sort by

134 publications mentioning mmu-mir-181c (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-181c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 257
Furthermore, to understand whether miR-181c overexpression induces differentiation mainly by regulating CARM1 expression, we co -transfected miR-181c mimics and a CARM1 miRNA-resistant expression vector into undifferentiated hESCs and found that co -expression of CARM1 and miR-181c maintained the number of AP -positive colonies independent of the expression of miR-181c (Figure 3C), CARM1 protein expression is also shown (Figure 3C). [score:14]
To further assess the effect of miR-181c on hESC differentiation, we knocked down miR-181c using a specific inhibitor and found that CARM1 and H3R17me2 protein expression levels were clearly down-regulated in comparison to hESCs treated with NC RNA (Figure 4A). [score:9]
Enforced expression of miR-181c led to a clear down-regulation of CARM1 expression at the protein level (Figure 3A). [score:8]
0053146.g004 Figure 4(A) Enforced expression of the miR-181c inhibitor down-regulated mature miR-181c levels relative to negative control (NC) RNA -transfected ESCs, as shown by qRT-PCR. [score:8]
ChIP was performed on sonicated chromatin from wild-type ES cells, CARM1- overexpressing cells, miR-181c -overexpressing cells and cells treated with the miR-181c inhibitor using anti-CARM1, anti-histone H3R17di-me antibodies, anti -RNA Polymerase antibodies and control IgG antibodies. [score:7]
Overexpression of miR-181c promoted the differentiation of hESCs, whereas overexpression of miR-181c inhibitor impeded differentiation. [score:7]
The depletion of CARM1 and histone H3R17 di-me at the promoters of pluripotency genes in miR-181c -overexpressing hESCs reveals that enforced expression of miR-181c induces differentiation independent of BMP4 by targeting CARM1. [score:7]
We found that CARM1 and histone H3R17 di-me were significantly enriched at the promoters of Oct4 and Sox2 in both NC RNA/pcDNA3 -overexpressing hESCs and CARM1 -overexpressing hESCs, whereas this enrichment was clearly decreased in miR-181c -overexpressing hESCs. [score:7]
We also found that CARM1 was post-transcriptionally regulated and was directly targeted by miR-181, which represses the 3′ untranslated region (3′UTR) of CARM1 in hESCs. [score:7]
Unexpectedly, the Nanog promoter did not show any detectable enrichment in NC RNA/pcDNA3 -overexpressing hESCs or miR-181c -overexpressing hESCs, but we found that CARM1 and histone H3R17 di-me were significantly enriched at the Nanog promoter in CARM1 -overexpressing hESCs (Fig. 3F). [score:7]
In differentiated hESCs, H3K27 methylation is inhibited because of the reduction of core pluripotency factors, and miR-181 family members are consequently significantly induced and down-regulate CARM1 activity. [score:6]
In this context, we scanned for microRNAs that target CARM1 and finally identified the miR-181 family as the critical regulator of CARM1 expression. [score:6]
In differentiated hESCs, H3K27 methylation is inhibited due to the reduction of core pluripotency factors, and miR-181 family members are subsequently induced and down-regulate CARM1 activity. [score:6]
To further investigate whether CARM1 directly targets the pluripotency genes Oct4, Sox2 and Nanog, we performed ChIP analysis on wild-type hESCs, miR-181c- overexpressing hESCs and CARM1 -overexpressing hESCs as well as hESCs transfected with negative control (NC) RNA or pcDNA3. [score:6]
Taken together, these results show that miR-181 directly regulates CARM1 by targeting its 3′UTR and that miR-181c may play a prominent role among the 4 members during hESC differentiation. [score:5]
hESCs treated with miR-181c inhibitor expressed Nanog after 8 days of differentiation (C). [score:5]
Figure S3 ChIP analysis of hESCs after miR-181c, CARM1 and miR-181c inhibitor overexpression. [score:5]
Enforced Expression of miR-181c Suppresses CARM1 -mediated Nanog Transcription. [score:5]
Enforced Expression of miR-181c Induced hESC Differentiation by Targeting CARM1 We selectively transfected miR-181c mimics in undifferentiated hESCs to study the effect of miR-181 on hESCs differentiation. [score:5]
Although the miR-181 family also regulates many target genes [21], [46], [47], [48], [49], it is important to highlight that in mouse ESCs, the miR-181 family regulates another histone modulator, Cbx7, which plays a critical role in maintaining ESC pluripotency [50]. [score:5]
The miR-181c inhibitor suppresses hESC differentiation. [score:5]
Enforced Expression of miR-181c Induced hESC Differentiation by Targeting CARM1. [score:5]
An siRNA that specifically targets and inhibits miR-181c was synthesized by GenePharma (Shanghai, China). [score:5]
The expression of Nanog and the marker genes for specific differentiated lineages was restored in comparison to miR-181c -overexpressing cells (Figure 3D, 3E). [score:5]
The core pluripotency factors also recruit H3K27 methylases to the miR-181c promoter to inhibit its expression. [score:5]
Enforced Expression of miR-181c Suppresses CARM1 -mediated Nanog TranscriptionIn previous reports, histone H3 methylation on R17 has been identified as the main substrate of CARM1 in mouse ESCs. [score:5]
Suppression of miR-181c led to a comparable number of AP -positive colonies relative to wild-type cells (Figure 4C), and the expression of most of the marker genes for specific differentiated lineages was restored to wild-type levels (Figure 4D). [score:5]
Figure S4 Changes of pluripotency and cell morphology in response to overexpression of CARM1 and inhibition of miR-181c upon induction of hESC differentiation. [score:5]
0053146.g002 Figure 2The miR-181 family directly regulates CARM1 expression in hESC. [score:5]
To investigate whether CARM1 can be directly targeted by miR-181, we engineered luciferase reporters that have either the wild-type 3′UTR of CARM1, or a mutant 3′UTR with three point mutations in the target sites as a negative control (Fig. 2C). [score:5]
As reported in previous studies [35], the core pluripotency factors co-occupied the promoters of pri-miR-181c/d with Polycomb group proteins, which increased local H3 lysine 27 (H3K27) methylation and inhibited miR-181c expression. [score:5]
The miR-181 family directly regulates CARM1 expression in hESC. [score:5]
All the results indicated that CARM1 down-regulation may greatly contribute to the miR-181-meidated hESC differentiation. [score:4]
Future studies will explore how the expression of the miR-181 family is regulated in ESC differentiation and whether other transcriptional factors are associated with CARM1. [score:4]
Suppression of miR-181c Impedes hESC Differentiation through the CARM1-related Pathway. [score:3]
By contrast, the expression of mutant reporters was not repressed by miR-181 (Fig. 2D). [score:3]
Comparison of mature miR-181c expression was performed with an unpaired Student’s t test. [score:3]
ChIP analysis detected that CARM1 and histone H3R17 di-me were significantly enriched at the Nanog promoter in antago-miR-181c -overexpressing hESCs (Fig. S3B). [score:3]
Human ESCs were transfected with miR-181c inhibitor or NC RNA and then induced to differentiate by the addition of BMP4 in the absence of bFGF. [score:3]
Thus, we suggest that CARM1 is one of the key target genes of the miR-181 family during the progression of ESCs differentiation. [score:3]
The mature transcripts of the 4 members of the miR-181 family were all found to be significantly increased in differentiated hESCs, and miR-181c had the highest expression level (Fig. 2A). [score:3]
We also found that the expression levels of the miR-181c/d primary transcripts (pri-181c/d) were notably elevated after differentiation in comparison to the primary transcripts of miR-181a and miR-181b (pri-181a1/b1 and pri-181a2/b2) (Fig. 2B). [score:3]
Furthermore, CARM1 partly rescued the effects of miR-181c expression by elevating the transcript levels of Nanog and maintained hESCs colony morphology temporarily under differentiation conditions. [score:3]
Our work suggests that downstream targets of the miR-181 family include epigenetic factors that reconfigure the H3 arginine methylation signature during the process of hESC differentiation. [score:3]
By contrast, the suppression of miR-181c promotes the recruitment of endogenous CARM1 to the promoters of pluripotency genes, especially Nanog, to impede differentiation. [score:3]
Meanwhile, we found that CARM1 overexpression greatly rescued the effects of miR-181c on promoting ESC differentiation. [score:3]
Considering that the sites of the CARM1 3′UTR that are targeted by miR-181 family members are conserved in mammals, we suppose that the interaction between miR-181 and CARM1 is conserved in mESCs. [score:3]
To further reveal the mechanism of CARM1 -mediated gene regulation, we then assessed whether the CARM1 -mediated histone H3 methylation contributed to the regulation of pluripotency genes Oct4, Sox2 and Nanog after miR-181c transfection. [score:3]
miR-181 Family Members are Critical Regulators of CARM1 during hESC Differentiation. [score:2]
This blockade implicated miR-181c as a prominent regulator of differentiation. [score:2]
Our results also suggest that the miR-181/CARM1/core-pluripotency-factors regulatory loop may be a novel mo del pathway involved in the modulation of hESC pluripotency (Figure 4E). [score:2]
miR-181c leads to hESC differentiation through negative regulation of CARM1 and H3R17 methylation. [score:2]
We selectively transfected miR-181c mimics in undifferentiated hESCs to study the effect of miR-181 on hESCs differentiation. [score:1]
In our results from miR-181c -transfected hESCs, we also found that the global level of histone H3 methylation on R17 was also significantly decreased (Figure 3A). [score:1]
To study the role of endogenous miR-181 in repressing the CARM1 3′UTR reporter in differentiated hESCs, we co -transfected the wild-type 3′UTR luciferase reporter and the negative control luciferase into differentiated hESCs. [score:1]
This finding suggests that the miR-181 family may also promote differentiation by affecting histone modulation in mESCs. [score:1]
[1 to 20 of 56 sentences]
2
[+] score: 198
Collectively, all data from our study demonstrate that miR-181c over -expression alleviated lung injury in COPD, as evident from the resulting amelioration of lung injury, reduction of the inflammatory response, neutrophil infiltration, and ROS generation, and down-regulation of CCN1 expression. [score:8]
These results suggest the critical roles of miR-181c and its target CCN1 in COPD development, and provide potential therapeutic targets for COPD treatment. [score:6]
Taken together, our data suggest the critical roles of miR-181c and its target CCN1 in COPD development, and provide potential therapeutic targets for COPD treatment. [score:6]
In the present study, we found that miR-181c over -expression alleviated lung injury in COPD, and decreased the inflammatory response, neutrophil infiltration, and ROS generation, whereas miR-181c inhibition showed the opposite effect on COPD development. [score:6]
Functional assays demonstrated that miR-181c over -expression decreased the inflammatory response, neutrophil infiltration, reactive oxygen species (ROS) generation, and inflammatory cytokines induced by CS, while its down-regulation produced the opposite effects. [score:5]
Yang et al. recently reported that miR-181c limits nitration stress of endothelial cells in diabetic db/db mice through inhibiting the expression of FoxO1 [25]. [score:5]
Moreover, levels of IL-6 and IL-8 in lung tissues were increased in CS-exposed mice; miR-181c over -expression reduced levels of IL-6 and IL-8, demonstrating that miR-181c can suppress the inflammatory response in COPD. [score:5]
CCN1 expression was increased in lung tissues of COPD patients, and was negatively correlated with miR-181c expression in human COPD samples (p < 0.01). [score:5]
miR-181c was over-expressed or inhibited using specific agomiRs and antagomiRs, respectively, which were synthesized by RiboBio Co. [score:5]
The relationship between miR-181c expression and CCN1 mRNA expression levels was analyzed using Pearson correlation analysis. [score:5]
Over -expression of miR-181c impeded CS -induced lung injury, while inhibition of miR-181c enhanced lung injury. [score:5]
Over -expression of miR-181c alleviated lung injury and neutrophil infiltration in CS-exposed mice, whereas miR-181c inhibition had the opposite effect. [score:5]
In the present study, CCN1 was found to be the direct and functional target of miR-181c. [score:4]
We also observed a down-regulation of miR-181c in HBECs and a mouse mo del after cigarette smoke (CS) exposure. [score:4]
Wang and colleagues reported that miR-181c targets Bcl-2 and regulates mitochondrial morphology in myocardial cells [24]. [score:4]
Functional assays demonstrated that miR-181c over -expression alleviated and miR-181c inhibition aggravated lung injury in COPD. [score:4]
miR-181c exerts its effect via negatively regulating CCN1 expression in COPD. [score:4]
A sequence with a mutation in the miR-181c target site (MUT) was synthesized. [score:4]
Taken together, these findings demonstrated that miR-181c may exert its effect through regulating CCN1 expression in COPD. [score:4]
In addition, CCN1 was identified as the direct target of miR-181c in COPD. [score:4]
To verify that CCN1 is a direct target of miR-181c, we cloned a reporter plasmid containing the wild-type (WT) or mutant (MUT) 3′-UTR of CCN1. [score:4]
BALF fluid COPD Chronic obstructive pulmonary disease CS Cigarette smoke CSE Cigarette smoke extract HBECs Human bronchial epithelial cells miR-181c microRNA-181c qRT-PCR Quantitative real-time PCR ROS Reactive oxygen species This work was supported by the grants from the Shanghai Municipal Health and Family Planning Commission scientific research project (201540123), and Key Department of Shanghai Fifth People’s Hospital (2017WYZDZK07). [score:3]
The expression levels of miR-181c and CCN1 were detected using SYBR Premix Ex Taq (TaKaRa) according to the manufacturer’s instructions. [score:3]
The cells were harvested for RNA isolation and miR-181c expression was analyzed. [score:3]
These data indicated that miR-181c was decreased in COPD and may serve as an inhibitor of COPD. [score:3]
Fang and colleagues showed that miR-181c targeting TRIM2 ameliorates cognitive impairment induced by chronic cerebral hypoperfusion in rats [23]. [score:3]
Previous studies have shown that miR-181c is implicated in regulation of the inflammatory response, energy metabolism, and cancer development. [score:3]
When miR-181c was inhibited, ROS generation increased significantly, clearly indicating an important role of miR-181c in ROS generation during COPD. [score:3]
We showed that miR-181c was significantly down-regulated in lung tissues from patients with COPD compared to individuals who had never smoked (p < 0.01). [score:3]
