in EC tissues (fold change cutoff ≥ 2.0 and P < 0.05) (Fig.   1a). [score:3]
As shown in Fig.   1b, miR-200c was significantly downregulated in EC tissues (n = 27) compared with in EN tissues (n = 12) (P < 0.0001). [score:3]
Overall, these findings suggest that the MALAT1/miR-200c sponge may represent a potential and novel therapeutic target for endometriosis. [score:3]
Two lncRNAs (MALAT1 and XIST) were identified as possible targets of miR-200c. [score:3]
The miR-200c mimic, miR-200c inhibitor, siRNA against MALAT1, and their respective negative controls (scrambled oligos) were obtained from RiboBio. [score:3]
When the rats were sacrificed 20 days after injection, we observed a significant reduction in the ectopic endometrial cyst volume in the miR-200c mimic treatment group compared with that in the mimic NC treatment group; in contrast, the volume of ectopic endometrial cysts was significantly increased in the miR-200c inhibitor treatment group compared with that in the inhibitor NC treatment group (Fig.   5c, d). [score:3]
miR-200c suppresses of the growth of endometriotic lesions in vivo. [score:3]
Furthermore, using a rat endometriosis mo del, we showed that local delivery of the miR-200c mimic significantly inhibited the growth of ectopic endometriotic lesions. [score:3]
The MALAT1/miR-200c sponge significantly affects the proliferation and migration of endometriotic stromal cells, indicating that this sponge may be a novel target for the diagnosis and treatment of endometriosis. [score:3]
In our study, we used a miRNA–lncRNA interaction analysis program and identified lncRNA MALAT1 and XIST as possible targets of miR-200c. [score:3]
Briefly, pMIR-REPORT-MALAT1 or pMIR-REPORT-MALAT1-mut was cotransfected with the miR-200c mimic, the miR-200c inhibitor, or the corresponding negative controls into HESCs using Lipofectamine 2000 according to the manufacturer’s instructions. [score:3]
In addition, we performed therapeutic interventions with the miR-200c mimic and inhibitor in a rat mo del of endometriosis, and our results demonstrated the potential therapeutic effect of miR-200c in endometriotic lesions. [score:3]
Moreover, the results of a 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay indicated that miR-200c overexpression substantially reduced the rate of cell proliferation. [score:2]
These results suggested that MALAT1 regulated the proliferation and migration of HESCs in a miR-200c -dependent manner. [score:2]
c EdU assay to evaluate the proliferation of HESCs treated with the miR-200c inhibitor (100 nM), NC inhibitor, siMALAT1 (50 nM), or siNC for 48 hours (magnification, 200×). [score:2]
Moreover, mutations in the predicted miR-200c binding sites abolished this effect (Fig.   3d–f). [score:2]
e Transwell assay to evaluate the migration of HESCs treated with the miR-200c inhibitor (100 nM), NC inhibitor, siMALAT1 (50 nM), or siNC for 48 hours (magnification, 200×). [score:2]
The miR-200c binding sites at positions 3483 and 5466 containing partial MALAT1 sequences are located at 3410–3809 nt and 5205–5634 nt, respectively. [score:1]
In addition, miR-200c and MALAT1 levels were significantly negatively correlated. [score:1]
h, i Relative RNA levels of MALAT1 (h) and miR-200c (i) in HESCs that were transiently transfected with siMALAT1(50 nM) or siNC for 24 hours. [score:1]
c Pearson correlation analysis of miR-200c and MALAT1 RNA levels in EC tissues represented by Pearson R scores (n = 27, R < 0 denotes negative correlation). [score:1]
Of note, the miR200/MALAT1 sponge mediating the EMT processes in endometriosis is complex and never exclusive. [score:1]
Furthermore, the level of MALAT1 was significantly lower in cells transfected with the miR-200c mimic than in cells transfected with the negative control miRNA mimic (mimic NC) (Fig.   3g). [score:1]
Fig. 5Therapeutic delivery of miR-200c reduced ectopic endometrial cysts in a rat mo del. [score:1]
Therefore, miR-200c exerts a therapeutic effect in a rat mo del of endometriosis. [score:1]
Next, we used RNA hybridization programs to demonstrate that the MALAT1 sequence (NR_002819.2) contains two putative binding sites for miR-200c at 3483–3489 bp and 5466–5481 bp (Fig.   3d). [score:1]
An increase in miR-200c levels in HESCs by transfection of the miR-200c mimic repressed ZEB1 and ZEB2 protein levels (Fig.   4a). [score:1]
Moreover, the level of MALAT1 was negatively correlated with the miR-200c level (P < 0.0001, r = −0.8176) (Fig.   3c). [score:1]
These findings prompted us to look further into the role of miR-200c in endometriosis. [score:1]
Notably, endometrial stromal β-catenin is required for steroid -dependent mesenchymal–epithelial crosstalk and decidualization [33]; whether the LPAR3/β-catenin pathway also contributes to the EMT processes in endometriosis and its possible crosstalk with the miR200/MALAT1 sponge requires further research. [score:1]
Moreover, the transfection of endometrial stromal cells with the miR-200c mimic or MALAT1 siRNAs decreased the protein levels of mesenchymal markers ZEB1, ZEB2, and N-cadherin and increased the protein levels of the epithelial marker E-cadherin. [score:1]
[1 to 20 of 76 sentences]
7
[+] score: 288
2016.00140/full#supplementary-material Figure S1 miR-200 inhibitors up-regulate PTEN expression. [score:8]
Taken together, the miR-200 family, especially miR-200c, directly targets the 3′UTR of PTEN and inhibits its protein expression. [score:8]
In conclusion, our results show that at the early stage of Aβ damage, ER stress induces upregulation of miR-200c to inhibit PTEN expression and protect neurons from Aβ toxicity. [score:8]
Overexpression of miR-200c rescued such reduction upon Aβ treatment, whereas transfection of miR-200c inhibitors further exacerbated neurite outgrowth inhibition (Figure 4C, lower panel; Figures 4D,E, black bars). [score:7]
To identify the binding site of miR-200 that plays the most important role in miR-200-regulated PTEN protein expression, we generated three different site-directed mutations on PTEN 3′UTR. [score:6]
In our study, we found Aβ peptide treatment induces phosphorylation of PERK and eIF2 α and upregulates miR-200c expression, which were also observed in APP/PS1 mouse brains (4–6 months old). [score:6]
Since we have identified PTEN as a major target of miR-200c, we then altered the level of PTEN protein by overexpression or knocking down and examine neurite outgrowth by immunostaining same as above (Figure 3H). [score:6]
To explore the potential roles of miR-200 family members in translational regulation of PTEN expression, we co -transfected a luciferase reporter construct containing PTEN 3′UTR together with different miR-200 family members. [score:6]
We provided evidence showing that upregulation of miR-200 family by ER stress exhibited protective roles via PTEN suppression in early phase of AD. [score:6]
In order to understand the role of miR-200 family in AD development, we employed the TargetScan (version 6.2, 2012) database to predict potential miR-200 target genes. [score:6]
Consistently, in AchE -positive cortical neurons, overexpression of miR-200c or inhibition of PTEN promoted neurite outgrowth. [score:5]
Since miR-200c is dysregulated in the AD brain and is important for neuronal survival at least in part through regulating the expression of PTEN, we examined the role of miR-200c in Aβ -induced neuronal cell death. [score:5]
On the other hand, transfection of miR-200 inhibitors to HCT116 colon cancer cells that have high endogenous levels of miR-200 resulted in increased expression of PTEN (Figure S1). [score:5]
Overexpression of miR-200 family inhibitors dramatically enhanced luciferase reading (Figure 1C). [score:5]
Consistent with this notion, pretreatment of neuronal cells with PBA, an ER stress inhibitor, decreased the level of phospho-eIF2α and inhibited the induction of miR-200c (Figure 6C). [score:5]
Knocking down of PTEN resulted in similar increase in the percentage of living cells compared to the overexpression of miR-200c, whereas overexpression of PTEN protein caused significant cell death (Figure 2B). [score:5]
The correlated expression pattern of miR-200c and early ER stress markers suggested a link between Aβ -induced ER stress and microRNA expression. [score:5]
Overexpression of miR-200c enhanced NGF -induced neurite outgrowth, whereas inhibition of miR-200c showed the opposite effect (Figures 3E–G). [score:5]
To further elucidate the role of miR-200c during AD development, we examined the expression of both miR-200c and PTEN in mouse cortexes at different developmental stages of APP/PS1 transgenic mice. [score:5]
The mimic or inhibitors of miR-200 family and siPTEN/control siRNAs were synthesized by Life Technologies with sequences shown in Table 1. Table 1 Sequences of synthesized miR mimics/inhibitors or siRNA. [score:5]
The mimic or inhibitors of miR-200 family and siPTEN/control siRNAs were synthesized by Life Technologies with sequences shown in Table 1. Table 1 Sequences of synthesized miR mimics/inhibitors or siRNA. [score:5]
Overexpression of miR-200c significantly promoted cell viability of both PC12 cells and cultured rat cortical neurons, while overexpression of antisense oligo against miR-200c reduced the survival rate (Figures 2A,C). [score:5]
To test if the expression level of miR-200c in the peripheral blood has an indicative role for AD development, we examined plasma miR-200c level in both APP/PS1 mice and AD patients. [score:4]
As shown in Figure S2H and Figure 4, overexpression of miR-200c in AChE positive cells resulted in enhanced neurites outgrowth and knocking down of miR-200c caused a significant reduction in neurites length in AChE positive cells (Figure S2H; Figure 4C, upper panel; Figures 4D,E, white bars). [score:4]
Figure 6 Expression of miR-200c is regulated by Aβ -induced ER stress. [score:4]
Among them, microRNA-200 family showed a dynamic expression profile during AD development in the APPswe/PSΔE9 transgenic mice. [score:4]
Consistent with this notion, we found that overexpression of miR-200c and knocking down of PTEN protect neurite outgrowth in both PC12 cells and SCG neurons. [score:4]
When we divided the AD patients into two groups according to the disease severity, we found the plasma miR-200c levels of the 7 moderate to severe AD patients were modestly higher (Range = 1.45 × 10 [5] to 7.28 × 10 [5] copies/μl plasma, mean = 2.80 × 10 [5] ± 0.82 × 10 [5] copies/μl plasma) than that of the healthy controls (P = 0.058) (Figure 7B), indicating that plasma miR-200c may also be related to AD development. [score:4]
miR-200c is up-regulated in the plasma of moderate to severe AD patients. [score:4]
TrkA seems to be the regulatory target of miR-200c in the process of neurite outgrowth. [score:4]
Among the three sites, site II seems to have the most important role in the regulation of PTEN expression by miR-200 family. [score:4]
Among them, miR-200a/b/c, miR-141, and miR-429 in the miR-200 family were significantly upregulated in early age AD in mice. [score:4]
Under the stress of Aβ peptide, UPR is activated and miR-200c is upregulated under an thus far unknown mechanism We hypothesized that it might be due to the activation of transcriptional factors such as XBP1, ATF4, and ATF6. [score:4]
It is plausible that the upregulation of miR-200c induced by Aβ may be mediated by ER stress. [score:4]
We found that miR-200c significantly suppresses the level of PTEN expression in 293T cells (Figure 1G), which is consistent with aforementioned results in the luciferase reporter assay. [score:4]
Taken together, our data show that ER stress pathways play an essential role in Aβ -induced miR-200c expression. [score:3]
In this study, we identified PTEN as a target of miR-200 family in neuronal cells. [score:3]
HCT-116 cells were transfected with different combinations of miR-200 inhibitors as indicated. [score:3]
miR-200c expression is correlated with neuronal ER stress. [score:3]
As predicted by Targetscan (version 6.2, 2012), three miR-200 family bind sites (Site I and Site III for miR-141/200a, Site II for miR-200b/c/429) are highlighted. [score:3]
Both phospho-PERK and phospho-eIF2α increased in APP/PS1 transgenic mice at early stages, which is similar to the expression pattern of miR-200c. [score:3]
Figure 5 Expression pattern of miR-200c and PTEN in APP/PS1 mice brains is correlated with ER stress makers. [score:3]
The expression of PTEN showed a reciprocal pattern to that of miR-200c (Figures 5B,C). [score:3]
Overexpression of miR-200c reduced the insult of Aβ in both PC12 cells and cortical neurons (Figures 4A,B), indicating that the miRNA plays a protective role against Aβ -induced neuronal damage. [score:3]
The UPR signalings contributes to neuron homeostasis at the early stage of Aβ impairment at least partially via miR-200c and its targets. [score:3]
These results indicate that ER stress pathways are the mediators of Aβ–induced miR-200c expression. [score:3]
Expression of miR-200c increased gradually during in cultured cortical neurons and NGF -treated PC12 cells (Figures 3A,B). [score:3]
PC12 cells were transfected with miR-200c mimic or inhibitor followed by NGF treatment for 48 h and cell lysate was harvested. [score:3]
ER stress pathways are essential for Aβ–induced miR-200c expression changes. [score:3]
Identification of PTEN as a target of miR-200 family. [score:3]
Database prediction indicated that PTEN has three miR-200 family binding sites in its 3′UTR and may be one of the potential targets of miR-200 family (Figure 1A). [score:3]
Increased miR-200c expression in early stage AD is induced by ER stress. [score:3]
Among miR-200 family, miR-200c is the major microRNA that targets PTEN. [score:3]
The level of PTEN protein gradually decreased in the same process (Figures 3C,D), further supporting the notion that PTEN is a target of miR-200c. [score:3]
MiR-200c expression increased gradually along with phosphorylated eIF2α (Figures 6A,B, middle and lower panels). [score:2]
In addition to neuronal cell survival, we also tested whether miR-200c regulates neurite outgrowth. [score:2]
Members of the miRNA-200 family regulate olfactory neurogenesis. [score:2]
Among the five miR-200 family members, miR-200c plays the most important regulatory role and was used to represent miR-200 family in the following parts of the study (Figures 1D–F). [score:2]
Relative expression of miR-200c was detected by qPCR Data was represented as fold changes compared with the level at 2-month old; [*] P < 0.05). [score:2]
To test if TrkA signaling plays an important role in miR-200c mediated regulation of neurite outgrowth, AChE was stained to label those cortical neurons that are TrkA positive. [score:2]
It will be valuable to examine the level of plasma miR-200c in familial AD patients that harbor APP or PS1 mutations. [score:2]
These results indicate that miR-200c regulates neurite outgrowth of TrkA positive neurons. [score:2]
To further confirm whether plasma miR-200c in human samples is indicative for AD development, we collected 27 human plasma samples. [score:2]
Critical role of the miR-200 family in regulating differentiation and proliferation of neurons. [score:2]
Expression level of miR-200c is represented as the fold change compared to time point 0. (B) PC12 cells were treated with Aβ, followed by similar experiments described in (A). [score:2]
miR-200c plays protective roles in Aβ -induced neuronal cell damage. [score:1]
Figure 7 Detection of plasma-circulating miR-200c in AD mice mo del and patients. [score:1]
Figure 4 miR-200c protects neurons from Aβ -induced damage. [score:1]
In nerve system, miR-200 family is enriched in olfactory and has been implicated in neuronal proliferation and differentiation (Choi et al., 2008; Pandey et al., 2015). [score:1]
Figure S3 miR-200c cannot induce ER stress. [score:1]
Plasma miR-200c levels were much higher in APP/PS1 mice than wild type mice from 2 to 6 months of age (Figure 7A). [score:1]
For luciferase activity assay, we introduced mutations on each miR-200 family miR binding site by overlap PCR. [score:1]
Figure S2 miR-200c is important for neurite outgrowth in cultural SCG neuron. [score:1]
The effects of miR-200c on neurite outgrowth were not observed in rat cortical neurons (Figure S2G), which may stem from the difference where PC12 cells and SCG neurons use TrkA signaling but cortical neurons mainly use TrkB signaling. [score:1]
In the 14 AD human patients (among them 7 with mild AD and 7 with moderate to severe AD), plasma miR-200c levels (range = 4.5 × 10 [4] to 7.28 × 10 [5] copies/μl plasma; mean = 2.04 × 10 [5] ± 0.50 × 10 [5] copies/μl plasma) were not significantly different from that in the healthy controls (range = 5.3 × 10 [4] to 3.36 × 10 [5] copies/μl plasma; mean = 1.49 × 10 [5] ± 0.25 × 10 [5] copies/μl plasma). [score:1]
We found that miR-200c does not induce ER stress (Figure S3). [score:1]
However, when Aβ is accumulated to a threshold, the apoptosis program is started and miR-200c is decreased, which is consistent with the time scale of neuronal loss in this APP/PS1 mouse mo del. [score:1]
So we hypothesized that in this APP/PS1 mouse mo del brain, at the early stages of Aβ stress (4–6 months old), UPR is activated and miR-200c increases to play the protective roles. [score:1]
However, in human, only patients with moderate to severe AD have a relatively higher plasma miR-200c level, but not mild AD patients. [score:1]
Our data indicate that Aβ-miR-200c-PTEN pathway may play important roles in cholinergic neurons at the early stage of AD. [score:1]
At this late stage of ER stress induced by Aβ, miR-200c is decreased and PTEN is restored to accelerate the detrimental neuron death. [score:1]
Chronic exposure to Aβ peptide disrupts homeostasis of neurons and results in the face of miR-200c response and neuronal cell death. [score:1]
The TaqMan probe for miR-200c is 5′-FAM-CACTGGATACGACTCCATCATTACC- TAMRA-3′. [score:1]
Name of miRs/siRNAs Sequence miR-200a 5′-UAACACUGUCUGGUAACGAUGU miR-200b 5′-UAAUACUGCCUGGUAAUGAUGA miR-200c 5′-UAAUACUGCCGGGUAAUGAUGGA miR-141 5′-UAACACUGUCUGGUAAAGAUGG miR-429 5′-UAAUACUGUCUGGUAAUGCCGU miR-NC 5′-UAACGUGUCACGUCUCCGACUA Anti-miR-200c 5′-UAACACUUGCCGGGUAAUGGUGUA Anti-miR-NC 5′-UCUUGCCGGGCCCGAUCCAACGA siCont 5′-UUCUCCGAACGUGUCACGU siPTEN 5′-AACCCACCACAGCUAGAACUU 2.3 kb PTEN 3′UTR was amplified by PCR from a human cDNA library. [score:1]
pMIR-Reporter constructs containing either wild type or mutant fragments of PTEN 3′UTR were co -transfected into 293T cells with miR-200 family miRs (miR-141/200a, miR-200b/c/429, or miR-200c). [score:1]
MiR-200 family can be divided into two groups according to the seed sequences (group I: miR-141 and miR-200a; group II: miR-200b, miR-200c, and miR-429). [score:1]
Total RNA was also extracted and subjected to qPCR analysis of miR-200c (right panel). [score:1]
To further investigate the role of miR-200c on neurite outgrowth, miR-200c mimic or inhibitor was transfected into PC12 cells together with GFP as a transfection indicative marker. [score:1]
miR-200c and PTEN are involved in neuronal survival and neurite outgrowth. [score:1]
Figure 2 Effects of miR-200c and PTEN on neuronal cell viability. [score:1]
Cotransfection of miR-200b, miR-200c, a mixture of group I, group II or the whole family of miR-200s all resulted in a decrease in luciferase activity (Figure 1B). [score:1]
In this study, miR-200c helps to maintain the balance between survival and death during Aβ -induced ER stress. [score:1]
A series of truncations containing different miR-200 family binding sites were also amplified and cloned into the pMIR-REPORT vector. [score:1]
Figure 3 miR-200c is important for neurite outgrowth in PC12 cells and cultural cortical neuron. [score:1]
Human plasma samples and quantification of plasma circulating miR-200c. [score:1]
[1 to 20 of 95 sentences]
8
[+] score: 272
Ectopic expression of ZEB1 in EGFR-mutated lung cancer cells inhibited cell growth by increasing miR-200c target Notch1, which repressed ErbB3 promoter activity and the expression of ErbB3 [77]. [score:9]
When HuR was nuclear, high expression of miR-200c inhibited TUBB3 expression and resulted in a good prognosis, whereas when HuR occurred in cytoplasm, the same miRNA enhanced TUBB3 expression and produced a poor outcome [116]. [score:9]
Concurrent down-regulation of TGF-β pathway genes and high levels of E-cadherin and miR-200 expression were revealed in the cancerous cysts by gene expression profiling. [score:8]
The expression of miR-200 targets, ZEB2 and TGF-β2, were increased several folds, without any change in the expression of epithelial protein E-cadherin [87]. [score:7]
Second, kidney tubule-specific knockout of Dicer, the miRNA biogenesis enzyme, led to significant down-regulation in the expression of all five members of the miR-200 family and formation of kidney tubule-derived cysts [16]. [score:7]
Most of the studies on the miR-200 family in cancer research have been focused on the function of this miRNA family in suppressing EMT, leading to E-cadherin overexpression, epithelial cell identity, and cancer metastasis inhibition [3, 18, 19]. [score:7]
This interesting study suggests a mo del for the combined regulatory activity of miR-200c and HuR on TUBB3 expression in ovarian cancer that may not happen in other cell types and provides additional insight into studying potential player(s) that may affect the outcome of miR-200 interaction with target genes. [score:6]
Our analysis of the miR-200 expression levels in ovarian cell lines growing in three-dimensional (3D) cultures suggests that the expression of miR-200s shows cluster -dependent co-regulation [6]. [score:6]
Similarly, in lung cancer [94], miR-200c directly targeted VEGF receptor 2. In a bone cancer study, overexpression of miR-200c transformed the metastatic fast-growing tumor into a dormant tumor both in vivo and ex vivo. [score:6]
A study to analyze miR-200 expression in tissue from patients with or without relapse showed that miR-200b and miR-200c were down-regulated in relapsers compared with non-relapsers. [score:5]
Panda H. Pelakh L. Chuang T. D. Luo X. Bukulmez O. Chegini N. Endometrial miR-200c is altered during transformation into cancerous states and targets the expression of ZEBs, VEGFA, FLT1, IKKβ, KLF9, and FBLN5Reprod. [score:5]
The expression levels of miR-200a and miR-200c were significantly associated with disease progression. [score:5]
This suppression was reversed by the presence of miR-200c inhibitors [95]. [score:5]
In ovarian cancer, overexpression of miR-200c in an ovarian cancer cell line (Hey8A) decreased IL8 and CXCL1 expressions. [score:5]
Conversely, Cao et al. reported that elevated expression of miR-200a and miR-200b was associated with advanced stage and high-grade tumors, while high miR-200c expression was only associated with advanced tumors [72]. [score:5]
However, studies of clinical samples are not conclusive to relate the expression level of miR-200 family with disease stage. [score:5]
Restoration of miR-200c expression in an intraperitoneal xenograft mo del of human ovarian cancer reduced TUBB3 expression and resulted in a significantly decreased tumor burden [115]. [score:5]
miR-200 family is one of the several miRNAs that have been studied for the diagnosis and prognosis of ovarian cancers [2] and also well known as the master suppressor of epithelial-mesenchymal transition (EMT) for the expression of E-cadherin, the classical calcium -dependent cell–cell adhesion protein to maintain epithelial cell phenotype [3]. [score:5]
A previous study on Ishikawa cells (endometrial adenocarcinoma) revealed that restoration of miR-200c expression resulted in reduced mRNA expression and protein level of vascular-endothelial-growth factor (VEGF) [92]. [score:5]
TUBB3 is a direct target of miR-200c. [score:4]
We have also shown by quantitative reverse transcription-polymerase chain reaction (RT-PCR) that miR-200 pathway genes are up-regulated in microdissected cells derived from ovarian tumor tissues and serous tubal intraepithelial carcinoma (STIC), a precursor lesion for high-grade serous ovarian carcinoma (HGSOC) [32, 33, 45, 46, 47], relative to normal ovarian surface epithelial (OSE) and fallopian tube epithelial (FTE) cells. [score:4]
This suppression was attributed to the direct binding of miR-200c to the VEGF mRNA 3′-UTR region. [score:4]
Multivariate analysis confirmed that down-regulation of miR-200c in the test set was associated with overall survival, independent of clinical covariates [71]. [score:4]
Tryndyak V. P. Beland F. A. Pogribny I. P. E-cadherin transcriptional down-regulation by epigenetic and microRNA-200 family alterations is related to mesenchymal and drug-resistant phenotypes in human breast cancer cellsInt. [score:4]
Gregory P. A. Bert A. G. Paterson E. L. Barry S. C. Tsykin A. Farshid G. Vadas M. A. Khew-Goodall Y. Goodall G. J. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat. [score:4]
Interestingly, increased expression of miR-200 and E-cadherin was also identified in the laying hen mo del of spontaneous ovarian carcinoma [27, 28], implicating the importance of this conserved pathway in ovarian cancer development. [score:4]
Third, miR-200 knockdown in cultured renal epithelial cells inhibited tubulogenesis and produced cyst-like structures. [score:4]
Hajarnis S. S. Patel V. Aboudehen K. Attanasio M. Cobo-Stark P. Pontoglio M. Igarashi P. Transcription factor hepatocyte nuclear factor-1β (HNF-1β) regulates microRNA-200 expression through a long noncoding RNAJ. [score:4]
Regulation of miR-200 family on EMT and E-cadherin expression is well documented [2, 3, 18, 19]. [score:4]
On the contrary, Prilei et al. reported a direct correlation between miR-200c expression and chemoresistance in a panel of ovarian adenocarcinoma cell lines [116]. [score:4]
Also, in the analysis of 220 ovarian cancer samples, the relationship of miR-200c expression with clinical outcome depended on the cellular localization of HuR. [score:3]
Intriguingly, another study by Zhang et al. showed an opposite function of miR-200 target ZEB1 in EGFR-mutated lung cancer cells. [score:3]
There is no direct evidence on linking miR-200s to ovarian inclusion cyst formation; several lines of emerging evidence suggest that the miR-200 family plays an important role in renal tubule development, renal cyst pathogenesis and spermatogenic cyst formation in yellow catfish. [score:3]
Application of miR-200 antagomirs can reverse EMT caused by the depletion of ERRα molecules, with an increase of Snail expression [68]. [score:3]
The recent Cancer Genome Atlas (TCGA) genomic study of uterine carcinomasarcomas has also shown that sarcomas and uterine carcinosarcomas with extensive sarcoma components showed enhanced promoter methylation and down -expression of miR-200 family [41]. [score:3]
Analysis of TUBB3 3′-UTR -associated complexes identified that miR-200c increased the association of the RNA binding protein HuR, which enhanced TUBB3 mRNA translation. [score:3]
Zuberi M. miR R. Das J. Ahmad I. Javid J. Yadav P. Masroor M. Ahmad S. Ray P. C. Saxena A. Expression of serum miR-200a, miR-200b, and miR-200c as candidate biomarkers in epithelial ovarian cancer and their association with clinicopathological featuresClin. [score:3]
Resistance to paclitaxel and carboplatin was induced when inhibitors of miR-200c or miR-141 were transfected into the parental OVCAR-3. Notably, both OVCAR-3/TP and MES-OV/TP cells regained sensitivity to carboplatin but only MES-OV/TP regained sensitivity to taxol [117]. [score:3]
In a study reported by Cittelly et al., low miR-200c expression correlated with poor prognosis in ovarian tumors. [score:3]
Depletion of IRS-1 partially inhibited the miR-200 -dependent AKT activation [57]. [score:3]
First, the expression of miR-200 family members is reduced in injured kidney tubules, but highly enriched in the normal kidney tubules. [score:3]
2009.11.020 20005803 8. Beclin C. Follert P. Stappers E. Barral S. Nathalie C. de Chevigny A. Magnone V. Lebrigand K. Bissels U. Huylebroeck D. miR-200 family controls late steps of postnatal forebrain neurogenesis via zeb2 inhibitionSci. [score:3]
For ovarian cancer prognosis, several studies have studied the association between circulating miR-200 levels and disease prognosis. [score:3]
Introduction of miR-200c and miR-141 mimics into OVCAR-4/TP resulted in alternation in expression of genes related to oxidative stress. [score:3]
miR-200a overexpression was found to be associated with mucinous histology and advanced stage tumors, and patients with lymph node metastasis showed significant elevation of miR-200c [123]. [score:3]
This further suggests that miR-200c negatively regulates angiogenesis. [score:2]
Pandey A. Singh P. Jauhari A. Singh T. Khan F. Pant A. B. Parmar D. Yadav S. Critical role of the miR-200 family in regulating differentiation and proliferation of neuronsJ. [score:2]
Concordantly, a recent study also showed that miR-200c negatively regulated VEGF mRNA and protein levels in placenta tissue [93]. [score:2]
Pecot C. V. Rupaimoole R. Yang D. Akbani R. Ivan C. Lu C. Wu S. Han H. D. Shah M. Y. Rodriguez-Aguayo C. Tumour angiogenesis regulation by the miR-200 familyNat. [score:2]
Further studies with more cell lines and co-culture experiments are required to provide insight into whether exosomal miR-200 transcript levels are associated with ovarian cancer development. [score:2]
Besides Taxol, miR-200c and miR-141 also regulate sensitivity to carboplatin. [score:2]
HNF-1β binds to a promoter region upstream of the miR-200 genes and directly controls the transcription of the miR-200a/b/429 cluster. [score:2]
miR-200s are highly conserved among vertebrate species and even in bilaterian animals, with miR-8 being the sole homolog of miR-200 in Drosophila melanogaster [7], implying that they possess important functions in a diversity of developmental processes. [score:2]
The miR-200 family is a master regulator of EMT in epithelial ovarian cancer. [score:2]
Gregory P. A. Bracken C. P. Smith E. Bert A. G. Wright J. A. Roslan S. Morris M. Wyatt L. Farshid G. Lim Y. Y. An autocrine TGF-β/ZEB/miR-200 signaling network regulates establishment and maintenance of epithelial-mesenchymal transitionMol. [score:2]
Furthermore, a study to characterize the function of an epithelial cell transcription factor implicated in cancer progression, grainhead-like 2 (GRHL2) in ovarian cancer showed that GRHL2 bound to miR-200 promoters, intronic enhancer of CDH1, and promoters of ErbB3 and other epithelial cell-related genes and positively regulated their expression [78]. [score:2]
Brozovic A. Duran G. E. Wang Y. C. Francisco E. B. Sikic B. I. The miR-200 family differentially regulates sensitivity to paclitaxel and carboplatin in human ovarian carcinoma OVCAR-3 and MES-OV cellsMol. [score:2]
Sulaiman S. A. Ab Mutalib N. S. Jamal R. miR-200c regulation of metastases in ovarian cancer: Potential role in epithelial and mesenchymal transitionFront. [score:2]
Chung V. Y. Tan T. Z. Tan M. Wong M. K. Kuay K. T. Yang Z. Ye J. Muller J. Koh C. M. Guccione E. GRHL2-miR-200-ZEB1 maintains the epithelial status of ovarian cancer through transcriptional regulation and histone modificationSci. [score:2]
As ErbB3 is essential for growth of EGFR-mutated lung cancer cells, the ZEB1/miR-200 negative feedback loop might potentially provide a cell context -dependent regulation of ErbB3. [score:2]
In our sequential in vitro 3D mo del in collagen I matrix, we noted that migrating HGSOC spheroids tended to release some single cells in the later phase of migration [6], and quantitative real-time PCR also demonstrated that HGSOC samples had a lower level of expression of miR-200 pathway genes compared to other histologic subtypes of ovarian tumors. [score:2]
In a study with two ovarian cancer cell lines, OVCAR-3 and MES-OV, and their paclitaxel resistant variants OVCAR-3/TP and MES-OV/TP, resistant variants OVCAR-3/TP showed a marked decrease in miR-200c and miR-141. [score:1]
Only high miR-200c levels and low miR-141 levels were significantly associated with a good survival rate [126]. [score:1]
A multivariate mo del combining miR-200b and miR-200c readings showed good predictive power to discriminate serous ovarian cancer patients and healthy controls. [score:1]
Herein we review the function of miR-200 on both pathogenesis and other aspects of ovarian cancer, and the potential utility in clinical diagnosis and therapies. [score:1]
Moreover, Kan et al. [124] revealed that individual levels of miR-200a, miR-200b and miR-200c normalized to serum volume and miR-103 were significantly higher in the sera of the serous ovarian cancer cohort. [score:1]
These five miRNAs form two clusters: cluster 1 of miR-200b, miR-200a and miR-429 maps to chromosome 1 (1p33.36), while the miR-200c and miR-141 cluster maps to chromosome 12 (12p13.31) [4]. [score:1]
miR-200 was reported to associate with chemoresponse in various types of cancer [109]. [score:1]
In human ovary, miR-200 may also have a role in ovarian cyst formation. [score:1]
Burk U. Schubert J. Wellner U. Schmalhofer O. Vincan E. SpadeRNA S. Brabletz T. A reciprocal repression between ZEB1 and members of the miR-200 family promotes emt and invasion in cancer cellsEMBO Rep. [score:1]
Two evolutionary-conserved binding sites for the miR-200 members were identified in the 3′-UTR of the polycystin 1 (PKD1) gene. [score:1]
In ovarian cancer, Taylor et al. reported that exosomal miR-200 levels were more elevated in sera from ovarian cancer patients than samples from benign controls [106]. [score:1]
Cortez et al. have shown that systemic delivery of miR-200c to the cancer cells in a lung cancer xenograft mo del could increase cellular radiosensitivity by modulation of miR-200c on oxidative stress response genes [128]. [score:1]
In a study of serum miR-200 levels in 74 ovarian cancer patients, both miR-200c and miR-141 were significantly elevated in cancer sera than in healthy control [126]. [score:1]
Koutsaki M. Spandidos D. A. Zaravinos A. Epithelial-mesenchymal transition -associated miRNAs in ovarian carcinoma, with highlight on the miR-200 family: Prognostic value and prospective role in ovarian cancer therapeuticsCancer Lett. [score:1]
Despite increase in tumor growth, the miR-200 -dependent stress response could also enhance sensitivity to chemotherapy, indicating its dual function in tumors. [score:1]
Korpal M. Kang Y. The emerging role of miR-200 family of microRNAs in epithelial-mesenchymal transition and cancer metastasisRNA Biol. [score:1]
Cittelly D. M. Dimitrova I. Howe E. N. Cochrane D. R. Jean A. Spoelstra N. S. Post M. D. Lu X. Broaddus R. R. Spillman M. A. Restoration of miR-200c to ovarian cancer reduces tumor burden and increases sensitivity to paclitaxelMol. [score:1]
However, the two miR-200 members showed discordant prognostic values. [score:1]
Alternatively, the miR-200 family members can also be categorized in two functional groups based upon the similarities of their seed sequences. [score:1]
Li Z. Yin H. Hao S. Wang L. Gao J. Tan X. Yang Z. miR-200 family promotes podocyte differentiation through repression of RSAD2Sci. [score:1]
2. miR-200 and Ovarian Cancer. [score:1]
Marchini S. Cavalieri D. Fruscio R. Calura E. Garavaglia D. Fuso Nerini I. Mangioni C. Cattoretti G. Clivio L. Beltrame L. Association between miR-200c and the survival of patients with stage I epithelial ovarian cancer: A retrospective study of two independent tumour tissue collectionsLancet Oncol. [score:1]
However, in our view, miR-200 function in epithelial cell identity and maintenance has a positive effect on ovarian cancer cell growth and collective movement in metastasis. [score:1]
Cao Q. Lu K. Dai S. Hu Y. Fan W. Clinicopathological and prognostic implications of the miR-200 family in patients with epithelial ovarian cancerInt. [score:1]
Cortez M. A. Valdecanas D. Zhang X. Zhan Y. Bhardwaj V. Calin G. A. Komaki R. Giri D. K. Quini C. C. Wolfe T. Therapeutic delivery of miR-200c enhances radiosensitivity in lung cancerMol. [score:1]
Li Q. Zhang C. Chen R. Xiong H. Qiu F. Liu S. Zhang M. Wang F. Wang Y. Zhou X. Disrupting MALAT1/miR-200c sponge decreases invasion and migration in endometrioid endometrial carcinomaCancer Lett. [score:1]
This miRNA family consists of five members: miR-200a, miR-200b, miR-200c, miR-141 and miR429. [score:1]
2.1. miR-200, EMT, and Epithelial Nature of Ovarian Cancer Cells. [score:1]
miR-200b, miR-200c and miR-429 (Functional Group I) all share the same seed sequence (5′-AAUACUG-3′), while miR-200a and miR-141 (Functional Group II) both share the same seed sequence (5′-AACACUG-3′), with the two functional groups differing in the seed sequence only by one nucleotide [5]. [score:1]
As mentioned in the Exosome section, Taylor et al. identified elevated exosomal miR-200 levels in the sera of ovarian cancer patients than in benign controls, and the circulating miRNA profiles accurately reflected the miRNA profiles in the tumors [106]. [score:1]
Taken together, the current studies have shown promising results for serum or plasma miR-200 levels as diagnostic and prognostic biomarkers. [score:1]
2.2. miR-200, Collective Movement, and Ovarian Cancer Metastasis. [score:1]
Gao Y. C. Wu J. MicroRNA-200c and microRNA-141 as potential diagnostic and prognostic biomarkers for ovarian cancerTumour. [score:1]
With the involvement of only two cell lines, Kobayashi’s study is not conclusive to associate the relationship between ovarian cancer cell invasiveness with miR-200 contents in the secreted exosomes. [score:1]
The levels of miR-200a in cancer sera samples were found to be six-fold, while the levels of miR-200b and miR-200c were three-fold higher than the levels in normal controls. [score:1]
miR-200c and miR-141, but not miR-200b, were reported to be associated with chemosensitivity in ovarian cancer. [score:1]
[1 to 20 of 97 sentences]
9
[+] score: 270
We confirmed that the recombinant mature form of miR-200c was active by observing downregulation in the expression of ZEB1, a known target for miR-200c, in both S2.028 and T3M-4 cells (Figure S1). [score:8]
These studies indicate that up-regulation of mucins and downregulation of miR-200c enhance the cancer cell malignant properties and thereby induce pancreatic cancer growth and metastasis. [score:7]
MiR-200c has been described as a powerful master regulator of epithelial-to-mesenchymal transition in breast and ovarian cancer cells through altering the expression of ZEB1 and E-cadherin by binding to 3’ UTRs and driving degradation or blocking translation of the target mRNA [11- 14]. [score:7]
Ectopic expression of miR-200c induces higher levels of E-cadherin in breast and pancreatic cancer cells through the direct targeting of transcription factor 8 (TCF8/ ZEB1), a negative regulator of E-cadherin [11- 14]. [score:7]
It has been shown that miR-200c is differentially expressed in pancreatic cancer, where high expression was associated with better survival and low expression is associated with worse survival [10]. [score:7]
These findings indicate that miR-200c regulates expression of oncogenic MUC4 and MUC16 transcription and translation. [score:6]
Overexpression of miR-200c increased the rate of proliferation in SUIT-2, PANC-1 and KP-3 pancreatic cancer cells [10], however, we observed reduced cell proliferation of S2.028 miR-200c expressing cells, suggesting that the cell growth properties differentially regulated by miR-200c are context dependent. [score:6]
These data led us to determine if miR-200c could directly target MUC4 and MUC16 transcripts within the translated regions. [score:6]
The mature sequence of miR-200c was synthesized and cloned into an expression vector as described above (p Silencer 4.1-CMV-miR-200c), and stably expressed in S2.028 cells and T3M-4. Quantitative RT-PCR analysis of miR-200c expression in S2.028-miR-200c cells showed a 3.68 fold increase and T3M-4-miR-200c cells showed a 2.6 fold increase in mature miR-200c levels compared to vector control transfected cells (Figure 1B and 1C). [score:6]
In conclusion, our study presents the first evidence that MUC4 and MUC16 are regulated at the post-transcriptional level by a miRNA, miR-200c, which directly targets MUC4 and MUC16 within their amino acid coding regions. [score:5]
0073356.g005 Figure 5Possible miR-200c targeting regions in MUC4 and MUC16 were identified by using the RegRNA MicroRNA target prediction web server (http://regrna. [score:5]
We report here that miR-200c targets exon coding sequences in transcripts of high molecular weight mucin glycoproteins MUC4 and MUC16 and reduces mRNA and protein expression. [score:5]
Potential miR-200c targeting regions in the MUC4 and MUC16 transcripts were identified by using the RegRNA MicroRNA target prediction web server (http://regrna. [score:5]
Overexpression of miR-200c significantly reduced the expression of ZEB1 in both (A) S2.028 and (B)T3M-4 cells. [score:5]
miR-200c: expression profiling and overexpression in pancreatic cancer cell lines. [score:5]
MUC4 and MUC16 expression is suppressed by miR-200c. [score:5]
This increased targeting of MUC16 by miR-200c may be due to the presence of ten different miR-200c binding regions in the MUC16 mRNA compared to the single binding region in the MUC4 coding sequence, raising the possibility that the number of targeting sites in a transcript influences the sensitivity of that transcript to miRNA regulation. [score:5]
Quantitative analysis of miR-200c expression in human pancreatic cancer cell lines and ectopic expression of miR-200c in S2.028 and T3M-4 cells. [score:5]
Previous work has also shown that pancreatic cancer cells overexpressing miR-200c exhibit reduced invasion and increased levels of E-cadherin mRNA, suggesting that miR-200c plays an inhibitory role in pancreatic cancer growth and invasion [10]. [score:5]
Recently, overexpression of miR-200c was shown to inhibit melanoma tumor progression and drug resistance [15]. [score:5]
Possible miR-200c targeting regions in MUC4 and MUC16 were identified by using the RegRNA MicroRNA target prediction web server (http://regrna. [score:5]
Cells expressing miR-200c or a scrambled control were harvested and protein was extracted using NP-40 cell lysis buffer (150mM NaCl, 50mM Tris-HCl, 1% NP-40, pH8.0) supplemented with protease inhibitors (Promega, Madison, WI, USA). [score:5]
Expression of MUC16 transcript was reduced in miR-200c expressing S2.028 and T3M-4 cells (C and D). [score:5]
Overexpression of miR-200c inhibits cancer cell invasion by modulating factors important in EMT [10]. [score:5]
These results are consistent with our study, which shows that overexpression of the mesenchymal to epithelial promoting miR-200c down regulates ZEB1 and MUC4 in pancreatic cancer cells. [score:4]
We assessed the ability of miR-200c to regulate membrane bound mucins by expressing miR-200c (p Silencer 4.1-CMV-miR-200c) in pancreatic cancer cell lines S2.028 and T3M-4. There was a dramatic reduction of MUC4 protein in S2.028-miR200c (1.7 fold) and T3M-4-miR-200c (4.46 fold) cells relative to control cells (Figure 2A and 2B). [score:4]
These results generally support the hypothesis that fluctuations in miR-200c contribute to regulation of expression of MUC4 and MUC16 during pancreatic tumor progression and metastases. [score:4]
miR-200c directly targets the coding sequences of MUC4 and MUC16. [score:4]
We report here that miR-200c interacts with specific sequences within the coding sequence of MUC4 and MUC16 mRNAs and regulates their levels of expression. [score:4]
These results indicate that miR-200c may have a potential inhibitory role in pancreatic cancer growth and metastasis and additional studies are required to delineate the regulatory relationship between membrane bound mucins and miR-200c. [score:4]
Regulation of MUC4 and MUC16 by miR-200c may be through effects on either transcription or translation. [score:4]
Mutations within potential miR-200c binding sites were generated by nucleotide replacement of wild type sequence to inhibit miR-200c binding. [score:4]
Specifically, miR-200c targets MUC4 and MUC16 exon sequences to regulate mRNA and protein levels for each of these mucins. [score:4]
A, RegRNA miRNA target prediction shows that miR-200c binds between base pairs 820-842 in the first exon of MUC4. [score:3]
The significantly reduced level of MUC16 observed in miR-200c overexpressing cells, along with the well documented role of miR-200c in multiple stages of cancer progression suggests that MUC16 may have a role in pancreatic cancer cell growth and metastasis. [score:3]
RegRNA miRNA target prediction identified high probability for miR-200c binding to coding sequences of MUC4 between base pairs 820-842 (Exon-1) (Figure 5A) (Figure S3) and ten different regions including nine different exons within MUC16 mRNA sequence (Figure 5B) (Figure S3). [score:3]
We have shown that miR-200c is differentially expressed in pancreatic cancer cells. [score:3]
Restoration of miR-200c expression in highly aggressive breast and ovarian cancer cells significantly reduced invasion, migration and drug resistance of these tumor types [30, 31]. [score:3]
S2.028 (B) and T3M-4 cells (C) stably expressing the primary transcript of miR-200c were evaluated for miR-200c expression by Real-time PCR. [score:3]
miR-200c targets transcriptionally membrane bound mucins MUC4 and MUC16. [score:3]
microRNA-200c targets MUC16. [score:3]
Clones were subsequently picked and analyzed for miR-200c expression in the S2.028 cell line (clone 7), while a polyclonal selected population was utilized for the T3M-4 cell line. [score:3]
0073356.g001 Figure 1 (A) The expression of miR-200c in seven pancreatic cancer cells were determined by Real-time PCR. [score:3]
As shown in Figure 1A, 5 pancreatic cancer cell lines, including Capan-1, S2.007, S2.013, S2.028, and T3M-4, express higher levels of miR-200c than S2.020 and HPAF cells. [score:3]
miR-200c targets transcript levels of MUC4 and MUC16 in S2.028 and T3M-4 cells. [score:3]
S2.028 and T3M-4 control and miR-200c expressing cells were counted and plated at 2,000 cells per well in a 96-well plate and 200 µl total volume, eight replicates for each time frame. [score:3]
Potential miR-200c binding sites in the membrane bound mucins (MUC4 and MUC16) transcripts were identified by using the RegRNA MicroRNA target predictor web server. [score:3]
We also examined the changes in the cell proliferation properties of miR-200c expressing S2.028 and T3M-4 pancreatic cancer cells. [score:3]
Luciferase assay showing that miR-200c regulates MUC4 and MUC16 expression in S2.028 and T3M-4 cells. [score:3]
miR-200c targets MUC4. [score:3]
miRNA-200c overexpression in S2.028 and T3M-4 pancreatic cancer cell lines. [score:3]
We also observed a significant reduction of both MUC4 and MUC16 mRNA levels in miR200c expressing cell lines. [score:3]
ORF regions of MUC16 and MUC4 mRNA that were predicted to interact with miR-200c were synthesized and inserted into pMIR-REPORT [TM] miRNA Expression Reporter Vector system (ABI, Carlsbad, CA, USA) using the SpeI and HindIII restriction sites (New England BioLabs, Ipswich, MA, USA). [score:3]
Oligonucleotides of the primary transcript of miR-200c were cloned into p Silencer 4.1-CMV plasmid (Ambion, Carlsbad, CA, USA) (Table S1) to establish a stable expression vector. [score:3]
Recently, Mohr et al showed miR-200c expression was reduced in primary pancreatic tumor tissues as compared to some metastatic sites [37]. [score:2]
Expression of miR-200c was quantified using TaqMan MicroRNA assay kit (ABI, Carlsbad, CA, USA) according to the manufacturer’s instructions. [score:2]
Expression of miR-200c was quantified using TaqMan MicroRNA assay kit (ABI, Carlsbad, CA, USA) according to the manufacturer’s protocol. [score:2]
Significant reductions of both high and low molecular weight MUC16 protein isoforms were observed in miR-200c expressing S2.028 (A) and T3M-4 cells (B) than compared to vector control cells. [score:2]
The miR-200c expressing cells (S2.028 and T3M-4) showed significantly reduced levels of MUC4 mRNAs compared to vector control cells (A and B). [score:2]
The miR-200c expressing cells showed a significant reduction of MUC4 protein compared to control cells in (A) S2.028 and (B) T3M-4 cells. [score:2]
We observed that luciferase reporter activity was significantly suppressed for both MUC4 and MUC16 in S2.028 and T3M-4 miR-200c cells transfected with wild type sequence vectors as compared to vector control transfected cells (***p<0.0001, MUC4-wt, MUC16-wt vs vector control) (Figure 6B-E). [score:2]
Table S1 List of oligonucleotides used for miR-200c expression and luciferase assay system. [score:2]
The numbers indicate the region of mRNAs that interact with miR-200c. [score:1]
Wild type and mutant MUC4 and MUC16/miR-200c interactions sequences were synthesized and used in this study (Table S1). [score:1]
Figure S3 Prediction of miR-200c binding sites in mucins. [score:1]
Prediction of miR-200c binding sequences on MUC4 and MUC16. [score:1]
We investigated the expression of miR-200c in 7 pancreatic cancer cell lines by quantitative real-time RT-PCR. [score:1]
microRNA isolation and Real time-PCR (RT-PCR) analysis of miR-200c. [score:1]
0073356.g004 Figure 4qRT-PCR analysis of MUC4 (A and B) and MUC16 (C and D) were carried out in vector control and miR-200c transfected S2.028 (A and C) and T3M-4 cells (B and D). [score:1]
