sort by

384 publications mentioning hsa-mir-30c-1 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-30c-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 349
Furthermore, the expression of MTDH and HMGA2 in FHIT -expressing H1299 cells, in which miR-30c is up-regulated, was severely suppressed and miR-30c silencing resulted in the increase in their expression levels (Figure 5D). [score:12]
A FHIT -activated miRNA, miR-30c, inhibits EMT through suppression of direct targets, Vimentin and FibronectinDue to the critical involvement of microRNAs (miRNAs) in cancer metastasis and EMT, we next determined if FHIT might regulate expression of specific miRNAs. [score:11]
In addition, in agreement with previous studies showing that the miR-30 family members inhibit the EMT process and confer epithelial phenotype to cancer cells including pancreatic and hepatocellular carcinomas [34], [35], our data demonstrated that FHIT-activated miR-30c inhibits TGF-β -induced EMT in NSCLC A549 cells through direct targeting of mesenchymal markers, VIM and FN1, and activation of epithelial marker and metastasis suppressor, E-cadherin (Figure 6I). [score:10]
Since this role of miR-30c seems to be necessary but not sufficient for mediating FHIT -dependent suppression of metastasis and EMT suppression, other FHIT-regulated targets must also operate to enable metastasis and EMT suppression. [score:10]
Interestingly, FHIT loss has been detected frequently during the early onset of disease progression in cancer [16] and the expression of FHIT and miR-30c is gradually decreased during tumor progression (normal tissues < non-metastatic tumors < metastatic tumors), while expression of miR-30c target genes, MTDH and HMGA2, is increased (Figure 6H). [score:9]
miR-30c down-regulates the expression of MTDH and HMGA2 by directly targeting their 3′UTRs. [score:9]
Next, we set out to identify putative target genes of miR-30c, which could mediate the inhibition of EMT induced by TGF-β, by using miRNA-target-predicting software PicTar and TargetScan 5.1 or RNA22 program. [score:9]
Using RT-qPCR analysis, we found that FHIT mRNA and miR-30c expression levels were inversely correlated with expression levels of MTDH and HMGA2: FHIT and miR-30c levels were more highly expressed in the primary tumors relative to expression in the matched lymph node tissues, while MTDH and HMGA2 mRNAs were increased in matched lymph node tissues (Figure S12). [score:9]
Fhitrexpressing A549 cells or miR-30c knockdown Fhit -expressing A540 cells were cotransfected with 1 µg of each construct and 0.1 µg of a Renilla luciferase expression construct, pRL-TK (Promega), using Lipofetamine 2000 (Invitrogen). [score:8]
A FHIT -activated miRNA, miR-30c, inhibits EMT through suppression of direct targets, Vimentin and Fibronectin. [score:8]
Taken together, the results strongly suggest that miR-30c can regulate EMT through down-regulation of the mesenchymal markers, Fibronectin and Vimentin, by directly targeting their 3′UTRs. [score:8]
A549 cells were stably infected with the Human pre-microRNA Expression Construct Lenti-miR expression plasmid containing the full-length miR-30c and the GFP gene under the control of two different promoters (System Biosciences), or the pGreenPuro shRNA expression lentivector containing the miRZip short hairpin of anti-sense miR-30c (System Biosciences). [score:7]
Furthermore, TGF-β -induced expression of the mesenchymal markers, Fibronectin and Vimentin, was suppressed in the presence of miR-30c, while TGF-β-repressed E-cadherin was markedly activated (Figure 4C), followed by transcriptional activation and suppression of E-cadherin and Vimentin, respectively (Figure 4D). [score:7]
Interestingly, the expression level of miR-30c was significantly down-regulated in TGF-β -treated A549 and H460 cells, suggesting that there is a reciprocal regulatory relationship between TGF-β signaling and miR-30c (Figure 6I). [score:7]
These observations suggest that miR-30c expression is often reduced at early stages of tumor progression when decreased FHIT expression is already apparent and therefore represents one of the driving forces for early stage lung tumor cells to proceed with EMT and subsequent metastatic progression, thus highlighting the relationship between FHIT and miR-30c as potential targets for early therapeutic intervention in lung cancer progression. [score:7]
To further clarify the mechanism whereby miR-30c suppresses metastasis, we generated stable knockdown cells for its target genes, MTDH or HMGA2, by using independent short hairpins and confirmed knockdown of protein by immunoblotting (Figure S11). [score:7]
Our results show that miR-30c functions as a negative regulator of EMT and metastasis through directly targeting mesenchymal markers, Vimentin and Fibronectin, and metastasis-related genes, MTDH and HMGA2, implying that miR-30c contributes to the FHIT regulation of EMT and metastasis (Figure 7). [score:6]
miR-30c inhibits TGF-β -induced EMT through direct targeting of Vimentin and Fibronectin. [score:6]
Figure S5The expression levels of miR-30c in miR-30c -overexpressing cells, A549 and H1299. [score:5]
We confirmed that miR-30c expression was higher in both FHIT -expressing cells vs control cells (Figure S5). [score:5]
We found, via BLI monitoring, that the over -expression of miR-30c in parental A549 lung cancer cells potently suppressed pulmonary metastases in the lung and brain (Figure 6A). [score:5]
Fhit -overexpressing A549 and H1299 or A549, H460 and H1299 stably expressing miR-30c were incubated with medium 5% FBS. [score:5]
miR-30c suppresses metastasis through the suppression of MTDH and HMGA2. [score:5]
In addition, expression levels of miR-30c were not dramatically induced in FHIT overexpressing cells, being ∼2-fold higher than in the control. [score:5]
miR-30c inhibits metastasis through the suppression of MTDH and HMGA2 in NSCLCs. [score:5]
We observed that FHIT (17/19 cases) and miR-30c (19/19 cases) expression levels were positively correlated in adjacent normal tissues and up-regulated as compared to primary lung tissues (Figure 3B, S6). [score:5]
Experiments were performed three times and the data are presented as the mean ± s. d. miR-30c targets metastasis-related genes, MTDH and HMGA2 Next, we determined if miR-30c targets other genes implicated in metastasis, bridging the connections among miR-30c, metastasis and EMT. [score:5]
Overall, these data strongly suggest that FHIT and miR-30c inhibit metastasis through targeting the metastasis-related genes, MTDH and HMGA2. [score:5]
Taken together, these data suggested that MTDH and HMGA2 are direct target genes for miR-30c in lung cancer. [score:4]
Among the miRNAs active in H1299/FHIT cells, the second most up-regulated miRNA, miR-30c, stood out as an attractive candidate for a role in FHIT-related function (median fold change: 2.279, P<0.0001). [score:4]
In accord with these results, lung cancer cells, A549, H460 and H1299, with enhanced expression of miR-30c, or MTDH or HMGA2 knockdown exhibited a decrease in cell invasion and migration in vitro (Figure 6E, 6F). [score:4]
1004652.g003 Figure 3(A) Unsupervised hierarchical clustering of FHIT-regulated miRNAs in H1299/FHIT cells; P<0.05 (B) RT-qPCR analysis showing up-regulation of FHIT and miR-30c in adjacent normal tissues compared to tumor tissues (n = 19). [score:4]
Experiments were performed three times and the data are presented as the mean ± s. d. (A) Unsupervised hierarchical clustering of FHIT-regulated miRNAs in H1299/FHIT cells; P<0.05 (B) RT-qPCR analysis showing up-regulation of FHIT and miR-30c in adjacent normal tissues compared to tumor tissues (n = 19). [score:4]
Figure S9 miR-30c directly targets MTDH and HMGA2. [score:4]
To verify that they are direct targets of miR-30c, their 3'UTRs containing miRNA-responsive elements were cloned into the pGL3 construct downstream of the luciferase ORF. [score:4]
Figure S7 miR-30c directly targets Vimentin and Fibronectin. [score:4]
However, knockdown of miR-30c in FHIT stable A549 cells could not overcome FHIT -suppressed metastasis in vivo. [score:4]
In hepatocellular carcinomas, miR-30c was identified as a metastasis-related miRNA, which is down-regulated in metastatic relative to non-metastatic lesions and is associated with improved survival [33]. [score:4]
Next, we were interested in identifying the expression patterns of FHIT, miR-30c, MTDH and HMGA2 in lung cancer progression and examined their mRNA levels in normal, non-metastatic and metastatic lung tissues. [score:3]
Here it is shown that FHIT reduces the motility and invasiveness of lung cancer cells in vitro and ability to metastasize in vivo, at least partially through the miR-30c -mediated suppression of EMT, a critical process during tumor metastasis. [score:3]
Furthermore, miR-30c cannot efficiently inhibit TGF-β -induced EMT in respect of morphological and molecular changes as FHIT does. [score:3]
Luciferase activity was suppressed by the wild type 3'UTRs of these genes in A549/Fhit cells compared to the control cells, which was reversed when the 3'UTR was mutated, whereas it was increased in A549/Fhit cells with knockdown of miR-30c (Figure 5A). [score:3]
To determine if miR-30c is capable of suppressing metastasis in lung cancer, this miR was stably introduced into A549 cells. [score:3]
Our findings further confirm miR-30c anti-metastatic function via targeting MTDH and HMGA2 and correlation with improved prognosis. [score:3]
Here, we identified novel miRNAs modulated by FHIT in NSCLC and delineated the role of one FHIT-regulated miRNA, miR-30c, in regulating EMT and metastasis. [score:3]
Finally, to determine if our experimental findings could be relevant to the pathogenesis of human lung cancer, we examined the expression pattern of FHIT, miR-30c, MTDH and HMGA2 in primary tumor tissues and matched lymph node metastatic tissues. [score:3]
miR-30c targets metastasis-related genes, MTDH and HMGA2. [score:3]
Interestingly, we found that FHIT and miR-30c gradually decreased with metastasis progression, while MTDH and HMGA2 expression increased (Figure 6H). [score:3]
We further evaluated the prognostic value of FHIT and miR-30c in a large public clinical microarray database [23], [24] and found trends towards improved metastasis-free survival on breast cancers in cases of high expression of FHIT and miR-30c (Figure 3D), suggesting that their associated expression may function to oppose cancer progression. [score:3]
Histological quantification revealed that there is a significant reduction in the total number of miR-30c expressing metastatic nodules in lungs (Figure 6B). [score:3]
In fact, this miRNA may function as an anti-metastatic miRNA in several types of human cancer; it has been shown that miR-30 inhibits metastasis in vivo and in vitro in a metastatic breast cancer mo del [31], [32]. [score:3]
FHIT expression leads to activation of miR-30c in lung cancer. [score:3]
Bioinformatics analyses indicated that miR-30c might target several other key mRNAs, including metastasis -associated genes metadherin (MTDH) and High-mobility group AT—hook 2 (HMGA2). [score:3]
To confirm that MTDH and HMGA2 are direct targets of miR-30c, luciferase assays were performed. [score:3]
Experiments were performed three times and the data are presented as the mean ± s. d. Next, we determined if miR-30c targets other genes implicated in metastasis, bridging the connections among miR-30c, metastasis and EMT. [score:3]
Also, the expression of FHIT and miR-30c was positively correlated in primary lung cancer tumors (n = 20, coefficient  = 0.851 and P<0.0001) (Figure 3C). [score:3]
Kruskal-Wallis was used to assess whether the miR-30c and Fhit are differentially expressed among normal lung and primary samples on the basis of the Bartlett test P value. [score:3]
We found miR-30c binding sites in the 3′UTRs of Vimentin and Fibronectin genes (Figure S7), supporting their candidacy as miR-30c targets. [score:3]
y, the relative expression level of miR-30c, U6, as an internal control. [score:3]
Interestingly, the expression of Vimentin mRNA was inversely correlated with that of miR-30c in the adjacent normal tissues and matched tumors (Figure S8). [score:3]
To explore the in vivo expression pattern of FHIT and miR-30c, total RNAs from human primary lung tumors and adjacent normal tissues (n = 19) were extracted, and RT-qPCR analyses performed. [score:3]
Figure S6The different expression levels of Fhit and miR-30c in primary lung tumors and their adjacent normal tissues, as found with the Wilcoxon test. [score:3]
1004652.g006 Figure 6(A) Representative BLI plots of lung metastasis of mice injected (IV) with 1×10 [6] A549 cells stably expressing miR-30c or a control vector; n = 4. (B) Representative H&E stained lung section. [score:3]
These facts suggest that the effect of FHIT on suppression of metastasis is in part dependent on the function of FHIT-activated miR-30c, showing that miR-30c functions as one mediator of FHIT-modulated metastasis, but not the only mediator. [score:3]
Consistently, at the molecular level, miR-30c expression led to decreased levels of Fibronectin and Vimentin and increased E-cadherin levels (Figure 4B, 4C). [score:3]
The reporter activity was markedly suppressed by the presence of the 3'UTRs of Vimentin and Fibronectin in A549/Fhit cells compared to the control cells, which reversed when the 3'UTR was mutated, whereas it was increased in A549/Fhit cells with knockdown of miR-30c (Figure 4F). [score:3]
MicroRNA-30c inhibits human breast tumour chemotherapy resistance by regulating TWF1 and IL-11. [score:3]
In immunoblot assays (Figure 5B, 5C), ectopic expression of miR-30c led to significantly decreased levels of MTDH and HMGA2 in H1299 and A549 cells. [score:2]
However, miR-30c silencing was insufficient to fully rescue this phenotype (Figure 5D), suggesting that additional mechanisms contribute to FHIT regulation of MTDH and HMGA2. [score:2]
RT-PCRs were carried out using ABI Prism 7900HT sequence detection systems with Applied Biosystems TaqMan Gene expression assays (miR-30c: 000419; Fibronectin: Hs00365052_m1; E-cadherin: Hs00154405_m1; N-cadherin: Hs00983056_m1; Vimentin: Hs00185584_m1; Snail: Hs00195591_m1: Fhit: Hs00179987_m1; MTDH: 00757841_m1). [score:2]
As shown in Figure 4A, A549/miR-30c cells exhibited reduction of EMT-like morphological features vs control cells which were converted from a predominant epithelial phenotype to an EMT phenotype within 48 hr in response to TGF-β1 treatment (Figure 4A). [score:1]
Notably, patients whose primary tumors were positive for FHIT and miR-30c have a significantly improved metastasis-free survival, implying that FHIT and miR-30c might be better used as a predictor of overall metastasis rather than lung- or bone-specific metastasis. [score:1]
Figure S8The inverse correlation between miR-30c and Vimentin in primary lung tissues (A) and their adjacent normal tissues (B). [score:1]
In addition, we found that, in the presence of miR-30c, Vimentin and Fibronectin protein levels decreased in H1299 and A549 cells (Figure S7). [score:1]
To validate the profile data, we performed stem-loop real-time quantitative PCR analysis for miR-30c, using RNAs from H1299/FHIT cells and A549/FHIT. [score:1]
In addition, we observed that MTDH mRNA, but not HMGA2 mRNA, was decreased in miR-30c -transfected lung cancer cells, A549, H460 and H1299 (Figure 5E) and showed inverse correlation with miR-30c in lung primary tumors (Figure 5F). [score:1]
To determine if miR-30c is implicated in EMT, we investigated its role upon expression in A549 cells induced to undergo EMT in response to TGF-β1 treatment. [score:1]
In addition, we observed that Vimentin mRNA, but not Fibronectin mRNA, was decreased in miR-30c -transfected lung cancer cells, A549 and H1299 (Figure S7). [score:1]
Proposed mo del for the function of the FHIT and miR-30c in lung metastasis and EMT. [score:1]
Figure S12Expression pattern of Fhit, miR-30c, MTDH and HMGA2 in primary lung tissues (P) and their matched metastatic lymph node tissues (M. L), measured by quantitative real time PCR. [score:1]
We found that there are four binding sites for miR-30c in MTDH 3′UTR and one binding site in HMGA2 (Figure S9). [score:1]
Luciferase reporters assays using wild type or mutant 3′ UTR were performed after transfection into A549/FHIT or A549/FHIT cells with miR-30c knockdown. [score:1]
This study provides new insights into the role of FHIT and a FHIT-activated miRNA, miR-30c, as crucial modulators in lung metastasis. [score:1]
1004652.g004 Figure 4(A) Phase contrast images of A549/miR-30c cells in response to TGF-β1 treatment. [score:1]
1004652.g005 Figure 5(A) Luciferase activity assays of luciferase reporters with wild type or mutant 3′UTRs of MTDH or HMGA2 were performed after transfection into A549/FHIT or A549/FHIT cells with miR-30c knockdown. [score:1]
Interestingly, we observed significant reduction of miR-30c levels in TGF-β treated A549 and H1299 cell lines (Figure 4E). [score:1]
[1 to 20 of 86 sentences]
2
[+] score: 324
However, enforced expression of miR-30c, and not of miR-21, decreased target mRNA levels (Supplementary Figures  S4a-c) indicating that miR-30c regulates BID, NF1, RASA1, and RASSF8 at the transcriptional level while miR-21 halts RASA1 and RASSF8 protein expression. [score:8]
MiR-30c and miR-21 are released into the bloodstream and could be potential biomarkers for early NSCLC detection KRAS, through the transcription factor ELK1, activates miR-30c and miR-21, which in turn, by downregulating NF1, RASA1, RASSF8, and BID, regulates KRAS, NF-kB, and the intrinsic apoptotic pathways, inducing lung tumorigenesis and inhibiting apoptosis in NSCLC. [score:7]
Fig. 7 KRAS, through the transcription factor ELK1, activates miR-30c and miR-21, which in turn, by downregulating NF1, RASA1, RASSF8, and BID, regulates KRAS, NF-kB, and the intrinsic apoptotic pathways, inducing lung tumorigenesis and inhibiting apoptosis in NSCLC. [score:7]
MiR-30c and miR-21 enhanced cell proliferation and migration/invasion and inhibited apoptosis by targeting important tumor suppressor genes, inducing the activation of KRAS downstream pathways. [score:7]
This work defines that miR-30c and miR-21 are specifically activated by KRAS and play an important role in lung cancer development and chemoresistance by targeting crucial tumor suppressor genes (Fig.   7). [score:6]
Overexpression of KRAS [WT] or KRAS [G12D] induced a significant upregulation of miR-30c and miR-21. [score:6]
We focused on the top modulated and highly expressed microRNAs and found that miR-30c directly silenced NF1, BID, RASSF8, and RASA1, whereas miR-21 inhibited RASSF8 and RASA1. [score:6]
Overexpression of miR-30c and miR-21 led to a significant downregulation of BID, NF1, RASSF8, and RASA1 endogenous levels as assessed by western blot and immunofluorescence (Fig.   2d–f). [score:6]
e, f (IF) showing downregulation of miR-30c and miR-21 target genes in H1299 cells. [score:6]
Importantly, silencing of RASA1, NF1, and RASSF8 increased the expression of two mesenchymal markers, AP4 and SNAIL, confirming that miR-30c and miR-21 regulate EMT through these target genes (Supplementary Figures  S7g, h). [score:6]
Overexpression of miR-30c and miR-21 resulted in the upregulation of RAS endogenous levels and augmented ERK1/2 and AKT phosphorylation in H1299 cells (Fig.   3a). [score:6]
miR-30c and miR-21 fostered proliferation and reduced response to cisplatin by targeting BID and RASA1 41, 42 while promoted invasive capabilities and EMT of NSCLC cells through RASA1, NF1, and RASSF8 downregulation. [score:6]
Next, we determined the effect of miR-30c and miR-21 overexpression or corresponding target genes silencing on migratory and invasive capabilities of NSCLC cells. [score:5]
Furthermore, NRAS knockdown alone did not have any effect on miR-30c and miR-21 levels in H1299 cells whereas simultaneous silencing of NRAS and overexpression of KRAS [G12D] did increase their levels, suggesting that the regulation of these microRNAs is exclusively KRAS dependent (Supplementary Figure  S1i). [score:5]
ELK1 silencing (Fig.   5b) or treatment with the MEK inhibitor Trametinib decreased miR-30c and miR-21 expression levels in two different NSCLC cell lines (Fig.   5c; Supplementary Figure  7i). [score:5]
Downregulation of SNAIL and several other mesenchymal markers was identified after miR-30c and miR-21 knockdown (Supplementary Figure  S7e, f), therefore miR-21 and miR-30c are involved in the control of the epithelial–mesenchymal transition (EMT) in lung cancer. [score:5]
Subsequently, we analyzed the expression of miR-30c and miR-21 in vivo in a mouse mo del of lung cancer (Kras [LSL-G12D]) that involves activation of an oncogenic Kras allele (Kras [G12D]) following intranasal administration of plaque-forming units of a recombinant adenovirus -expressing Cre recombinase (AdenoCre) [31]. [score:5]
In addition, we showed that ELK1, a transcription factor downstream of KRAS, directly regulated the expression of miR-30c and miR-21 by binding to the miRNA proximal promoter regions. [score:5]
Taken together, our findings suggest that miR-30c and miR-21 are upregulated in NSCLC in the early stage of NSCLC development and released into the bloodstream. [score:5]
Kaplan–Meier Plotter software was used to analyze and generate survival time data relative to high or low expression of miR-30c and miR-21 target genes [30]. [score:5]
Bars indicate mean ± SD (n = 3) and the P values were addressed by two-tailed Student’s t test (* P < 0.05, ** P < 0.001) Kaplan–Meier analysis based on the average expression of miR-30c and miR-21 target genes was performed to predict the risk for NSCLC patients using Kmplot database [30]. [score:5]
miR-30c and miR-21 expression was analyzed in plasma from a peripheral vein (P) (taken before the operation) and in plasma from the pulmonary vein directly draining a cancer-bearing lobe (C) (taken during surgery) (Supplementary Figure  9Se). [score:4]