miR-181c has also been shown to be down-regulated in patients with COPD compared to never smokers [8]. [score:3]
Data represent mean ± SD from three independent experiments; * p < 0.05, ** p < 0.01 We first determined the expression pattern of miR-181c in a total of 34 human lung tissue samples, including 8 never smokers, 8 smokers without COPD and 18 COPD patients. [score:3]
In addition, ROS generation was markedly increased in CS-exposed mice, and miR-181c over -expression reduced ROS generation, indicating that miR-181c decreased ROS generation in COPD. [score:3]
h Pearson correlation analyses between miR-181c levels and mRNA expression levels of CCN1 in human COPD tissues. [score:3]
Levels of miR-181c and mRNAs were normalized to RNU6B small nuclear RNA and β-actin, respectively, to yield a 2 [-ΔΔCT] value for relative expression of each transcript. [score:3]
c miR-181c expression was tested in lungs of mice exposed to air or CS for 4 or 24 weeks. [score:3]
a The relative expression levels of miR-181c were examined by qRT-PCR in lung tissues of 8 never smokers, 8 smokers without COPD and 18 COPD patients. [score:3]
Levels of miR-181c expression in lung tissues of COPD patients and CS-exposed mice. [score:3]
We also analyzed the miR-181c expression in a mouse mo del of CS exposure. [score:3]
Consistent with our observations in the human lung, miR-181c was significantly down-regulated in lung tissues of mice exposed to CS for 24 weeks, compared with air-exposed mice (p < 0.05; Fig. 1c). [score:3]
miR-181c expression was detected in human lung tissue samples of 34 patients, an in vivo murine mo del of CS exposure, and primary human bronchial epithelial cells (HBECs) by qRT-PCR. [score:3]
These results indicated that miR-181c inhibited the inflammatory response in CS-exposed cells and mice. [score:3]
Here, we showed that the expression of miR-181c was decreased significantly in COPD clinical samples. [score:3]
miR-181c COPD CCN1 Lung injury Inflammatory cytokines Chronic obstructive pulmonary disease (COPD) is a common, preventable and treatable disease that is characterized by persistent respiratory symptoms and a progressive airflow limitation due to airway and/or alveolar abnormalities usually caused by an abnormal inflammatory response of the lung to noxious particles and gases [1]. [score:3]
We first determined the expression pattern of miR-181c in a total of 34 human lung tissue samples, including 8 never smokers, 8 smokers without COPD and 18 COPD patients. [score:3]
b The expression levels of miR-181c in HBECs 24 h after CSE exposure. [score:3]
In addition, correlation analyses revealed that miR-181c levels were negatively correlated with expression levels of CCN1 in human COPD tissues (Fig. 4h). [score:3]
Moreover, miR-181c levels were negatively correlated with expression levels of CCN1 in human COPD samples. [score:3]
Subsequent investigation found that CCN1 was a direct target of miR-181c. [score:2]
Subsequent investigation revealed that CCN1 is the direct and functional target of miR-181c in COPD. [score:2]
miR-181c is a member of the miR-181 family and plays an important role in inflammatory response, energy metabolism, and cancer development [11]. [score:2]
Compared with never smokers, the relative expression levels of miR-181c were significantly decreased in lung tissues of smokers and COPD patients (p < 0.01; Fig. 1a). [score:2]
Mutations in the complementary site for the seed region of miR-181c in 3′-UTR of CCN1 gene are indicated. [score:2]
In addition, we exposed HBECs to 2.5% CSE or control medium, and found that the expression of miR-181c in CSE -treated cells was significantly decreased by 53% as compared with control cells (p < 0.01; Fig. 1b). [score:2]
a miR-181c binding sites in the CCN1 3′-UTR. [score:1]
Effect of miR-181c on inflammatory cytokine levels in CS-exposed mice and cells. [score:1]
However, the role of miR-181c in COPD remains unclear. [score:1]
Co-transfection of agomiR-181c and CCN1–3′-UTR-WT strongly decreased luciferase activity, whereas co-transfection of agomiR-181c and CCN1–3′-UTR-MUT did not alter luciferase activity (Fig. 4b), indicating that miR-181c can bind to the CCN1–3′-UTR. [score:1]
In our study, we explored the biological activity of miR-181c in COPD. [score:1]
CCN1, also named Cyr61, was predicted to harbor one highly conservative miR-181c binding site in the 3′-UTR of CCN1 at position 519–525 (Fig. 4a). [score:1]
[1 to 20 of 59 sentences]
3
[+] score: 140
In MCAO mice, miR-181c modestly increased infarct volume, which was associated with downregulation of the anti-apoptotic protein Bcl-2 and upregulation of the pro-apoptotic factors, Bax and activated caspase-3. We found that miR-181c was involved in acute ischemic stroke, promoting apoptosis of BV2 and Neuro-2a cells and aggravating brain ischemia-reperfusion injury in a mouse mo del of stroke via modulation of pro- and anti-apoptotic proteins. [score:7]
Human activated CD4(+) T lymphocytes increase IL-2 expression by downregulating microRNA-181c. [score:6]
MiR-181 family members play a key role in the regulation of lymphocyte development and function [6- 11]; in particular, miR-181c has been shown to suppress the activation of CD4+ T cells [10]. [score:5]
MiR-181 has been shown to inhibit inflammation in astrocytes, microglia, and dendritic cells by suppressing cytokine levels [11, 14, 15, 22], and miR-181c -transfected BV2 cell culture medium reduced neuronal apoptosis induced by LPS [15]. [score:5]
Treatment with H [2]O [2] or LPS inhibited BV2 cell proliferation without inducing apoptosis, while treatment with miR-181c agomir suppressed proliferation and increased apoptosis in the presence or absence of H [2]O [2]/LPS treatment (Fig. 3A, B; P < 0.05). [score:5]
These results indicate that miR-181c suppresses microglia activation and the expression of the anti-apoptotic factor Bcl-2 while stimulating pro-apoptotic factors Bax and activated caspase-3. Figure 6. MiR-181c agomir exacerbates brain ischemia-reperfusion injury in an MCAO mouse mo del. [score:5]
C) MiR-181c agomir inhibited the expression of the anti-apoptotic protein Bcl-2 in the ipsilateral cortex, as detected by immunocytochemistry. [score:5]
We found that hsa-miR-181c levels were downregulated in the lymphocytes and plasma of stroke patients. [score:4]
Plasma hsa-miR-181c levels are downregulated in stroke patients. [score:4]
Furthermore, the upregulation of Bax and activated caspase-3 levels in the control MCAO group was potentiated by miR-181c agomir treatment (Fig. 6D; P < 0.05). [score:4]
The lymphocyte miRNA microarray analysis of acute stroke patients revealed that miR-181 family members, including hsa-miR-181a/c/d, were among the top 44 down- or up-regulated miRNAs (Table 1, P < 0.05), implying that this family is clinically relevant. [score:4]
Figure 1. Expression of miR-181c and miR181d in the plasma of acute stroke patients. [score:3]
In the present study, we showed that the miR-181c agomir suppressed proliferation and induced apoptosis of BV2 microglial cells cultured alone with or without H [2]O [2]/LPS treatment. [score:3]
Bcl-2, a mitochondrial membrane -associated protein, is a target of miR-181 that mediates miR-181a -mediated Neuro-2a cell death upon oxidative stress [14], miR-181a-triggered mitochondrial dysfunction and astrocyte death upon glucose deprivation [9], and miR-181d -induced glioma cell apoptosis [23]. [score:3]
Our data demonstrated that miR-181c expression was positively and negatively correlated with neutrophil and lymphocyte percentage, respectively. [score:3]
The microRNA miR-181c controls microglia -mediated neuronal apoptosis by suppressing tumor necrosis factor. [score:3]
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
Figure 3. MiR-181c agomir inhibits proliferation and induces apoptosis of BV2 microglial cells upon oxidative stress and inflammation. [score:3]
Hence, miR-181 causes cell injury mainly by targeting mitochondrial proteins. [score:3]
B) MiR-181c agomir inhibited microglia activation in the ipsilateral cortex, as determined by immunocytochemistry. [score:3]
Inhibition of microRNA-181 reduces forebrain ischemia -induced neuronal loss. [score:3]
Cerebral infarct volume was measured 72 h after reperfusion, and the expressions of the microglia marker Iba-1, the miR-181c target Bcl-2, and the pro-apoptotic factors Bax and activated caspase-3 in the ipsilateral cortex were detected by immunocytochemistry and western blotting. [score:3]
MicroRNA-181c negatively regulates the inflammatory response in oxygen-glucose-deprived microglia by targeting Toll-like receptor 4. J Neurochem, 132: 713- 723. [score:3]
These results indicate that although miR-181c and -181d belong to the same family, their expression levels are differentially altered in response to stroke. [score:3]
miR-181 regulates GRP78 and influences outcome from cerebral ischemia in vitro and in vivo. [score:2]
MiR-181c was also shown to increase the production of reactive oxygen species by targeting cyclooxygenase 1, a subunit of mitochondrial complex IV of the electron transport chain [24]. [score:2]
The positive correlation between the NIHSS score and miR-181c level suggest that miR-181c is a potential risk factor for stroke, and that miR-181c is a potential regulator of neutrophil and lymphocyte numbers in acute ischemic stroke. [score:2]
Given that higher neutrophil numbers before thrombolysis for cerebral ischemia predict worse outcomes [20] as well as the association between neutrophil-to-lymphocyte ratio and risk of stroke in patients with atrial fibrillation [21] we suggest that miR-181c is an immune regulator that modulates the neutrophil-to-lymphocyte ratio following acute ischemic stroke. [score:2]
Figure 5. MiR-181c agomir induces apoptosis of Neuro-2a cells co-cultured with BV2 microglial cells upon oxidative stress and inflammation. [score:1]
Given that acute stroke patients had lower levels of circulating miR-181c, we examined the correlation between this and the NIHSS score, which indicated the severity of ischemic stroke. [score:1]
MiR-181c agomir induces apoptosis of BV2 microglial and Neuro-2a neuronal cells. [score:1]
Real-time PCR (RT-PCR) quantification of miR-181c/d levels. [score:1]
Plasma levels of miR-181c (A) and miR-181d (B) in acute stroke patients and controls, as determined by semi-quantitative RT-PCR (n = 7 in the control group, n = 10 in the stroke group). [score:1]
Neuro-2a cells were transfected with miR-181c agomir at a final concentration of 50 nmol/l using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen) according to the manufacturer’s protocol, and 24 h later, the cells were treated with H [2]O [2] (200 μM) or lipopolysaccharide (LPS; 100 ng/ml) to induce oxidative stress and inflammation, respectively, for 24 h. BV2 microglia and Neuro-2a cells were co-cultured using transwell cell culture inserts (Dow Corning, Corning, NY, USA). [score:1]
The number of Bcl-2 [+] cells was increased in control MCAO mice, which was abrogated by miR-181c agomir treatment (Fig. 6C). [score:1]
[14] We observed that in Neuro-2a cells cultured alone, miR-181c agomir accelerated apoptosis induced by H [2]O [2], but not by LPS; however, when these cells were co-cultured with BV2 microglial cells, the miR-181c agomir accelerated both H [2]O [2]- or LPS -induced Neuro-2a apoptosis. [score:1]
Our results reveal a pro-apoptotic function of miR-181c both in vitro and in vivo. [score:1]
MiR-181c agomir accelerates apoptosis of neuronal cells co-cultured with microglial cells. [score:1]
Figure 4. MiR-181c agomir promotes apoptosis of Neuro-2a cells upon oxidative stress and inflammation. [score:1]
MiR-181c agomir promotes brain ischemia-reperfusion injury in a mouse MCAO mo del. [score:1]
Figure 2. Correlation between miR-181c level in plasma and NIHSS score (n = 7). [score:1]
Indeed, our in vitro study showed that miR-181c increased the apoptosis of Neuro-2a cells to a greater extent under conditions of oxidative stress than under inflammation, an effect that may be exerted via activation of a mitochondria -dependent apoptosis pathway. [score:1]
MicroRNA-181 regulates CARM1 and histone arginine methylation to promote differentiation of human embryonic stem cells. [score:1]
This is consistent with a previous observation that miR-181 levels were reduced in the brain tissue of rats subjected to transient focal ischemia [12], and were decreased in the ischemic penumbra, but increased in the ischemic core following transient focal ischemia in the mouse [13]. [score:1]
Plasma miR-181c concentration was positively correlated with neutrophil number (Fig. 2B, P < 0.05) and blood platelet count (Fig. 2C, P < 0.05), and negatively correlated with lymphocyte number (Fig. 2D, P < 0.05). [score:1]
We assessed the function of miR-181c in vivo using a mouse mo del of focal cerebral ischemia. [score:1]
Neuro-2a and BV2 cells transfected for 24 h with miR-181c agomir followed by H [2]O [2] (200 μM) or LPS (100 ng/ml) treatment for 24 h were washed twice with phosphate-buffered saline (PBS), and the apoptotic fraction was detected by staining with fluorescein isothiocyanate-conjugated annexin-V and propidium iodide (PI) using the Annexin-V/PI Apoptosis Detection kit (BD Biosciences, Franklin Lakes, NJ, USA) followed by cell sorting using a FACS Canto instrument (BD Biosciences). [score:1]
However, plasma miR-181c level was not correlated with other risk factors such as homocysteic acid, C reactive protein, triglyceride, total cholesterol, low density lipoprotein, and ApoB levels. [score:1]
Plasma miR-181c and -181d levels of stroke patients and healthy subjects were detected by RT-PCR. [score:1]
NIHSS scores were positively correlated with miR-181c levels, suggesting a neuroprotective role for miR-181c in acute ischemic stroke, even when correlation was not statistically significant (Fig. 2A). [score:1]
In the MCAO group, most Iba-1 [+] microglia were hypertrophied, with dense cytoplasm and rounded cell bodies (Fig. 6B, d-f); this phenotype was abolished by miR-181c agomir treatment (Fig. 6B, g-i). [score:1]
D) MiR-181c agomir increased the levels of the pro-apoptotic factors Bax and activated caspase-3 in the ipsilateral cortex, as detected by western blotting. [score:1]
We further examined the role of miR-181c in oxidative stress- or inflammation -induced apoptosis using an established BV2-Neuro-2a cell co-culture system, with apoptotic cells detected by flow cytometry (Fig. 5A). [score:1]
Neuro-2a cells were transfected with miR-181c agomir at a final concentration of 50 nmol/l using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen) according to the manufacturer’s protocol, and 24 h later, the cells were treated with H [2]O [2] (200 μM) or lipopolysaccharide (LPS; 100 ng/ml) to induce oxidative stress and inflammation, respectively, for 24 h. BV2 microglia and Neuro-2a cells were co-cultured using transwell cell culture inserts (Dow Corning, Corning, NY, USA). [score:1]