0073356.g002 Figure 2 Lysates from (A) S2.028 and (B) T3M-4-miR-200c and respective vector control transfected cells were separated on SDS-Agarose gel electrophoresis, subjected to western blot using an anti-MUC4 antibody (left panels) and signals were quantified by densitometry and analyzed using the ImageJ program (right panels). [score:1]
The fold change in protein band intensity (percent arbitrary units) was calculated by dividing the protein density of miR-200c expressing cells by the protein density of vector control cells. [score:1]
Negative controls were produced in which the pMIR-MUC4 and MUC16 sequences were mutated at the putative binding sites for miR-200c and the mucins (pMIR-MUC4 and MUC16 mt) (Figure 6A). [score:1]
Lysates from (A) S2.028 and (B) T3M-4-miR-200c and respective vector control transfected cells were separated on SDS-Agarose gel electrophoresis, subjected to western blot using an anti-MUC4 antibody (left panels) and signals were quantified by densitometry and analyzed using the ImageJ program (right panels). [score:1]
qRT-PCR analysis of MUC4 (A and B) and MUC16 (C and D) were carried out in vector control and miR-200c transfected S2.028 (A and C) and T3M-4 cells (B and D). [score:1]
Higher expression of transmembrane mucins and loss of miR-200c are highly associated with metastatic characteristics of cancer cells. [score:1]
Therefore, cells with high levels of miR-200c have a more epithelial and less mesenchymal phenotype that may impact metastasis. [score:1]
Prediction of miR-200c interaction sites in MUC4 and MUC16 genes. [score:1]
B, In MUC16 mRNA, the miR-200c is predicted to bind nine different exons including E1, E3, E19, E39, E44, E49, E54, E64 and E73. [score:1]
These reports suggest that introduction of miR-200c into cancer cells could reverse tumor progression and provide a novel treatment strategy. [score:1]
0073356.g003 Figure 3 (A) S2.028 and (B) T3M-4-miR200c and respective vector control transfected cell lysates were separated by SDS-Agarose gel electrophoresis and subjected to western blot using an anti-MUC16 antibody (left panels). [score:1]
We evaluated binding of miR-200c to the putative target sequence by cloning the regions containing human MUC4 and MUC16 coding sequences into the pMIR-Luciferase reporter vector (pMIR-MUC4 and MUC16 wt). [score:1]
S2.028 and T3M-4/miR-200c cells were transiently transfected with plasmid DNAs encoding vector alone, wild type MUC4 and MUC16 sequences in the vector, and mutant type MUC4 and MUC16 sequences in the vector. [score:1]
[1 to 20 of 82 sentences]
10
[+] score: 262
Finally, we sought to determine if the epigenetic regulation of miR-200c expression in normal cells is conserved evolutionarily, reasoning that DNA methylation-linked control of miR-200c expression across mammalian species would provide further experimental support for epigenetic control of cell-type specific expression of miR-200c. [score:8]
Second, different histone codes exist between miR-200c/141 expressing and non -expressing cells that accurately mirror the expression and DNA methylation states. [score:7]
Mamm Genome 9 Hurteau GJ Carlson JA Spivack SD Brock GJ 2007 Overexpression of the microRNA hsa-miR-200c leads to reduced expression of transcription factor 8 and increased expression of E-cadherin. [score:7]
In this study, we show that the epigenetic state is closely linked to normal cell type specific expression of miR-200c and miR-141, and this epigenetic state is dysregulated in carcinoma cells, where loss of miR200c/141 expression is linked to aberrant DNA methylation and histone modifications. [score:6]
The significant conservation in DNA sequence, patterns of cell type-specific DNA methylation, and the associated miR-200c expression patterns between the human and mouse genomes, which are separated by 75 million years of evolution [22], provides evidence that epigenetic mechanisms play a functional role in the control of miR-200c expression. [score:5]
miR-200c and miR-141 expression is lost in different types of cancer cells [5], [11], [20], [21], and we sought to determine if this loss of expression was linked to epigenetic changes in the miR-200c/miR-141 CpG island. [score:5]
We show two prostate cancer cell lines (PC3 and PC3 B1) where loss of miR-200c and miR-141 expression is linked with aberrant DNA methylation of the mir-200c/141 CpG island (Figure 3B; Figure S3), and two prostate cancer cell lines (LNCaP and DU145) that retain miR-200c/miR-141 expression and an unmethylated mir-200c/141 CpG island. [score:5]
Mouse keratinocytes expressed significant levels of miR-200c, while the mouse fibroblasts did not express detectable levels of miR-200c (Figure 6B). [score:5]
Our small RNA library sequencing data (Figure 1A) show that the miR-200 family is highly expressed in cultured normal human mammary epithelial cells (HMEC) derived from three different individuals, whereas the isogenic human mammary fibroblast cells (FB) lack miR-200 family expression (Figure 1A). [score:5]
Taken together, the results from the analyses of miR-200c/141 expression, DNA methylation, and histone modification states across a variety of normal and cancer cell types demonstrate a close link between the expression of mir-200c/141 and the epigenetic state of their associated CpG island. [score:5]
In all cases, miR-200c and miR-141 were highly expressed in epithelial cells, but were not expressed in fibroblasts. [score:5]
The left panel shows the expression of miR-200c in the same samples as panel A. The right panel shows the expression of miR-200c in human prostate epithelial cells (PREC), prostate stromal fibroblasts (PSF), human skin keratinocytes (Kcytes) and skin fibroblasts (HFF). [score:5]
B. Mouse cells show a similar cell type specific pattern in miR-200c expression to human cells and this expression is linked to the DNA methylation state of the CpG island. [score:5]
The PC3 cells that have lost miR-200c and miR-141 expression, display an aberrantly methylated CpG island and a mesenchymal phenotype, whereas LnCaP and Du145 retain miR-200c and miR-141 expression and an epithelial phenotype [11], [30]. [score:5]
In summary, our findings provide multiple lines of evidence that epigenetic mechanisms are involved in the regulation of miR-200c/141 expression in both normal and cancer cells. [score:4]
Regulation of the miR-200 family expression in normal and cancer cells is not fully understood. [score:4]
In addition to the role of miR-200c and miR-141 in the phenotypic conversion of normal cells, dysregulation of normal patterns of miR-200c expression occurs in multiple types of cancer cells and is linked to tumor progression [2], [6], [12], [13], [14], [15]. [score:4]
Mouse cells show a similar inverse correlation between DNA methylation and miR-200c expression. [score:3]
B. miR-200c expression and mir-200c CpG island methylation in four prostate cancer cell lines. [score:3]
To demonstrate the functional significance of the epigenetic state of the miR-200c/mir-141 CpG island in cancer cells, we exposed cancer cells to the epigenetic modifier and DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-AdC). [score:3]
The other four breast cancer cell lines tested do not express miR-200c and miR-141 and exhibit a densely methylated mir-200c CpG island. [score:3]
It is apparent from the small RNA library sequencing data (Figure 1A) that the most highly expressed members of the miR-200 family in HMEC are miR-200c and miR-141. [score:3]
The histone modification state of the mir-200c cluster CpG island also shows cell type-specific differences that are closely linked to the expression state of miR-200c/141 in normal and cancer cells. [score:3]
The epigenetic modifier drug, 5-aza-2′-deoxycytidine, reactivates miR-200c/miR-141 expression showing that epigenetic mechanisms play a functional role in their transcriptional control. [score:3]
B. Real-time PCR assessment of miR-200c expression in normal cell types. [score:3]
miR-200c is expressed in an epithelial selective fashion. [score:3]
The CpG island is unmethylated in human miR-200/miR-141 expressing epithelial cells and in miR-200c/miR-141 positive tumor cells. [score:3]
The microRNA-200 family participates in the maintenance of an epithelial phenotype and loss of its expression can result in epithelial to mesenchymal transition (EMT). [score:3]
Epigenetic mechanisms participate in the control of miR-200c and miR-141 expression in both normal and cancer cells. [score:3]
Dysregulation of miR-200c and miR-141 occurs in multiple cancer types [5], [11], [20], [21], [23], [24], [25], [26], and this dysregulation involves a compromise of the epigenetic state of the CpG island associated with miR-200c and miR141. [score:3]
Since miR-200c and miR141 play an important role in EMT and therefore cell identity, disruption of mechanisms that govern cell type specific DNA methylation patterns during carcinogenesis could likely effect expression of miR-200c and miR141 and provide phenotypic plasticity to cancer cells. [score:3]
Seven of the breast cancer cell lines tested express miR-200c and miR-141 and each has an unmethylated mir-200c CpG island. [score:3]
Figure 4 shows 5-AdC reactivated miR-200c expression in all three cancer cell lines. [score:3]
A CpG island near the predicted mir-200c/mir-141 transcription start site shows a striking correlation between miR-200c and miR-141 expression and DNA methylation in both normal and cancer cells, as determined by MassARRAY technology. [score:3]
Furthermore, the loss of expression of miR-200 family members is linked to an aggressive cancer phenotype. [score:3]
The upper panel shows the expression of miR-200c detected by real-time PCR. [score:3]
Similarly, the breast cancer cell lines that had lost miR-200c/141 expression lost histone H3 acetylation and K4 trimethylation and acquired a repressive histone state, enriched for the H3 lysine 9 dimethylation mark (Figure 5). [score:3]
In contrast, those breast cancer cell lines that express miR-200c and miR-141 and have an unmethylated CpG island display an epithelial phenotype [11], [29]. [score:3]
A. miR-200 family expression according to massive parallel sequencing of small RNA libraries from a set of three isogenic pairs of human mammary epithelial cells (HMEC) and fibroblasts (FB). [score:3]
We report that DNA methylation plays a role in the normal cell type-specific expression of miR-200c and miR-141 and this role appears evolutionarily conserved, since similar results were obtained in mouse. [score:3]
We corroborated the expression of miR-200c and miR-141 in the same set of normal mammary samples by real-time PCR, and then expanded these results to pairs of epithelial cells and fibroblasts from prostate and skin, as well (Figure 1B; Figure S1). [score:3]
miR-200 family expression according to massive parallel sequencing of small RNA libraries from a set of three isogenic pairs of human mammary epithelial cells (HMEC) and fibroblasts (FB). [score:3]
reactivates miR-200c expression in breast and prostate cancer cell lines. [score:3]
0008697.g003 Figure 3 A. miR-200c expression and mir-200c CpG island methylation in eleven breast cancer cell lines. [score:3]
The inverse correlation between miRNA expression and DNA methylation extends to other miR-200c/miR-141 -positive/negative pairs of normal cells, such as prostate epithelial cells and skin keratinocytes, and their mesenchymal cell type counterparts, prostate and skin fibroblasts. [score:3]
These data suggest that epigenetic mechanisms participate in the inappropriate repression of miR-200c/miR-141 expression in cancer cells. [score:3]
All four of the breast cancer cell lines that lost miR-200c and miR-141 expression have an aberrantly methylated mir-200c/141 CpG island, and each of these cell lines displays a mesenchymal phenotype [11], [29]. [score:3]
Figure S2DNA methylation of the mir-200c CpG island inversely correlates with miR-200c expression in normal human samples. [score:3]
We analyzed 11 breast cancer cell lines, and in each case, miR-200c and miR-141 expression was closely linked to the DNA methylation state of the CpG island (Figure 3A; Figure S3). [score:3]
The top panel of each figure shows the expression of miR-200c in cancer samples as detected by real-time PCR, normalized to let-7a. [score:3]
A. miR-200c expression and mir-200c CpG island methylation in eleven breast cancer cell lines. [score:3]
The miR-200c/miR-141 -negative breast cancer cell lines MDA-MB-231 and BT549 and prostate cancer cell line PC3 were treated with 3 µM 5-AdC for 96 h and miR-200c/141 expression was assessed by real-time PCR. [score:3]
The mechanism responsible for the control of miR-200c expression in both normal and cancer cells is not fully understood. [score:3]
Epigenetic control of miR-200c expression is evolutionarily conserved. [score:3]
The left panel shows the expression of miR-200c in mouse epithelial cells (308, 6R90, SKH-1 epidermis) and mouse fibroblast cell lines (NIH 3T3, NR6, NIH 3T6) as detected by real-time PCR. [score:3]
The CpG units within the MassARRAY amplicon are numbered in the reverse direction, with CpG 2 being located within the miR-200c coding sequence. [score:2]
miR-200c and miR-141 are members of the miR-200 family and are important regulators of the epithelial to mesenchymal transition (EMT) [5], [9], [10], [11]. [score:2]
CpG units within MassARRAY amplicon are numbered in reverse direction, with CpG 1 being located within the miR-200c coding sequence. [score:2]
Finally, we found that the miR-200c regulation by DNA methylation is evolutionarily conserved between humans and mice. [score:2]
The level of miR-200c increased 4.3-fold in MDA-MB-231 (p-value = 0.0004), 6.4-fold in BT549 (p-value = 0.0107) and 4.2-fold in PC3 cells (p-value = 0.0072). [score:1]
The regions encoding the mir-200c and mir-141 hairpins and the putative transcription start (TSS) region inferred from the human EST track of the UCSC genome browser are displayed, and each circle on this track represents the position of a CpG dinucleotide. [score:1]
The y-axis shows fold enrichment of each histone mark over input DNA within the mir-200c CpG island. [score:1]
Together these results indicate that cancer cells derived from normal miR-200c/miR-141 -positive epithelial cells can replicate the cell type-specific DNA methylation pattern of the miR-200c/141 CpG island seen in normal miR-200c/miR-141 -negative cells, and that the aberrant DNA methylation of the miR200c/141 CpG island in these cancer cells is associated with its transcriptional silencing in carcinoma cells. [score:1]
The mir-200c CpG island shows differential cytosine methylation between miR-200c -positive and miR-200c -negative normal human tissues. [score:1]
DNA methylation of mir-200c CpG island in breast and prostate cancer cell lines. [score:1]
A MassARRAY amplicon was designed to analyze the DNA methylation state of the mouse mir-200c/141 region homologous to that analyzed in human (Figure 6A). [score:1]
The regions encoding the hairpins of mir-200c and mir-141 and the putative transcription start (TSS) inferred from the mouse EST track displayed on the UCSC genome browser are shown, and each circle on this track represents the location of a CpG dinucleotide. [score:1]
Since the miR-200c cluster plays a significant role in EMT, our results suggest an important role for DNA methylation in the control of phenotypic conversions in normal cells. [score:1]
Results show that the CpG sites are unmethylated in three separate strains of miR-200c/miR-141 -positive HMEC. [score:1]
revealed that the miR-200c -positive keratinocytes showed minimal DNA methylation in the mir-200c CpG island, while the miR-200c -negative mouse fibroblasts showed extensive DNA methylation of all CpG sites in the region (Figure 6B). [score:1]
Similar to the human hsa-mir-200c, the mouse mmu-mir-200c contains a CpG island, identified by the program CpG Cluster. [score:1]
Results suggest that these carcinoma cells may co-opt de novo DNA methylation pathways involved in the epigenetic control of normal cell type-specific genes, such as those that govern the epigenetic state of miR-200c/miR-141. [score:1]
The CpG island is heavily methylated in human miR-200c/miR-141 negative fibroblasts and miR-200c/miR-141 negative tumor cells. [score:1]
With the average of 63,829 counts out of 3,926,984 per library in HMEC, miR-200c forms 1.625% of all small RNAs in these cells. [score:1]
One cluster resides on human chromosome 1 and encodes miR-200b, miR-200a, and miR-429, while the other cluster is located on human chromosome 12, and encodes miR-200c and miR-141. [score:1]
No enrichment of trimethylation of histone H3 lysine 27 was detected in the miR-200c/141 CpG island in the samples analyzed (Figure S5). [score:1]
Thus, the miR-200c cluster CpG island is unmethylated in normal miR-200c/miR-141 -positive epithelial cells, while being densely methylated in the paired normal miR-200c/miR-141 -negative fibroblasts (Figure 1B, Figure 2B, Figure S2). [score:1]
In contrast, all the CpG sites are highly methylated in the isogenic miR-200c/miR-141 -negative fibroblast strains. [score:1]
HMEC samples are shown in green, isogenic FB samples are shown in red, and two miR-200 -negative breast cancer cell lines are in blue. [score:1]
The mir-200c hairpin coding sequence and approximately 300 bp of upstream genomic sequence is CpG rich. [score:1]
To evaluate a potential role for DNA methylation in the control of miR-200c/141 in mice, CpG methylation and miRNA expression were analyzed in mouse epithelial cells (epidermis of SKH-1 mouse and keratinocyte cell lines 308 and 6R90) and mouse fibroblasts (cell lines NIH 3T3, NIH 3T6, and NR6). [score:1]
We used MassARRAY technology to analyze the DNA methylation state of the mir-200c cluster CpG island (Figure 2B). [score:1]
A. A diagram of the genomic region of hsa-mir-200c. [score:1]
Enrichment of permissive histone modifications, H3 acetylation and H3K4 trimethylation, is seen in normal miR-200c/miR-141 -positive epithelial cells, as determined by chromatin immunoprecipitation coupled to real-time PCR. [score:1]
Strikingly similar results for miR-200c were found between the human cells and mouse cells. [score:1]
Cells were treated with 3 µM 5-aza-2′-deoxycytidine for 96 h. The level of expression of miR-200c was measured by real-time PCR. [score:1]
In contrast, in the isogenic miR-200c/miR-141 -negative mammary fibroblasts permissive histone modifications are absent, and the repressive H3 lysine 9 dimethylation mark is present (Figure 5). [score:1]
Figure 5 shows the results of chromatin immunoprecipitations coupled to quantitative real-time PCR analysis that were used to examine the histone modification state of the miR-200c/141 CpG island in normal and cancer cells. [score:1]
The histone modification state of the mir-200c CpG island. [score:1]
Similar to the human mir-200c/141 genomic region, the mouse mir-200c/141 genomic region also contains a CpG island (Figure 6A; length 325 bp, GC% 66.77, O/E ratio 0.58, 19 CpGs, p-value 1.06×10 [−10]). [score:1]
Figure S5Histone H3 K27 trimethylation state of the mir-200c CpG island. [score:1]
A. Diagram of the mouse mmu-mir-200c genomic interval. [score:1]
0008697.g006 Figure 6 A. Diagram of the mouse mmu-mir-200c genomic interval. [score:1]
Taken together, these findings indicate that miR-200c/141 is an evolutionarily conserved epigenetically labile miRNA cluster. [score:1]
The bottom panel shows the methylation level of the mir-200c CpG island region in the same cancer samples. [score:1]
The CpG island of mir-200c/141 in the three different strains of miR-200c/miR-141 -positive HMEC exists in a transcriptionally competent state; it is enriched for the transcriptionally permissive modifications of histone H3 acetylation (H3Ac) and lysine 4 trimethylation (H3TriMeK4), while the transcriptionally repressive histone mark of histone H3 lysine 9 dimethylation (H3DiMeK9) is underrepresented (Figure 5). [score:1]
The whole genomic cluster containing mir-200c and mir-141 is well conserved between the human and mouse genome. [score:1]
The miR-200 family is comprised of five miRNAs that are encoded within two clusters. [score:1]
A diagram of the genomic region of hsa-mir-200c. [score:1]
The right panel shows the methylation level of the mir-200c CpG island region in the same mouse samples. [score:1]
Since miR-200c plays a significant role in EMT, our results suggest that DNA methylation plays an important role in the control of phenotypic conversions of normal and cancer cells. [score:1]
In contrast, repressive H3K9 dimethylation marks are present in normal miR-200c/miR-141 -negative fibroblasts and miR-200c/miR-141 negative cancer cells and the permissive histone modifications are absent. [score:1]
The y-axis shows a lack of enrichment of the histone H3 K27 trimethylation mark within the mir-200c CpG island relative to input DNA in all the samples analyzed. [score:1]
Aberrant DNA methylation of the miR-200c/141 CpG island is closely linked to their inappropriate silencing in cancer cells. [score:1]
The bottom panel shows the methylation level of mir-200c CpG island region in the same human samples. [score:1]
Histone H3 lysine 27 trimethylation levels of the region of the mir-200c CpG island described in Figure 2A were analyzed by chromatin immunoprecipitation coupled to real-time PCR. [score:1]
Third, the epigenetic modifier 5-aza-2′-deoxycytidine relieves the repression of miR-200c/miR-141 in cancer cell lines. [score:1]
0008697.g004 Figure 4Cells were treated with 3 µM 5-aza-2′-deoxycytidine for 96 h. The level of expression of miR-200c was measured by real-time PCR. [score:1]
The epigenetic state of the miR-200c/141 CpG island shows clear and extensive cell type specific differences between normal miR-200c/141 -positive and miR-200c/141 -negative cells. [score:1]
[1 to 20 of 109 sentences]
11
[+] score: 247
Other miRNAs from this paper: hsa-mir-139, hsa-mir-200b, hsa-mir-141, hsa-mir-200a, hsa-mir-429
In line with this observation, we found that the expression levels of the miR-200 family in a panel of HCC cell lines showed an opposite trend with the E-cadherin expression, and transient overexpression of miR-200a, miR-200b, and miR-200c precursors were all able to suppress the ZEB1/2 expression. [score:11]
In line with this observation, the endogenous expression of RhoA and ROCK2 mRNA was significantly inhibited in miR-200b- and miR-200c-stably overexpressing BEL7402 cells when compared to the empty vector and miR-200a-stably overexpressing controls (Figure 3c and 3d). [score:8]
Consistent with our findings, down-regulation of miR-200 family has been previously observed in HCC miRNA profiling and miR-200 expression studies reported by others [18- 20], suggesting that loss of miR-200 expression is a frequent event in liver carcinogenesis. [score:8]
Furthermore, we employed locked nucleic acid (LNA) miRNA inhibitors to specifically inhibit the expression of the miR-200 family members. [score:7]
Overexpression of miR-200b and miR-200c moderately suppressed HCC cell proliferation and colony formation, and drastically attenuated cell migration; all these effects were not seen in miR-200a overexpressing cells. [score:7]
Surprisingly, we found that although miR-200a, miR-200b and miR-200c all attenuated ZEB1/2 expression in HCC cells, only stable overexpression of miR-200b and miR-200c remarkably suppressed HCC cell migration. [score:7]
We performed quantitative RT-PCR (qRT-PCR) to validate the expression of miR-200 family members in an expanded HCC cohort (n = 64) and found that, consistent to our miRNA profiling data, miR-200a, miR-200b, and miR-200c were all significantly down-regulated in primary HCC samples (Figure 1b, P < 0.001). [score:6]
Indeed, down-regulation (> 2-fold) of all the miR-200 family members was detected in approximately 80% of primary HCC cases, suggesting that loss of miR-200 expression was a common event in human HCCs (Figure 1c). [score:6]
Consistently, inactivation of miR-200b and miR-200c resulted in up-regulation of endogenous RhoA and ROCK2 protein expression in immortalized hepatocyte cell line, MIHA (Figure 3f). [score:6]
We found that the empty vector and miR-200a overexpressing cells were readily seeded onto the uncoated glass surface, exhibited an extended cell morphology and started to migrate within 12 hours, whereas miR-200b and miR-200c overexpressing cells failed to seed on the uncoated glass surface till the end of the experiment (Figure 5b and Supplementary Videos). [score:5]
By comparing the expression of miR-200 in a pair of HCC cell lines derived from the primary tumor and its portal vein metastasis of the same patient, we noted that the miR-200 family members were significantly down-regulated in the metastatic cell line (H2M) when compared to its non-metastatic counterpart (H2P), suggesting that loss of miR-200 family might play a role in HCC metastasis (Supplementary Figure 2). [score:5]
The successful overexpression and post-translational gene regulatory activity of miR-200 family members in the stably infected cells were confirmed by qRT-PCR and luciferase reporter assays. [score:5]
In addition, miRNA specific sensors containing the complementary sequences to individual mature miR-200 family members were also cloned into the same vector and served as positive control for accessing the post-translational gene repression activity of ectopically expressed miR-200 family members. [score:5]
To interrogate the expression of miR-200 family members in human HCCs, we retrieved the data from our previous miRNA expression profiling of 20 pairs of primary HCCs and their corresponding non-tumorous livers [4]. [score:5]
The miR-200b and miR-200c overexpressing cells exhibited a rounded morphology, in contrast to a flat and extended morphology of the empty vector and miR-200a overexpressing cells (Figure 5a lower panel). [score:5]
Overexpression of miR-200b and miR-200c significantly inhibited the luciferase activity associated with the wild-type 3′UTRs of RhoA and ROCK2. [score:5]
s showed that overexpression of miR-200b or miR-200c precursors significantly suppressed the luciferase signals of RhoA- and ROCK2- 3′UTR fusion reporters. [score:5]
Overexpression of miR-200b and miR-200c modestly suppressed HCC cell proliferation. [score:5]
Computer-aided cell migration tracking revealed that the cell migratory ability was modestly impaired in miR-200a overexpressing cells when compared to the empty control, but was drastically abolished in miR-200b and miR-200c overexpressing cells (Figure 5c). [score:4]
Loss of miR-200 family results in up-regulation of ZEB1 and ZEB2 and consequently leads to transcriptional repression of E-cadherin to facilitate EMT [5- 7]. [score:4]
When seeded onto uncoated glass surfaces, miR-200b- and miR-200c -overexpressing cells exhibited a rounded morphology as compared to the flat and extended morphology of miR-200a -overexpressing cells and empty vector controls. [score:4]
Both down- and up-regulations of miR-200 family have previously been reported [10- 14]. [score:4]
As illustrated by the heat map diagram, all five members of miR-200 family were profoundly down-regulated in human HCCs, suggesting that loss of miR-200 family might play a role in liver carcinogenesis (Figure 1a). [score:4]
These miR-200 family members negatively regulate the expression of transcription repressors ZEB1 and ZEB2. [score:4]
In summary, the work present here revealed that all the miR-200 family members were frequently down-regulated in human HCC. [score:4]
Frequent down-regulation of miR-200 family in human HCCs. [score:4]
We found that the formations of stress fibers (stained by Phallodin) and focal adhesions (stained by anti-paxillin antibody) were profoundly impeded in miR-200b- and miR-200c -overexpressing cells as compared to the empty vector and miR-200a -overexpressing controls (Figure 4a and 4b). [score:4]
To further investigate the functions of miR-200 family in human HCC, miR-200a, miR-200b, and miR-200c were subcloned into a lenti-viral based expression vector (Supplementary Figure 4a) and stably overexpressed in HCC cell lines, BEL7402 and SMMC-7721. [score:3]
Both the size and number of colonies formed were significantly reduced in miR-200b- and miR-200c -overexpressing cells. [score:3]
Figure 2(a) Proliferation rate of miR-200 stably overexpressing cells. [score:3]
Aberrant expression of either miR-200 family or ZEB1/2 will therefore feed-forward to disrupt the equilibrium and result in epithelial-mesenchymal transition (EMT) or mesenchymal-epithelial transition (MET) [8, 9]. [score:3]
MiR-200 family miRNA precursors and LNA inhibitors. [score:3]
For miR-200 overexpression, the cells were transfected with 30 ηM of designated miRNA precursors or pre-miR negative control 1 (Applied Biosystems) using X-tremeGENE siRNA transfection reagent (Roche). [score:3]
Overexpression of miR-200b and miR-200c, but not miR-200a, resulted in a moderate but significant reduction on cell proliferation and also impeded anchorage independent growth on soft agar (Figure 2a and 2b). [score:3]
This observation was reproducible by transiently overexpressing the miR-200 precursors in the same cell lines, thus ruling out the possibility of experimental artifacts that might be introduced by the lenti-viral vector or stable infection (Supplementary Figure 5). [score:3]
A delayed cell-substratum attachment was observed in miR-200b- and miR-200c -overexpressing cells. [score:3]
Unsupervised clustering analysis revealed a profound differential expression of the miR-200 family members in primary HCCs. [score:3]
12p13 cluster), whereas, at the functional level, the miR-200 family members are categorized into two other groups based on the sequence homology hence two distinct groups of targets involved (miR-200b subfamily and miR-200a subfamily) (Supplementary Figure 1a) [5, 6]. [score:3]
Our findings have demonstrated the functional discrepancy of miR-200 family members and provided a mechanistic explanation toward the miR-200b specific tumor suppressive function in HCC. [score:3]
Figure 1(a) Expression of the miR-200 family members in 20 pairs of primary HCCs and their corresponding non-tumorous livers. [score:3]
Figure 5(a) Cell morphology of miR-200 stably overexpressing BEL7402 cells was observed under phase-contrast microscope (20×) and scanning electron microscope (2500×). [score:3]
In this study, we demonstrated that all five members of miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) were frequently down-regulated in human HCCs as compared to their corresponding non-tumorous livers. [score:3]
However, knowledge regarding the expression and functional implications of miR-200 family in human HCC is awaited for detailed elucidation. [score:3]
Figure 4(a) Stress-fibers (filaments across the cytosol) in miR-200 stably overexpressing BEL7402 cells were visualized by TRITC-Phalloidin staining. [score:3]
Stable overexpression of miR-200b and miR-200c profoundly abolished the stress-fiber and focal adhesion formation and induced morphological change in BEL7402 cells. [score:3]
GFP maker was used to indicate the stable infection of miR-200 expression vectors. [score:3]
We reasoned that, at the expression level, the miR-200 family can be categorized into two groups based on the chromosomal locations in which two different up-stream promoters are involved (Ch. [score:3]
MiR-200a, miR-200b and miR-200c genes were amplified from the genomic DNA of MIHA cells and sub-cloned into a lenti-viral based miRNA expression vector, pCDH-CMV-MSC-EF1-copGFP/Puro (System Biosciences) utilizing the EcoRI and NotI restriction sites. [score:3]
Figure 3 expression(a) and (b)s. Wild-type and mutated RhoA or ROCK2 3′UTR were co -transfected with miR-200 precursors into BEL7402 cells. [score:3]
Therefore, as proof-of-concept, miR-200a, miR-200b, and miR-200c were selected to represent each subgroup for expression and functional studies (Supplementary Figure 1b). [score:3]
The loss of stress fiber and focal adhesion complex resulted in dramatic morphological change of the miR-200b and miR-200c overexpressing cells (Figure 4), and the morphological change could be more clearly visualized under the scanning electron microscope (SEM) (Figure 5a). [score:3]
For miR-200 inactivation, cells were transfected with 50 ηM designed miRCURY LNA™ miRNA Inhibitor or LNA control (Exiqon). [score:3]
The homeostatic expression between miR-200 family and ZEB1/2 is critical for maintaining the stability of epithelial or mesenchymal phenotype of cells. [score:3]
Nevertheless, the expression of the miR-200 family in human cancer remains contentious. [score:3]
Interestingly, ZEB1 and ZEB2 are also involved in the transcriptional repression of the miR-200 family, thus the miR-200 family and ZEB1/2 form a double -negative feedback loop to regulate each other. [score:2]
These findings recapitulated the previous reports and supported the negative regulatory functions of miR-200 family in ZEB1/2 mediated EMT (Supplementary Figure 3). [score:2]
Since EMT is a crucial step in cancer metastasis, the miR-200 family members have been considered as metastasis-suppressive miRNAs. [score:2]
MiR-200 family has recently been identified as a major regulator of epithelial-mesenchymal transition (EMT). [score:1]
MiR-200 family can also be sub-divided into two subfamilies according to their seed sequence homology, with miR-200a and miR-141 as a group (hereafter, denoted as miR-200a subfamily) and miR-200b, miR-200c, and miR-429 as another group (henceforward, named as miR-200b subfamily) (Supplementary Figure 1a) [5, 6]. [score:1]
First, although the miR-200 family members are generally considered as functionally redundant paralogs, the miR-200a and miR-200b subfamilies in fact have distinct functions in regulating HCC cell growth and migration. [score:1]
In this sense, the miR-200 family can be sub-divided into the functionally miR-200a subfamily (miR-200a and miR-141) and miR-200b subfamily (miR-200b, miR-200c and miR-429). [score:1]
MiR-200 family members are conventionally divided into two groups based on their genome locations clustered at 1p36 (miR-200a, miR-200b and miR-429) and 13p12 (miR-200c and miR-141), respectively. [score:1]
With these miR-200s stably overexpressing cells, we then investigated the effects of miR-200 family in HCC cell growth. [score:1]
MiR-200 family consists of five evolutionarily conserved members located in two separate clusters in the human genome, with miR-200b, miR-200a, and miR-429 mapped to chromosome 1p36 (thereafter, referred as 1p36 cluster), and miR-200c and miR-141 mapped to chromosome 12p13 (henceforth, indicated as 12p13 cluster). [score:1]
To experimentally validate these in-silico prediction results, 3′UTRs of RhoA and ROCK2 were cloned into a luciferase reporter construct and co -transfected with miR-200 precursors in BEL7402. [score:1]
15 ηM of each miR-200 precursors was first individually transfected into HCC cells using X-tremeGene. [score:1]
Also, the miR-200 family may play different roles in different cancers depending on their specific cellular contexts [15]. [score:1]
Whether functional cross-talks exist between miR-200 subfamilies in both normal cells and during pathological conditions is an interesting question worthy to be further explored. [score:1]
Effects of the miR-200 family on HCC cell growth and migration. [score:1]
In this regard, immunofluorescence staining was performed to visualize the effects of miR-200 family on Rho/ROCK mediated stress fiber and focal adhesion formations. [score:1]
[1 to 20 of 70 sentences]
12
[+] score: 242
However, the stable overexpression of the miR-200c in the CD117 [+]CD44 [+]CSCs resulted in a significant down-regulation of ZEB-1 and the Vimentin expression, an upregulation of the E-cadherin expression as well as a decrease of colony forming, migratory and invasion in vitro. [score:13]
We found that the down-regulation of the ZEB1 expression in the CD44 [+]CD117 [+]CSCs indeed had the similar effects as the miR-200c overexpression in the CD44 [+]CD117 [+]CSCs; this was reflected in the significant suppression of the tumorigenesis and tumor metastasis in the mice injected with the shZEB1 CD44 [+]CD117 [+]CSCs in comparison with the mice injected with the CD44 [+]CD117 [+]CSCs or with the CD44 [+]CD117 [+]CSCs with lentivirus mock. [score:10]
Apparently, the miR-200c overexpression decreased the ZEB1 expression, which directly inhibited the EMT of the CD44 [+]CD117 [+]CSCs, and reduced the CSC metastasis potential. [score:8]
However, restoration of the miR-200c served as a tumor suppressor by directly targeting the zinc-finger E-box binding homeobox 1 (ZEB1) to inhibit EMT and ovarian cancer metastasis [7- 10]. [score:8]
We noticed that the enforced overexpression of miR200c in the CD44 [+]CD117 [+]CSCs significantly reduced the expressions of both ZEB1 and Vimentin, but increased the expression of E-cadherin in the RNA and the protein levels in tumor samples. [score:7]
In some studies, miR-200c was found to be down-regulated in ovarian cancer cell lines and in stage III ovarian tumors; the miR-200c down-regulation correlated with poor prognoses. [score:7]
Because the stable miR-200c overexpression in the established tumors delayed tumor progression and extended the survival of the tumor-bearing mice, we wanted to find out if the miR-200c overexpression would inhibit tumor metastasis. [score:7]
Our results suggested that the miR-200c overexpression, by modulating the EMT, specifically inhibited the ZEB1 expression in the CD117 [+]CD44 [+]CSCs and reduced cell tumorigenicity and lung metastasis in our nude mouse mo del. [score:7]
Importantly, the miR-200c overexpression significantly inhibited the CD117 [+]CD44 [+]CSCs xenograft growth and lung metastasis in vivo in nude mice by inhibition of the EMT. [score:7]
The down- regulation of the ZEB-1 expression in the CD117 [+]CD44 [+]CSCs induced the similar effects as the miR-200c overexpression. [score:6]
In addition, the down-regulation of ZEB-1 showed the same efficacy as the miR-200c overexpression in the CD117 [+]CD44 [+]CSCs. [score:6]
To assess the relationship between ZEB1 and miR-200c in the CD44 [+]CD117 [+]CSCs, we asked whether the down-regulation of ZEB1 would have similar effects as the miR-200c overexpression. [score:6]
A. The CD117 [+]CD44 [+]CSCs isolated from the human EOC S KOV3 cell line were identified by FCM; B. The miR-200c expression differences between the non CD117 [+]CD44 [+]CSCs and the CD117 [+]CD44 [+]CSCs were detected by qRT-PCR; C. The top and bottom panels show the morphological structures of the CD44 [+]CD117 [+]CSCs with the stable miR-200c overexpression under a fluorescence microscope and a light microscope, respectively. [score:5]
Because the miR-200c overexpression exhibited significant effects on the colony forming and on the migratory and invasion of CD44 [+]CD117 [+]CSCs in vitro, we sought to determine whether the miR-200c overexpression could affect the establishment and progression of ovarian cancer in vivo nude mouse mo del. [score:5]
The miR-200c overexpression in the tumors significantly increased the E-cadherin expression (Figure  4C, 4F). [score:5]
miR-200c inhibited ZEB1,Vimentin and enhanced E-Cadherin expression levels in tumor as well as decreased tumor lung metastasis in nude mouse mo del. [score:5]
Therefore, we wanted to find out whether the miR-200c overexpression would also impact the ZEB1 expression in the tumors of the nude mice that were injected with the CD44 [+]CD117 [+]CSCs with lentivirus miR-200c. [score:5]
Figure 4 Impacts of the overexpression of miR-200c on ZEB1, E-Cadherin, and the Vimentin expressions in tumors, and tumor cell metastasis in mouse lungs. [score:5]
The results revealed that the miR-200c overexpression in the tumors led to a marked reduction of ZEB1 mRNA (Figure  4A), Vimentin mRNA (Figure  4B) and the protein expressions (Figure  4D) compared with the CD44 [+]CD117 [+]CSCs with lentivirus mock and with the CD44 [+]CD117 [+]CSCs without lentivirus infection. [score:4]
Our goal for this study was to assess the epigenetically regulation function of the miR-200c overexpression in the EMT, the tumorigenicity, and the metastasis of the EOC CD117 [+]CD44 [+]CSCs in vitro and in vivo. [score:4]
We found in vitro a direct association between the miR-200c overexpression and the capability of the CD117 [+]CD44 [+]CSC in colony forming, migration and invasion. [score:4]
In EOC, metastases account for the majority of deaths from gynecologic malignancies [35, 36], therefore, we next explored the relationship between the miR-200c overexpression and tumor metastases. [score:3]
In particular, we noticed the evident relationship between the miR-200c and the ZEB1 expression. [score:3]
These results suggested that the miR-200c overexpression not only effectively decreased the colony forming capability but also obviously reduced the tumorigenicity and the tumor burden in our establishment mouse mo del. [score:3]
In comparison, for the group that was injected with the 5 × 10 [4] CD44 [+] CD117 [+]CSCs with the miR-200c overexpression, only 3 out of the 6 mice with equal injection of 5 × 10 [4] cells developed tumors after 56 days into the observation; the tumor sizes of these 3 mice were also smaller than those of the control group mice. [score:3]
In summary, the findings from our experiments demonstrate that the overexpression of miR-200c significantly reduced the CD117 [+]CD44 [+]CSCs xenograft growth and lung metastasis in vivo, partially through the reversal of the EMT phenotype. [score:3]
Figure 1 Identification, selection and detection of the miR-200c expression in the CD44 [+ ] CD117 [+] CSCs. [score:3]
Figure 3 The miR-200c overexpression decreased tumor progression of CD44 [+ ] CD117 [+ ] CSCs in xenograft mice. [score:3]
Isolation of CD44 [+]CD117 [+]CSCs, transduction of lentivirus miR-200c and production of stable expression colonies. [score:3]
As was described in the method section, the CD44 [+]CD117 [+]CSCs were isolated from the S KOV-3 cell line using MACS and were identified for cell phenotype using FCM to study the miR-200c overexpression in CD44 [+]CD117 [+]CSCs. [score:3]
The CD44 [+]CD117 [+]CSCs were transduced with the pHAGE-CMV- miR-200c-IzsGreen lentivirus, and were selected by the IzsGreen expression [7, 19]. [score:3]
However, it is unknown whether the EOC CSCs, the “seed cells” in EOC, are closely associated with the miR-200 family expression. [score:3]
With the stable miR-200c overexpression in the CD44 [+]CD117 [+]CSCs, the cells markedly decreased the colony forming capability. [score:3]
Figure  1B indicates that the miR-200c expression analyzed by qRT-PCR was markedly lower in the CD44 [+]CD117 [+]CSCs than in the non CD44 [+]CD117 [+]CSCs. [score:3]
The results suggested that the stable miR-200c overexpression in established tumors delayed tumor progression. [score:3]
The cell migration and invasion in vitro results indicated that the stable miR-200c overexpression in the CD44 [+]CD117 [+]CSCs reduced cell migration and invasion. [score:3]
Effect of miR-200c overexpression on the capability of colony formation and cellular motility of CD44 [+] CD117 [+] CSCsTo characterize the function of miR-200c in the CD44 [+]CD117 [+]CSCs, we examined the effects of miR-200c overexpression on the CD44 [+]CD117 [+]CSCs with regard to colony forming, cell migration, cell invasive ability, and cell proliferation ability, respectively. [score:3]
Overexpression of miR-200c reduced ovarian tumor formation and tumor burden. [score:3]
Our findings were in agreement with a recent report that the overexpression of miR-429, a member of the miR-200 family of microRNAs, in the mesenchymal-like ovarian cancer cells resulted in the mesenchymal–epithelial transition [33]. [score:3]
Phenotype identification, morphologic characteristics and miR-200c expression in lentivirus transduced CD44 [+]CD117 [+]CSCsAs was described in the method section, the CD44 [+]CD117 [+]CSCs were isolated from the S KOV-3 cell line using MACS and were identified for cell phenotype using FCM to study the miR-200c overexpression in CD44 [+]CD117 [+]CSCs. [score:3]
The CD44 [+]CD117 [+]CSCs transduced with lentivirus-mock (left) or lentivirus miR-200c (right) in the stem cell culture medium; D. miR-200c expression differences among the CD44 [+]CD117 [+]CSCs transduced with lentivirus-mock, the lentivirus miR-200c and without lentivirus infection were detected by qRT-PCR. [score:3]
The findings from our study demonstrated that the population of the rare CD44 [+]CD117 [+]CSCs (3.1%) existed in the human EOC S KOV3 cell line, and that the CD44 [+] CD117 [+]CSCs showed lower expression of miR-200c than the non CD44 [+]CD117 [+]CSCs. [score:3]
Figure  1D presents the results of the miR-200c expression analyzed by qRT-PCR. [score:3]
The overexpression of miR-200c clearly resulted in a significant reduction in cell migration in comparison the control cells (CD44 [+]CD117 [+]CSCs with lentivirus mock and CD44 [+]CD117 [+]CSCs without lentivirus infection); the differences were statistically significant (Figure  2E). [score:3]
The CD44 [+]CD117 [+]CSCs transduced with the lentivirus miR-200c (the rightmost bar) exhibited a significantly higher level of miR-200c overexpression than the CD44 [+]CD117 [+]CSCs transduced with the lentivirus mock (18 ± 5 vs 3 ± 1, P < 0.01) or the CD44 [+]CD117 [+]CSCs (18 ± 5 vs 2 ± 1, P < 0.01). [score:3]
Isolation of CD44 [+]CD117 [+]CSCs, transduction of lentivirus miR-200c and production of stable expression coloniesThe CD44 [+]CD117 [+]CSCs were isolated from the S KOV3 cell line by using the magnetic- associated cell sorting (MACS) method as described previously [16, 17]. [score:3]
Effect of miR-200c overexpression on the capability of colony formation and cellular motility of CD44 [+] CD117 [+] CSCs. [score:3]
Next, we detected the miR-200c expression in the CD44 [+]CD117 [+]CSCs and in the lentivirus miR-200c transduced CD44 [+]CD117 [+]CSCs after the cells were stably selected using a single clone screening method. [score:3]
To generate the miR-200c expression lentivirus vector, we amplified an insert (full-length human miR-200c) by PCR from S KOV3 DNA. [score:3]
These findings from this study suggest that the miR-200c overexpression may be considered a critical approach for the EOC CD117 [+]CD44 [+]CSCs in clinical trials. [score:2]
The miR-200c expression was reduced in the CD117 [+]CD44 [+]CSCs compared with the non-CD117 [+]CD44 [+]CSCs. [score:2]
The overexpression of miR-200c resulted in fewer CD44 [+]CD117 [+]CSCs with lentivirus miR-200c (mean ± SD: 70.81% ± 2.16%), in the bottom of the chamber insert, than in the CD44 [+]CD117 [+]CSCs with lentivirus miR-200c compared with the CD44 [+]CD117 [+]CSCs with lentivirus mock (125.92% ± 2.14%), or than the CD44 [+]CD117 [+]CSCs without lentivirus infection (162.26% ± 6.78%) (Figure  2C, 2F). [score:2]
The 36 mice were randomly divided into six groups of equal size (6) as follows: group 1 for CD44 [+]CD117 [+]CSCs with lentivirus miR-200c; group 2 for CD44 [+]CD117 [+]CSCs with lentivirus mock; group 3 for CD44 [+]CD117 [+]CSCs without lentivirus infection; group 4 for CD44 [+]CD117 [+]CSCs transfected with the shZEB1; group 5 for CD44 [+]CD117 [+]CSCs transfected with the scrambled control siRNA; group 6 for CD44 [+]CD117 [+]CSCs without transfection. [score:1]
The mice injected with the 5 × 10 [4] CD44 [+]CD117 [+]CSCs with lentivirus miR-200c showed much higher tumor free rates than the mice injected with the 5 × 10 [4] CD44 [+]CD117 [+]CSCs with lentivirus mock or 5 × 10 [4] CD44 [+]CD117 [+]CSCs without lentivirus infection on different days after the injection. [score:1]
Morphologically, the CD44 [+]CD117 [+]CSCs transduced with the lentivirus miR-200c appeared to be fusiform-shaped and closely connected clones in the media, whereas the CD44 [+]CD117 [+]CSCs transduced with the lentivirus mock seemed to have a looser and more dispersed structure (Figure  1C). [score:1]
Figure 2 The CD44 [+] CD117 [+] CSCs transduced with lentivirus miR-200c reduced the ability of colony forming, cell migration, invasion and cell proliferation in vitro. [score:1]
The plating colony formation rates were about 60% and 50% for the CD44 [+]CD117 [+]CSCs and the CD44 [+]CD117 [+]CSCs transduced with lentivirus mock, respectively; the colony formation rates were less than 20% for the CD44 [+]CD117 [+]CSCs transduced with the lentivirus miR-200c (Figure  2A, 2D). [score:1]
The EOC CD117 [+]CD44 [+]CSCs were isolated from the human ovarian cancer cell line S KOV3 by using a magnetic-activated cell sorting system, and the lentivirus miR-200c transduced CSCs were then selected for the study. [score:1]
To characterize the function of miR-200c in the CD44 [+]CD117 [+]CSCs, we examined the effects of miR-200c overexpression on the CD44 [+]CD117 [+]CSCs with regard to colony forming, cell migration, cell invasive ability, and cell proliferation ability, respectively. [score:1]
The lentivirus miR-200c was produced from the transient transfection of the HEK293T cells with pHAGE-CMV- miR-200c-IZsGreen, psPAX2, and pMD2. [score:1]
Numerous studies of EOC have focused on modulating the miR-200 family (including miR-200a, miR-200b, miR-200c, and miR-141) [31- 34]. [score:1]