In summary, these findings indicate that miR-30c and miR-21 not only activate KRAS signaling through the silencing of NF1 and RASA1 but also activate NF-κB signaling via RASSF8 downregulation. [score:4]
d MiR-30c and miR-21 activate NF-κB p65 by silencing IKB-α through RASSF8 downregulation. [score:4]
b, c ELK1 knockdown reduced miR-30c and miR-21 expression in A549 and Calu-1 cells. [score:4]
Upregulation of miR-30c and miR-21 was also detected in a normal immortalized KRAS [G12V] inducible human cell line derived from alveolar epithelia 18, 19 and in a pancreatic KRAS inducible mouse cell line after treatment with doxycycline (Fig.   1f; Supplementary Figure  S1e) [20]. [score:4]
e MiR-30c and miR-21 knockdown increases RASSF8 and IKB-α endogenous level f– g NF-kBp65 nuclear localization after miR-30c and miR-21 enforced expression. [score:4]
We previously reported that miR-30c and miR-21 are regulated by the epidermal growth factor receptor and induce resistance to tyrosine kinase inhibitors [33]. [score:4]
MiR-30c and miR-21 directly silence several tumor suppressor genes. [score:4]
e, f MiR-30c (44 normal samples, 150 lung adenocarcinoma KRAS [WT], and 5 lung adenocarcinoma KRAS [G12D]) and miR-21 (46 normal samples, 155 lung adenocarcinoma KRAS [WT], and 5 lung adenocarcinoma KRAS [G12D]) expression in tumors expressing KRAS [WT] and KRAS [G12D] compared to normal samples from the TCGA data set LUAD. [score:4]
Accordingly, same results were obtained after miR-30c and miR-21 enforced expression, as a consequence of RASSF8 knockdown (Fig.   3d) whereas anti-miR-30c and anti-miR-21 increased RASSF8 and IκB-α protein levels (Fig.   3e). [score:4]
Forced expression of mutant NRAS in different cell lines revealed that NRAS does not increase ERKs phosphorylation, fundamental for ELK1 and accordingly miR-30c and miR-21 activation. [score:3]
Fig. 6 a MiR-30c and miR-21 upregulation in tumor samples compared to normal lung (tumor samples n = 21; normal lung n = 21). [score:3]
Bars indicate mean ± SD (n = 3) and the P values were addressed by two-tailed Student’s t test (* P < 0.05, ** P < 0.001) a MiR-30c and miR-21 upregulation in tumor samples compared to normal lung (tumor samples n = 21; normal lung n = 21). [score:3]
From a therapeutic perspective, our findings indicate that miR-30c and miR-21 inhibition halts lung tumorigenesis in vitro and in vivo by switching off simultaneously KRAS effector signalings such as PI3K/AKT, ERKs, and the NF-κB pathways and that these microRNAs could be potential biomarkers for NSCLC early detection and to stratify KRAS -driven NSCLC. [score:3]
MiR-30c and miR-21 enforced expression promoted migration and invasion in H1299 cells (Supplementary Figure  S7a). [score:3]
Conversely, miR-30c or miR-21 silencing (Supplementary Figure  S5b) inhibited cell proliferation in KRAS mutant A549 cells and reduced cisplatin resistance (Supplementary Figure  S5c-d). [score:3]
Further, we checked the expression of miR-30c and miR-21 in 21 adenocarcinomas and corresponding normal counterpart. [score:3]
MiR-30c and miR-21 target genes. [score:3]
Analysis was performed on the available samples expressing miR-30c (normal lung samples n = 44, lung adenocarcinoma KRAS WT samples n = 150 and lung adenocarcinoma KRAS G12D samples n = 5) or miR-21 (normal lung samples n = 46, lung adenocarcinoma KRAS WT samples n = 155 and lung adenocarcinoma KRAS G12D samples n = 5) using GraphPad Prism package (GraphPad Software Inc). [score:3]
Further, we conducted an in silico study using four different algorithms to predict miR-30c and miR-21 putative mRNA targets (Fig.   2a). [score:3]
H1299 cells harbor a mutation in NRAS, therefore to exclude a role for NRAS in miR-30c and miR-21 regulation, Calu-6 and A549 (NRAS wild type) cells were transfected with a mutant NRAS plasmid (NRAS Q61K). [score:3]
In line with these findings, transient transfection of both BID and RASA1 sensitized A549 cells to cisplatin (Fig.   4d), suggesting that miR-30c and miR-21 exert their proliferative and oncogenic role by repressing these tumor suppressor genes. [score:3]
g MiR-30c and miR-21 are significantly upregulated in tumors from KRAS [G12D] mice compared to control mice. [score:3]
Therefore, we checked whether enforced expression of miR-30c and miR-21 could affect NF-κB signaling. [score:3]
Using a unique set of plasma samples from patients undergoing surgical resection of early NSCLC and a mouse mo del of lung cancer we verified that miR-30c and 21 are upregulated in tumors compared to the normal counterpart and then released into the circulation (Fig.   7). [score:3]
Scale bar 200 μm a Activation of AKT and ERKs pathways after miR-30c and miR-21 enforced expression in H1299 cells. [score:3]
DIANA miRPath v3.0 software was employed to analyze miR-30c and miR-21-related signaling pathways and number of target genes based on TarBase v7.0 data set [57]. [score:3]
In NSCLC specimens, miR-30c and miR-21 positively correlated with KRAS [WT] or KRAS [G12D] and ELK1 expression. [score:3]
Seven weeks after infection with AdenoCre, mice were killed and expression of miR-30c and miR-21 was analyzed in the lungs of these mice and in the lungs of mice that were infected with GFP adenovirus as control. [score:3]
Fig. 3 a Activation of AKT and ERKs pathways after miR-30c and miR-21 enforced expression in H1299 cells. [score:3]
MiR-30c and miR-21 expression and modulation in vivo. [score:3]
f Overexpression of miR-30c or miR-21 in H1299 cells induced an increase in the S phase of the cell cycle. [score:3]
Overexpression of KRAS [G12C] also increased miR-30c and miR-21 in H1299 and A549 cells (Supplementary Figure  S1f). [score:3]
ELK1 knockdown reduced miR-30c and miR-21 promoter activity (Fig.   5e,f) whereas deletion of the binding sites by site direct mutagenesis rescued this effect (Fig.   5d–f). [score:3]
l MiR-30c and miR-21 expression levels in plasma from KRAS [G12D] mice treated with anti-miR-ctr or anti-miR-21. [score:3]
MiR-30c and miR-21 levels were also upregulated in the blood from KRAS [LSL-G12D] mice treated with anti-miR-ctrl compared to mice treated with anti-miR-21 (Fig.   6l). [score:3]
Finally, we analyzed miR-30c and miR-21 expression in a unique set of plasma samples obtained from patients undergoing surgical resection of early stage NSCLC. [score:3]
Furthermore, miR-30c and miR-21 were found upregulated in KRAS [WT] (miR-30c, sample n = 150; miR-21, sample n = 155) and KRAS [G12D] mutant lung adenocarcinoma (miR-30c, sample n = 5; miR-21, sample n = 5) compared to normal lung (miR-30c, sample n = 44; miR-21 sample n = 46) (Fig.   6e,f). [score:3]
Importantly, miR-30c and miR-21 were upregulated in a large cohort of NSCLC samples compared to the normal counterparts and in the lungs from a KRAS mouse mo del, therefore these two miRNAs are KRAS-modulated oncogenes also in vivo. [score:3]
Scale bar 200 μm It is known that KRAS plays an important role in cell proliferation, apoptosis, and drug resistance [2] Ectopic expression of miR-30c and miR-21 significantly promoted cell growth of KRAS wild-type H1299 cells and reduced the response to cisplatin of H292 cisplatin-sensitive cells (Fig.   4a; Supplementary Figure  S5a). [score:3]
Notably, miR-30c and miR-21 were found highly expressed in matched normal/tumor samples and in the blood of patients that underwent surgical resection of early NSCLC, indicating that they may be useful biomarkers for lung cancer early detection. [score:3]
d Enforced miR-30c and miR-21 expression decreased BID, NF1, RASSF8 and RASA1 endogenous levels in H1299 cells. [score:3]
MiR-30c and miR-21, as well KRAS and ELK1 expression, was significantly elevated in tumors compared to normal lung samples (Fig.   6a and Supplementary Figure  S9a). [score:2]
In summary, miR-30c and miR-21 induce cisplatin resistance by silencing BID and RASA1 and increase the proliferation rate of NSCLC cells by regulating cell cycle progression. [score:2]
ELK1 directly binds to miR-30c and miR-21 proximal promoter regions. [score:2]
b, c KRAS and ELK1 directly correlate with miR-30c in lung tumors (tumor samples n = 21). [score:2]
MiR-30c and miR-21 were predicted to be involved in the regulation of oncogenic signaling downstream of KRAS such as PI3K/AKT and MAPK. [score:2]
Bars indicate mean ± SD (n = 3) and the P values were addressed by two-tailed Student’s t test (* P < 0.05, ** P < 0.001) Since miR-30c and miR-21 silenced important KRAS regulators we tested whether these miRNAs had an effect on KRAS activation. [score:2]
Furthermore, miR-30c and miR-21 knockdown induced apoptosis and this effect was significantly higher after cisplatin treatment (Fig.   4e). [score:2]
We also examined the response to pemetrexed alone or as platinum doublet, frequently used as first line chemotherapy in patients with advanced NSCLC [27] after miR-30c and/or miR-21 knockdown. [score:2]
miR-30c and miR-21 regulate KRAS and NF-κB signaling. [score:2]
Co-transfection of these constructs along with miR-30c or miR-21 induced a significant reduction of the luciferase activity that was rescued when the miRNA -binding site was deleted by site direct mutagenesis (Fig.   2b,c and Supplementary Figure  S3b). [score:2]
Bars indicate mean ± SD (n = 3) and the P values were addressed by two-tailed Student’s t test (* P < 0.05, ** P < 0.001) a Enforced expression of miR-30c and miR-21 promoted cell growth compared to control cells. [score:2]
As shown in Fig.   6j,k, miR-30c and miR-21 expression levels were significantly higher in C compared to P and in the matched tumor/normal tissue of the same patients (Fig.   6j,k; Supplementary Figures  S9f, g). [score:2]
e MiR-30c and miR-21 expression in KRAS [WT] and KRAS [G12D] compared to control cells. [score:2]
Fig. 4 a Enforced expression of miR-30c and miR-21 promoted cell growth compared to control cells. [score:2]
g ChIP showing a direct interaction between ELK1 and miR-30c and miR-21 promoter regions. [score:2]
Consequently, we selected the top most upregulated microRNAs (miR-30 family and miR-21) for further characterization. [score:2]
c Effect of miR-30c and miR-21 silencing on cell proliferation in H1299 cells. [score:1]
These results indicate that KRAS transactivates miR-30c and miR-21 through the downstream activation and recruitment of ELK1 to the miRNAs’ proximal promoters. [score:1]
MiR-30c and miR-21 are released into the bloodstream and could be potential biomarkers for early NSCLC detection All cell lines used in this study were purchased from ATCC or identification was performed on established lines using PowerPlex® 21 System (Promega). [score:1]
Since members of miR-30 family share almost the same sequence and they potentially silence the same genes we chose to study miR-30c as representative member of the family. [score:1]
Primers used to amplify 3′ UTRs of miR-30c and miR-21 target genes or delete the microRNA -binding sites and primers used to amplify miR-30c and miR-21 promoter regions are reported in Supplementary Tables  S2 and S3, respectively. [score:1]
To determine whether an alteration in cell cycle progression was responsible for the promotion of cell proliferation by miR-30c and miR-21, we performed flow cytometry analysis. [score:1]
Bars indicate mean ± SD (n = 3) and the P values were addressed by two-tailed Student’s t test (* P < 0.05, ** P < 0.001) a Schematic representation of ELK1 -binding sites in miR-30c and miR-21 promoters. [score:1]
MiR-30c and miR-21 increase proliferation, invasion, and chemoresistance in NSCLC cell lines. [score:1]
Cells cultured on coverslips were transfected with miR-30c, miR-21 or control miR for 48 h and then fixed with 4% paraformaldehyde for 15 min, permeabilized in 0.2% Triton X-100 /PBS for 20 min, and incubated in primary antibodies for 1 h. Cells were stained with DAPI (ThermoFisher Scientific) and imaged using confocal microscope (Leica). [score:1]
3′UTRs of NF1, RASA1, BID, and RASSF8 containing miR-30c- or miR-21 -binding sites were PCR amplified and inserted into the pGL3 control vector (Promega). [score:1]
f Increased levels of miR-30c and miR-21 in Type II pneumocytes after KRAS [G12V] induction. [score:1]
Highlighted with different colors are miR-30c family members and miR-21. [score:1]
Since we have previously shown the therapeutic potential of miR-30c [33], we tested whether modulation of miR-21 could have an effect on lung tumorigenesis in vivo. [score:1]
ELK1 transcriptionally activates miR-30c and miR-21. [score:1]
b after cisplatin, pemetrexed or combination cisplatin/pemetrexed, and miR-30c and/or miR-21 silencing in KRAS mutant A549 cells. [score:1]
To verify whether ELK1 was the transcription factor involved in miR-21 and miR-30c activation, two miR-30c promoter regions containing one and two ELK1 -binding sites, respectively, and one region containing two ELK1 -binding sites spanning miR-21 promoter, were cloned in a promoterless reporter vector (Fig.   5d). [score:1]
Cells were grown on coverslips in six-well plates and transfected with anti-miR-ctrl, anti-miR-30c, or anti-miR-21. [score:1]
Our experiments also pointed out that miR-30c and miR-21 are exclusively modulated by KRAS and not NRAS as they might perform distinct functions during transformation [45]. [score:1]
Fig. 5 a Schematic representation of ELK1 -binding sites in miR-30c and miR-21 promoters. [score:1]
Furthermore, forced increase of miR-30c and miR-21 resulted in the accumulation of NF-κB p65 in the nucleus, as assessed by immunofluorescence and immunoblot (Fig.   3f,g). [score:1]
MiR-30c and miR-21 promote cell proliferation and increase drug resistance. [score:1]
A total of 8.4 × 10 [4] cells were seeded in 12-well plate and transfected with miRNA control or miR-30c and miR-21 for 12, 24 or 48 h. Cells were counted using Count II FL (Life Technologies) at different time points. [score:1]
All four search engines predicted potential binding sites for miR-30c in the 3′UTRs of NF1 and RASA1 mRNA (Fig.   2a; Supplementary Figure  S3a). [score:1]
MiR-30c and miR-21 promote tumorigenesis in vivo. [score:1]
MiR-30c and miR-21 activate AKT, ERKs, and NF-κB signaling. [score:1]
Promoter regions of miR-30c and miR-21 containing ELK1 putative -binding sites were PCR amplified and inserted into the promoterless pGL3 basic vector (Promega). [score:1]
Computational tools identified potential binding sites for miR-30c and miR-21 in the 3′UTRs of neurofibromin 1 (NF1), BH3-interacting domain death agonist (BID), Ras association domain-containing protein 8 (RASSF8), Ras p21 GTPase-activating protein 1 (RASA1) mRNAs (Supplementary Figure  S3a). [score:1]
MiR-30c and not miR-21 silencing increased the response to pemetrexed. [score:1]
Bars indicate mean ± SD (n = 3) and the P values were addressed by two-tailed Student’s t test (* P < 0.05, ** P < 0.001) We used the online tool DIANA miRPath to identify miR-30c-modulated and miR-21-modulated pathways (Supplementary Figures  S2a, b and Supplementary Table  S1). [score:1]
j, k qPCR showing miR-30c and miR-21 levels in plasma samples obtained from patients undergoing surgical resection of NSCLC. [score:1]
A significant positive correlation between miR-30c and KRAS or ELK1 was observed in the 21 lung tumor samples (P = 0.0229 and P = 0.0011, respectively) (Fig.   6b,c) and between miR-21 and ELK1 in 160 adenocarcinoma samples from the TCGA (LUAD data set) (Fig.   6d). [score:1]
Using PROMO 8.3 algorithm we found three different putative ELK1 -binding sites in miR-30c and two ELK1 -binding sites in miR-21 promoter (Fig.   5a) [29]. [score:1]
H1299 cells were transfected with miR-30c, miR-21, or NF1, RASSF8 and RASA1 siRNAs for 48 h using Lipofectamine 2000 (Invitrogen). [score:1]
Combination of anti-miR-30c and anti-miR-21 had a synergic effect in the response to cisplatin in both KRAS mutant and wild-type cells (Fig.   4b,c). [score:1]
[1 to 20 of 113 sentences]
3
[+] score: 281
Since radiation upregulated miR-30s in CD34+ cells, and overexpression of miR-30c resulted in hFOB cell death and inhibition of REDD1 expression, we decided to perform knockdown of miR-30c in CD34+ cells using miR-30c inhibitor. [score:13]
Interestingly, miR-30 family members respond to radiation differently in CD34+ and hFOB cells and radiation oppositely regulated miR-30 expression in these cells: miR-30b, miR-30c and miR-30d were upregulated in CD34+ cells whereas miR-30c was downregulated in hFOB cells (Figure 1). [score:10]
Transfection of miR30c -inhibitor upregulated REDD1 gene and protein levels in irradiated samples, whereas radiation -induced REDD1 expression was inhibited by pre-miR30c compared with control-miR transfected sample determined by western blot assays. [score:8]
Furthermore, our data show that radiation regulates miR-30 expression in the opposite manner in CD34+ and hFOB cells, with enhanced miR-30b, miR-30c and miR-30d expression in CD34+ cells (which are sensitive to radiation damage), and decreased miR-30c expression in the relatively radio-resistant hFOB cells. [score:8]
We asked whether miR-30c expression can influence osteoblast and hematopoietic cell fate since it inhibited REDD1 expression in these cells and our previous study suggested that knockdown of REDD1 resulted in hFOB cell death [4]. [score:8]
Interestingly, transfection of miR-30c inhibitor significantly increased REDD1 mRNA (Figure 5A) and protein (Figure 5B) expression in 8 Gy irradiated hFOB cells, whereas pre-miR30c transfection did not change the gene level of REDD1 but suppressed the radiation -induced REDD1 protein expression in these cells compared with control-miR transfected samples. [score:8]
Next, we analyzed potential targets of miR-30 family members using the miRNA target prediction database TargetScan 5.1 (http://www. [score:7]
miR-30b, miR-30c and miR-30d were upregulated in CD34+ cells whereas miR-30c was downregulated in hFOB cells. [score:7]
In contrast, transfection of inhibitors suppressed miR-30c expression by 7–8 fold in 14 day cultured CD34+ cells and 2 logs in hFOB cells. [score:7]
Notably, although inhibition of miR30c significantly protected CD34+ cells from radiation damage, it did not induce REDD1 expression in these cells, suggesting that other targets of miR-30c may be involved in radiation -induced stress responses of CD34+ cells. [score:7]
miR-30 family members are involved in regulation of p53 -induced mitochondrial fission and cell apoptosis [11], regulation of B-Myb expression during cellular senescence [12], and play important roles in epithelial, mesenchymal, osteoblast cell growth and differentiation [13]- [15]. [score:5]
Our data suggest that CD34+ and hFOB cells have different miRNA expression patterns after irradiation and that radiation -induced miR-30 expression in CD34+ cells may aggravate cell death. [score:5]
Transfection of miR-30c inhibitor produced a significant increase of clonogenicity in irradiated CD34+ cells and overexpression of miR30c resulted in hFOB cell death. [score:5]
Our data showed that inhibition of miR-30c significantly enhanced endogenous and overexpressed REDD1 gene and protein in hFOB cells. [score:5]
Radiation -induced REDD1 expression was inhibited by pre-miR30 transfection. [score:5]
Fresh thawed human hematopoietic progenitor CD34+ cells were transfected with miR-30c inhibitor or control miRNA and were exposed to 2 Gy radiation at 24 h post-transfection of miR-30 inhibitor or control molecule. [score:5]
REDD1 expression was not observed in either miR-30c inhibitor- or control molecule -transfected CD34+ cells (data not shown). [score:5]
Since multiple potential targets of miRNAs have been suggested (5), validating miR-30 targets in irradiated CD34+ cells will be important to understand the roles of miR-30 in these cells after radiation injury. [score:5]
Interestingly, miR-30 has potential target sites located in the 3′UTR of REDD1 gene, and we show here that REDD1 is a target of miR30c in response to γ-radiation in primary human hematopoietic CD34+ and hFOB cells. [score:5]
The data suggest that miR-30c plays a key role in radiation -induced cell damage and that this effect may be due, at least in part, to suppression of REDD1 expression. [score:5]
Co-transfection with miR-30c inhibitor enhanced REDD1 gene expression by 2.3 fold compared to co-transfection with control or pre-miR30c. [score:4]
Together, these results provide direct evidence that REDD1 is a common target of miR-30c. [score:4]
hsa-miR30c regulates REDD1 gene and protein expression in hFOB and CD34+ cells after γ-irradiation. [score:4]
Levels of surviving cells as shown by OD were dramatically low in pre-miR30c -transfected cells in both irradiated and non-irradiated hFOB samples compared with control and miR-30c inhibitor -transfected hFOB cells (Figure 6A; p<0.01), suggesting overexpression of miR-30c induced hFOB cell death. [score:4]
The profiles of miRNA expression in human CD34+ cells and osteoblast cells in response to γ-radiation were completely different, and only Let-7 and miR-30 miRNA families were regulated by radiation in both types of cells (Table 1) with increased Let-7f in CD34+ cells and increased let-7g in hFOB cells. [score:4]
hsa-miR30c regulation by pre-miR30c or miR30c -inhibitor in human CD34+ and hFOB Cells. [score:4]
Interestingly, miR-30 family member expression in irradiated CD34+ and hFOB cells were changed in opposite directions. [score:4]
The pre-miR30c, miR30c inhibitor, or control miR (CT-miR) molecules were transfected into CD34+ cells and hFOB cells. [score:3]
The 14 day cultured CD34+ cells or hFOB cells were transfected with miR-30c inhibitor (AM11060) and precursors (pre-miR30c, PM11060) or control-miR from Life Technologies CO. [score:3]
We decided to compare the effects of miR30c in CD34+ and hFOB cells in response to radiation, and asked whether the different features of miR-30c in CD34+ and hFOB cells were associated with their radiation resistance and REDD1 expression. [score:3]
MicroRNA-30c regulates REDD1 expression in hFOB and 14 day cultured CD34+ cells. [score:3]
Thus, we demonstrate for the first time that REDD1 is a miR-30c target in human hematopoietic cells and their niche osteoblast cells. [score:3]