These results suggest that high miR-181c level is a potential risk factor for ischemic stroke and apoptosis of various types of neural cells during the acute stage. [score:1]
Given the correlation between miR-181c level and immune cell numbers in acute stroke patients, we examined the role of miR-181c in BV2 microglial cell proliferation and apoptosis under oxidative stress and inflammation. [score:1]
All cells were transfected with miR-181c agomir and concurrently treated with H [2]O [2] or LPS, and Neuro-2a cells and medium were analyzed 24 h later. [score:1]
After intracerebroventricular injection of control or miR-181c agomir or a negative control, focal ischemia was induced by middle cerebral artery occlusion (MCAO). [score:1]
Evidence for miR-181 involvement in neuroinflammatory responses of astrocytes. [score:1]
These results demonstrate that miR-181c exacerbates Neuro-2a cell apoptosis induced by H [2]O [2] but not LPS. [score:1]
Future studies will focus on the therapeutic potential of miR-181c delivered via intravenous injection in the treatment of ischemic stroke. [score:1]
We also analyzed the correlation between miR-181c level and serum biochemical parameters. [score:1]
In our ischemic stroke mo del, we demonstrated that the miR-181c agomir exacerbated brain ischemia-reperfusion injury, consistent with the reported effects of miR-181a in a mouse stroke mo del [13]. [score:1]
Treatment with miR-181c agomir along with H [2]O [2], but not LPS, markedly increased early and late apoptosis fractions (Fig. 4B, C; P < 0.05). [score:1]
Our analysis revealed a positive correlation between NIHSS score and miR-181c level although this was not statistically significant, suggesting that miR-181c is a potential risk factor for stroke. [score:1]
Sense and antisense miR-181c agomirs were synthesized by GenePharma based on the following sequences: has-miR-181c, 5'-AACAUUCAACCUGUC GGUGAGU-3' and 5'-UCACCGACAGGUUGAAUG UUUU-3'; and scrambled miRNA (negative control), 5'-UUCUCCGAACGUGUCACGUTT-3' and 5'-ACG UGACACGUUCGGAGAATT-3'. [score:1]
Cell culture and miR-181c agomir transfection. [score:1]
[1 to 20 of 67 sentences]
4
[+] score: 133
Since the expression of miR-181a is downregulated and Sirt1 expression is upregulated in muscle during ageing, and miR-181 negatively regulates myotube size, we suggest that age-related changes in miR-181a and its target gene(s) expression may act as a failing compensatory mechanism intended to preventing loss of muscle mass and potentially function. [score:16]
The expression of SIRT1 protein, but not mRNA in C2C12 myotubes was downregulated following overexpression of miR-181 and upregulated following inhibition of miR-181 function (Fig.   4d–f). [score:13]
We did not detect significant changes in p21 mRNA expression following manipulation of miR-181a levels, however p21 expression was downregulated following SIRT1 upregulation in C2C12 myotubes indicating that SIRT1 may play additional, miR-181-independent function in muscle, such as regulating cell senescence (Fig. S5). [score:12]
Error bars show SEM, *p < 0.05 (compared to control), n = 4The effect of changes in miR-181 and SIRT1 expression on the expression of p21, a cell cycle regulator associated with senescence and upregulated in muscle of older mice, was examined (Table  2; Fig. S5). [score:8]
Error bars show SEM; *p < 0.05 (compared with control or scrambled control as indicated); n = 3To validate Sirt1 as a physiologically relevant miR-181 target gene in muscle, the expression of Sirt1 transcript and protein was examined in C2C12 myotubes following miR-181 overexpression or inhibition using miRNA mimic or antimiR (AM181), respectively (Fig.   4c, d). [score:8]
Error bars show SEM, *p < 0.05 (compared to control), n = 4 The effect of changes in miR-181 and SIRT1 expression on the expression of p21, a cell cycle regulator associated with senescence and upregulated in muscle of older mice, was examined (Table  2; Fig. S5). [score:8]
Error bars show SEM; *p < 0.05 (compared with control or scrambled control as indicated); n = 3 To validate Sirt1 as a physiologically relevant miR-181 target gene in muscle, the expression of Sirt1 transcript and protein was examined in C2C12 myotubes following miR-181 overexpression or inhibition using miRNA mimic or antimiR (AM181), respectively (Fig.   4c, d). [score:8]
We have validated Sirt1 as a physiologically relevant direct miR-181a target in C2C12 myotubes (Fig.   4) and showed that miR-181 regulates myotube size through Sirt1, and potentially other target genes (Fig.   5). [score:7]
Mutation of the putative target site in the 3′UTR rendered the reporter construct insensitive to miR-181, indicating that interaction with the target site is required for the response (Fig.   4b, c). [score:6]
Co-transfection of SIRT1 overexpression construct together with miR-181 mimic rescued the miR-181 -induced phenotype, indicating the importance of Sirt1 as miR-181 target gene in controlling myotube size (Fig.   5). [score:5]
Error bars show SEM; n = 4–7; *p < 0.05 miR-181a directly regulates the expression of Sirt1The 3′UTR of Sirt1 has one putative miR-181 binding site conserved between human and mouse (Fig.   4a). [score:5]
Expression of miR-181 and its target gene, Sirt1, was manipulated in C2C12 myotubes; following transfections myotubes were stained for myosin heavy chain: MF20 - green; DAPI-blue. [score:5]
C2C12 myotubes were transfected with miR-181 mimic or inhibitor (AM) or SIRT1 overexpression construct. [score:5]
The GFP reporter containing wild type Sirt1 3′UTR was efficiently regulated by miR-181 but not by miR-24; a microRNA not predicted to target Sirt1 (negative control) (Fig.   4b, c). [score:4]
d, e Endogenous SIRT1 protein but not mRNA expression is regulated by miR-181 in C2C12 myotubes, as shown by representative Western blot or qPCR, respectively. [score:4]
Predicted target genes of miR-181 were initially chosen based on the global profiling data. [score:3]
Supplementary material 4 (TIFF 2558 kb)Fig. S5 miR-181 does not control the expression of p21, a marker of senescence. [score:3]
The 3′UTR region of Sirt1 with a wild type (WT) or mutated miR-181 target site (mutant) were synthesised using GeneArt service (Invitrogen) and cloned into a GFP TOPO vector (Invitrogen). [score:3]
Myotubes were transfected with either 100 nM miRNA-181, 100 nM antimiR-181 or 2.5 µg SIRT1 overexpression vector (Addgene, 1791) (Brunet et al. 2004) using Lipofectamine 2000™. [score:3]
Supplementary material 3 (TIFF 16208 kb)Fig. S4 a miR-181 expression can be modulated in C2C12 myotubes. [score:3]
To establish whether miR-181 directly interacts with the Sirt1 3′UTR, we generated a reporter construct containing a fragment of the Sirt1 3′UTR downstream of a GFP reporter (“wild type”). [score:2]
“Mutant” reporter contained a mutated miR-181 binding site. [score:1]
Error bars show SEM; n = 4–7; *p < 0.05 The 3′UTR of Sirt1 has one putative miR-181 binding site conserved between human and mouse (Fig.   4a). [score:1]
[1 to 20 of 23 sentences]
5
[+] score: 120
The results showed that miR-181 overexpression significantly decreased the luciferase activity, and mutations in the miR-181 binding site from the DAX-1 3′-UTR abolished this effect, suggesting that miR-181 directly inhibited DAX-1 expression by targeting the 3′-UTR (Fig. 4B). [score:11]
miR-181 targets the DAX-1 3′-untranslated region (3′-UTR) and downregulates its expression. [score:10]
They demonstrate that miR-181 overexpression causes the upregulation of AR target genes, suggesting that the proliferative role of miR-181, at least in part, may be dependent on androgen signaling. [score:8]
In the present study, elevated expression levels of AR target genes and proteins, including prostate-specific antigen, cyclin -dependent kinase (CDK) 1 and CDK2, was observed in LNCaP cells overexpressing miR-181 (Fig. 5). [score:7]
Therefore, these results suggest that miR-181 may negatively regulate DAX-1 expression at the translational level in LNCaP cells. [score:6]
In order to understand the underlying mechanism, potential targets of miR-181 were determined using TargetScan software. [score:5]
Previous studies have demonstrated that the upregulation of hepatic miR-181 promotes the growth, clonogenic survival, migration and invasion of hepatocellular carcinoma cells (7, 8). [score:4]
It was found that miR-181 is significantly upregulated in cancer tissues compared with that in normal adjacent tissues, as shown in Fig. 1. Since miR-181 was found to be upregulated in prostate cancer tissues, the effect of miR-181 on prostate cancer cell growth was investigated. [score:4]
Furthermore, in the present study DAX-1 was identified as a direct target of miR-181 in prostate cancer cells. [score:4]
miR-181 is upregulated in prostate cancer tissues. [score:4]
In addition, miR-181 overexpression was observed to promote the growth of LNCaP tumors in nude mice. [score:3]
The results suggest that miR-181 may be a potential therapeutic target for the treatment of prostate cancer in the future. [score:3]
The expression of miR-181 was analyzed in prostate cancer tissues and adjacent normal tissues using qPCR. [score:3]
DAX-1 was identified as a potential target of miR-181. [score:3]
In addition, the average tumor weight was significantly increased by miR-181 overexpression (Fig. 3C), suggesting that miR-181 may promote tumor growth in vivo. [score:3]
Furthermore, miR-181 overexpression decreased the percentage of cells in the G1 phase and increased the percentage of cells in the S phase (Fig. 2D). [score:3]
miR-181 overexpression promotes prostate cancer cell proliferation in vitro. [score:3]
Furthermore, the expression level of miR-181 is significantly associated with overall survival in hematological malignancies and may be an important clinical prognostic factor for patients with hepatocellular carcinoma (9). [score:3]
Therefore, in the present study, the expression of miR-181 was determined in prostate cancer tissues. [score:3]
A total of 2×10 [5] LNCaP cells stably expressing miR-181 or NC were injected subcutaneously into the dorsal flank of the mice. [score:3]
In the present study, it was demonstrated for the first time, to the best of our knowledge, that miR-181 overexpression may promote cell proliferation and cell-cycle progression in LNCaP cells. [score:3]
In combination, these results further confirm that DAX-1 is an important target gene of miR-181 in prostate cancer cells. [score:3]
Mutations were introduced in potential miR-181 binding sites using a site-directed mutagenesis kit (Qiagen). [score:3]
miR-181 overexpression promotes tumor growth in vivo. [score:3]
Therefore, miR-181 may be an onco-miRNA in the development of prostate cancer. [score:2]
To analyze miR-181 expression, specific stem-loop reverse transcription primers (Invitrogen Life Technologies) were used. [score:2]
The tumor size and volume were markedly increased in mice injected with LNCaP cells overexpressing miR-181 compared with those in control mice (Fig. 3A and B). [score:2]
To investigate whether DAX-1 may be directly targeted by miR-181, a luciferase reporter vector was constructed, containing the putative miR-181 binding sites within the DAX-1 3′-UTR. [score:2]
To further investigate the function of miR-181 on tumor growth in vivo, LNCaP cells with stable overexpression of miR-181 were generated and injected subcutaneously into the dorsal flank of nude mice. [score:1]
Notably, the 3′-UTR of DAX-1 mRNA was observed to contain a complementary site for the seed region of miR-181 (Fig. 4A). [score:1]
Furthermore, miR-181 mimics decreased the endogenous protein levels of DAX-1, as indicated by western blot analysis (Fig. 4C), while the DAX-1 mRNA levels remained unchanged (Fig. 4D). [score:1]
LNCaP cells were transfected with miR-181 mimics or NC (Fig. 2A). [score:1]
In conclusion, the present study provides a novel role for miR-181 in prostate cancer cell proliferation. [score:1]
Furthermore, the targets of miR-181 were investigated in order to determine the underlying mechanism of miR-181 in prostate cancer. [score:1]
Human miR-181 mimics and negative controls (NC) were purchased from Qiagen (Shanghai, China). [score:1]
[1 to 20 of 35 sentences]
6
[+] score: 77
DNMT3A (validated target of miR-29a-3p), BCL2 (validated target of both miR-34b-3p and miR-181c-5p), CCNE2 (validated target of miR-34b-3p) were downregulated only in SH-SY5Y (Figure 1). [score:10]
In silico analysis of DE miRNAs targets allowed to select four validated targets for both miR-29a-3p (CDK6, DNMT3A, DNMT3B, RAN) and miR-181c-5p (BCL2, GATA6, KIT, SIRT); five validated targets for miR-34b-3p (BCL2, CCNE2, CDK4, E2F3, MYB); four predicted targets for miR-517a-3p (IFNAR1, OLFM3, TNIP1, WEE1) (Supplementary Table S4). [score:9]
Expression profiling of candidate miRNAs in GI-ME-N, SK-N-BE(2)-C, SK-N-SH and SH-SY5Y revealed a statistically significant downregulation of miR-181c-5p and 517a-3p in all cell lines. [score:6]
MiR-181c-5p is a known tumor suppressor in neuroblastoma: it belongs to the miR-181 family, whose members are known to be upregulated after MYCN silencing [26, 27]. [score:6]
Moreover, by considering only neuroblastoma patients who showed relapse or progression of the disease and no MYCN amplification, lower expression of miR-181c was significantly associated with a worse prognosis (χ [2] = 8.29, df = 1, p-value = 4.0e-03, n = 120) (Figure 4C). [score:5]
Reduced expression of miR-181c is not significantly associated to a worse prognosis when considering the whole cohort of patients who undergo tumor progression event C. this relationship is significant when considering only the cases that progress and have no amplification of MYCN D. The cut off modus for miR-181c expression to draw Kaplan-Meier curves derives from the scan setting. [score:5]
Interestingly, Tumor Neuroblastoma - SEQC - 498 - RPM - seqcnb1 dataset analysis revealed that a decreased expression of miR-181c in neuroblastoma is linked to a worse overall survival (OS), either considering all neuroblastoma patients (χ [2] = 11.34, df = 1, p-value = 7.6e-04, n = 498) or selecting only cases with no MYCN amplification (χ [2] = 16.51, df = 1, p-value = 4.8e-05, n = 401) (Figure 4A, 4B). [score:3]
The link between miR-181c underexpression and poor outcome of neuroblastoma patients (found by querying public databases) suggests a potential prognostic value of this miRNA. [score:3]
Lower expression of miR-181c is related with a worse OS, either A. in the whole cohort of neuroblastoma samples or B. in only no amplified MYCN cases. [score:3]
Figure 4Lower expression of miR-181c is related with a worse OS, either A. in the whole cohort of neuroblastoma samples or B. in only no amplified MYCN cases. [score:3]