Phenotype identification, morphologic characteristics and miR-200c expression in lentivirus transduced CD44 [+]CD117 [+]CSCs. [score:1]
Figure  4H shows that the tumor lung metastasis was significantly reduced in the mice injected with the CD44 [+]CD117 [+]CSCs with lentivirus miR-200c in comparison with the mice of the two control groups (Figure  4I). [score:1]
The goal of this study was to investigate the effect of miRNA-200c overexpression on the EMT, tumorigenicity and metastasis of epithelial ovarian cancer (EOC) CSCs. [score:1]
The lung tumor metastasis in the mice injected with the CD44 [+]CD117 [+]CSCs with lentivirus miR-200c was markedly decreased. [score:1]
The labels ‘WT, mock and miR-200c’ denote the CD44 [+]CD117 [+] CSCs, the CD44 [+]CD117 [+] CSCs transduced with lentivirus-mock, and the lentivirus miR-200c, respectively. [score:1]
A. 5 × 10 [4] CD44 [+]CD117 [+]CSCs transduced with lentivirus miR-200c or lentivirus-mock or without infection were subcutaneously injected in the nude mice (n = 6/group). [score:1]
The results show that more brown cells were found in miR-200c-CD44 [+]CD117 [+]CSCs of tumor tissue than the control cells. [score:1]
It is known that the feedback loop mo del links ZEB1 to miR-200c in melanoma and breast cancer cells, and that ZEB1 and miR-200c repress each other in the loop that impacts the change in EMT-MET[10, 23]. [score:1]
To accomplish this goal, we transduced the lentivirus miR-200c vector into the CD117 [+]CD44 [+]CSCs that were isolated from the human EOC S KOV3 cell line [15, 16]. [score:1]
[1 to 20 of 70 sentences]
13
[+] score: 225
The mo deling results of miR-200c inhibitor and the expression of miR-200c after tumorigenesis in nude mice are described in 1. To explore the effects of XIST and miR-200c expression on proliferation and EMT, IHC assays were performed to detect the expression of Ki67 and E-cadherin. [score:8]
miR-200c mimics (Catalog#: HmiR-SN0301), miR-200c inhibitor (Catalog#: HmiR-AN0301), mimics scramble (Catalog#: CmiR-SN0001) and inhibitor scramble (Catalog#: CmiR-AN0001) purchased from GeneCopoeia (Maryland, USA) were used to construct the overexpression and knockdown mo dels, as well as negative controls. [score:8]
XIST knockdown dramatically increased the expression of EMT -associated factor E-cadherin compared with that in the control group (Fig.   5e), whereas co-transfection with miR-200c inhibitor partially restored the expression levels of this protein. [score:7]
These data indicate that EMT processes that reflect the ability of metastasis and invasion are inhibited by miR-200c overexpression and XIST knockdown. [score:6]
Our present study suggests that lncRNA XIST knockdown inhibits the stemness properties and tumourigenicity by sponing miR-200c in BCSC-like cells and reveals a potential strategy of targeting XIST for bladder cancer therapy. [score:6]
In the present study, which aimed to detect the metastasis potential of BCSC 5637 and T24 under miR-200c overexpression or XIST knockdown condition, we detected the protein expression of E-cadherin, vimentin, ZEB1 and ZEB2, which are known as EMT-specific markers, by. [score:6]
LncRNA XIST may act as an inhibitor of miR-200c to regulate the stemness properties and tumourigenicity of bladder cancer cells, and our findings might reveal a potential strategy of targeting XIST for bladder cancer therapy. [score:6]
The results indicated that miR-200c overexpression and XIST knockdown could inhibit cell clone formation, self-renewal ability and EMT in BCSC-like cells. [score:6]
The high expression of LncRNA XIST in tumour tissues promotes cancer progression, whereas that of miR-200c inhibits cancer progression. [score:5]
miR-200c overexpression inhibited the cell clone formation and self-renewal properties of BCSC-like cells. [score:5]
The results suggested that the expression of E-cadherin was increased and that of vimentin, ZEB1 and ZEB2 were decreased in the BCSC-like 5637 and T24 cells under miR-200c overexpression and XIST knockdown compared with cells in their respective control groups. [score:5]
miR-200c knockdown could restore the tumour growth inhibition caused by XIST knockdown. [score:5]
Several studies have reported that lncRNA XIST expression is negatively associated with miR-200c expression in tumour tissues [16, 17]. [score:5]
In the present study, we found that XIST expression was negatively correlated with miR-200c expression in human BCSC-like cells. [score:5]
Compared with the control group, xenografts in the anti-XIST group were much smaller and lighter, and co-transfection with miR-200c inhibitor could partially revert the inhibition of tumour growth (Fig.   5a–c). [score:4]
Our results demonstrated that the self-renewal and clone formation capacities were significantly decreased with miR-200c overexpression and XIST knockdown in the BCSC-like 5637 and T24 cells. [score:4]
miR-200c expression has also been demonstrated to participate in the regulation of the epithelial-to-mesenchymal transition (EMT), which is a biological process responsible for tumour progression, invasion and migration in bladder cancer cells [12]. [score:4]
The objectives were to detect biological effects of BCSCs with miR-200c overexpression or with XIST knockdown. [score:4]
The mutation-carrying psiCHECKTM-2 vector with a different sequence of the miR-200c binding site, named as the XIST-mutation (Mut), as the control group, was constructed using the QuickChange Site-Directed Mutagenesis Kit (Stratagene, California, USA). [score:4]
miR-200c has a low expression and XIST has a high expression in the sphere forming cells compared to the parental cells. [score:4]
Biological effects including cell clone formation, sphere formation, self-renewal properties and mouse tumourigenesis were examined in BCSC-like cells with miR-200c overexpression or XIST knockdown. [score:4]
These findings suggest that miR-200c inhibited the growth in human bladder cancer cells. [score:3]
a The relative mRNA expression level of miR-200 was detected using qPCR in sphere and parental cells. [score:3]
Our results demonstrated that miR-200c can inhibit the stemness properties such as self-renewal, clone formation and EMT in human bladder cancer cells. [score:3]
The efficiency of clone formation and self-renewal and the phenomenon of EMT were decreased after miR-200c overexpression. [score:3]
These results suggested that miR-200c inhibits the proliferation, metastasis and migration in human bladder cancer cells. [score:3]
After 6–8 days in sphere formation culture, the anti-XIST plasmid or the miR-200c overexpression plasmid was transfected in sphere forming cells using the transfection reagent. [score:3]
In different human cancers, such as ovarian [9], breast [10] and prostate [11] cancers, miR-200c expression is obviously reduced. [score:3]
These results suggested that miR-200c had the lowest expression in human BCSC-like cells. [score:3]
The T24 sphere forming cells (1 × 10 [7]) transfected with anti-XIST plasmid and miR-200c inhibitor were subcutaneously injected into the left and right flanks of 6-week-old NOD/SCID mice that were purchased from the Laboratory Animal Centre of Xiangya Hospital of Central South University. [score:3]
miR-200c functions as a tumour suppressor that impacts the growth of bladder cancer cells and the epithelial-to-mesenchymal transition (EMT). [score:3]
These data revealed that miR-200c functions in inhibiting the stemness properties and that lncRNA XIST possesses the reverse function in bladder cancer cells. [score:3]
d miR-200c mimics affected the expression of EMT -associated factors such as E-cadherin, vimentin and ZEB1 and ZEB2 proteins. [score:3]
c The targeted binding sites of miR-200c and XIST. [score:3]
We cloned the predicted miR-200c binding site of XIST, named as XIST-Wt, and a mutated targeting site of XIST, named as XIST-Mut vector. [score:3]
miR-200c was found to have a low expression in BCSC-like cells that possess stemness properties. [score:3]
Based on the results from our study investigating the underlying mechanism of XIST and miR-200c in regulating bladder cancer cell growth and invasion, XIST might be considered as a potential target for suppressing the proliferation, metastasis and tumourigenicity of human BCSCs. [score:3]
Fig.  2Targeting relationship between miR-200c and XIST. [score:3]
Numerous studies have demonstrated that miR-200c functions as a tumour suppressor that impacts the cancer cell growth and survival [7, 8]. [score:3]
anti-con group To further ascertain a functional relationship between miR-200c and XIST, the relative expression of miR-200c was detected using qPCR and shown to be significantly increased after XIST knockdown compared with that in the control group both in 5637 and T24 cells (Fig.   4b). [score:3]
anti-con group To further ascertain a functional relationship between miR-200c and XIST, the relative expression of miR-200c was detected using qPCR and shown to be significantly increased after XIST knockdown compared with that in the control group both in 5637 and T24 cells (Fig.   4b). [score:3]
These results suggested that miR-200c inhibits the self-renewal ability of BCSC-like cells. [score:3]
1. The relative mRNA expression levels of miR-200c in T24 sphere forming cells (A) and mouse tissues (B). [score:3]
was used to examine the changes of XIST and miR-200c expression levels. [score:3]
The miR-200c overexpression mo del was successfully constructed. [score:3]
Furthermore, we used the sphere forming 5637 and T24 cells as BCSC mo dels to investigate their self-renewal and clone formation capacities under miR-200c overexpression or XIST knockdown condition. [score:2]
Moreover, the results suggested that lncRNA XIST performs the exact opposite function as miR-200c in regulating the proliferation and metastasis of bladder cancer cells. [score:2]
Therefore, this study aimed to explore the function and regulatory mechanism of XIST and miR-200c in the maintenance of the stemness properties and tumourigenicity of human bladder cancer cells. [score:2]
The cancer stem cells were isolated from cell lines 5637 and T24 in the present study to better understand the biological function and regulatory mechanisms of lncRNA XIST and miR-200c in human bladder cancer cells. [score:2]
Cell self-renewal assays were performed using ultra-low adhesion, 96-well plates containing 200 μL stem cell growth medium at a density of 1 cell/well after transfection with the anti-XIST plasmid or the miR-200c overexpression plasmid. [score:2]
This study aimed to examine the relationship between lncRNA XIST and miR-200c and to assess their functions in the regulation of the stemness properties and tumourigenicity of human bladder cancer stem cell (BCSC)-like cells. [score:2]
In addition, we detected that the expression of EMT -associated factors such as E-cadherin was significantly increased and that of vimentin, ZEB1 and ZEB2 was significantly decreased in the miR-200c mimics group compared to the mimics NC group (Fig.   3d). [score:2]
Together with the results of the dual luciferase reporter assay, this demonstrated that XIST directly forms a complementary base pair with miR-200c and acts as a molecular sponge of miR-200c to regulate the biological functions of bladder cancer cells. [score:2]
To identify whether miR-200c has a function in targeting XIST, dual luciferase reporter assays were performed. [score:2]
Fig.  5XIST and miR-200c regulated the tumour growth and proliferation in vivo. [score:2]
Only the relative expression of miR-200c was significantly decreased in the BCSC sphere cells compared to the parental cells in the 5637 and T24 cell lines. [score:2]
Therefore, we speculate a competitive relationship between XIST and miR-200c in the regulation of tumour cell occurrence, proliferation and invasion. [score:2]
These results suggest that XIST regulates BCSC-like cells by functioning as a molecular sponge of miR-200c. [score:2]
qPCR revealed decreased mRNA expression levels of miR-200a, miR-200b, miR-200c (Fig.   2a) in the sphere forming cells compared to the parental cells in 5637 and T24 cell lines. [score:2]
To explore the effect of miR-200c on the proliferation and metastasis in the BCSC-like cells, we transfected the first passage of BCSC-like 5637 and T24 cells with the miR-200c mimics (the miR-200c mimics group) or negative control (the mimics NC group). [score:1]
XIST and miR-200c are associated with tumour growth and proliferation in vivo. [score:1]
In this study, we predicted lncRNAs with complementary base pairing with miR-200c using an online software program (http://www. [score:1]
In addition, we assumed that lncRNA XIST performed these functions by acting as a molecular sponge of miR-200c in human bladder cancer cells. [score:1]
The results showed a dramatically decreased relative luciferase activity in 5637 and T24 parental cells co -transfected with XIST-Wt and miR-200c and no significant changes in the group co -transfected with XIST-Wt and miR-NC and in the group co -transfected with XIST-Mut and miR-200c or miR-NC (Fig.   2d). [score:1]
The psiCHECKTM-2 vector with the cloned miR-200c binding site of XIST, named XIST-wild type (WT), was co -transfected with miR-200c mimics or mimics NC using the Lipofectamine [2000] transfection reagent. [score:1]
The mechanism and function of XIST and miR-200c in the pathogenesis of bladder cancer remain largely unknown. [score:1]
The assay showed that the self-renewal capacity of BCSC-like 5637 and T24 cells was significantly inhibited in the miR-200c mimics group compared to the mimics NC group (Fig.   3c). [score:1]
miR-200c and lncRNA XIST have been reported to affect the biological functions of multiple cancer cells including gastric cancer and breast cancer cells, respectively [21, 22]. [score:1]
These evidences may suggest a relationship between miR-200c and XIST influencing the biological functions of bladder cancer cells. [score:1]
miR-200a (Catalog#: HmiRQP0297), miR-200b (Catalog#: HmiRQP0299), miR-200c (Catalog#: HmiRQP0301) and U6 (Catalog#: HmiRQP9001) were purchased from GeneCopoeia. [score:1]
Furthermore, our software analysis revealed a binding site between miR-200c and XIST (Fig.   2c). [score:1]
The effect of miR-200c and lncRNA XIST in bladder cancer and a potential relationship between miR-200c and XIST remain largely unknown. [score:1]
b miR-200c was significantly increased in the XIST knockdown group compared to the control group. [score:1]
[1 to 20 of 73 sentences]
14
[+] score: 213
In addition, re -expression of miR-200c into MMTV-Wnt-1 induced murine mammary tumor cells almost completely suppressed colony formation and re -expression of miR-200c in human breast cancer stem cells almost completely inhibited in vivo tumor growth in NOD/SCID mice [18, 82]. [score:9]
The top 15 differentially expressed microRNAs based on fold change (p<0.05) are presented in Table 1. The most differentially expressed miRNA was mmu-miR-429, a member of the miR-200 family, and 4 of the 5 miR-200f members (miR-141, miR-200b, miR-200c and miR-429) were in the top 15 differentially expressed miRNAs (shaded in Table 1). [score:7]
Re -expression of miR-200c in RJ423200c cells only had a modest effect on mesenchymal gene expression (Figure 5A-5H) and only Twist1 was significantly down-regulated in RJ423200c cells compared to RJ423EV cells (Figure 5E). [score:7]
This analysis identified 5 potential miR-200c targets and these targets are listed in Table 6. Quantitative RT-PCR confirmed that these 5 genes were significantly downregulated in RJ423200c cells compared to RJ423EV cells (Table 6). [score:7]
TaqMan RT-PCR revealed that the RJ423200c cells expressed significantly higher levels of miR-200c compared to RJ423EV cells (>300-fold increase in miR-200c levels) and the level of miR-200c expression in the RJ423200c cells was nearly restored to the levels expressed by RJ345 cells (Figure 4). [score:6]
5-aza-2′-deoxycytidine treatment significantly increased the expression of both miR-200c (4.6-fold) and miR-200b (4.7-fold) suggesting that the expression of both miR-200 clusters are regulated, at least in part, by methylation. [score:6]
genes downregulated in RJ423200c cells with potential miR-200c target sequences. [score:6]
Interestingly, one of the genes regulated by miR-200c and found to be significantly downregulated in RJ42300c cells was Flt1 [87]. [score:5]
Promoter hypermethylation appears to be the primary mechanism for silencing miR-200c/141 expression while histone modifications via the Polycomb group has been reported to be responsible for silencing miR-200b/200a/429 expression [17]. [score:5]
Re -expression of miR-200c impairs mammary tumor growth in vivoTo determine whether re -expression of miR-200c in RJ423 cells affected mammary tumor growth in vivo, RJ423EV and RJ423200c cells were injected into the 4 [th] mammary glands of wild type, FVB mice. [score:5]
Our findings indicate that miR-200c can suppress proliferation and colony formation of murine claudin-low tumor cells in vitro and impair tumor growth in vivo, potentially through inhibiting angiogenesis. [score:5]
It should be noted that although only miR-200c was re-expressed in RJ423 cells, miR-200c has hundreds of predicted mRNA targets (microrna. [score:5]
Thus, our work further demonstrates the importance of restoring miR-200c expression as a mechanism to inhibit the growth/tumorigenic potential of claudin-low mammary tumor cells. [score:5]
Quantitative RT-PCR was used to validate the differential expression of the miR-200 family and as shown in Table 2, all 5 members of the miR-200f (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) were expressed at significantly higher levels in the PMT samples compared to the RST samples. [score:4]
org) and thus can potentially be regulated by miR-200c expression. [score:4]
Expression of the miR-200 clusters appears to be regulated by modifications to the promoter regions of each cluster. [score:4]
None of the other miR-200f members were elevated in the RJ423200c cells indicating that miR-200c was specifically upregulated in these cells (Figure 4). [score:4]
Inhibition of angiogenesis by miR-200c is consistent with a study by Pecot et al [92] that showed miR-200 family members could regulate tumor angiogenesis in basal-like breast cancer. [score:4]
The lack of change in invasive properties following miR-200c re -expression in our study could be due to the modest changes in several of the mesenchymal genes such as Zeb1 and Zeb2 that have also been implicated in regulating cell migration and invasion [75– 79]. [score:4]
Other miR-200c targets identified by included Arhgap6, Dmd, Slc14a1, and Vldlr. [score:3]
Re -expression of miR-200c impairs mammary tumor growth in vivo. [score:3]
One specific example is a study by Shimono et al [18] that compared miRNA profiles between breast cancer stem cells and the remaining non-tumorigenic, breast cancer cells and 3 miRNA clusters, miR-200c/141, miR-200b/200a/429 and miR-183/96/182, were consistently downregulated in breast cancer stem cells [18]. [score:3]
The expression of the other miR-200f members was not affected by transfection with the CMV-miR200c plasmid. [score:3]
Cell morphology displayed by RJ423EV and RJ423200c cells grown as monolayers was similar suggesting the re -expressing only miR-200c was insufficient to convert the mesenchymal RJ423 cells to epithelial cells. [score:3]
In this plasmid, mmu-miR-200c expression is driven by a CMV promoter. [score:3]
RJ423 cells were transfected with either the control plasmid (pCMV-MIR) creating RJ423EV cells or a plasmid expressing miR-200c driven by a CMV promoter (pCMV-MIR containing the miR-200c) creating RJ423200c cells. [score:3]
miR-200c and miR-200b (first miRNA in miR-200c/141 or miR-200b/200a/429 cluster) levels in RJ423 cells treated daily with DMSO or 3μM of the DNA methyltransferase inhibitor, 5-aza-2′-deoxycytidine (5-aza) for 72hrs (B). [score:3]
To further understand the genetic alterations induced by re -expression of miR-200c in RJ423 cells, was performed on RJ423EV and RJ423200c cells using 3 independent replicates for each cell line. [score:3]
The microRNA expression plasmid containing murine miR-200c was purchased from Origene (cat # SC400903; Origene Technologies, Rockville, MD). [score:3]
Re -expression of miR-200c in RJ423 cells. [score:3]
Although iPathwayGuide did not identify Vegfc as a miR-200c target, Vegfc does contain a predicted miR-200c binding site (microRNA. [score:3]
Re -expression of miR-200c impairs cell proliferation and anchorage independent growth but not invasion in vitro. [score:3]
Neither Zeb1 nor Zeb2 were significantly reduced by the re -expression of miR-200c in RJ423 cells. [score:3]
In summary, re -expression of miR-200c in murine claudin-low mammary tumor cells reduces proliferation and colony formation in vitro and tumor growth in vivo. [score:3]
Re -expression of miR-200c did however induce a partial reversion of sphere morphology when the cells were grown as three dimensional cultures in matrigel. [score:3]
Expression (mean ± SEM) of miR-200a, miR-200b, miR-200c, miR-141 and miR-429 in RJ345 cells, RJ423 cells containing the empty vector control (RJ423EV) or RJ423 cells containing miR-200c (RJ423200c) as determined by Taqman RT-PCR. [score:3]
Previous reports indicate that the miR-200c/miR-141 promoter region can be methylated and this methylation decreases miR-200c and miR-141 expression [44– 47]. [score:3]
To determine the function of miR-200f in murine mammary tumor cells with features of human claudin-low breast cancer, miR-200c was re-expressed in RJ423 cells. [score:3]
Therefore, our study and others suggest that miR-200c can inhibit progenitor/stem cell function in mammary tumor cells. [score:3]
To determine whether re -expression of miR-200c in RJ423 cells affected mammary tumor growth in vivo, RJ423EV and RJ423200c cells were injected into the 4 [th] mammary glands of wild type, FVB mice. [score:3]
Re -expression of miR-200c impairs cell proliferation and anchorage independent growth but not invasion in vitroProliferation was determined using phospho-histone H3 immunofluorescence in RJ345, RJ423EV and RJ423200c cells. [score:3]
The two significant biological pathways and top 5 molecular functions identified by iPathwayGuide are presented in Table 5. This software was also used to identify genes downregulated in RJ423200c cells compared to RJ423EV cells that had miR-200c consensus sequences as predicted by iPathwayGuide software. [score:3]
In the first approach, DNA isolated from RJ345, RJ423 and RJ348 cells using a Quick-DNA Universal Kit (Cedarlane, Burlington, ON) or DNA isolated from primary mammary tumors (PMTs) or recurrent spindle tumors (RSTs), described in [41], using DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD) was sent to Zymo Research Corporation for targeted bisulfite sequencing of the miR-200c/141 promoter region. [score:3]
This family of microRNAs is expressed as two clusters on distinct chromosomes with the miR-200c/miR-141 cluster located on chromosome 12 in humans and chromosome 6 in mice and the miR-200b/miR-200a/miR-429 cluster located on chromosome 1 in humans and chromosome 4 in mice [15]. [score:3]
First, targeted bisulfite sequencing of a putative miR-200c/miR-141 promoter region was performed in RJ345, RJ423 and RJ348 cell lines as well as in PMT and RST samples. [score:3]
This study focused on miR-200c as it was easier to manipulate a single miRNA rather than one or both miR-200f clusters and regulating an individual miRNA would simplify the analysis as each miRNA can potentially regulate hundreds or even thousands of mRNAs. [score:3]
Our findings are consistent with the study by Song et al [62] who demonstrated that miR-200c can suppress mammary tumor cell proliferation. [score:3]
Expression of miR-200c in RJ345, RJ348 and RJ423 cells. [score:3]
These findings suggest that expression of miR-200c negatively impacts cell proliferation rates. [score:3]
However, re -expression of miR-200c in RJ423 cells did not significantly alter cell invasion. [score:3]
Under these conditions, RJ423EV cells produced significantly more colonies than RJ345 cells while re -expression of miR-200c in RJ423200c completely abolished the ability of RJ423 cells to produce colonies in a soft agar assay (Figure 6B). [score:2]
miR-200c is regulated by promoter methylation. [score:2]
One family of microRNAs that has garnered considerable attention in cancer biology is the miRNA-200 family (miR-200f) which consists of 5 members, miR-141, miR-200a, miR-200b, miR-200c and miR-429. [score:1]
At the end of the treatment period, RNA was extracted and Taqman qRT-PCR for miR-200c or miR-200b (first member of each cluster) was performed as described above using SnoRNA202 and SnoRNA234 as normalizers. [score:1]
miR-200c promoter methylation analysis. [score:1]
Evaluation of the methylation status of 30 CpG sites ~1000bp upstream of the miR-200c/miR-141 cluster on murine chromosome 6 as determined by targeted bisulfite sequencing. [score:1]
Since one of the hallmarks of claudin-low breast cancer is the suppression of miR-200f members, this manuscript evaluated the impact of re -expressing a miR-200f member, namely miR-200c, in murine mammary tumor cells with characteristics similar to human claudin-low breast cancer. [score:1]
Figure 3B shows the levels of the first member of each miR-200f cluster (miR-200c and miR-200b) in RJ423 cells treated with the vehicle control (DMSO) or 5-aza-2′-deoxycytidine. [score:1]
Two approaches were utilized to determine methylation of the miR-200c promoter. [score:1]
miR-200a and miR-141 share the same seed sequence (AACACUG) that is different from the seed sequence of miR-200b, miR-200c and miR-429 by one nucleotide [16]. [score:1]
In order to evaluate the function of the miR-200f in mesenchymal mammary tumor cells, miR-200c was re-expressed in RJ423 cells. [score:1]
To assess miR-200c promoter methylation in our mo del systems two approaches were employed. [score:1]
The seed sequence, the region of the miRNA that determines mRNA binding, is the same in miR-200b, miR-200c, and miR-429 (AAUACUG). [score:1]
Using a plasmid containing mmu-miR-200c driven by a CMV promoter, mature miR-200c levels could be restored nearly to the level observed in RJ345 cells and >300-fold higher than RJ423 cells transfected with an empty vector (RJ423EV cells). [score:1]
In an attempt to understand the mechanism of reduced tumor growth induced by miR-200c, proliferation, apoptosis and blood vessel density were assessed. [score:1]
RJ423200c cells were created by transfecting RJ423 cells with 1μg of the pCMV-miR-200c plasmid using 5μl/ml of Lipofectamine 2000 (Thermo Fisher Scientific, Burlington, ON). [score:1]
[1 to 20 of 66 sentences]
15
[+] score: 205
In this study we have identified microRNAs whose expression is influenced by knock-down of Nkx2-1. Using genome- wide miRNA expression profiling in a lung adenocarcinoma-derived mouse epithelial cell line (MLE15) [21], we observed that reduction of Nkx2-1 levels to approximately half of that in control cells promoted significant and reproducible changes in miRNA expression patterns, including a high up-regulation of miR-200c. [score:11]
We intersected TargetScanMouse predicted targets with 557 genes showing anti-correlated expression to that of miR-200c (Figure  4A) in Nkx2-1 knockdown cells. [score:8]
Therefore, a reduction of Nkx2-1may modulate the proliferative activity of lung epithelial cells not only by direct inhibition of cyclin B, as it was previously described [12, 13], but also through direct or indirect activation of miR-200c to inhibit downstream oncogenes. [score:8]
In particular, we identified a regulatory link between Nkx2-1, the known tumor suppressor miR-200c, and the developmental and oncogenic transcription factors Nfib and Myb, adding new players to the regulatory mechanisms driven by Nkx2-1 in lung epithelial cells that may have implications in lung development and tumorigenesis. [score:7]
Gene ontology analysis of predicted miR-200c targets down-regulated in Nkx2-1 knock-down cells. [score:7]
Mouse lungs lacking functional phosphorylated Nkx2-1 showed increased expression of miR-200c and alterations in the expression of other top regulated miRNAs. [score:6]
The studies indicate that down-regulation of Nkx2-1 de-represses miR-200c, either by a direct or an indirect mechanism. [score:6]
Expression of miR-200c is higher in adult rat lung alveolar cells than fibroblasts, and its expression is lower during development than in adult lung. [score:6]
In this study we have characterized miRNAs regulated by Nkx2-1 in a mouse lung cell line system by genome-wide analysis of mRNA and miRNA profiles and confirm the expression patterns of highly regulated miRNAs in normal mouse lung and in lungs expressing phosphorylation mutant Nkx2-1. In particular, we found a regulatory link between Nkx2-1, miR-200c and the nuclear factor I/B (Nfib) and myeloblastosis oncogene (Myb). [score:6]
Particularly, miR-200c, negatively regulated by Nkx2-1, reduces the expression of downstream targets Nfib and Myb. [score:6]
A significant number of miR-200c targets whose expression was negatively correlated to miR-200c in the microarray analysis were overrepresented in the transcriptional regulation GO category (Additional file 4: Table S3). [score:6]
Predicted targets of miR-200c were retrieved from TargetScanMouse (Release 6.2) [27]. [score:5]
Predicted targets of miR-200c were downloaded from TargetScanMouse 6.2 (aggregate PCT > 0.1) [27]. [score:5]
In lung adenocarcinoma a high-level of NKX2-1 expression is significantly associated with longer overall survival [7], whereas a high-level of miR-200c expression is associated with shorter overall survival [30] supporting the inverse correlation. [score:5]
One well studied function of the miR-200 family is the induction of an epithelial phenotype by inhibiting the transcriptional repressor Zeb2 and thereby enhancing E-cadherin expression [31, 35]. [score:5]
Downstream, miR-200c reduces the expression of its predicted targets Nfib and Myb. [score:5]
The expression of miR-141, clustered and usually co-expressed with miR-200c [30], is higher in Nkx2-1-shRNA than in control (p = 0.0196; FDR = 0.087) (Table  1) following the same trend than miR-200c. [score:5]
miR-200c controls expression of its predicted targets Nfib and Myb. [score:5]
mmu-miR-200c and mmu-miR-1195 predicted target genes identified in TargetScanMouse 6.2. [score:5]
By RT-qPCR analysis we showed that absence of phosphorylated NKX2-1 results in a significant increment in the levels of miR-200c and miR-221; miR-1195 is down-regulated although no significantly, showing a similar trend than in Nkx2-1 knockdown experiments in MLE15 cells (Figure  2C). [score:5]
3′UTR reporter assays support a direct regulation of the predicted targets Nfib and Myb by miR-200c. [score:4]
From these, 29 miRNAs increased their expression levels by Nkx2-1 knock-down including miR-200c (16.7 fold), miR-200b (1.7 fold), miR-221 (4.2 fold), and miR-222 (3.7 fold) (Figure  2A and Table  1). [score:4]
By miRNA array analyses of mouse epithelial cell lines in which endogenous Nkx2-1 was knocked-down, we revealed that 29 miRNAs were negatively regulated including miR-200c, and 39 miRNAs were positively regulated by Nkx2-1 including miR-1195. [score:4]
These transcription factors [38, 39] and other known miR-200c targets such as E2F3 [40] and Kras [41] have been linked to lung epithelial proliferation in development and in tumorigenesis acting as oncogenes. [score:4]
So, Nkx2-1 has a strong effect in controlling the levels of miR-200c expression but this control might be indirect. [score:4]
In support of these results, a search in a ChIP-chip dataset of NKX2-1 target genes in mouse lung development that we previously published [12] indicates a significant binding of NKX2-1 within the 1kb 5′ flanking region of the miR-200c gene (Figure  3C). [score:4]
The other predicted target, Myb has been recently linked to the differentiation of airway epithelial cells [43], and was shown to be regulated by miR-200c in glioblastomas [44] and breast cancer cells [43]. [score:4]
Expression patterns of the most altered miRNAs (miR-200c, miR-221, miR-1195, and miR-378) were analyzed in Nkx2-1 knock-down cells by RT-qPCR (Figure  2B) confirming the microarray data. [score:4]
Figure 4 Analysis of predicted targets of miR-200c. [score:3]
Adjusted p value < 0.0005 (C) Selected transcription factors target of miR-200c were validated by RT-qPCR in Nkx2-1 shRNA treated cells vs. [score:3]
Plasmids harboring a Firefly luciferase reporter and the 3′UTR flanking region of the mir-200c predicted targets Myb (MmiT029722-MT01), Nfib (MmiT027729a2-MT01), and Six1 (MmiT028207-MT01), or a control vector (CmiT000001-MT01) were co -transfected in MLE15 cells either with a pre-miR-200c plasmid (MmiR3304-MR01) or with an scrambled control clone (CmiR0001-MR01) using EndoFectin Plus transfection kit. [score:3]
A total of 770 predicted targets of miR-200c (total context score ≤ −0.01) were identified (Additional file 2: Table S1). [score:3]
The transcription factors Gata4 [33], Ntf3 [34] and Sox2 [35] are experimentally validated targets of miR-200c in human cells. [score:3]
The intersection showed 32 genes whose changes in expression were anti-correlated with miR-200c (including the transcription factors Gata4, Myb, Nfib Ntf3, Phf6, Six1, Sox2, and Trps1) (Figure  4B). [score:3]
These data indicate a potential regulatory link between NKX2-1 and miR-200c, miR-221, or miR-1195. [score:2]
The 5′ flanking region of miR-200c exhibits intense transcriptional activity (15-fold ± 0.66; p = 0.0005) with normal levels of Nkx2-1. Unexpectedly, we found that knock-down of Nkx2-1 resulted in lower transcriptional activity of this 1kb fragment (8-fold ± 0.24; p = 1.6 × 10 [−6]). [score:2]
But in epithelial cell contexts, as the ones described in this work, increased miR-200c may regulate cellular processes other than MET, such as proliferation, or survival of lung cells. [score:2]
Alternatively, the elements mediating Nkx2-1 repression of miR-200c might be located in regulatory regions beyond the -1kb 5′ flanking region. [score:2]
Nkx2-1 is recognized to act mainly as a transcriptional activator [11], binding to the promoters/enhancers of 58% of activated downstream genes but only to 23% of genes repressed by Nkx2-1. Therefore, most genes repressed by Nkx2-1 do so by mechanisms other than direct promoter binding as may be the case for miR-200c. [score:2]
The individual functions of NKX2-1 [5- 7, 49], miR-200c [30, 50, 51], MYB [39, 52], and NFIB [42] in lung development and/or lung cancer have been wi dely documented. [score:2]
Promoter reporter assays indicated that 1kb of the miR-200c 5′ flanking region was transcriptionally active but did not mediate Nkx2-1- repression of miR-200c expression. [score:2]
We selected Nfib, Six1, and Myb to perform 3′UTR-luciferase reporter assays in MLE 15 cells expressing pre-miR-200c or scrambled control. [score:2]
Thus, miR-200c-Luc and miR-221-Luc plasmids were transiently transfected using Lipofectamine 2000 (Life Technologies, Grans Island, NY) in the cell lines described above. [score:1]
miR-200c was initially identified as a lung-specific miRNA in rats [37]. [score:1]
miR-200c –Luc; (**) p < 0.05 in miR-200c-Luc + scrambled vs. [score:1]
Most studies about miR-200c have been performed in the mesenchymal-epithelial transition (MET) context. [score:1]
In the latter, the human MYB 3′UTR was shown to contain miR-200c binding sites. [score:1]
Our data shows that miR-200c represses Nfib and Myb genes. [score:1]
Detailed ChIP methods are described in Additional file 1. Genomic regions (1.1 kb) 5′ to the first nucleotide of miR-200c and of miR-221 pre-miRNA sequences were retrieved from the UCSC Mouse Genome Browser [29]. [score:1]
Analysis of histone marks in distinct microRNA loci to identify putative transcription start sites (TSS) indicates that a putative TSS of miR-200c in mouse cells might be within 5 kb of the pre-miRNA sequence [32]. [score:1]
Nkx2-1 controls transcriptional activity of the miR-200c 5′ flanking region. [score:1]
For miR-200c, the enrichment of the IP fractions with the Nkx2-1 antibody and IgG were 28 and 0.4% of input while for miR-1195, were 129% and 1.3% of input respectively. [score:1]
We used oligonucleotides with restriction enzyme adaptors to amplify ~ 0.9-1kb of each region by PCR (miR-200c F 5′-SacI CAGGCAGACACTGCCATCT-3′, R 5′-HindIII CTACCCAACCAGTCCACCTCC-3′; miR-221 F 5′-SacI AGGAGAGGCCCTTGGTATAG-3′, R 5′-HindIII GTTCAGCCTGCAAATTATCC). [score:1]
Data represents binding signal (y axis) for each probe on the promoter tiling array (x axis) corresponding to the 5′ flanking region of the pre-miR-200c. [score:1]
miR-200c. [score:1]
Supporting its role in maintaining an epithelial phenotype in the lung, miR-200c expression is significantly reduced in the lung of mice with experimental fibrosis and in lungs of IPF patients where the epithelium undergoes profound alterations by acquiring some mesenchymal characteristics. [score:1]
No difference in luciferase activity was observed in cells co -transfected with Six-1-Luciferase and pre-miR-200c or scrambled plasmids. [score:1]
The miR-200c 5′flanking fragment is highly conserved in humans where it is transcriptionally active [31]. [score:1]
Because of the high conservation between mouse and human homologs of Nkx2-1, Nfib, Myb, and miR-200c it is likely that these links apply to human cells. [score:1]
[1 to 20 of 59 sentences]
16
[+] score: 204
MicroRNAs have been recently implicated in the regulation of tumorigenesis, differentiation, proliferation, and survival through the inhibition of major cellular pathways 4– 9. Among them, miR-200c has been demonstrated to function as a tumor suppressor, and loss of miR-200c expression has been reported in many cancer types, restoration of miR-200c expression has been shown to abrogate tumorigenesis 10– 14. [score:10]
Then, we will ask several important questions in this study: (1) what are the roles of miR-200c in osteosarcoma; (2) what is the potential direct target of miR-200c that may be associated with cancer development; and (3) whether miR-200c overexpression inhibits cell proliferation and migration; (4) What role of miR-200c and underlying mechanisms in osteosarcoma resistance to cisplatin treatment. [score:9]
To fully understand the mechanisms of miR-200c in osteosarcoma, TargetScan search program was used to predict targets of miR-200c, which AKT2 has been thought to be putative target of miR-200c (Fig.   3a). [score:7]
MiR-200c has been reported to inhibits autophagy and enhances radiosensitivity in breast cancer cells by targeting UBQLN1; meanwhile, miR-200c increases the radiosensitivity of non-small-cell lung cancer cell line A549 by targeting VEGF-VEGFR2 pathway 36, 37. [score:7]
Overexpression of miR-200c increases chemosensitivity of osteosarcoma cells to cisplatin by inhibiting its target AKT2. [score:7]
Taken together, the present study provides the first evidence that miR-200c is significant in suppressing osteosarcoma growth through inhibition of AKT2 translation. [score:7]
Figure 4Overexpression of miR-200c increases chemosensitivity of osteosarcoma cells to cisplatin by inhibiting its target AKT2. [score:7]
AKT2 is a direct target of miR-200c, osteosarcoma tissues exihibits higher levels of AKT2 which are inversely correlated with miR-200c expression. [score:6]
Figure 3AKT2 is a direct target of miR-200c, osteosarcoma tissues exihibits higher levels of AKT2 which are inversely correlated with miR-200c expression. [score:6]
In this study, we found that the expression of miR-200c is downregulated in osteosarcoma samples compared with normal tissues. [score:5]
Taken together, these results suggest that miR-200c inhibits tumor growth through targeting AKT2 in vivo. [score:5]
MiR-200c expression is down-regulated in human osteosarcoma tissues and cell lines. [score:5]
Secondly, AKT2 expression was significantly abolished in osteosarcoma cells which miR-200c stablely-expressed. [score:5]
RT-PCR analysis demonstrated miR-200c was highly expressed in MG-63/miR-200c and U-2OS/miR-200c cells, confirming that stable cell line over -expressing miR-200c was successfully established (Fig.   2a). [score:5]
Moreover, overexpression of miR-200c significantly inhibited osteosarcoma cell proliferation, migration, tumor growth and chemoresistance to cisplatin. [score:5]
Thus, our results show that miR-200c is responsible for suppressing cell proliferation and cell migration, thus functioning as a tumor suppressor in osteosarcoma cells. [score:5]
Moreover, we found that compared with miR-200c or cisplatin treatment alone, the activities of caspase-3, a key executor of cell apoptosis, were significantly upregulated upon combination treatment of miR-200c and cisplatin, whereas forced expression of AKT2 attenuated the activation of caspase-3 during the treatment (Fig.   4d). [score:5]
In the present study, we demonstrated that miR-200c was downregulated in human osteosarcoma. [score:4]
These results suggest that miR-200c directly targets AKT2 by binding its seed region to its 3′-UTRs in osteosarcoma cells. [score:4]
Our results firstly indicated that miR-200c was downregulated in osteosarcoma tissues and cell lines. [score:4]
Then, western blotting analysis was conducted to measure the levels of AKT2 protein, we found that the expression of AKT2 protein was downregulated in miR-200c treated cells. [score:4]
To further study whether miR-200c and its target AKT2 play a role in cell apoptosis in the presence of cisplatin treatment, FACS analysis was performed to detect cell apoptosis rates. [score:3]
MiR-200c regulate cell proliferation, cell migration and chemosensitivity to cisplatin in osteosarcoma by targeting AKT2. [score:3]
The correlation between miR-200c expression and AKT2 levels in osteosarcoma tissues were analyzed using Spearman’s rank test. [score:3]
Then, we determine the correlation between AKT2 levels and miR-200c expression levels in the same osteosarcoma tissues. [score:3]
These results indicated that miR-200c renders osteosarcoma cells more sensitive to cisplatin treatment, miR-200c and cisplatin combination induced apoptotic effect through targeting AKT2 in osteosarcoma cells. [score:3]
The results showed that the expression of miR-200c was consistently lower in the osteosarcoma tissues. [score:3]
To examine the role of miR-200c during carcinogenesis of human osteosarcoma, MG-63 and U-2OS cells were infected with lentivirus expressing miR-200c or miR-NC(negative control). [score:3]
In our study, we found that forced overexpression of miR-200c promoted the effects of cisplatin. [score:3]
MG-63 cells stably expressing miR-200c or miR-NC were injected subcutaneously into both flanks of nude mice (5 × 10 [6] cells in 100 μl). [score:3]
The combination of miR-200c and cisplatin treatment significantly induced cell apoptosis, whereas forced expression of AKT2 partially abolished the effect induced by miR-200c plus cisplatin treatment (Fig.   4c). [score:3]
Recent studies have been reported that miR-200c plays a potential role as a tumor suppressor in many kinds of cancers. [score:3]
Finally, osteosarcoma tissues exihibits higher levels of AKT2 which are inversely correlated with miR-200c expression. [score:3]
MiR-200c inhibits tumor growth in vivoIn order to test whether miR-200c attenuates progression of osteosarcoma in vivo, we engineered MG-63 cells to stably express miR-NC or miR-200c, which were subsequently implanted into both posterior flanks of immunodeficient mice, and tumor sizes were measured after 2 weeks. [score:3]
Our results showed that overexpression of miR-200c in MG-63 cells significantly increased chemosensitivity to treatment of cisplatin (Fig.   4a). [score:3]
To date, some genes have been identified as miR-200c target genes, including K-RAS, CDK2, ZEB2, Snail1, USP25, HMGB1 15– 20, which are involved in pathogenesis of cancers. [score:3]
In our study, AKT2 oncogene has been experimentally validated as the novel target of miR-200c. [score:3]
As shown in Fig.   3e, Spearman’s rank correlation analysis showed that the expression levels of AKT2 and miR-200c in 35 pairs of osteosarcoma specimens were inversely correlated (Spearman’s correlation r = −0.6686). [score:3]
MiR-200c stable -expressing cells generated xenografts that were statistically significantly smaller than control (Fig.   5b). [score:2]
MiR-200c inhibits the activity of cell proliferation and cell migration. [score:2]
MiR-200c inhibits tumor growth in vivo. [score:2]
In addition, expression of miR-200c in four osteosarcoma cell lines, HOS, Saos-2, MG-63 and U-2OS, was significantly decreased compared with the normal osteoblast cells NHOst (Fig.   1b). [score:2]
MiR-200c markedly suppressed luciferase activity in AKT2 3′-UTR (WT) reporter constructs. [score:2]
MiR-200c overexpression causes a decrease in tumor volume and weight. [score:2]
In agreement with in vitro studies, the levels of AKT2 from the tumor tissues of miR-200c expressing group were lower than that of miR-NC group by immunoblotting assay and qRT-PCR (Fig.   5d). [score:2]
To further study the role of miRNA-200c in regulating cell proliferation and cell migration, we found that cell growth and migration were attenuated in miR-200c cells compared with miR-NC cells (Fig.   2b and c). [score:1]
Furthermore, cell growth rate in the presence of cisplatin (5 μM) was assayed by CCK-8 proliferation assay at different time points, forced expression of AKT2 reversed miR-200c -induced osteosarcoma chemosentivity to cisplatin (Fig.   4b). [score:1]
For its mutagenesis, the sequences complementary to the binding site of miR-200c in the 3′-UTR (AKT2: CAGUAUU) was replaced by CTCUTAU. [score:1]
As shown in Fig.   3b, luciferase activities were significantly reduced in those cells transfected with the wild sequence and miR-200c, but not in the cells with the mutant sequence and miR-200c. [score:1]
Firstly, luciferase reporter assay confirmed that miR-200c directly recognize the 3′-UTR of AKT2 transcripts. [score:1]
After cultured overnight, cells were cotransfected with the wild-type or mutated plasmid, pRL-TK plasmid, and equal amounts of miR-200c or miR-NC. [score:1]
After selection by puromycin, stable cell lines termed as MG-63/miR-NC, MG-63/miR-200c, U-2OS/miR-NC and U-2OS/miR-200c were established. [score:1]
In order to test whether miR-200c attenuates progression of osteosarcoma in vivo, we engineered MG-63 cells to stably express miR-NC or miR-200c, which were subsequently implanted into both posterior flanks of immunodeficient mice, and tumor sizes were measured after 2 weeks. [score:1]
From the 2 [nd] to 4 [th] week, miR-NC -injected group developed significantly larger tumors than miR-200c group (Fig.   5a). [score:1]
However, the molecular mechanism of miR-200c repression in osteosarcoma has not been determined. [score:1]
* indicates significant difference compared to control; [#] indicates significant difference compared to miR-200c forced expression of AKT2 treatment. [score:1]
Lentivirus carrying hsa-miR-200c or hsa-miR -negative control (miR-NC) was packaged following the manufacturer’s manual. [score:1]
Male BALB/c nude mice were subcutaneously injected with 5 × 10 [6] MG-63 cells infected with lentiviruses harboring miR-NC or miR-200c. [score:1]
Meanwhile, the final tumor weight of miR-NC group was much heavier than miR-200c group (Fig.   5c). [score:1]
However, there are no results referring to the role of miR-200c in osteosarcoma at present. [score:1]
Thus, it is important that a miR-200c restoration approach may offer a new modulation strategy to overcome chemoresistance to cisplatin in osteosarcoma. [score:1]
In summary, we have identified a link between miR-200c and AKT2 that is a novel constituent of osteosarcoma tumorigenesis. [score:1]
[1 to 20 of 62 sentences]
17
[+] score: 188
Furthermore, downregulating paracrine TGF-β can inhibit and reverse EMT by downregulating ZEB1 and ZEB2 and upregulating miR-200b and miR-200c [26]. [score:12]
For example, in one study, overexpression of Stat3 [44], PDGF-D [45], Notch-1 [46], and DCLK1 [47] in cancer cells led to significant downregulation of miR-200 family members; this resulted in up-regulation of ZEB1, ZEB2, and SNAI2 expression and acquisition of the EMT phenotype. [score:11]
Similarly, NPV-LDE-225 suppressed EMT by upregulating E-cadherin and inhibited N-cadherin, Snail, Slug, and ZEB1 by increasing miR-200a, miR-200b, and miR-200c [43]. [score:8]
A plethora of miRNAs, including miR-200 family members and miR-506, have been found to directly regulate the expression of the target genes that are known to play critical roles in EMT regulation (Figure  4). [score:8]
A report suggested that miR-200b and miR-200c were significantly associated with survival in gastric cancer patients; miR-200b suppressed ZEB1, augmented E-cadherin, inhibited cell migration, and suppressed tumor growth in a mouse mo del [97]. [score:7]
MiR-200 can directly target β-catenin mRNA, inhibiting its translation and blocking Wnt/β-catenin signaling in meningioma [24]. [score:7]
IDH1 and IDH2 mutants also caused an EMT-like phenotype; this phenotype was dependent on upregulation of the transcription factor ZEB1 and downregulation of miR-200 family members [48]. [score:7]