miR-30c expression was examined by quantitative RT-PCR 24 h post-transfection and U6 was used as a loading control. [score:3]
org), and found that members of the miR-30 family were predicted to target the stress-response gene REDD1. [score:3]
The cells were exposed to γ-radiation at 24 h after miR30c inhibitor, precursor or miR-control transfection and REDD1 gene and protein expression were measured 24 h after irradiation (48 h post- transfection). [score:3]
Cells were incubated at 37°C for 24 h. PCMV6-AC-GFP or PCMV6-AC-GFP-REDD1 plasmid DNA (1 or 2 µg/dish) from OriGene (Rockville, MD) was co-transferred with Pre-miR30c (PM11060), miR30c -inhibitor (AM11060) or control-miRNA into hFOB cells (1.45 million cells per 10 cm dish) using Lipofectamine 2000 reagent (20 µl/dish) according to the manufacturer's protocol (Life technologies). [score:3]
miRNA Real-Time RT-PCR validation of miR-30 family member expressions in CD34+ and hFOB cells. [score:3]
Radiation slightly increased miR-30c expression in both 4 and 14-day cultured CD34+ cells (2 Gy irradiated vs. [score:3]
PCMV6-AC-GFP (vector control) or PCMV6-ACGFP-REDD1 plasmid DNA (purchased from OriGENE Bethesda, MD) was co -transfected with miR-30c inhibitor, precursor or control-miRNA molecule into hFOB cells using Lipofectamine 200 reagent. [score:3]
Inhibition of miR-30c significantly protected hematopoietic progenitors from γ-irradiation as shown in Figure 6B. [score:3]
pre-miR30c, miR30c -inhibitor, or control-miR was co -transfected with either PCMV6-AC-GFP-REDD1 plasmid DNA (1 µg or 2 µg /dish) or vector control. [score:3]
Colony efficiencies for unirradiated CD34+ cells ranged from 22–27% in 2 separate experiments, and these efficiencies were not affected by miR-30c -inhibitor. [score:3]
0048700.g004 Figure 4 The pre-miR30c, miR30c inhibitor, or control miR (CT-miR) molecules were transfected into CD34+ cells and hFOB cells. [score:3]
Effects of miR30c on REDD1 -overexpressing cells are shown. [score:3]
**, p <0.01, miR30c inhibitor vs. [score:3]
Recent studies suggested that miR-30 is one of the most common known tumor suppressor miRNAs [10]. [score:3]
from two experiments showed that transfection of miR30 inhibitor resulted in significant colony number increases in irradiated cells. [score:3]
miR30c expression was examined 24 h post-transfection by quantitative RT-PCR. [score:3]
Since miRNA array data showed that miR-30c was decreased in hFOB cells but increased in CD34+ cells after irradiation, we further investigated the effects of miR-30c on REDD1 expression in CD34+ and hFOB cells, using gain and loss of miR-30c expression approaches. [score:3]
hsa-miR-30 expression after γ-irradiation (Quantitative Real Time-PCR). [score:3]
To confirm the miRNA microarray findings, the changes in miRNA expression for miR-30 family were validated by RT-PCR. [score:3]
Cells were incubated at 37°C for 24 h. PCMV6-AC-GFP or PCMV6-AC-GFP-REDD1 plasmid DNA (1 or 2 µg/dish) from OriGene (Rockville, MD) was co-transferred with Pre-miR30c (PM11060), miR30c -inhibitor (AM11060) or control-miRNA into hFOB cells (1.45 million cells per 10 cm dish) using Lipofectamine 2000 reagent (20 µl/dish) according to the manufacturer's protocol (Life technologies). [score:3]
After transfection with miR30c inhibitor, precursor or miR-control, hFOB cells were exposed to 8 Gy γ-radiation. [score:3]
Pre-miR30c (PM11060), miR30c -inhibitor (AM11060) or control-miRNA were transfected into hFOB cells using the siPORT NeoFX Transfection Method and CD34+ cells with the Lipofectamine RNAiMAX Method according to the manufacturer's protocol. [score:3]
Consistent with miRNA microarray data, RT-PCR results demonstrated that 2 Gy γ-radiation significantly induced miR-30b and miR-30c expression in CD34+ cells. [score:3]
shown in Figure 4 demonstrate that transfection of pre-miR-30c enhanced miR-30c expression by 6 fold in 14-day cultured CD34+ cells and 2 logs in hFOB cells. [score:3]
There is abundant evidence of miR-30 in regulation of cell growth, differentiation, apoptosis and senescence in hematopoietic [25], osteoblast [15], adipocyte [26], epithelial and pancreatic cells [27] through different signal transduction pathways. [score:2]
Levels of OD were dramatically lower in pre-miR30 -transfected hFOB cells in both irradiated and non-irradiated samples, compared with controls and miR30 inhibitor -transfected samples (p<0.01). [score:2]
Half, 1, 4, 8 and 24 h after irradiation, cells were collected and real time quantitative RT-PCR for miR-30c and REDD1 gene and immunoblotting assays for REDD1 protein expression were performed in samples from both cells cultured for 4 and 14 days. [score:2]
Next, the effects of miR-30c on regulation of REDD1expression after γ-irradiation were evaluated in 14 day cultured CD34+ cells and hFOB cells. [score:2]
Nevertheless, Let-7 and miR-30 families were regulated by radiation in both CD34+ and hFOB cells. [score:2]
For irradiated cells, colonies in miR-30c inhibitor -transfected cultures were significantly increased compared with control -transfected and untransfected cells. [score:2]
On the contrary, pre-miR-30c repressed REDD1 in these cells. [score:1]
miR-30b and miR30c expression were evaluated by RT-PCR. [score:1]
MicroRNA-30c regulates survival of osteoblast cells and hematopoietic progenitor cells. [score:1]
Using bioinformatics analysis we found a potential binding site of miR-30 in the 3′ UTR of REDD1 gene. [score:1]
Effects of miR-30c on radiation injury of hFOB and CD34+ cells. [score:1]
miR-30 family members, miR -30a,-30b, -30c, 30d and 30e, were examined in both irradiated and non-irradiated CD34+ and hFOB cells using quantitative real-time RT-PCR. [score:1]
Hence manipulation of miR-30 may be a useful approach to explore the mechanisms of radiation -induced apoptosis and/or premature senescence in mammalian hematopoietic tissues. [score:1]
At 2 h after irradiation, levels of miR-30b and miR-30c returned to baseline as shown in non-irradiated cells and did not change thereafter. [score:1]
Furthermore, we addressed the functional activities of miR-30c in survival of radiation-injured CD34+ and hFOB cells. [score:1]
Finally, we examined the effects of miR-30c on γ-irradiated hematopoietic progenitor CD34+ cells. [score:1]
To confirm these results, we evaluated effects of miR30c in REDD1 -overexpressing hFOB cells. [score:1]
Endogenous REDD1 gene (A) and protein (B) levels were measured after pre-miR30c, miR30c -inhibitor, or control-miR (CT-miR) transfection and γ-irradiation in hFOB cells. [score:1]
Finally, pre-miR-30c transfection -induced reduction of REDD1 protein levels was also observed in 14 day cultured and 2 Gy-irradiated CD34+ cells (Figure 5E). [score:1]
In contrast with CD34+ cells, levels of miR-30b did not change and miR-30c was reduced 0.4 fold in hFOB cells by 8 Gy γ-irradiation (Figure 2B). [score:1]
Furthermore, co-transfection of pre-miR30c with different concentrations (1 or 2 µg/dish) of REDD1 plasmid DNA dose -dependently repressed REDD1 protein levels in hFOB cells (Figure 5D). [score:1]
0048700.g005 Figure 5 Endogenous REDD1 gene (A) and protein (B) levels were measured after pre-miR30c, miR30c -inhibitor, or control-miR (CT-miR) transfection and γ-irradiation in hFOB cells. [score:1]
Hence we explored interactions between the miR-30 family and REDD1. [score:1]
However, effects of miR-30 on ionizing radiation -induced cell damage have not been reported. [score:1]
Figure 2C shows the miR-30b and miR-30c binding site in the 3′UTR of the REDD1 gene. [score:1]
miR-30b and miR-30c levels were increased at 0.5 or 1 h after γ-irradiation in (A) CD34+ cells, whereas they were decreased or not altered in (B) hFOB cells in response to radiation. [score:1]
Data from our study suggest that miR-30c plays a key role in radiation -induced hematopoietic cell damage, hence it may be a valuable biomarker of radiosensitivity of hematopoietic cells. [score:1]
[1 to 20 of 83 sentences]
4
[+] score: 214
Radiation downregulated Mcl-1 and enhanced Bax expression in non- or CT-miR transfected samples, whereas transfection of miR30 -inhibitor maintained Mcl-1 protein levels and suppressed Bax expression in CD34+ cells 24 and 48 h after irradiation. [score:12]
The effect of miR-30 occurred only when both miR-30 and its target sequence were present; suggesting that miR-30 directly inhibits the expression of Mcl-1 through binding to its target sequence in Mcl-1gene. [score:10]
shown in Fig.   6a demonstrate that transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitor suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells. [score:9]
Forty-eight h after pre-miR-30 transfection, the level of Mcl-1 expression in CD34+ cells was inhibited significantly, whereas no Mcl-1 downregulation was shown in control- or miR-30 -inhibitor transfected samples compared with non-transfection control (Fig.   6c). [score:9]
a Transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitors suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells. [score:9]
We previously reported that radiation upregulated miR-30b and miR-30c in human hematopoietic CD34+ cells, and miR-30 played a key role in radiation -induced human hematopoietic and their niche osteoblast cell damage through negatively regulating expression of survival factor REDD1 (regulated in development and DNA damage responses 1) and inducing apoptosis in these cells. [score:9]
Furthermore, we found putative miR-30 binding sites in the 3′UTR of Mcl-1 mRNA (Fig.   5b) and demonstrated for the first time that miR-30 directly inhibits the expression of Mcl-1 by binding to its target sequences (Fig.   7c, d). [score:8]
Levels of Mcl-1 expression in CD34+ cells were significantly inhibited 48 h after pre-miR-30 transfection, whereas Bcl-2 was not impacted by miR-30 overexpression in these cells. [score:7]
Transfection of miR-30 inhibitor significantly protected Mcl-1 from radiation -mediated downregulation and maintained the Mcl-1 levels as in sham-irradiated CD34+ cells. [score:6]
To answer this question, we analyzed potential targets of miR-30 family members using the miRNA target prediction database RNAhybrid 2.2 (http://bibiserv. [score:5]
The cells were exposed to different doses of γ-radiation at 24 h after non-transfection, miR-control, or miR-30 inhibitor transfection, and Mcl-1 and Bcl-2 protein expressions were tested by western blot in samples collected at 24 h (48 h post-transfection) and 48 h (72 h post- transfection) after irradiation. [score:5]
As expected, Bcl-2 expression was not changed by radiation nor miR-30 inhibition in CD34+ cells. [score:5]
Thus, our data from the current study suggest an important downstream target of miR-30 in irradiated hematopoietic cells is Mcl-1, and miR-30 is responsible for radiation -induced apoptosis in mouse and human hematopoietic cells through targeting the antiapoptotic factor Mcl-1. The authors declare no conflict of interest. [score:5]
In this study, expression of miR-30b and miR-30c was determined in mouse serum at 4 h, and 1, 3 and 4 days after 5, 8 or 9 Gy irradiation, since miR-30 levels in serum were parallel to expression in BM after radiation [15]. [score:5]
However, when the mir-30 target site from the Mcl-1 3′UTR is inserted into the luciferase construct (pMIR-hMcl-1), expression of luciferase is strongly decreased when cotransfected with pre-miR-30. [score:5]
Radioprotector delta-tocotrienol suppressed miR-30 expression in mouse serum and cells and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [14, 15]. [score:5]
Radiation -induced Mcl-1 downregulation was miRNA-30 dependent. [score:4]
Western blot assays were used to test Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells as shown in Fig.   6b. [score:4]
In addition, radiation -induced Bax expression was completely blocked by knockdown of miR-30 in CD34+ cells. [score:4]
Antiapoptosis factor Bcl-2 was not impacted by miR-30 overexpression in these cells (Fig.   6b, c). [score:3]
The putative miR-30 binding sites were predicted using target prediction programs RNAhybrid 2.2 [21]. [score:3]
b Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells were evaluated by immunoblotting 24 and 48 h after transfection. [score:3]
Delta-tocotrienol (DT3), a radioprotector, suppressed miR-30 and protected mice and human CD34+ cells from radiation exposure [15]. [score:3]
; miR-30b and miR-30c expression were examined by quantitative RT-PCR 24 h post-transfection and U6 was used as a control. [score:3]
de/rnahybrid/) [21], and found that members of the miR-30 family were predicted to target the antiapoptosis factor Mcl-1. Figure  5b shows putative binding sites for miR-30b and miR-30c in the 3′UTR of the Mcl- 1 gene. [score:3]
Recently, we further reported that miR-30 expression in mouse BM, liver, jejunum and serum was initiated by radiation -induced proinflammatory factor IL-1β and NFkB activation. [score:3]
irradiated We previously reported that miR-30 played a key role in radiation -induced human CD34+ and osteoblast cell damage through an apoptotic pathway [14], and a radiation countermeasure candidate, delta-tocotrienol (DT3), suppressed radiation -induced miR-30 expression in mouse BM, liver, jejunum and serum, and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [15]. [score:3]
However the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cell damage are not well understood. [score:3]
Pre-miR30, miR30 inhibitor (si-miR30), or control miR (CT-miR) molecules were transfected into CD34+ cells. [score:3]
Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression. [score:3]
Pre-miR30 (PM11060), miR30 -inhibitor (AM11060) or control-miRNA were purchased from Thermo Fisher Scientific (Grand Island, NY) and transfected into CD34+ cells using the Lipofectamine RNAiMAX (Cat# 13778-075, Invitrogen) according to the manufacturer’s protocol discussed in our previous report [14]. [score:3]
Levels of miR-30b and miR-30c expression were determined by Quantitative Real Time-RT PCR in mouse (a) Serum at 4 h, and 1, 3 and 4 days after 5, 8 or 9 Gy irradiation. [score:3]
d The firefly luciferase p-MIR-report vector (pMIR) as a control, p-MIR-report vector with Mcl-1 3′UTR (pMIR-hMcl-1), and p-MIR-report vector with mutant 3′UTR (pMIR-MUT) were transiently transfected or cotransfected with an expression plasmid for pre-mir-30 into human CD34+ cells. [score:3]
As shown in Fig.   7d, cotransfection of CD34+ cells with the parental firefly luciferase reporter construct (pMIR-vector control) plus the pre-mir-30 does not significantly change the expression of the reporter. [score:3]
CD34+ cells were transfected with miR-30 inhibitor, precursors (pre-miR30) or control-miR from Life Technologies Co. [score:3]
miR-30b and miR-30c expression were examined 24 h post-transfection by quantitative RT-PCR. [score:3]
However, the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cells damage are not well understood. [score:3]
Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression. [score:3]
In contrast, Bcl-2 expression was not affected by miR-30 in these cells. [score:3]
Reverse transcription (RT) was performed using TaqMan [®] MicroRNA Reverse Transcription Kits (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions, and the resulting cDNAs were quantitatively amplified in triplicate for miR-30b and -30c expression using TaqMan [®] MicroRNA specific primers for miR30b (ID#000602), miR30c (ID#000419) and U6 (ID#001973) on an IQ5 Real-Time PCR System (Bio-Rad, Hercules, CA). [score:2]
Knockdown of miR-30 blocked radiation -induced Mcl-1 reduction in CD34+ cells. [score:2]
Knockdown of miR-30c before radiation significantly increased clonogenicity in irradiated CD34+ cells [14]. [score:2]
In the current study as shown in Fig.   7a and b, we further demonstrated that knockdown of miR-30 before irradiation in human CD34+ cells blocked radiation -induced reduction of Mcl-1, and the proapoptotic factor Bax was no longer increased by radiation. [score:2]
In this study, we extend our findings using human hematopoietic stem and progenitor CD34+ cells and an in vivo mouse mo del, to explore the effects and mechanisms of miR-30 on regulation of apoptotic cell death signaling in hematopoietic cells after γ-radiation. [score:2]
A mutation was generated on the Mcl-1 3′-UTR sequence in the complementary site and the 5′end seed region of miR-30, as indicated. [score:2]
Previously we reported that knockdown of miR-30 before irradiation significantly increased clonogenicity in irradiated human CD34+ cells [14]. [score:2]
Luciferase activity in CD34+ cells transfected with pMIR alone, or pre-miRNA-30 precursor cotransfected with pMIR-control, pMIR-hMcl-13′UTR, or pMIR-MUT 3′UTR is shown. [score:1]
β-actin were measured in different treatment groups We next examined the effects of miR-30 on Mcl-1 expression in CD34+ cells after radiation. [score:1]
c Two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329–1351 and 1584–1602 nt) and the alignment of miR-30 with the 3′UTR insert are illustrated. [score:1]
We found that both miR-30b and miR-30c were highly induced by 5–9 Gy within 4 h in serum, in a radiation dose -dependent manner (Fig.   5a). [score:1]
NM_021960) containing two putative miR-30 binding sites (1329–1351 and 1584–1602 nt) or a corresponding multi-base mutant sequence was cloned into the SacI and HindIII sites downstream of the firefly luciferase reporter gene in pMIR-REPORT Luciferase (Ambion, Austin, TX, USA) by BioInnovatise, Inc. [score:1]
There are two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329-1351 and 1584–1602 nt, with the 5′ end of the miR-30 seed sequence in the latter) and the alignment of miR-30 with the 3′UTR insert is illustrated in Fig.   7c. [score:1]
The Pre-miRNA-30 Precursor was co -transfected where indicated in Fig.   7d. [score:1]
The firefly luciferase -report vector plasmid (p-MIR, Ambion, Austin, TX, USA) was modified by insertion of the Mcl-1-derived mir-30 binding sites or a multi-base mutant into the 3′UTR. [score:1]
b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shownWe further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells. [score:1]
b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shown We further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells. [score:1]
The Ambion pre-miR-30 precursors were co -transfected with pMIR-report, pMIR-hMcl-1-WT, or pMIR-hMcl-1-MUT plasmid. [score:1]
Our previous studies suggested miR-30 is an apoptosis inducer in mouse and human hematopoietic cells. [score:1]
Our results from both in vitro and in vivo studies suggested miR-30 is an apoptosis inducer after radiation exposure. [score:1]
In the current study, we demonstrated increased levels of miR-30b and miR-30c in mouse serum after 5–9 Gy WBI, and this increase was radiation dose -dependent. [score:1]
[1 to 20 of 60 sentences]
5
[+] score: 210
r = −0.56, P = 0.0143 To determine whether CTHRC1 is a direct downstream target of miR-30c, we firstly transfected miR-30c mimics or miR-30c inhibitor into BT549 cells, and then detected CTHRC1 expression level with qRT-PCR and western blot. [score:8]
In addition, CTHRC1 promoted cell proliferation, invasion and migration and suppressed cell apoptosis in breast cancer, which might be by activating GSK-3β/β-catenin signaling and inhibiting Bax/Caspase-9/Caspase-3 signaling respectively; and these biological functions of CTHRC1 could be directly negatively regulated by miR-30c. [score:7]
We thus detected Bax with western blot and found ectopic expression of miR-30c markedly increased the expression level of Bax, which could be mimicked by loss of CTHRC1, whereas gain of CTHRC1 decreased Bax expression (Fig. 6b). [score:7]
In this study, we found CTHRC1 promoted cell proliferation, invasion and migration and suppressed cell apoptosis in breast cancer, which might be by activating GSK-3β/β-catenin signaling and inhibiting Bax/Caspase-9/Caspase-3 signaling respectively; and these biological functions of CTHRC1 could be directly negatively regulated by miR-30c. [score:7]
A, The relative expression level of miR-30c overexpression and inhibition in indicated cells was detected by qRT-PCR. [score:7]
Therefore, we suppose strategies designed to up-regulate miR-30c or down-regulate CTHRC1 may provide a promising method to alleviate breast cancer progression. [score:7]
Our data demonstrated that CTHRC1, negatively regulated by miR-30c, promoted cell proliferation, invasion and migration and suppressed cell apoptosis in breast cancer, which might be by activating GSK-3β/β-catenin signaling and inhibiting Bax/Caspase-9/Caspase-3 signaling respectively. [score:6]
showed restoration of miR-30c markedly suppressed the phosphorylation of GSK-3β at Ser9, which could be mimicked by knock-down of CTHRC1, whereas overexpression of CTHRC1 significantly promoted the phosphorylation of GSK-3β (Fig. 6a). [score:6]
d Schematic representation of the major molecular mechanism that miR-30c/CTHRC1 axis exerts its role in cell proliferation, apoptosis, invasion and migration Taken together, the above data indicated CTHRC1, negatively regulated by miR-30c, might promote cell proliferation, invasion and migration by activating GSK-3β/β-catenin signaling and suppress cell apoptosis by inhibiting Bax/Caspase-9/Caspase-3 signaling (Fig. 6d). [score:6]
d Schematic representation of the major molecular mechanism that miR-30c/CTHRC1 axis exerts its role in cell proliferation, apoptosis, invasion and migration Taken together, the above data indicated CTHRC1, negatively regulated by miR-30c, might promote cell proliferation, invasion and migration by activating GSK-3β/β-catenin signaling and suppress cell apoptosis by inhibiting Bax/Caspase-9/Caspase-3 signaling (Fig. 6d). [score:6]
We found miR-30c mimics markedly decreased the luciferase activity of Wt 3′ UTR of CTHRC1, whereas miR-30c inhibitor up-regulated the luciferase activity; and the luciferase activity of Mut 3′ UTR of CTHRC1 showed no significant difference (Fig. 4d). [score:6]
In this study, BT549 and HEK293T cells were transfected with miR-30c mimics, negative control, miR-30c inhibitor and inhibitor negative control. [score:5]