miR-181c expression and neuroblastoma patients' overall survival (OS). [score:3]
The same dataset did not show any significant variation in the expression of miR-181c-5p. [score:3]
In conclusion, our experimental data demonstrate that miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p are involved in neuroblastoma and are potential new therapeutic targets in neuroblastoma. [score:3]
Expression of miR-181c-5p and miR-517a-3p is known to be reactivated by 5′-AZA in gastric and bladder cancer, respectively [28, 29]. [score:3]
The analysis performed for different neuroblastoma stages showed a significant association between decreased expression of miR-181c and a worse overall survival of stage 4 neuroblastoma cases with no MYCN amplification (χ [2] = 7.17, df = 1, p-value = 7.4e-03, n = 116), but not with amplified MYCN (χ [2] = 1.7, df = 1, p-value = 0.192, n = 65) (Supplementary Figure S5). [score:3]
MiR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p regulate neuroblastoma cell viability. [score:2]
Expression profiling of 754 miRNAs, combined with methylation assays of specific CpG islands and in silico analyses, allowed us to focus on miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p. [score:2]
We focused our analysis on 12 miRNAs (miR-22, miR-29a-3p, miR-34a, miR-126, miR-140-3p, miR-141, miR-181c-5p, miR-202, miR-455-5p, miR-508-3p, miR-517a-3p and miR-576-3p). [score:1]
Cells were transiently reverse -transfected with 30 pmoles of miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p mimics or equal amounts of scrambled molecules for 24h and 48h, by using siPORTNeoFX Transfection Agent (Ambion [®], Austin, TX), according to the manufacturer's instruction. [score:1]
Transfection with miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p mimics determined a significant decrease of cell viability, both in SK-N-BE(2)-C and in SH-SY5Y. [score:1]
The promoter of the genes encoding seven of them (miR-29a-3p, miR-34a, miR-126, miR-141, miR-181c-5p, miR-202 and miR-517a-3p) contained CpG islands, whose methylation significantly decreased after treatment with 5′-AZA (see later). [score:1]
Briefly, 1.2 x 10 [4] cells / well were reverse -transfected with miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p mimics or equal amounts of scrambled molecules and were grown for 24h and 48h. [score:1]
[1 to 20 of 22 sentences]
7
[+] score: 65
A beta-galactosidase expressing vector, and luciferase reporter constructs containing the 3′ untranslated region of the murine Cd69, Prox1, and Lif (WT or with point mutations in two putative miR-181 binding sites (Mut. [score:6]
Thus, the entire miR-181 family could modulate stress responses by targeting Lif and IL-6, especially since IL-6 is a putative target of these miRs (Table 1). [score:5]
The miR-181 family members have overlapping targets such as Cd69, Prox1, Bcl-2, dual specificity phosphatases, and protein tyrosine phosphatases (Table 1). [score:3]
This miR has both similar and distinct gene targets as miR-181a, another member of miR-181 family. [score:3]
Interestingly, the 3′ untranslated region (UTR) of Lif contains 5 putative miR-181 binding sites (Figure S4A). [score:3]
It should be noted that the down-regulation of the miR-181 family was not as obvious with the RT-PCR assays as with the arrays. [score:3]
These experiments indicate that miR-181 family members can have both overlapping and distinct gene targets. [score:3]
While both miR-181c and miR-181d are expected to arise from the same polycistronic message, miR-181c is not highly expressed in thymocytes, suggesting additional post-transcriptional processes [39]. [score:3]
Of the miR-181 family members that were stress responsive in the thymus, miR-181a and miR-181b were also weakly expressed in the brain and spleen. [score:3]
MiR-181d, a member of the miR-181 family, had a 5–15 fold reduced expression following LPS or dexamethasone treatment, suggesting an important functional role for this miR in thymopoiesis. [score:3]
B) Schematic representation of the reporter constructs and predicted binding sites of miR-181 family in the 3′ untranslated region of Cd69, prox1, and Lif. [score:3]
The reduced expression of the miR-17-90 cluster and the miR-181 family was even more pronounced in the DP population (Figure 4B). [score:3]
Figure S5 Dose-response analysis of miR-181 target genes. [score:3]
Less is known about the role of the three other miR-181 family members (miR-181b, c, and d), two of which are expressed in developing thymocytes [39]. [score:3]
Target specificity of miR-181 family members. [score:3]
Thus, the pre-miR loop nucleotides of miR-181a versus miR-181c result in the differential ability of miR-181a to regulate thymocyte development compared to miR-181c [53]. [score:2]
Comparing all the thymocyte subsets, the CD8 SP was the most divergent, with the miR-17-90 cluster up regulated 2-fold and the miR-181 group unaffected by the LPS treatment. [score:2]
These included the miR-17-90 cluster, which have anti-apoptotic functions, and the miR-181 family, which contribute to T cell tolerance. [score:1]
The seed sequence of miR-181 is underlined. [score:1]
While all murine miR-181 family members have the same seed region (nucleotides 2–8 at the 5′ end), miR-181d is the most divergent based on total pre-miR sequence, and its precise function is unknown (Figure 5A) [53], [54]. [score:1]
A) Homology of miR-181 family members with the seed sequences shaded. [score:1]
MiR-181d is the most divergent of the four, and is located approximately 100 bp downstream of miR-181c. [score:1]
In addition, miR-181d and miR-181c are encoded on a chromosome (murine chromosome 8) distinct from the miR-181a and miR-181b cluster, which have undergone gene duplication on two separate chromosomes (murine chromosomes 1 and 2). [score:1]
0027580.g005 Figure 5 A) Homology of miR-181 family members with the seed sequences shaded. [score:1]
Each graph represents mean +/− SD of the ratio of the normalized luciferase activity in miR-181 and control vector transfections from three independent experiments, with each sample tested in triplicate (n. s.  = not significant, *p<0.05, **p<0.01, *** p<0.001, versus vector alone, unpaired Student t-test). [score:1]
This miR is a member of the miR-181 family, with all four members sharing an almost identical seed sequence. [score:1]
This is because miR-181a, miR-181b, miR-181c, and miR-181d are very conserved, with only 1–4 bp differences within this family. [score:1]
Each graph represents mean +/− SD, using the ratio of the normalized luciferase activity in miR-181 and control vector transfections. [score:1]
[1 to 20 of 28 sentences]
8
[+] score: 64
While a number of mRNA targets of miR-181 have been reported, it is not known whether miR-181d has overlapping and/or distinct targets. [score:5]
Such results reveal a differential regulation of miR-181 family members under both steady and disease states [11], [34], [35]. [score:4]
This finding is consistent with recent reports that miR-181c/d knock-out mice have normal T cell development [38], [39]. [score:3]
All miR-181 family members are primarily expressed in the thymus, at levels at least 10-20 fold higher than the brain and liver [35]. [score:3]
These experiments suggest that the targeted elimination of one miR-181 family member is insufficient to modulate the stress responsiveness of developing thymocytes. [score:3]
This excluded the first 28 nucleotides of miR-181c, eliminating the sense-antisense base pairing involved in pre-miR formation, thereby preventing miR-181c over -expression (Figure 1C and Figure S1). [score:3]
Since miR-181c and miR-181d are separated by only 85 nucleotides, the expression of miR-181d could only be achieved by including 146 bases upstream of miR-181d [11]. [score:3]
None of the miR-181 family members are normally expressed in these cells [11]. [score:3]
Consistent with this, a complete targeting of all miR-181 family members causes an embryonic lethality [39]. [score:3]
Although miR-181c and miR-181d are transcribed from the same cistron, miR-181d is expressed at least 5-10 fold higher in the hematopoietic lineages, including immature thymocytes and T-helper cells [34], [35]. [score:3]
In fact, the processing appears specific to miR-181d, as miR-181c is only marginally affected in spite of being expressed from the same cistron and separated by only 85 nucleotides. [score:3]
For the generation of the miR-181d knock-in construct, PCR reactions were performed to amplify a 3.56 kb genomic DNA fragment containing miR-181d followed by miR-181c (reverse orientation). [score:2]
Since miR-181c and miR-181d are separated by only 85 nucleotides, we utilized a knock-in (KI) approach in which only the miR-181d sequence was modified (miR-181d KI) (Figure 5A and Figure S4). [score:2]
MiR-181c expression was unaffected upon stress [11]. [score:2]
MiR-181 family members also target Bcl2, with its reduction increasing the GC-sensitivity of DP thymocytes [19], [36], [53]. [score:2]
Mature miR-181c (blue) and miR-181d (red) sequences are shown in uppercase, indicating that mature miR-181c sequence was excluded from the transgenic cassette. [score:1]
Contrasting this, the complete deficiency of all miR-181 family members is embryonic lethal, suggesting a functional compensation or redundancy [38]. [score:1]
It is a member of miR-181 family that includes miR-181a, miR-181b, and miR-181c. [score:1]
This indicates that the processing of the miR-181c/d locus during stress is very distinct from the two miR-181a/b loci. [score:1]
The transgenic construct was designed with the first 28 nucleotides of miR-181c lacking. [score:1]
These results suggest that multiple miR-181 family members function in a compensatory manner. [score:1]
The miR-181 family comprises four members, miR-181a, miR-181b, miR-181c, and miR-181d, which are generated from three separate genomic clusters (miR-181ab1, miR-181ab2, and miR-181cd) [32], [33]. [score:1]
This eliminates a significant segment of miR-181c, while leaving intact miR-181d. [score:1]
Wild-type pri-miR-181d sequence (∼394 bp, excluding the first 28 nucleotides of miR-181c) was cloned into pCDNA3.1 (Invitrogen). [score:1]
Mature mir-181c and miR-181d sequences are highlighted in green and blue, respectively. [score:1]
It is also plausible that stress can lead to a metabolic reprogramming in immature thymocytes by modulating miR-181 levels. [score:1]
This strongly argues for a functional redundancy/compensatory process among the miR-181 family members. [score:1]
A 3.03 kb genomic piece that continued from miR-181c, included new Nhe I and Hind III restriction sites, was PCR amplified and also cloned into a pCR2.1 TOPO-TA cloning vector. [score:1]
0085274.g001 Figure 1(A) Schematic shows the sequence homology between mature miR-181 family members. [score:1]
Following carbodiimide -mediated cross-linking [61], the membranes were hybridized with miR-181c and miR-181d probes labeled with [[32]P]-dATP using the Starfire kit (Integrated DNA Technologies, Coralville, IA). [score:1]
Pri-miR-181c/d cluster is located on mouse chromosome 8. Lengths of miR-181c (blue) and miR-181d (red) sequences are 89 and 72 nucleotides, respectively. [score:1]
This was done to disrupt the formation and processing of the pre-miR-181d stem-loop structure, without affecting miR-181c (Figure 5A and Figure S5). [score:1]
Accordingly, T cell-specific elimination of miR-181 family members might be beneficial to recover from thymic atrophy. [score:1]
The mutated miR-181d (KI) sequence (∼394 bp, excluding the first 28 nucleotides of miR-181c) was amplified by PCR using genomic DNA isolated from a tail biopsy from the miR-181d KI mice. [score:1]
In contrast to the stress effects on miR-181d, miR-181c remains unchanged while miR-181a and miR-181b are reduced 2- and 6-fold, respectively [11]. [score:1]
[1 to 20 of 35 sentences]
9
[+] score: 52
In contrast to mature CD4+ T cells, the miR-181 site affected eGFP- Cd69 3'UTR expression in CD4+ CD8+ DP thymocytes, which express maximal levels of the developmentally regulated miR-181 [31]. [score:7]
Mutation of the miR-181 site in the Cd69 3'UTR did not measurably affect the expression of eGFP in mature CD4+ T cells (Fig. 3C), which express only low levels of the developmentally regulated miR-181 [31]. [score:6]
In addition, miR-181, which also targets Cd69 and is a known modulator of T cell receptor signaling, also affects cell-to-cell variation of CD69 expression. [score:5]
miR-181 is a known modulator of TCR signal transduction [36– 38] and our data show that the deletion of mir-181ab1 affected the CV of CD69 expression mainly by altering the proportion of thymocytes that expressed CD69 at high levels. [score:5]
org) and established target of miR-34 [28] as well as the predicted miR-181 targets Ly6a and H2-K1 (www. [score:5]
To explore the influence of miR-181 on the CV of CD69 expression we analysed DP thymocytes deficient in mir-181ab1, which accounts for most of the miR-181a and -b copies in DP thymocytes [36]. [score:3]
Interestingly, CD69 expression in miR-181 -deficient DP thymocytes also showed an increased CV (Fig. 4A) over a range of activation conditions (Fig. 4B). [score:3]
A dual fluorescence reporter system identifies endogenous microRNAs that target the Cd69 3'UTR in DP thymocytesThe Cd69 3'UTR contains predicted sites for miR-181, miR-130 and miR-17/20 (http://www. [score:3]
Following activation, miR-181 -deficient DP thymocytes showed increased mean CD69 expression (control = 245 ± 17, mean miR-181 ko = 278 ± 10, n = 26, P<10 [–10], 2-tailed T-test). [score:3]
These results show that miR-181 is an important determinant of cell-to-cell variability in CD69 expression in activated DP thymocytes, and is required to restrict the fraction of CD69 [hi] DP cells. [score:3]
The microRNA miR-181 is a critical cellular metabolic rheostat essential for NKT cell ontogenesis and lymphocyte development and homeostasis. [score:2]
CD69 controls cell migration and sphingosine 1-phosphate signaling [30], and the Cd69 mRNA is a well-characterised target of miR-181 and other microRNAs [31– 33]. [score:1]
The 842 nt 3’ UTR of Cd69 contains predicted binding sites for miR-181, miR-130 and miR-17-20 starting at positions 255, 354 and 391, respectively, which were mutated alone and in combination. [score:1]
miReduce analysis [27] of 3'UTR motifs associated with post-transcriptional de-repression in Lck-Cre DP thymocytes (see GSE57511) showed enrichment for microRNAs miR-181, miR-17 and miR-142 (Fig. 1B). [score:1]
The increased CV was due mainly to a higher fraction of CD69 [hi] cells among miR-181 -deficient DP thymocytes (Fig. 4C). [score:1]
This is consistent with a role for miR-181 as a modulator of TCR signaling [36– 38] (Fig. 4E). [score:1]
E) Mo del for the action of miR-181 upstream of TCR signaling and on Cd69 mRNA. [score:1]
The Cd69 3'UTR contains predicted sites for miR-181, miR-130 and miR-17/20 (http://www. [score:1]