Inhibition of the Smad signaling pathway completely blocked the TGF-β1 -mediated decrease in miR-200, suggesting that TGF-β1 -induced suppression of the miR-200 family is regulated via Smad [27]. [score:6]
Pathways that promote EMT by suppressing miR-200 and upregulating ZEB1 and ZEB2. [score:6]
Furthermore, a recent study illustrated that miR-200 members can target Jagged1, thereby mediating the downregulation of ZEB1 [23]. [score:6]
Pathways that suppress EMT by upregulating miR-200 and repressing ZEB1 and ZEB2. [score:6]
Several molecules have been found to upregulate the miR-200 family and consequently suppress EMT. [score:6]
p53 has been reported to transactivate miR-200 family members by directly binding to the promoters that repress ZEB1 and ZEB2 expression, leading to inhibition of EMT [41, 42]. [score:6]
Exposing epithelial cells to TGF-β promotes the loss of epithelial morphological features, the increased expression of EMT marker genes such as ZEB1 and ZEB2, and the decreased expression of miR-200 [25]. [score:5]
MiRNAs other than miR-200 inhibit EMT by targeting ZEB1 and ZEB2. [score:5]
The results of recent studies suggest that members of the miR-200 family play a critical role in suppressing EMT and cancer invasion and metastasis [34] by targeting transcriptional repressors of ZEB1 and ZEB2 [35]. [score:5]
In addition to miR-200 family members, other miRNAs have been identified that regulate EMT by directly targeting ZEB1 and ZEB2. [score:5]
While SNAI2 is targeted by miR-200, SNAI2 directly binds E-boxes in the miR-200a/b promoter regions and represses miR-200a/b transcription. [score:4]
Moreover, some signaling pathways, including p53, regulate EMT by regulating the miR-200-ZEB1 and ZEB2 regulatory loop. [score:4]
It was reported that miR-200c expression was epigenetically regulated in CRC [54]. [score:4]
Meanwhile, ZEB1 can directly suppress miRNA-200 family members in cancer cells, including miR-141 and miR-200c [36, 37]. [score:4]
Members of the miR-200 family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429) have emerged as important regulators of EMT, in part by targeting ZEB1 and ZEB2. [score:4]
The miR-200 family is usually downregulated in human cancer cells and tumors as a result of aberrant epigenetic gene silencing. [score:4]
Other miRNAs can induce EMT by downregulating miR-200 through DICER, such as miR-103 or miR-107 [49]. [score:4]
Smad3 was also reported to upregulate miR-200 family members at the transcriptional level in a TGF-β-independent manner [40]. [score:4]
Similarly, it was reported that EGF and EGFR can promote EMT by downregulating the miR-200 family in anaplastic thyroid cancer cells [32]. [score:4]
This results in lysine acetylation of ZEB1 and releases ZEB1’s suppression of miR-200c/141 transcription [39]. [score:3]
All of these findings indicate that these molecules promote EMT by suppressing miR-200. [score:3]
In addition to their role in regulating EMT, miR-200 family members are negatively regulated by multiple signaling pathways. [score:3]
ZEB1 and Twist1 bound the E-box consensus in the promoters proximal to the putative miR-200 TSS and repressed miR-200 expression. [score:3]
Therefore, ZEB1 and ZEB2 and miR-200 family members repress expression of each other in a reciprocal feedback loop, which may lead to amplification of EMT. [score:3]
Epigenetic regulation of miR-200. [score:2]
Twist1 was also reported to directly associate with miR-200 promoters as a transcriptional repressor of miR-200 [56] (Figure  3A). [score:2]
In another double-feedback loop, miR-200 and SNAI2 regulate EMT. [score:2]
Therefore, SNAI2 and miR-200 act in a self-reinforcing regulatory loop that leads to amplification of EMT [71]. [score:2]
Moreover, SNAI1 can repress transcription of miR-34 genes, resulting in a SNAI1/miR-34 feedback loop that is analogous to the reciprocal ZEB/miR-200 feedback loop [66]. [score:1]
Similarly, miR-130b silencing can restore DICER1 to a threshold level that allows miR-200 family members to repress EMT in endometrial cancer [50]. [score:1]
The miR-200 family consists of five members in two clusters: miR-200b ~ 200a ~ 429 and miR-200c ~ 141. [score:1]
Rui Neves et al. also showed that the miR-200c/141 cluster is repressed by DNA methylation of a CpG island located in the promoter region of these miRNAs in invasive breast cancer cells [55]. [score:1]
Figure 3 MiR-200 and miR-506 DNA methylation genomic loci and promoters of E- and N-cadherin. [score:1]
Aberrant DNA methylation of the CpG island or the CpG-enriched regions is closely linked to miR-200 inappropriate silencing in cancer cells [57]. [score:1]
Other factors may also be involved in miR-200 repression, such as ZEB1 and Twist1. [score:1]
A. Graphical depiction of the miR-200b ~ 429 and miR-200c ~ 141 genomic loci, with putative transcription start sites (TSS) indicated by arrows. [score:1]
Studies have illustrated DNA methylation in two regions (#1 and #2) of a 2.5-kb large CpG island that is 2 kb upstream in miR-200b ~ 429 and in smaller CpG-enriched regions associated with miR-200c ~ 141. [score:1]
Furthermore, delivery of miR-200 members into the tumor endothelium resulted in marked reductions in metastasis and angiogenesis [98]. [score:1]
A recent study showed that induction of ZEB1 and ZEB2 increased the methylation of miR-200 promoters [58]. [score:1]
For example, both P300 and PCAF act as cofactors for ZEB1, forming a P300/PCAF/ZEB1 complex on the miR200c/141 promoter. [score:1]
MiR-200 family members can also be epigenetically regulated. [score:1]
[1 to 20 of 48 sentences]
18
[+] score: 187
These findings suggest that dysregulation of the three miRNA clusters, namely the downregulation of the miR-200 clusters and the upregulation of the miR-221-222 cluster, is involved in the suppression of apoptosis in both breast CSCs and normal mammary stem/progenitor cells. [score:10]
miR-22 targets the methylcytosine dioxygenase TET (ten-eleven translocation) family members, inhibits the demethylation of the miR-200 promoter, and suppresses the expression of miR-200 [65]. [score:9]
The miR-200 family miRNAs downregulate ZEB1 and ZEB2 expression, and effectively upregulate the cellular E-cadherin level to maintain a cell in a more epithelial-like state (Figure 3). [score:9]
The multiple miRNAs dysregulated in the breast CSCs, such as miR-142, miR-146, miR-200, and miR-141, cooperatively activate the Wnt signaling pathway by targeting or upregulating the expression of its components. [score:9]
ZEB1 suppresses the expression of all miR-200 family members (miR-141, miR-200a,b,c and miR-429), which in turn inhibits the translation of ZEB1 mRNA, resulting in the double -negative ZEB/miR-200 feedback loop [160]. [score:9]
Expression of the miR-200 family miRNAs is downregulated in the breast CSCs and normal mammary stem/progenitor cells, and is upregulated in the more differentiated counterparts. [score:9]
These findings suggest that the downregulation of miR-200 members and upregulation of miR-146 are involved in the activation of the Notch signaling pathway in the breast CSCs and normal mammary stem/progenitor cells. [score:7]
These findings suggest that the three miRNA clusters, namely two miR-200 clusters and one miR-183 cluster, coordinately upregulate the expression of Bmi1 to enhance the stem cell self-renewal abilities in both breast CSCs and normal mammary stem/progenitor cells. [score:6]
miR-200 family miRNAs that are downregulated in human breast CSCs and normal mammary stem/progenitor cells function as the suppressors of the Wnt signaling pathways (Figure 3 and Figure 4). [score:6]
Among them, miR-200b, miR-200c, miR-141, and miR-183 are specifically downregulated in the human breast CSCs and normal mammary stem/progenitor cells [24], suggesting that miRNAs are important regulators of self-renewal abilities in breast CSCs and normal mammary stem/progenitor cells (Figure 3). [score:5]
miR-200b, miR-200c and miR-141 target Bmi1 which suppresses p53 -mediated cell cycle arrest and apoptosis by repressing p19 [Arf](Figure 2 and Figure 3). [score:5]
miR-8, a Drosophila homologue of miR-200, targets TCF transcription factor and suppresses the Wnt signaling activities [152]. [score:5]
In addition, miR-200c functions as an enhancer of apoptosis by targeting molecules such as FAP-1, a known inhibitor of CD95 -mediated apoptosis, and Noxa, a member of the Bcl-2 family (Figure 3) [126, 127]. [score:5]
miR-200 family miRNAs suppress the Notch signaling by targeting Notch pathway components, such as JAG1 and the mastermind-like Notch coactivators, Maml2 and Maml3 (Figure 3) [170]. [score:5]
Downregulation of miR-200 family miRNAs and let-7 family miRNAs is observed in the CSCs of other cancers, such as colon cancer and Wilms tumor, and is associated with cancer progression [48, 49]. [score:4]
The miR-200 family miRNAs are involved in the regulation stem cell functions by targeting the genes and pathways important for stem cell maintenance, such as self-renewal factor Bmi-1, the apoptosis signaling pathway, the canonical Wnt signaling pathway, EMT and the Notch signaling pathway. [score:4]
Schickel R. Park S. M. Murmann A. E. Peter M. E. miR-200c regulates induction of apoptosis through CD95 by targeting FAP-1 Mol. [score:4]
The expression of the miR-200 family members can be regulated through interactions with transcriptional factors, modifications of their promoter regions, and Polycomb-group-gene -mediated repression. [score:4]
Because the expression of miR-200 family is downregulated in breast CSCs, analyses of the metastatic CSCs will be required to further characterize the roles of miR-200 family miRNAs in colonization and metastases to distant organs. [score:4]
The mammalian miR-200 clusters are expressed as two separate polycistronic pri-miRNA transcripts. [score:3]
A large number of studies demonstrate the strong suppressive effects of miR-200 on cell transformation, cancer cell proliferation, migration, invasion, tumor growth and metastasis [61]. [score:3]
ZEB1 and ZEB2 can inhibit the transcription of the entire miR-200 family [58]. [score:3]
The mammalian miR-200 family gained particular prominence because it is involved in the regulation of EMT, EGF signaling, regulation of stem cell characters, and somatic cell reprogramming into induced pluripotent stem cells [24, 56, 66, 67, 68, 69, 70, 71, 72]. [score:3]
The miR-200 family is highly expressed within epithelial cells and miR-200c and miR-141 have both been strongly linked to epithelial integrity [158, 159]. [score:3]
These eight miRNAs are located on the three miRNA clusters and two of the three clusters are the miR-200 clusters, suggesting that the suppression of miR-200 family miRNAs is critically important in the maintenance of stem cell functions. [score:3]
The mammalian miR-200 family clusters are expressed as two separate polycistronic pri-miRNA transcripts: miR-200b-200a-429 and miR-200c-141 clusters (Figure 1). [score:3]
miR-200c strongly suppresses the ability of human breast CSCs to form tumor when engrafted into the mammary fat pad region of immunodeficient mice [24]. [score:3]
The miR-200 cluster is an extensively studied tumor-suppressive miRNA cluster in the genome (Figure 1). [score:3]
miR-200c also suppresses the ability of normal mammary stem cells to form mammary ducts when engrafted into the mammary fat pad of the syngeneic mice. [score:3]
miR-22 targets the ten-eleven-translocation (TET) family of methylcytosine dioxygenases and demethylates the promoter region of the miR-200 precursor [161]. [score:3]
Figure 3 Targeting of the genes and pathways for stem cell maintenance by miR-200 family miRNAs. [score:3]
Kolesnikoff N. Attema J. L. Roslan S. Bert A. G. Schwarz Q. P. Gregory P. A. Goodall G. J. Specificity protein 1 (Sp1) maintains basal epithelial expression of the miR-200 family: Implications for epithelial-mesenchymal transition J. Biol. [score:3]
The promoter regions of the miR-200 family are bound by multiple transcription factors, including zinc finger E-box binding homeobox 1 (ZEB1) and 2 (ZEB2, also known as SIP1), specificity protein 1 (Sp1), Smad3, Wnt inhibitory factor 1 (WIF1) and p53. [score:3]
The modifications to the promoter regions of each of the miR-200 clusters cause the loss of the expression of the miR-200 family miRNAs in cancer. [score:3]
Therefore, the interplay between the miR-200 family, miR-22, and ZEB1/ZEB2 plays an important role in the stemness regulation and EMT. [score:2]
Brabletz S. Brabletz T. The ZEB/miR-200 feedback loop—A motor of cellular plasticity in development and cancer? [score:2]
Wang G. Guo X. Hong W. Liu Q. Wei T. Lu C. Gao L. Ye D. Zhou Y. Chen J. Critical regulation of miR-200/ZEB2 pathway in Oct4/Sox2 -induced mesenchymal-to-epithelial transition and induced pluripotent stem cell generation Proc. [score:2]
The miR-200 family miRNAs have been highly conserved in deuterostome from Echinodermata and Chordata to all Vertebrata classes, including fish, amphibians, reptiles, birds and mammals [55]. [score:1]
Interestingly, the cooperation between miR-22 and the miR-200 family results in EMT, an elevated pool of stem cells and increased tumorigenesis. [score:1]
Le M. T. Hamar P. Guo C. Basar E. Perdigao-Henriques R. Balaj L. Lieberman J. miR-200-containing extracellular vesicles promote breast cancer cell metastasis J. Clin. [score:1]
The miR-200 family in mammals is composed of five miRNAs: miR-200a, miR-200b, miR-200c, miR-141, and miR-429. [score:1]
3.1. miR-200 Clusters. [score:1]
Among them, miR-200a, miR-200b and miR-429 are found in all deuterostomes including Echinodermata, Chordata and Vertebrata, but miR-200c and miR-141 are only detected in cephalochordates, teleosts and mammals or in tunicates, teleosts and mammals, respectively. [score:1]
The miR-200 family members can also be divided into two subgroups based upon their seed sequences that differ by only 1 nt between the subgroups: miR-200b, -200c, and -429 (AA UACUG) and miR-200a and -141 (AA CACUG). [score:1]
Thus, ZEB1 and ZEB2 keep a cell in a mesenchymal phenotype by repressing the transcription of both E-cadherin and the miR-200 family miRNAs. [score:1]
Burk U. Schubert J. Wellner U. Schmalhofer O. Vincan E. Spaderna S. Brabletz T. A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells EMBO Rep. [score:1]
Furthermore, the metastatic mouse mammary tumor 4T1 cells, but not the poorly metastatic mammary tumor 4TO7 cells, can secrete miR-200 family miRNAs into exosomes [190]. [score:1]
In addition, miR-200 family miRNAs are involved in colonization and metastases to distant organs [195]. [score:1]
Mongroo P. S. Rustgi A. K. The role of the miR-200 family in epithelial-mesenchymal transition Cancer Biol. [score:1]
Lim Y. Y. Wright J. A. Attema J. L. Gregory P. A. Bert A. G. Smith E. Thomas D. Lopez A. F. Drew P. A. Khew-Goodall Y. Epigenetic modulation of the miR-200 family is associated with transition to a breast cancer stem-cell-like state J. Cell Sci. [score:1]
Trumbach D. Prakash N. The conserved miR-8/miR-200 microRNA family and their role in invertebrate and vertebrate neurogenesis Cell Tissue Res. [score:1]
Furthermore, miR-200 family members belonging to either seed sequence subgroup do not show a clear phylogenetic relationship, suggesting that the 1 nt difference between the two subgroups arose independently in different lineages [56]. [score:1]
The roles of miR-200 family miRNAs in breast CSCs are described in more detail later in Section 4. The miR-183 cluster, which is comprised of miRNA-183, -96 and -182, is a miRNA family with sequence homology (Figure 1). [score:1]
The poorly metastatic 4TO7 cells can take up miR-200 from the exosomes of 4T1 cells and become metastatic in a miR-200 -dependent manner. [score:1]
[1 to 20 of 54 sentences]
19
[+] score: 185
Interestingly, we showed a downregulation of hsa-miR-200c-3p in active UC and of hsa-miR-196b-5p in both active and inactive UC mucosa compared to controls, while expression of both miRNAs is upregulated in inflammatory controls. [score:8]
Here, we could confirm the upregulation of hsa-let-7i-5p, hsa-miR-21-5p, hsa-miR-146a-5p and hsa-miR-155-5p, and the downregulation of hsa-miR-196b-5p, hsa-miR-200a-5p, hsa-miR-200a-3p, hsa-miR-200c and hsa-miR-378a-3p. [score:7]
Correlation analysis between miRNA and the predicted target mRNA expression levels showed that 4 of the top 10 most significantly inversely correlated miRNA target mRNA pairs belong to hsa-miR-200c-3p. [score:7]
We confirmed the significant downregulation of hsa-miR-200c-3p and significant upregulation of IL8 and CDH11 in active UC vs. [score:7]
Interestingly, it has been shown that IL8 expression is indirectly regulated by hsa-miR-200c-3p by targeting IKBKB [54]. [score:7]
This indicates that endogenous hsa-miR-200c-3p can target the 3′UTR of CDH11 and hereby regulating its expression. [score:6]
To verify that hsa-miR-200c-3p directly targets the 3′UTR of IL8 and CDH11, we co -transfected the luciferase vectors with a 10 nM of anti-miR-200c-3p or a negative control inhibitor in HT-29 cells. [score:6]
The miR-200c-3p inhibitor restored the relative luciferase activity of pGL3_IL8_WT and pGL3_CDH11_WT with 10% and 30% respectively (p<0.01), indicating the binding of hsa-miR-200c-3p to the target 3′UTRs. [score:5]
The miRNA microarray expression data was confirmed by performing qRT-PCR for hsa-miR-200c-3p and 10 other differentially expressed miRNAs selected because of their highly significant p-value or fold change (hsa-miR-21-5p, hsa-miR-31-5p, hsa-miR-146a-5p, hsa-miR-155-5p, hsa-miR-196b-5p, hsa-miR-196b-3p, hsa-miR-200b-3p, hsa-miR-375, hsa-miR-422a and hsa-miR-650). [score:5]
Scatter plot of expression levels of hsa-miR-200c-3p and its predicted target genes. [score:5]
However, 2 miRNAs (hsa-miR-196b-5p and hsa-miR-200c-3p) with decreased expression in active UC were significantly upregulated in IC compared to both active UC and controls. [score:5]
Integrated analysis of miRNA and gene expression profiles revealed potential targets, such as hsa-miR-200c-3p, for use of miRNA mimics as therapeutics. [score:5]
In this study, we demonstrated that in UC hsa-miR-200c-3p also directly regulates IL8 expression. [score:5]
Endogenous miRNAs, excluding hsa-miR-200c-3p, can suppress the luciferase activity by targeting the 3′UTR of IL8 at different binding sites. [score:5]
To test whether this is true in HT-29 cells, varying concentrations of a synthetic specific miRNA inhibitor (anti-miR-200c-3p) and negative control inhibitor were transfected into the cells (Fig. 7C ). [score:5]
Further studies demonstrated that hsa-miR-200c-3p directly regulates IL8 and CDH11 expression. [score:5]
We could demonstrate that hsa-miR-200c-3p directly regulates IL8 and CDH11 expression. [score:5]
0116117.g005 Figure 5 Boxplots of the expression level of hsa-miR-200c-3p and 9 other significantly differentially expressed miRNAs in controls (n = 10), active UC (n = 10), inactive UC (n = 7), active CDc (n = 5) and IC (n = 5) patients, as assessed by qRT-PCR (line, average; *p<0.05; ** p<0.01; *** p<0.001). [score:5]
0116117.g004 Figure 4Correlation between hsa-miR-200c-3p expression values and IL8 (A) and CDH11 (B) expression values, with their respective Spearman correlation coefficient. [score:5]
Correlation analysis suggested a highly significant negative correlation between expression levels of hsa-miR-200c-3p and its potential target mRNAs of interest: IL8 and CDH11. [score:5]
Boxplots of the expression level of hsa-miR-200c-3p and 9 other significantly differentially expressed miRNAs in controls (n = 10), active UC (n = 10), inactive UC (n = 7), active CDc (n = 5) and IC (n = 5) patients, as assessed by qRT-PCR (line, average; *p<0.05; ** p<0.01; *** p<0.001). [score:5]
Using an integrated analysis of miRNA and mRNA expression in breast cancer, Luo et al. recently identified CDH11 as a target gene of hsa-miR-200c-3p [59]. [score:5]
Various concentrations (5, 10 or 20 nM) of hsa-miR-200c-3p LNA Power Inhibitor (anti-miR-200c-3p) or negative control LNA Power Inhibitor (Exiqon) were transfected after 24 hours using Lipofectamine 3000 (Invitrogen) and the transfected cells were incubated for 48 hours. [score:5]
To determine whether these mRNAs are targeted by endogenous miRNAs, we transfected HT-29 cells with luciferase reporter vectors containing the WT 3′UTR (pGL3_IL8_WT and pGL3_CDH11_WT with putative binding site for hsa-miR-200c-3p) or luciferase vector containing mutant 3′UTR (pGL3_IL8_mut and pGL3_CDH11_mut with mutations at the binding site) (Fig. 7A ). [score:4]
These results indicate that IL8 and CDH11 are directly targeted by hsa-miR-200c-3p. [score:4]
Compared to transfection with the negative control, miRNA expression of hsa-miR-200b-3p and hsa-miR-429 significantly increased (FC = 1.9 and 2.3, respectively) in the cells transfected with 5 nM of anti-miR-200c-3p, while expression significantly decreased (FC = -2.2 and -1.9, respectively) after transfection with 20 nM. [score:4]
Downregulation of CDH11 could serve as an interesting therapeutic goal in UC, potentially by the use of a mimic of hsa-miR-200c-3p. [score:4]
However, expression of both miR-200c family members was not significantly affected after transfection with 10 nM anti-miR-200c-3p (Fig. 7C ). [score:3]
Four of the top 10 most significantly inversely correlated miRNAtarget mRNA pairs are related to one specific miRNA, hsa-miR-200c-3p (Table 2 ). [score:3]
Regulation of IL8 and CDH11 expression by hsa-miR-200c-3p was determined by luciferase reporter assays. [score:3]
0116117.g007 Figure 7Luciferase reporter assay showing that hsa-miR-200c-3p regulates IL8 and CDH11 expression in HT-29 cells. [score:3]
Mutations in the hsa-miR-200c-3p seed regions of the IL8 and CDH11 3′UTRs were generated using the QuikChange II Site-Directed Mutagenesis kit (Agilent), according to the manufacturer's instructions with one modification: LA Taq DNA polymerase (TaKaRa, Kyoto, Japan) was used instead of PfuUltra DNA polymerase. [score:3]
In the present study, we demonstrated that CDH11 is also targeted by hsa-miR-200c-3p in colonic epithelial cells. [score:3]
Expression of hsa-miR-200b-3p and hsa-miR-429 (both having the same seed sequence as hsa-miR-200c-3p) was assessed. [score:3]
Luciferase reporter assay showing that hsa-miR-200c-3p regulates IL8 and CDH11 expression in HT-29 cells. [score:3]
This result is consistent with previous localization studies in normal and UC mucosa, where it has been shown that hsa-miR-200c-3p and IL8 are expressed in colonic epithelial cells [49], [57]. [score:3]
Hsa-miR-200c-3p is known to be involved in innate immunity by regulating the efficiency of TLR4 signaling through the MyD88 -dependent pathway [47]. [score:2]
5. Regulation of IL8 and CDH11 by hsa-miR-200c-3p in colonic epithelial cells. [score:2]
Additionally, members of the miR-200 family are involved in the epithelial to mesenchymal transition (EMT) by regulating the E-cadherin transcriptional repressors ZEB1 and SIP1 both in cancer [48], [49]and in IBD [50]. [score:2]
controls and found a highly significant inverse correlation between hsa-miR-200c-3p and IL8, an inflammatory marker, and between hsa-miR-200c-3p and CDH11, a gene related to intestinal epithelial barrier function. [score:1]
In a second series of experiments, HT-29 cells were co -transfected with luciferase vectors (original luciferase vector, luciferase vector containing WT 3′UTR, or luciferase vector containing mutant 3′UTR), 10 nM of either anti-miR-200c-3p or negative control, and pCMV-β-gal as internal control, using Lipofectamine 3000 (Invitrogen). [score:1]
Therefore, hsa-miR-200c-3p and/or hsa-miR-196b-5p show promise as a diagnostic biomarker of UC, although further verification is needed. [score:1]
Potentially, treatment with a synthetic mimic of miR-200c-3p in IBD could decrease inflammation by counteracting the inflammatory action of IL8, or by down-modulating the NF-κB response after TLR4 ligation. [score:1]
Total RNA, including miRNA, was isolated from the cells (see paragraph ‘miRNA isolation’) and stored at -80°C for qRT-PCR analysis of miR-200 family members hsa-miR-200b-3p and hsa-miR-429. [score:1]
profiles revealed hsa-miR-200c-3p for use of miRNA mimics as therapeutics. [score:1]
Hsa-miR-200c-3p is part of the miR-200 family, where it shares the same seed sequence with hsa-miR-200b-3p and hsa-miR-429. [score:1]
Luciferase activity of mutant vectors was not significantly different after transfection with anti-miR-200c-3p or negative control (Fig. 7D ). [score:1]
[1 to 20 of 47 sentences]
20
[+] score: 168
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-141, hsa-mir-200a, hsa-mir-429
Across a diverse range of epithelial-derived cancer cell types, high miR-200c expression can enforce an epithelial state by repressing the expression of E-cadherin transcriptional repressors ZEB1 and ZEB2, whereas inhibited expression of miR-200c in mesenchymal cancer cells leads to upregulation of ZEBs and induces downregulation of E-cadherin. [score:15]
However, while miR-200 is downregulated in some cancers, upregulation of miR-200c has been found in multiple tumors indicating that miR-200c may also exhibit oncogenic potential, likely due to miR-200c overexpression increasing metastatic risk by the induction of MET. [score:9]
Given the suppressive effect of miR-200c on EMT, tumors with upregulation of miR-200c have decreased the potential of invasion and metastasis by inhibiting EMT, ultimately leading to a favorable prognosis of cancer. [score:8]
With the increasing of tumor invasiveness, during the process of tumor metastasis, the positive prognostic role of upregulation of miR-200c in tissue may become less or even inexistent in advanced tumors and the negative prognostic value of high expression of circulating miR-200c may begin to raise in metastatic tumors. [score:6]
For this meta-analysis, the results indicated that high expression of miR-200c in circulation and low expression of miR-200c in tumor tissue were associated with worse survival in solid tumors. [score:5]
We analyzed tumor progression associated with high miR-200c expression by combining disease recurrence and metastasis. [score:5]
Included studies in this meta-analysis referred to evaluating miR-200c and miR-141 expression for overall survival (OS), disease-free survival (DFS), progression-free survival (PFS), and disease-specific survival (DSS). [score:5]
In one of the included studies, Yuji Toiyama researched miR-200c expression in both serum and tissue and found that the matched metastases had higher expression level of miR-200c than the primary tumor. [score:5]
The miR-200c have been indicated to regulate epithelial-to-mesenchymal transition (EMT) through the reciprocal miR-200-ZEB feedback loop, and the impaired expression of miR-200c induces EMT and promotes invasion and metastasis in various human tumors [14– 18]. [score:4]
MiR-200c was suitable to predict tumor progression especially in Asians and urogenital system cancers and there was no direct correlation between peripheral blood and matched tissue miR-200c expression. [score:4]
This may suggest that there was no direct correlation between circulating and matched tissue miR-200c expression. [score:4]
A total of 536 studies were identified after searching in PubMed, Embase, and Web of Science for publications on miR-200c and miR-141 expression associated with cancer prognosis. [score:3]
Overall Survival (OS) Associated with miR-200c Expression. [score:3]
Hence, the prognostic relevance of miR-200c and miR-141 expression in cancer remains controversial. [score:3]
The expression levels of miR-200c and miR-141 were dichotomized in all these 23 studies, but the cut-off value was different, with median, mean, and defined level. [score:3]
Results indicated that high miR-200c expression was not a significant prognostic predictor for OS in both Asians and Caucasian populations. [score:3]
Numerous researches have indicated that in different cancers the functional roles of miR-200 family members changed frequently, either as an oncogenic or as a tumor suppressive factor. [score:3]
Therefore, in this study, we performed a comprehensive meta-analysis to clarify the prognostic value of miR-200c and miR-141 expression in human cancers. [score:3]
In the light of this finding, the expression of miRNAs in circulation and cancerous tissues cannot maintain consistency under some circumstance, which may be attributed to the hypothesis that the impact of miR-200c on the prognosis of cancer may be a process of dynamic change in tumorigenesis and tumor progression. [score:3]
The miRNA-200 family consisting of five highly homologous members (miR-200a, miR-200b, miR-200c, miR-429, and miR-141) can be separated into two gene clusters based on the fact that they are expressed from two distinct polycistronic transcripts; the miR-200b/a/429 cluster is located on chromosome 1p36, and the miR-200c/141 cluster is located on chromosome 12p13 [14, 15]. [score:3]
Accordingly, we speculate that low expression of miR-200c in tumor tissue may be related to a worse prognosis mainly in early stage of cancer. [score:3]
The expression of miR-200c and miR-141 was measured in collected cancerous tissues in the majority of studies except seven targeted in circulation samples [23– 25, 27, 29, 37, 39], including one researched in cancerous tissues and blood samples meanwhile [29]. [score:3]
By stratified analyses of enrolled studies associated with miR-200c expression, we successfully drew some valuable conclusions. [score:3]
The survival outcome of cancer associated with miR-200c or miR-141 expression was estimated by using the hazard ratio (HR) and their associated 95% confidence intervals (95% CI) for each study. [score:3]
Surprisingly but familiar to the results of previous meta-analysis by Wang et al. [55], our result demonstrated that elevated miR-200c expression can predict a significantly worse DFS/PFS in serum/plasma samples but a significantly favorable DFS/PFS in cancerous tissues. [score:3]
This study also supports that circulating miR-200c in blood may be the origin of metastasis and overexpression of circulating miR-200c can be a valuable prognostic biomarker for advanced tumors. [score:3]
Presumably, the expression of miR-200 family members may differ depending on the cellular contexts [31]. [score:3]
However, the pooled outcome in tissue subgroup surprisingly showed that high miR-200c expression was significantly associated with a favorable DFS/PFS (HR = 0.56; 95% CI: 0.43–0.73; P = 0.000) by a fixed-effects mo del (I [2] = 0.0%, P = 0.454) (Figure 3(b)). [score:3]
Interestingly, analyses revealed that high miR-200c expression was a significant favorable prediction for tumor progression in Asians, but not in Caucasians. [score:3]
In summary, we concluded that miR-200c and miR-141 expression in peripheral blood may be effective predictors for monitoring cancer progression and prognosis in the future. [score:3]
Tumor Progression (DFS/PFS) Associated with miR-200c Expression. [score:3]
Additionally, miR-200c plays a crucial role in regulating stem cell self-renewal and differentiation. [score:2]
The miR-200 family has emerged recently as a significant marker, as well as a pivotal regulator of the epithelial-to-mesenchymal transition (EMT) in a variety of cancers [14, 16– 18]. [score:2]
Quantitative real-time polymerase chain reaction (qRT-PCR) assay was wi dely applied to detect the expression level of miR-200c and miR-141 except two studies which used in situ hybridization (ISH) [30, 38]. [score:2]
Similarly, the result (random-effects mo del: pooled HR = 1.20; 95% CI: 0.69–2.07; P = 0.515) showed that the association between high level of miR-200c and poor OS was not significant in Asians (Figure 2(c)). [score:1]
These results indicated that the pooled HRs of overall analyses are too crude to present accurate prognostic values of miR-200c and miR-141. [score:1]
If more than one miR-200 family member or cancer type was reported in one study, each was extracted separately. [score:1]
It has been documented that the capacity of circulating miR-200c and miR-141 indicated the CTCs status, as well as its potential surrogate markers for CTCs and prognostic markers in patients with metastatic breast cancer [57]. [score:1]
However, consensus has not been reached to the reliability of miR-200c and miR-141 as prognostic biomarkers in tumors [19– 21]. [score:1]
When stratified by dominant ethnicity, no significant association was observed in Caucasians (pooled HR = 0.63; 95% CI: 0.23–1.74; P = 0.370) by a random-effects mo del (I [2] = 79.9%, P = 0.002), but high level of miR-200c significantly associated with favorable DFS/PFS (pooled HR = 0.65; 95% CI: 0.49–0.86; P = 0.002) in Asians by fixed-effects mo del (I [2] = 33.9%, P = 0.220) (Figure 3(c)). [score:1]
In the subgroup analysis of sample source, no significant association between the high level of miR-200c in tissue and overall survival was found (pooled HR = 0.89; 95% CI: 0.58–1.37; P = 0.599) by a random-effects mo del (I [2] = 73.5%, P = 0.000). [score:1]
Therefore, circulating miR-200c was conjectured to be the origin of metastatic site. [score:1]
Substantial heterogeneity was discovered in tissue subgroup for miR-200c (OS as endpoint, I [2] = 73.5%), as well as tissue subgroup for miR-141 (OS as endpoint, I [2] = 44.7%). [score:1]
This can be explained by the hypothesis that miRNA-200c in circulation may be a mirror of circulating tumor cells (CTCs). [score:1]
The result showed that high level of miR-200c may predict poorer OS, with the pooled HR being 1.14 (95% CI: 0.77–1.69). [score:1]
In subgroup analysis stratified by detected samples, high level of miR-200c in serum/plasma exhibited a significant association with poor DFS/PFS (HR = 1.90; 95% CI: 1.08–3.36; P = 0.027) and no heterogeneity was observed (I [2] = 0.0%, P = 0.500). [score:1]
The role of miR-200c and miR-141 has been studied extensively in various cancers, but the conclusions are inconsistent. [score:1]
In this meta-analysis, heterogeneity was observed in total comparison for overall survival on miR-200c and miR-141, as well as overall comparison for tumor progression on miR-200c. [score:1]
Finally, the results revealed that high level of miR-200c significantly associated with favorable DFS/PFS in respiratory system cancers (HR = 0.61; 95% CI: 0.42–0.89; P = 0.010) and urogenital system cancers (pooled HR = 0.32; 95% CI: 0.16–0.66; P = 0.002) by a fixed-effects mo del (I [2] = 0.0%, P = 0.340). [score:1]
The results of sensitivity analyses for miR-200c with OS as the endpoint (Figure 7(a)) and DFS/PFS as the endpoint (Figure 7(b)) demonstrated that the pooled HRs were not significantly altered by removing every single study in sequence. [score:1]
MiR-200c-141 genomic cluster, which located on chromosome 12p12.31, is the member of miR-200 family. [score:1]
We found that high level of miR-200c was significantly related to a poor OS in serum/plasma subgroup, but no statistical significance was defined in tissue subgroup for OS. [score:1]
The main features of these 23 studies were summarized in Table 1 for miR-200c and Table 2 for miR-141. [score:1]
Particularly, hints to the specific settings for application of miR-200c as a prognostic biomarker might be missed because analyses of eligible studies were performed only according to sample types in this meta-analysis. [score:1]
A random-effects mo del was applied and no obvious relationship between high level of miR-200c and DFS/PFS was shown (pooled HR = 0.72; 95% CI: 0.45–1.14; P = 0.161) (Figure 3(a)). [score:1]
The following three sets of key words and their combination search terms were simultaneously applied, namely, “miR-200c OR miR-141,” “cancer OR carcinoma OR tumor OR malignant neoplasm,” and “survival OR prognosis OR outcome. [score:1]
In the light of this, the prognostic value of miR-200c may vary in different cancers. [score:1]
Recent studies have revealed that the miR-200 family members exert important effects at distinct stages in tumor cell invasion and metastasis. [score:1]
In terms of this, we conducted the first comprehensive meta-analysis including 23 articles and showed that evaluated miR-200c expression cannot predict poor survival, local recurrence, and metastasis in patients with cancer. [score:1]
The prognostic role of miR-200c may differ in distinct progression stages of tumor. [score:1]
As the first meta-analysis [55] of miR-200c related to outcomes of various cancers, Wang et al. retrieved 5 studies and found that lower level of miR-200c in tumor tissue and higher level of miR-200c in serum might be associated with worse overall survival in solid tumors. [score:1]
However, significant effect was observed between the high level of miR-200c in serum/plasma and poorer OS (pooled HR = 2.12; 95% CI = 1.62–2.77; P = 0.000) by a fixed-effects mo del (I [2] = 0.0%, P = 0.932) (Figure 2(b)). [score:1]
Second, the enrolled studies associated with miR-200c were subgrouped into Asians and Caucasians according to ethnic affiliation in order to clarify the impact caused by the different genetic backgrounds on the results. [score:1]
First, in order to clarify the prognostic values of miR-200c in different source of samples, we classified the enrolled studies into subgroups of tissue samples and serum/plasma samples. [score:1]
However, there was still significant heterogeneity among Asians in some subgroup analyses (OS for miR-200c: I [2] = 85.1%; OS for miR-141: I [2] = 84.9%). [score:1]
The heterogeneity was partly decreased in Caucasians in some subgroup analyses (OS for miR-200c: I [2] = 70.7%; OS for miR-141: I [2] = 61.5%). [score:1]
[1 to 20 of 66 sentences]
21
[+] score: 167
Our previous data show that miR-200c is highly induced by ischemia and its inhibition is able to increase limb perfusion, reverting the downregulation of its targets responsible of apoptosis, senescence, ROS increase, and nitric oxide (NO) decrease [10]. [score:8]
Our results showed that miR-200c inhibits myogenic differentiation when forced miR-200c overexpression was performed in myoblasts; moreover, when miR-200c is overexpressed in differentiated myotubes, a decrease in myotube number and size was also observed. [score:7]
In keeping, the present study demonstrates that miR-200c that we previously showed to be upregulated upon ischemia [9, 10] is associated with myotube loss and is upregulated in mdx and DMD. [score:7]
Therefore, we showed that miR-200c upregulation decreases NO, increases ROS production, and induces p66Shc protein phosphorylation in Ser-36; this, in turn, induces ROS via different mechanisms, one of which is the inhibition of FOXO1 transcription of ROS scavengers, reinforcing this molecular circuitry [10]. [score:6]
miR-200c upregulation might contribute to the establishment of the negative consequences associated with this muscle disease, such as muscle wasting, lack of muscle regeneration, necrosis, NO decrease, and oxidative stress increase. [score:6]
We demonstrated that miR-200c is the most upregulated family member and is responsible for apoptosis and senescence by targeting zinc finger E-box -binding homeobox 1 (ZEB1) protein [9]. [score:6]
p66Shc phosphorylation in Ser-36 is increased in mdx muscles, and miR-200c expression levels are upregulated both in mdx muscles and in differentiated human myoblasts of DMD. [score:6]
In a recent publication, we demonstrated that miR-200c increased ROS production and induced p66Shc protein phosphorylation in Ser-36; this mechanism upregulated ROS and inhibited FOXO1 transcription of ROS scavengers, reinforcing this molecular circuitry [10]. [score:6]
We then analyzed myogenic differentiation by Western blot, and we observed that ZEB1, MyHC, myogenin, and MyoD proteins were all downregulated upon miR-200c overexpression (Figure 2(d)). [score:6]
We then analyzed myogenic differentiation by Western blot analysis, and we observed that ZEB1, MyHC, and myogenin proteins were all downregulated upon miR-200c overexpression, whereas MyoD was not affected (Figure 1(c)). [score:6]
3.1. miR-200c Overexpression Inhibits Myogenic Differentiation. [score:5]
The results of the present work show that miR-200c impairs muscle differentiation, whereas miR-200c inhibition ameliorates differentiation; moreover, both miR-200c expression levels and p66Shc phosphorylation in Ser-36 increase in mdx mice. [score:5]
Our recent report demonstrated that miR-200c targets directly SIRT1 and also two important proteins that modulate NO production and ROS scavenger transcription, that is, endothelial nitric oxide synthase (eNOS) and FOXO1. [score:4]
Interestingly, in adductor muscles of mdx, a miR-200c upregulation was found in a miRNA screening, although not significantly [13]. [score:4]
We previously showed that the miR-200 family is upregulated upon oxidative stress in different cells, such as endothelial cells, human fibroblasts, murine myoblasts, and myotubes [9]. [score:4]
Indeed, Greco et al. found that in adductor muscles of mdx, a miR-200c upregulation was present, although not significant [13]. [score:4]
3.2. miR-200c Inhibition Enhances Myogenic Differentiation. [score:3]
Moreover, a decrease in differentiation index, fusion index, and number of nuclei within myotubes was also observed in differentiated miR-200c -overexpressing cells (Figure 2(c)). [score:3]
Moreover, in C2C12 -overexpressing miR-200c, p66 wt was phosphorylated also in basal conditions, that is, without H [2]O [2], and the phosphorylation in Ser-36 increased even further upon H [2]O [2] treatment (Figures 4(a) and 4(b)). [score:3]
Herein, we wanted to dissect the role of miR-200c in muscle differentiation and to comprehend whether miR-200c levels were modulated in muscle pathological diseases associated with oxidative stress increase, such as Duchenne muscular dystrophy (DMD) [11, 12]. [score:3]
miR-200c levels were normalized to U6 small RNA expression as previously reported [24, 25]. [score:3]
To this aim, we overexpressed miR-200c in C2C12 myoblasts; then, we shifted the cells to differentiation medium (DM). [score:3]
As shown in phase contrast images of Figure 2(a), we started from cells with a similar degree of differentiation prior to infection (upper panels); we found that miR-200c overexpression decreased the myotube number (Figure 2(a) lower panels), assessed also by MyHC immunofluorescence staining (Figure 2(b)). [score:3]
All these results suggested a role for miR-200c in myogenic differentiation inhibition and in myotube loss. [score:3]
Stable expression of miR-200c, anti-miR-200c, or miR-scramble in C2C12 cells was generated by viral infection using lentiviral supernatants. [score:3]
Although further experiments should be accomplished in order to point to miR-200c as a therapeutic target, these data strongly suggest its possible involvement in muscle wasting in DMD, through apoptosis and senescence induction, as well as, by the induction of ROS and the decrease of NO. [score:3]
Moreover, we showed that anti-miR-200c treatment in hind limb ischemia in mice rescued the decrease of miR-200c protein targets and improved limb perfusion [10]. [score:3]
In summary, cells were infected with lentiviral virus for 2 h and then were recovered in complete fresh medium for 24 h. Afterwards, infected cells were selected by puromycin-containing medium (Sigma) for 72 h. miR-200c overexpression was controlled by quantitative real-time PCR (RT-qPCR) (see methods below). [score:3]
We found that miR-200c inhibited myotube formation as assessed by MyHC immunofluorescence staining (Figure 1(a)). [score:3]
miR-200c overexpression was also performed in C2C12 after 24 hrs of myogenic differentiation. [score:3]
We analyzed miR-200c expression levels in different muscles, that is, quadriceps (Q), gastrocnemius (GA), tibialis anterior (TA), extensor digitorum longus (EDL), and soleus (SOL), in both young (4-week-old mice (4 w)) and older mice (36-week-old mice (36 w)) (Figures 5(a) and 5(b)). [score:3]
We analyzed myogenic differentiation by Western blot, and we found that MyHC, myogenin, and MyoD proteins were increased at 48 h and 72 h of DM upon anti-miR-200c expression at higher levels compared to anti-scramble -treated C2C12 (Figure 3(c)). [score:2]
We found that miR-200c was significantly higher in mdx mice compared to wt, in all muscle groups examined, both in young and older mice (Figures 5(a) and 5(b)); indeed, in Q of young (~6-fold) and in GA of older mice (~12-fold), we found a very high increase of miR-200c expression (Figures 5(a) and 5(b)). [score:2]
An increase of miR-200c expression was also found in human myoblasts derived from muscle biopsies of DMD patients cultured in muscle differentiation medium, compared to human-differentiated myoblasts derived from muscle biopsies of healthy donors (Figure 5(c)). [score:2]
As shown in Figure 4c, we found an increase in Ser-36 phosphorylation in the immunoprecipitates of p66 in miR-200c -overexpressing C2C12 compared to scramble control (Figures 4(c) and 4(d)). [score:2]
This miRNA family consists of five members (miR-200c, miR-141, miR-200a, miR-200b, and miR-429). [score:1]
We therefore asked whether miR-200c phosphorylated p66Shc in this residue, also in C2C12 myoblasts. [score:1]
We then asked whether anti-miR-200c treatment was able to ameliorate myogenic differentiation. [score:1]
We previously found that miR-200c induces oxidative stress and p66Shc phosphorylation in Ser-36 in endothelial cells [10]. [score:1]
Moreover, miR-200c increases also in differentiated human myoblasts of DMD. [score:1]
Taken together, these results suggest a pivotal role of miR-200c in oxidative stress induction in DMD via a p66Shc -dependent mechanism. [score:1]
3.3. miR-200c Increased p66Shc Phosphorylation in Ser-36 in C2C12 Myoblasts. [score:1]
We also demonstrated that miR-200c is induced following acute hind limb ischemia in skeletal muscles and this induction was oxidative stress dependent, since in p66Shc [−/−] mice, which exhibit less oxidative stress than wild-type (wt) mice [1], miR-200c increase is significantly attenuated [9]. [score:1]
Taken together, these results indicate that miR-200c enhances p66Shc phosphorylation in Ser-36 as well as in C2C12 myoblasts, supporting its role in oxidative stress production [10]. [score:1]
Further, we aimed at establishing whether endogenous p66 was phosphorylated in Ser-36 by miR-200c. [score:1]
These results suggest a role for miR-200c in oxidative stress increase in mdx mice, mediated, at least in part, by p66Shc -dependent mechanism. [score:1]
Therefore, we transduced C2C12 cells with anti-miR-200c lentiviral particles and we shifted cells to DM for increasing period of times. [score:1]
To this aim, we transduced C2C12 with miR-200c and scramble control and then transfected the cells with a p66Shc wt cells or a mutated p66 (p66mut) plasmid in which Ser-36 was replaced with Ala, that is not phosphorylable. [score:1]
1-miR-200c and plko. [score:1]
In this report, we dissected the role of the oxidative stress -induced miR-200c on muscle differentiation, since our and other laboratories reported a decrease in myogenic differentiation upon oxidative stress in vitro [1, 27– 29]. [score:1]
Therefore, we asked whether miR-200c modulation had an effect on myogenic differentiation. [score:1]
We found that anti-miR-200c increased myotube formation as assessed by MyHC immunofluorescence staining (Figure 3(a)). [score:1]
We also demonstrated that miR-200c is highly induced upon H [2]O [2] treatment in C2C12 in both myoblasts and differentiated myotubes [9]. [score:1]
Notably, p66 phosphorylation in Ser-36 was increased in older mice also in basal conditions and was even higher in Q and particularly in GA, showing that older mice displayed higher miR-200c (Figure 5(d)). [score:1]
We previously showed that, in endothelial cells, miR-200c induces p66Shc phosphorylation in Ser-36, a phosphorylation known to be elicited by oxidative stress [10]. [score:1]
1-anti-miR-200c constructs were described previously [9, 10]. [score:1]
In keeping, anti-miR-200c treatment in growing myoblasts accelerates myogenic differentiation, increasing myotube numbers and size. [score:1]
Therefore, we hypothesized a miR-200c role in muscle wasting and myotube loss via a p66Shc -dependent mechanism in DMD. [score:1]
3.4. miR-200c and p66Shc Phosphorylation in Ser-36 Increase in Skeletal Muscles of mdx Mice. [score:1]
[1 to 20 of 59 sentences]
22
[+] score: 164
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Some of the miR-9 and miR-200-class targets upregulated in the mutant OE (Qk, Foxf2) are mesenchymally-expressed rather than OE-expressed, while other targets were actually downregulated in the absence of Dlx5 (Akap6, Elmod1, Snap25) (Table 1C). [score:15]
To determine whether the forced expression of DLX5 may result in an upregulation of miR-9 and miR-200-class RNAs, SH-SY5Y cells were transfected with myc-tagged wild-type DLX5 or Q178P mutant DLX5 expression vectors, and the relative abundance of miR-9 and miR-200 was quantified by Real-Time qPCR. [score:8]
In summary, since miR-9 and miR-200-class are down-modulated in the absence of Dlx5, while Foxg1 protein level is up-regulated, and since the 3′ UTR of the Foxg1 mRNA is a predicted target of these miRs, we can infer that the Dlx5-miR-Foxg1 regulation is most likely a direct one. [score:8]