c Correlation analysis of miR-30c expression and CTHRC1 expression in clinical breast cancer samples. [score:5]
Next we cloned wild-type and mutant CTHRC1–3′ UTR target sequences into the luciferase reporter vector (Fig. 4c) and transfected into HEK293T cells with miR-30c mimics or inhibitor also transfected. [score:5]
In addition, Rodr et al. [18] and Bockhorn et al. [19] have successively reported the low expression of miR-30c was associated to poor prognosis in breast cancer, whereas our data showed CTHRC1 high -expression indicated poor prognosis. [score:5]
Transwell invasion/migration assay demonstrated restoration of miR-30c markedly suppressed invasion and migration of BT549 cells, which could be mimicked by knock-down of CTHRC1, whereas overexpression of CTHRC1 significantly increased cell invasion and migration (Fig. 5e). [score:5]
Western analyses showed that the caspase-9 and caspase-3 were significantly elevated after restoration of miR-30c, which was mimicked in the group with CTHRC1 knock-down, whereas gain of CTHRC1 markedly down-regulated caspase-9 and caspase-3 (Fig. 6b). [score:5]
Moreover, our previous miRNA microarray analysis also revealed that miR-30c was significantly down-regulated in breast cancer tissues (Additional file 4: Figure S2B). [score:4]
CTHRC1 is a direct target of miR-30c. [score:4]
Therefore, these data indicated CTHRC1, which was negatively regulated by miR-30c, promoted cell proliferation, invasion and migration, and inhibited cell apoptosis. [score:4]
In the present study, we demonstrated that CTHRC1, negatively regulated by miR-30c, could promote breast cancer cell proliferation, invasion and migration and suppress cell apoptosis. [score:4]
Fig. 4CTHRC1 is a direct target of miR-30c. [score:4]
We supposed those breast cancer patients with CTHRC1 high -expression could be characterized into poor prognosis group, whose therapeutic effect of traditional strategies was not so good, and might be treated with strategies designed to up-regulate miR-30c. [score:4]
showed gain of miR-30c decreased both mRNA and protein level of CTHRC1, and loss of miR-30c caused up-regulation of CTHRC1 (Fig. 4a, b). [score:4]
Thus, these data indicated that loss of miR-30c was related to the up-regulation of CTHRC1. [score:4]
B, miRNA microarray analysis revealed miR-30c was significantly down-regulated in breast cancer tissues. [score:4]
Compared with matched PBC, miR-30c in BC was frequently down-regulated (Fig. 3b). [score:3]
Fig. 3CTHRC1 and miR-30c expression are inversely correlated in human breast cancer cells and tissues. [score:3]
Flow cytometry revealed that ectopic expression of miR-30c markedly increased cell apoptosis rate, which could be mimicked by loss of CTHRC1, whereas gain of CTHRC1 decreased apoptosis rate (Fig. 5d). [score:3]
We further adopted colony formation assay and found restoration of miR-30c markedly decreased the number of colonies, which could be mimicked by knock-down of CTHRC1, whereas overexpression of CTHRC1 significantly increased the number of colonies (Fig. 5b). [score:3]
We firstly detected β-catenin and its active (dephosphorylated) form with western blot, and found ectopic expression of miR-30c resulted in a markedly decrease of β-catenin and its active form, which could be mimicked by loss of CTHRC1 with CTHRC1-siRNA, whereas gain of CTHRC1 significantly increased β-catenin and its active form (Fig. 6a). [score:3]
We detected miR-30c in normal breast tissue, 5 benign breast tumor tissues and 18 paired breast cancer tissues with qRT-PCR, and results were normalized with its expression in normal tissue. [score:3]
Therefore, we hypothesized miR-30c/CTHRC1 axis might also exert its role by targeting GSK-3β/β-catenin signaling in breast cancer. [score:3]
Fig. 5Ectopic expression of miR-30c or gain and loss of CTHRC1 affects breast cancer cell proliferation, apoptosis, invasion and migration. [score:3]
Fig. 6Ectopic expression of miR-30c or gain and loss of CTHRC1 affects GSK-3β/β-catenin signaling and Bax/Caspase-9/Caspase-3 signaling in breast cancer. [score:3]
Furthermore, there was an inverse correlation between the expression of miR-30c and CTHRC1 in breast cancer tissues (Fig. 3c, r = −0.56, P = 0.0143). [score:3]
demonstrated ectopic expression of miR-30c resulted in a markedly decreased cell viability, which could be mimicked by loss of CTHRC1 with CTHRC1-siRNA, whereas gain of CTHRC1 significantly increased cell viability (Fig. 5a). [score:3]
a The relative expression level of miR-134, miR-155, miR-30c and miR-630 in breast cancer cells respectively was detected by qRT-PCR. [score:3]
CTHRC1 and miR-30c expression are inversely correlated in human breast cancer cells and tissues. [score:3]
The relative expression level of miR-134, miR-155, miR-30c and miR-630 in breast cancer cells respectively was detected by qRT-PCR. [score:3]
Taken together, these results demonstrated that CTHRC1 was directly regulated by miR-30c. [score:3]
Then we investigated the expression of these candidate miRNAs in nontumorigenic breast epithelial cell line MCF-10A and breast cancer cells by qRT-PCR and found only miR-30c was markedly down-regulated in breast cancer cells compared to MCF-10A (Fig. 3a). [score:3]
Ectopic expression of miR-30c or gain and loss of CTHRC1 affects GSK-3β/β-catenin signaling and Bax/Caspase-9/Caspase-3 signaling in breast cancer. [score:3]
Ectopic expression of miR-30c or gain and loss of CTHRC1 affects breast cancer cell proliferation, apoptosis, invasion and migration. [score:3]
Taken together, we identified the role of miR-30c/CTHRC1 axis in breast cancer progression and demonstrated CTHRC1 may serve as a prognostic biomarker and therapeutic target for breast cancer. [score:3]
demonstrated the β-catenin in nucleus was decreased evidently after ectopic expression of miR-30c, which was mimicked by loss of CTHRC1, whereas gain of CTHRC1 enhanced the nuclear localization of β-catenin (Fig. 6c). [score:3]
Also, cell cycle analysis revealed a significant increase in the percentage of cells in G1 phase and a decrease in the percentage of cells in S phase in cells transfected with miR-30c, which could be mimicked by CTHRC1 knock-down, whereas gain of CTHRC1 decreased the proportion of cells in G1 phase and increased the proportion of cells in S phase (Fig. 5c). [score:2]
a The effect of ectopic expression of miR-30c or gain and loss of CTHRC1 on cell viability was detected by CCK-8 assay. [score:2]
All of these further prompted us to postulate miR-30c was potential critical upstream negative regulator of CTHRC1. [score:2]
To confirm the interference efficiency on miR-30c and CTHRC1. [score:1]
Therefore, we focused on miR-30c for further study. [score:1]
Next we explored the role of miR-30c/CTHRC1 axis in cell apoptosis. [score:1]
We used miRwalk database to identify potential miRNAs that bind to 3′ UTR of CTHRC1 and identified miR-134, miR-155, miR-30c and miR-630 as possible candidates (Additional file 4: Figure S2A). [score:1]
Breast cancer Prognosis Metastasis CTHRC1 miR-30c Breast cancer is the most frequently diagnosed cancer and the leading cause of cancer death among females worldwide [1]. [score:1]
[1 to 20 of 54 sentences]
6
[+] score: 196
The horizontal dashed line shows p = 0.05, and vertical dashed lines indicate FC = −1.5 and 1.5. e, results of miRhub analysis to test for enrichment of predicted miR-30 target sites in significantly up-regulated (purple) and down-regulated (green) genes at each time point. [score:9]
We found that both highly conserved and species-specific predicted miR-30 targets sites were significantly enriched (p < 0.05) in genes up-regulated at both 48 and 72 h post-transfection, but as expected not in down-regulated genes (Fig. 4 e). [score:9]
To identify genes that might act as post-translational regulators of SOX9 protein in response to LNA30bcd treatment, we performed Gene Ontology Molecular Function enrichment analysis (40, 41) using Enrichr (42) on genes with predicted miR-30 target sites that were significantly up-regulated (FC > 1.5 and FDR < 0.05) relative to mock treated cells at each time point (see supplemental Table S2 for gene lists). [score:9]
Moreover, UBE3A does have a predicted miR-30 target site and is up-regulated in LNA30bcd -treated HIECS. [score:6]
Knockdown of miR-30 in Vitro in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 ProteinTo evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs). [score:6]
We performed next generation high throughput RNA sequencing and found that up-regulated genes with predicted miR-30 target sites were most significantly enriched for ubiquitin ligases. [score:6]
We hypothesized that the opposite effect of miR-30 inhibition on SOX9 mRNA and protein levels could be due to miR-30 -mediated regulation of factors that modify SOX9 protein stability without affecting SOX9 RNA levels, such as post-translational modifiers (Fig. 2 e). [score:6]
” Ubiquitin ligase -mediated regulation of SOX9 has been shown previously in chondrocytes (43) and therefore is consistent with our hypothesis that miR-30 may regulate SOX9 protein levels indirectly through control of post-translational modifiers of SOX9. [score:6]
We focused on miR-30 because it has a SOX9 target site that is broadly conserved across vertebrates, including human and rodent, and it is robustly and variably expressed among stem, progenitor, and differentiated cell types of the intestinal epithelium. [score:5]
Agrawal R., Tran U., and Wessely O. (2009) The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1. [score:5]
miR-30 Is Predicted to Target SOX9 and Is Robustly Expressed in the Intestinal Epithelium. [score:5]
Below, we show the conservation of the predicted miR-30 target site (red text) across various species (TargetScan6.2). [score:5]
FIGURE 1. miR-30 is predicted to target the 3′-UTR of SOX9 and is differentially expressed across functionally distinct cell types of the intestinal epithelium. [score:5]
This suggests that miR-30 is able to regulate SOX9 protein expression through post-transcriptional regulation of ubiquitin ligases (Fig. 5 d). [score:5]
To evaluate this hypothesis, we next sought to define the regulatory program that miR-30 directs in HIECs and to identify potential miR-30 targets that may be regulating SOX9 protein levels. [score:4]
Knockdown of miR-30 in Vitro Results in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 Protein. [score:4]
Up-regulation of miR-30 family members in myoblasts promotes differentiation (53). [score:4]
Taken together, our data suggest that miR-30 normally acts to promote proliferation and inhibit enterocyte differentiation in the intestinal epithelium through a broad regulatory program that includes the proteasome pathway. [score:4]
Through time course mRNA profiling following knockdown of a single miRNA family, we found that the effect of treatment with LNA30bcd on miR-30 target genes was only beginning to emerge at 24 h, evident at 48 h, and very robust at 72 h post-transfection. [score:4]
d, cartoon showing mo del of miR-30 regulation of SOX9 mRNA and protein expression levels. [score:4]
FIGURE 2. Knockdown of miR-30 increases SOX9 mRNA and decreases SOX9 protein expression. [score:4]
We observed increased relative luciferase activity in cells transfected with 100 n m LNA30bcd (Fig. 2 d), consistent with direct targeting of SOX9 by miR-30 that has been previously shown in cartilage (35). [score:4]
In Caco-2 cells we observed significant knockdown of miR-30 even 21 days following a single transfection with LNA30bcd; therefore, it would of interest to evaluate gene expression at this time point to determine whether the effects on miR-30 target genes are still robust. [score:4]
Upon knockdown of miR-30 in two intestinal-relevant cell lines, we unexpectedly found inverse effects on SOX9 mRNA and protein expression. [score:4]
Further analyses in vivo (mouse) or through ex vivo culture systems (mouse or human) are warranted to extend the definition of the function of miR-30 across distinct cell types of the intestinal epithelium in health and disease. [score:3]
However, the predicted miR-30 target site in UBE3A is human-specific. [score:3]
miR-30 Promotes IEC Proliferation and Inhibits IEC Differentiation. [score:3]
Moreover, the miR-30 target site and flanking ∼15 bases are highly conserved among most mammals including human, rodent, dog, opossum, and horse, as well as distant vertebrates such as lizard. [score:3]
Upon knockdown of these miR-30 family members, we observed a significant increase in SOX9 mRNA at 48 and 72 h post-transfection (Fig. 2 a), which is consistent with alleviation of negative post-transcriptional regulation of SOX9 by miR-30. [score:3]
Only four miRNA families were expressed at a minimum of 10 reads/million mapped: miR-145, miR-101, miR-320, and miR-30 (Fig. 1 a). [score:3]
In contrast, members of the miR-30 family and miR-320a showed robust expression in IECs (Fig. 1 b). [score:3]
At 24 h post-transfection, predicted miR-30 target sites were not enriched. [score:3]
To evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs). [score:3]
FIGURE 6. miR-30 promotes proliferation and inhibits enterocyte differentiation. [score:3]
FIGURE 5. miR-30 target genes in intestinal epithelial cells are over-represented in the ubiquitin ligase pathway. [score:3]
Moreover, only miR-30 family members exhibited differential expression across functionally distinct IECs, leading us to select this miRNA family for follow-up analyses. [score:3]
This finding is consistent with the relatively higher expression levels of miR-30 in proliferating subpopulations, such as the progenitors, compared with non-proliferating enterocytes (Fig. 1 b). [score:2]
Therefore, given the strong regulatory effect of miR-30 on SOX9 protein, we hypothesized that treatment of HIECs with LNA30bcd would affect this balance as well. [score:2]
Guess M. G., Barthel K. K., Harrison B. C., and Leinwand L. A. (2015) miR-30 family microRNAs regulate myogenic differentiation and provide negative feedback on the microRNA pathway. [score:2]
f, mo del of miR-30 regulation of SOX9 in the intestinal epithelium. [score:2]
Alternatively, knockdown of miR-30 in an osteoblast precursor cell line promotes differentiation (54). [score:2]
To test whether miR-30 regulates enterocyte differentiation of IECs, we transfected Caco-2 cells with 100 n m LNA30bcd and allowed the cells to differentiate on Transwell membranes (see “Experimental Procedures”). [score:2]
Together, these data suggest that our knockdown of miR-30 using LNA30bcd was specific and highly effective in HIECs, particularly in the later time points of our study. [score:2]
Next Generation High Throughput Reveals That miR-30 Regulates Genes Enriched in the Ubiquitin Ligase Pathway. [score:2]
In terms of differentiation, the miR-30 family has been shown to regulate myogenic and osteoblastic differentiation. [score:2]
Although increased proliferation has been seen in many cancer cells in response to reduced miR-30 levels, a number of studies have found knockdown of miR-30 to result in decreased proliferation (52). [score:2]
Knockdown of the miR-30 family in HIECs and Caco-2 cells resulted in reduced proliferation and enhanced enterocyte differentiation. [score:2]
Our analyses provide new evidence that miR-30 plays a significant role in regulating proliferation and differentiation in the intestinal epithelium. [score:2]
More research will be needed to identify the specific miR-30-directed ubiquitin ligase protein that acts on SOX9 protein in intestinal epithelial cells. [score:2]
Wu T., Zhou H., Hong Y., Li J., Jiang X., and Huang H. (2012) miR-30 family members negatively regulate osteoblast differentiation. [score:2]
To test for a direct relationship between miR-30 and the SOX9 3′-UTR, we performed a luciferase reporter assay in Caco-2 cells. [score:1]
To evaluate whether miR-30 influences ubiquitin ligase -mediated degradation of SOX9 protein, we subjected Caco-2 cells to either mock or LNA30bcd transfection and then treated them with vehicle or MG132, a potent proteasome inhibitor. [score:1]
Of these, miR-30 has the strongest predicted base pairing with SOX9, consisting of an 8-mer seed as well as supplementary 3′-end pairing for two of the family members. [score:1]
LNAs against mouse miR-30 family members are cross-reactive with the human miR-30 family. [score:1]
♭, FDR < 0.001; ♮, FDR < 0.01; #, FDR < 0.05. d, RQV of miR-30c by RT-PCR in Caco-2 cells at 72 h and 21 days after either mock transfection (72 h, n = 9; 21 days, n = 6), 100 n m LNA30bcd transfection (72 h, n = 9; 21 days n = 6), 100 n m LNA101* (72 h, n = 6; 21 days, n = 3), or 100 n m LNA320a (72 h, n = 9; 21 days, n = 6). [score:1]
[1 to 20 of 55 sentences]
7
[+] score: 196
Our results have indicated that reduced miR-30* is required for XBP1 activation in the early stages of hypertrophic hearts in vivo and the upregulation of miR-30* and miR-214 inhibit the expression of XBP1 by targeting XBP1 3′ UTR, resulting in VEGF suppression in the maladaptive heart phage. [score:12]
These results suggest that ectopic expression of miR-214 and miR-30* led to a decrease in XBP1 expression, sequentially inhibited the expression of its targets. [score:11]
Together, these results of upregulated miR-214 and reduced miR-30* expression in several forms of heart failure raise the intriguing possibility that disbalance between miR-214 and miR-30* actually cause accumulation of XBP-1 protein in the early phase of cardiac hypertrophy and thereby contribute to impairment of cardiac XBP1 expression in the maladaptive diseased heart. [score:10]
However, along with increasing expression of miR-214 in late stage of hypertrophy, the inhibitory effects of miR-214 become dominant which results in the suppression of XBP-1. In another hand, we also found that XBP1 is a potential target of the miR-30* family. [score:9]
Moreover, the time-course change in the ratio of miR-30a*/miR-214 during cardiac hypertrophy and heart failure (Additional file 1: Fig. S1) show that down-regulation of miR-30a* may minimize the role of increased miR-214 in regulation of XBP-1 in the early phase of cardiac hypertrophy, while increased expression of both miR-214 and miR-30* synergistically lead to suppression of XBP1 in the maladaptive heart. [score:9]
These results provide the first clear link between miRNAs and direct regulation of XBP1 in heart failure and reveal that miR-214 and miR-30* synergistically regulates cardiac VEGF expression and angiogenesis by targeting XBP1 in the progression from adaptive hypertrophy to heart failure. [score:8]
These data suggest that miR-30* can inhibit the expression of XBP1 by directly targeting the 3′-UTR of XBP1 mRNA. [score:8]
XBP1 was declined in response to miR-30* upregulation in maladaptive hypertrophy, further suggesting that miR-30* is able to directly target the XBP1 pathway, either during the period of compensated hypertrophy or during the transition to heart failure. [score:7]
Along with increasing expression of miR-30* in the late stage of hypertrophy, the inhibitory effects of miR-30* on XBP1 become dominant, and results in the suppression of XBP1 and impairment of cardiac angiogenesis. [score:7]
Previous studies shows that expression of miR-30* and miR-30 were significantly down-regulated in mouse heart hypertrophy mo dels and failing human hearts [22, 40]. [score:6]
To further establish the relevance of the above observations of miR-30* with ISO infused hypertrophic mo del, we then analyze the changes in myocardial expression of the miR-30* family and found that the expression trend of miR-30a* in ISO mo del heart was similar with AAC mo del (Fig.   4b). [score:5]
Moreover, we found that miR-30* was significantly reduced in the early phase of cardiac hypertrophic animal mo del and in human failing hearts, while both miR-214 and miR-30* were increased in the maladaptive diseased heart, thereby contribute to impairment of cardiac XBP1 and VEGF expression. [score:5]
Fig.  5miR-214 and miR-30* reduce the target of XBP1 expression in cardiomyocytes. [score:5]
Hence, we therefore examined the expression of VEGF, the downstream target of miR-30*/XBP1, in AAC heart. [score:5]
These data show that dynamic expression of miR-30* and miR-214 caused opposite expression of XBP1 and VEGF in hypertrophic and failing heart. [score:5]
We first analyzed the effect of the miR-30* family on XBP1 expression and found that among these candidates, overexpression of miR-30a* caused a significant decrease in the protein levels of XBP1 s in H9c2 cells, with greater effect than the others (Fig.   3c). [score:5]
miR-214 and miR-30* reduce the expression of XBP1’s targets in cardiomyocyte. [score:5]
In this study, we have established the essential roles of miR-30* in the transition of the hypertrophic heart to the failing heart by down-regulation of XBP1. [score:4]
miR-30* are downregulated in the early phase of cardiac hypertrophy, but restored in maladaptive hypertrophy. [score:4]
Reduced miR-30* caused cardiac XBP1 and VEGF upregulation in hypertrophic and failing heart. [score:4]
Fig.  6Reduced miR-30* caused cardiac XBP1 and VEGF upregulation in hypertrophic and failing human heart. [score:4]
Our study has for the first time established that XBP1 is an important angiogenic factor to maintain normal cardiac function in the early stage of hypertrophy and deregulation of of mir-214 and miR-30* in the hypertrophic and failing hearts inhibits XBP1 and XBP1 -induced angiogenesis results in the transition of hypertrophic hearts into heart failure. [score:4]
The VEGF-A suppressing effect of miR-214 and miR-30* over expression was similar to what was measured after down regulation of XBP1 in H9c2 (2-1) cells (Additional file 1: Fig. S2). [score:4]
Fig.  4Dynamic expression of miR-30* contributed to XBP1 dysregulation in hypertrophic and failing heart. [score:4]
Interestingly, we further found that XBP1 and its downstream target VEGF were attenuated by miR-30* and miR-214 in cardiomyocyte. [score:3]