[1 to 20 of 18 sentences]
10
[+] score: 50
Asking whether miR-181 overexpression might affect the differentiation of macrophages toward M1 or M2 phenotypes, we examined the expression of iNos, a key M1 marker, and arginase and Mrc1 as M2 markers in transfected cells. [score:5]
Interestingly, gene ontology and pathway analysis performed on miR-181 predicted targets has shown an overrepresentation of TCR signaling and TGF-β signaling pathways among miR-181a and -b’s predicted targets (20). [score:5]
Indeed, two miRNA expression profiling studies on tissues derived from MS patients have demonstrated differential expression of miR-181 family members in MS brain tissue (13, 14). [score:5]
In the context of MS, both up- and downregulation of miR-181 mature isoforms have been reported in MS brains, this is likely a consequence of the degree of inflammation and tissue location with respect to MS lesions (13, 14). [score:4]
A profiling study performed by Junker et al reported downregulation of miR-181 family members in MS lesions (13). [score:4]
Overall these data showed that Smad7 expression was associated with alterations in miR-181 levels leading to molecular effects that influence T cell differentiation and macrophage activation in the context of autoimmune neuroinflammation. [score:3]
Overall, these data indicated that activation of immune cells could be associated with diminished expression of miR-181 isoforms, which in turn might play a role in subsequent pathogenic events. [score:3]
To examine the expression levels of miR-181 isoforms in T cells following polyclonal activation, we stimulated splenocytes with anti-CD3/CD28 antibodies and studied the transcript levels at several time points following stimulation. [score:3]
miR-181 family members show altered expression in MS tissues although their participation in MS pathogenesis remains uncertain. [score:3]
To examine whether diminished expression of miR-181 isoforms might occur in these cells following activation, we evaluated miR-181a and -b expression levels in primary macrophages and lymphocytes following cell activation. [score:3]
miR-181 Family Members Regulate the Differentiation of Th1 Cells and Tregs. [score:2]
Studies on mouse astrocytes have also indicated a regulatory role for miR-181 family members in these cells (46). [score:2]
Members of the miR-181 family are among dysregulated miRNAs in the CNS of patients affected by MS (13, 14). [score:2]
Prior studies have reported on the roles of miR-181 family members in development and function of immune cells, including their role in B cell and T cell differentiation and activities (10, 19). [score:2]
miR-181 -deficient mice show severe defects in development of B, T, NK and NKT cells (49). [score:2]
Correlation analyses revealed a significant inverse correlation between miR-181a or miR-181 b and Smad7 transcripts in EAE tissues (Figures 6C,D). [score:1]
The miR-181 family is highly conserved and consists of four members (miR-181a, miR-181b, miR-181c, and miR-181d) in both humans and mice. [score:1]
[1 to 20 of 17 sentences]
11
[+] score: 48
miR-181 overexpression down-regulates endogenous MADD expression. [score:8]
Studies on human glioma and glioma cell lines have shown decreased expression of miR-181 family members together with apoptosis induction and tumor growth inhibition following miRNA overexpression [41, 42]. [score:7]
Aberrant expression of miR-181 in neurodegenerative disease like multiple sclerosis has also been reported in previous studies [15, 17]. [score:5]
miR-181 upregulation enhances TNF -induced apoptosis. [score:4]
Among the microRNAs which are predicted to target DENN/MADD, we focused on miR-181 family members because of their implication in regulating apoptosis pathways and their broad conservation across species. [score:4]
DENN/MADD transcripts are targeted by miR-181. [score:3]
Other studies on astrocytes have shown increased resistance to apoptosis following miR-181 reduction likely through altered expression of Bcl-2 family members. [score:3]
Gene ontology analysis on the putative targets of miR-181 also indicates the involvement of this microRNA in cellular death processes (S4 Fig). [score:3]
Suppression of DENN/MADD could explain the resulting enhancement in TNF mediated apoptosis, however, the possibility remains that miR-181 might also affect other apoptosis mediators downstream of TNF receptor and its adaptor molecules. [score:3]
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
We also provide experimental findings indicating alteration of mitochondrial membrane potential in L929 cells following miR-181 mimic transfection. [score:1]
miR-181 repress DENN/MADD mRNA levels in L929 cells. [score:1]
miR-181 family of miRNAs is a broadly conserved group of miRNAs and its members have been revealed to influence different aspects of cell biology, including cell proliferation, differentiation and death [18– 23]. [score:1]
Co-transfection of HEK293T cells with vectors encoding the 3'UTR of DENN/MADD ligated to the Renilla luciferase with microRNA mimic sequences and negative control sequence showed significant decrease of luciferase activity in cells transfected with miR-181 b mimic sequences. [score:1]
In the current study, we show experimental evidence pointing to the regulation of DENN/MADD by miRNA-181 through luciferase assays and transfection experiments. [score:1]
[1 to 20 of 15 sentences]
12
[+] score: 41
The expression of the miR-302-367 cluster and the miR-181 family of miRNAs are activated by Wnt/β-catenin pathway 26 27, thereby we speculated that members of these family should be upregulated by BIO and CHIR because these inhibitors activate Wnt/β-catenin signalling. [score:8]
The small RNA deep-sequencing data shows that most of differentially expressed miRNAs in the BIO- and CHIR -treated cells were downregulated, including the Wnt/β-catenin-regulated miR-302-367 cluster and miR-181 family members. [score:7]
These data suggest that BIO and CHIR inhibit miRNA maturation, particularly inhibiting maturation of Wnt/β-catenin signalling-activated miR-302-367 cluster and miR-181 family of miRNAs, is probably because inhibition of GSK3 activity disturbs the nuclear localisation of Drosha. [score:7]
Additionally, BIO downregulated the expression of miR-181 family of miRNAs (Table 1). [score:6]
Unexpectedly, CHIR significantly downregulated the expression of miR-302-367 cluster and miR-181 family members, including miR-302a-5p, miR-302b-3p, miR-302d-3p, miR-181a-2-3p, miR-181a-5p, miR-181b-5p, miR-181c-5p, miR-181c-3p, and miR-181d-5p (Table 1). [score:6]
Expression of miR-302-367 cluster and miR-181 family members in BIO and CHIR treated mESCs detected by small RNA deep-sequencing. [score:3]
To better understand how BIO and CHIR regulate miRNAs that induced by Wnt/β-catenin signalling, we compared the expression of primary and mature miRNAs of miR-302-367 cluster and miR-181 family following BIO and CHIR treatment in J1 mESCs. [score:3]
The qPCR results of precursor form of the miR-302-367 cluster and miR-181 family members confirmed this notion. [score:1]
[1 to 20 of 8 sentences]
13
[+] score: 34
In order to mitigate the observed off- target transgene expression in ganglion cells following intravitreal delivery of hGRK1-containing AAV vectors, we incorporated a target sequence for miR181, an miRNA shown to be expressed exclusively in ganglion cells and inner retina into our AAV vectors (Atlas of miRNA distribution: http://mirneye. [score:9]
Similar to methods previously described, [32] we further restricted transgene expression to PRs by incorporating multiple target sequences for miR181, an miRNA endogenously expressed in cells of the inner and middle retina. [score:7]
At 4 weeks post-intravitreal injection, funduscopy and IHC on frozen retina cross sections revealed that addition of miR181c to the vector construct did eliminate off-target expression (Figure 7). [score:5]
A microRNA expression atlas of the mouse eye [55] indicates that miR-181c is highly expressed in retinal ganglion cells and middle retina and absent in photoreceptors in P60 mouse (http://mirneye. [score:5]
Although hGRK1-GFP-miR181c -mediated GFP expression was exclusive to PRs, it was also appreciably decreased (Figure 7). [score:3]
0062097.g007 Figure 7. Both hGRK1-GFP and hGRK1-GFP-miR181c were packaged in AAV2(quadY-F+T-V) and delivered intravitreally to C57BL/6 mice (1.5×10 [10] vg). [score:1]
php?state=P60&mirna=mmu-miR-181c). [score:1]
Both hGRK1-GFP and hGRK1-GFP-miR181c were packaged in AAV2(quadY-F+T-V) and delivered intravitreally to C57BL/6 mice (1.5×10 [10] vg). [score:1]
Both hGRK1-GFP and hGRK1-GFP-miR181c were packaged in AAV2(quadY−F+T−V) and delivered intravitreally to C57BL/6 mice (1.5×10 [10] vg). [score:1]
A hGRK1-GFP-miR181c construct was also generated and packaged in AAV2(quad Y−F+T−V) by inserting four tandem copies of complementary sequence for mature miR-181 (5′ ACTCACCGACAGGTTGAA 3′) (Atlas of miRNA distribution: http://mirneye. [score:1]
[1 to 20 of 10 sentences]
14
[+] score: 31
miR-181 is thought to function partly through inhibition of Hox-A11 expression [60]. [score:5]
An acute bout of endurance exercise results in the up-regulation of miR-1 and miR-181. [score:4]
In addition, miR-181 was found to be strongly up-regulated in regenerating muscle from an in vivo mouse mo del of muscle injury [60]. [score:4]
miR-1 and miR-181 expression in the quadriceps of C57Bl/6J mice (N = 7/group) 3-hour following an acute bout of END exercise vs. [score:3]
miR-1 and miR-181 expression following exercise. [score:3]
Both miR-1 and miR-181 expression, were increased in quadriceps by 40% and 37% (END vs. [score:3]
0005610.g004 Figure 4miR-1 and miR-181 expression in the quadriceps of C57Bl/6J mice (N = 7/group) 3-hour following an acute bout of END exercise vs. [score:3]
miR-1 and miR-181 are thought to play an important role in muscle differentiation and development as positive regulators of skeletal muscle remo deling and maintenance [26]. [score:3]
miR-1 and miR-181 expression are normalized to Rnu6. [score:3]
[1 to 20 of 9 sentences]
15
[+] score: 29
[9] The miR-181 family has also been reported to play an essential role in early NKT cell development by targeting 3'-UTR of PTEN in the thymus. [score:4]
Activin and TGFbeta regulate expression of the microRNA-181 family to promote cell migration and invasion in breast cancer cells. [score:4]
Several studies have suggested that TGF-β induces miR-181 expression. [score:3]
[7, 8] Accumulating evidence indicates that miR-181 modulates vascular function by targeting multiple key cell signaling pathways, including NF-κB signaling in the vascular endothelium as well as the PI-kinase pathway. [score:3]
Role of miR-181 family in regulating vascular inflammation and immunity. [score:2]
Better understanding of the role of miR-181 in the development of vascular stiffness and systolic hypertension may lead to novel therapeutic approaches in the future. [score:2]
miR-181 and metabolic regulation in the immune system. [score:2]
In theory, the entire miR-181 family can bind to the same 3'-UTR region of TGF-β ligand. [score:1]
This is due to 99.9% homology between the sequences (miR-181a and miR-181c; miR-181b and miR-181d). [score:1]
[7, 40, 41] The mature sequence of miR-181a1 and miR-181a2, and miR-181b1 and miR-181b2 are identical, but they are encoded from two different genomic loci: the miR-181a1 and miR-181b1 cluster is located on chromosome 1, and the miR-181a2 and miR-181b2 cluster is located on chromosome 9. [42] To test the baseline vascular function of miR-181 family in vivo, we used mice deficient for the miR-181a1-miR-181b1 cluster. [score:1]
Among the six mature family members, miR-181 a1, a2, b1, b2, c, and d, it has been found that miR-181a1 and miR-181b1 are the most prevalent in the aorta of mice. [score:1]
[7, 8, 10, 33] However, there is no evidence showing the role of miR-181 in baseline vascular function. [score:1]
[11] However, the role of the miR-181 family in overall vascular function, including endothelial function and vascular stiffness, remains unknown. [score:1]
[10] Together, these results suggest that the miR-181 family is an important modulator of vascular inflammation. [score:1]
Here we tested whether the miR-181 family can influence the pathogenesis of hypertension and vascular stiffening. [score:1]
The critical role for the miR-181 family in vascular inflammation has been documented. [score:1]
[1 to 20 of 16 sentences]
16
[+] score: 27
The sequences for control and miR-181a inhibitors were as follows: control inhibitor, 5′-CAGUACUUUUGUAGUACAA-3′ and miR-181 inhibitor, 5′-ACUCACCGACAGCGUUGAAUGUU-3′. [score:7]
MiR-181a down-regulates triglycerides and total cholesterol levels in vivoWe have recently characterized the inhibitory function of miR-181 in the regulation of embryo implantation in mice (unpublished data). [score:5]
The findings that IDH1 is a direct target of miR-181 and the opposite phenotypes displayed by miR-181a TG and IDH1 TG mice led us to test the possibility that miR-181a may regulate lipid metabolism through IDH1. [score:5]
To knockdown miR-181a in mice, six-week old miR-181 WT male mice were given administration of nanoparticles packed with either control or miR-181a inhibitors four times at one-week intervals 33. [score:4]
To determine whether miR-181a is involved in the regulation of lipid metabolism, six-week old miR-181 TG and WT male mice were fed with high fat diet (HFD) for 10 weeks. [score:2]
To explore whether miR-181a is involved in the regulation of lipid metabolism, both miR-181 TG and WT mice were fed with high fat diet (HFD), and after 10 weeks of feeding, miR-181a TG mice exhibited smaller size and lower body weight than miR-181a WT mice (Figures 1A and 1B) while these mice showed no obvious differences in food intake (Supplementary Figure S1B). [score:2]
We have recently characterized the inhibitory function of miR-181 in the regulation of embryo implantation in mice (unpublished data). [score:2]
[1 to 20 of 7 sentences]
17
[+] score: 26
With regard to AML, we previously provided preliminary evidence that miR-181 may target elements of the “inflammasome” that ultimately lead to NF-κB activation and leukemia growth, while Li et al. showed that miR-181 promoted apoptosis, reduced viability and delayed leukemogenesis in MLL-rearranged AML by downregulating the homeobox gene PBX3 [28]. [score:6]
However, in glioma high expression of miR-181 seems to have tumor suppressor activity [22]. [score:5]
In hematologic malignancies higher expression of miR-181 is associated with better outcomes [2, 9, 26– 28]. [score:3]
High expression of miR-181 has been associated with poor clinical outcomes in patients with colorectal cancer [20] and lymph node metastasis in oral squamous cell carcinoma [21]. [score:3]