Two possible explanations: either changes in the abundance of miR-9 and miR-200-class cause changes in the abundance of target RNAs that are too modest to pass the imposed cut-off value, or these miRs preferentially affect translation and not stability of the target mRNAs. [score:7]
For chromatin immunoprecipitation (ChIP) we used the human SHSY-5Y neuroblastoma cells, which express low endogenous levels of Dlx5, miR-9 and miR-200, transfected with 5 μg of DLX5-myc-tag expression vector (from Open-Biosystem) or with the same vector in which the Q178P mutation (Shamseldin et al., 2012) was introduced (BioFab, Rome, sequence verified). [score:6]
A significant enrichment of miR-9 and miR-200-class target sequences was detected in the 3′ UTR of genes up-regulated in the Dlx5 [−/−] OE (Table 1A, B). [score:6]
myc-tagged version of either the WT or the Q178P mutant DLX5 were expressed in the SH-SY5Y human neuroblastoma cells, which express DLX5, miR-9 and miR-200 endogenously. [score:5]
We also show that Dlx5 promotes expression of miR-9 and miR-200 class, thereby tends to repress Foxg1 protein translation. [score:5]
•Dlx5 controls the expressions of miR9 and miR-200, which target the Foxg1 mRNA • miR-9 and -200 are needed for olfactory neurons differentiation and axon extension • miR-9 and -200 are required for the genesis and position of GnRH neurons. [score:5]
2.9To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
On the contrary, DLX5 overexpression did not induce changes in miR-200 expression, either in SH-SY5Y (Fig.  2d) or in GN11 (neuroendocrine) or in U2OS (osteosarcoma) cells (data not shown). [score:5]
Next we intersected the predicted miR-9 and miR-200-class targets with the coding mRNAs found to be differentially expressed in the Dlx5 [−/−] OE compared to the WT (Garaffo et al., 2013). [score:4]
To overexpress miR-9 and miR-200 exogenously we used commercially available Ambion pre-miR precursors (Life Technologies). [score:3]
miR-200a, miR-200b, miR-141 and miR-429 share the same seed sequence and likely target the same mRNAs; for this reason they are grouped in a single miR class (named miR-200-class). [score:3]
The 3′ UTR of tetrapod and zebrafish Foxg1 mRNAs hosts miR-9 and miR-200 target sequences. [score:3]
To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
3.7To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
Searching for functionally relevant targets of miR-9 and miR-200 clsss in the OE. [score:3]
Here we show that mouse and fish foxg1 mRNA is a target of miR-9 and miR-200 class, both of which are down-modulated in the Dlx5 null embryonic OE. [score:3]
We also show that miR-9 and miR-200-class target (amongst others) the foxg1 mRNA, through which they likely exert their functions. [score:3]
Instead, we could easily monitor the number and position of early GFP -expressing neurons, and noted that upon depletion of miR-200 class they appear reduced in number but normally clustered. [score:3]
To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
The results presented here indicate that loss of Dlx5 causes a down-modulation of miR-9 and of miR-200-class, which results in the over -expression of the Foxg1 protein. [score:3]
3.6To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
In the same cells, the expression of pre -miR-200 led to a 3.9-fold decrease in Foxg1 proteins level (Fig.  3c). [score:3]
The most abundant miRs expressed in the developing mouse OE are: the miR-200-class (- 200a, - 200b, - 200c, - 141 and - 429), miR-199, miR-152, miR-214, miR-205, miR-183, miR-182 and miR-96 (Choi et al., 2008). [score:3]
Examining olfactory development more thoroughly we now can implicate the miR-9 and miR-200-class networks in a more complex phenotype reminiscent of the Kallmann syndrome (see below). [score:2]
Another indication comes from a study in zebrafish, showing a role of miR-200-class for olfactory development (Choi et al., 2008). [score:2]
To determine whether miR-9 and miR-200-class may modulate Foxg1 protein level, the effect of introduction of pre-miR-9 or depletion of endogenous miR-9 on Foxg1 protein level was assayed by Western blot analysis in SH-SY5Y cells, which express DLX5, miR-9, miR-200-class and Foxg1 endogenously. [score:2]
Thus, both miR-9 and miR-200 negatively regulate Foxg1 protein level. [score:2]
Genomic regulation of miR-9 and miR-200 by Dlx5. [score:2]
miR-9 and miR-200-class regulate Foxg1. [score:2]
In this work we define the role of miR-9 and miR-200-class in the development of the olfactory system, with functions ranging from ORN differentiation to axon guidance, glomerulus formation and GnRH neuron migration. [score:2]
Starting from profile data obtained from a mouse mo del of Kallmann syndrome, we functionally examined this pathway in zebrafish showing that miR-9 and miR-200-class are required for normal differentiation of the ORNs, for the extension and connectivity of the olfactory axons, and for the migration of the GnRH neurons from the nasal primordium to the forebrain. [score:1]
It has also been shown that miR-200 represses neural induction of human embryonic stem cells, via modulation of Pax6 and Zeb transcription factors (Du et al., 2013). [score:1]
No Dlx5 binding site was predicted within a 50 kb range from the miR-9.1, miR-141, miR-200c and miR-376a loci. [score:1]
miR200a and miR200b could not be tested by in situ hybridization due to high sequence conservation between all members of the miR-200-class. [score:1]
To complement the previous (static) data with live images of the migrating GnRH3 neurons, we carried out few time-lapse video recordings on untreated (4) and z- miR-200-class MO injected (4) embryos at earlier ages (36–52 hpf), in order to observe the first appearance of these neurons. [score:1]
We depleted the miR-200 class in fish zygotes, by injecting a mix of anti -miR-200 MO previously described and found to efficiently down-modulate several miR of the class-200 and to affect ORN differentiation (Choi et al., 2008). [score:1]
We previously verified that the depletion of miR-9 and miR-200-class in zebrafish embryos leads to higher level of z-foxg1 mRNA (no Ab efficiently recognizes the z-foxg1 protein). [score:1]
The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
The abundance of z-hoxa-7a and z-hoxa-10b mRNAs did not greatly change, indicating that the differentiation delay observed upon depletion of miR-200-class is specific. [score:1]
Thus, our results provide the first evidence of the participation of miR-9 and miR-200-class in these early events. [score:1]
z-foxg1 mRNA level increased by three-folds when either miR-9 or miR-200-class were depleted (Figs.  5e and 6f). [score:1]
In control embryos, we counted an average of 13 (+/− 2) GnRH3::GFP + neurons/embryo at 72 hpf, while in miR-9 and miR-200 MO injected embryos the average number was, respectively, 5 (+/− 1) and 6 (+/− 1) (Suppl. [score:1]
3.4The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in altered GnRH neuron genesis and position. [score:1]
Previous results in which zebrafish embryos were injected with anti- miR-200 class MOs found a delayed ORN differentiation, but axonal organization and GnRH neuron migration was not assessed (Choi et al., 2008). [score:1]
com/request/, while the anti- z-miR-200 MO mix was as previously published (Choi et al., 2008). [score:1]
Similarly, the depletion of miR-200-class (N = 23) resulted in a reduced number of GFP + neurons in 22% of GFP + embryos with the phenotype “reduced number” and 50% of the cases showing the phenotype “scattered position” (Fig.  7). [score:1]
We used the same MOs indicated above to deplete miR-9 and miR-200 class in GnRH3::GFP zygotes, and examined the effect on the number and position of the GFP + neurons associated to the terminal nerves, between 36 and 72 hpf. [score:1]
In Danio rerio (zebrafish) the miR-200-class is required for the proliferation, differentiation and survival of ORNs (Choi et al., 2008). [score:1]
Upon injection of the anti-miR-200 MO mix, only about 24% of examined embryos turned out CFP + (vs. [score:1]
Using reporter zebrafish strains to visualize the embryonic olfactory axons (Miyasaka et al., 2005; Sato et al., 2005; Yoshida et al., 2002) or the GnRH + neurons (Abraham et al., 2008, 2009, 2010), we show that miR-9 and miR-200-class play a role in ORN differentiation and axonal organization. [score:1]
miR-9 and miR-200 mediate the Dlx5-Foxg1 cascade. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in delayed ORN differentiation. [score:1]
We injected anti- miR-9 and anti- miR200 (or control) MOs in WT zygotes, then at 48 hpf we extracted total -RNA from these and carried out Real-Time qPCR analyses. [score:1]
[1 to 20 of 58 sentences]
23
[+] score: 148
Other miRNAs from this paper: hsa-mir-205, hsa-mir-200b, hsa-mir-141, hsa-mir-200a, hsa-mir-587
These results suggest that the upregulation of N-BLR expression in colon cancer cells could regulate the acquisition of EMT phenotype by buffering the levels of both miR-141-3p and miR-200c-3p resulting in the upregulation of their target gene ZEB1. [score:12]
On the other hand, the decreased levels of N-BLR were associated with a concomitant increase in miR-200c-3p levels, downregulation of the inhibitor of apoptosis XIAP and a subsequent upregulation of caspase activity (Caspases 3/7, 8, and 9) and levels of cleaved PARP-1, resulting in increased levels of apoptosis. [score:9]
The ectopic expression of miR-200c-3p led to the downregulation of XIAP at both mRNA and protein level (Additional file 3: Figure S13A left) and rendered Colo320 cells more susceptible to 5-FU -induced apoptosis (Additional file 3: Figure S13A right). [score:6]
It was reported that miR-200c-3p could target XIAP, thereby leading to decreased levels of XIAP and cell viability [46]; tumor cells were more resistant to the apoptosis induced by 5-FU, when they express higher levels of XIAP [47]. [score:5]
Data are shown as mean ± SEM: EMPTY n = 4, WT N-BLR n = 5, pyk90-DEL N-BLR n = 7. (Student’s t-test; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001) Having shown the inverse correlation between N-BLR and N-BLR and the ZEB1 -targeting miR-141-3p and miR-200c-3p, we sought to determine whether the modulation of N-BLR could influence the expression levels of ZEB1 and, by extension, the levels of E-cadherin. [score:5]
To prioritize among the miR-200 family’s members, we used the rna22 algorithm [45] to predict putative miRNA targets: miR-141-3p and miR-200c-3p were predicted to target N-BLR (Additional file 3: Figure S10A). [score:5]
Thus, in this context, an increase in the expression levels of N-BLR, such as we observed in the cell lines and the CRC samples, can induce a concomitant interaction between N-BLR and available copies of the endogenous miR-141-3p/miR-200c-3p pool resulting in a reduced targeting of ZEB1. [score:5]
Gregory PA Bert AG Paterson EL Barry SC Tsykin A Farshid G The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat Cell Biol. [score:4]
N-BLR localizes to the cytoplasm where it directly interacts with miR-141-3p and miR-200c-3p, two members of the highly conserved miR-200 family known to inhibit EMT [44]. [score:4]
The levels of miR-200c-3p were significantly reduced by the overexpression of the WT N-BLR compared to the empty vector, whereas they were restored by the overexpression of the mutant vector. [score:4]
Moreover, the reduction of free miR-200c-3p can increase the levels of its target XIAP, resulting in an increased ability to resist apoptotic stimuli, including those related to the current chemotherapy drugs for CRC patients (such as 5-FU). [score:3]
More interestingly, the ectopic expression of the pyk90-DEL N-BLR transcript, which lacks part of the miR-200c-3p binding site, could not induce the reduction of miR-200c-3p levels (Fig.   5b and c), whereas it was still able to significantly affect miR-141-3p levels (Additional file 3: Figure S14E and F). [score:3]
N-BLR overexpressing vectors were transiently co -transfected with either miR-141-3p or miR-200c-3p into HT-29 cells. [score:3]
Because it has been reported that miR-200c-3p can target XIAP in pancreatic beta cells [46], we sought to determine whether the finding extends to the CRC context. [score:3]
According to our in silico miRNA target predictions, a segment of the miR-200c-3p binding site is shared with the 5′ region of the pyk90 motif (Additional file 3: Figure S14A). [score:3]
We particularly observed that an increase in the levels of N-BLR was associated with decreased levels of miR-141-3p and miR-200c-3p and accordingly increased levels of ZEB1, whereas a decrease of N-BLR levels was associated with opposite effects on miR-141-3p, miR-200c-3p, and ZEB1 expression. [score:3]
We showed that this crosstalk is mediated by a pyknon, a short ~20 nucleotide-long DNA motif contained in the N-BLR transcript and is targeted by members of the miR-200 family. [score:3]
b miR-200c-3p expression levels following 48 h of co-transfection with empty pcDNA 3.1 vector, pyk90-DEL N-BLR vector, pyk90-DEL N-BLR del miR-200c-3p, pyk90-DEL N-BLR double del for both miR-200c-3p and miR-141-3p binding sites. [score:3]
We particularly showed that increased levels of N-BLR were associated with a decrease in miR-200c-3p and increase in XIAP expression levels. [score:3]
Unsurprisingly, we found that ectopic expression of miR-200c-3p induced increased susceptibility to 5-FU -induced apoptosis. [score:3]
Having established above that N-BLR can regulate miR-200c-3p levels, we assessed whether N-BLR and miR-200c-3p play a role in regulating the 5-FU -induced apoptosis. [score:3]
c Comparison of miR-200c-3p expression levels between WT N-BLR and pyk90-DEL N-BLR cells: the binding of miR-200c-3p to N-BLR is partly dependent on the presence of the pyk90 motif. [score:3]
Indeed, increased levels of miR-200c-3p were associated with significant decreased levels of the mRNA of its target gene XIAP (Additional file 3: Figure S6E). [score:3]
For each set of co-transfection experiments, the expression levels of miR-200c-3p were corrected by subtracting the values derived from the corresponding miRNA mimic negative control. [score:3]
miR-141-3p and miR-200c-3p interaction with N-BLR influence ZEB1 expression. [score:3]
This further confirmed indirectly the inverted correlation between the two short ncRNAs (miR-141-3p and miR-200c-3p) and the lncRNA N-BLR. [score:2]
Given the above-mentioned involvement of N-BLR in the EMT, and of the miR-200 family in the EMT, we conclude that N-BLR and the two miRNAs are linked into a feedback loop that regulates the events occurring during EMT. [score:2]
This human-specific motif partially overlaps with the binding of the EMT -regulating miR-200c-3p and our deletion studies proved that these interactions are functionally important. [score:2]
As expected, ectopic expression of WT N-BLR significantly reduced the levels of miR-200c-3p and miR-141-3p compared with the corresponding variants containing the deleted binding sites for each miRNA (Fig.   5a and Additional file 3: Figure S14C-E). [score:2]
The pcDNA3.1-WT N-BLR and pcDNA3.1-pyk90-DEL N-BLR constructs carrying the single deletion for either miR-200c-3p or miR-141-3p binding sites, the double deletion for both miRs’ binding sites and the deletion between the miR-200c-3p and miR-141-3p binding sites synthesized by using Quik-Change II XL Site-Directed Mutagenesis kit (Stratagene, Agilent Technologies) and named WT N-BLR- del-miR200c, WT N-BLR- del-miR141, WT N-BLR double del, pyk90-DEL N-BLR- del-miR200c, pyk90-DEL N-BLR- del-miR141, pyk90-DEL N-BLR double del, and pyk90-DEL2 N-BLR. [score:2]
Belgardt BF Ahmed K Spranger M Latreille M Denzler R Kondratiuk N The microRNA-200 family regulates pancreatic beta cell survival in type 2 diabetesNat Med. [score:2]
Next, we examined whether the 20-nt pyknon motif from the 844-nt long N-BLR transcript could affect the direct coupling of miR-141-3p and miR-200c-3p to N-BLR. [score:2]
Interestingly, when we transiently knocked down N-BLR in Colo320 cells, we noted a concomitant increase in the levels of miR-141-3p and miR-200c-3p (Fig.   4a). [score:2]
It was previously reported that the miR-200 family is involved in the regulation of EMT through a negative feedback loop with the ZEB1 and ZEB2 transcription factors [44]. [score:2]
Conversely, N-BLR -mediated decrease of levels of miR-200c-3p was associated with increased levels of XIAP and resistance to 5-FU -induced apoptosis. [score:1]
When R KO cells were transiently transfected to overexpress WT N-BLR, we measured a decrease in the levels of miR-200c-3p, as expected, and, again, a concomitant small but statistically significant increase in the levels of XIAP and in the ability to resist 5-FU -induced apoptosis (Additional file 3: Figure S13C). [score:1]
These results made us conclude that these three non-coding transcripts (N-BLR, miR-141-3p, and miR-200c-3p) and three coding genes (E-cadherin, vimentin, and ZEB1) comprise a new component of signaling interactions in the EMT pathway. [score:1]
To quantify the levels of N-BLR, miR-141-3p, and miR-200c-3p in the ISH of tissue microarray, images of each tissue core were automatically captured using a Perkin Elmer Caliper Vectra 2 microscope and then analyzed using inForm 2.0 image analysis software (Perkin Elmer, Inc. [score:1]
We confirmed a direct molecular coupling between both miR-141-3p and miR-200c-3p and N-BLR using luciferase assays and constructs carrying either the wild-type (WT) or the mutant miRNA response element sites within N-BLR (Fig.   4b). [score:1]
We constructed pcDNA3.1 plasmids containing either WT N-BLR or pyk90- deleted N-BLR (pyk90-DEL construct from position 779 to 798 of N-BLR); then, for each of the two N-BLR variants we constructed a set of mutant vectors carrying the deletion either for miR-141-3p or miR-200c-3p binding sites or both (Additional file 3: Figure S14B). [score:1]
b A luciferase vector including the full N-BLR sequence (pGL3-N-BLR) as well as vectors that were mutated separately at the interaction sites of either miR-141-3p or miR-200c-3p [pGL3-N-BLR(M)] were constructed. [score:1]
We used individual vectors containing the following sequences: (1) WT N-BLR; (2) N-BLR with the miR-141-3p binding site deleted (WT N-BLR del miR-141-3p); (3) N-BLR with the miR-200c-3p biding site deleted (WT N-BLR del miR-200c-3p); and (4) N-BLR with both the miR-200c-3p and miR-141-3p binding sites deleted (WT N-BLR double del). [score:1]
Luciferase activity is decreased only when miR-141-3p and miR-200c-3p are co -transfected with the WT construct but not when a mutated vector is used. [score:1]
To this end, we transiently transfected Colo320 with miR-200c-3p mimic. [score:1]
Our results are in concordance with the recent finding that miR-200c-3p plays an important role in controlling EMT and the metastatic process of colon cancer cells to the liver [49]. [score:1]
Particularly in adenocarcinoma, high N-BLR levels were associated with low levels of miR-141-3p and miR-200c-3p. [score:1]
We found that low levels of both miR-141-3p and miR-200c-3p were associated with a poor OS of CRC patients (Additional file 3: Figure S12A and B right), and high levels of N-BLR associated with poor OS (Fig.   1c and d). [score:1]
Fig. 4Interaction between N-BLR and miR-200 family members. [score:1]
We also confirmed in R KO cells that transient transfection with the WT N-BLR vector could lower the levels of miR-141-3p and miR-200c-3p (Additional file 3: Figure S10D) and could increase the levels of ZEB1 (Additional file 3: Figure S15B). [score:1]
The mirVana miRNA Mimics hsa-miR-200c-3p, hsa-miR-141-3p (MC11714, MC10860, Life Technologies), and mirVana miRNA Mimic Negative Control #1 were used for transfection at a final concentration of 50 nM. [score:1]
a The effect of transient transfection of N-BLR siRNA3 and siRNA4 on the miR-200 family in Colo320 cells. [score:1]
Similarly, when we transfected R KO cells with either miR-141-3p or miR-200c-3p mimics, the levels of N-BLR were decreased by ~30% (Additional file 3: Figure S11). [score:1]
The miR-200c-3p and miR-141-3p LNA probes were purchased from Exiqon. [score:1]
N-BLR modulates resistance to 5-fluorouracil (5-FU) through miR-200c-3p and XIAP. [score:1]
a. miR-200c-3p levels following 48 h of co-transfection with empty pcDNA 3.1 vector, WT N-BLR vector, WT N-BLR del miR-200c-3p, WT N-BLR double del for both miR-200c-3p and miR-141-3p binding sites in HT-29 cell lines. [score:1]
On the contrary, in the transiently overexpressing N-BLR R KO cells that were used for the migration/invasion assays shown in Additional file 3: Figure S8, the levels of miR-141-3p and miR-200c-3p were significantly reduced compared with cells transfected with empty vector control (Additional file 3: Figure S10D). [score:1]
Having established that the levels of N-BLR are inversely correlated to those of miR-141-3p and miR-200c-3p, we sought to determine whether this finding persists in clinical samples as well. [score:1]
Y-axis values represent the ratio of miR-200c-3p and miR-141-3p to U6. [score:1]
LncRNA-ATB was shown to promote invasion and metastasis in hepatocellular carcinoma through interactions with members of the miR-200 family and with ZEB1/ZEB2. [score:1]
In summary, our findings suggest a mo del whereby N-BLR may mediate the switch from an epithelial to a mesenchymal cell phenotype by sequestering miR-141-3p and miR-200c-3p. [score:1]
[1 to 20 of 60 sentences]
24
[+] score: 142
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-141, hsa-mir-200a, hsa-mir-429
miR-200c expression upregulated α-smooth muscle actin (SMA) and vimentin, enhanced HSCs growth and migration, increased expression of collagen type I (a main component of ECM) gene and secretion of epidermal growth factor (EGF), and upregulated the phosphorylation of Akt, a downstream effector of the PI3K pathway. [score:11]
We found that the effects of miR-200c on HSCs and liver fibrosis are mediated via downregulation of FOG2 protein synthesis, activation of PI3K/Akt signaling, upregulation of activation of autocrine EGF signaling, and upregulation of collagen type I production in HSCs (Figure 4). [score:10]
These data suggest that miR-200c activates HSCs in liver fibrosis possibly by downregulating FOG2 protein expression and upregulating PI3K/Akt signaling. [score:9]
Mei et al. [23] also found that miR-200c inhibited the expression of PTEN and FOG2 to promote the expansion and immune suppressive activity of myeloid-derived suppressor cells (MDSCs). [score:9]
We found that miR-200c overexpression significantly upregulated the gene expression of collagen type I in HSCs (Figure 3(a)). [score:8]
3.3. miR-200c Overexpression Upregulates the Expression of Collagen Type I and Epidermal Growth Factor (EGF) via the FOG2/PI3K/Akt Pathway. [score:8]
Intriguingly, miR-200 was reported to decrease FOG2 expression by targeting the 3′ UTR of the FOG2 mRNA, thereby altering PI3K activity and regulating the insulin signaling pathway and metabolism [16, 21]. [score:6]
First, we constructed two cell lines from the human HSC line (LX2): one stably overexpressed miR-200c (LX2-200c) and its control that expressed empty vector (LX2-nc) (P = 0.013, Figures 1(a) and 1(b)). [score:5]
To further probe the mechanism of miR-200c -mediated PI3K signaling, we measured the expression of FOG2 (a reported inhibitor of PI3K [16, 21– 23]) and PI3K after miR-200c transfection and found that LX2-200c cells had significantly decreased levels of FOG2 while no significant change was observed in PI3K expression (Figure 2(f)), which is consistent with our previous finding of increased Akt phosphorylation. [score:5]
Our results showed that miR-200c overexpression also promoted the secretion of EGF in HSCs and that miR-200c -mediated EGF secretion could be inhibited by LY294002 treatment. [score:5]
3.2. miR-200c Activates the PI3K/Akt Pathway via Suppressing Expression of FOG2. [score:5]
Park et al. [22] indicated that FOG2 is downregulated by mimics of miR-200b and miR-200c in mouse mesangial cells (MMC). [score:4]
To assess whether PI3K/Akt signaling is involved in miR-200c -mediated collagen type I gene expression, we treated LX2-200c cells with 25  μM LY294002 in the presence of 10% serum for 30 min and detected a marked drop in their collagen type I mRNA levels (Figure 3(b)). [score:3]
We engineered human HSCs (LX2 cell line) to stably express miR-200c (LX2-200c) or empty vector control (LX2-nc). [score:3]
Puromycin (2  μg/ml) was added 3 days after transfection to select and purify the miR-200c -expressing or scramble clones. [score:3]
The results showed that LY294002 treatment significantly inhibited miR-200c-enhanced LX-2 cell proliferation and migration and ECM deposition, which suggested that PI3K/Akt activation was essential to the profibrotic effect of miR-200c. [score:3]
Moreover, LY294002, a highly selective inhibitor of PI3K, blocked phosphorylation of Akt and the effects of miR-200c. [score:3]
Cell Culture and Construction of the HSCs Stably Overexpressing miR-200c. [score:3]
So miR-200c can be a potential marker for HSCs activation and liver fibrosis progression, as well as a potential target to attenuate liver fibrosis. [score:3]
Our results in the present study revealed that miR-200c plays a critical role in HSC activation and liver fibrosis progression via targeting FOG2 and activating PI3K/Akt signaling. [score:3]
Then, 2 × 10 [4] LX2 cells were infected in a 35 mm dish by 1 ml of miR-200c -expressing or scramble lentiviruses containing 1  μl of polybrene (8 mg/ml). [score:3]
To determine whether the effect of miR-200c is mediated through the FOG2/PI3K pathway, we used LY294002, a specific PI3 kinase inhibitor, to block PI3K activation in the LX-2 cells transfected with miR-200c. [score:3]
Herein, we showed that proliferation and migration of a human HSC (LX-2) cell line were enhanced by engineering it to stably overexpress miR-200c (LX2-200c). [score:3]
However, our preliminary experiment showed that miR-200c overexpression had no effect on other growth factors, including transforming growth factor- β1 (TGF- β1), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), hepatocyte growth factor (HGF), and vascular endothelial growth factor (VEGF). [score:3]
Assessment of EGF protein level in the conditioned medium of HSCs revealed a significantly increased level of EGF secretion by HSCs after miR-200c transfection (Figure 3(c)), which could be inhibited by treatment with 25  μM LY294002 for 30 min (Figure 3(c)). [score:3]
In view of its putative pathogenic role in HSCs, miR-200c may be a potential marker for HSC activation and liver fibrosis progression, and even a potential target for the treatment of liver fibrosis. [score:3]
Although several studies have reported the involvement of miR-200s in the development of tissue fibrosis, including liver fibrosis, no study has implicated miR-200c. [score:2]
In summary, our results show directly that miR-200c is an important promoter of HSCs activity, proliferation, and migration and has a very important role in liver fibrosis. [score:2]
The 293T cells were cotransfected with 5  μg of either hsa-miR-200c-eGFP carrying plasmid (Catalog No. [score:1]
These findings proved that PI3K/Akt signaling is involved in miR-200c-enhanced secretion of EGF. [score:1]
3.1. miR-200c Promotes the Activity, Proliferation, and Migration of HSCs. [score:1]
The miR-200s (miR-200a, miR-200b, miR-200c, miR-429, and miR-141) have recently been implicated in tissue fibrosis [13, 14]. [score:1]
Briefly, we first generated miR-200c-eGFP lentiviral particles or control scramble lentiviral particles. [score:1]
So we speculated that miR-200c promoted HSC proliferation, migration, and ECM production in part via autocrine activation of EGF signaling, rather than signaling by other growth factors. [score:1]
Because activation of the PI3K/Akt pathway is required for HSC proliferation and migration [20], we further probed whether the proliferative and migratory effects of miR-200c are dependent on the activation of PI3K/Akt. [score:1]
In addition, PI3K/Akt signaling also played a key role in miR-200c -mediated EGF secretion by HSCs. [score:1]
However, few reports have addressed the role of miR-200c in HSC activation and liver fibrosis. [score:1]
Autocrine activation of EGF signaling may also be a mechanism of miR-200c -mediated HSCs activation. [score:1]
In the present studies, we showed that transfection of miR-200c significantly reduced FOG2 protein levels in LX-2 cells, which subsequently led to PI3K/Akt signaling activation. [score:1]
[1 to 20 of 39 sentences]
25
[+] score: 135
In addition, downregulation of miR-200 family members has been associated with resistance to cytotoxic chemotherapeutic agents and EGFR inhibitors [16, 22, 31, 49, 50]. [score:6]
The miR-200 family acts as key inhibitors of epithelial-to-mesenchymal transition (EMT) by directly targeting transcriptional repressors of E-cadherin, ZEB1, and ZEB2 [5]. [score:6]
In addition, the miR-200 family inhibits EMT by regulating a number of target genes such as ZEB1 and ZEB2 [5]. [score:6]
MiR-200c strongly suppressed mammary duct formation from normal mammary stem cells and tumor formation from breast cancer stem cells in vivo by targeting B lymphoma Mo-MLV insertion region 1 homolog, a regulator of stem cell self-renewal [48]. [score:5]
The tumor-suppressive roles of the miR-200 family have also been reported in gastric [8], breast [9], endometrial, [10] pancreatic cancers [11, 12], hepatocellular carcinoma [13], gliomas [14], and lung cancer [15, 16]. [score:3]
Supplementary Figure 3: Forest plot of hazard ratios for the prediction of overall (A) and progression-free survival (B) by high -expressing miR-200 family members according to individual tissue miRNA levels. [score:3]
Quantitative real-time PCR was performed in 22 studies, in situ hybridization in 2 studies, and two separate techniques in 2 studies to assess miR-200 family expression. [score:3]
MiR-200 family members are also likely downregulated during tumor progression. [score:3]
The results of this meta-analysis showed a pooled HR of 0.70 (95% CI 0.54–0.91), demonstrating that increased miR-200 family expression in cancer tissues is associated with a favorable outcome (P = 0.007). [score:3]
Moreover, expression of miRNA, including miR-200, may be an early predictor of chemotherapy outcomes in prostate and esophageal cancers [35, 37]. [score:3]
Overall Effects of miR-200 Expression in Cancer Tissues on OS and PFS. [score:3]
Supplementary Figure 2: Forest plot of hazard ratios for the prediction of overall (A) and progression-free survival (B) by high -expressing serum miR-200 family members according to tumor type. [score:3]
Overall Effects of Circulating miR-200 Expression on OS and PFS. [score:3]
In addition, the PFS analysis of seven studies revealed a protective role for increased miR-200 tissue expression (pooled HR = 0.63, 95% CI 0.52–0.76), as determined using a random-effects mo del (P = 0.03, I [2] = 44%; Figure 2(b)). [score:3]
The pooled results showed that high miR-200 expression was a favorable prognostic factor in patients with various types of cancer (pooled HR = 0.70, 95% CI 0.54–0.91). [score:3]
In the stratified analyses of PFS, increased tissue miR-200 expression was significantly associated with increased PFS in the ovarian cancer subgroup (pooled HR = 0.50, 95% CI 0.35–0.72) with low heterogeneity (P = 0.26, I [2] = 21%; Supplementary Figure  1B). [score:3]
Supplementary Figure 4: Forest plot of hazard ratios for the prediction of overall (A) and progression-free survival (B) by high -expressing miR-200 family members according to individual serum miRNA levels. [score:3]
In the breast cancer subgroup, circulating miR-200 expression showed a significantly negative correlation with PFS (pooled HR = 2.87, 95% CI 1.43–5.73) with low heterogeneity (P = 0.69, I [2] = 0%, Supplementary Figure  2B). [score:3]
This systemic review and meta-analysis showed that elevated cancer tissue expression of miR-200 was associated with longer survival in patients with multiple carcinoma types. [score:3]
Thus, expression of miR-200 family members could influence the cancer phenotype and prognosis of cancer patients [5]. [score:3]
A number of studies showed that miR-200 family members are aberrantly expressed in multiple human malignancies, suggesting that these miRNAs play a role in tumor pathogenesis during all stages of carcinogenesis. [score:3]
In contrast, the analysis stratified by circulating miRNA levels showed that circulating miR-200c expression was negatively correlated with OS (pooled HR = 1.97, 95% CI 1.47–2.65; Supplementary Figure  4A) and PFS (pooled HR = 2.65, 95% CI 1.61–4.35) which was determined using a fixed-effects mo del given the low heterogeneity among the studies (P = 0.83, I [2] = 0%; Supplementary Figure  4B). [score:3]
The pooled outcome from the OS and PFS analyses revealed HRs of 1.68 (P = 0.007) and 2.62 (P < 0.001), respectively, showing that increased circulating miR-200 family expression is associated with unfavorable survival. [score:3]
Supplementary Figure 1: Forest plot of hazard ratios for the prediction of overall (A) and progression-free survival (B) by high -expressing tissue miR-200 family members according to tumor type. [score:3]
Tissue (in 26 studies), serum (in 9 studies), and both tissue and serum samples (in 1 study) were used to determine miR-200 expression. [score:3]
We found that higher expression of circulating miR-200 significantly predicted poor OS (pooled HR = 1.68, 95% CI 1.15–2.46; Figure 3(a)). [score:3]
Pooled analyses of the brain tumor and pancreatic cancer subgroups indicated that tissue miR-200 family expression was positively correlated with OS (pooled HR = 0.51, 95% CI 0.32–0.82 in brain tumor subgroup; pooled HR = 0.35, 95% CI 0.21–0.60 in pancreatic cancer subgroup), with low heterogeneity among the studies analyzed (P = 0.71, I [2] = 0% in brain tumor subgroup; P = 0.26, I [2] = 26% in pancreatic cancer subgroup; Supplementary Figure  1A). [score:3]
These finding suggest that the miR-200 family members function as tumor suppressor genes. [score:3]
The decreased tumor expression of the miR-200 family was significantly associated with poor survival in patients with brain, pancreas, and ovarian cancers. [score:3]
In contrast, a pooled analysis of the colorectal cancer subgroup showed that serum miR-200 expression was negatively correlated with OS (pooled HR = 2.50, 95% CI 1.50–4.18) with low heterogeneity (P = 0.44, I [2] = 0%; Supplementary Figure  2A). [score:3]
The miR-200 family has regulatory functions in diverse biological processes. [score:2]
The authors proposed that the miR-200 family is potentially involved in promoting the last step of the metastatic cascade in the development of macroscopic metastatic masses at distant sites. [score:2]
Taken together, the miR-200 family can affect cancer progression by regulating various cell signaling and genetic pathways. [score:2]
MiR-200 expression is correlated with metastasis and relapse in breast cancer [34]. [score:2]
The miR-200 family includes five members (miR-200a, miR-200b, miR-200c, miR-141, and miR-429) and can be divided into two clusters based on chromosomal location. [score:1]
org/10.1155/2017/1928021): miR-141, miR-200, or miR-429 combined with prognostic, prognosis, survival, tumor, cancer, neoplasm, or carcinoma. [score:1]
Shi and Zhang [46] evaluated seven ovarian cancer studies and showed that high expression of miR-200c may predict improved survival (OS: HR = 0.34, 95% CI 0.20–0.58; PFS: HR = 0.64, 95% CI 0.50–0.82). [score:1]
Of the remaining 145 studies, 74 were excluded because they did not have the survival data associated with miR-200 family. [score:1]
Although the miR-200 family is a determinant of epithelial cell phenotypes, its prognostic role has not yet been elucidated. [score:1]
Twenty-five studies on miR-200 expression in tissue samples were evaluated for OS analysis (Figure 2(a)) using a random-effects mo del due to high heterogeneity (OS, P < 0.00001, I [2] = 85%). [score:1]
In contrast, low circulating miR-200 levels were associated with a positive prognosis in patients with colon and breast cancers. [score:1]
PFS analysis of three studies (Figure 3(b)) demonstrated a significant association between circulating miR-200 levels and PFS (pooled HR = 2.62, 95% CI 1.68–4.07). [score:1]
Articles meeting the following criteria were included: (1) human patient versus animal study on any type of malignant cancer or neoplasm and (2) assessment data on patient survival (overall survival [OS] and progression-free survival [PFS]) and the miR-200 family with multivariate hazard ratios (HRs) included. [score:1]
Wu et al. [47] found that miR-200c was not significantly correlated with either OS (HR = 1.41, 95% CI 0.95–2.10; P = 0.09) or PFS (HR = 1.12, 95% CI 0.68–1.84; P = 0.67) in various types of cancer. [score:1]
The miR-200c/141 cluster is comprised of miR-200c and miR-141 and is located on chromosome 12p13 [5]. [score:1]
However, due to small sample sizes and different detection methods used in previous studies, the prognostic role of miR-200 has not been clearly elucidated. [score:1]
Le et al. reported that miR-200 family members are secreted by highly metastatic epithelial breast cancer cells and that the secretion of these miRNAs results in increased metastatic potential in xenograft mo dels [45]. [score:1]
The miR-200 family was first reported to play a role in olfactory neurogenesis [7]. [score:1]
In addition, increasing evidence suggests that miRNAs have different roles in tumor tissues and blood [44, 45], and thus the prognostic roles of miR-200 family members in both tumor and serum samples were analyzed in this study. [score:1]
Interestingly, the miR-200 levels in plasma and tumor tissues had opposing associations with survival in this study. [score:1]
In contrast, high levels of miR-200 in serum were associated with poor prognosis. [score:1]
Therefore, we performed a literature -based meta-analysis of eligible studies to obtain evidence -based results on the prognostic role of miR-200 family members in various types of malignancies. [score:1]
In conclusion, our meta-analysis suggests that the miR-200 family members are potential biomarkers and accurate prognostic predictors in patients with various carcinomas. [score:1]
For future clinical application, large prospective studies are needed to validate the prognostic values of circulating miR-200 in individual cancer types. [score:1]
Therefore, further clarification on the clinical roles of circulating miR-200 family members in well-designed prospective studies is needed. [score:1]
For example, Song et al. identified a signature of 17 miRNAs, which included the miR-200 family, in patients with gastric cancer [24]. [score:1]
MiR-200b, miR-200c, and miR-429 have the same seed region (nucleotides 2–7), and miR-200a and miR-141 share a seed region with a difference in only the fourth nucleotide (U to C) among these regions [6]. [score:1]
Some studies have shown no correlation between miR-200 levels in serum and tumor tissues [53]. [score:1]
Similarly, Wu et al. 's meta-analysis indicated that higher blood levels of miR-200c were significantly associated with poor OS (HR = 2.10, 95% CI 1.52–2.90, P < 0.00001), but there was no significant association in tumor tissue (HR = 1.41, 95% CI 0.95–2.10; P = 0.09) [47]. [score:1]
Recently, two meta-analyses on the prognostic value of miR-200 were published. [score:1]
[1 to 20 of 60 sentences]
26
[+] score: 132
Importantly, inhibition of endogenous miR-29b, and to a lesser extent miR-200c, in two different cell lines representing the basal subtype of breast cancer, SUM102PT and SUM149PT, led to increased expression of ADAM12-L. These findings support a role for the endogenous miR-29b and/or miR-200c in the regulation of ADAM12-L gene expression at the post-transcriptional level via targeting of the unique 3′UTRs of ADAM12-L. Since the translation product of ADAM12-L differs from the protein product of ADAM12-S in its biochemical properties, cellular localization, and most likely substrate specificity and function, better understanding of the mechanisms controlling expression of each splice variant is an important step in the research on ADAM12 in breast cancer. [score:14]
To further test this hypothesis, we asked whether inhibition of the endogenous miR-29b or miR-200c in SUM102PT and SUM149PT, two basal cell lines with low to moderate expression of miR-29b and miR-200c (see Figure  1D), is sufficient to increase the level of ADAM12-L. We transfected these cells with miRNA hairpin inhibitors to miR-29b and miR-200c (or with control hairpin inhibitor) and assessed the level of ADAM12-L mRNA by qRT-PCR. [score:9]
Thus, low expression levels of miR-200 family members, together with low expression of miR-29, may create permissive conditions for high expression of ADAM12-L in claudin-low tumors and cell lines. [score:7]
Since the ADAM12-S 3′UTR lacks predicted target sites for these miRNA families and since miR-29, miR-30, or miR-200 levels are highly variable in breast cancer, selective targeting of the ADAM12-L 3′UTR by these miRNAs might explain why ADAM12-L and ADAM12-S expression patterns in breast tumors in vivo and in response to experimental manipulations in vitro often differ significantly. [score:7]
We have selected to study two representative miRNAs from each family: miR-29b (a potent inhibitor of breast tumor metastasis [34]) and miR-29c (associated with a significantly reduced risk of dying from breast cancer [41]), miR-30b and miR-30d (both significantly down-regulated in ER -negative and progesterone receptor (PR) -negative breast tumors [42]), and miR-200b and miR-200c (both representing key negative regulators of EMT and anoikis resistance [30- 32]). [score:7]
To assess the clinical relevance of our results on the regulation of ADAM12-L expression in breast cancer cell lines, we analyzed publicly available expression data for a cohort of 100 breast cancer patients and found negative correlations between ADAM12-L mRNA and miR-29b, miR-200b, and miR-200c. [score:6]
The miR-29, miR-30, and miR-200 families have potential target sites in the ADAM12-L 3′UTR and they may negatively regulate ADAM12-L expression. [score:6]
The miR-200 family, by forming a double -negative feedback loop with transcription factors of ZEB1 and ZEB2, is a key negative regulator of EMT and is down-regulated in breast cancer stem-like cells and in normal mammary stem/progenitor cells [29- 33]. [score:5]
Inhibition of the endogenous miR-29b and miR-200c with miRNA hairpin inhibitors increased the level of ADAM12-L mRNA in SUM149PT and SUM102PT cell lines. [score:5]
Mutations within these two miR-200 target sites abolished the effect of transfected miR-200b/c mimics, suggesting direct interaction between miR-200b/c and the ADAM12-L 3′UTR. [score:5]
Inhibition of endogenous miR-29b and miR-200c in SUM149PT and SUM102PT cells led to increased ADAM12-L expression. [score:5]
In this report, we examined whether three miRNA families, miR-29, miR-30, and miR-200, directly target the ADAM12-L 3′UTR in human breast cancer cells. [score:4]
The predicted miR-29, miR-30, and two miR-200 target sites in the ADAM12-L 3′UTR reporter plasmid were mutated by site-directed mutagenesis. [score:4]
These results are consistent with a role of miR-29b and miR-200c (and possibly miR-200b) in the regulation of ADAM12-L expression in breast tumors. [score:4]
In this report, we asked whether ADAM12-L expression in breast cancer cells is regulated by members of the miR-200, miR-29, and miR-30 families. [score:4]
The third miRNA family tested here, miR-200, has not been previously reported to regulate ADAM12 expression. [score:4]
Similar to miR-29, the miR-200 family is down-regulated in claudin-low tumors and cell lines. [score:4]
The ADAM12-L 3′UTR is a direct target of miR-29 and miR-200 family members. [score:4]
We focused on the miR-29, miR-30, and miR-200 families, which act as tumor suppressors in breast cancer. [score:3]
Both miR-200b and miR-200c mimics elicited a statistically significant, ~50% decrease in the luciferase activity, which was abolished when the two putative miR-200b/c target sites were destroyed (Figure  4C). [score:3]
Analysis of a publicly available gene expression dataset for 100 breast tumors revealed a statistically significant negative correlation between ADAM12-L and both miR-29b and miR-200c. [score:3]
Of particular interest are the miR-200, miR-29, and miR-30 families, which all have been linked to the mesenchymal phenotype, invasion, or metastasis in breast cancer [28, 29], and which all have predicted target sites in the ADAM12-L 3′UTR, but not in the ADAM12-S 3′UTR. [score:3]
In SUM149PT cells, miR-29b and miR-200c inhibitors increased ADAM12-L levels by ~50% and ~30%, respectively, and these effects were statistically significant (Figure  5B). [score:3]
The roles of endogenous miR-29b and miR-200c were tested by transfecting cells with miRNA hairpin inhibitors. [score:3]
Finally, the ADAM12-L 3′UTR reporter activity was significantly reduced by miR-200b/c, despite the fact that the two predicted miR-200 target sites present in the ADAM12-L 3′UTR are not well conserved between species. [score:3]
Among these three miRNAs, miR-29b and miR-200c appear to be the most strongly correlated with ADAM12-L in breast tumors. [score:1]
Figure 5 Relationship between endogenous miR-29b, miR-200c, and ADAM12-L in breast tumors and breast cancer cell lines. [score:1]
Since the miR-29 and miR-200 families play important roles in breast cancer progression, these results may help explain the different prognostic and chemopredictive values of ADAM12-L and ADAM12-S in breast cancer. [score:1]
Importantly, we found a significant negative correlation between ADAM12-L and both miR-29b and miR-200c in breast invasive carcinomas. [score:1]
There was a significant negative correlation between miR-29b and ADAM12-L (P = 0.0001), between miR-200c and ADAM12-L (P = 0.0002), and a weaker but significant correlation between miR-200b and ADAM12-L (P = 0.0464) (Figure  5A). [score:1]
We have found that two members of this family, miR-200b and miR-200c, strongly diminished ADAM12-L protein in SUM159PT, SUM1315MO2, and Hs578T cells. [score:1]
The miR-29 family consists of three members with the same seed sequence, miR-29a-c. The miR-30 family is made up of 5 members, miR-30a-e. The miR-200 family consists of five members: miR-200a-c, miR-141 and miR-429. [score:1]
[1 to 20 of 32 sentences]
27
[+] score: 128
Upon removal of Dox on day 18, the Dox+/− cells gradually returned to an epithelial expression signature when analyzing all the parameters examined in the EMT process i. e. direct miR-200 targets (Zeb1, Zeb2, FHOD1, PPMIF and FN-1mRNA), Zeb1/Zeb2 regulated genes (miR-200c/141 locus, ESA, ESRP1, E-cadherin and Vimentin), splicing isoforms of CD44 and p120 catenin and the SRF target gene, CTGF (Figs 3 and 4). [score:9]
On day 6, the reporter activity for either miR-200c or miR-141 in Dox+ cells reached similar levels to that of the reporters without the target sequence (untargeted, UT) indicating that RNA interference by either miR-200c or miR-141 had been almost fully suppressed. [score:7]
Expression levels of the indicated mRNAs after TuD-141/200c induction and a release from the functional inhibition of the miR-200 family. [score:5]
Protein expression levels of the indicated genes after a release from the functional inhibition of the miR-200 family. [score:5]
Expression levels of specific genes after TuD-141/200c induction and a release from the functional inhibition of the miR-200 family. [score:5]
Overall, these findings indicated that the inhibition of miR-200 family activity alone can trigger several layers of molecular events in a sequential manner including RNA interference, transcriptional repression and activation, switching of splicing isoforms and probably actin remo deling and subsequent SRF target gene induction. [score:5]
Our current results indicate that EMT induced by TuD -mediated miR-200 family inhibition is fairly reversible after a release from this inhibition. [score:5]
Since each MBS in TuD can efficiently suppress the activity of miRNAs with the same core sequence 17, this TuD hybrid, TuD-141/200c, would therefore efficiently suppress almost the entire miR-200 family (Fig. 1a). [score:5]
MiR-200c and-141 were inhibited in a Dox -dependent manner using the Tet-inducible TuD-141/200c expression system. [score:4]
Of note, CTGF mRNA was induced by the miR-200 inhibition and repressed by the release from this inhibition with a slightly delayed kinetics compared with those of vimentin. [score:4]
Importantly, transcription of the miR-200c/141 locus, which is also known to be under direct negative regulation of Zeb1 and Zeb2 11, was also suppressed in the Dox+ cells as judged by the reduction in the pri-miR-200c/-141 transcript level using a primer pair that does not detect mature miR-200c or miR-141. [score:4]
This would lead to the down-regulation of endogenous miR-200c/-141 production, confirming the establishment of a double -negative feedback loop between Zeb1/2 and the miR-200 family members in a quite early stage of EMT. [score:4]