Potential miRNA binding sites in the XBP1 3′UTR were predicted using these tools, and analysis indicated that XBP1 is an evolutionarily conserved target of miR-30*. [score:3]
miR-30* targets XBP1 in cardiomyocytes. [score:3]
As cardiac expression of XBP-1 was induced in the early adaptive phase, but decreased in the maladaptive phase in hypertrophic and failing heart, it was interesting to monitor the levels of miR-30* in the different phases of AAC -induced cardiac hypertrophy. [score:3]
Real-time PCR analysis confirmed that miR-30* and miR-30 showed a striking decrease in expression in a murine mo del of right ventricular hypertrophy (RVH) and failure (RVF) pulmonary artery constriction (PAC) [41]. [score:3]
d The expression of miR-30* in human failing heart. [score:3]
In particular, we found that restored expression of miR-30* decreased the protein levels of XBP1 s and the mRNA levels of VEGF in H9c2 cells and the luciferase activity of the pMIR-reporter-XBP1-3′UTR (XBP1-3′UTR) vector in 293T cells. [score:3]
a Expression of the miR-214 and miR-30* family in normal mice heart tissue. [score:3]
Next we performed real time PCR to analyze the changes in myocardial miR-30* expression in human failing heart tissue. [score:3]
As with the miR-30 family, miR-30* family members all have the similar ‘‘seed sequence’’ in their 5′ termini, and are abundantly expressed in the heart under physiological conditions [22]. [score:3]
These findings suggest a direct interaction between miR-30* and XBP1 3′ UTR. [score:2]
These reports indicate that distinct miR-30* were regulated during heart failure, suggesting the possibility that this might function as modulators of this process. [score:2]
We extend the previously reported loss of mature miR-30* family in hypertrophic hearts [22, 41, 42], to two rodent mo dels of cardiac hypertrophy and heart failure. [score:1]
Recent study found that miR-30* family was involved with TGF-beta induced-impaired endothelial cells function [42]. [score:1]
XBP1-3′ UTR vector -transfected 293T cells showed a distinct decrease in luciferase activity when co -transfected with miR-30*, while no significant change in luciferase activity was observed following the co-transfection of mut 3′ UTR vector with miR-30* mimics or miR-NC (Fig.   3d). [score:1]
Non-specific negative control oligonucleotides, antimiRNA, mimics, for miR-214 and miR-30* (miR-30a*, miR-30b*, miR-30c-2*, miR-30d*, miR-30e*) and specific siRNA against rat XBP-1 were obtained from RiboBio (Guangzhou, China). [score:1]
n = 6, *P < 0.05 compared with normal controlFinally, we measured the expression of miR-30* and XBP-1s in two normal hearts and six patients with heart failure and the results showed that both XBP-1 and its downstream target VEGF were significantly increased in all failing human hearts, with the mean signal intensity increased compared to normal hearts (Fig.   6c). [score:1]
c Western blot of XBP1 in H9C2 (2-1) cells 48 h after transfection of miR-30* mimics or miRNA negative control (miR-NC) oligonucleotides. [score:1]
As we known, the miR-30* family members include miR-30a*, miR-30b*, miR-30c*, miR-30d* and miR-30e* [39]. [score:1]
We predicted six miRNAs for miR-30* (recently designated miR-30-3p) family, including miR-30a*, miR-30b*, miR-30c-1*, miR-30c-2*, miR-30d*, miR-30e* (Fig.   3a), with potential base pair complementarities to conserved sequences in the XBP1 mRNA 3′UTR (Fig.   3b). [score:1]
a, b Dynamic levels of miR-30* in AAC -treated heart, ISO -induced heart mo del, respectively. [score:1]
n = 6, *P < 0.05 compared with normal control Finally, we measured the expression of miR-30* and XBP-1s in two normal hearts and six patients with heart failure and the results showed that both XBP-1 and its downstream target VEGF were significantly increased in all failing human hearts, with the mean signal intensity increased compared to normal hearts (Fig.   6c). [score:1]
n = 6. b a schematic diagram of the reporter constructs showing the entire XBP1 3′ UTR sequence and the sequence of the miR-30* binding sites within the human XBP1 3′ UTR and MUT 3′ UTR. [score:1]
To measure a direct interaction between miR-30* and its potential binding site within XBP1 mRNA, the pMIR-reporter-XBP1-3′UTR (XBP1-3′UTR) vector or pMIR-reporter -XBP1-3′UTR mut (mut 3′UTR) vector was co -transfected into 293T cells along with miR-30a* mimics or miRNA negative controls (miR-NC) and assayed for expression of a luciferase reporter. [score:1]
[1 to 20 of 48 sentences]
8
[+] score: 188
We recently reported that radiation upregulates miR-30b and miR-30c in human hematopoietic CD34+ cells, and miR-30c plays a key role in radiation -induced human hematopoietic and osteoblast cell damage through negatively regulating expression of survival factor REDD1 (regulated in development and DNA damage responses 1) in these cells after γ-irradiation [19]. [score:9]
DT3 protected mouse BM hematopoietic progenitor cells and human hematopoietic stem and progenitor CD34+ cells from radiation damage, repressed the expression of radiation -induced proinflammatory factors IL-1β and IL-6 in mouse spleen, and we report for the first time that DT3 downregulated radiation -induced miR-30b and miR-30c expression in mouse tissues and serum and in human CD34+ cells. [score:8]
To determine whether the radiation -induced IL-1β increase contributed to miR-30 expression and whether DT3 could inhibit the miR-30 expression induced by IL-1β, we used assays to validate the effects of IL-1β on miR-30 expression in CD34+ cells (Fig 5B). [score:8]
We reported recently that radiation upregulates miR-30b and miR-30c in human hematopoietic CD34+ cells, and miRNA-30c plays a key role in radiation -induced human hematopoietic and osteoblast cell damage by negatively regulating survival factor REDD1 expression in these cells after γ-irradiation[19]. [score:7]
DT3 downregulated radiation -induced miR-30 expression and secretion in mouse tissues and serum. [score:6]
Finally, neutralization of IL-1β activation or knockdown of NFκBp65 gene expression in CD34+ cells resulted in complete abrogation of the radiation -induced miR-30 expression in these cells. [score:6]
DT3 downregulated the expression and secretion of radiation -induced miR-30 in mouse tissues and serum. [score:6]
DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in CD34+ cells. [score:5]
We previously demonstrated radiation -induced miR-30b and miR-30c expression in human hematopoietic CD34+ cells [19], and here we further examined the effects of gamma-radiation on miR-30b and miR-30c expression in mouse tissues. [score:5]
These data suggest that radiation -induced IL-1β may be responsible for miR-30 expression and the radioprotective effects of DT3 may result from inhibition of a storm of radiation -induced inflammatory cytokines. [score:5]
DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in human CD34+ cells. [score:5]
In the current study, we confirmed expression of radiation -induced miR-30b and miR-30c in mouse tissues and serum, and miR-30 expression in mouse BM, jejunum, and liver within 1 h, that returned to baseline 4 or 8 h after irradiation (data not shown). [score:5]
In this study, we further demonstrated the effects of DT3 and the anti-IL-1β antibody on suppression of radiation or IL-1β -induced miR-30 expression in CD34+ cells. [score:5]
In this study, we confirmed our previous in vitro results and extend our findings using an in vivo mouse mo del, to explore our hypothesis that the radioprotective effects of DT3 are mediated through regulation of miR-30 expression in irradiated cells. [score:4]
To further understand the interaction between miR-30 and IL-1β in response to radiation and DT3, and the mechanisms of DT3 on radiation protection, we explored the role of radiation and DT3 on regulation of miR-30 and IL-1β expression. [score:4]
We reported recently that knockdown of miR-30c expression significantly protected CD34+ cells from radiation damage as shown by increased colony formation [19]. [score:4]
We further compared the effects of anti-IL-1β antibody and DT3 on miR-30 expression and survival of CD34+ cells after radiation and found that treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in these cells. [score:4]
Due to the ability of miRNA to target multiple transcripts [29], miR-30 has been found in multiple cellular processes to regulate cell death through different genes such as cyclin D1 and D2 [30], integrin b3 (ITGB3) [31], B-Myb [32], and caspase-3 [33]. [score:4]
IL-1β (10 ng/mL) was added to CD34+ culture with the anti-IL-1β antibody (0.2 μg/mL) or the same amount of a nonspecific IgG, and miR-30 expression was tested at 15 min, 30 min, and 1 h after addition of IL-1β. [score:3]
NFκB activation was responsible to radiation (and IL-1β) -induced miR-30 expression in CD34+ cells. [score:3]
DT3 protected against radiation -induced apoptosis in mouse and human CD34+ cells through suppressing of IL-1β -induced NFκB/miR-30 signaling, and significantly enhanced survival after lethal doses of total-body γ-irradiation in mice. [score:3]
Next, miR-30b and miR-30c expression were validated in sham- or 2 Gy radiation with or without anti-IL-1β antibody -treated and siNFκB or control-siRNA transfected cells by quantitative real-time RT-PCR. [score:3]
Interestingly, IL-1β -induced miR-30 expression was completely blocked by DT3 treatment (Fig 5C). [score:3]
Interestingly, radiation induced miR-30 expression in serum was observed at 4 h and remained elevated up to 24 h post-irradiation. [score:3]
Treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in CD34+ cells. [score:3]
Addition of the anti-IL-1β antibody for 30 min completely neutralized the expression of IL-1β -induced miR-30 in these cells. [score:3]
Cells were used for quantitative real-time PCR to determine the effects of IL-1β neutralization on miR30 expression. [score:3]
DT3 significantly suppressed miR-30 and protected animals from the acute radiation syndrome and increased survival from lethal doses of total-body irradiation. [score:3]
Fig 7C shows that in the control-siRNA transfected samples, γ-radiation enhanced miR-30b and miR-30c expressions by 3- and 2.2-fold, respectively, in comparison with sham-irradiated cells. [score:3]
DT3 treatment suppressed miR-30b and miR-30c in irradiated mouse serum at all time points in comparison with vehicle -treated samples. [score:3]
We next evaluated the effects of DT3 on radiation and/or IL-1β -induced miR-30 expression in human hematopoietic CD34+ cells because DT3 had suppressed the radiation -induced IL-1β and its downstream cytokine IL-6 production in mouse spleen (Fig 3) and jejunum [4]. [score:3]
0122258.g005 Fig 5 (A) Vehicle, DT3, or neutralizing antibody for IL-1β activation were added into CD34+ cell culture before 2 Gy radiation, and miR-30b and miR-30c expression were examined 1 h after irradiation. [score:3]
Vehicle, DT3, or a neutralizing antibody for IL-1β activation were added into CD34+ cell culture before 2 Gy irradiation, and miR-30 expression was examined 1 h after irradiation. [score:3]
DT3 or anti-IL-1β antibody inhibited radiation -induced IL-1β production and reversed IL-1β -induced NFκB/miR-30 stress signaling. [score:3]
IL-1β significantly induced both miR-30b and miR-30c expression in CD34+ cells at all-time points. [score:3]
We next sought to determine which a stress-response signal-transduction pathway may be involved in this IL-1β -induced miR-30 expression. [score:3]
NFκB activation was responsible for radiation -induced miR-30 expression in CD34+ cells. [score:3]
shown in Fig 5C confirmed that DT3 administration abolished expression of IL-1β -induced miR-30 in CD34+ cells. [score:3]
As expected, both miR-30b and miR-30c were expressed significantly in CD34+ cells 15 min after IL-1β addition and continually increased to 3-fold at 1 h after IL-1β-treatment as shown in Fig 5B (IL-1β + IgG). [score:3]
Modulation of miR-30 expression with IL-1β neutralizing antibody. [score:3]
Finally, vehicle or DT3 was added to CD34+ culture 22 h before IL-1β treatment, and miR-30 expression was examined at 24 h post-DT3 addition and 1 h after IL-1β treatment. [score:3]
It was also observed that anti-IL-1β antibody-treatment blocked the radiation -induced miR-30 expression in control-siRNA transfected cells. [score:3]
DT3 administration abolished IL-1β -induced miR-30 expression in CD34+ cells. [score:3]
DT3-treatment completely blocked the radiation -induced miR-30b and miR-30c expressions in mouse (B) BM cells after 7 Gy irradiation and in (C) jejunum and liver cells after 10 Gy irradiation, compared with vehicle -treated mice. [score:2]
DT3-treatment completely blocked the radiation -induced expression of miR-30b and miR-30c in mouse BM, jejunum and liver cells compared with vehicle -treated mice (Fig 4B and 4C, N = 6/ group). [score:2]
Radiation induced both miR-30 subunits between 4–24 h after 7 and 10 Gy TBI. [score:1]
In conclusion, results from our current study demonstrated that an increase of miR-30 in irradiated cells results from a cascade of IL-1β -induced NFκB -dependent stress signals that are responsible for radiation damage in mouse and human cells. [score:1]
This circulating miR-30 increase is specific, reproducible, and radiation dose -dependent in irradiated mouse serum. [score:1]
In contrast, no miR-30 increase was observed after 2 Gy irradiation to siNFκB transfected cells. [score:1]
Fig 5A shows that 2 Gy radiation increased miR-30b and miR-30c by 3- and 2.5-fold in vehicle -treated CD34+ cell samples, respectively. [score:1]
We found that miR-30 was highly induced by radiation within 1 h in BM (Fig 4B), jejunum, and liver (Fig 4C), but not in kidney cells (data not shown). [score:1]
We believe that the acute secretion of extracellular miR-30 in mouse serum after radiation is likely to derive from a variety of cell types. [score:1]
in Fig 4D demonstrated the levels of miR-30b and miR-30c in serum changed in a radiation dose -dependent manner. [score:1]
These results further support our hypothesis that levels of miR-30 in irradiated mouse tissues and serum reflect the severity of radiation damage in these animals. [score:1]
[1 to 20 of 54 sentences]
9
[+] score: 167
Furthermore, we found that miR-30c could modulate reporter gene expression through the PAI-1 mRNA 3′ UTR seed sequence and directly negatively regulated its mRNA and protein expression in megakaryocytes, consistent with PAI-1 being a direct target of miR-30c and that platelet miR-30c negatively regulates PAI-1 levels. [score:11]
In conclusion, we described a novel regulatory mechanism of miR-30c regulating conserved target PAI-1 mRNA and protein expression by directly binding to the PAI-1 mRNA 3′ UTR seed sequence. [score:8]
Thus, miR-30c modulated reporter gene expression through the PAI-1 mRNA 3′ UTR seed sequence and directly negatively regulated its expression. [score:7]
Transfection with miR-30c mimic significantly increased miR-30c gene expression (Fig. 4B) and significantly inhibited the expression levels of the PAI-1 mRNA and protein compared to a NC (Fig. 4C–E). [score:6]
Increased miR-30c expression by lenti-miR-30c injection significantly decreased the expression of PAI-1 mRNA and protein and prolonged the arterial time to occlusion in HFD-fed diabetic mice, thereby modulating arterial thrombus formation. [score:5]
Predictions of miR-30c target genes were performed as described above in “Methods-Bioinformatic analysis”, and the results provided information regarding target site accessibility. [score:5]
In this study, we found significantly lower expression of miR-30c and higher expression of PAI-1 mRNA and protein in patients with NCDM and DM-CHD compared with healthy subjects. [score:4]
In contrast, transfection with the miR-30c inhibitor showed a significant reduction in miR-30c expression and a significant increase in PAI-1 mRNA and protein levels when compared to a NC (Fig. 4B–E). [score:4]
The inhibitory effect of the miR-30c mimic and enhancement of the miR-30c inhibitor were indeed abrogated compared to co-transfection of control oligo with vector or empty vector (Fig. 3C). [score:4]
Platelet expressed miR-30c negatively regulates PAI-1 levels. [score:4]
Assessing miR-30c over -expression or knockdown of PAI-1. Animals. [score:4]
Similarly, there was also significantly lower expression of miR-30c and higher expression of PAI-1 mRNA and protein in db/db mice compared with control mice (Fig. 2G–J). [score:4]
PAI-1 is a direct target of miR-30c. [score:4]
In experimental animal mo dels subjected to high fat feeding, miR-30c modulates thrombus formation by regulating PAI-1 levels, furthermore, platelet depletion/reinfusion experiments generating mice with selective ablation of PAI-1 demonstrate a major contribution by platelet-derived PAI-1, which is regulated by miR-30c, plays a major role in the modulation of thrombosis formation in DM2, consistent with platelet miRNAs playing an important regulatory role for the fibrinolytic system in DM2. [score:4]
[#] p < 0.05, miR-30c inhibitor experimental vs. [score:3]
MEG-01 cells (2 × 10 [5]) were seeded in 24-well plates and co -transfected with miR-30c mimic (30 nM), inhibitor (30 nM) and NC control oligo (30 nM) using Lipofectamine 2000 (Invitrogen). [score:3]
As shown in Fig. 6C,D, miR-30c expression in HFD mice was significantly lower than in WT mice. [score:3]
miR-30c mimic, a double-stranded RNA molecule (numbered as miR10000244), miR-30c inhibitor, a single-stranded RNA molecule (numbered as miR20000244), or its negative control cel-miR-239b-5p (NC) are obtained from RiboBio (Guangzhou, Guangdong, China). [score:3]
However, miR-30c has multiple targets including growth factors 26, extracellular matrix proteins 51, cytokine receptors 52, transcription factors, and ADAM family members), and miR-30c is probably mediated by some upstream transcription factors including Spermatogenic leucine zipper protein 1 (Spz1), (sex determining region Y)-box 17 (SOX17), and Hepatocyte Nuclear Factor-3 Homologue 1 (HFH-1) etc. [score:3]
As shown in Supplementary Figure S1A, there is only a single predicted miR-30c target site (643 bp–669 bp) in the PAI-1 mRNA 3′ UTR based on good complementarity (ΔG°~ −25.67 kcal/mol). [score:3]
How to cite this article: Luo, M. et al. Hyperglycaemia -induced reciprocal changes in miR-30c and PAI-1 expression in platelets. [score:3]
The miR-30c inhibitor increased the relative luciferase activity to approximately 12% (Fig. 3B). [score:3]
Furthermore, the treatment of lenti-miR-30c significantly inhibited thrombus formation in both the HFD- Pai-1 [−/−] → HFD-WT group (mean time to thrombotic occlusion increased to 379 ± 26 seconds, n = 11, P < 0.05) and the HFD-WT → HFD-WT group (mean time to thrombotic occlusion increased to 594 ± 26 seconds, n = 11, P < 0.05). [score:3]
We demonstrated that only miR-30c was especially enriched and jointly expressed with PAI-1 in platelets. [score:3]
The constructs were cotransfected with miR-30c mimic, inhibitor and control oligo into HEK 293 cells using Lipofectamine 2000 (Invitrogen). [score:3]
The finding of reciprocal changes of platelet miR-30c and PAI-1 levels in PLT, PRP and PPP in subjects with DM2 leads to the hypothesis that decreased platelet miR-30c removes a normally inhibitory influence on PAI-1 levels and thus plays a significant role in thrombus formation. [score:3]
In this situation, lenti-miR30c administration resulted in a significant inhibitory effect on thrombosis formation. [score:3]
Validation of the expression of the sequence-specific miR-30c was determined using quantitative stem-loop qRT-PCR using the NCode [TM] miRNA First-Strand cDNA Synthesis Kit (Invitrogen). [score:3]
These experiments further demonstrate that platelet-derived PAI-1, regulated by miR-30c, plays a critical role in modulating thrombosis in DM2. [score:2]
Platelet depletion/reinfusion procedure identifies miR-30c as a critical regulator of arterial thrombosis in DM2. [score:2]
To study the effect of miR-30c on thrombosis, lenti-miR30c and lenti-NC were directly injected into the tail vein in mice. [score:2]
Together, these findings suggest that platelet-derived PAI-1, regulated by miR-30c, plays a major role in the modulation of thrombosis formation in DM2. [score:2]
Platelet-derived miR-30c negatively regulates PAI-1 mRNA and protein levels. [score:2]
miR-30c and its target gene PAI-1 quantitative RT-PCR assay. [score:2]
, suggesting that additional experiments will be required to further define the upstream and downstream regulatory network of miR-30c on thrombosis formation in DM2 in future studies. [score:2]
A total of 200 μl (1 × 10 [7] TU/ml, labelling with green fluorescent) of lenti-miR30c and lenti-NC were directly injected into the tail vein of all control and high-fat diet-fed C57BL/6J mice. [score:2]
In vivo analysis of miR30c regulating PAI-1 in platelets. [score:2]
After the lenti-miR-30c injection, PAI-1 mRNA expression was significantly reduced (~90%) in HFD-fed mice compared to lenti-NC mice (Fig. 5D). [score:2]
The gene expression levels of miR-30c and PAI-1 in LDPs were measured by qRT-PCR, and the PAI-1 total antigen was determined by ELISA as described above. [score:1]
miR-30c modulates thrombus formation in vivo. [score:1]
lenti-NC injection HFD- Pai-1 [−/−] → HFD-WT mice; ** p < 0.05 lenti-miR-30c injection HFD-WT → HFD-WT vs. [score:1]
Reciprocal changes of platelet miR-30c and PAI-1 levels in DM2. [score:1]
To study the contribution of platelet miR-30c in thrombosis and PAI-1 levels, we used a platelet depletion/reinfusion mo del to examine arterial thrombosis in different groups (HFD- Pai-1 [−/−] → HFD-WT, HFD-WT → HFD-WT). [score:1]
Human platelets contain miR-30c and PAI-1.. [score:1]
To further determine the reciprocal changes of miR-30c and PAI-1 in DM2, we analyzed miR-30c and PAI-1 levels in the LDPs, PRP and PPP from db/db and corresponding control mice. [score:1]
Importantly, after the lenti-miR-30c, mean time to occlusion in HFD-WT → HFD-WT group was significantly longer than that of HFD- Pai-1 [−/−] → HFD-WT group. [score:1]