Whereas in colorectal cancer [20] and lymph node metastasis in oral squamous cell carcinoma [21] a high miR-181 level seems to be associated with worse clinical outcomes, in glioma this miR has tumor suppressor function [22]. [score:3]
The miR-181 family comprises four mature miRs (miR-181a, miR-181b, miR-181c, miR-181d) and has been associated with the regulation of inflammatory mechanisms [17, 18]. [score:2]
It should also be underscored that we and others have reported that increased levels of miR-181 lead to enhancement of sensitivity to chemotherapy in AML mo dels [45, 46, 63]. [score:1]
The miR-181 -family has been reported to be an effector in inflammatory response by TNF-α, IL-6, IL-1β, IL-8 and IL-10 [17, 18, 51– 53]. [score:1]
Physiologically, miR-181 may accelerate the megakaryocyte differentiation of CD34 -positive hematopoietic cells [19]. [score:1]
In solid tumors the role of miR-181 seems to be organ-specific. [score:1]
[1 to 20 of 10 sentences]
18
[+] score: 23
Moreover, miR-181 is showed to be involved in synaptic plasticity and memory processing of Alzheimer's disease mice via targeting functional gene expression (Rodriguez-Ortiz et al., 2014). [score:7]
Upregulation of miR-181 decreases c-Fos and SIRT-1 in the hippocampus of 3xTg-AD mice. [score:4]
To be noted, study has pointed out that MEG3 serves as a competing endogenous RNA for miR-181 in other disease mo del. [score:3]
miR-181 regulates GRP78 and influences outcome from cerebral ischemia in vitro and in vivo. [score:2]
MiR-181 suppressed proliferation, migration, and invasion of astrocytoma and was proved to be involved in neuroinflammatory responses of astrocytes (Hutchison et al., 2013; Zhi et al., 2014). [score:2]
Basing on our data and online reference, we proposed that MEG3 might function as a regulator for miR-181 in ischemic neuron. [score:2]
Evidence for miR-181 involvement in neuroinflammatory responses of astrocytes. [score:1]
Interestingly, MEG3 has been recognized as a competing endogenous RNA for miR-181 in other experiments (Peng et al., 2015). [score:1]
As for brain ischemia, miR-181 contributes to astrocyte, a neuroprotective cell for brain ischemia (Ouyang et al., 2014), cell apoptosis in ischemic injury brain and in vitro glucose deprivation cultured astrocyte (Ouyang et al., 2012). [score:1]
[1 to 20 of 9 sentences]
19
[+] score: 23
Specifically, miR-181 family members (including miR-181c) were found to be upregulated in hepatocarcinoma stem cells [64] and are misexpressed in different forms of leukemia [68], [69], [70]. [score:6]
In these experiments, miR-181c remained upregulated by >2-fold after Activin treatment, suggesting that not only is its induction under the control of p-Smad2/3 but also its maintenance. [score:4]
Furthermore, the over -expression of a pool of six miRNAs, including miR-181c, promoted the differentiation of ES cells into the endoderm lineage suggesting that this miRNA is a candidate involved in the well known function of Nodal to induce endoderm. [score:3]
This suggests distinct commitments of Smad2/3 in either the transcriptional (Smad4 -dependent) or post-transcriptional (Smad4-independent) regulation of miR-181 family members. [score:2]
Interestingly, several studies have demonstrated the deregulation of the miR-181 family [64], [65], [66], [67], [68], [69], [70] and members of the pri-miR-341∼3072 cluster [71], [72], [73], [74], [75], [76], [77], [78], [79], in various forms of cancer. [score:2]
However, in this study siRNA knockdown of Smad4 actually increases mature levels of miR-181 family members, consistent with a Smad4-independent role for Smad effectors, as demonstrated by previous studies [44], [45], [46]. [score:2]
Future studies would address the role for miR-181d, derived from the same primary transcript as miR-181c, in vivo. [score:1]
miR-181 family members and miR-382 have been previously reported to respond to TGF-β/Activin treatment in different cells and tissues [46], [61], [62], [63]. [score:1]
Within this region, we found two ASE for pri-miR-181c/d and eight for pri-miR-341∼3072. [score:1]
0055186.g003 Figure 3(A, B) Schematic representations of the predicted gene structures of pri-miR-181c/d (A) and pri-miR-341∼3072 (B). [score:1]
[1 to 20 of 10 sentences]
20
[+] score: 23
Since activation of SIRT1 in neuronal precursors promotes astrocyte formation over neurogenesis [34], SIRT1 might represent a critical target for miR-9. Another similar example is miR-181, which is transiently upregulated during muscle differentiation [35]. [score:6]
Site-directed mutagenesis was performed using a QuikChange II Site-Directed Mutagenesis kit (Stratagene; La Jolla, CA) to mutate base pairs 3-6 in the predicted seed region targeted by miR-181 and miR-9 in the SIRT1 3'-UTR. [score:5]
Furthermore, miR-181 and miR-29 family members are downregulated in chronic lymphocytic leukemia, and miR-29 is lost in colon, breast, and lung cancer [50, 53]. [score:4]
Thus, miR-181 family members and miR-9 target the 3'-UTR of SIRT1 through the predicted seed sites. [score:3]
The specificity of this inhibition was demonstrated by testing the effect of the same miRNAs on a construct in which the miR-181 seed -binding site was mutated (pGL3-SIRT1 3'-UTR 181mt; Figure 4A, left panel). [score:3]
Thus, regulation of SIRT1 by miR-181 might contribute to the muscle differentiation program. [score:2]
[1 to 20 of 6 sentences]
21
[+] score: 23
For instance, miR-206 was upregulated in cTECs, mTEC [high], and mTEC [low]; miR-10b was downregulated in cTECs but upregulated in mTEC [high] and mTEC [low]; miR-181c was downregulated in cTECs and mTEC [high] but upregulated in mTEC [low]; and miR-363 was downregulated in cTECs, mTEC [low], and mTEC [high] (33). [score:19]
From the set of the 87 Aire -dependent miRNAs identified in this study, we identified 6 miRNAs (miR-10, miR-30e*, miR142-3p, miR-425, miR-338-3p, and miR-297) that were shared with the set of Aire -dependent miRNAs identified by in vitro Aire-knockdown of an mTEC cell line (35) and 4 miRNAs (miR-206, miR-10b, miR-181c, and miR-363) whose expression was previously detected in TECs. [score:4]
[1 to 20 of 2 sentences]
22
[+] score: 20
[21] Out of the nine miRNAs that were screened, four were upregulated (miR-135b, miR-155, miR-205 and miR-206: Figure 1a) and five were downregulated (miR-31, miR-148a, miR-181c, miR-200b and miR-210: Figure 1b). [score:7]
[21]Out of the nine miRNAs that were screened, four were upregulated (miR-135b, miR-155, miR-205 and miR-206: Figure 1a) and five were downregulated (miR-31, miR-148a, miR-181c, miR-200b and miR-210: Figure 1b). [score:7]
[30] Three of the downregulated miRNAs (miR-148a, miR-181c and miR-210) are normally highly expressed during lactation in the mouse mammary gland. [score:6]
[1 to 20 of 3 sentences]
23
[+] score: 20
Auxiliary pairing regulates miRNA–target specificity in vivoAs a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:7]
identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m). [score:4]
As a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:4]
Analysis of miR-125 and miR-181 families revealed additional intra -family target preferences (Supplementary Fig. 9a–d). [score:3]
Similarly, miR-181 family members were enriched in both seed -dependent and -independent classes. [score:1]
Interestingly, a number of major miRNAs enriched for seedless interactions (for example, miR-9, miR-181, miR-30 and miR-186) have AU-rich seed sites, indicating that weak seed-pairing stability may favour seedless non-canonical interactions 10. [score:1]
[1 to 20 of 6 sentences]
24
[+] score: 18
Further, p53-miRs, such as miR-181c, 30b and 92 [Table S2], are predicted to target lin-28B [56], [69], [70], indicating that p53, by suppressing the expression of lin-28B, it could increase the processing of the tumor suppressor miRNA, let-7. Interestingly, increased expression of let-7 has been shown to increase the expression of Ago-2 [71]. [score:13]
Among the p53-miRs that target the components of the miRNA processing complexes, miR-15/16/195, miR-103, miR-107, let-7, miR-124, miR-181, miR-148a/b, miR-30a/c, miR-27, miR-17, and miR-20 appear to target more than five components of the miRNA-processing pathway [Table 4, Table S3], suggesting the conserved nature of p53-miRs. [score:5]
[1 to 20 of 2 sentences]
25
[+] score: 18
In order to determine the functional role of miR-181-5p in TEC, the cell line mTEC1 was transfected with miR-181a-5p mimic, miR-181a-5p inhibitor, or a negative control and their in vitro proliferation was quantified[28]. [score:3]
Deletion of both miR-181 and miR-181 in mice perturbed Natural Killer T (NKT) cell and thymocyte development by regulation through PTEN phosphatase modulation of phosphatidylinositol 3-kinase (PI3K) that affects their anabolic activity[24]. [score:3]
Role of miR-181 family in regulating vascular inflammation and immunity. [score:2]
This resulted in decreased number of T cells and an increase number of B cells showing that miR-181 acts as a positive regulator of B cells. [score:2]
The importance of miR-181 genes has been shown to be important in cellular growth, development, endothelial cell function and also plays an important role in the immune system[19] [20] [21]. [score:2]
TaqMan Probes used for miRNA181 detection were: mmu-miR-181a (mature miRNA sequence): ACCGACCGUUGACUGUACCUUG, miRBase Accession Number MIMAT0005443. [score:1]
These mice had a decrease in the absolute number of thymocytes further emphasizing the important role miR-181 plays in thymus[24]. [score:1]
In mice with a miR-181 deletion, the absolute number of thymocytes is significantly decreased, highlighting the important role miR-181 plays in thymus[24]. [score:1]
The family of miR181 genes is encoded by 6 miRNAs on three separate chromosomes- MiR-181a1, miR-181a2, miR-181b1, miR-181b2, miR-181c, and miR-181d[22]. [score:1]
In mature CD8+ T cells that were transduced with miR-181a, the TCR was much more sensitive to antigenic stimulation based on the number of peptides required to produce IL-2. Studies by Chen et al. [21], evaluated the ectopic expression of miR-181 in murine lineage negative bone marrow cells. [score:1]
miRNA181 [a/b] relative expression was calculated as 2 [-∆Ct] values. [score:1]
[1 to 20 of 11 sentences]
26
[+] score: 17
As shown, the expression levels of miR-183 and miR-181 were significantly downregulated, while miR-29a and miR-34a were upregulated with aging compared to P21. [score:8]
The two downregulated miRNAs, miR-181 and miR-183, are important for proliferation and differentiation, respectively [39]– [42]. [score:4]
miRNAs that were significantly downregulated include members of the miR-181 and miR-183 families. [score:4]
The miR-181 family is known to mediate proliferation in many cells [54], [65], [66]. [score:1]
[1 to 20 of 4 sentences]
27
[+] score: 17
Another study revealed that miR-181 could effectively suppress the expression of Lin28 expression, disrupt the Lin28-let-7 reciprocal regulatory loop, upregulate Let-7, and eventually promote the differentiation of megakaryocytic. [score:11]
Chen et al. [51] reported that miR-181 was preferentially expressed in B cells of bone marrow in mice; moreover, a tissue culture differentiation assay in mice showed that the fraction of B-lineage cells increased after ectopic expression in HSPCs. [score:4]
Nevertheless, miR-181 had no function on hemin -induced erythrocyte differentiation [52]. [score:1]
Li X. Zhang J. Gao L. McClellan S. Finan M. A. Butler T. W. Owen L. B. Piazza G. A. Xi Y. MiR-181 mediates cell differentiation by interrupting the Lin28 and let-7 feedback circuit Cell Death Differ. [score:1]
[1 to 20 of 4 sentences]
28
[+] score: 16
In fact, this same pattern of regulation was observed for other seven miRNAs (mmu-miR-29c, mmu-miR-296, mmu-miR-130b, mmu-miR-17, mmu-miR-434, mmu-miR-181c, mmu-miR-132), which further confirms the validity of our analysis and suggests miRNA regulation at the gene expression level [48]. [score:5]
Likewise, miR-181c-5p and-3p were down-regulated with age exclusively in df/df mice. [score:4]
One of the main targets of miR-181 is the ATM mRNA, an important cell cycle checkpoint kinase [61] that has role in repairing double strand DNA breaks [62]. [score:3]
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
The mir-181 family has a role in differentiation of hematopoietic cells [60], and was shown to be induced by TGF-β ligands [61]. [score:1]
[1 to 20 of 5 sentences]
29
[+] score: 16
MiR-181a overexpression or SIRT1 knockdown impairs glucose and lipid metabolism in vivoTo explore the function of miR-181a and SIRT1 in vivo, we used Antagomir of miR-181 (Ago-181a) and adenovirus expressing a mouse SIRT1 short hairpin RNA (shRNA) (Ad-shRNA SIRT1) to overexpress miR-181a and knock down SIRT1, respectively, in the livers of mice. [score:9]
To explore the function of miR-181a and SIRT1 in vivo, we used Antagomir of miR-181 (Ago-181a) and adenovirus expressing a mouse SIRT1 short hairpin RNA (shRNA) (Ad-shRNA SIRT1) to overexpress miR-181a and knock down SIRT1, respectively, in the livers of mice. [score:6]
uk/) showed that four miR-181s, namely, miR-181a, miR-181b, miR-181c, and miR-181d, have been identified previously. [score:1]
[1 to 20 of 3 sentences]
30
[+] score: 16
Furthermore, qPCR was performed again to validate the downregulated and upregulated expression of selected miRNAs that may be relevant to development and confirmed that miR-135, miR-302, miR-449a, miR-200b, miR-200c, miR-193b, miR-130, and miR-141 were downregulated, whereas miR-10a, miR-181, and miR-470 were upregulated by RA treatment (Fig 4C and 4D). [score:16]
[1 to 20 of 1 sentences]
31
[+] score: 14
Regulation of CXCR4 function by miRNAs may also occur at the signaling level as another regulator of NK cell development, miR-181, was shown to repress PTEN expression in NKT cells thus allowing proper CXCL12-stimulation of Akt without affecting CXCR4 expression during thymic development (54). [score:9]
In human, miRNA-181 expression increases during NK cell maturation and promotes NK cell differentiation by regulating Notch signaling, essential for lymphocyte development (26). [score:5]
[1 to 20 of 2 sentences]
32
[+] score: 14
Suppression of miR-181-a/-b produced a significant delay in tumour development in a mouse mo del of MM, confirming that this miRNA nourishes MM tumour growth. [score:4]
Pichiorri et al. [25] have shown that miR-181-a/-b, miR-106b~25 and miR-32 are up-regulated in MGUS, MM primary cells and cell lines. [score:4]
Moreover, miR-21, as well as miR-181-a/-b, is upregulated in two drug resistant MM cell lines when compared with parental line [31]. [score:3]
Finally, miR-181-a/-b were significantly upregulated in two drug resistant MM cell lines when compared with parental line [31]. [score:3]
[1 to 20 of 4 sentences]
33
[+] score: 13
For example, differences in the transcripts level of two microRNA were detected (Table S2 in): mir181-b was downregulated in the 3NF/pCI, while mir1186 was downregulated in K3/pCI. [score:7]