EMT and MET induced by the regulated inhibition of miR-200 family activity. [score:4]
When HCT116-TetOnIII cells were transduced with this vector, no miRNA inhibitory effects was observed in the absence of Dox in a reporter assay, whereas almost full suppression of endogenous miR-200c activity was observed at a Dox dosage of 10 ng/ml-1 μg/ml (Supplementary Figure S5b). [score:4]
Importantly, the down-regulation of endogenous miR-200c/141 loci at the early stages of this transition would have reinforced the effects of hybrid TuD-141/200c molecule. [score:4]
To test whether our observations that the EMT induced by miR-200 suppression is highly reversible could be extended to another cell line, we tested the mammary tumor cell line, SUM149PT, as it has been reported to show phenotypic equilibrium in monolayer culture 27. [score:3]
The hybrid TuD molecule we have designed and described herein, TuD-141/200c, can very efficiently and simultaneously inhibit miR-141 and miR-200c (Fig. 1b,c). [score:3]
Other miR-200 family targets, including FHOD1, PPMIF and FN1 mRNAs, were induced in a lesser extent with distinct kinetics for each gene (Fig. 3a). [score:3]
As a result, pri-miR-200c, E-cadherin, ESA and ESRP1 were more efficiently suppressed in SUM149PT culture C due to the highly elevated Zeb1/2. [score:3]
An miR-200 target, FHOD1 (formin homologue domain-containing protein 1) (Fig. 3a), as a member of the formins, is expected to contribute to actin polymerization (F-actin formation) during EMT. [score:3]
Kinetics of the multiple molecular events involved in the EMT induced by inhibition of the miR-200 family. [score:3]
Reversion of the observed multiple molecular events after the release from miR-200 -family inhibition. [score:3]
Importantly in culture C (ESA(−) cells originated from ESA(+) cells after the TuD-141/200c induction), Zeb1 and Zeb2 were drastically elevated among the miR-200 family targets. [score:3]
How to cite this article: Haraguchi, T. et al. Dynamics and plasticity of the epithelial to mesenchymal transition induced by miR-200 family inhibition. [score:3]
As early as 12–16 hours after Dox addition, representative miR-200 family targets, Zeb1 and Zeb2 began to increase their levels by more than 5-fold, indicating that their mRNAs are extremely sensitive to a reduction in miR-200 activity (Fig. 3a and Supplementary Figure S9). [score:3]
The expression ratios of miR-200c-RL/FL to UT-RL/FL or miR-141-RL/FL to UT-RL/FL are represented by the mean ± SD (n = 3). [score:3]
Importantly, all of the major mRNAs shown to be involved in miR-200 -mediated EMT in HCT116 cells had similar changes in SUM149PT cells upon induction of and release from TuD-141/200c expression, indicating that cascade of molecular events represented in Supplementary Figure S10 can be induced by modulation of the functional miR-200 family activity in different cell types. [score:3]
EMT and MET are also regulated by the activities of miR-200 family members in the SUM149PT triple -negative breast cancer cell line. [score:2]
Using our system described above for regulating miR-200 family activity, we performed time course analysis of the key molecular events that have been previously reported to be involved in the EMT. [score:2]
The cumulative evidence to date indicates that the miR-200 family members are among the key regulators of the EMT. [score:2]
12) is much higher than that of the other miR-200 members (which are transcribed from chr. [score:1]
In contrast, the activities of miR-200c and miR-141 had almost reverted to their original states by day 27 in the Dox+/− cells (9 days after Dox removal). [score:1]
Even with this limitation, we were still able to detect the reversibility of miR-200 -mediated EMT in this cell line. [score:1]
MiRNA microarray analysis of HCT116 cells indicated that two miR-200 loci are transcribed at basal levels, whereas production of miR-200c/-141 (transcribed from chr. [score:1]
Sequences of miR-200 family members as well as their seed sequences (grey box) are shown in the lower panel. [score:1]
The observed cascade of molecular events induced by modulation of the functional miR-200 family activity is schematically represented in Supplementary Figure S10. [score:1]
Our current results highlight the molecular basis of epithelial plasticity supported by the miR-200 family. [score:1]
Hence, the major cascade of molecular events associated with miR-200 -dependent EMT that we observed in HCT116 cell system can be basically recapitulated in SUM149PT cells. [score:1]
Considering that the core sequence of miR-200c is shared by miR-200b and -429, whereas that of miR-200a is identical to miR-141 (Fig. 1a), we designed a hybrid type TuD molecule with 2 miRNA binding sites (MBS) that are complementary to miR-200c and miR-141, respectively. [score:1]
This is mechanistically supported by the transcriptional reversibility of key genes downstream of the miR-200 family examined here including Zeb1, Zeb2, FHOD1, PPM1F, E-Cad, ESRP1, ESA, and CTGF. [score:1]
The analyzed genes included (a) Zeb1, Zeb2, FHOD1, PPM1F and FN1; (b) pri-miR200c/141, vimentin, E-Cadherin, ESA and ESRP1; (c) Total, epithelial type isoform and mesenchymal type isoform of CD44; and (d) total, epithelial type isoform and mesenchymal type isoform of p120 catenin. [score:1]
Overall these observations support that miR-200 -mediated EMT is reversible in this cell line. [score:1]
[1 to 20 of 42 sentences]
28
[+] score: 123
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200a
Given the remarkable pleiotropy of the miR-200 family in regulating genome-wide targets to suppress EMT, the regulation of specific cellular functions is still being elucidated. [score:7]
Based upon our previously published findings that the KP tumors have significantly elevated levels of TGFβ as a driver of EMT and metastasis 30 and that metastatic cell lines from the mo del can be alternately shifted in their phenotype by miR-200 expression (Supp Fig. S3h) or treatment with TGFβ, we probed the effect of TGFβ -induced EMT on the 344SQ murine cells and demonstrated robust up-regulation of signaling through the FAK/CRKL pathway (Fig. 5g). [score:6]
Either intrinsic dysregulation of Zeb1 or TGFβ -mediated suppression of miR-200 can de-repress CRKL expression to drive subsequent collagen I -mediated ITGβ1-FAK signaling. [score:6]
As a functional consequence, in vitro migration and invasion were enhanced in the previously non-invasive 393P cells, and suppressed upon miR-200 re -expression (Fig. 1e). [score:5]
Additionally, across the TCGA datasets (n = 9105 tumor specimens), CRKL levels negatively correlated with the miR-200 family levels, positively correlated with the expression of ZEB1, an EMT gene expression signature, and the p-Src Y416 levels (Fig. 4b). [score:5]
Because neither Itgβ1 nor FAK are predicted miR-200 family targets and neither correlated with the EMT status of the cells, we analyzed the pan-cancer TCGA datasets 34 and a separate compendium of publically-available lung cancer datasets 25 for genes with negative correlation to miR-200 family expression, high correlation to ZEB1, and predicted miR200b sites in the 3′ UTR by three different prediction algorithms (Fig. 4a and Supplemental Table 2). [score:5]
Upon re -expression of miR-200 the cells displayed a more organized epithelial acinar structure in Matrigel culture, with pronounced cortical actin staining, and suppression of the collagen -induced protrusions (Fig. 2a, bottom row). [score:5]
In this manner, direct regulation by miR-200 of the CRKL adaptor suppresses FAK/Src complex formation at the membrane and subsequent downstream signaling from collagen I-Itgβ1. [score:5]
Conversely, the ability of miR-200 expression to suppress cellular response to the ECM also explains the normalizing effects of laminin-rich matrices on tumor cells 30, a counter-balancing effect that enhances tumor cell adaptability to the microenvironment and facilitates the later steps in metastasis, such as distant colonization. [score:5]
This MET with expression of miR-200 significantly suppressed the migratory and invasive ability of the H157 cells (Fig. 1h). [score:5]
Consistently, the importance of miR-200 in modulating CRKL regulation of collagen I-Itgβ1 -dependent cell signaling was emphasized by results from multiple different experimental systems, including 2D and 3D in vitro assays with murine and human cells, knockdown -based strategies at several points in the pathway, and in vivo metastasis driven by loss of miR-200 expression in the syngeneic KP mo del. [score:4]
CRKL is a miR-200 target that regulates integrin -dependent signaling and is prognostic of patient outcome. [score:4]
Biochemically, the increased matrix responsiveness of tumor cells upon Zeb1 expression was due to enhanced FAK signaling, which was essentially shutoff with high miR-200 levels and phenocopied by CRKL or Itgβ1 knockdown. [score:4]
A very recent study from the Goodall lab 41 using breast cancer cells to identify transcriptome-wide miR-200 targets by an Ago-HITS-CLIP and sequencing approach identified multiple genes involved in invadopodia formation, MMP activity, and regulation of actin cytoskeletal dynamics. [score:4]
CRKL is a miR-200 target that regulates integrin -dependent signaling and correlates with patient outcome. [score:4]
However, the full complement of cellular functions altered during EMT that are specifically regulated by gain of Zeb1 expression and loss of miR-200 is unclear. [score:4]
The morphologic changes observed with Zeb1 expression were concordant with an EMT, as judged by the mRNA and protein levels of epithelial and mesenchymal markers (Fig. 1c) and decreases in the miR-200 family members (Fig. 1d). [score:3]
The morphologic changes, signaling activation and focal adhesion formation were completely abrogated by constitutive miR-200 expression in the cells (Fig. 5g,h and Supp Fig. S3i). [score:3]
Given the enhanced focal adhesion complex formation and signaling observed in 2D cultures, we studied the importance of the ECM in regulating tumor cell behavior in coordination with Zeb1/miR-200 expression changes in a well-established assay 33. [score:3]
This change was partially reversed by re -expression of miR-200, which restored cell-cell junctions (lower panel of Fig. 1a). [score:3]
Immunofluorescent staining demonstrated that the mesenchymal, invasive 344SQ and 393P_ZEB1 cells display extended cell protrusions, long actin stress fibers and thin cell bodies with enhanced cell matrix contact, while miR-200 expression produced rounded, clustered cells with cortical actin staining and minimal matrix contact (393P_vec or 344SQ_miR-200) (Fig. 1b). [score:3]
Zeb1 expression induces EMT/miR-200 repression and FAK pathway activation in previously non-invasive cells. [score:3]
Moreover, in the genetically manipulated 393P cells (Fig. 3b) and the inducible miR-200 -expressing human H157 cells (Fig. 3c) we observed an inverse correlation between the activation of this pathway and the miR-200 levels, with no clear relationship to the levels of Itgβ1 or total FAK. [score:3]
Our extensive prior bioinformatic analyses incorporating mRNA and proteomic profiles of tumor cells with high/low miR-200 expression revealed genome-wide changes altering the balance of cell-cell and cell-matrix interactions, along with substantial effects on the surrounding ECM composition 23. [score:3]
How to cite this article: Ungewiss, C. et al. The microRNA-200/Zeb1 axis regulates ECM -dependent β1-integrin/FAK signaling, cancer cell invasion and metastasis through CRKL. [score:2]
Two point mutations were introduced in each miR-200 seed sequence (red). [score:2]
Based upon the multiple lines of in vitro and in vivo data included herein, a schema is presented that outlines our working mo del for the role of miR-200 in regulating tumor cell activation by interactions with the ECM (Fig. 5j). [score:2]
As a master EMT regulator, the Zeb1-miR-200 double -negative feedback loop has been shown by multiple groups to play a prominent role in tumor invasion and metastasis. [score:2]
To test whether total CRKL levels are regulated by miR-200, and could therefore modulate signaling downstream of Itgβ1, we constructed a luciferase reporter containing the wild-type CRKL 3′ UTR. [score:2]
These results suggest that miR-200 repression produces a cellular EMT while also potentiating the response of the cells to external stimulation from the collagen I-containing ECM, both of which are required to produce an invasive phenotype. [score:1]
miR-200 repression alters collagen I -dependent cell-matrix interactions. [score:1]
Zeb1/miR-200 balance induces a functional EMT in non-invasive epithelial tumor cells. [score:1]
In contrast, concomitant changes in the miR-200 levels and manipulation of the matrix composition by inclusion of type I collagen produced robust invasion. [score:1]
Two isogenic cell line pairs (344SQ_vector vs 344SQ_miR-200 and 393P_vector vs 393P_Zeb1) were used to measure the expression levels of six candidates, which again identified CRKL in strong relationship with Zeb1 and miR-200 levels (Fig. 4d and Supp. [score:1]
These findings suggest that during tumor progression miR-200 loss controls cell-intrinsic EMT features and coordinates complementary changes in the surrounding tumor microenvironment. [score:1]
Our previous work with metastasis-prone tumor cells from the KP murine mo del revealed that miR-200 repression is necessary in a subset of cells at the tumor periphery to produce EMT, invasion and distant metastasis 30 31. [score:1]
miR-200 repression potentiates cells to collagen I -dependent interactions. [score:1]
s of 344SQ, paralleling the normal changes in miR-200 levels upon 3D growth (Supp Fig. S1a). [score:1]
Significance of correlation: p < 1E-12 for miR-200c, p < 1E-35 all other features. [score:1]
We wanted to further assess the importance of repression of this particular pathway as a key mediator of miR-200 action. [score:1]
[1 to 20 of 40 sentences]
29
[+] score: 116
Cumulatively, our study provided the first evidence that: (1) DOXO promotes a compensatory response in human CmPC by the CXCR4 upregulation, making this cardiac mesenchymal subpopulation more prone to respond to SDF1 protective stimuli; (2) DOXO induces the upregulation of miR-200c which, in turn, downregulates ZEB1; 3) ZEB1 binds to the CXCR4 promoter repressing its expression (Supplementary Fig. S4); (4) the activation of the SDF1/CXCR4 axis is protective both in vivo and in vitro against the adverse cardiac events induced by DOXO; (5) SDF1 treatment is able to rescue cardiac dysfunction via a miR-200c/ ZEB1/p53 pathway modulation. [score:12]
We have previously demonstrated that p53 is necessary for miR-200c upregulation by oxidative stress in EC [24] and DOXO treatment is known to induce p53 and oxidative stress; [29] in keeping, we found that ZEB1 protein was downregulated 24 h after DOXO treatment, a time point at which p53 protein expression was upregulated (Figures 4c and d). [score:12]
Since DOXO cardiotoxicity has been ascribed to oxidative stress and DNA damage, we tested the possibility that DOXO could affect the expression of miR-200c and its target protein ZEB1, that our group demonstrated to be modulated by oxidative stress and to stimulate apoptosis and senescence of HUVECs via the upregulation of miR-200c and the downregulation of ZEB1. [score:11]
[41] Notwithstanding acute upregulation of miR-200c ultimately leads to CXCR4 upregulation and consequent SDF1 -induced amelioration of cardiotoxicity, chronic upregulation of miR-200c might be one of the leading causes for the establishment of DOXO -induced apoptosis and senescence. [score:10]
Further, our results proved that miR-200c upregulation and the concomitant inhibition of its target ZEB1 is implicated in the increased expression of CXCR4. [score:10]
[41] In this study the mechanism of CXCR4 upregulation involved another transcription factor targeted by the miR-200 family that is Zinc-Finger-E-Box-Binding-Homeobox-2 (ZEB2), which also binds to and inhibits E-boxes. [score:8]
Moreover, we tested the mRNA expression levels of ZEB1 and we observed that, inversely to miR-200c, ZEB1 mRNA was downregulated by DOXO and returned to control levels in DOXO+SDF1 -treated mice (Figure 8b). [score:6]
Moreover, our results indicated that in LV specimens of mice treated with SDF1+DOXO there is a decrease of miR-200c and p53 upregulation caused by DOXO and a restoration of ZEB1 expression, explaining SDF1 positive effect also via the modulation of this molecular pathway. [score:6]
Conversely, the mRNA level of the miR-200c target ZEB1 was downregulated (Figure 4b). [score:6]
[24] Recently, we demonstrated that miR-200c upregulation is responsible of reactive oxygen species production and nitric oxide decrease by targeting three important proteins involved in endothelial function (i. e., Sirtuin1, endothelial nitric oxide synthase and Forkhead box O1), further supporting a role for this miRNA in cardiotoxicity. [score:6]
[24]We found that miR-200c was upregulated after 24 h of DOXO treatment (Figure 4a). [score:4]
[24] Since DOXO is known to induce p53 and oxidative stress, [29] the upregulation of miR-200c was expected. [score:4]
We have previously showed that p53 is necessary for miR-200c upregulation by oxidative stress in EC. [score:4]
[24] We found that miR-200c was upregulated after 24 h of DOXO treatment (Figure 4a). [score:4]
In keeping with this, the upregulation of CXCR4 by the miR-200 family was already reported in mouse embryonic stem cells upon nitric oxide treatment. [score:4]
In fact, we previously demonstrated that oxidative stress inducing miR-200c causes ZEB1 downregulation which enhances apoptosis and senescence in EC and in different cell types. [score:4]
Interestingly, SDF1 treatment upon DOXO significantly reduced miR-200c levels (Figure 8a). [score:1]
Doxorubicin modulates miR-200c/ZEB1 pathway in CmPC. [score:1]
We successively asked whether SDF1 cardioprotection was due to the modulation of miR-200c/ZEB1/p53 pathway. [score:1]
Moreover, we demonstrated a novel implication of miR-200c/ZEB1 pathway in response to DOXO. [score:1]
SDF1 partially rescues DOXO -dependent cardiac dysfunction via a miR-200c/ ZEB1/p53 pathway modulation. [score:1]
[1 to 20 of 21 sentences]
30
[+] score: 108
In the dataset we analysed in [86], all members of the miR-200 family appear to be highly up-regulated in cancer tissues (from 4- to 8- folds) and this up-regulation is counteracted by a similar, even if not comparable, overexpression of PVT1 that in cancer tissues appears to increase of about two folds. [score:9]
This observation is highly consistent with our hypothesis that the up-regulation of PVT1 in tumour samples is mostly due to the up-regulation of isoforms of the gene devoid of the key exons exerting the sponge activity on miR-200 family members. [score:7]
A large number of studies showed that the down-regulation of the miR-200 family members appears to promote the epithelial-mesenchymal transition, proving their suppressive effects on cancer cell proliferation, migration, and invasion [115– 118]. [score:6]
This up-regulation is counteracted by a similarly, but even more significant, overexpression of the miR-200 family members (see Fig 3A and 3C for the representative case of the miR-200b). [score:6]
Moreover, it revealed, in normal MMI-network, a net binding preference towards the miR-200 family, which it antagonizes to regulate the expression of hundreds of mRNAs known to be related to the cancer development and progression (e. g. GATA3, CDH1, TP53, TP63, TP73, RUNX1, and RUNX3). [score:5]
However, Park et al. [119] experimentally demonstrated how the down-regulation of all members of the miR-200 family would result in mesenchymal cell lines, while a their up-regulation would appear characteristic of an epithelial phenotype. [score:5]
From one hand, the absence in two PVT1 isoforms of the exon where the MREs for the all members of the miR-200 family reside could lead to support the hypothesis of a preferential expression in cancer tissues of these two isoforms, thus justifying the lack of the miRNA/target interaction with a consequent breakdown of the PVT1 ceRNA activity (i. e. the exon skipping mechanism). [score:5]
Specifically, PVT1 emerged as a putative ceRNA modulating the activity of all members of the miR-200 family on their target mRNAs, which are well-known to be drastically involved in breast cancer morphogenesis and development. [score:4]
The question, then, arises: if PVT1 and the miR-200 family are both up-regulated in cancer, why PVT1 stops working as sponge in cancer? [score:4]
From the other hand, the observation of a simultaneous up-regulation of the PVT1 gene and the miR-200 family members could lead to support the alternative hypothesis of different relative concentrations between each isoform and the miR-200 family members. [score:4]
This consideration together with the observed synchronised up-regulation of the PVT1 gene and the miR-200 family members encouraged us to hypothesize different scenarios that could be in principle compatible with the ceasing of the PVT1 sponge activity in breast cancer tissues. [score:4]
Interestingly, such a sponge mechanism resulted completely abolished in cancer tissues, although both PVT1 and the miR-200 family members appeared up-regulated in the pathological condition. [score:4]
This suggests the following argument of plausibility of the PCA analysis results: the first PC, which explain by alone about the 60% of the total variance of the analysed data (S2 Table), corresponds to the variation of the isoform that, missing the binding site, does not interact with the miR-200 family; while the second PC, explaining by alone about the 20% of the total variance of the analysed data (S2 Table), represents the variation of the isoform that, hosting the binding site for the miR-200b/200c/429 cluster, could be act as competitors of the targets of these miRNAs. [score:3]
The observation that both the isoforms, with and without the exons where the MREs of the miR-200 family memebrs reside, resulted expressed in both cancer and normal breast tissues undermine the truthfulness of the hypothesis rested on the exon skipping mechanism and corroborates the proposal based on the relative concentrations of the PVT1 isoforms and the miR-200 family members. [score:3]
In particular, inspiring by our amazing results of [86] and by the growing interest of the scientific community in the oncogenic role of the lncRNA PVT1, we focused on its activity as sponge modulator of the activity of the miR-200 family members on their targets and on the withdrawal of its decoy service in breast cancer tissues. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
S4 TableThis table reports the variations between cancer and normal tissues of the expression levels of all the PVT1 isoforms with respect to the variation of the TCONS_147501 isoform lacking the binding site for the miR-200 family members, showed in Fig 7A. [score:3]
According to that, a substantial decrease in cancer tissues of the relative variation of the isoform harbouring the binding site for one or more members of the miR-200 family could be due to a huge increase of the miR-200 family associated with a moderate growth in cancer of the expression levels of this PVT1 isoform. [score:3]
In particular, we thoroughly studied the intriguing phenomenon of the breakdown of the PVT1 functioning as sponge of the miR-200 family members in the breast invasive carcinoma by analysing the expression data of its multiple isoforms (S1 Table). [score:3]
We speculate that in the normal tissues only the red isoform of PVT1 gene acts as sponge regulator of the miR-200 family members. [score:2]
In both panels, the red slice corresponds to the isoform (TCONS_147426) with seed match for the miR-200b/200c/429 cluster and the blue slice corresponds to the isoform (TCONS_147501) lacking the binding site for any member of the miR-200 family. [score:1]
On the basis of the similarities of their seed sequences (i. e. 6 nucleotides at positions 2-7 from the miRNA 5’-end [113]), the miR-200 family members can be clustered into two groups only differing for one nucleotide in the seed sequence: miR-200a/141 (AA CACU) and miR-200b/200c/429 (AA UACU) [114, 115]. [score:1]
The analysis of the PVT1 genomic locus showed the existence of multiple isoforms (Fig 4 and S2 Fig) representing all the possible configurations: hosting the binding site for some (e. g. Iso6 or Iso7 in Fig 4) or all members of the miR-200 family (e. g. Iso1 in Fig 4); missing the binding site (e. g. Iso11 and Iso12 in Fig 4). [score:1]
The miR-200 family consists of five members: miR-200a, miR-200b, miR-200c, miR-141 and miR-429. [score:1]
It is connected to 753 different mRNAs (∼ 50% of total mRNAs in the network) and the miR-200 family members are arbitrating over the 80% of these interactions (Fig 2A). [score:1]
To shed light on which of the two hypothesised mechanisms lies the origin of the PVT1 stoppage as sponge, we looked at the PVT1 abundance in terms of its isoforms and we found that in both normal (Fig 5A and S3 Table) and cancer tissues (Fig 5B and S3 Table) only two isoforms represent the biggest slices: the first largest slice—which corresponds to the 50% (48%) of the PVT1 total abundance in normal (cancer) breast samples—represents the isoform missing the binding site for the miR-200 family (TCONS_147501); the second largest slice—which corresponds to the 15% (17%) of the PVT1 total abundance in normal (cancer) breast samples—represents the isoform hosting the binding site for the miR-200b/200c/429 cluster (TCONS_147426). [score:1]
S2 File This file contains the full genome sequences (in FASTA format) of the two PVT1 isoforms that mostly change between normal and cancer tissues: TCONS_147501 (missing the binding site for miR-200 family members) and TCONS_147426 (harbouring the binding site for the miR-200b/200c/429 cluster). [score:1]
0171661.g003 Fig 3The main actors of the normal MMI-network are the miR-200 family members and the long non-coding PVT1. [score:1]
The main actors of the normal MMI-network are the miR-200 family members and the long non-coding PVT1. [score:1]
More than the 80% corresponds to the miR-200 family members. [score:1]
In order to understand the meaning of these two PCs, we drew the score plot (Fig 6B and S2 Table) and found that the first PC is able to separate the contribution of the isoform missing the binding site for any members of the miR-200 family from the others, while the second PC is able to separate the contribution of the isoform hosting the binding site for the miR-200b/200c/429 cluster from the others. [score:1]
Among them, there are all members of the miR-200 family, whose importance in breast cancer is well-known and is related to the epithelial-mesenchymal transition. [score:1]
In particular, the principal component analysis suggested that the variations between cancer and normal breast tissues of all PVT1 isoforms can be explained by only two principal components: one corresponding to the isoform harbouring the binding site for the miR-200b/200c/429 cluster and the other one representing the isoform missing the binding site for any member of the miR-200 family members. [score:1]
In particular, the analysis of the normal miRNA -mediated interactions network, built in [86], pointed out how the main actors of this rewiring were PVT1 and the miR-200 family members. [score:1]
Studying the variation of each PVT1 isoform between normal and cancer breast tissues with respect to the variation of TCONS_147501, the results of PCA seems to be confirmed (Fig 7 and S4 Table): the isoform harbouring the binding site for the miR-200b/200c/429 cluster and the isoform missing the binding site for any member of the miR-200 family, are the only isoforms that change (Fig 7A). [score:1]
In this plot, it is possible to group isoforms in three classes: the isoform missing the binding site for the miR-200 family members (blue isoform, TCONS_147501), the isoform with the seed match for the miR-200b/200c/429 cluster (red isoform, TCONS_147426), and all the others. [score:1]
edu/) in order to obtain the S2 Fig. (GTF) This file contains the full genome sequences (in FASTA format) of the two PVT1 isoforms that mostly change between normal and cancer tissues: TCONS_147501 (missing the binding site for miR-200 family members) and TCONS_147426 (harbouring the binding site for the miR-200b/200c/429 cluster). [score:1]
Red boxes correspond to the binding sites for the miR-200 family members. [score:1]
In cancer tissues it stops working as sponge since its concentration is much lower than the concentration of the miR-200 family members (here is reported only the case of miR-200b). [score:1]
The role of the miR-200 family in epithelial-mesenchymal transition. [score:1]
The miR-200 family is one of the most wi dely studied for its crucial role in cancer initiation, metastasis, diagnosis, and treatment. [score:1]
0171661.g007 Fig 7(A) The variations between cancer and normal tissues of all the PVT1 isoforms with respect to the variation of the blue isoform lacking the binding site for the miR-200 family members (S4 Table). [score:1]
[1 to 20 of 42 sentences]
31
[+] score: 106
: primary mouse or human keratinocytes were transfected with miR-200c mimic or negative control RNA and allowed to migrate for 48 hours (n = 3; mean ± SE; **p < 0.001; Wilcoxon rank sum test); (e): primary mouse keratinocytes transfected with miR-200c inhibitor exhibited accelerated migration compared to the negative control (n = 3; mean ± SD; *p < 0.05; Student’s t test); (f) RT-qPCR: Accelerated wound closure induced by anti-miR-200c is associated with upregulation of genes controlling cell migration, including Zeb1, Srf, Clic4, Rac1, Met in mouse keratinocytes treated with miR-200c inhibitor (n = 3; mean ± SD; *p < 0.05; Student’s t test); (g) Ca [2+] -induced differentiation in mouse primary keratinocytes; increase in the expression of miR-200c 48 hours after Ca [2+] treatment (n = 3, mean ± SD; **p < 0.01; Student’s t test); (h) Ca [2+] -induced differentiation in human keratinocytes; increase in the expression of miR-200c at 48 h and 72 h after Ca [2+] treatment (n = 3, mean ± SD; **p < 0.01; Student’s t test); (i) Ca [2+] -induced differentiation in mouse keratinocytes; downregulation of Loricrin and Involucrin expression in primary mouse keratinocytes transfected with miR-200c inhibitor 48 hours after Ca [2+] treatment (n = 3, mean ± SD; *p < 0.05; Student’s t test). [score:18]
Transfection of mouse keratinocytes with miR-200c inhibitor resulted in decreased expression of differentiation -associated genes, such as Krt1, Lor and Ivl, while the expression of Krt14, a marker of undifferentiated keratinocytes, was not affected by miR-200c inhibition (Fig.   2g). [score:9]
Similar to in vivo observations, miR-200c expression was downregulated in both primary mouse and human keratinocytes during closure of scratch -induced wounds (Fig.   2a,b). [score:6]
Keratinocyte differentiation was induced in both primary mouse and human keratinocytes in vitro by their exposure to high calcium medium [45]; it was associated with significant upregulation in the expression of miR-200c (Fig.   2g,h). [score:6]
In addition to the transient upregulation of miR-200c during wound healing in aged mouse skin, miR-200c expression was significantly increased in the intact unwounded skin of 2-year-old mice in contrast to 8 week-old mice (Fig.   1e, Supplementary Table  2). [score:6]
All these genes have previously been shown to be involved in the control of cell migration during cutaneous wound healing 40– 43 and, more importantly, are potential target genes of miR-200c identified by the TargetScan software [44]. [score:5]
The miR-200 family consists of epithelial-specific miRNAs that are known to function as negative regulators of epithelial to mesenchymal transition (EMT) by targeting E-cadherin transcriptional repressors, zinc finger E-box -binding homeobox 1 (ZEB1) and ZEB2 [37]. [score:4]
Taken together, these data suggest that miR-200c can be involved in the regulation of different aspects of wound healing, sustaining keratinocyte differentiation and inhibiting their migration. [score:4]
miR-200c compromises wound healing in human ex vivo skinTo further demonstrate the inhibitory effects of miR-200c on skin repair induced by injury, a human ex vivo skin wound healing mo del was used as described before [48]. [score:3]
To further demonstrate the inhibitory effects of miR-200c on skin repair induced by injury, a human ex vivo skin wound healing mo del was used as described before [48]. [score:3]
Therefore, this experiment confirms that aberrant levels of miR-200c may indeed compromise wound healing by suppressing the process of re-epithelialisation. [score:3]
Therefore, the aberrant expression of miR-200c in the epithelial edges of chronic wounds (Fig.   1g) could have a negatively impact not only on keratinocyte migration, but may also interfere with their differentiation. [score:3]
In conclusion, our study for the first time 1) reports differences in the expression of miRNAs in young and aged mouse skin wounds that suggest involvement of various miRNAs in age -associated impairment in wound healing; 2) provides evidence about contribution of miR-31 to the delay in wound healing in aged skin; 3) identifies miR-200c as an important player in successful re-epithelialisation during cutaneous wound healing that can exert positive and negative effects on keratinocyte differentiation and migration, respectively. [score:3]
Transfections of the cells were performed using Lipofectamine RNAiMAX (ThermoFisher Scientific) using 100 nM miR-200c mimic (ThermoFisher Scientific), 200 nM inhibitor (Dharmacon) and corresponding negative controls according to the manufacturers’ protocol. [score:3]
The wound epithelium treated with miR-200c mimic exhibited reduced expression of Keratin 16, Keratin 17 and CD49f (Integrin, alpha 6), markers of keratinocyte migration (Fig.   3f,g,h). [score:3]
Our data suggest that the increased expression of miR-200c in aged skin could contribute to the impaired skin repair associated with ageing and might be implicated in the pathogenesis of chronic wounds. [score:3]
For BrdU analysis, the keratinocytes were seeded on collagen-coated sterile glass coverslips in a 6-well cell culture dish and transfected with miR-200c inhibitor or negative control RNA. [score:3]
Moreover, accelerated wound closure induced by anti-miR-200c in scratch assay was associated with upregulation of Zeb1, serum response factor (Srf), chloride intracellular channel 4 (Clic4), RAS-related C3 botulinum toxin substrate 1 (Rac1) and hepatocyte growth factor receptor (Met) (Fig.   2f). [score:3]
This fact makes miR-200 family members potential candidates for the regulation of re-epithelialisation during wound healing. [score:2]
miR-200c regulates keratinocyte migration and differentiation. [score:2]
miR-200c compromises wound healing in human ex vivo skin. [score:1]
Moreover, fluorescence-activated cell sorting (FACS) analysis of human immortalised keratinocytes, HaCaT cells, transfected with miR-200c mimic did not show any changes in proliferation in response to the increased levels of miR-200c (Supplementary Figure  1c). [score:1]
However, miR-200c mimic significantly reduced primary mouse and human keratinocyte migration in transwell assay (Fig.   2d), while inhibition of miR-200c in keratinocytes resulted in significant acceleration of their migration in scratch assay (Fig.   2e). [score:1]
Acute wounds were topically treated at the time of wounding with 50 μM of miR-200c mimic and corresponding scrambled control (Dharmacon) dissolved in 30% pluronic F-127 gel (Sigma) [13]. [score:1]
Next, we examined the involvement of miR-200c in keratinocyte differentiation. [score:1]
Twenty-four hours after cell seeding to the membrane in the upper chamber of the transwell insert, keratinocytes were transfected with miR-200c mimic or negative control RNA as described above. [score:1]
Similarly, miR-200c levels are higher in the human aged epidermis (Fig.   1f). [score:1]
Consistently, quantification of Ki-67 positive cells in the primary mouse keratinocytes 24 hours after transfection with miR-200c mimic also revealed no effect of miR-200c on keratinocyte proliferation (Supplementary Figure  1a,b). [score:1]
Thus, miR-200c can exert stimulatory effects on epidermal differentiation that is also known to be essential for proper wound healing. [score:1]
No significant difference in the proliferation rate was detected in anti-miR-200c treated and corresponding control groups in both mouse and human keratinocytes (Fig.   2c). [score:1]
There are multiple reasons to suggest that miR-200c may be involved in wound healing. [score:1]
Excisional wounds were treated with either miR-200c mimic or a scrambled control for 5 consecutive days (Fig.   3a). [score:1]
Possible effects of miR-200c on keratinocyte proliferation were evaluated by transfecting primary mouse and human epidermal keratinocytes with miR-200c inhibitor for 48 hours followed by quantitative analysis of bromodeoxyuridine (BrdU) positive cells. [score:1]
Elevated levels of miR-200c in the skin could contribute to the age -associated delay in wound healing and compromised skin repair in chronic wounds. [score:1]
[1 to 20 of 34 sentences]
32
[+] score: 106
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-200b, hsa-mir-141, hsa-mir-200a
Indeed, miR-200c upregulation after treatment with one of these compounds inhibited ZEB1 expression, resulting in E-cadherin induction and vimentin inhibition in breast cancer cell lines. [score:10]
To confirm that the invasiveness inhibition induced by these three substances is regulated by miR-200c, MDA-MB-231-luc-D3H2LN cells were transfected with an antisense oligonucleotide targeting miR-200c (miR-200c inhibitor) in the presence of these molecules. [score:8]
This result indicates that, in response to treatment with natural substances, the increased expression of miR-200c leads to ZEB1 inhibition through direct targeting of its 3′ UTR. [score:8]
We selected miR-200c to serve as a reporter in this study because we previously demonstrated that resveratrol suppresses breast cancer cell malignancy by increasing the expression of miR-200c, and we provided evidence of the tumour-suppressor activity of this specific miRNA 15. [score:7]
In this study, we identified three agents — enoxolone, magnolol and palmatine chloride —that upregulate miR-200c expression. [score:6]
Using the tumour-suppressor miRNA miR-200c as a reporter, we demonstrated that enoxolone, magnolol and palmatine chloride can have positive effects on cells by downregulating oncogenes. [score:6]
In addition, miR-200c activation inhibits ZEB1 expression, resulting in E-cadherin induction in breast cancer cells 18. [score:5]
We hypothesised that the induction of miR-200c by natural products may have a similar effect on ZEB1 and E-cadherin expression, leading to tumour suppression. [score:5]
Inhibition of ZEB1 and enhancement of E-cadherin expression through miR-200c induction by enoxolone, magnolol or palmatine chloride. [score:5]
As shown in Fig. 3C,D, the tumour-suppressor effect of each natural compound was abrogated by the addition of miR-200c inhibitor as the invasiveness of the MDA-MB-231-luc-D3H2LN cells increased. [score:5]
Taken together, these results suggest that enoxolone, magnolol and palmatine chloride have an important role in breast cancer prevention by upregulating miR-200c. [score:4]
To identify natural compounds that activate tumour-suppressor miRNAs, we designed a reporter system to monitor miR-200c activity. [score:3]
Then, from our screening data, we selected three substances — enoxolone, magnolol and palmatine chloride — that strongly induced miR-200c expression (Supplementary Table S1, Fig. 2C). [score:3]
Inhibition of invasive activity through the enhancement of miR-200c activity by natural substances. [score:3]
To monitor miR-200c activity, we generated a reporter sensor vector that expresses a version of firefly luciferase and contains tandem -binding sites with a precise complementary sequence to miR-200 c. If the level of miR-200c increases after treatment with a natural substance, the firefly luciferase activity decreases. [score:3]
A recent study demonstrated that miR-200c strongly inhibits the invasion ability of breast cancer cells 16. [score:3]
The values on the y-axis are depicted relative to the miR-200c expression in the DMSO -treated cells (Control), which is defined as 1.0. [score:3]
As shown in Fig. 2A, transfection with miR-200c mimic significantly downregulated the firefly luciferase activity in pmiR-200c-MCF7 cells compared with transfection with the control miRNA. [score:3]
As shown in Fig. 1A, our sensor vector expresses a version of firefly luciferase that contains a sequence complementary to miR-200c in its 3′ UTR region. [score:3]
Identification of natural products that activate miR-200c expression. [score:3]
By contrast, firefly luciferase activity was not altered in response to miR-200c induction in pmiR-control-MCF7 cells (Fig. 2A). [score:1]
Taken together, these results demonstrate that the anti-cancer effect of these natural products is mediated by the induction of miR-200c. [score:1]
Screening method for the identification of molecules that promote miR-200c activity. [score:1]
The natural compounds enoxolone, magnolol and palmatine chloride show a miR-200c -dependent anti-cancer activity. [score:1]
Taken together, these results suggest that these natural compounds could contribute to the prevention of breast cancer via the modulation of the miR-200c/ZEB1/E-cadherin pathway. [score:1]
Stable MCF7 cell lines used to monitor miR-200c activity were generated by selection with geneticin (500 μg/mL). [score:1]
Natural product screening to identify agents that enhance miR-200c activity. [score:1]
In this system, firefly luciferase activity decreases when miR-200c activity is increased and vice versa (Fig. 1B). [score:1]
Then, to validate that miR-200c directly modulates ZEB1 protein levels, we performed ZEB1 3′ UTR assays. [score:1]
These data suggest that our screening method is suitable for identifying natural substances with miR-200c activation capacity in breast cancer cells. [score:1]
[1 to 20 of 30 sentences]
33
[+] score: 105
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-141, hsa-mir-200a, hsa-mir-429
Treatment of resveratrol could upregulate the expression of miR-200c and EZH2/H3K27me3 to repress ZEB1 expression and leads to the inhibition of myofibroblast properties in fibrotic BMFs and may benefit to OSF disease, the pre-cancerous lesion of oral cavity. [score:12]
In this study, we determined that resveratrol inhibited the fibrotic features of fBMFs derived from OSF tissues via the epigenetic inhibition of ZEB1: the upregulation of miR-200c and EZH2/H3K27me3 expression. [score:10]
From these results, we hypothesized that resveratrol could inhibit the myofibroblast properties of fBMFs derived from OSF tissues, including the contraction activity and expression of fibrotic genes (α-SMA, collagen, or S100A4) through the epigenetic repression of ZEB1, which was composed of the upregulated miR-200c and EZH2/H3K27me3 expression (Figure 7). [score:10]
In our study, we observed that resveratrol inhibited the fibrotic features of fBMFs and could upregulate the expression of miR-200c (Figure 4B and 4C). [score:8]
In addition to miR-200c, H3K27me3 is associated with the downregulation of ZEB1 expression [20]. [score:6]
Thus, we examined if resveratrol upregulated miR-200c expression in fBMFs. [score:6]
Among the 8 cases, 6 specimens displayed downregulation of either EZH2 or miR-200c (Figure 6E). [score:4]
The downregulation of the miR-200 family by TGF-β1 could also be observed in human biliary epithelial cells as a mo del of liver fibrosis [27]. [score:4]
The tumor growth factor (TGF)-β1 was used to induce EMT of renal tubular epithelial cells, and the downregulation of the miR-200 family was observed via a Smad signaling -dependent mechanism [26]. [score:4]
The effect of resveratrol in miR-200c expression of fibrotic BMFs. [score:3]
miR-200c expression was determined by quantitative RT-PCR method and presented as fold change of ethanol treated group. [score:3]
In OSF tissues, the expression levels of ZEB1 and miR-200c also displayed a reverse correlation (Figure 6E). [score:3]
Resveratrol induces miR-200c expression in fBMFs. [score:3]
Resveratrol treatment of fBMFs induced the expression of miR-200c and the enhancer of zeste homolog 2 (EZH2) to trimethylate lysine 27 of histone 3 (H3K27me3). [score:3]
Finally, we determined the expression of ZEB1 and miR-200c in 12 OSF tissues and their adjacent normal oral mucosa. [score:3]
ZEB1 is a well-known target of miR-200c [19]. [score:3]
These results suggest that the miR-200 family may protect against OSF disease. [score:3]
E. The expression of EZH2, ZEB1 and miR-200c in OSF tissues and their adjacent normal mucosa was determined by qRT-PCR. [score:3]
, Guangzhou, China) was used for detection of miR-200c expression. [score:3]
The miR-200 family, which consists of miR-200a, miR-200b, miR-200c, miR-141, and miR-429, is known for its capability to regulate epithelial-mesenchymal transition (EMT) program in cancer cells via the posttranscriptional repression of ZEB1 or ZEB2 [24]. [score:2]
Quantitative RT-PCR (qRT-PCR) analysis indicated that resveratrol treatment significantly increased miR-200c expression in two fBMF cell lines compared with the ethanol control (Figure 5A and 5B). [score:2]
The role of PPARα in the up-regulation of miR-200c in resveratrol treated fBMFs remains to be further investigated. [score:2]
The repression of the miR-200 family could also cause EMT of the renal tubular epithelium, which could be reversed by the knockdown of ZEB1 [26]. [score:2]
miR-200c expression was determined by SYBR Green reagent and specific Bulge-Loop [TM] forward and reverse primers by following cycling reaction: 95°C for 20 sec followed by 40 cycles of 95°C for 10 sec, 60C for 20 sec and 70C for 10 sec. [score:2]
miR-200c expression of each group was normalized to U6 snRNA and calculated the fold changes in comparison with 0.1% EtOH treated samples. [score:1]
[1 to 20 of 25 sentences]
34
[+] score: 104
Among those significantly differentially expressed miRNAs, five downregulated (miR-26b-5p, miR-200c-3p, miR-203a, miR-223-3p, miR-363-3p) and three upregulated (miR-328, miR-574-3p, miR-1825) miRNAs were selected as a result of detailed literature search for further confirmation with qRT-PCR. [score:9]
MicroRNA profiling of CD133 [+] and CD133 [−] LCa samples with microarray revealed that miR-26b, miR-203, miR-200c, and miR-363-3p were significantly downregulated and miR-1825 was upregulated in CD133 [+] larynx CSLCs. [score:7]
Additionally, miR-200c was reported to repress epithelial-to-mesenchymal transition through directly targeting and inhibiting ZEB1 and ZEB2 transcription factors [71]. [score:6]
Besides, miR-200c was found to be strongly downregulated in Oct3/4, Sox2, and Nanog overexpressing CD133 [+] ovarian cells [69]. [score:6]
c Relative expression levels of miR-200c in each CD133 [+] and CD133 [−] sample pairs, and (d) mean relative expression levels miR-200c in CD133 [+] cells with respect to CD133 [−] cells. [score:5]
As to the analysis of validated targets of these miRNAs, miRTarBase database analysis revealed that miR-26b, miR-200c, miR-203, and miR-363-3p, and miR-1825 cooperatively target stem cell associated signaling pathways like Wnt, Hedgehog, and Notch (Fig.   4). [score:5]
Besides, coordinated loss of miR-200c and miR-203 has been found to result in enhanced translation of the multiple targets and chronic activation of NF-κB, PI3K-Akt, and Ras-Erk pathways, leading to B cell transformation, which suggest that collaborative actions of multiple miRNAs rather than a single miRNA ensure the robustness of biological processes [82]. [score:5]
Expressions of miR-26b, miR-200c, and miR-203 were significantly correlated with miR-363-3p, miR-203, and miR-363-3p expressions, respectively. [score:5]
Among those, miR-26b (Fig.   2a, b), miR-200c (Fig.   2c, d), miR-203 (Fig.   2e, f), and miR-363-3p (Fig.   2g, h) were found to have significantly reduced expression in CD133 [+] larynx CSLCs, whereas miR-1825 (Fig.   2i, j) were validated to have increased expression in these CD133 enriched LCa cells. [score:5]
We here also demonstrated that miR-200c, and miR-203 expressions were significantly correlated with miR-203, and miR-363-3p expressions, respectively, in CD133 [+] LCa tissue samples. [score:5]
Correlation of those microRNAs expressions supports a recent report, which demonstrated that decreased expressions of miR-200c, miR-363, and miR-203 were associated with poor prognosis in human head and neck squamous cell carcinoma [81]. [score:5]
Additionally, miR-200c and miR-203 cooperatively inhibit stem cell factors’ expressions in both cancer cells and mouse embryonic stem cells [80]. [score:5]
In this study, we have found miR-200c and miR-203 to be downregulated in CD133 [+] larynx CSLCs, supporting their potential involvement in carcinogenesis as driving forces for tumor initiation, progression, metastasis, and recurrence. [score:4]