miR-30c modulates thrombus formation in vivoTo assess the effect of miR-30c on the arterial thrombosis relevant to DM2, we fed mice a HFD for 14 weeks, which produced obesity and hyperglycaemia, and high plasma leptin levels (Supplementary Figure S2). [score:1]
The results revealed potentially conserved sites for approximately nine miRNA family candidates (miR-30c, miR-34a/c, miR-449b, miR-181, miR-301a, miR-421, miR-299-5p, miR-609 and miR-99a) in the PAI-1 mRNA 3′ UTR. [score:1]
Further, we found an apparent negative relationship between miR-30c levels and glucose and HbA1c levels in subjects with DM2. [score:1]
The results also revealed that miR-30c had high complementarity and a high degree of species conservation with respect to binding sites within the 3′ UTR of the PAI-1 mRNA. [score:1]
These results from an animal mo del are therefore consistent with there being reciprocal changes in platelet miR-30c and PAI-1 levels in DM2. [score:1]
Platelet-derived miR-30c is critical for modulating arterial thrombosis. [score:1]
We investigated a potential role of miR-30c as a mediator of PAI-1mRNA and protein levels in platelets by transfection with the miR-30c mimic or inhibitor in MEG-01 cells. [score:1]
In vivo analysis of miR30c regulating PAI-1 in plateletsTo investigate whether miR-30c negatively regulates PAI-1 levels in vivo, blood was collected following the studies of thrombus formation, and LDP, PRP, and PPP were prepared as described above. [score:1]
The data were normalized to U6 RNA (for miR-30c) and 18S rRNA (for PAI-1) in each sample. [score:1]
This finding indicates that platelet miR-30c plays a key role in mediating arterial thrombosis and has antithrombotic consequences. [score:1]
After the lenti-miR-30c injection, the blood flow was recorded using the Color Laser Doppler Image scanner. [score:1]
lenti-NC injection HFD-WT → HFD-WT mice; [#] p < 0.05, lenti-miR-30c injection HFD-WT → HFD-WT vs. [score:1]
To assess the effect of miR-30c on the arterial thrombosis relevant to DM2, we fed mice a HFD for 14 weeks, which produced obesity and hyperglycaemia, and high plasma leptin levels (Supplementary Figure S2). [score:1]
A fragment of the PAI-1 mRNA 3′ UTR containing the putative or mutated miR-30c binding site was amplified by RT-PCR from MEG-01 cell total RNA. [score:1]
In the left panel of (C), “M” represents as 20 bp DNA Ladder Marker, “miR-30c” represents as human miR-30c. [score:1]
lenti-miR-30c injection HFD- Pai-1 [−/−] → HFD-WT mice. [score:1]
Lenti-miR-30c injection in vivo. [score:1]
These results suggest that miR-30c modulates arterial thrombus formation independently of diabetes. [score:1]
Finally, the production of lenti-miR-30c droplets was adjusted to 1 × 10 [8] TU/ml. [score:1]
Further, we demonstrated that miR-30c was negatively related to glucose and HbA1c levels. [score:1]
Reciprocal changes of platelet-derived miR-30c and PAI-1 levels in DM2. [score:1]
As shown in Fig. 2A,B, miR-30c levels progressively decreased in LDP samples from patients classified as pre-DM, NCDM and DM-CHD. [score:1]
To investigate the predicted interaction of miR-30c with PAI-1, the 3′ UTR of human PAI-1 containing the putative miR-30c binding sites was cloned into the psi-CHECK2 [TM] vector downstream of the Renilla luciferase coding sequence and co -transfected with miR-30c mimic, inhibitor or control oligo into HEK 293 cells. [score:1]
[1 to 20 of 69 sentences]
10
[+] score: 152
The level of expression of each gene in control cells (anti-miR-neg or pre-miR-neg) was taken as 1. To identify molecular mechanisms that would regulate the effects of miR-30 miRNAs on adipogenesis, bioinformatics prediction of their targets was performed with TargetScan. [score:8]
Inhibition of the miR-30 family was achieved with the transfection of a combination of three oligonucleotides that can target and inhibit activity of the whole miR-30 family. [score:7]
The up-regulation of miR-30 expression is triggered at early stages of adipocyte differentiation (day 3) and increases until terminal differentiation. [score:6]
The expression profile of the miRNAs that were strongly up-regulated during adipogenesis (miR-642a-3p, miR-378, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, and miR-193b) was validated by quantitative PCR (qPCR; Additional file 4). [score:6]
Although expressed at lower levels than the highly abundant miR-30 family, two members of the miR-642 family were the most highly up-regulated miRNA in our adipogenesis mo del. [score:6]
Moreover, as adipose tissue-derived stem cells can differentiate into either adipocytes or osteoblasts, the down-regulation of the osteogenesis regulator RUNX2 represents a plausible mechanism by which miR-30 miRNAs may contribute to adipogenic differentiation of adipose tissue-derived stem cells. [score:5]
In order to test whether RUNX2 is targeted by the miR-30 family, we cloned two regions of its 3' UTR that contain the predicted miR-30 binding sites into the pSi-CHECK™-2 vector, downstream of the Renilla translational stop codon (Figure 5a,b). [score:5]
Finally, we checked for the expression of the adipogenic -induced transcripts C/EBPβ, PPARγ and fatty acid binding protein (FABP) 4. These genes showed consistent profiles after inactivation of the miR-30 family and over -expression of miR-30a (Figure 4c). [score:5]
Inhibition of the miR-30 family blocked adipogenesis, whilst over -expression of miR-30a and miR-30d stimulated this process. [score:5]
Quantitative RT-PCR confirmation of inhibition or over -expression of the miR-30 family. [score:5]
Given their up-regulation after induction of adipogenesis and their high abundance in adipocytes, we focused on the role of miR-30 family members in adipogenesis. [score:4]
In addition to miR-30 miRNAs, we identified potent up-regulation of other miRNA families, such as miR-378 (35.7-fold), during adipogenic differentiation. [score:4]
Altogether, these data strongly support a direct and functional link between RUNX2 and miR-30, but does not exclude the contribution of additional miR-30 targets. [score:4]
We then focused our study on the miR-30 family, which was also up-regulated during adipogenic differentiation and for which the role in adipogenesis had not yet been elucidated. [score:4]
Finally, we sought to establish a direct link between miR-30 effects on adipogenesis and RUNX2 targeting. [score:4]
In addition to miR-378, our data confirmed that the miR-30 family was up-regulated in adipogenesis (Table 1). [score:4]
Up-regulation of miR-642a-3p, miR-378/378* and miR-30 miRNAs suggests their contribution to adipogenesis. [score:4]
In conclusion, RUNX2 targeting is, at least in part, responsible for miR-30 positive effects on adipocyte differentiation. [score:3]
Screen shot from TargetScan (release 5.1) showing conserved and poorly conserved miR-30 family putative binding sites located in the 3' UTR of human RUNX2. [score:3]
For the target protection experiment, sub-confluent hMADS cells were transfected with TSBs, which are custom designed LNA oligonucleotides with a phosphorothioate backbone (Exiqon); the sequences were 5'-ACATGAAGTAAACACACA-3' for miR-30-TSB and 5'-CAGTCGAAGCTGTTTAC-3' for TSB-neg (mismatch control). [score:3]
In the list of predicted miR-30 targets, we noticed the presence of CBFB (core binding factor beta), a co-transcription factor that forms a heterodimer with RUNX proteins [28]. [score:3]
We used the target site blocker (TSB) strategy to mask miR-30 binding sites 2 and 3 in the RUNX2 3' UTR. [score:3]
Morphological observation and coloration of lipid droplets showed that inactivation of the miR-30 family impaired adipogenesis and that over -expression of miR-30a and miR-30d improved adipogenesis (Figure 4a). [score:3]
We altered their expression by transfecting synthetic miR-30 miRNAs or the corresponding antagomirs. [score:3]
Importantly, we also showed that miR-30 stimulation of adipogenesis was impaired by masking miR-30 binding sites in the 3' UTR of RUNX2, and preliminary data suggest that miR-30 inhibition might stimulate osteogenesis. [score:3]
The simultaneous use of these three oligonucleotides successfully inhibited all miRNAs from the miR-30 family (Exiqon, personal communication; Additional file 6). [score:3]
We show here for the first time that miR-30 miRNAs target RUNX2. [score:3]
miR-30 miRNAs stimulate adipogenesis via inhibition of the osteogenesis transcription factor RUNX2. [score:3]
However, we found that miR-204 and miR-211 were expressed at extremely low levels - for example, below our 0.03% threshold - while miR-30 represented 4.9% of the miRNA reads in adipocytes. [score:3]
Using miRonTop [27], we verified that predicted miR-30 targets were correctly enriched in these experiments. [score:3]
Thus, it is tempting to speculate that RUNX2 inhibition is required for adipocyte differentiation and that miR-30 miRNAs play a critical role in this process. [score:3]
In order to dissect the molecular mechanisms involved in the effects of miR-30 on adipogenesis, we searched for predicted target genes. [score:3]
Overall, our data suggest that the miR-30 family plays a central role in adipocyte development. [score:2]
Figure 4 The miR-30 family positively regulates hMADS cell adipocyte differentiation. [score:2]
In particular, we show that the miR-30 family is a positive, key regulator of adipocyte differentiation in a human adipose tissue-derived stem cell mo del. [score:2]
Thus, in our system, this very low abundance of miR-204 and miR-211 suggests that their impact on RUNX2 and differentiation is minor when compared with the highly expressed miR-30 family. [score:2]
Statistical scores were highest for the miR-30 family (P-value = 5.32.10 [-10]), showing its strong overall impact in these cells. [score:1]
The first region covers positions 32 to 332 of the RUNX2 3' UTR and contains a poorly vertebrate-conserved putative miR-30 binding site (positions 229 to 235 of the RUNX2 3' UTR). [score:1]
Gain and loss of function studies reveal that the miR-30 family favors adipogenesis. [score:1]
Inactivation of the miR-30 family drastically reduced GPDH activity at day 10 (fold reduction of 23.9). [score:1]
The day after this first transfection, hMADS cells were co -transfected with miR-30 Pre-miR™ miRNA precursor molecules (Ambion) at a final concentration of 40 nM, together with the miR-30-TSB again, or the mismatch control TSB. [score:1]
This is probably not due to a deep sequencing cloning bias, as miR-204 detection was above average and better than that of miR-30 in a synthetic equimolar miRNA panel that we sequenced in similar conditions (data not shown). [score:1]
Since CBFB was shown to be essential for functions of RUNX1 and RUNX2 [28], these additional data may explain the drastic effect of miR-30 on adipogenesis. [score:1]
Transfection with RUNX2 miR-30-specific TSB, but not a control TSB, significantly decreased miR-30a stimulation of adipogenesis (Figure 5E). [score:1]
Even though none of the miR-30 family members are encoded within introns of pro-adipogenic sites, their increased abundance is likely to reflect a major role in differentiation. [score:1]
Interestingly, the relative abundance of the miR-30 family varies from 1.1% in undifferentiated cells to 4.9% in adipocyte-differentiated cells (Figure 2b). [score:1]
Of note, all miR-30 miRNAs do not belong to the same genomic cluster (Additional file 8). [score:1]
Table S2: miR-30 family identifiers, genomic coordinates and mature sequences. [score:1]
Amongst the adipogenesis -induced miRNAs, miR-30 reached the highest levels during differentiation. [score:1]
[1 to 20 of 49 sentences]
11
[+] score: 149
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Searching 3′-UTR of putative target mRNA, targeting sequences which can make base pairing with 5′ seed sequences of miR-30 were found in the 3′-UTR of lifr, eed, pcgf5 and sirt1 utilizing TargetScan (Fig 7B). [score:7]
miR-30 targets were predicted using TargetScan. [score:5]
These data suggest that miR-30 members could be repressing targets at the MSC and osteocytic stages, while repression on target mRNA may be relieved during the intermediate osteoblastic stage. [score:5]
0058796.g009 Figure 9(A) Relative expression levels of miR-30 target mRNA in proliferating/sparse KUSA cells. [score:5]
In fact, runx2 as well as sox9 a master transcription factor for chondrogenesis was upregulated in mRNA level by miR-30d, indicating miR-30 could direct differentiation of MSC. [score:5]
mRNA expression patterns of miR-30 targets in mMSC line. [score:5]
Together with the data of expression patterns in Fig 9 and Fig 2, miR-30 targets were classified into several groups; immediate induction followed by rapid attenuation group (ccn1/2/3, hnrnpa3 vC, eed, hspa5/grp78), immediate reduction and rapid recovery group (runx2 and lifr), the constant induction group (lin28a and opn/spp1) and the constant reduction group (pcgf5 and hnrnpa3 vB). [score:5]
As observed in Fig 11C, suppression of lifr expression by miR-30 may control osteoblast and osteocyte differentiation leading to attenuation of Lif/LifR/Jak-Stat signal. [score:5]
Expression pattern of miR-30 targets. [score:5]
For a better understanding of miR-30 targeting, basal mRNA expression levels of 18 gene products were quantified and compared in proliferating/sparse KUSA-A1 cells (vector transfected control cells). [score:4]
miRNA downregulated by two weeks osteo-induction included members of the let-7 and miR-30 families (miR-30a/d/e) (Table 1). [score:4]
EED, named after embryonic ectoderm development, is another novel target of miR-30. [score:4]
miR-30 controls expression of LifR and Runx2, the known regulators for osteoblasts. [score:4]
One miR-30 targeting sequence in the 3′-UTR of ctgf/ccn2 has been reported. [score:3]
List of predicted miR-30 targets. [score:3]
Note the different expression levels: miR-30d>30a>30e: miR-30c>30b. [score:3]
A previous study showed that runx2 is a target of miR-30c, miR-135a, miR-204, miR-133a, miR-217, miR-205, miR-34, miR-23a and miR-338 [34]. [score:3]
A recent study proposed that Lin28 is essential in embryonic stem cells (ESC), induced pluripotent stem cells (iPSC) and tumorigenesis and that the expression of LIN28 is controled by let-7, miR-9, miR-125 and miR-30 [41], indicating not only miR-30, but let-7, miR-9 and miR-125 can control lin28a during osteogenesis. [score:3]
These predictions appear to be specific to each of the miR-30 members; however, 11 nt of the 5′ seed sequence in miR-30 family members are common and the mature miR-30s sequences are quite homologous among miR-30a/d/e or between miR-30b/c (Fig 7A), indicating shared and distinctive targets among miR-30 members. [score:3]
Analysis of miR-30 targeting. [score:3]
Target of miR-30 family, miR-34 family, let-7 family, miR-15/16 family (including miR-322/424), miR-21 family, miR-541/654 was predicted and selected using cut off score −0.2. [score:3]
In addition, two putative miR-30 targeting sites on spp1/osteopontin were found. [score:3]
miR-30 controls CCN family gene expression during MSC osteogenesis. [score:3]
miR-30 targeting prediction. [score:3]
As targets of miR-30, we found novel key factors in osteogenesis including Lin28, hnRNPA3, Eed, Pcgf5 and HspA5/Grp78. [score:3]
0058796.g006 Figure 6(A) miR-30 family expression pattern in KUSA-A1 mMSC line with (red bars, Os+) or without (blue bars, Os−) osteoinduction. [score:3]
Known target of miR-30. [score:3]
miR-30 targeting in mMSC line. [score:3]
Matching around the 3′ part and intermediate part of miR-30 were tested to those targets. [score:3]
miR-30 controls CCN family gene expression during MSC osteogenesisPhysiological production of CCN2/CTGF is more abundant from chondrocytes in cartilage than those in other tissues, while CCN1/2/3, the prototype members of CCN family, control both chondrocytic and osteoblastic differentiation [57, 58). [score:3]
miR-30 expression pattern during KUSA-A1 MSC osteocytogenesis. [score:3]
Prediction of miR-30 targeting. [score:3]
Since miR-30 family members are homologous (Fig 6A) and possibly share targets, we further investigated the miR-30 family expression patterns at four time points with or without osteo-induction. [score:3]
These in silico analyses suggested putative shared and distinctive target mRNA recognition by miR-30 family, the groups of miR-30a/d/e and miR-30b/c. [score:3]
After repeated osteo-induction (2w+), miR-30d and miR-30c were induced, and the expression levels of miR-503, miR-322 and miR-125b-3p were the most powerfully repressed (Fig. 4B, E). [score:3]
As a result, miR-30a, miR-30c and miR-30d were highly expressed compared with miR-30b or miR-30e (Fig. 6B). [score:2]
In myocardial cells CTGF/CCN2 is regulated by miR-133 and miR-30c [67] and the 3′-UTR of ctgf and miR-30c are basepairing by 9 bases at 5′ seed of miR-30c and 11 bases at 3′ part including one of each GU non-Watson-Crick base pairing (Fig 7A). [score:2]
Hspa5/grp78, lifr, eed, opn/spp1 and pcgf5 mRNA levels in miR-30 transfected cells were 20–30% lower than those in control cells in both proliferating and confluent cells (Fig 8AB), indicating direct repression of mRNA stability. [score:2]
Moreover, the miR-30 family was predicted to recognize sox9, lrp6, smad2, smad1, notch1, bdnf and a number of epigenetic factors (Table 2). [score:1]
0058796.g007 Figure 7(A) List of mature miR-30 family members. [score:1]
These immediate early induction followed by quick attenuation patterns were shared with those of CCN gene family shown in Fig 2A, indicating these 6 kinds of transcripts are under the control of same factors and the miR-30 family. [score:1]
Mature miR-30 quantification during osteocytogenesis. [score:1]
In addition, miR-30d was induced by osteo-induction (Fig. 5J), and miR-30 family recognition sites were found in the 3′-UTR regions of the runx2 and nov/ ccn3 mRNAs (Fig. S2, S3). [score:1]
These findings suggest that members of the miR-30 family could play an essential role in osteocytic differentiation. [score:1]
Therefore, immediate induction and subsequent rapid repression of ctgf/ccn2 could be controlled by fluctuations in these miRNAs including the miR-30 family. [score:1]
Tuning mo del of canonical and novel osteogenic factors by miRNA-30 family and miR-541 during MSC osteogenesis. [score:1]
WD protein associated, miR-30-specificity. [score:1]
All the miR-30 members once reduced during osteoblastic differentiation stage on day 2 and day 7. Among those members, miR-30a/d/e were increased on day 14 around a late osteocytic stage (Fig 6A). [score:1]
We focused on the miR-30 family and miR-541 in this study, while still further analyzing roles of OstemiR in MSC differentiation. [score:1]
phosphorylation of RNA polymerase II CTD for transcription elongation Txn Chro miR-30c ZBTB44 −0.47 Zinc finger and BTB domain containing 41 Txn N miR-30c CTGF/CCN2 ref. [score:1]
Together with these results and data interpretations, we propose the tuning mo del of canonical and novel osteogenic factors by the OstemiRs including miR-30 family and miR-541. [score:1]
RNA, stem N miR-30c S100PBP −1.19 Ca, Zn/transport miR-30c ZBTB41 −0.92 Zinc finger and BTB domain containing 41 Txn N miR-30c CCNT2 −0.49 Transcription, component of pTEFb with CDK9. [score:1]
[1 to 20 of 52 sentences]
12
[+] score: 110
Other miRNAs from this paper: hsa-mir-30c-2, hsa-mir-34a, hsa-mir-195, hsa-mir-155, hsa-mir-130b
For example, miR-34a-5p regulated Cdk4, and miR-195-5p regulated CDC42; both miR-34a-5p and miR-195-5p were up-regulated by DHA and co-regulated Cdk6, VEGF, E2F3, and Cdk4; the up-regulated microRNA miR-30c-5p regulated Rac1, and co-regulated MEK1 with miR-34a-5p and E2F3 with miR-34a-5p and miR-195-5p; the up-regulated microRNA miR-130b-3p co-regulated E2F1 with miR-34a-5p; and the down-regulated microRNA miR-155-5p regulated p16. [score:20]
Here, we found that DHA treatment up-regulated miR-34a-5p, miR-195-5p, miR-130b-3p, and miR-30c-5p expression and down-regulated the expression of the target mRNAs Cdk4, Cdk6, E2F3, and E2F1, respectively; DHA treatment also decreased protein levels translated from these mRNAs. [score:15]
To analyze the mechanism by which DHA suppresses growth, inhibits angiogenesis, and promotes apoptosis in tumor tissues, expression of the microRNAs (miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p) that were up-regulated by DHA and their target mRNAs (Cdk4, Cdk6, VEGF, IKKα, MEK1, E2F3, Rac1, E2F1, and CDC42) were analyzed using qRT-PCR. [score:12]
In this study, DHA treatment up-regulated miR-34a-5p and miR-30c-5p and down-regulated MEK1 mRNA expression and protein levels, which both microRNAs target. [score:11]
miR-34a-5p, miR-195-5p, miR-30c-5p, miR-130b-3p, mir-34a-5p specific inhibitor (miR-34a-5p antisense oligodeoxyribonucleotide, AMO-34a-5p), mir-195-5p specific inhibitor (miR-195-5p antisense oligodeoxyribonucleotide, AMO-195-5p), mir-30c-5p specific inhibitor (miR-30c-5p antisense oligodeoxyribonucleotide, AMO-30c-5p), mir-130b-3p specific inhibitor (miR-130b-3p antisense oligodeoxyribonucleotide, AMO-130b-3p), and negative control miRNA (NC) were obtained from RiboBio (Guangzhou, China). [score:9]
Here, DHA -induced, miR-30c-5p -mediated down-regulation of Rac1 expression might be another novel mechanism by which DHA inhibits cancer cell proliferation, viability, and migration. [score:8]
To assess the regulatory relationships between the microRNAs and target mRNAs identified via microarray and systematic analysis, we next transfected PANC-1 and BxPC-3 cells with miR-34a-5p, miR-195-5p, miR-30c-5p, or miR-130b-3p or their inhibitors and examined the protein levels of their target mRNAs, including Cdk4, Cdk6, VEGF, IKKα, MEK1, E2F3, Rac1, E2F1, and CDC42 in western blots. [score:8]
To confirm the results of microarray experiments and mRNA data obtained from the experimentally validated databases, all of the microRNAs (miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p) that were up-regulated by DHA, suppressed growth and angiogenesis, and promoted apoptosis in pancreatic cancer cells, and their target mRNAs (Cdk4, Cdk6, VEGF, IKKα, MEK1, E2F3, Rac1, E2F1, and CDC42), were analyzed with qRT-PCR. [score:8]
