Stem-loop mmu-mir-181c

Accession

MI0000724

Symbol

MGI: Mir181c

Description

Mus musculus mmu-mir-181c precursor miRNA

Literature search

134 open access papers mention mmu-mir-181c
(681 sentences)

Sequence

354082 reads, 830 reads per million, 106 experiments

gccaaggguuugggggAACAUUCAACCUGUCGGUGAGUuugggcagcucagacaaACCAUCGACCGUUGAGUGGACCccgaggccugga
.(((.((.(((((((...((((((((..(((((((.(((((...........)))))))))))).))))))))..))))))).))))).

Structure

g   a  g       gAA        CU       A     ggca 
 cca gg uuugggg   CAUUCAAC  GUCGGUG GUuug    g
 ||| || |||||||   ||||||||  ||||||| |||||    c
 ggu cc gagccCC   GUGAGUUG  CAGCUAC CAaac    u
a   -  g       -AG        -C       -     agac 

Annotation confidence High

Comments

Mouse miR-181c was predicted by computational methods using conservation with human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish and independently in mouse [2,3].

Genome context

chr8: 84178873-84178961 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-181c

Mature mmu-miR-181c-5p

• Accession: MIMAT0000674
• Description: Mus musculus mmu-miR-181c-5p mature miRNA
• Sequence: 17 - AACAUUCAACCUGUCGGUGAGU - 38
• Evidence: experimental ; cloned [2-3], Illumina [4,6]

Mature mmu-miR-181c-3p

• Accession: MIMAT0017068
• Description: Mus musculus mmu-miR-181c-3p mature miRNA
• Sequence: 56 - ACCAUCGACCGUUGAGUGGACC - 77
• Evidence: experimental ; 454 [5], Illumina [6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12624257
   Vertebrate microRNA genes
   "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
   "Science (2003) 299:1540


3. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


4. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


5. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


6. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275