As one of the central regulators of epithelial mesenchymal transition (EMT), abnormal expression of miR-200c was found to alter several important biological processes implied in cell–cell contact, cell adhesion and motility [72]. [score:4]
Loss of miR-200 expression was observed during conversion of immortalized human mammary epithelial cells to a stem-like phenotype [68]. [score:3]
Furthermore, miRWalk analysis showed that 3’UTR of several oncogenes were predicted to be targeted by miR-26b (202 out of 348 oncogenes), miR-200c (161 out of 348 oncogenes), miR-203 (216 out of 348 oncogenes), and miR-363-3p (175 out of 348 oncogenes). [score:3]
CSLCs isolated from metastatic breast tumor tissues also exhibited reduced miR-200 expression [68]. [score:3]
Interestingly, reduced miR-200c expression was significantly correlated with recurrence in LCa [73]. [score:3]
Besides, we included miR-200c and miR-203 since they are strongly associated with stemness and cancer, although these miRNAs are not in the top 10 differentially expressed miRNAs. [score:3]
To validate the differential expression of miR-26b, miR-200c, miR-203, miR-223, miR-328, miR-363-3p, 574-3p, and miR-1825, a total of 25 pairs of CD133 [+] and CD133 [−] cell populations collected from 25 tumor samples including those used in microarray experiments were studied. [score:3]
To evaluate their correlation, we used Pearson correlation analysis, which demonstrated that miR-26b, miR-200c, and miR-203 expressions were significantly correlated with miR-363-3p, miR-203, and miR-363-3p expressions, respectively, in CD133 [+] LCa tissue samples (Fig.   3). [score:3]
In addition to miR-200c and miR-203, which have been demonstrated in distinct cancers as having CSLCs specific deregulation pattern, we propose miR-1825, miR-363-3p, and miR-26b as specific miRNAs with potential roles in acquisition and maintenance of stem cell associated features as well as in contributing to tumor initiation, progression, metastasis, chemoresistance, and recurrence. [score:2]
MiR-200c expression was significantly reduced in ALDH1+/CD44+ cells with cancer stem cell potency in head and neck squamous cell carcinoma [70]. [score:2]
Yellow, high fold change in CD133 [+] patient sample as compared to its corresponding CD133 [−] paired sample; blue, high fold change in CD133 [−] sample compared to CD133 [+] paired sample The qRT-PCR results confirmed that five of the eight selected miRNAs had a differential expression between groups: miR-26b, miR-200c, miR-203, miR-363-3p, and miR-1825 (Fig.   2, p values and fold changes are provided in Table  2). [score:1]
MiR-200c and miR-203 have previously been extensively studied in various contexts, and both miRNAs are associated with the stemness of normal stem cells and CSLCs. [score:1]
Yellow, high fold change in CD133 [+] patient sample as compared to its corresponding CD133 [−] paired sample; blue, high fold change in CD133 [−] sample compared to CD133 [+] paired sample The qRT-PCR results confirmed that five of the eight selected miRNAs had a differential expression between groups: miR-26b, miR-200c, miR-203, miR-363-3p, and miR-1825 (Fig.   2, p values and fold changes are provided in Table  2). [score:1]
[1 to 20 of 26 sentences]
35
[+] score: 99
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2, hsa-mir-200b, hsa-mir-141, hsa-mir-200a
Alternatively, the lack of ZEB1 downregulation could be due to the fact that the expression levels of miR-200c and -141 did not reach a certain threshold necessary to substantially reduce ZEB1 expression levels. [score:8]
To exclude the possibility that activation of the miR-200c/141 cluster observed by chemical demethylation was mainly due to an indirect effect, e. g. activation of third party transcription factors, we next explored if expression of the miRNA cluster could be directly inhibited by DNA methylation. [score:7]
Interestingly, in clones established after experimental knockdown of ZEB1 in MDA-MB-231 cells, others observed an upregulation of miR-200c/141 expression [19]. [score:7]
Interestingly, we did not observe a decrease in expression of ZEB1 at mRNA or protein levels (data not shown), although it was described as a target of the miRNA-200 family [2- 4]. [score:5]
With respect to the EMT process, observations suggest that members of the miRNA-200 family (especially the two clustered miRNAs miR-200c and miR-141) play a prominent role as metastasis suppressor genes by preventing the expression of zinc finger E-box binding homeobox 1 (ZEB1), which in turn promotes EMT and the switch to an invasive phenotype [4, 7- 10]. [score:5]
Secondly, ectopic expression of the EMT inducer Twist led to a limited increase of DNA methylation in the miR200c/141 promoter, which was nevertheless accompanied by complete shut down of miRNA expression. [score:5]
Firstly, in vitro methylation experiments showing how DNA methylation of the miR200c/141 locus shuts down expression of miR-200c and miR-141 provides a functional link between DNA methylation of the promoter and expression of the miR-200c/141 locus. [score:5]
The present study demonstrates that expression of the miR-200c/141 cluster is regulated by DNA methylation, suggesting epigenetic regulation of this miRNA locus in aggressive breast cancer cell lines as well as untransformed mammary epithelial cells. [score:5]
Little is known about the regulation of the mir200c/141 cluster, whose targeting has been proposed as a promising new therapy for the most aggressive tumors. [score:4]
Indeed, after in-vitro methylation, promoter activity was strongly silenced (Fig. 2B) and together, these observations suggest a direct role of DNA methylation in transcriptional regulation of the miR-200c/141 cluster. [score:3]
Whereas in vitro methylation of the miR-200c/141 promoter led to shutdown of promoter activity, treatment with a demethylating agent caused transcriptional reactivation in breast cancer cells formerly lacking expression of miR-200c and miR-141. [score:3]
Given the reported role of miRNA-200c and miRNA-141 in metastasis formation [16, 17] and, more recently, in tumorigenesis, development and stem cells homeostasis [14, 24] we speculated that this locus might be subject to epigenetic regulation. [score:3]
To further explore the role of DNA methylation for repression of the miR-200c/141 cluster in the course of EMT, we took advantage of an in-vitro EMT mo del, which is based on ectopic expression of the EMT transcription factor Twist in non-transformed immortalized human mammary epithelial cells (HMLE) [28]. [score:3]
Importantly, loss of expression of miRNA-200 family members correlates with EMT in various tumor entities such as breast [4], renal [11], and ovarian [2] cancer and thus seems to be a conserved pathway promoting metastasis formation. [score:3]
Of note, the expression levels in the epithelial cell lines were substantially higher than the levels we could reach by demethylation of the mesenchymal MDA-MB-231 line, which is again consistent with incomplete demethylation of the miR-200c/141 promoter during 5-AZA-CdR treatment (Additional file 1: Supplementary Figure S2). [score:3]
During preparation of this manuscript, a correlation between the expression levels of miR-200c/141 and the degree of DNA methylation of the promoter -associated CpG island was also reported by Vrba and colleagues [29]. [score:3]
In line with this, in vitro induction of EMT by ectopic expression of the EMT transcription factor Twist in human immortalized mammary epithelial cells (HMLE) was accompanied by increased DNA methylation and concomitant repression of the miR-200c/141 locus. [score:3]
The present study goes beyond the correlative analysis by providing evidence that expression of the miR-200c/141 locus is indeed partly controlled by DNA methylation. [score:3]
This might explain the observation previously made by us and others [4, 23] that miR-200c is usually expressed at higher levels compared to miR-141. [score:2]
Importantly, the effect of Twist on DNA methylation levels shown in our study further stresses the functional relevance of epigenetic changes in the miR200c/141 locus and suggests a potential role for epigenetic regulation of EMT. [score:2]
Bands shown for the miRNAs correspond to the mature forms of miR-141 (22bp) and miR-200c (23bp). [score:1]
Our observation, that the miR-200c/141 cluster is epigenetically regulated by DNA methylation, prompted us to investigate whether DNA methylation of these miRNAs correlates with their reported role in the regulation of tumorigenicity and invasiveness. [score:1]
Upon in-silico inspection, a high-score splice donor site (boundary exon/intron) was detected between the two miRNAs in position +373, supporting the existence of an alternative splicing variant that splices out miR-141 and conserves the miR-200c transcript. [score:1]
Recently, specific microRNAs (miRNAs), namely members of the miRNA-200 family including miR-200c and miR-141, have been implicated in this process [2- 4]. [score:1]
The miR-200c/141 cluster has recently been implicated in the epithelial to mesenchymal transition (EMT) process. [score:1]
Previously published results pointed out the region encompassing positions -683 to -67 (relative to the precursor miRNA-200c (pre-miRNA-200c) first nucleotide) as relevant for transcription [18, 19], therefore we concentrated our attention on this area. [score:1]
This opens the possibility that ZEB1 might be necessary for maintaining DNA methylation of the miR-200c/141 promoter. [score:1]
Sequence analysis revealed the presence of a well-defined CpG island between positions -343 to -115, upstream of the miR-200c/141 cluster (Fig. 1A). [score:1]
Figure 1 The promoter of the miR-200c/141 cluster is located in a CpG-rich region. [score:1]
We show that the miR-200c/141 cluster is repressed by DNA methylation of a CpG island located in the promoter region of these miRNAs. [score:1]
As these complexes promote DNA methylation via interaction with DNMTs [32], ZEB1 could indeed enforce DNA methylation of the miR-200c/141 promoter. [score:1]
The EMT process was accompanied by DNA hypermethylation and transcriptional silencing of the miR-200c/141 promoter (Fig. 4B and 4C). [score:1]
For this purpose, we analyzed the DNA methylation status of the miR-200c/141 locus in a panel of 8 different breast cell lines of divergent origin. [score:1]
The data thus suggest that effective silencing of the miR-200c/141 locus is already achieved by intermediate levels of DNA methylation. [score:1]
More importantly, we observed that DNA methylation of the identified miR-200c/141 promoter was tightly correlated with phenotype and the invasive capacity in a panel of 8 human breast cancer cell lines. [score:1]
Although the present work supports the idea that changes in DNA methylation of this particular locus might be involved in EMT, it remains to be determined if the initial trigger to shutdown the miR-200c/141 promoter during the EMT process is given by changes in DNA methylation levels or binding of repressors (as ZEB1, ZEB2, or Twist) to the promoter or if several of these repressor mechanisms act simultaneously and synergistically. [score:1]
Nonetheless, the above observations do not exclude that under physiological conditions, ZEB1 still is sensitive to changes in DNA methylation of the miR-200c/141 locus. [score:1]
[1 to 20 of 37 sentences]
36
[+] score: 90
Although inhibition of miR-200c did not yield consistent results, overexpression of both miRNAs decreased their respective target (BMI1 and EZH2) at the mRNA level, suggesting that overexpressed miRNA during cellular senescence regulates the expression levels of BMI1 and EZH2. [score:12]
Because the absolute quantity of miR-200c was relatively lower than that of miR-214 in early passages of hUCB-MSCs and expression of miR-200c would be in an inhibited state in early passage cells compared to senescent cells, additional miR-200c inhibition may have no effect on BMI1 expression. [score:8]
According to the results shown in Figure 4, DNMT inhibition induced the expression of miR-200c and miR-214, which target PcGs. [score:7]
MiR-200c and miR-214 were previously reported to target BMI1 and EZH2, respectively, in studies that showed that miR-214 targets Ezh2 in skeletal muscle and embryonic stem cells and that miR-200c targets BMI1 in breast cancer stem cells [33], [46]. [score:7]
Inhibition or overexpression of miRNAs was achieved by commercial antisense miRNAs or mature miRNAs of hsa-miR-200c and hsa-miR-214 with an appropriate miRNA precursor -negative control (mature miRNA: Invitrogen, USA, anti-miRNA inhibitor: Ambion, USA, and miRNA precursor -negative control #1, Ambion, USA). [score:7]
To confirm whether the targets of miR-200c and miR-214 are BMI1 and EZH2, respectively, in hUCB-MSCs, we performed miRNA inhibition and overexpression experiments using transient transfection of anti- and mature-miRNA oligonucleotides. [score:7]
After overexpression of miR-200c and miR-214, MSCs underwent cellular senescence, as shown by SA β-gal staining, and BMI1 and EZH2, the respective targets of miR-200c and miR-214 were decreased, as shown by real-time qPCR (Fig. 6d and 6e). [score:5]
It is well known that miR-214 targets EZH2 and that miR-200c targets BMI1 [33], [46]. [score:5]
However, after inhibition of miR-200c, BMI1 expression was not changed at the mRNA level. [score:5]
Next, to confirm whether miR-200c and miR-214 regulate BMI1 and EZH2 expression levels in hUCB-MSCs, we performed transient transfection of antisense or mature miRNA oligonucleotides. [score:4]
We confirmed that miR-200c and miR-214 were up-regulated in senescent hUCB-MSCs. [score:4]
However, anti-miR-200c did not regulate BMI1 mRNA expression levels. [score:4]
By real-time qPCR analysis, we confirmed that miR-200c and miR-214 were up-regulated in senescent hUCB-MSCs (Fig. 6a). [score:4]
MiR-200c, which targets BMI1, is one of the important miRNAs that are epigenetically repressed in breast cancer cells. [score:3]
DNMT inhibition modified histone marks, transcriptional enzymes as well as the CpG island methylation status in the vicinity of miR-200c and 214 genomic regions. [score:3]
Transfection of mature miR-200c also decreased BMI1 expression. [score:3]
This study shows that miR-200c and miR-214 are related not only to cancer cells but also to the cellular senescence of MSCs, linking DNA methylation and PcG-related histone modification. [score:1]
A significant increase in RNA polymerase II bound on the indicated locations shows that the transcriptional activities might be increased at both miR-200c and miR-214 genomic regions. [score:1]
[1 to 20 of 18 sentences]
37
[+] score: 87
As a matter of fact, the over -expression of miR-200c down-regulates both cMaf mRNA and protein expression with the subsequent decrease in Gcg RNA and suppresses Zfpm2 at both RNA and protein levels, effectively attenuating the α-cell phenotype. [score:10]
To test if the expression of miR-200c, miR-125b and miR-182 could contribute to the low expression of cMaf in beta cells, Min6 cells were transfected with a combination of 200 nM each miR-200c, miR-125b, and miR-182 exogenous hairpin inhibitors (Dharmacon-Thermo Scientific). [score:7]
miR-200c down-regulated the expression of cMaf mRNA and protein. [score:6]
The overexpression of miR-200c also downregulated Zfpm2 mRNA and protein levels (Fig. 4C ). [score:6]
Compared to irrelevant negative control the transfected mimic miR-200c significantly down-regulated the 3′UTR reporter activity (Fig. 4A ), indicating that miR-200c recognized the specific site on 3′-UTR of cMaf and could modulate the expression and function of this gene. [score:5]
72 hrs overe-xpression of mimic miR-200c (50 nM) inhibits the expression of endogenous cMaf (RNA and protein) and RNA Gcg, (n = 8), * p = 0.0078 and 0.0495 (Gcg), Wilcoxon signed rank test-2 tails. [score:5]
B. miR-200c inhibits Maf, Gcg expression in α-TC6 cells. [score:5]
We then over-expressed miR-200c in αTC6 cells and analyzed the effects on cMaf and Zfpm2 expression. [score:5]
Among the β-miRNAs potentially targeting cMaf are miR-125b, miR-182 and miR-200c, which are 27.3-, 9.7- and 3.3 fold more expressed in β-cells (Table 1 ). [score:5]
The difference in expression is particularly high because miR-200c is almost undetectable in alphaTC6 cells. [score:3]
C. miR-200c inhibits Zfpm2 at RNA and protein levels, (n = 8), * p = 0.0078, Wilcoxon signed rank test-2 tails. [score:3]
To asses if cMAf is a target for miR-200c, the firefly Luciferase was used as a reporter gene. [score:3]
In addition, miR-200c has been shown to target Zfpm2 [42]. [score:3]
miR-200c targets the 3′UTR of cMaf. [score:3]
B. Differential expression of β-miRNAs: miR-200c, miR-125b and miR-182 assessed by qRT-PCR. [score:3]
Conversely, inhibition of miR-200c, miR-125b and miR-182 in Min6 cells increased the amount of cMaf transcripts. [score:3]
To demonstrate if the cMaf 3′UTR is a target of miR-200c, αTC6 cells were co -transfected with luciferase reporter containing the 3′-UTR of murine cMaf and exogenous mimic miR-200c or irrelevant negative control mimic. [score:3]
Moreover, in Min6 the expression of miR-125b, miR-182 and miR-200c is much higher than in alpha TC6. [score:3]
Both miR-200c and Zfpm2 are conserved components of the insulin pathway, a critical regulator of metabolism and cell/tissue growth in animals. [score:2]
In n = 4 independent experiments we found a 222 fold (Min6 vs alphaTC6) for miR-125b, 27 fold for miR-182 and 166×103 for miR-200c (Fig. 3B ). [score:1]
U6 small nuclear RNA was used as endogenous control, mean ± SD (n = 4), * p = 0.005, 0.005 and 0.0022 (t-test, 2 tails) for miR-200c, miR-125b and miR-182. [score:1]
The pEZX- MT01-cMaf 3′UTR-fLuc (GeneCopoeia; Rockville MD) vector (1 µg) was transfected into cells with Dharmafect duo (Dharmacon -Thermo Scientific Lafyate CO) alone or together with either mimic miR-200c (50 nM) or irrelevant mimic (50 nM) (Thermo Scientific –Dharmacon). [score:1]
α-TC6, transfected either with 50 nM mimic miR-200c, mimic miR-182,, mimic miR-125b or irrelevant control were lysed in SDS, Tris-HCL buffer (pH 6.8), and aliquots corresponding to 1.8 to 2.6 µg of protein (for cMaf nuclear proteins) were subjected to. [score:1]
[1 to 20 of 23 sentences]
38
[+] score: 86
Other miRNAs from this paper: hsa-mir-21, hsa-mir-200b, hsa-mir-200a
In contrast, we found that the CDF treatment with or without gemcitabine combination showed increased expression of both miR-200b, and miR-200c, but the effect with curcumin or its combination was minimal, suggesting the superiority of CDF in suppressing the expression of miR-21, resulting in the re -expression of PTEN, and re -expression of miR-200 which could be responsible for the reversal of EMT phenotype in cells treated with CDF. [score:11]
We also showed anti-tumor activity of CDF alone and in-combination with gemcitabine, which was consistent with inactivation of miR-21, and consequently increased expression of PTEN, attenuation of the DNA binding activity of NF-κB inhibition in the expression of COX-2, and activation in the expression of miR-200 in tumor remnants of a xenograft mouse mo del of human PC, all of which provide convincing in vivo activity of CDF which is consistent with in vitro findings. [score:9]
In contrast to miR-21, miR-200 family is known as tumor suppressor and they are usually down-regulated in some tumors including PC and the loss of expression of miR-200 family contribute to the acquisition of EMT phenotype and drug resistance. [score:8]
In a xenograft mouse mo del of human PC, CDF treatment significantly inhibited tumor growth, which was associated with decreased NF-κB DNA binding activity, COX-2, and miR-21 expression, and increased PTEN and miR-200 expression in tumor remnants. [score:7]
Down-regulation of miR-200 by siRNA technique has been shown to be associated with EMT phenotype while re -expression of miR-200 can result in the reversal of EMT phenotype [29], [30]. [score:6]
Here we showed, for the first time, that CDF can up-regulate miR-200b and miR-200c in tumor remnants in vivo, consistent with significantly greater inhibition of tumor growth in the xenograft mouse mo del when CDF was used in combination with gemcitabine. [score:6]
CDF exhibited anti-tumor activity in MIAPaCa-2 cells induced tumors in a xenograft mouse mo del, which was consistent with inhibition of NF-κB DNA binding, COX-2, miR-21, and caused re -expression of miR200 in tumor remnants. [score:5]
Modulation in the expression of miR-21 and miR-200 family in vivo We determined the expression levels of miR-21, miR-200b and miR-200c in MIAPaCa-2 tumors by real time RT-PCR. [score:5]
We further determined the expression levels of miRNA-200b and miR-200c in tumor tissues which are known regulators of EMT and found to be significantly low in MIAPaCa-2 cells (Figure 7D). [score:4]
These results suggest that the anti-tumor activity of CDF is mediated via re -expression of miR-200 which may potentially results in the reversal of EMT phenotype and could also lead to overcome drug resistance in PC. [score:3]
Western blots analysis of COX-2, PTEN and β-actin expression in tumor remnants (C); miR-21, miR-200b and miR-200c expression in tumor remnants as measured by real-time RT-PCR (D). [score:3]
In our previous publication [12], we demonstrated that CDF treatment could re-express miR-200 in PC cells. [score:3]
Modulation in the expression of miR-21 and miR-200 family in vivo. [score:3]
Recently, we have developed a novel synthetic analogue of curcumin, 3,4-difluoro-benzo-curcumin [we named it as Difluorinated-Curcumin or in short CDF [10], [11]], which showed greater bioavailability in pancreatic tissues, and also inhibited cell growth, DNA -binding activity of NF-κB, Akt, COX-2, and the production of PGE [2] and VEGF, and caused induction of miR-200 and inactivation of miR-21 in PC cells [12]. [score:3]
We determined the expression levels of miR-21, miR-200b and miR-200c in MIAPaCa-2 tumors by real time RT-PCR. [score:3]
In the current study we showed, for the first time, that CDF could significantly inhibit the sphere-forming ability (pancreatospheres) of PC cells consistent with increased disintegration of pancreatospheres, which was associated with attenuation of CSC markers (CD44 and EpCAM), especially in gemcitabine-resistant (MIAPaCa-2) PC cells containing high proportion of CSCs consistent with increased miR-21 and decreased miR-200. [score:3]
To determine the expression of miRNAs (miRNA-200b, miR-200c, and miR-21) in MIAPaCa-2 tumors, we used TaqMan MicroRNA Assay kit (Applied Biosystems) following manufacturer's protocol. [score:2]
In xenograft mouse mo del of human PC tumors induced by MIAPaCa-2 cells, CDF exhibits anti-tumor activity by regulating COX-2, PTEN, miR-21, miR-200, and NF-κB in vivo. [score:2]
[1 to 20 of 18 sentences]
39
[+] score: 83
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, hsa-mir-200b, hsa-mir-200a
In rat INS-1 cells and mouse islets, miR-200 has been found to inhibit EMT by direct targeting of Zeb1 transcripts, thereby increasing E-cadherin expression 39. miR-200c levels increased more than 3-fold following ZEB1 inhibition. [score:10]
ZEB1 inhibition in expanded islet cells had a similar effect on these two miR-200c targets: SOX6 expression was significantly decreased by 33%, while SOX2 was downregulated by 15%, (Fig. 6D). [score:10]
Expression of SOX6 and SOX2, two transcription factors encoded by transcripts targeted by miR-200c 30 31, was downregulated in expanded islet cells overexpressing miR-200c by 43% and 37%, respectively (Fig. 6C). [score:10]
SOX6 was shown to inhibit transactivation of the insulin gene by PDX1 32, suggesting that its downregulation by miR-200c may stimulate insulin gene expression. [score:8]
miR-200 family expression has been identified in human islets and found to be highly downregulated during BCD cell dedifferentiation 29. [score:6]
miR-200c was found to be significantly upregulated 3.3-fold following ZEB1 inhibition (Fig. 6A), while miR-200a and miR-200b were not significantly affected (see Supplementary Fig. S4 online). [score:6]
We hypothesized that the ZEB1/miR-200 feedback loop may account in part for the ZEB1 effects on EMT, cell proliferation, and inhibition of insulin expression in expanded BCD cells. [score:5]
We therefore studied the effect of miR-200c overexpression on redifferentiation of expanded islet cells using a retrovirus vector expressing pre-miR-200c. [score:5]
Insulin expression and cell proliferation in expanded islet cells is regulated by the ZEB1/miR-200 negative feedback loop. [score:4]
Using a miRNA microarray we have recently identified the miR-200 family among miRNAs highly downregulated during BCD cell dedifferentiation 29. [score:4]
miR-200c levels in transduced cells were upregulated by 770 ± 550 fold (mean ± SE; n = 3; p = 0.03). [score:4]
ZEB1 inhibition in BCD cells is associated with miR-200c activation. [score:3]
Two miR-200c targets, SOX6 and SOX2, are suggested as possible mediators of the miR-200c effects. [score:3]
For miR-200c retrovirus production, the pre-mmu-miR-200c miR-VEC-Blasticidin vector 42 was co -transfected into human embryonic kidney 293T cells with the Ampo-helper packaging plasmid. [score:1]
Additionally, treatment of expanded islet cells with RC stimulated a similar increase in miR-200c levels (Fig. 6B), suggesting that miR-200c played a role in BCD cell redifferentiation induced by RC. [score:1]
An increase in miR-200c levels upon RC treatment may explain the synergistic effect of combined ZEB1 shRNA and RC treatments on BCD cell redifferentiation. [score:1]
Our findings suggest that the effects of ZEB1 in BCD cells are likely mediated, at least in part, by the ZEB1/miR-200c feedback loop. [score:1]
To investigate a possible involvement of miR-200, RNA from sorted eGFP-labeled BCD cells treated with ZEB1 shRNA was analyzed by qPCR for miR-200 expression. [score:1]
[1 to 20 of 18 sentences]
40
[+] score: 83
ZEB1 can inhibit expression of miR-200c, miR-203 and miR-183, which in turn were shown to target BMI1, a known factor for stem cell renewal. [score:7]
Hurteau G. J. Carlson J. A. Spivack S. D. Brock G. J. Overexpression of the microrna hsa-mir-200c leads to reduced expression of transcription factor 8 and increased expression of e-cadherin Cancer Res. [score:7]
ZEB1 expression results in downregulation of the miR-200 family, miR-203 and miR-183. [score:6]
Yu J. Ohuchida K. Mizumoto K. Sato N. Kayashima T. Fujita H. Nakata K. Tanaka M. Microrna, hsa-mir-200c, is an independent prognostic factor in pancreatic cancer and its upregulation inhibits pancreatic cancer invasion but increases cell proliferation Mol. [score:6]
MiR-200c, miR-203 and miR-183 cooperatively inhibit BMI1 expression. [score:5]
Regarding other stem cell factors, putative conserved targets of miR-200c comprise KLF4 and SOX2, and p63 is a known target of miR-203. [score:5]
Furthermore, high miR-200c expression correlated with E-Cadherin expression and better survival after surgery for pancreatic cancer [44]. [score:5]
For example, repression of miR-200c by ZEB1 results in disinhibition of TUBB3, which in turn is responsible for resistance to microtubule -targeting agents [57]. [score:5]
Overexpression of miR-200c inhibited mammary outgrowth from breast epithelial cells in mice, clonogenicity of mouse breast cancer cells, growth of embryonic carcinoma cells and tumorigenicity of human breast cancer stem cells [47]. [score:5]
Gregory P. A. Bert A. G. Paterson E. L. Barry S. C. Tsykin A. Farshid G. Vadas M. A. Khew-Goodall Y. Goodall G. J. The mir-200 family and mir-205 regulate epithelial to mesenchymal transition by targeting zeb1 and sip1 Nat. [score:4]
Intriguingly, downregulation of the two miR-200 family clusters and miR-183-96-182 cluster has also been found to be a common feature of mouse and human mammary epithelial stem cells and breast cancer stem cells. [score:4]
Vice versa, ZEB1 is a target of the microRNA-200 family. [score:3]
However, this concept is challenged by the recent observation that a mesenchymal-epithelial transition, accompanied by expression of the miR-200 family and miR-205, is necessary for the generation of induced pluripotent cells (iPC) from fibroblasts [49, 50]. [score:3]
Park S. M. Gaur A. B. Lengyel E. Peter M. E. The mir-200 family determines the epithelial phenotype of cancer cells by targeting the e-cadherin repressors zeb1 and zeb2 Genes Dev. [score:3]
SOX2 and KLF4 are putative targets of miR-200c. [score:3]
ZEB1 and the microRNA-200 family have been identified as central players in regulation of EMT, invasion and metastasis of pancreatic and other cancers. [score:2]
BMI1 is likely also regulated by miR-200c in these mo dels. [score:2]
Antagonism of ZEB1 and the miR-200 Family. [score:1]
Cochrane D. R. Howe E. N. Spoelstra N. S. Richer J. K. Loss of mir-200c: A marker of aggressiveness and chemoresistance in female reproductive cancers J. Oncol. [score:1]
Its seems that of this family, miR-200c is has the strongest anti-ZEB1 and anti-EMT effect [30]. [score:1]
Bracken C. P. Gregory P. A. Kolesnikoff N. Bert A. G. Wang J. Shannon M. F. Goodall G. J. A double -negative feedback loop between zeb1-sip1 and the microrna-200 family regulates epithelial-mesenchymal transition Cancer Res. [score:1]
A negative feedback loop between ZEB1 and microRNA-200 family has recently been described in various carcinoma mo dels [29, 30, 31, 32, 33, 34]. [score:1]
We made similar observations after gemcitabine-selection in another cell line and showed that miR-200c is lost in the gemcitabine-resistant cells. [score:1]
The negative feedback loop between ZEB1 and members of the miR-200 family could also be demonstrated for pancreatic cancer cell lines [31]. [score:1]
Burk U. Schubert J. Wellner U. Schmalhofer O. Vincan E. Spaderna S. Brabletz T. A reciprocal repression between zeb1 and members of the mir-200 family promotes emt and invasion in cancer cells EMBO Rep. [score:1]
[1 to 20 of 25 sentences]
41
[+] score: 78
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200a
Members of the miR-200 family are downregulated in human cancer cells and tumors due to aberrant epigenetic gene silencing and play a critical role in the suppression of EMT, tumor cell adhesion, migration, invasion and metastasis, by targeting and repressing the expression of key mRNAs that are involved in EMT (ZEB1 and ZEB2), and participates in a signalling network with the E-cadherin transcriptional repressors ZEB1/ deltaEF1 and ZEB2/SIP1, and TGF-β2 that is postulated to facilitate maintenance of stable epithelial or mesenchymal states but also allow reversible switching between these states in response to EMT effectors (such as TGF-β) [15, 16]. [score:10]
Among many miRNAs, miR-200 family is known as tumor suppressor and they are usually down-regulated in some tumors including prostate cancer and the loss of expression of miR-200 family contributes to the acquisition of EMT phenotype and drug resistance. [score:8]
Members of miR-200 family are known to be tumor suppressors, which are usually downregulated in some tumors. [score:6]
Down-regulation of miR-200 by siRNA technique has been shown to be associated with EMT phenotype while reexpression of miR-200 can result in the reversal of EMT phenotype. [score:6]
Real time-PCR result showed that miR-200a were significantly downregulated in CSCs (Figure  2A), while miR-200b and miR-200c expressions were similar with PANC-1 cell line (data was not shown). [score:6]
Down-regulation of miR-200 by siRNA technique has been shown to be associated with EMT phenotype while overexpression of miR-200a can result in the reversal of EMT phenotype [22]. [score:6]
MiR-200 family is known as tumor suppressor and they are usually down-regulated in EMT in some cancer stem cells, such as in prostate cancer and breast cancer [22, 23]. [score:5]
Interestingly, recent studies have also shown that miR-200 family could regulate the processes of EMT by targeting E-box binding protein ZEB1 and ZEB2 [36]. [score:4]
Then, we analysed the miR-200 family and transcription factors Oct4 and Nanog expression in CSCs of pancreatic cancer cell line PANC-1, and determined their relationships with EMT markers and repressors of E-cadherin transcription. [score:3]
We determined the expression levels of miR-200a, miR-200b and miR-200c in PANC-1 cell line and CSCs by real time-PCR. [score:3]
We determined the expression levels of miR-200a, miR-200b and miR-200c in CSCs of PANC-1 by real time RT-PCR. [score:3]
In ovarian and breast cancer, low expression of miRNA-200 plays important roles in cancer metastasis [14, 17, 18]. [score:3]
These findings hypothesizes that the expression of miR-200 in pancreatic cancer cell is correlated with stemness, EMT and metastasis. [score:3]
Among the family of miR-200, only miR-200a expression was dramatically decreased. [score:3]
And miR-200 has been identified as a powerful regulator of EMT. [score:2]
MiR-200 changed the tumor environment, inhibiting the process of EMT and metastasis [19, 20]. [score:2]
RT-qPCR was performed using the miScript PCR Kit to assay the expression of miR-200 family. [score:2]
MiR-200a, miR-200b, miR-200c and U6 kits were purchased from Biomics biotech (NanTong). [score:1]
Thus, the discovery of molecular knowledge of drug resistance and metastasis in relation to miR-200 family, CSCs and EMT in pancreatic cancer are becoming an important area of research, and such knowledge is likely to be helpful in the discovery of newer drugs as well as designing novel therapeutic strategies for the treatment and/or prevention of pancreatic cancer with better outcome. [score:1]
Figure 5 miR-200 reduces invasion and migration in human pancreatic cancer. [score:1]
[1 to 20 of 20 sentences]
42
[+] score: 78
Other miRNAs from this paper: hsa-mir-205, hsa-mir-200b, hsa-mir-141, hsa-mir-200a, hsa-mir-429
In our breast cancer samples, we found that low expression of the mir-141/mir-200c cluster was associated with activated signaling via the PI3K–AKT pathway, which concurs with recent data suggesting that p53 negatively regulates the ZEB–E-cadherin pathway by upregulating mir-200s [23]. [score:7]
High expression of either member of the indicated mir-200 cluster was associated with substantial expression of CDH1 mRNA (R = 0.22, p = 0.034), whereas ZEB1 and CDH1 mRNA were negatively correlated (R = –0.23, p = 0.027). [score:5]
Expression of mir-200s in primary colorectal tumors with known metastatic status revealed a significant association with metastatic disease for low levels of mir-200c, relative to matched normal mucosa (p=0.041) (b) and in the metastatic lesions low levels of CDH1 indicated a trend of shorter time to recurrence (p=0.11) (c). [score:5]
The outcome of breast cancer disease in connection to mir-200 expression in primary tumors was highly dependent on the adjuvant therapy regimen used. [score:5]
Analysis of the expression of mir-200 family in primary colorectal tumors with known metastatic status showed that low levels of mir-200c were significantly associated with a metastatic disease (p = 0.041; Figure 1b). [score:5]
After stratifying for mir-200 expression, RT reduced the risk of local recurrences in the group of patients with tumors expressing high levels of mir-200s (b) but not in the group of tumors showing low mir-200 levels (c). [score:5]
In support of that assumption, we found a negative correlation between mutated p53 and high expression of mir-141 (R = –0.26, p = 0.012) and mir-200c (R = –0.21, p = 0.039), which agrees with recently reported data suggesting that p53 is a negative regulator of the EMT pathway [23]. [score:4]
Furthermore, there was a positive correlation between mutated PIK3CA status and ZEB1 (R = 0.30, p = 0.0042), whereas there was a negative correlation between PIK3CA mutations and expression of mir-141/mir-200c (R = –0.23, p = 0.032). [score:4]
We also show for the first time that the expression of the mir-200 family was associated with larger but fewer metastases, indicating a better prognosis for these patients. [score:3]
For the survival analyses, a combination variable, mir-200, was created and defined as high expression (upper quartile) of mir-141 and/or mir-200c. [score:3]
Our data support the theory that loss of expression of mir-200 family members activates the EMT system, and could thereby lead to migration and spreading of cells, as has been reported in various types of cancers [27, 28, 34]. [score:3]
To selectively analyze the expression of mir-200 in the epithelial compartment, matched normal, primary, and metastatic FFPE tissue samples from patients with metastatic colorectal cancer were microdissected (Figure 2a). [score:3]
Radiotherapy significantly decreased the risk of local recurrence in the patients with tumors expressing high levels of mir-200 but not in the patients whose tumors had low mir-200 levels (Figure 3a, b and c ). [score:3]
Metastatic tumors show altered mir-200 expression. [score:3]
Conversely, low mir-200 expression was associated with pronounced benefits of CMF, chiefly with regard to distant recurrence-free survival (Figure 3d, e and f). [score:3]
In summary, high ZEB1/low mir-200 expression was associated with activation of the PI3K–AKT pathway and with FGF signaling. [score:3]
There are five members of the mir-200 family, which are clustered together at two polycistronic sites: mir-200a, mir-200b, and mir-429 are located on chromosome 1p36 [13]; and mir-200c and mir-141 are located on chromosome 12p13. [score:1]
0084815.g003 Figure 3The treatment predictive value of mir-200 was analyzed in tumors from women who had been randomized to treatment with radiotherapy (RT) or systemic chemotherapy (CMF: cyclophosphamide, methotrexate, 5-FU) (a, d). [score:1]
Several microRNAs have been associated with EMT and metastasis, and the microRNA-200 (mir-200) family is described most frequently in this context [11]. [score:1]
Considering clinicopathological variables, mir-200c was negatively correlated with lymph node status (R = –0.24, p = 0.0047), and mir-141 was negatively correlated with S-phase fraction (R = –0.22, p = 0.035). [score:1]
The interaction between the treatment effect and miR-200 was clearly significant (CMF vs. [score:1]
radiotherapy: mir-200 high HR = 3.3 [CI 95% 1.3–9.42; p = 0.013] and mir-200 low HR = 0.49 [CI 95% 0.24–1.03; p = 0.059]; test for interaction p = 0.0035). [score:1]
The aim of the present study was to examine the potential of microRNAs as clinical markers and to elucidate the participation of the mir-200–ZEB–E-cadherin pathway in the progression of human cancers by using patient materials from metastatic colorectal and breast cancer. [score:1]
It is also plausible that additional microRNAs and signaling systems can play important roles in the metastatic process in vivo, perhaps in synergy with mir-200–ZEB. [score:1]
Interestingly, mir-141 was positively correlated with ER status (R = 0.31, p = 0.0019), whereas mir-200c was negatively correlated with HER2 status (R = –0.25, p = 0.013), suggesting that these microRNAs play disparate roles in different subtypes of breast cancer. [score:1]
The EMT-related mir-200 cluster has prognostic value in breast cancer patients. [score:1]
To summarize, we have shown that the EMT-related mir-200–ZEB–E-cadherin signaling pathway is of clinical relevance in predicting metastatic progression of primary tumors and the responses to different treatments. [score:1]
The treatment predictive value of mir-200 was analyzed in tumors from women who had been randomized to treatment with radiotherapy (RT) or systemic chemotherapy (CMF: cyclophosphamide, methotrexate, 5-FU) (a, d). [score:1]
Expression levels of all the five members of the mir-200 family, ZEB1, and CDH1 were measured by RT-qPCR in frozen tissue samples, and the results showed that the relationships between these factors in metastatic tissues were comparable those observed in primary tumors. [score:1]
We also observed that mir-141 was correlated with positive ER status, whereas mir-200c was negatively associated with HER2 status, which suggests that these microRNAs play different roles in different subtypes of breast cancer. [score:1]
[1 to 20 of 30 sentences]
43
[+] score: 76
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-141, hsa-mir-200a, hsa-mir-429
ZEB1 expression is inversely correlated to that of miR-200 in the different cell lines tested, with high miR-200b and -200c and low ZEB1 expressions in the human gastric epithelial cell lines, and low miR-200b and -200c and high ZEB1 expressions in HeLa or HEK293 cells (Fig. S3A), accordingly to the reciprocal negative feedback loop linking ZEB1 and the miR-200. [score:7]
MiR-200 regulate ZEB1 expression in basal conditions and are up-regulated by H. pylori. [score:6]
In turn, miR-200 post-transcriptionaly silence ZEB1/2 by inhibiting translation of their mRNA. [score:5]
ZEB1/2 are reciprocally linked to the miR-200 family members in a negative feedback loop, each strictly regulating the expression of the other, thereby controlling both the stability and reversibility of the epithelial versus mesenchymal phenotypes [16]; [20]. [score:4]
Figure S4 Up-regulation of miR-200b and miR-200c in MKN-74 and NCI-N87 cells 24 h post infection with cagPAI+ H. pylori (Hp WT) at MOI 100 bacteria/cell. [score:4]
MiR-200 are microRNA (miRNA), small noncoding RNA molecules that post-transcriptionaly regulate gene expression in a variety of biological process [21]. [score:4]
An attractive hypothesis of the role of that regulation could be that enhanced cdh1 and miR-200 gene expression in H. pylori-challenged epithelial cells could provide a feedback control that would keep in check the effects of excessive NF-κB -mediated ZEB1 production, impede EMT progression and allow the process to stay reversible. [score:4]
Thus, while the activation of the NFκB-ZEB1-miR-200 axis and the concomitant up-regulations of both epithelial and mesenchymal markers upon 24 hr infection is a common feature of the three gastric cell lines, each of them displays specific kinetics in the early time points of infection, likely dependent on their genetic background and their sensitivity to the pathogen. [score:4]
We identified a mechanism that partly could explain the paradoxical miR-200 up-regulation in infected cells: analyzing miR-200b-a-429 promoter, we unveiled a NF-κB binding site stimulating promoter activity and pri-miR-200b-200a-429 synthesis, and leading to higher miR-200b levels. [score:4]
We show here that these EMT-like morphological changes, specifically induced by cagPAI+ H. pylori in gastric epithelial cells, are associated to enhanced expression of mesenchymal genes and are regulated by a tripartite NF-κB/ZEB1/miR-200 signaling pathway. [score:4]
Unexpectedly, we observe a significantly enhanced expression of both miR-200b and miR-200c by wt H. pylori, but not by the Δ cagA or Δ cagE mutants (Fig. 2E). [score:3]
ZEB1 and miR-200 are Overexpressed in Human Gastric Mucosa in the Context of H. pylori -driven Inflammation. [score:3]
Our previous data on AGS miRNA profile indicated that these cells express mainly miR-200b and miR-200c of that family, which share a quite similar sequence [24]. [score:3]
These histological observations of simultaneous NFκB activation and ZEB1, E-cadherin, miR-200 expressions in areas of H. pylori colonization and associated chronic inflammation corroborate our in vitro data on gastric cell lines. [score:3]
Table S2 Expression of the miR-200 family members in gastric epithelial cell lines. [score:3]
Changes in mesenchymal and epithelial gene expression and miR-200 levels. [score:3]
However, the effects of miR-200 overproduction seem to be dominated by those of ZEB1, since infected cells nevertheless undergo an EMT. [score:1]
The miR-200 are produced from two miRNA clusters, miR-200b-200a-429 and miR-200c-141, the promoters of which harbor ZEB1/2 binding sites and are repressed by ZEB1/2 [22]; [23]. [score:1]
Collectively, these findings demonstrate the existence of NF-κB/ZEB/miR-200 signaling network that initiates mesenchymal transition of H. pylori-infected gastric cells. [score:1]
Contrarily to the miR-200 levels, which appear to be more versatile, ZEB1 could constitute an early marker of these preneoplastic lesions in cagPAI + H. pylori-infected mucosa. [score:1]
Whereas scrambled control oligonucleotide (sc200) affect neither miR-200 levels (Fig. S3B), nor the original cobblestone cell morphology, antisense oligonucleotides (as200b, as200c) specifically decreases by 75% the detectable miR-200b and miR-200c levels (Fig. S3B) and dramatically affects cell morphology, which turns for 62.88±28.53% cells (versus 3.44±1.85% in sc200 -treated cells, n = 9, p<0.001) in an extremely elongated shape similar to the one provoked by H. pylori (Fig. 2A). [score:1]
Conversely, global miRNA analyses of H. pylori-infected human gastric mucosa revealed 30 miRNAs significantly decreased in the H. pylori -positive group, among which all the miR-200 family members [40]. [score:1]
080 (**) 0.969±0.256 0.894±0.102 0.818±0.044 (***) 0.981±0.077 miR-200c 0.592±0.050 (**) 0.852±0.172 0.971±0.096 0.876±0.029 0.564±0.098 (***) 0.723±0.189 (*) 48 hrs post-infection at a MOI 100, infected and non-infected cells were trypsinized and subcultured for 10 days in a 6-well plate starting at an initial cell density of 2,000 cells/well. [score:1]
At last, we demonstrated that ZEB1 and miR-200 were both dependent on cagPAI, which activates NF-κB. [score:1]
In NCI-N87 cells, miR-200a and miR-141, which belongs to the same clusters than miR-200b and miR-200c, respectively, are also positively affected by infection. [score:1]
The other miR-200 family members miR-200a, -141 or -429 are diversely affected by the infection (Table S2B). [score:1]
ZEB1 and miR-200 are Overexpressed in Human Gastric Mucosa in the Context of H. pylori -driven InflammationTo evaluate the in vivo relevance of these findings, ZEB1, miR-200b, E-cadherin expressions and the activation of NFκB were investigated on gastric mucosa tissue sections from patients infected with H. pylori (all with cagPAI positive strains, n = 3) or uninfected (n = 3). [score:1]
ZEB1 is Repressed by miR-200 in Gastric Epithelial Cells. [score:1]
[1 to 20 of 28 sentences]
44
[+] score: 73
As can be seen, there is upregulation of miR 200c target genes like VIMENTIN (2.5 fold), TUBB-3 (5 fold), ZEB 1 (5 fold), and miR 34a targets like CD44 (6 fold) and SIRT1 (2.5 fold) while the expression of another miR200c target E-CADHERIN was downregulated in DU145-TXR cells. [score:15]
In aggressively metastatic cell lines from breast, ovarian and endometrial cancers, E-CAD levels are suppressed by ZEB-1 which is upregulated as a result of suppression of miR200c. [score:8]
Since miRNAs act by either repressing or cleaving their target mRNAs, we carried out gene expression analysis of several known downstream targets of several miRNAs, including miR200c and 34a identified in our cell and tissue miRNA arrays. [score:7]
Expression analysis of select genes which are known targets of differentially expressed miRNAs, including miR200c and 34a was carried out to further support our miRNA data. [score:7]
Downregulation of miR200c also increases the protein and gene levels of TUBB-3. It has been suggested that decreased protein levels of TUBB-3 protein correlate to increased cell death in response to microtubule -targeting agents such as PTX. [score:6]
miRNA200c, which is downregulated in DU145-TXR cells, is a tumor-suppressor miRNA known which maintains ‘epithelialness’ of cancer cells by preventing EMT and the assumption of an aggressive chemoresistant mesenchymal phenotype. [score:6]
Downregulation of miRNA200c leads to an EMT transformation which is characterized by a loss of E-CADHERIN (E-CAD) and upregulation of VIMENTIN (VIM) [15]. [score:5]
Further, as several miRNAs which are verifiably altered in PTX-resistant cell lines, such as miR200c and miR34a, are similarly modified in a clinical prostate cancer sample, our hypothesis and the overall approach taken to confirm it are strengthened substantially We have established that chemoresistance to PTX in DU145-TXR and PC3-TXR cells is possibly regulated by miRNAs which are differentially expressed when the PTX sensitive cell line is transformed to a resistant phenotype. [score:4]
Significant among these include miR200c, miR34a and miR29b, all of which are downregulated in DU145-TXR cells. [score:4]
In view of the findings described above, we decided to confirm the effect of our combination therapy on the expression of miR200c and miR34a (Fig. 6D). [score:3]
A recent study by Cochrane et al. confirmed reduced expression of miR200c as being responsible for chemoresistance to microtubule stabilizers (such as taxanes) in endometrial, breast and ovarian cancer cells. [score:3]
This observation is further supported by evidence that the loss of miR200c expression results in a highly aggressive, mesenchymal and chemoresistant phenotype in lung cancer cells [46]. [score:3]
A similar approach was used to measure expression of miR200c and miR 34a in DU 145-TXR cells treated with 0.5 µM PTX+10 µM CYA. [score:1]
In multi-drug resistant cancer cells, restoration of miR200c levels by transfection of its mimic restored chemosensitivity to PTX [15]. [score:1]
[1 to 20 of 14 sentences]