Surprisingly, we found that four crucial microRNAs (miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p) regulated the expression of many mRNAs (Cdk4, Cdk6, VEGF, IKKα, MEK1, E2F3, Rac1, E2F1, ERK1, and CDC42) and their proteins, and thus were crucial to the anti-pancreatic cancer effects of DHA. [score:4]
As shown in Figure 4, miR-30c-5p overexpression reduced Rac1, MEK1, and E2F3 levels in both PANC-1 and BxPC-3 cells. [score:3]
As shown in Figure 5, miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p were up-regulated in DHA -treated PANC-1 and BxPC-3 cells compared to vehicle -treated controls, confirming the microarray results. [score:3]
As shown in Figure 8A, miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p were up-regulated in the DHA -treated group compared to the vehicle -treated group, confirming the microarray results in vivo. [score:3]
Conversely, inhibition of endogenous miR-30c-5p increased Rac1, MEK1, and E2F3 levels compared to the control group. [score:2]
Figure 4 A. PANC-1 and BxPC-3 cells were transfected with miR-34a-5p, miR-195-5p, miR-30c-5p, miR-130b-3p, AMO-34a-5p, AMO-195-5p, AMO-30c-5p, AMO-130b-3p, or negative control miRNA. [score:1]
These results indicate that the anti-pancreatic cancer effects of DHA were mediated at least partly by miR-195-5p, mir-34a-5p, and mir-30c-5p. [score:1]
All of the microRNAs (miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p) were also analyzed with qRT-PCR in HPDE6-C7 cell line (Supplementary Figure S2). [score:1]
A. PANC-1 and BxPC-3 cells were transfected with miR-34a-5p, miR-195-5p, miR-30c-5p, miR-130b-3p, AMO-34a-5p, AMO-195-5p, AMO-30c-5p, AMO-130b-3p, or negative control miRNA. [score:1]
[1 to 20 of 17 sentences]
13
[+] score: 94
As both miR-421 and miR-30c were expressed in HUVEC, we cloned the entire PAI-1 3′UTR in the luciferase expression vector and over-expressed these two miRNAs. [score:7]
Conversely, the over -expression of miR-30c previously shown to inhibit PAI-1 mRNA level in pulmonary endothelial cells [14] was associated with a 43% decrease in PAI-1 mRNA level (Figure 2A ). [score:5]
The mRNA inhibition was not observed with miR-421 and this could explain why the inhibitory effect on PAI-1 protein was stronger with miR-30c than with miR-421. [score:5]
MiR-421 and miR-30c inhibit SERPINE1 expression in HUVEC. [score:5]
MiR-421 and miR-30c overexpression did not show any additive effect on PAI-1 protein expression. [score:5]
0044532.g002 Figure 2MiR-421 and miR-30c inhibit SERPINE1 expression in HUVEC. [score:5]
A homogeneous decrease in luciferase expression was observed when miR-30c and miR-421 were over-expressed (63% and 60%, respectively). [score:5]
Note that simultaneously co -expressing miR-421 and miR-30c did not reveal any additive effect on PAI-1 inhibition (Figure 2B ). [score:5]
Recently SERPINE1 expression was shown to be regulated by miR-30c and miR-301a in pulmonary endothelial cells [14]. [score:4]
Over -expression of miR-421 and miR-30c lead to a decrease in luciferase activity of 40% in both cases (Figure 3A ), indicating that both miRNAs can directly bind to PAI-1 3′UTR mRNA. [score:4]
Consistent with aforementioned results, we indeed showed that miR-30c inhibits both PAI-1 mRNA and protein levels. [score:3]
Graph shows renilla luciferase activity normalized to firefly luciferase activity and expressed as percentage of Pre-Neg transfected cells (n = 4 for miR-30c and n = 5 for miR-421; *, p<0.05; **, p<0.01)). [score:3]
This may explain why we did not observe an association of miR-30c with PAI-1 as initially reported in sickle anemia diseased patients [14]. [score:3]
The low sample size of our study could also have limited the power for detecting a differential miR30-c expression. [score:3]
However, as shown in Figure 2B, both over -expression of miR-421 and miR-30c were associated with a significant decrease in PAI-1 protein level, 59% and 32%, respectively. [score:3]
This could be explained by the degradation of SERPINE1 mRNA by miR-30c before miR-421 could exert its inhibitory effect. [score:3]
A. Quantification by qRT-PCR of PAI-1 mRNA level after over -expression of either Pre-miR-421, Pre-miR-30c or a Pre-miR Negative control (Pre-Neg) in HUVEC cells. [score:3]
Our work also extends recent results obtained in pulmonary endothelial cells [14] and adipose tissue [30] as we demonstrated that miR-30c also participate to PAI-1 expression in HUVECs. [score:3]
Data shown were normalized to GAPDH protein level and expressed as percentage compared to Negative control (n = 5 for miR-421 and miR-30c, n = 3 for miR-421+30c; *, p<0.05; **, p<0.01). [score:2]
Oligonucleotides corresponding to the serpine1 3′UTR surrounding the predicted miR-421 binding sites with or without mutation and miR-30c binding site were inserted into psiCHECK-2 using XhoI and NotI restriction enzyme (see Table 3 ). [score:2]
B. Western-Blot and quantification of PAI-1 and GAPDH protein level after over -expression of either Pre-miR-421, Pre-miR-30c or both compared to Pre- Neg transfected cells. [score:2]
Levels of miR-421 and of miR-30c were strongly correlated, the corresponding Spearman correlation coefficient being 0.51 and 0.66 in the low and high PAI-1 groups, respectively. [score:1]
Influence of miR-421 and miR-30c binding to total 3′UTR SERPINE1 on luciferase activity. [score:1]
A. Psicheck2 vector containing total 3′UTR SERPINE1 sequence fused to renilla luciferase was co -transfected with Pre-Neg, Pre-miR-30c, Pre-miR-421 or both Pre-miR-30c and Pre-miR-421. [score:1]
MiR-421 and miR-30c were detected by qRT-PCR in plasma samples from two groups of 20 patients either with low (1.6+/−1 ui/ml) or high (40.5+/−13 ui/ml) PAI-1 plasma levels. [score:1]
A. psicheck2 vector containing 3′UTR SERPINE1 sequence surrounding miR-30c predicted binding site or miR-421 predicted binding sites according to the allele present at rs1050955 fused to renilla luciferase were co -transfected with Pre-Neg, Pre-miR-30c or Pre-miR-421. [score:1]
Influence on luciferase activity of miR-421 and miR-30c binding to the 3′UTR SERPINE1 1704–1760 region. [score:1]
0044532.g003 Figure 3Influence on luciferase activity of miR-421 and miR-30c binding to the 3′UTR SERPINE1 1704–1760 region. [score:1]
B. Psicheck2 vector containing total 3′UTR SERPINE1 sequence with the mutated rs1050955-A allele fused to renilla luciferase was co -transfected with Pre-Neg, Pre-miR-421, Pre-miR-30c or both. [score:1]
SERPINE1 3′UTR is 1841 bp long and miR-30c and miR-421 binding sites are separated by more than 1000 bp (662–668/1722–1729 and 1746–1752 for sequence complementary to seed sequence of miR-30c or miR-421 respectively). [score:1]
It is noteworthy that the miR-30c and miR-421 plasma variability tended to be higher in patients with high PAI-1 levels than in patients with extremely low levels of PAI-1. 10.1371/journal. [score:1]
Plasma levels of miR-421 and miR-30c in plasma samples of venous thrombosis patients. [score:1]
Conversely, unlike miR-421, plasma levels of miR-30c were not associated with PAI-1 in our sample of venous thrombosis patients despite a trend for such association. [score:1]
0044532.g005 Figure 5 MiR-421 and miR-30c were detected by qRT-PCR in plasma samples from two groups of 20 patients either with low (1.6+/−1 ui/ml) or high (40.5+/−13 ui/ml) PAI-1 plasma levels. [score:1]
0044532.g004 Figure 4Influence of miR-421 and miR-30c binding to total 3′UTR SERPINE1 on luciferase activity. [score:1]
[1 to 20 of 35 sentences]
14
[+] score: 91
Recent studies showed that miR-30a regulated growth of breast cancer cells [26], down-regulation of miR-30 maintained self-renewal and inhibited apoptosis in breast tumor-initiating cells [27], miR-30 regulated B-Myb expression during cellular senescence [28]. [score:10]
As miRNAs are a group of post-transcriptional gene regulators which potentially play a critical role in tumorigenesis by regulating the expression of their target genes, the target genes of miR-30 that functioned in NSCLC pathogenesis was further analyzed. [score:9]
Our results showed that Rab18 mRNA expression was not affected by miR-30b and miR-30c (Figure  1C), while the level of Rab18 protein was consistently and substantially down-regulated by miR-30b and miR-30c (Figure  1D). [score:6]
Increasing evidences indicate that miR-30 expression is down-regulated in numerous human cancers including non-small cell lung cancer (NSCLC) which hypothesizes that miR-30 may play an important role in tumorigenesis. [score:6]
As the down-regulation of miR-30 is related to a number of cancers, it has been hypothesized that miR-30 may play an important role in tumorigenesis and tumor development. [score:5]
Compared with the negative control, treatment of cells with miR-30b or miR-30c led to a decrease in NSCLC cell growth at 72 h, and the inhibitory efficiencies in A549 cells were 25.1% (P < 0.05) and 35.7% (P < 0.05), respectively, and the inhibitory efficiencies in H23 cells were 37.2% (P < 0.05) and 43.6% (P < 0.01), respectively. [score:4]
miR-30 is significantly down-regulated in several cancers, including breast cancer [17], malignant peripheral nerve sheath tumors [18], glioma [19], and lung cancer [20]. [score:4]
Human miR-30 is down-regulated in several tumor types including NSCLC [20]. [score:4]
s were conducted to explore the impact of miR-30 overexpression on the proliferation of human NSCLC cells. [score:3]
The effect of miR-30 on endogenous levels of this target were subsequently confirmed via (WB). [score:3]
Luciferase reporter assays were employed to validate regulation of a putative target of miR-30. [score:3]
HEK293 cells were cotransfected with miR-30b or miR-30c mimics and negative control oligonucleotides, pRL-TK and firefly luciferase reporter plasmid containing putative miR-30b/c targeting sequences of Rab18. [score:3]
This suggests miR-30 is a potential tumor suppressor. [score:3]
qRT-PCR results determined that transfection of miR-30b or miR-30c increased their expressions in A549 (Figure  3A) and H23 (Figure  3B) cells. [score:3]
The CLASH data showed that both miR-30b and miR-30c targeted in coding DNA sequence of Rab18 which was associated with proliferation in hepatocellular carcinoma [23]. [score:3]
We found that miR-30b and miR-30c were down-regulated in these five pairs of clinical NSCLC tissues compared with their adjacent non-tomor tissues (Figure  2B). [score:3]
Both miR-30b and miR-30c (miR-30b/c) were found having target site in same region of Rab18 mRNA. [score:3]
Our results showed that the reporter plasmid with wild-type targeting sequence of Rab18 mRNA caused a significant decrease in luciferase activity in cells transfected with miR-30b and miR-30c, whereas reporter plasmid with mutant sequence of Rab18 produced no change in luciferase activity (Figure  1A,B). [score:3]
Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed to determine the expression level of miR-30 in NSCLC specimens and adjacent non-tumor tissues. [score:3]
miR-30b miR-30c Proliferation Rab18 NSCLC Lung cancer is the most common cause of cancer -associated deaths worldwide, especially for male [1]. [score:1]
Our results showed that cellular proliferation gradually declined following transfection with miR-30b or miR-30c in A549 (Figure  3C) and H23 (Figure  3D) cells. [score:1]
A549 and H23 cells were transfected with miR-30b or miR-30c, and Rab18 protein levels and mRNA levels were examined by WB and qRT-PCR, respectively. [score:1]
A549 and H23 cells were cotransfected with miR-30b or miR-30c mimics and negative control oligonucleotides. [score:1]
In this study, we focused on miR-30 which was decreased in several tumor types including NSCLC. [score:1]
Human miR-30 family including miR-30a, miR-30b, miR-30c, miR-30d and miR-30e have the samilar sequence. [score:1]
However, the function of miR-30 especially in NSCLC remains unclear. [score:1]
Sequence of human miR-30b mimics was 5′- UGU AAA CAUC CUA CAC UCA GCU -3′ and human miR-30c mimics was 5′- UGU AAA CAU CCU ACA CUC UCA GC -3′. [score:1]
However, the role of miR-30 in cancers especially in NSCLC is not very much known. [score:1]
The aim of this study was to investigate the target gene of miR-30 and its roles in tumor growth of NSCLC. [score:1]
[1 to 20 of 29 sentences]
15
[+] score: 91
For example, downregulation of expression of miR-30c has been associated with shorter progression-free survival in clear cell renal carcinoma [40] and breast cancer [41], but better survival in malignant mesothelioma [42], and low plasma level of miR-30e-3p was associated with shorter disease-free survival in non-small cell lung cancer [43]. [score:8]
org) we identified nine miRNAs that regulate these three genes: miR-368 targeting MINT31, miR-181d, miR-30a-3p, miR-30c, miR-30d, miR-30e-3p, miR-370, miR-493-5p and miR-532-5p targeting CDH13, and miR-181d targeting RASSF1. [score:8]
Wyman et al. showed that miR-30c, miR-30d and miR-30e were upregulated, while miR-493 was downregulated in ovarian carcinomas when compared to normal, and expression of miR-30a was specific to the clear cell histological type [19]. [score:8]
Expression of four miRNAs (miR-30c, 30d, 30e-3p, and 370) was significantly different between benign neoplasms and ovarian carcinoma: expression of miR-30c (P = 0.02), miR-30d (P = 0.001) and miR-30e-3p (P <0.0001) was higher while expression of miR-370 (P = 0.05) was lower in ovarian carcinomas. [score:7]
Expression of miR-30c, miR-30d, miR-30e-3p and miR-532-5p was significantly downregulated among Her2/neu -positive ovarian carcinomas. [score:6]
Expression of miR-30c (P = 0.01), miR-30d (P = 0.002), miR-30e-3p (P = 0.008) and miR-532-5p (P = 0.002) were significantly downregulated in Her2/neu -positive ovarian carcinomas (Figure 3). [score:6]
Finally, lower expression of miR-30c, miR-30d, miR-30e-3p and miR-532-5p was significantly associated with overexpression of Her-2/neu. [score:5]
Lastly, expression of miR-30c (P = 0.04) and miR-30d (P = 0.04) were significantly higher in serous carcinomas than in mucinous samples, and expression of miR-30e-3p (P = 0.04) was significantly higher in clear cell than in endometrioid carcinomas. [score:5]
In addition, expression of miR-30c and miR-30e-3p was significantly different between cell lines and normal ovaries, and expression of miR-30c was significantly different between normal ovaries and benign tumors. [score:5]
In multivariate analyses, higher expression of miR-181d, miR-30c, miR-30d, and miR-30e-3p was associated with significantly better disease-free or overall survival. [score:5]
Interestingly, expression of miR-30c, 30d, 30e-3p and 532-5p were significantly higher in Her-2/neu -negative than in Her-2/neu -positive ovarian carcinoma. [score:3]
Expression of miR-30c, 30d and 30e-3p has also been associated with survival in other types of cancer. [score:3]
In addition, miR-181d, miR-30c and miR-30e-3p were also significantly associated with disease-free survival in the multivariate analysis. [score:3]
Among ovarian carcinomas, expression of four miRNAs (miR-30a-3p, miR-30c, miR-30d, miR-30e-3p) was lowest in mucinous and highest in clear cell samples. [score:3]
Expression of four miRNAs (miR-30c, miR-30d, miR-30e-3p, miR-370) was significantly different between carcinomas and benign ovarian tissues as well as between carcinoma and borderline tissues. [score:3]
Scatter plots of expression of miR-30a-3p, miR-30c, miR-30d and miR-30e-3p indicated significant differences among different histological types. [score:3]
Several studies reported association of expression of miR-30c and 370 with response to chemotherapy in ovarian carcinoma [21, 24]. [score:3]
We identified that several miRNAs (miR-30a-3p, miR-30c, miR-30d, and miR-30e-3p) differently expressed in ovarian carcinoma with different histological types and this finding is pertinent to the fact that different histological types are biologically and pathogenetically distinct entities [16]. [score:3]
We identified that expression of four miRNAs (miR-30c, 30d, 30e-3p, and 370) was significantly different between ovarian carcinoma and benign tumor. [score:3]
In a univariate mo del investigating disease-free survival, there was a moderate decreased risk of recurrence for miR-181d (P = 0.25), miR-30c (P = 0.14), miR-30d (P = 0.07), and miR-30e-3p (P = 0.11). [score:1]
[1 to 20 of 20 sentences]
16
[+] score: 81
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-30b, hsa-mir-30e
In the process of generating stable EGFP knockdown cell lines in human Jurkat T cells by using an anti-EGFP shRNA expressed from CMV -driven miR30-backbone expression vectors (shRNA-miRs, see Figure 1A for design of the constructs), we noted a much reduced target knockdown (52.7%) as compared to identical shRNAs expressed from the mouse polymerase III U6 promoter (90.2%, see Figure 1B, top panels). [score:10]
Since this processing could be impacted by the number of mRNA copies present in the cell, we thus chose to correlate the relative mCherry expression with viruses not expressing the miR-30 cassette to the percentage of target knockdown in cells expressing the shRNAs. [score:10]
B) EGFP -expressing Jurkat T cells (top panels) or 293T cells (lower panels) were infected at an MOI of <0.2 with anti-EGFP shRNAs expressed from a mouse U6 promoter (U6 anti-EGFP shRNA) or from a miR-30 backbone expressed from a CMV promoter (miR-context anti-EGFP shRNA) or the relevant control viruses that lack shRNA inserts. [score:7]
EGFP -expressing human immune cell types (Raji B cells, Jurkat T cells, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs expressed from a miR-30 backbone driven by various indicated polymerase-II promoter. [score:5]
EGFP -expressing human immune cell types (Raji B, Jurkat T, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs (left panels) expressed from a miR-30 backbone driven by various polymerase-II promoters. [score:5]
2±2.4 72.2±2.4 60.2±0.4 56.7±4.9 76.7±0.7EGFP -expressing human cell lines (see top row) were infected at an MOI of <0.2 with anti-EGFP shRNAs expressed from a miR-30 backbone driven by various indicated polymerase-II promoters (left column). [score:5]
0026213.g003 Figure 3 EGFP -expressing human immune cell types (Raji B cells, Jurkat T cells, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs expressed from a miR-30 backbone driven by various indicated polymerase-II promoter. [score:5]
0026213.g006 Figure 6EGFP -expressing human immune cell types (Raji B, Jurkat T, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs (left panels) expressed from a miR-30 backbone driven by various polymerase-II promoters. [score:5]
EGFP -expressing human immune cell types (Raji B, Jurkat T, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs (left panels) expressed from a miR-30 backbone driven by various polymerase-II promoter. [score:5]
0026213.g005 Figure 5EGFP -expressing human immune cell types (Raji B, Jurkat T, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs (left panels) expressed from a miR-30 backbone driven by various polymerase-II promoter. [score:5]
We set out to explore the nature of this discrepancy, and assessed whether the potency of the polymerase II promoter used to express the miR30-backbone anti-EGFP shRNAs could impact the shRNA-directed silencing in Jurkat T cells. [score:4]
Monitoring EGFP knockdown by shRNAs expressed from miR-30 backbone vectors. [score:4]
For all lines, there was a clear correlation between promoter strength (as determined by mCherry expression) and EGFP-knockdown by the miR30-backbone anti-EGFP shRNA, suggesting that the strength of the promoter is a major determinant for shRNA-miR potency. [score:4]
B) mCherry expression is reduced upon cloning of an shRNA-containing miR-30 cassette in the 3′UTR of the fluorescent protein. [score:3]
As additional controls, cells were infected with the same viruses lacking a miR-30-anti-EGFP unit. [score:1]
Various mammalian and viral polymerase II promoters (CMV, PGK, UbiC, CAGGS, EF1A) were cloned upstream of mCherry in the miR30-anti-EGFP vectors and control (mCherry alone) vectors. [score:1]
To this end, we cloned five different polymerase II promoters upstream the miR-30 anti-EGFP shRNA cassette that is located in the 3′UTR of the fluorescent protein mCherry to mark cells that have been infected with the lentiviral construct. [score:1]
A similar anti-EGFP shRNA sequence with the miR30 loop (bold) was cloned between miR30 pricursor arms (underlined and italic) downstream of mCherry in the same vector (AAGAAGGTATATTGCTGTTGACAGTGAGCG TCAAGCTGACCCTGAAGTTCAT TAGTGAAGCCACAGATGTAATGAACTTCAGGGTCAGCTTGC TGCCTACTGCCTCGGACTTCAAGGGG ), the U6 promoter unit was removed. [score:1]
[1 to 20 of 18 sentences]
17
[+] score: 78
To do this, we injected the neurone -targeted gene knock-down system (LV-mCMV/SYN-tTA + LV-Tretight-GFP-miR30-shRNA/Luc) with LVV to express Luc in astrocytes (LV-GfaABC [1]D-Luc) and, conversely, the astrocyte -targeted knock-down system (LV-mCMV/GfaABC [1]D-tTA+ LV-Tretight-GFP-miR30-shRNA/Luc) together with LVV for neuronal Luc expression (LV-SYN-Luc). [score:11]
LTR, lentiviral long terminal repeats; Tretight, a modified tetracycline and Dox-responsive promoter derived from pTRE-tight (Clontech); GFP, green fluorescence protein; miR30-shRNA/Luc, miR30 -based shRNA targeting firefly Luc gene; miR30-shRNA/nNOS, miR30 -based shRNA targeting rat neuronal nitric oxide synthase gene; Luc, firefly Luc gene; GfaABC [1]D, a compact glial fibrillary acidic protein promoter (690 bp); SYN, human synapsin 1 promoter (470 bp); mCMV, minimal CMV core promoter (65 bp); GAL4BDp65, a chimeric transactivator consisting of a part of the transactivation domain of the murine NF-κBp65 protein fused to the DNA binding domain of GAL4 protein from yeast; WPRE, woodchuck hepatitis post-transcriptional regulatory element. [score:6]
To this end, we constructed a binary Dox-controllable and cell-specific miR30 -based RNAi system to express shRNAs targeting a reporter gene for Luc and an endogenous gene for nNOS. [score:5]
a: LV-mCMV/GfaABC [1]D-tTA controlled miR30-shRNA/Luc didn't knockdown Luc expression in neurones. [score:4]