Interestingly, mir181-b inhibits the expression of importin-α3 that is crucial for translocation of NF-κB from cytoplasm to nucleus. [score:5]
The level of mir181-b is reduced after proinflamatory stimulation, e. g., by TNF-α and the transcription of NF-κB -dependent genes can be activated (33). [score:1]
[1 to 20 of 3 sentences]
34
[+] score: 12
Similarly, while miR-133a and miR-181 were down-regulated, the mRNA level of their target, pro-survival gene Mcl1 [36, 37] was up-regulated in the CR heart (Fig. A in S2 File). [score:9]
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
[1 to 20 of 2 sentences]
35
[+] score: 12
In this work, we have discovered that, knockdown of Beclin‐1 by siRNA protected the cells from miR181‐5p‐ADSC‐induced autophagy and propose that miR‐181‐5p induces autophagy by inhibiting the STAT3/Bcl‐2/Beclin 1‐dependent pathway. [score:4]
Furthermore, the up‐regulated expression of fibrotic genes in HST‐T6 cells induced by TGF‐β1 was repressed following the addition of isolated miR181‐5p‐ ADSC exosomes compared with miR‐67‐ ADSCexosomes. [score:3]
We found that miR181‐5p down‐regulated STAT3 and Bcl‐2 and activated autophagy in HST‐T6 cells. [score:2]
Exosomes from miR181‐5p‐ ADSCs down‐regulated Stat3 and Bcl‐2 and activated autophagy in the HST‐T6 cells. [score:2]
By exploiting the characteristics of exosome excretion, we have shown that up‐regulated expression of fibrotic genes in HST‐T6 cells induced by TGF‐β1 was repressed following the addition of isolated exosomes containing miR181‐5p compared with exosomes containing the control miR‐67 from C. elegans. [score:1]
[1 to 20 of 5 sentences]
36
[+] score: 11
Moreover, miR-181c modulates the proliferation, migration, and invasion of neuroblastoma cells by targeting Smad7, while miR-181d acts as a tumor suppressor in glioma by targeting K-ras and Bcl-2 [18, 19]. [score:7]
Li Y. Wang H. Li J. Yue W. MiR-181c modulates the proliferation, migration, and invasion of neuroblastoma cells by targeting Smad7 Acta Biochim. [score:2]
MicroRNA Style Degree mmu-miR-106b-5p up 166 mmu-miR-181d-5p down 158 mmu-miR-181c-5p down 136 mmu-let-7f-1-3p up 61 mmu-miR-377-3p down 60 mmu-miR-155-5p down 52 mmu-miR-33-3p up 51 Figure 7 The miRNA-gene-network of the specified miRNAs. [score:1]
MicroRNA Style Degree mmu-miR-106b-5p up 166 mmu-miR-181d-5p down 158 mmu-miR-181c-5p down 136 mmu-let-7f-1-3p up 61 mmu-miR-377-3p down 60 mmu-miR-155-5p down 52 mmu-miR-33-3p up 51 Figure 7 The miRNA-gene-network of the specified miRNAs. [score:1]
[1 to 20 of 4 sentences]
37
[+] score: 11
The overlap between human AD and our in vitro and in vivo AD mo dels indicates that amongst the complex pathology in human AD brain, down-regulation of miR-9, miR-181c, miR-30c, miR-20b, miR-148b and Let-7i could be attributed at least in part to the presence of Aβ. [score:4]
Three of the down-regulated miRNAs (miR-181, miR-21 and Let-7) have this pathway as their top candidate with p-values of less than 0.001. [score:4]
Individual TaqMan assays (Applied Biosystems) were used to analyse the expression of the following mature mouse miRNAs: miR-181c, miR-9, miR-20b, miR-21, miR-30c, miR-148b, miR-361, miR-409-3p and Let-7i. [score:2]
In comparison, miR-21, miR-181 and Let-7 have well characterized roles in cancer and it is not surprising therefore that their target genes result in enrichment for cancer-related pathways as well. [score:1]
[1 to 20 of 4 sentences]
38
[+] score: 11
Consistent with these results, miR-181 has also been reported to be upregulated in various human cancer types, including CRC (Nakajima et al., 2006; Xi et al., 2006; Schetter et al., 2008; Degagne et al., 2014; Liu et al., 2014), hepatocellular cancer (Wang et al., 2010a), breast cancer (Mansueto et al., 2010) and ovarian cancer (Parikh et al., 2014). [score:4]
Among them, human miR-181a/b have more gene copies (Ji et al., 2009) and higher expression levels (Landgraf et al., 2007) than miR-181c/d. [score:3]
We identified miRNAs in the miR-181 family as the top candidates. [score:1]
During the CRC oncogenic process, miR-181 can promote tumor growth and metastasis (Ji et al., 2014) and is tightly associated with a poor prognosis (Nishimura et al., 2012) and the chemoresponse of CRC patients (Nakajima et al., 2006). [score:1]
In addition, miR-181a/b have been more closely implicated in cancer than miR-181c/d, and have thus received more attention in the miRNA field (Mansueto et al., 2010; Wang et al., 2010a; Liu et al., 2014; Parikh et al., 2014). [score:1]
There are four miR-181 family members (miR-181a/b/c/d) encoded by three independent transcripts on three separate chromosomes. [score:1]
[1 to 20 of 6 sentences]
39
[+] score: 11
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-181b-1, mmu-mir-181b-2
Downregulation of Six2 by microRNAs miR-181b or miR-181c inhibits cell proliferation and promotes apoptosis in metanephric kidney mesenchymal cells in vitro (Lyu et al., 2013; Lv et al., 2014). [score:6]
miR181c promotes apoptosis and suppresses proliferation of metanephric mesenchyme cells by targeting Six2 in vitro. [score:5]
[1 to 20 of 2 sentences]
40
[+] score: 10
In order to over-express miRNAs in differentiating ESCs, six synthetic mature miRNAs (Invitrogen), mir-181c/338-5p/222/196a/196b/let-7e, were pooled together equivalently. [score:3]
Six synthetic mature miRNA inhibitors including mir-181c/338-5p/222/196a/196b/let-7e were pooled together equivalently. [score:3]
We over-expressed a pool of miRNAs consisting mir-181c/338-5p/222/196a/196b/let-7e at 3 days of differentiated ES cells and then examined the DE markers 2 days later. [score:3]
Red: mir-338-5p binding site; Yellow: mir-181c binding site; Blue: mir-196 a/mir-196b binding site. [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 10
Other miRNAs from this paper: mmu-mir-29a
Our data demonstrated that miR-520b and miR-520e (miR-29a and miR-181c) were remarkably down-regulated (up-regulated) (Additional file 3: Figure S2(A) and Additional file 2: Table S2). [score:7]
Figure 2. (A) The expression levels of miRNA-520b, miRNA-520e, miRNA-29a and miRNA-181c were examined by qRT-PCR in LO2-X-S/LO2-X cells. [score:3]
[1 to 20 of 2 sentences]
42
[+] score: 9
To further explore how miR-181/Ago2 downregulates Malat1 transcripts, we first tested whether they could suppress Malat1 transcription as increasing lines of evidence showed the non-canonical functions of nuclear miRNA/Ago in recruiting epigenetic silencing complex, which triggered transcriptional silencing [48]. [score:6]
However, by nuclear run-on assay, we did not detect a decrease in nascent Malat1 transcription by miR-181a overexpression, suggesting that the regulation may not be at the transcriptional level; instead, miR-181/Ago2 may cause Malat1 degradation through an nRISC machinery (Figure 6k). [score:3]
[1 to 20 of 2 sentences]
43
[+] score: 9
We found a significant up-regulation of oncogenic miRNAs and a significant down-regulation of tumor-suppressing miRNAs, which included let-7, miR-17-92, miR-10b, miR-15, miR-16, miR-26, and miR-181. [score:9]
[1 to 20 of 1 sentences]
44
[+] score: 9
Consistently, we previously demonstrated that CBX7 negatively regulates the expression of miR-181 that has among its targets CBX7, creating a synergistic loop that contributes to breast cancer progression [11]. [score:6]
The results presented in Fig.   1 confirm a drastic overexpression of miR-181, miR-137, miR-199, miR-706 and miR-719 and repression of miR-155 in Cbx7 KO MEFs in comparison with the WT ones. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 9
Functional enrichment of predicted targets of both miRNAs indicates enrichment in GO terms for tissue morphology, nervous system development and cellular development, which was confirmed by in vitro inhibition of miR-181c [54]. [score:7]
We also see a trend towards a significant increase in miR-181c-5p (1.4 fold increase) in our sequencing data (Additional file 1: Table S1), which may be contributing to the gross morphological changes seen in GF mice. [score:1]
Administration of valproic acid coincides with an enlarged amygdala and increased miR-30d and miR-181c (~ 1.2 fold increase). [score:1]
[1 to 20 of 3 sentences]
46
[+] score: 8
miR-148b −2.6183 decrease apoptosis miR-152 −2.3341 Increase cell growth miR-17 −6.2545 Bcl2, N-myc miR-181c −3.5756 proliferation and remo deling of muscles miR-190b −2.2 Binds to Ubiquitin-specific protease 46, increase cell growth miR-192 −2.4871 Increase cell growth miR-199a-3p −1.9 Activin receptor IIA, Map3k4 miR-218-1 −2.2887 Increase cell growth miR-23b −2.1623 Increase Cell growth, proliferation miR-26a −2.4565 decrease proapoptotic signaling miR-27a −2.7 Ubiquitin-conjugating enzyme E2N miR-27b −3 Ubiquitin-conjugating enzyme E2N miR-296-3p −7.3378 Increase cell growth, decrease apoptosis miR-322 8.7 Hydroxysteroid (17-beta) dehydrogenase 7 miR-455 129.249 Up-regulated brown adipocyte differentiation miR-470 3.2 TGFB -induced factor homeobox 1 miR-715 18.25 Fucosyltransferase 1 miR-7a −6.2174 Increase cell growth, decrease apoptosis miR-93 −48.423 Map3k14 (NIK) miR-98 1.8 Tripartite motif-containing 6, insulin-like growth factor 2 mRNA binding protein 1 In order to understand the interaction between different genes, we generated common networks using Ingenuity Pathway Analysis (IPA) software. [score:4]
miR-148b −2.6183 decrease apoptosis miR-152 −2.3341 Increase cell growth miR-17 −6.2545 Bcl2, N-myc miR-181c −3.5756 proliferation and remo deling of muscles miR-190b −2.2 Binds to Ubiquitin-specific protease 46, increase cell growth miR-192 −2.4871 Increase cell growth miR-199a-3p −1.9 Activin receptor IIA, Map3k4 miR-218-1 −2.2887 Increase cell growth miR-23b −2.1623 Increase Cell growth, proliferation miR-26a −2.4565 decrease proapoptotic signaling miR-27a −2.7 Ubiquitin-conjugating enzyme E2N miR-27b −3 Ubiquitin-conjugating enzyme E2N miR-296-3p −7.3378 Increase cell growth, decrease apoptosis miR-322 8.7 Hydroxysteroid (17-beta) dehydrogenase 7 miR-455 129.249 Up-regulated brown adipocyte differentiation miR-470 3.2 TGFB -induced factor homeobox 1 miR-715 18.25 Fucosyltransferase 1 miR-7a −6.2174 Increase cell growth, decrease apoptosis miR-93 −48.423 Map3k14 (NIK) miR-98 1.8 Tripartite motif-containing 6, insulin-like growth factor 2 mRNA binding protein 1 A) C2C12 myotubes were treated with 10ng/ml of TWEAK for 18h following isolation of total RNA enriched with small RNAs. [score:4]
[1 to 20 of 2 sentences]
47
[+] score: 8
miR-181 and miR-29 could down-regulate TCL1, Mcl1, Bcl2 and Bcl2L11 [46- 48]. [score:4]
From our analyses, miR-181b appeared to be the strongest TCL1 inhibitor among members of the miR-181 or miR-29 families. [score:3]
Following transfection of miRNA mimics of the miR-181 and miR-29 families, we assessed the TCL1 protein level. [score:1]
[1 to 20 of 3 sentences]
48
[+] score: 8
Since we have previously shown that HMGA1 is able to negatively regulate CBX7 expression (Mansueto et al., 2010) and that HMGA1 positively regulates miR-181 that has CBX7 as target, we can envisage a HMGA1-CBX7 network that operates in the regulation of tumour progression and adipocyte cell growth and differentiation. [score:8]
[1 to 20 of 1 sentences]
49
[+] score: 7
miRNAs that are over-expressed (miR-374, miR-181c) or under-expressed (miR-125a) without a known target or function in Tregs are indicated with a question mark. [score:7]
[1 to 20 of 1 sentences]
50
[+] score: 7
The expression of miR-1A and miR-181 was detected at baseline and was increased at six and 24 hours after hepatectomy (Fig 3C). [score:3]
For validation, the expression of miR-1A and miR-181 was examined in exRNA obtained from serum samples obtained from an independent group of mice undergoing partial hepatectomy. [score:3]
miR-1A and miR-181 were most significantly altered microRNA in both serum and in hepatic tissues, and their presence in serum was quantitated using digital PCR. [score:1]
[1 to 20 of 3 sentences]
51
[+] score: 7
miR-181 is upregulated during myocyte differentiation and represses homeobox protein Hox-A11, a repressor of muscle-cell differentiation, thereby allowing new muscle growth [81]. [score:4]
The expression of miR-133 (miR-133a, miR-133b), miR-1, and miR-181 (miR-181a, miR-181b, and miR-181c) was profiled in muscle from patients affected by myotonic dystrophy type1 and it was observed that they were specifically induced during myogenesis [82]. [score:3]
[1 to 20 of 2 sentences]
52
[+] score: 7
For example, miR-29, miR-181 and miR-148a can promote myoblast differentiation by inhibiting the expression of downstream target genes Akt3, Hox-A1 and ROCK1 at protein levels [10– 12]. [score:7]
[1 to 20 of 1 sentences]
53
[+] score: 7
Indeed, miR-181 is highly expressed in the blood vasculature, but significantly reduced in lymphatic endothelial cells, reciprocally to Prox1 expression [32]. [score:5]
The regulation of Prox1 by miR-181 further highlighted the contribution of RNA interference in the induction of lymphatic endothelium. [score:2]
[1 to 20 of 2 sentences]
54
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-29a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-194-1, mmu-mir-200b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-140, hsa-mir-194-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-96, mmu-mir-34a, mmu-mir-135b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181b-1, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-376c, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-135b, mmu-mir-181b-2, mmu-mir-376b, dre-mir-34a, dre-mir-181b-1, dre-mir-181b-2, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-29a, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-181c, dre-mir-194a, dre-mir-194b, dre-mir-200b, dre-mir-200c, hsa-mir-376b, hsa-mir-181d, hsa-mir-507, dre-let-7j, dre-mir-135b, dre-mir-181a-2, hsa-mir-376a-2, mmu-mir-376c, dre-mir-34b, dre-mir-34c, mmu-mir-181d, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, mmu-mir-124b
The data verified that two miRNAs, miR-29a and -34a, which have been implicated in apoptotic pathways, are up-regulated and the two miRNAs, miR-181 and -183, which have been shown to have roles in proliferation and differentiation, are down-regulated While it is believed that a major cause of ARHL is the death of hair cells, other age-related changes in the central auditory pathways cannot be ruled out. [score:7]
[1 to 20 of 1 sentences]
55
[+] score: 7
For example, miR-2137, miR-5130 and miR-5112 were highly expressed in heart tissues; miR-490, miR-491, miR-181, miR-362, miR-425, and miR-3104 were expressed at quite a low level (Ct value ∼ over 30), whereas 32 out of those 58 altered miRNA were expressed at an extremely low level in hearts and there were almost no Ct value detected by qPCR. [score:7]
[1 to 20 of 1 sentences]
56
[+] score: 7