45
[+] score: 72
Similarly, miR-200c overexpression was shown to induce VEGF expression in non-small cell lung cancer [76], although opposite results suggesting that miR-200c directly targets VEGF expression were also obtained for different cancer types [38, 77, 78]. [score:10]
As miR-200c has so far been shown to target HO-1 and is associated with HO-1 decreased expression in other tissues and cancer types [74, 75], we did not expect that it could be a mediator of HO-1 upregulation or action in bladder cancer. [score:8]
Among the miRNAs analyzed, upregulation of miR-200c and downregulation of miR-155 were observed, which may be responsible for the induction of HIF-1α mRNA. [score:7]
Liu L. Qiu M. Tan G. Liang Z. Qin Y. Chen L. Chen H. Liu J. miR-200c inhibits invasion, migration and proliferation of bladder cancer cells through down-regulation of BMI-1 and E2F3 J. Transl. [score:6]
Finally, we have also demonstrated the increased expression of miR-200c in specimens of bladder cancer in comparison to healthy controls, which supports previous data showing an upregulation of this miRNA in bladder cancer [39, 40, 41]. [score:6]
Chuang T. D. Panda H. Luo X. Chegini N. miR-200c is aberrantly expressed in leiomyomas in an ethnic -dependent manner and targets ZEBs, VEGFA, TIMP2, and FBLN5 Endocr. [score:5]
Similar tendencies were demonstrated for other types of cancer [37, 38], but the current data for bladder cancer are ambiguous and show either an induction of miR-200c expression [39, 40, 41] or an inhibition [33, 42, 43, 44, 45]. [score:5]
Panda H. Pelakh L. Chuang T. D. Luo X. Bukulmez O. Chegini N. Endometrial miR-200c is altered during transformation into cancerous states and targets the expression of ZEBs, VEGFA, FLT1, IKKβ, KLF9, and FBLN5 Reprod. [score:5]
Adam L. Zhong M. Choi W. Qi W. Nicoloso M. Arora A. Calin G. Wang H. Siefker-Radtke A. McConkey D. miR-200 expression regulates epithelial-to-mesenchymal transition in bladder cancer cells and reverses resistance to epidermal growth factor receptor therapy Clin. [score:4]
Analysis of miRNAs showed that the level of miR-200c is significantly induced in samples of bladder cancer, whereas miR-155 is downregulated. [score:4]
On the other hand, miR-200c was positively correlated with VEGF expression in samples of bladder cancer. [score:3]
Gravgaard K. H. Lyng M. B. Laenkholm A. V. Sokilde R. Nielsen B. S. Litman T. Ditzel H. J. The miRNA-200 family and miRNA-9 exhibit differential expression in primary versus corresponding metastatic tissue in breast cancer Breast Cancer Res. [score:3]
MiR-200c was found to positively correlate to VEGF expression in bladder cancer (Table 3). [score:2]
Mahdavinezhad A. Mousavi-Bahar S. H. Poorolajal J. Yadegarazari R. Jafari M. Shabab N. Saidijam M. Evaluation of miR-141, miR-200c, miR-30b expression and clinicopathological features of bladder cancer Int. [score:1]
Wiklund E. D. Bramsen J. B. Hulf T. Dyrskjot L. Ramanathan R. Hansen T. B. Villadsen S. B. Gao S. Ostenfeld M. S. Borre M. Coordinated epigenetic repression of the miR-200 family and miR-205 in invasive bladder cancer Int. [score:1]
Changes in miR-200c are suggested to be associated with the pathogenesis of bladder cancer and to affect the efficacy of therapeutic treatment [35, 36]. [score:1]
Therefore it seems that the relationship between miR-200c and VEGF depends on cell type. [score:1]
[1 to 20 of 17 sentences]
46
[+] score: 72
These microRNAs are downregulated in high grade and poorly differentiated tumors, while forced expression of miR-200 microRNAs has been shown to inhibit TGF-β1 -induced EMT in MDCK cells. [score:8]
Expression of miR-200 family members correlated positively with E-cadherin expression and negatively with the miR-200 target Zeb1 [38]. [score:7]
Yu J. Ohuchida K. Mizumoto K. Sato N. Kayashima T. Fujita H. Nakata K. Tanaka M. MicroRNA, hsa-miR-200c, is an independent prognostic factor in pancreatic cancer and its upregulation inhibits pancreatic cancer invasion but increases cell proliferation Mol. [score:6]
Interestingly, Zeb1 can also directly suppress transcription of miR-200 family members miR-141 and miR-200c [40] indicating an interplay between Zeb1 and miR-200 family that regulates the differentiation state of pancreatic cancer cells. [score:5]
Recent surveys of global microRNA expression patterns in pancreatic cancer cell lines showed that 39 microRNAs, including the miR-200 family, were deregulated and have at least two-fold differential expression in PDAC cell lines compared to control nontransformed pancreatic ductal cell lines [38]. [score:5]
miR-200c cooperates with other microRNAs to suppress expression of stem cell factors, such as Bmi1, Sox2 and KLF4 in cancer cells and mouse embryonic stem cells [49, 50]. [score:5]
Restoring expression of miR-200 family micro -RNAs or, alternatively, targeting EMT signaling pathways such as Notch and Hedgehog, or their ultimate downstream mediators the EMT-inducing transcription factors, such as Zeb1, could also restore the epithelial state and make the tumors more sensitive to therapeutic agents. [score:5]
Li Y. VandenBoom T. G. Kong D. Wang Z. Ali S. Philip P. A. Sarkar F. H. Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells Cancer Res. [score:4]
The miR-200 family targets the key regulators of EMT, such Zeb1 and Sip1 (also known as Zeb2), and as such leads to increased E-cadherin levels [36, 37]. [score:4]
Gregory P. A. Bert A. G. Paterson E. L. Barry S. C. Tsykin A. Farshid G. Vadas M. A. Khew-Goodall Y. Goodall G. J. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1 Nat. [score:4]
High levels of miR-200c expression strongly correlated with E-cadherin levels in resected human pancreatic tumor samples and were associated with significantly better survival rates compared with patients whose tumors had low levels of miR-200c expression [39]. [score:4]
Ali S. Ahmad A. Banerjee S. Padhye S. Dominiak K. Schaffert J. M. Wang Z. Philip P. A. Sarkar F. H. Gemcitabine sensitivity can be induced in pancreatic cancer cells through modulation of miR-200 and miR-21 expression by curcumin or its analogue CDF Cancer Res. [score:3]
In lung cells, forced miR-200 expression abrogated the cells’ invasive and metastatic abilities. [score:3]
Expression of miR-200c in breast cancer stem cells prevented the formation of tumors in vivo and even prevented new duct formation by non-malignant mammary stem cells [50]. [score:3]
Further, microRNAs that are associated with EMT, such as the miR-200 family, which are repressed by Zeb1 [49], also regulate stem cell behavior [49, 50]. [score:2]
MicroRNAs of the miR-200 family (miR-200a, b, c, miR-141 and miR-429) and miR-205 have been identified as key negative regulators of both EMT and the metastatic ability of cancer cells [36, 37]. [score:2]
Recently, it was shown that treating pancreatic cancer cells with the circumin analogue CDF restored miR-200 levels and sensitized the pancreatic cancer cells to gemcitabine treatment in vitro [64]. [score:1]
Burk U. Schubert J. Wellner U. Schmalhofer O. Vincan E. Spaderna S. Brabletz T. A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells EMBO Rep. [score:1]
[1 to 20 of 18 sentences]
47
[+] score: 71
Because ZEB factors induce EMT by suppressing the expression of epithelial marker genes, including E-cadherin [9, 10], the overexpression of miR-200 s decreases expression of ZEB factors and induces epithelial differentiation. [score:9]
The cells were analyzed on culture day 6. We transfected synthesized miR-200c (Qiagen) and/or a miR-21 inhibitor composed of single-stranded, modified RNAs that specifically inhibit miR-21 function (miScript miRNA Inhibitor; Qiagen) into isolated mouse alveolar type II cells using HiPerFect Transfection Reagent (Qiagen). [score:7]
Transfection of both miR-200c and the miR-21 inhibitor had no significant added effect on the down-regulation of mesenchymal cell markers (Figure  6). [score:6]
We also examined the levels of miR-200c, one of the miR-200 family microRNAs that are expressed in the cells, preserve epithelial phenotypes and function as EMT suppressors. [score:5]
Neither synthesized miR-200c nor the miR-21 inhibitor prevented the decrease in SFTPC expression. [score:5]
The transfection of synthesized miR-200c significantly attenuated the increased expression of vimentin and α-SMA as well as that of Zeb1/2 and prevented the decrease in E-cadherin expression in cultured mouse alveolar type II cells that was induced by the pro-EMT environment containing TGF-β (Figure  6). [score:5]
The specific primer sets for quantification were purchased from Qiagen as follows: MS00001827 for miR-200c; MS00011487 for miR-21; MS00033740 for RNU6B snRNA (a constitutively expressed housekeeping control); QT00121163 for E-cadherin; QT00109424 for Surfactant protein C (SP-C); QT00110467 for VE-cadherin; QT00159670 for Vimentin; QT00140119 for alpha-smooth muscle actin (α-SMA); QT00105385 for ZEB1; QT00148995 for ZEB2 (E-cadherin repressors); QT01658692 for glyceraldehyde-3-phosphate dehydrogenase (GAPDH, a constitutively expressed gene). [score:4]
We also transfected non-specific oligonucleotides as negative controls or synthesized miR-200c as positive controls because miR-200c has been reported to be an EMT suppressor. [score:3]
A recent publication showed that the miR-200 family members inhibit TGF-β -induced EMT in a rat alveolar epithelial cell line [11]. [score:3]
Phase contrast images of cultured mouse alveolar type II cells showed that cells cultured under EMT-inducing conditions adopted a spindle-like shape with irregular processes, whereas cells transfected with miR-21 inhibitor as well as synthesized miR-200c adopted a cobblestone-like appearance and had lamellar body-like granules (Figure  7). [score:3]
In contrast to miR-21, the EMT inducing culture conditions decreased the expression of miR-200c (Figure  5D). [score:3]
Note that the cells cultured under EMT-inducing conditions adopted their spindle-like shape with irregular processes, whereas cells transfected with synthesized miR-200c and/or miR-21 inhibitor adopted a cobblestone-like appearance and had granules (lamellar bodies). [score:3]
In contrast to miR-21, miR-200c decreased significantly in epithelial cells, implying that miR-200c also functions as an EMT suppressor in lung epithelial cells (Figure  2D). [score:3]
200c & 21-i: cells co -transfected with both synthesized miR-200c and miR-21 inhibitor. [score:3]
The miR-200 family targets the ZEB factors (ZEB1 and ZEB2) that function as transcriptional repressors. [score:3]
The microRNA-200 (miR-200) family can reverse EMT and induce an epithelial phenotype in cancer cells [3- 8]. [score:1]
Therefore, it is likely that microRNAs, including let-7d, miR-21 and miR200c, that are involved in TGF-β signaling also play a significant role in EMT during lung fibrosis [2, 11, 14]. [score:1]
miR-200c: cells transfected with synthesized miR-200c. [score:1]
In contrast, the levels of miR-200c were decreased significantly in alveolar type II cells from IPF patients (Figure  4B). [score:1]
miR-200c & miR-21-i: cells co -transfected with both synthesized miR-200c and miR-21-i. The data were analyzed by one-way analysis of variance with a post hoc test (Scheffé’s test). [score:1]
The levels of miR-200c were much higher in lung epithelial cells than in endothelial or mesenchymal cells in saline treated mice (Figure  2D). [score:1]
[1 to 20 of 21 sentences]
48
[+] score: 70
Other miRNAs from this paper: mmu-mir-200b, hsa-mir-200b, mmu-mir-200a, mmu-mir-200c, hsa-mir-200a
It is of note that further down-regulation of Zeb1 in Zeb1 null MEF cells had little effects on miR-200 expression (Figure  4B), possibly due to [1] the level of Zeb1 protein in het MEF cells is low enough to relieve the repression on miR-200 family, further decrease in Zeb1 expression in null cells will not increase in miR-200 expression accordingly or/and [2] it is also possible that Zeb1 might down-regulate other unknown factor(s) that positively regulates expression of miR-200 family at the same time and thereby makes the regulation network more complex. [score:17]
Our results suggest that E2F-Rb1 binds constitutively to the Ets1 promoter and limits the level of expression, but a second major impact of Rb1 on Ets1 expression is mediated through Rb1 repression of Zeb1 [40] and in turn induction of miR-200, which targets Ets1. [score:7]
Knockdown of Zeb1 in the T KO MEFs using shRNA lenvirirus, as described previously [17], eliminated much of the induction of Ets1 (Figure  4D), suggesting that induction of Zeb1 and repression of miR-200 as Rb1 family members are mutated is contributing significantly to the upregulation of Ets1. [score:5]
Because miR-200 has been shown to target Ets1 [19], we wondered if Zeb1 might also affect expression of Ets1. [score:5]
We link the effect of Zeb1 to its regulation of miR-200, which in turn target Ets1. [score:4]
Such findings raised the possibility that Zeb1 might feedback to induce Ets1 via its repression of miR-200, and that Rb1 might also influence Ets1 expression via its regulation of Zeb1. [score:4]
Rrm2, ribonucleotide reductase, Ntf3, neurotrophin 3. Zeb1 is a target of the miR-200 family, but in a negative loop Zeb1 feeds back to repress transcription of miR-200 family members [20, 21]. [score:3]
We link Rb1 repression of Zeb1 to induction of miR-200 family members, which in turn target Ets1 mRNA. [score:3]
miR-200 also represses Zeb1, but in a double negative loop Zeb1 binds the promoters of miR-200 family members and represses their expression [20, 21]. [score:3]
These results suggest that Rb1-E2F binds the Ets1 promoter to limit its level of expression, but it is induction of Zeb1 and in turn repression of miR-200 when the Rb1 family activity is lost that is responsible for most of the induction of Ets1. [score:3]
Taken together, our results provide evidence of an amplification loop consisting of Ets1 and Zeb1, which is mediated by miR-200 and regulated by Rb1. [score:2]
Figure 8 Mo del depicting an Ets1-Zeb1 amplification loop that is dependent upon miR-200 and regulated by Rb1. [score:2]
These results imply that CtBP -dependent transcription repression of miR-200 family members by Zeb1 is important for regulation of Ets1 and for thymocyte differentiation. [score:2]
We propose that Ets1 and Zeb1 form an amplification loop that is dependent upon Zeb1 repression of miR-200 and regulated by the Rb1 family (Figure  8). [score:2]
These findings suggest that Ets1 and Zeb1 comprise an amplification loop that is dependent upon miR-200 and regulated by Rb1. [score:2]
As we demonstrated previously [16], mutation of Rb1 family members led to induction of Zeb1 and this induction of Zeb1 was accompanied by repression of miR-200 (Figure  4C) and, as shown above, Ets1 (Figure  1). [score:2]
Zeb1 repression of the miR-200 family is linked to induction of Ets1. [score:1]
Ets1 Zeb1 miR-200 Thymocyte differentiation Lung adenocarcinoma c-Ets1 was identified as a proto-oncogene based on v-ets in the genome of the avian leukemia retrovirus E26, and is the founding member of the Ets family of transcription factors [1]. [score:1]
Recent studies have found that Ets is repressed by miR-200 family members [19]. [score:1]
Taken together, these results suggest an amplification loop between Ets1 and Zeb1, where Ets1 increases transcription of Zeb1, and Zeb1 in turn represses miR-200 to further elevate Ets1. [score:1]
[1 to 20 of 20 sentences]
49
[+] score: 69
The choice of miRNAs for validation with real-time RT-PCR was based on their differential expression among the groups as well as their putative biological significance: miR-542-5p is predicted to target estrogen receptor alpha mRNA; miR-200a and miR-429 are both members of the miR-200 family; and miR-503 is the most down-regulated miRNA in both types of carcinoma and the precursor lesion. [score:8]
While most tumours have shown a down-regulation of the miR-200 family, the up-regulation observed in endometrial carcinoma is shared with a few other tumours including melanoma, ovarian carcinoma, and colorectal carcinoma. [score:7]
Recently, Castilla et al [38] have demonstrated differential miRNA expression levels between the epithelial and mesenchymal elements in uterine carcinosarcoma, with up-regulation of the miR-200 family in the epithelial part. [score:6]
In the studies of miRNA expression in endometrial carcinomas, the up-regulation of the miR-200 family may be influenced by estradiol and ERα and this possibility deserves further study. [score:6]
The most striking similarity among studies of miRNA expression in EEC is the up-regulation of the miR-200 family. [score:6]
Insights into the up-regulation of the miR-200 family in certain tumour types, including endometrial carcinoma, may be gained by examining the role of steroid receptors in the regulation of miRNAs. [score:5]
However, there are some tumour types in which an up-regulation of the miR-200 family has been observed. [score:4]
It may be that the less aggressive nature of ERα -positive endometrial carcinomas relates to the up-regulation of the miR-200 family, which, in turn, maintains an epithelial phenotype and resists the EMT transition. [score:4]
The entire miR-200 family (miR-200a/b/c, miR-141, and miR-429) was up-regulated in cases of EEC. [score:4]
Our data share some important similarities with previously published reports [22]– [26]; Table 4. The most striking similarity is the up-regulation of the miR-200 family (miR-141, 200a, 200b, 200c, 429) in EEC relative to normal controls. [score:4]
MicroRNAs which have similar expression changes in other studies of EEC are italicized and the miR-200 family miRNAs are bolded. [score:3]
Examination of miRNAs that are consistently dysregulated in various studies of EEC, like the miR-200 family, will aid in the understanding of the role that miRNAs play in tumorigenesis in this tumour type. [score:2]
A recent review by Cochrane et al [39] describes the regulation of the miR-200 family by estrogen receptor-α and estradiol. [score:2]
Studies have shown an association with low miR-200 family levels and an aggressive tumour phenotype [31], [32] consistent with the regulation of the EMT switch as described. [score:2]
Efforts to elucidate the role that miRNAs play in endometrial carcinoma should focus on the miR-200 family as well as the other miRNAs that are consistently dysregulated in the multiple studies of endometrial carcinoma to date. [score:2]
The miR-200 family consists of five members localized on two genomic clusters (miR-200a/b, miR-429 on chromosome 1, and miR-200c, miR-141 on chromosome 12) [27]. [score:1]
Conversely, if ZEB1 and ZEB2 levels are low, as would be expected with high miR-205 and miR-200 family members, E-cadherin levels increase and an epithelial phenotype should be maintained. [score:1]
The miR-200 family has been implicated in the epithelial-to-mesenchymal transition (EMT) that occurs as a part of tumour invasion and metastasis [28]– [30]. [score:1]
Cochrane et al [37] have shown that miR-200c levels are associated with a less aggressive tumour phenotype in ovarian cancer, breast cancer and EEC cancer cell lines. [score:1]
[1 to 20 of 19 sentences]
50
[+] score: 66
To further explore the potential significance of the deletion overlap involving the miR-200 family, we examined gene expression in patients and found that a number of TargetScan-predicted targets of either miR-200a or miR-200b were collectively upregulated in the tumor compared to unaffected pair-matched myometrium (∼180 genes ranging from 1.25–10.3 fold upregulation). [score:12]
These findings indicated that alteration (loss) of two overlapping genomic regions (7.09 Mb of Chr1 1p36.33-p36.23 and 24.56 Mb of Chr3 3q26.1-q27.2 harboring cancer related miRNAs may be related to the tumorigenesis of a subset of ULMs via deregulation of the miR200a/b and miR-15/16 gene targets and in part this process may be due to the loss of convergent inhibitory action of the miR-200 family and miR-15 and miR-16 on a small group of the same downstream target genes. [score:8]
B analysis of expression of five miR-200 predicted target genes in ULMs cell line UtLM with stable miR-200a expression (see Methods) and control (vector PGIPZ only). [score:7]
Collectively, these findings suggest that the loss of miR-200 family, identified by miRNA profiling and a CGH analysis, together with upregulation of its target genes may contribute to the tumor growth and underlie the mesenchymal character of ULMs. [score:6]
Conversely, loss of miR-200 shown to modulate growth as well as the UtLM morphology (Figure 4C,D), may lead to upregulation of genes (some of them convergent targets of lost miR-15/16) that contribute to the progression of ULM tumorigenesis. [score:6]
As shown above, downregulation of miR-200 family members appears a candidate event in leiomyomas in select patients due to loss of corresponding genomic DNA loci and broader reduction of miR-200 expression in ULMs (Table 3 and Figure S2). [score:6]
A Scatter plot analysis of relative mRNA expression in five miR-200 predicted target genes in 10 ULMs and matched myometria (our data and GSE593). [score:5]
Focused pathway analysis (using GO, KEGG, Biocarta and Panther databases) of the predicted miR-200 family targets that are consistently upmodulated in ULMs including patient B4 (Table S3) implicates categories of regulation of transcription proliferation and cell cycle control, actin cytoskeleton and adherens, tight, gap and focal adhesion junction remo deling, as well as cancer related signaling pathways (MAPK, RAS, WNT, NOTCH, TGF-β, VEGF). [score:4]
Importantly and as predicted by pathway analysis (Table S3), overexpression of miR-200a in UtLM cells led to growth inhibition compared to mock infected controls (Figure 3C), and reverted the fibroblastoid morphology towards more pronounced epithelial phenotype (Figure 3D), consistent with the established role of miR-200 family in epithelial-mesenchymal transition [33]. [score:4]
MiR-200 predicted target gene analysis in uterine ULMs. [score:2]
0012362.g003 Figure 3 MiR-200 predicted target gene analysis in uterine ULMs. [score:2]
Primers for 11 let-7 and 5 miR-200 predicted target genes are summarized in Table S1. [score:2]
Candidate role of the loss of miR-200 family and miR-15 and miR16 in ULMs. [score:1]
Loss of miR-200 family is associated with epithelial and mesenchymal transition (EMT) and aggressive tumor phenotypes of ovarian cancer [30], [31]. [score:1]
[1 to 20 of 14 sentences]
51
[+] score: 66
Pecot et al. demonstrated that miR-200 members inhibit angiogenesis through direct and indirect mechanisms by targeting interleukin-8 and CXCL1 secreted from the tumor epithelial and cancer cells. [score:7]
In ovarian cancer, 11 miRs were upregulated (miR-16, miR-20a, miR-21, miR-23a, miR-23b, miR-27a, miR-93, miR-141, miR-200a, miR-200b, and miR-200c) and 12 were downregulated (miR-10b, miR-26a, miR-29a, miR-99a, miR-100, miR-125a, miR-125b, miR-143, miR-145, miR-199a, miR-214, and let-7b). [score:7]
Pecot et al. demonstrated that miR-200 inhibits angiogenesis through direct and indirect mechanisms by targeting interleukin-8 and CXCL1 that is secreted by tumor endothelial cells [58]. [score:7]
Of 29 miRs, they showed that only 4 (miR-141, miR-200a, miR-200b, and miR-200c) were upregulated and 25 were downregulated, including miR-199a, miR-140, miR-145, and miR-125b-1 in the cancer samples [21]. [score:7]
The miR-200 family plays a critical role in the suppression of epithelial-to-mesenchymal transition (EMT) and tumor cell migration, invasion, and metastasis by directly targeting ZEB1 (zinc finger E-box -binding homeobox 1) and ZEB2 [55, 56]. [score:6]
Van Jaarsveld et al. compared the miR expression profiles of cisplatin-sensitive and -resistant ovarian cancer cells, revealing that high expression of miR-141, miR-200c, miR-215, and miR-421 and low expression of miR-492-5p correlated with increased cisplatin resistance [61]. [score:6]
The restoration of miR-200c increased sensitivity to microtubule -binding chemotherapeutic drugs, paclitaxel, epothilone B, and vincristine and suppressed the expression of TUBB3. [score:5]
The researchers compared the expression profiles of 8 miRs (miR-21, miR-141, miR-200a, miR-200b, miR-200c, miR-203, miR-205, and miR-214) between cancer tissues and exosomes collected from the peripheral sera of the corresponding patients, since these had been previously demonstrated to be overexpressed in ovarian cancer. [score:4]
Members of the miR-200 family (miR-141, miR-200a, miR-200b, miR-200c, and miR-429) are downregulated in the majority of ovarian cancers, as previously described [21, 23]. [score:4]
Cochrane et al. found that class III tubulin (TUBB3), which encodes a tubulin isotype normally found only in neuronal cells, is a direct target of miR-200c [59, 60]. [score:4]
miR-200a or miR-200c inhibits cancer stem-like cell populations [56, 57]. [score:3]
They showed the therapeutic potential of miR-200 delivery in treating ovarian cancer or other malignancies [58]. [score:1]
Using several experimental mo dels, including mo dels of ovarian cancer, they showed that the delivery of the members of the miR-200 family into the tumor endothelium led to marked reduction in metastasis and angiogenesis and induced vascular normalization, resulting in ovarian cancer regression. [score:1]
6.1. miR-200 Family. [score:1]
Marchini et al. reported that low levels of miR-200c can predict poor survival and are a biomarker of relapse in stage I epithelial ovarian cancer [28]. [score:1]
Kan et al. found that miR-200a, miR-200b, and miR-200c were significantly elevated in the serum of patients and suggested that their presence could be used as a predictor of ovarian cancer [50]. [score:1]
Furthermore, it has been reported that miR-200 family members are associated with chemosensitivity in ovarian cancer. [score:1]
[1 to 20 of 17 sentences]
52
[+] score: 64
Dysregulated miRs in breast CAF included upregulation of miR-221, miR-31, and miR-221 with the downregulation of miR205, miR-200b, miR-200c, miR-141, miR-101, miR-342, let-7g and miR-26b affecting all aspects of cell differentiation and paracrine regulation (Zhao et al. 2012). [score:9]
Conversely, miR-200 expression down regulates known targets, including TGF-β2, that are particularly up regulated in many cancers (Benlhabib et al. 2015). [score:7]
CD-11-0219) 22585994 Benlhabib H Guo W Pierce BM Men delson CR 2015 The miR-200 family and its targets regulate type II cell differentiation in human fetal lung. [score:4]
However, the redundancy of miR-200 downregulation in both the epithelial and stromal compartments is highly supportive of using miR mimetic of this species. [score:4]
However, miR-200 family members have been reported to be both up- as well as downregulated in ovarian cancer (Park et al. 2008, Kan et al. 2012). [score:4]
Yet, in multiple independent studies miR-200 family was upregulated in metastatic breast and prostate cancers (Lin et al. 2014, Taylor et al. 2016). [score:4]
miR-9 inhibition or miR-200c restoration, delivered peritumorally to MDA-MB-231 xenografts, decreased the number of vascular lacunae, associated with breast tumor growth and dissemination (D’Ippolito et al. 2016). [score:3]
In the breast CAF, miR-200 family members seem to contributed to ECM remo deling through the expression of fibronectin and lysyl oxidase to potentiate cancer epithelial invasion (Tang et al. 2016). [score:3]
In a specific example, ectopic expression of miR-200 members significantly reduced anaplastic thyroid carcinoma cell invasion in a ZEB1/ZEB2 -dependent manner (Fig. 1) (Braun et al. 2010). [score:3]
Several miRs, such as miR-21, miR-34a, and the miR-200 family cluster target TGF-β signaling in prostate, breast and thyroid cancer for their functions during tumor progression and promotion (Braun et al. 2010, Shen et al. 2012, Chen et al. 2016) (Fig. 1). [score:3]
2013.405) 24096486 Park SM Gaur AB Lengyel E Peter ME 2008 The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
Another target of miR-200 is Zeb1/Zeb2 in the maintenance of cellular plasticity, a major hallmark of tumor cell morphology (Brabletz & Brabletz 2010). [score:3]
CAN-15-2321) 26676753 Ahn SM Cha JY Kim J Kim D Trang HT Kim YM Cho YH Park D Hong S 2012 Smad3 regulates E-cadherin via miRNA-200 pathway. [score:2]
22283) 18506891 D’Ippolito E Plantamura I Bongiovanni L Casalini P Baroni S Piovan C Orlandi R Gualeni A Gloghini A Rossini A 2016 MiR-9 and miR-200 regulate PDGFR -mediated endothelial differentiation of tumor cells in triple negative breast cancer. [score:2]
Recently, miR-9 and miR-200c was found to regulate PDGFR -mediated endothelial differentiation of triple negative breast cancer (D’Ippolito et al. 2016). [score:2]
1090922) 14764882 Brabletz S Brabletz T 2010 The ZEB/miR-200 feedback loop – a motor of cellular plasticity in development and cancer? [score:2]
The point of this study was to test if the recovery of miR-200c can improve response to chemotherapy. [score:1]
It turned out that miR-21 helped distinguish between healthy and prostate cancer patients, but miR-141 (miR-200 family member) enabled distinction between localized and metastatic subjects. [score:1]
With the reports miR-200c role in ZEB1/ZEB2 -mediated EMT progression, Cittelly and coworkers found that restoration of miR-200c induced chemo- and ankoikis sensitivity (Cittelly et al. 2012). [score:1]
Importantly, miR-16 and miR-200 family members silences TGF-β signaling and blocks EMT (Brabletz & Brabletz 2010, Wang et al. 2014 b, Tang et al. 2016). [score:1]
Although in the epithelia miR-205 and miR-200 family members (miR-200c, miR-200b and miR-141) are associated with EMT progression, in fibroblastic cells they clearly have a different function. [score:1]
2012.210) 23070117 Cittelly DM Dimitrova I Howe EN Cochrane DR Jean A Spoelstra NS Post MD Lu X Broaddus RR Spillman MA 2012 Restoration of miR-200c to ovarian cancer reduces tumor burden and increases sensitivity to paclitaxel. [score:1]
[1 to 20 of 22 sentences]
53
[+] score: 64
For example, miR-200a and miR-200c were upregulated in all subtypes (mucinous, endometrioid, and clear cells), miR-200b and miR-141 were upregulated in serous as well as endometrioid carcinomas, and miR-21, miR-203, and miR-205 were upregulated only in endometrioid carcinomas. [score:10]
Prislei et al. (2013) showed that overexpression of miR-200c repressed the expression of level of class III β-tubulin (TUBB3), a factor associated with drug resistance and poor prognosis in ovarian cancer, and increased sensitivity to paclitaxel and cisplatin. [score:5]
ZEB1/2, two transcription factors involved in the mediation of the epithelial to mesenchymal transition, can inhibit the expression of miR-200 family members by binding to the promoter of both miR-200 clusters thereby blocking transcription (Gregory et al., 2008). [score:5]
In fact, Park et al. (2008) have shown a positive correlation in the expression of E-cadherin with the expression of miR-200c in ovarian-cancer tissues. [score:5]
The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. [score:4]
In turn, over expression of miR-200 family members repress ZEB1/2 levels, and leads to higher levels of E-cadherin and an epithelial phenotype (Burk et al., 2008). [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
The miR-200 family controls beta-tubulin III expression and is associated with paclitaxel -based treatment response and progression-free survival in ovarian cancer patients. [score:3]
miR-200c was the most differentially expressed and a combination of miR-200b and miR-200c gave the best predictive power for serous ovarian cancer. [score:3]
Leskelä et al. (2010) demonstrated instead that miR-200 family showed a significant association with treatment response to paclitaxel–carboplatin regimen: women lacking complete response to paclitaxel–carboplatin regimen had tumors with significantly lower miR-200c levels than the ones who had achieved complete response; in addition, higher expression of miR-200c was associated with lower relapse/progression rates. [score:3]
Same results were also obtained by Cochrane et al. (2010) which showed that restoration of miR-200c increases sensitivity to microtubule -targeting agents and mitigates invasiveness by 85%. [score:3]
We can summarize that cancer cells after being triggered by molecular signaling, such as TGF-β or PDGF-D, increases their levels of ZEB1/2 which in turn decrease the expression of miR-200 and induce EMT. [score:3]
The authors analyzed also the somatic mutations status of a ∼500-bp genomic region surrounding 10 ovarian-cancer-implicated miRNA genes (let-7a-2, let-7a-3, let-7b, miR-10b, miR-125b-1, miR-125b-2, miR-143, miR-145, miR-200c, miR-206). [score:2]
The analyses highlights the important role of a miRNA regulatory network consisting of eight key miRNAs for the mesenchymal subtype including miR-141 and miR-200, miR-29c, miR-101, miR-506, and miR-128. [score:2]
Another member of the miR-200 family, miR-200c, was also identified by Marchini et al. (2011) as associated with progression-free survival, overall survival, or both in multivariate analysis of stage I ovarian cancers. [score:1]
An important example of miRNA transcriptional control in ovarian cancer is represented by the miR-200 family, which has been shown highly modulated in ovarian cancer. [score:1]
A miR-200 microRNA cluster as prognostic marker in advanced ovarian cancer. [score:1]
miR-200a, miR-200b, and miR-429 are located on chromosome 1, while miR-200c and miR-141 are on chromosome 12. [score:1]
miR-200c and HuR in ovarian cancer. [score:1]
Loss of miR-200c: a marker of aggressiveness and chemoresistance in female reproductive cancers. [score:1]
Elevated levels of circulating microRNA-200 family members correlate with serous epithelial ovarian cancer. [score:1]
Association between miR-200c and the survival of patients with stage I epithelial ovarian cancer: a retrospective study of two independent tumour tissue collections. [score:1]
A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. [score:1]
The miR-200 family contains miR-200a, miR-200b, miR-200c, miR-141, and miR-429 which are arranged in two clusters in the human genome. [score:1]
[1 to 20 of 24 sentences]
54
[+] score: 63
This process may be reversible, since an increase in miR-200 family miRNAs expression initiates MET, restoring E-cadherin expression and promoting an epithelial phenotype [77]. [score:5]
Histograms showing relative expression (RQ) of mesenchymal markers (A), epithelial markers (B) and miRNA predictive target genes (C) in MSCs, after one week of transfection with miR-200 mimics (black bars), or with a control miRNA (scramble, white bars), in respect to control cells (CTR, grey bars). [score:5]
0159163.g008 Fig 8Histograms showing relative expression (RQ) of mesenchymal markers (A), epithelial markers (B) and miRNA predictive target genes (C) in MSCs, after one week of transfection with miR-200 mimics (black bars), or with a control miRNA (scramble, white bars), in respect to control cells (CTR, grey bars). [score:5]
Moreover, MSCs transfection with miR-200 mimics reduced the expression of two miRNA targets from our predictive analysis, CCND1 and IGF-1R (Fig 8C). [score:5]
In fact, mature miR-200 family miRNAs promote E-cadherin expression with the acquisition of an epithelial cell phenotype via post-transcriptional repression of zinc finger E-box binding transcription factor 1 and 2 (ZEB1 and ZEB2) [77]. [score:3]
We showed that both EVs and miR-200 family miRNAs can effectively reduce CCND1 and IGF1R expression in MSCs. [score:3]
A mixture of mimics was used to increase the expression of miR-200a, miR-200b, miR-200c, miR-141 and miR-429 in MSCs. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
In particular, we detected the expression of some miRNAs belonging to miR-200 family. [score:3]
Moreover, we observed an increased expression of ENPEP, indicating that the miR-200 miRNAs can induce the epithelial commitment of MSCs. [score:3]
After one week of transfection of bone marrow derived-MSCs with 5 synthetic miR-200 mimics, we observed a reduction in the expression of VIM and FN1, which is another mesenchymal marker involved in cell adhesion, cell migration, cell growth and cell differentiation [78]. [score:3]
Taken together, these results suggest that the miR-200 family carried by EVs can induce MET in MSCs by binding to the 3’UTR sequences of predicted target genes, like CCND1 and IGF1R (Fig 8D). [score:3]
Luciferase-3’UTR reporter constructs (0.8 μg) or the empty expression vector (negative control) were co -transfected with miR-200a, miR-200b, miR-200c, miR-141 and miR-429 mimics (0.5 μg, MiScript miRNA mimics, Qiagen) using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. [score:3]
We employed qRT-PCR to validate the expression levels of the five miRNAs belonging to miR-200 family, selected from the miRNA array. [score:3]
Analysis of mesenchymal and epithelial markers expression in MSCs transfected with miR-200 mimics. [score:3]
To assess whether miR-200 family can effectively repress translation through binding to CCND1 and IGF1R 3’UTR, we performed luciferase reporter assay. [score:2]
Among them, we found a subset of five miRNAs (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) that belong to miR-200 family, known to be involved in EMT [40, 41]. [score:1]
Recent studies on tumor cells [73– 76] have demonstrated that miR-200 family miRNAs (miR-200a, miR-200b, miR-200c, miR-141, miR-429) are involved in EMT. [score:1]
These data suggest that EVs may contribute to the epithelial commitment of MSCs by transferring a small subset of miRNAs that belong to the miR-200 family. [score:1]
MSCs were transiently transfected with miR-200a, miR-200b, miR-200c, miR-141 and miR-429 mimics (20 μM, MiScript miRNA mimics, Qiagen) using the HiPerFect Transfection Reagent (Qiagen), according to the manufacturer’s protocol. [score:1]
The role of the miR-200 family in epithelial-mesenchymal transition. [score:1]
As a result, miR-200 family induced a 90% reduction of luciferase activity in transfected cells. [score:1]
Role of the miR-200 family in the epithelial commitment of MSCs. [score:1]
We evaluated the expression of CCND1 and IGF1R in MSCs after incubation with EVs or TOT-CM and after cell transfection with miR-200 mimics. [score:1]
[1 to 20 of 24 sentences]
55
[+] score: 62
They found that miR-200 family inhibitors down-regulated pro-SP-C and SP-B expression. [score:8]
Of note, we did not observe upregulation of the primary direct targets of the miR-200 family in the transcriptome analysis of miR-200b [−/−] lungs. [score:7]
Others have shown that miR-200 is down-regulated in a mouse mo del of fibrotic lung disease and human patients with idiopathic pulmonary fibrosis (IPF) [21]. [score:6]
miR-200a and miR-429 were significantly downregulated, but no changes were observed in abundance of miR-200c and miR-141 ** P < 0.01, Student’s t-test, Data represent mean ± SEM of at least four independent experiments. [score:4]
Therefore, changes in proteins of the direct gene targets of the miR-200 family might not be reflected in the transcriptome of miR-200b [−/−] lungs. [score:4]
Benlhabib H Guo W Pierce BM Men delson CR The miR-200 Family and Its Targets Regulate Type II Cell Differentiation in Human Fetal LungJ. [score:4]
Members of the miR-200 family are down-regulated in the lungs of patients with IPF and a mouse mo del of lung fibrosis [21]. [score:4]
Moreover, miR-200c and miR-141, which are transcribed independently, are expressed normally suggesting that there are no compensatory effects. [score:3]
The expression of miR-200c and miR-141 did not change in the miR-200b [−/−] lungs compared to miR-200b [+/+] lungs, suggesting that there were no compensatory effects on other family members (Fig.   1f and Supplementary Fig. 5). [score:2]
Using human fetal lung cultures, Benlhabib, et al. showed previously that miR-200 family members regulate epithelial type II cell differentiation and function [33]. [score:2]
Du, J. T. et al. MicroRNA-200 family members are weakly expressed in the neurosensory epithelia of the developing zebrafish (Danio rerio) inner ear. [score:2]
MiR-200b belongs to the miR-200 family (miR-141, miR-429, miR-200a, miR-200b and miR-200c) and regulates epithelial-to-mesenchymal transition (EMT) in cancer and organ fibrosis 17– 20. [score:2]
The expression of miR-200c and miR-141 did not change in the miR-200b [−/−] fetal lungs compared to miR-200b [+/+] lungs, suggesting that there were no compensatory effects on other family members. [score:2]
miR-200b [−/−] lungs have dysfunctional surfactant and denser parenchyma with more fibroblast- like cellsSome of the lung function abnormalities in miR-200 [−/−] could result directly from changes in surfactant function or distal airway branching. [score:2]
Some of the lung function abnormalities in miR-200 [−/−] could result directly from changes in surfactant function or distal airway branching. [score:2]
mRNA-Seq whole transcriptome analysis demonstrated that mRNAs of epithelial cell differentiation and surfactant genes are most affected in miR-200b [−/−] lungsIn order to evaluate the effect on downstream targets and associated pathways owing to loss of miR-200b on the lung tissue transcriptome, we performed Next Generation Sequencing (NGS) on total RNA samples from lungs of three 8-week-old miR-200b [−/−] mice and three miR-200 [+/+] (wt) mice. [score:1]
Like what we observed in fetal lungs, adult miR-200b [−/−] lungs had lower miR-200ba and miR-429 abundance, but no changes in miR-200c and miR-141 abundance (Supplementary Fig. 5). [score:1]
Although miR-200c has the exact same seed sequence as miR-200b, the abundance of this microRNA along with miR141 was not changed in lungs and kidneys of 8-week old miR-200b [−/−] mice suggesting the absence of any compensatory effects of these two miR-200 family members in miR-200b deficient mice. [score:1]
Therefore, we assessed the biophysical function of surfactant from miR-200b [−/−] and miR-200 [+/+] lungs using capillary surfactometry. [score:1]
In order to evaluate the effect on downstream targets and associated pathways owing to loss of miR-200b on the lung tissue transcriptome, we performed Next Generation Sequencing (NGS) on total RNA samples from lungs of three 8-week-old miR-200b [−/−] mice and three miR-200 [+/+] (wt) mice. [score:1]
We then scanned three complete sections per lung of three miR-200b [+/+] and three miR-200 [−/−] lungs using an Axio Scan. [score:1]
These two miR-200 family members share the same transcript with miR-200b. [score:1]
We observed lower percentages of airspace in miR-200 [−/−] lungs (Fig.   3d). [score:1]
[1 to 20 of 23 sentences]
56
[+] score: 60
However, it has been shown that ZEB1 triggers a double negative feedforward loop, by downregulating its own inhibitors (i. e., the mir-200 family members) [47, 48]. [score:6]
As a case study, we propose two prototypes of pure sponge (Figure  5A) and mixed TF-sponge (Figure  6A) modules, extracted from the normal breast analysis: the first employs PTENP1, a growth-suppressive lncRNA already identified as ceRNA [22, 25]; the second engages PVT1 as a competitor of CDH1 for binding to the mir-200 family and ZEB1 as both a transcriptional repressor of CDH1 and a target of the mir-200 family. [score:5]
However, this mo del may be undermined by the evidence that PVT1 - the main sponge regulator of the mir-200 family in the normal network - also results upregulated (∼ 2-fold) in cancer. [score:5]
Specifically, ZEB1 results downregulated in our breast cancer dataset compared to normal samples, while both the mir-200 family members and CDH1 are overexpressed. [score:5]
This is suggestive of an epithelial-like phenotype maintained by high levels of the mir-200 family members, which inhibit ZEB1 and, hence, increases the expression of ZEB-repressed epithelial genes, such as CDH1 (also known as E-cadherin) [33, 47]. [score:5]
Interestingly, the mir-200 family members are well-known to be involved in cancer metastasis and are believed to play an essential role in tumor suppression by inhibiting epithelial-to-mesenchymal transition (EMT), the initiating step of metastasis [32- 34]. [score:5]
Along this line, the mir-200 family members appear highly upregulated in the cancer dataset that we analyzed (from 4- to 8-fold). [score:4]
Moreover, it reveals a net binding preference towards the mir-200 family (Figure  7A), which it antagonizes to regulate the expression of hundreds of mRNAs in the normal case. [score:4]
In particular, the switch to a mesenchymal state can be induced by the transforming growth factor TGF β, which increases ZEB1, while ectopic expression of the mir-200 family members, which reduces ZEB1, seems either to prevent TGF β -induced EMT or to initiate epithelial-like reversion in mesenchymal cells [33]. [score:3]
Moreover, the mir-200 family members have recently been associated to human breast cancer [35- 39] and their overexpression was shown to promote the mesenchymal-to-epithelial transition [40]. [score:3]
This marked pattern suggests the existence of specific miRNAs, particularly the mir-200 family, acting at global level as buffers of mRNA/lncRNA highly co-expressed pairs. [score:3]
We speculate that the withdrawal in cancer of the PVT1 ceRNA activity can be due to the preferential expression of the two isoforms missing the binding sites for the mir-200 family. [score:3]
Particularly, ceRNA mechanisms orchestrated by the mir-200 family, which is preponderant in the normal breast scenario, disappear in the BRCA network, where other sponges appear to be activated. [score:1]
In particular, members of the mir-200 family can be grouped in two clusters based on the seed sequence (i. e., the mir-200b/c/429 and mir-200a/141 clusters), differing by one nucleotide. [score:1]
It is connected to 753 different mRNAs (∼50% of total mRNAs in the network) and the mir-200 family members are mediating over 80% of these interactions (Additional file 5: Tables S5 and S10). [score:1]
Note that two isoforms (Iso 11 and 12) lack seed matches for the mir-200 family. [score:1]
In particular, we observed an outstanding prevalence of the mir-200 family in the whole normal-MMI-network. [score:1]
Interestingly, PVT1 revealed a net binding preference towards the mir-200 family as the bone of contention with its rival mRNAs. [score:1]
Colored boxes correspond to exons where the seed-complementary sites - for mir-200a/mir-141 (red), and for mir-200b/mir-200c (purple) - occur. [score:1]
Despite most of the PVT1 alternative isoforms harboring seed matches for both clusters (Figure  7C), two isoforms lack the putative MREs for the mir-200 family. [score:1]
Notably, the normal MMI-network (1738 nodes and 32375 edges) is marked by a clear segregation into two internally well connected components: a larger one (1354 nodes and 31417 edges) mainly dominated by the mir-200 family and a smaller one (378 nodes and 954 edges) mainly controlled by mir-452. [score:1]
[1 to 20 of 21 sentences]
57
[+] score: 58
We also found that treating Huh7.5 human hepatoma cell-derived tumor xenografts with DCLK1-specific siRNA resulted in tumor growth arrest, downregulation of DCLK1, and increased expression of tumor suppressor miRNAs let-7a, miR-200, and miR-143/145. [score:8]
Treatment of Huh7.5 human hepatoma cell-derived tumor xenografts with DCLK1-specific siRNA produced tumor growth arrest, DCLK1 downregulation, and increased expression of tumor suppressor miRNAs let-7a, miR-200, and miR-143/145. [score:8]
Inhibition of DCLK1 results in downregulation of EMT-related genes via miR-200. [score:6]
Figure 5Knockdown of DCLK1 results in inhibition of cMYC via let-7a and EMT via miR-200 A. Decreased expression of cMYC mRNA in NP-siDCLK1 -treated tumors. [score:6]
These results show that DCLK1 negatively regulates tumor and EMT suppressor miRNA miR-200 in liver cancer, and DCLK1 affects miR-200 downstream targets. [score:6]
Tumor suppressor miRNAs miR-144 C. miR-145 D. and miR-200a, b, c E. were significantly (p < 0.0001, except for miR-200c) downregulated in HCC tumors compared with adjacent normal tissue. [score:5]
Following DCLK1 knockdown, a significant downregulation (>50%, p < 0.01) in miR-200 -dependent luciferase activity was observed (Figure 5C). [score:5]
Knockdown of DCLK1 results in inhibition of cMYC via let-7a and EMT via miR-200. [score:4]
We predicted that DCLK1 plays a regulatory role in EMT, and that DCLK1 negatively regulates miR-200. [score:3]
C. siRNA -mediated knockdown of DCLK1 resulted in a decrease in miR-let-7a and miR-200 -dependent luciferase activity was observed in Huh7.5 cells. [score:2]
To demonstrate that DCLK1 negatively regulates miR-200, we transfected the Huh7.5 cells with plasmid containing luciferase gene under the control of 3′UTR containing miR-200 binding site. [score:2]
In xenografts treated with NP-siDCLK1, we observed a reduction of miR-200 downstream targets ZEB1, ZEB2, (Figure 5D), SNAIL, and SLUG (Figure 5E), compared with controls and tumors treated with NP-siSCR. [score:2]
Plasmids containing binding sites for miR-200a, miR-200b, and miR-200c at the 3′UTR of the firefly luciferase gene were obtained from Switchgear Genomics (Menlo Park, CA). [score:1]
[1 to 20 of 13 sentences]
58
[+] score