Three were downregulated (miR-10b, miR-188, and miR-200c) and three were upregulated (miR-494, miR-297, and miR-181c) (Figures 1B,C). [score:7]
[1 to 20 of 1 sentences]
57
[+] score: 6
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-375, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9]. [score:6]
[1 to 20 of 1 sentences]
58
[+] score: 6
In addition, it has been reported that miR-181 promotes the development of NK cells from CD34 [+] hematopoietic progenitor cells and IFN-γ production in primary human CD56 [+]CD3 [−] NK cell, at least in part through the suppression of nemo-like kinase (NLK), an inhibitor of Notch signaling [48]. [score:6]
[1 to 20 of 1 sentences]
59
[+] score: 6
Interestingly, the miR-103-2 (16,537 CPM), miR-107 (2,068 CPM), miR-181 (6,627 CPM) and miR-30 (5,740 CPM) families have not previously been associated with the development of the brain, but were found to be highly expressed in our dataset. [score:4]
MiR-181 plays a crucial role in modulating haematopoietic lineage differentiation [53] whereas miR-30 has been strongly implicated with kidney development and nephropathies [54]. [score:2]
[1 to 20 of 2 sentences]
60
[+] score: 6
Together with the Yamanaka factors (OCT4, SOX2, KLF4, and c-MYC) (Takahashi and Yamanaka, 2006), co -expression of the miRNA cluster 302/367 or 106a/363; members of the miR-302, miR-294, or miR-181 family; or miR-93 and miR-106b greatly enhance iPSC derivation efficiency (Judson et al., 2013, Li et al., 2011, Liao et al., 2011, Lin et al., 2011, Subramanyam et al., 2011). [score:3]
Recent work has demonstrated that miRNAs such as miR-294, miR-302, and miR-181 family members facilitate (Judson et al., 2013, Li et al., 2011, Liao et al., 2011, Lin et al., 2011, Melton et al., 2010, Subramanyam et al., 2011), but let-7 family members inhibit, reprogramming (Melton et al., 2010, Unternaehrer et al., 2014). [score:3]
[1 to 20 of 2 sentences]
61
[+] score: 6
Despite conclusive evidence of the high expression of miRNAs such as miR-181, -182 and -183 in the retina [8, 9] the genes targeted by these miRNAs did not show significant down regulation at the mRNA level in our analysis. [score:6]
[1 to 20 of 1 sentences]
62
[+] score: 5
Other MET genes have had characterized miRNA regulation in other tissue types, including regulation of Hoxa11 by miR-181 during muscle differentiation [69], and hypoxia -induced targeting of Fgfrl1 by miR-210 [70]. [score:3]
Literature evidence of microRNA association is represented for Lhx1 (miR-30) and Hoxa11 (miR-181) along with other known transcriptional regulatory relationship (dotted arrows). [score:2]
[1 to 20 of 2 sentences]
63
[+] score: 5
6 miRNAs (miR-221-3p, miR-181-5p, miR-181b-5p, miR-712-5p, miR-345-5p, miR-100-5p; Fig. 4a2,b2) showed a lower expression level in KO crypts than KO villi, but showed higher expression level in WT crypts than WT villi (Fig. 4b2: Red spots vs Fig. 4a2: Blue spots). [score:5]
[1 to 20 of 1 sentences]
64
[+] score: 5
Among others miR-146a, miR-let7e and miR-181c target inflammatory components of the TLR pathway, exhibiting a suppressive role during innate immune responses [29– 31]. [score:5]
[1 to 20 of 1 sentences]
65
[+] score: 5
For example, miR-196 expression affected limb development [8], miR-1 and miR-133 cardiogenesis [9, 10] and skeletal muscle development [11], and miR-181 enhanced myoblast differentiation [12]. [score:5]
[1 to 20 of 1 sentences]
66
[+] score: 5
Inhibition of GSK3β activates miR-181 expression through Wnt/beta-catenin signaling in HCC (34). [score:5]
[1 to 20 of 1 sentences]
67
[+] score: 5
Similarly, miR-181c and miR-378 regulated mitochondria targets in cardiomyocytes, leading to alteration in electron transport chain, fatty acid metabolism, and apoptosis under metabolic stress [14– 16]. [score:4]
Only a few microRNAs, that is, miR-181c, miR-4485, and miR-1973, were suggested to have a mitochondrial origin [14, 30, 31]. [score:1]
[1 to 20 of 2 sentences]
68
[+] score: 5
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
Several of the miRNAs on the list from P7 wildtype forebrain astrocytes such as miR-21, miR-223, miR-146a and miR-181 (S2 Table) have been previously shown to regulate astrocyte functions [26– 30]. [score:2]
[1 to 20 of 2 sentences]
69
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Our study revealed miR-181 and miR-142-3p with relatively high expression in thymus (Figure 2C), and miR18a and miR-20a appeared to be weakly expressed in thymus (Figure 2D). [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 4
To date, in HCC, miR-130b has been shown to promote CD133 [+] CSC tumorigenicity and self-renewal [18], whereas miR-181 inhibition reduces the number of EpCAM [+] CSCs and tumor-initiating ability [19]. [score:3]
It has been reported that exogenous miR-181 increased EpCAM [+] HCC cell quantity and tumor-initiating ability [19]. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 4
miR-181, miR-30b* and miR-874 are additional suggestive eQTL with significant genome-wide (α < 0.1) threshold after permutation Similarly, on chromosome 8 we identified eQTL for three miRNAs (miR-486, miR487b and miR-501) in confidence interval 72–95 Mb. [score:2]
miR-181, miR-30b* and miR-874 are additional suggestive eQTL with significant genome-wide (α < 0.1) threshold after permutationSimilarly, on chromosome 8 we identified eQTL for three miRNAs (miR-486, miR487b and miR-501) in confidence interval 72–95 Mb. [score:2]
[1 to 20 of 2 sentences]
72
[+] score: 4
The expression of miR-17, miR-18a, miR-20a, miR-93, and miR-181 in was evaluated from published gene expression datasets [24, 25]. [score:3]
Specifically, 52 non-CBF-AML and 31 CBF-AML were analyzed for miR-17, 31 non-CBF-AML and 18 CBF-AML were analyzed for miR-18a, 53 non-CBF-AML and 34 CBF-AML were analyzed for miR-20a, 34 non-CBF-AML and 18 CBF-AML were analyzed for miR-93 and miR-181. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 4
hsa-miR-30 and hsa-miR-181 are downregulated [58], and apoptosis is a key mechanism in AD [59]. [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 4
Das, S. et al. Divergent Effects of miR-181 Family Members on Myocardial Function Through Protective Cytosolic and Detrimental Mitochondrial microRNA Targets. [score:3]
Seeger and colleagues reported that a decrease of miR-181b and miR-181c levels in serum correlate with changes in the course of immune-senescence accentuated in chronic heart failure patients, providing evidence for miR-181c as a biomarker of poor prognosis in patients with ischaemic or dilated cardiomyopathy [54]. [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 4
For instance, microRNA-181, a negative regulator of several protein phophatases involved in TCR signaling, causes increased basal signaling and a lowered activation threshold when over-expressed [46]. [score:4]
[1 to 20 of 1 sentences]
76
[+] score: 4
Other miRNAs from this paper: cel-let-7, cel-lin-4, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-101a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-132, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-132, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-138-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, rno-let-7d, rno-mir-7a-1, rno-mir-101b, mmu-mir-101b, hsa-mir-181b-2, mmu-mir-17, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-101-2, cel-lsy-6, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7a-2, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-92a-1, rno-mir-92a-2, rno-mir-101a, rno-mir-128-1, rno-mir-128-2, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-199a, rno-mir-181a-1, rno-mir-421, hsa-mir-181d, hsa-mir-92b, hsa-mir-421, mmu-mir-181d, mmu-mir-421, mmu-mir-92b, rno-mir-17-2, rno-mir-181d, rno-mir-92b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, mmu-mir-101c, mmu-let-7j, mmu-let-7k, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Examination of the temporal clusters revealed that probes with similar sequences showed correlated expression, as exemplified by miR-181a, miR-181b, miR-181c, smallRNA-12 (Figure 4a) and miR-29a, miR-29b and miR-29c (Figure 4b), respectively. [score:3]
The mouse microRNA miR-181 has been implicated in the modulation of hematopoietic differentiation, and other mammalian microRNAs have been suggested to play roles in cancer [22, 23]. [score:1]
[1 to 20 of 2 sentences]
77
[+] score: 4
In the order of the significance score by SAM, 15 up-regulated miRNAs are mmu-miR-127, mmu-miR-410, mmu-miR-433, mmu-miR-138, mmu-miR-181c, mmu-miR-382, mmu-miR-19b, mmu-miR-381, mmu-miR-666-3p, mmu-miR-376a, mmu-miR-873, mmu-miR-181a, mmu-miR-383, mmu-miR-181b, and mmu-miR-99b. [score:4]
[1 to 20 of 1 sentences]
78
[+] score: 4
The miR-17 family (miR-17, 18, 20, 93, and 106) affect G1 checkpoint regulation, and overexpression in cancers activates cell proliferation, while the miR-181 family affect radiation sensitivity in certain cell lines [51]. [score:4]
[1 to 20 of 1 sentences]
79
[+] score: 4
We validated this and eight additional miRNAs (miR-181c, -148b, -30c, -20b, -361, -21, -409-3p, and Let-7i) as being down-regulated by Aβ42 (Schonrock et al., 2010). [score:4]
[1 to 20 of 1 sentences]
80
[+] score: 4
MiRNAs can notably regulate whole biological pathways; for example, miR-181 controls mouse hematopoiesis (Chen et al., 2004), miR-608 targets two inflammation-related transcripts, CDC42 and IL6 (Jeyapalan et al., 2011; Kang et al., 2011) and miR-221 controls multiple cancer pathways (Lupini et al., 2013). [score:4]
[1 to 20 of 1 sentences]
81
[+] score: 3
To determine whether STAT3 influences miR-181 expression, we constructed a 2-kb fragment upstream of the human miR-181b stem-loop and inserted the fragment into the luciferase reporter plasmid pGL4.11. [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The miRNA families that change expression in both mice and rats were: mir-7, mir-9, mir-10, mir-15, mir-17, mir-26, mir-29, mir-30, mir-101, mir-130, mir-181, mir-204, mir-339, mir-340, mir-368, mir-434, mir-467. [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
Expression of miR-181 in Lin [−] hematopoietic progenitor cells leads to an increase in lymphoid (B-lineage) differentiation [20]. [score:3]
[1 to 20 of 1 sentences]
84
[+] score: 3
miR-181a belongs to the miR-181 family, and its nucleic acid sequence is highly conserved in mammals (Ji et al., 2009). [score:1]
Identification of microRNA-181 by genome-wide screening as a critical player in EpCAM -positive hepatic cancer stem cells. [score:1]
MicroRNA-181 variants regulate T cell phenotype in the context of autoimmune neuroinflammation. [score:1]
[1 to 20 of 3 sentences]
85
[+] score: 3
Interestingly, nuclear encoded miRNA-181c has been shown to decrease the mitochondrial encoded mt-COX1 gene expression [11], illustrating the intricate interactions of miRNAs and the genome. [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 3
ZNF91 belongs to a C [2]H [2] zinc finger (ZNF) gene family that is greatly expanded in the primate lineage and known to contain exceptionally abundant target sites for several miRNA families, including miR-23, miR-181 and miR-199 [28]. [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
In addition, non-muscle-specific miRNA involved in myogenesis (e. g. miR-24, miR-181 and mir-214) were broadly expressed [41]. [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
Three miRNAs (miR-181, miR-186, and miR-590-3p) are predicted to target over 50% of all lupus susceptibility genes [19]. [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
In relation to the eye, miR-7 has been shown to play an important role in photoreceptor differentiation in Drosophila [25] and other miRs, such as miR-9, miR-96, miR-124a, miR-181, miR-182, and miR-183, were found to be highly expressed during morphogenesis of the zebrafish eye [16]. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
Other microRNAs with important muscle functions such as miR-29 [22] and miR-181 [23] can have a broad expression pattern in many tissues [18, 19]. [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
Role of miR-181 family in regulating vascular inflammation and immunity. [score:2]
Additionally, miR-181 family also plays crucial roles in inflammation (44), likely by binding to human TNF-α mRNA 3′UTR to promote the fine-tuning of TNF-α in immunoparalysis (45). [score:1]
[1 to 20 of 2 sentences]
92
[+] score: 3
Previous studies have demonstrated that the myomiRs miR-1, miR-133a/b, miR-206, miR-486, miR-26a, miR-27b, miR-378, miR-148a and miR-181 are highly enriched in skeletal muscle and play a key role in skeletal muscle metabolism [28, 29, 30, 31]. [score:1]
The top nine most abundant miRNAs shared between the two groups were ssc-miR-10b, ssc-miR-22-3p, ssc-miR-486, ssc-miR-26a, ssc-miR-27b-3p, ssc-miR-191, ssc-miR-378, ssc-126-5p and ssc-miR-181. [score:1]
In our sequencing libraries, five of these known myomiRs (miR-486, miR-26a, miR-27b, miR-378 and miR-181) were identified with the greatest abundance, accounting for 26% and 29% of the total normalized miRNA reads in the LPS-challenged and saline -treated groups, respectively. [score:1]
[1 to 20 of 3 sentences]
93
[+] score: 3
Naguibneva I The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiationNat. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Ectopic expression of miR-181 in lineage negative hematopoietic progenitor cells from mouse bone marrow increased the fraction of B lineage cells (CD19 [+]) in vitro and in vivo [14]. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
Consistent with these observations is the fact that miRNAs predicted to target AR, such as miR-23b-5p, miR-181-5p, and miR-205-5p are constitutively reduced in TRAMP prostates. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
In addition to mir-34a, p53 protein promotes the expression of other miRNAs in lung cancer cells, including mir-184, mir-148, and mir-181. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
At 10 femtomoles concentration of the mir-181a amplicon the two non target assays for mir-181b and mir-181c gave only a background signal. [score:2]
Similar results were seen with the two other amplicons, namely mir-181b and mir-181c. [score:1]
[1 to 20 of 2 sentences]
98
[+] score: 3
Numerous miRNAs have been shown to regulate immune cell development and function, such as miR155, miR-223 and miR-181 (reviewed in [7], [44], [45]). [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
In our experimental conditions, 18 h post OxS, we observed an increase in TNF-α and IL-1β levels and 4 h post OxS we observed a decrease in miR-181-5p and miR-146a; these miRNAs are known to target TNF-α and IL-1β, respectively [79]. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
We found that miRNAs with higher expression in WBCs includes different miRNA families: mir-15, mir-17, mir-181, mir-23, mir-27 and mir-29 families. [score:3]
[1 to 20 of 1 sentences]