b: LV-mCMV/SYN-tTA controlled miR30-shRNA/Luc didn't knockdown Luc expression in glia. [score:4]
These results demonstrate that bidirectional transcriptionally amplified SYN and GfaABC [1]D promoters provide a sufficient level of tTA to activate the Tretight promoter which then drives the synthesis of GFP-miR30-shRNA/Luc transcript to induce substantial Luc knock-down. [score:3]
tTA binds to Tretight promoter in LV-Tretight-GFP-miR30-shRNA/Luc and activates the expression of shRNA/Luc. [score:3]
In these constructs gene targeting sequences were embedded in the precursor miRNA context derived from miR30, one of the most well-studied miRNA in mammals. [score:3]
Abbreviation Vector combination Function LVVs-miRLuc-neuroneLV-SYN-Luc+ LV-Tretight-GFP-miR30-shRNA/Luc+ LV-mCMV/SYN-tTA Neurone-specific Luc knock-down system. [score:2]
LVVs-miRnNOS-neuroneLV-Tretight-GFP-miR30-shRNA/nNOS+ LV-mCMV/SYN-tTA Neurone-specific nNOS knock-down system. [score:2]
LVVs-miRLuc-control2LV-GfaABC [1]D-Luc+ LV-Tretight-GFP-miR30-shRNA/Luc + LV-GfaABC1D-WPRE Control combination used in Luc knock-down experiments for the astrocyte-specific system. [score:2]
LVVs-miRnNOS -negative control1LV-Tretight-GFP-miR30-shRNA/Luc+ LV-mCMV/SYN-tTA Negative control combination used in nNOS knock-down experiments for the neurone-specific system. [score:2]
Again, the anti-Luc construct LV-Tretight-GFP-miR30-shRNA/Luc (treatments 4 in Figure 4c and Figure 4d) did not trigger nNOS knock-down. [score:2]
LVVs-miRnNOS-control2LV-Tretight-GFP-miR30-shRNA/nNOS + LV-GfaABC [1]D-WPRE Control combination used in nNOS knockdown experiments for the astrocyte-specific system. [score:2]
LVVs-miRLuc-gliaLV-GfaABC [1]D-Luc+LV-Tretight-GFP-miR30-shRNA/Luc+LV-mCMV/GfaABC1D-tTA Astrocyte-specific Luc knock-down system. [score:2]
LVVs-miRnNOS-control1 LV-Tretight-GFP-miR30-shRNA/nNOS + LV-SYN-WPRE Control combination used in nNOS knockdown experiments for the neurone-specific system. [score:2]
LVVs-miRnNOS-glia LV-Tretight-GFP-miR30-shRNA/nNOS + LV-mCMV/GfaABC1D-tTA Astrocyte-specific Luc knock-down system. [score:2]
Lentiviral systems developed in the course of this study enable tight Dox-controllable and cell-specific miR30 -based RNAi gene knock-down. [score:2]
LVVs-miRLuc-control1LV-SYN-Luc+ LV-Tretight-GFP-miR30-shRNA/Luc+ LV-SYN-WPRE Control combination used in Luc knock-down experiments for the neurone-specific system. [score:2]
LVVs-miRnNOS -negative control2LV-Tretight-GFP-miR30-shRNA/Luc+ LV-mCMV/GfaABC1D-tTA Negative control combination used in nNOS knock-down experiments for the astrocyte-specific system. [score:2]
It is important to note that anti-Luc construct, LV-Tretight-GFP-miR30-shRNA/Luc (treatment 4 in Figure 4a and Figure 4b), was without effect in either cell line, indicating that the nNOS knock-down was sequence-specific. [score:2]
Figure 3Analyses of the efficacy of miR30-shRNA/Luc in vivo in adult rat brain. [score:1]
First, the effect of miR30-shRNA/Luc was assessed in cell lines. [score:1]
To examine whether the different RNAi efficiency in DVC and HIP is caused by different processing of RNAi, we performed northern blotting analysis to assess the ratio between mature -RNAi and precursor-miR30 -RNAi in these two regions. [score:1]
Analysis of the effects of miR30-shRNA/Luc in vivo. [score:1]
We first confirmed the efficacy of the anti-nNOS construct, LV-Tretight-GFP-miR30-shRNA/nNOS in PC12 and 1321N1 cells. [score:1]
Figure 4Western-blot analyses of the functions of miR30-shRNA/nNOS both in vitro (a, b) and in vivo (c, d). [score:1]
A: LVVs-miRLuc-control1; B: LV-SYN-Luc + LV-Tretight-GFP-miR30-shRNA/Luc + LV-mCMV/GfaABC [1]D-tTA. [score:1]
To construct the LV-Tretight-GFP-miR30-shRNA/nNOS shuttle vector, we replaced the Luc shRNA sequence in the LV-Tretight-GFP-miR30-shRNA/Luc shuttle vector with the nNOS shRNA. [score:1]
Figure 2Analyses of the functions of miR30-shRNA/Luc in vitro. [score:1]
A': LVVs-miRLuc-control2; B': LV-GfaABC [1]D-Luc + LV-Tretight-GFP-miR30-shRNA/Luc + LV-mCMV/SYN-tTA. [score:1]
To generate the LV-Tretight-GFP-miR30-shRNA/Luc shuttle vector, we excised the Tretight fragment containing the modified Tet-responsive promoter from pTRE-Tight-DsRed2 (Clontech) and inserted it into the pTYF-SW Linker and cloned, into the obtained vector, PCR product of GFP-miR30-shRNA/Luc cassette from pPRIME-CMV-GFP-FF3 (kindly provided by F. Stegmeier, Harvard Medical School) downstream of Tretight promoter. [score:1]
Our constructs, following the design of Stegmeir et al. used flanking and loop sequences from an endogenous miR30 [37]. [score:1]
Analyses of the functions of miR30-shRNA/Luc in vitro. [score:1]
[1 to 20 of 34 sentences]
18
[+] score: 70
Here, we demonstrated that a sublethal dose of H [2]O [2] (200 µM) up-regulated the expression of miR-30b, a member of the miR-30 family, which inhibited the expression of endogenous catalase both at the transcript and protein levels. [score:10]
Using TargetScan and miRanda algorithms, the human catalase was predicted to be the putative target of miR-30. [score:5]
To determine the potential role of miR-30 in H [2]O [2] -mediated cellular effects on antioxidative defense system in ARPE-19 cells, we selected a H [2]O [2] -upregulated miRNA, miR-30b. [score:4]
Our in silico analyses demonstrated that miR-30c and miR-30e are localized in the intron of nuclear transcription factor Y, gamma (NF-YC) on chromosome 1. miR-30a derived from the intronic sequence of ‘chromosome 6 ORF155’, a putative transcription factor, is located on chromosome 6. miR-30b and miR-30d are possibly clustered and expressed under the control of the promoter of ZFAT (zinc finger and AT hook domain containing) gene located on the chromosome 8. The sensitivity of miR-30b/miR-30d to H [2]O [2], as demonstrated in our experiment, is possibly mediated through the transcriptional regulation of the promoter of ZFAT gene. [score:4]
The bioinformatic analysis for the target site of miR-30 in catalase 3′-UTR is shown in Figure 1. [score:3]
The 8 bp seed sequences of miR-30 and the putative target site in catalase 3′-UTR in both the panels are highlighted in bold. [score:3]
In summary, all five members of the miR-30 family are expressed in human RPE cells of which miR-30b and miR-30d are found to be sensitive to H [2]O [2]. [score:3]
The transcriptional regulation of the members of miR-30 family seems to be different from each other, since they are regulated by different promoters of their respective genes. [score:3]
0042542.g001 Figure 1Panel A: Complimentarity between the members of miR-30 family and the putative human catalase 3′-UTR site targeted (318–324 bp downstream from the human catalase stop codon). [score:3]
The H [2]O [2] treatment in our experiment did not influence the expression of the other three members (miR-30a, miR-30c, and miR-30e) of miR-30 family. [score:3]
As shown in Figure 1, all five members of the miR-30 family (miR-30a through miR-30e) have one 8 bp conserved target site in catalase 3′-UTR. [score:3]
miR-30 targeting human catalase is sensitive to H [2]O [2]. [score:3]
The expression levels of miR-30 family members were determined by qRT-PCR using snRNA U5 as an internal control. [score:3]
Panel A: Complimentarity between the members of miR-30 family and the putative human catalase 3′-UTR site targeted (318–324 bp downstream from the human catalase stop codon). [score:3]
Moreover, absence of G∶U wobble pairing in the seed sequence and the substantial 3′ pairing of miR-30 with the catalase 3′-UTR strongly led us to believe that the catalase 3′-UTR could be a target of miR-30. [score:3]
Response of miR-30b to H [2]O [2] In order to investigate whether the expression of miR-30 family members was influenced by H [2]O [2], ARPE-19 cells were treated with vehicle or 200 µM H [2]O [2] for 18 h. The expression level of miR-30b as determined by qRT-PCR was found to be sensitive to H [2]O [2] (p = 0.004) when compared with the control. [score:2]
The expression of other members of miR-30 family (miR-30a, miR-30c, and miR-30e) was not observed to be altered by H [2]O [2] treatment, as compared to the control (Figure 4 ). [score:2]
The plasmid containing mutant catalase 3′-UTR (pmirGLO-Cat-3′-UTR-mut) was generated using QuikChange Site-Directed Mutagenesis Kit (Stratagene, Santa Clara, CA) by changing the core of the three miR-30 binding sites from 5′-TGTTTAC-3′ to 5′-T CT AT GC-3′. [score:2]
In order to investigate whether the expression of miR-30 family members was influenced by H [2]O [2], ARPE-19 cells were treated with vehicle or 200 µM H [2]O [2] for 18 h. The expression level of miR-30b as determined by qRT-PCR was found to be sensitive to H [2]O [2] (p = 0.004) when compared with the control. [score:2]
The molecular mechanism of ROS -mediated gene regulation of the miR-30 family members has not been demonstrated yet. [score:2]
The miR-30 family is comprised of five distinct mature miRNA sequences, which are organized into three clusters: miR-30a/miR-30c-2, miR-30d/miR-30b, and miR-30e/miR-30c-1 [39]. [score:1]
The human catalase 3′-UTR contains one putative miRNA binding site for the members of miR-30 family. [score:1]
Although the mature miRNA sequences of all the members of miR-30 family share a common 8-mer conserved seed sequence, the flanking sequences between the members are substantially different from each other (Figure 1A ). [score:1]
In silico analysis of these databases demonstrated that the human catalase 3′-UTR harbors a single binding site for the members of miR-30 family. [score:1]
[1 to 20 of 24 sentences]
19
[+] score: 70
Seven miRNAs (miR-30b, miR-30c, miR-130a, miR-192, miR-301, miR-324-5p, and miR-565) were down-regulated in HCV-infected Huh7.5 cells (p<0.05) and subsequently up-regulated following interferon-α treatment (p<0.01). [score:7]
Interestingly, 7 of the 12 miRNAs that were up-regulated in the presence of IFN-α (miR-30b,miR-30c, miR-130a, miR-192, miR-301, miR-324-5p and miR-565) were also down-regulated in HCV -infected Huh7.5 cells. [score:7]
MiR-324-5p (FC = 6.26, p = 0.003) and miR-489 (FC = 9.34, p = 0.006) exhibited the greatest degree of up-regulation in the presence of IFN-α while miR-30c and miR-130a demonstrated the greatest difference in expression between HCV-infected Huh7.5 cells treated with or without IFN-α (Fig. 3C). [score:6]
Inhibition of miR-30c expression significantly enhanced HCV replication (951.5 HCV RNA copies, p value = 0.029) while miR-130a inhibition decreased HCV RNA compared to the HCV infected Huh7.5 control (352 mean HCV RNA copies, p value = 0.018). [score:6]
Our data suggest that the miR-30(a–d) cluster and miR130a/301are significantly associated with gene targets found in pathways that involve HCV entry and replication, and thus, may play a role in the pathogenesis of chronic liver disease. [score:5]
Several miR-30 targets including the Suppressor of cytokine signaling 1 and 3 (SOCS1, SOCS3) genes contained conserved 8 mer sites that matched the seed region of miR-30c (Table 2). [score:5]
The GOMir tool JTarget, using five major miRNA-mRNA prediction databases, identified a list of mRNA targets for miR-30, miR-130a, miR-192, miR-301 and miR-324-5p [21]. [score:5]
We hypothesize that the down regulation of miR-30 in HCV-infected Huh7.5 cells may alter the expression of genes involved in the ubiquitin and actin cytoskeleton pathways that create a permissive environment for viral replication and this “proviral effect” is diminished with the addition of IFN-α. [score:4]
Bioinformatic analysis predicted that mRNAs of gene targets associated with the miR-30 cluster were concentrated in 2 major pathways – ubiquitin mediated proteolysis and regulation of actin cytoskeleton (Fig. S2, Fig. S3). [score:4]
Figure S3 MiR-30(a–d) -associated gene targets in the Regulation of Actin Cytoskeleton pathway. [score:3]
Location of putative miR-30c binding sites in the 3′ UTR of target mRNAs. [score:3]
Loss of function experiments using anti-miRs revealed that inhibition of miR-30c increased HCV RNA levels in vitro. [score:3]
The miR-30(a-d) cluster and miR-130a/301 and their putative mRNA targets were predicted to be associated with cellular pathways that involve Hepatitis C virus entry, propagation and host response to viral infection. [score:3]
The DAVID Pathway analysis tool applied to the same data sets revealed targeted bio-pathways for the miR-30 cluster (miR-30a, miR-30b, miR-30c and miR-30d) and miR-130a/301 cluster (Table 1). [score:3]
Figure S2 MiR-30(a–d) -associated gene targets in the Ubiquitin-Mediated Proteolysis pathway. [score:2]
Anti-miRs specific for 5 miRNAs down regulated upon HCV infection (miR-30b, miR-30c, miR-130a, miR-192, and miR-324-5p) were tested against a mock -transfected HCV [+] Huh7.5 cell control (Fig. 2). [score:2]
A Mann-Whitney test of multiple comparisons confirmed a significant increase in HCV RNA for Ant-miR-30c and significant decrease in HCV RNA for miR-130a. [score:1]
Two pathways, ubiquitin -mediated proteolysis and regulation of actin cytoskeleton, were predicted for MiR-30 at a p-value of 3.2×10 [−3] and 6.33×10 [−3] respectively. [score:1]
[1 to 20 of 18 sentences]
20
[+] score: 59
To calculate the expression of the target gene miR-30* relative to each of the EC candidates, the ΔΔCt method was used, with ΔΔCt = (Ct target gene, test sample-Ct endogenous control gene, test sample)-(Ct target gene, calibrator sample-Ct endogenous control gene, calibrator sample). [score:7]
For example, in the BEN and BM breast tissues, the expression of miR-30* could be made to appear up- or down-regulated relative to normal breast tissue depending on the EC gene used (Fig. 2A). [score:6]
Downregulation of miR-30* has previously been shown to increase transcription of mRNAs involved in processes such as angiogenesis (thrombospondin I, cysteine-rich, angiogenic inducer) and cell cycle transition (cyclin -dependent kinase 6) [38]. [score:4]
MiR-30* expression was significantly different between the tissue subgroups (P < 0.05) except when using miR-26b as a single EC. [score:3]
Significant differences in miR-30* expression were detected between tissue groups using either the one EC (P = 0.007) or the two EC (P = 0.01) approach, however the BM and MF tissue groups were found to be significantly different using the EC pair, let-7a and miR-16 but this was not detected when let-7a was used as the sole EC gene. [score:3]
Effect of EC on Relative Quantity of miR-30*To assess the effect of EC on relative quantitation of the target gene, miR-30*, this miRNA was normalised using each of the candidate EC genes in turn. [score:3]
miR-30* was differentially expressed between groups using either the top 2 or the top 5 most stable ECs (p < 0.05). [score:3]
To assess the effect of EC on relative quantitation of the target gene, miR-30*, this miRNA was normalised using each of the candidate EC genes in turn. [score:3]
Conversely, the 5 gene approach identified a significant difference in miR-30* expression between the MF and VBM tissues, not detected when using the most stable pair. [score:3]
Significant differences in miR-30* expression were detected between the tissue groups using either the top two ECs (P = 0.01) or the top five ECs (P = 0.002, Fig. 2B). [score:3]
The differences in miR-30* expression detected between the tissue groups varied greatly depending on which single EC was used for normalisation. [score:3]
MiR-30*, previously referred to as miR-30a-3p, targets RNA involved in several cancer-related biological processes [38] and was chosen as a target gene to investigate the effect of EC gene selection on relative quantitation. [score:3]
Significant differences in miR-30* expression were detected between the tissue groups using either the top two ECs (P = 0.01) or the top five ECs (P = 0.002, Fig. 2B), however the post-hoc analyses varied slightly in that the two gene normalisation detected a difference between the BEN and MF tissue groups not detected by the five EC gene approach. [score:3]
Thus the effect of using either let-7a as a single gene or using the recommended EC pair, let-7a and miR-16, on miR-30* expression was assessed. [score:3]
Only normalisation with RNU48 detected a significant difference in miR-30* expression between the MF and VBM tissue groups. [score:3]
Depending on the normaliser, miR-30* expression was either significantly different between tissue groups (P < 0.05) or no differences were detected. [score:3]
Figure 3Boxplot of miR-30* relative quantities in benign (BEN, clear), bone metastases (BM, dark), metastases free (MF, dashed) and visceral and bone metastases (VBM, shaded) tissues using different normalisation strategies. [score:1]
MiR-30* was normalised using the top two EC genes and using the top five EC genes to assess what effect this would have on miR-30* relative quantification. [score:1]
Effect of EC on Relative Quantity of miR-30*. [score:1]
[1 to 20 of 19 sentences]
21
[+] score: 57
Mutation of the ARE-motif further downregulated reporter expression, whereas the double mutation of miR-30 binding sites abolished the downregulatory effect of the calretinin 3′UTR. [score:11]
Utilizing several prediction algorithms, miR-30 family members were identified as potential candidates targeting calretinin mRNA; overexpression or inhibition experiments revealed that only miR-30e-5p is able to modulate calretinin protein levels through the calretinin 3′UTR. [score:7]
FIGURE 4Members of miR-30 family are abundantly expressed in mesothelioma cell lines and miR-30e-5p regulates calretinin expression. [score:6]
The observation that the double miR-30 mutant construct (pmiRGLO-CALB2-3′UTR-mir30-dmt) abolished the downregulatory effect mediated by CALB2-3′UTR, led us to identify the critical miR-30 member conveying this effect. [score:4]
In contrast, mutation of both miR-30 binding sites restored the expression of the luciferase reporter to the level of the empty vector. [score:4]
This downregulatory effect is possibly conveyed through the second miR-30 binding site alone. [score:4]
We then generated an additional four constructs harboring mutations of the consensus sequence for the predicted ARE motif and miR-30 binding sites and transiently transfected all variants into ONE58 cells to test for their effects on luciferase expression (Figures 2C,D). [score:4]
Based on the analysis of 1319 differentially expressed genes, Cheng et al. (2016) identified the miR-30 family amongst the top 20 enriched miRNA families in mesothelioma. [score:3]
The AREsite2 software (Fallmann et al., 2016) revealed a putative ARE motif (AUUUA) within the first stretch, and TargetScan7.1 software predicted two binding sites for the miR-30 family and one for miR-9, within the second conserved stretch (Figures 2A,B). [score:3]
Interestingly, unlike the other miR-30 members where the 3p arm was almost absent, both the miR-30e-5p and-3p arms were expressed in ZL55, ONE58, ACC-MESO-4 cells. [score:3]
Four additional luciferase reporter constructs carrying mutations in either ARE and/or miR-30 binding sites were generated and their activity was tested in ONE58 cells. [score:2]
The miR-30 family includes five members, miR-30a through miR-30e and is evolutionary well conserved. [score:1]
Calretinin 3′UTR Harbors a Functional ARE Motif and miR-30 Sites. [score:1]
So far there was no study on the biological function of the miR-30 family or AUBP in mesothelioma. [score:1]
Upon miR-30-5p mimetic treatment (red) no change is observed on calretinin protein levels due to exogenous CALB2-3′UTR that sponges miR-30e-5p. [score:1]
For mimics and anti-miR treatment, following mimics were used: 1 or 5 nM of has-miR-30b-5p (MSY0000420, Qiagen), has-miR-30c-5p (MSY0000244, Qiagen), hsa-miR-9-5p (MSY0000441, Qiagen), hsa-miR-30e-5p (Shanghai GenePharma Co. [score:1]
The QuickChange Site-Directed mutagenesis kit (200518, Agilent technologies) was employed to introduce mutations in the ARE or miR-30 sites with the following primers: pmiRGLO-CALB2-3′UTRmtARE (74425 Addgene), 5′-ctctgttggacatagaagcccagaccatacagcgagggagctcat-3′, 5′-atgagctccctcgctgtatggtctgggcttctatgtccaacagag-3′; pmiRGLO-CALB2-3′UTRmir30mt (74428 Addgene), 5′-cgtgctccttttctctttgggtttcttttatcccaaagaagagtttacagacaat-3′, 5′-attgtctgtaaactcttctttgggataaaagaaacccaaagagaaaaggagcacg-3′; pmiRGLO-CALB2-3′UTRmir30dmt (74429 Addgene), 5′-ttgggtttcttttatcccaaagaagattatccagacaataaaatggaaaggtcctgc-3′, 5′-gcaggacctttccattttattgtctggataatcttctttgggataaaagaaacccaa-3′ and, a combination of primers above to construct pmiRGLO-CALB2-3′UTR-mir30dmt-mtARE (74430 Addgene). [score:1]
[1 to 20 of 17 sentences]
22
[+] score: 56
Another approach to multiple siRNA expression was stimulated by report that a mouse miR30 -based shRNA expression cassette can be driven by Pol II promoters and provide higher knockdown efficiency than those driven by the Pol III U6 promoter [10]. [score:6]
These results suggest that although NP miRNA can be expressed from the mouse miR30 -based cassette in DF-1 cells, the level of target gene knockdown is modest following stable integration of the lentiviral vector. [score:6]
Subsequently, Sun et al showed that a single Pol II promoter can drive three artificial miR30 cassettes to express siRNAs all targeting GFP, resulting in further knockdown of the GFP intensity in the cells [17]. [score:6]
The mouse miR30 -based miRNA expression cassette has been wi dely used to express artificial miRNA in lentiviral vectors [21]. [score:5]
As shown in Figure 1c, transient expression of miR30-NP inhibited Renilla luciferase activity by ∼85%. [score:5]
Inhibition of luciferase activity by NP miRNA expressed from a mouse miR30 -based lentiviral vector. [score:5]
To express anti-influenza artificial miRNA, we replaced the mature miR30 sequences in pLB2 with sequences that target nucleoprotein (NP) of influenza virus (Figure 1b). [score:5]
As a control, Vero cells were transduced with a CPGM lentivirus that expressed miR30 -based miRNA specific for the firefly luciferase transcript. [score:3]
Expression of NP miRNA from the mouse miR30 -based lentiviral vector. [score:3]
Zhou et al reported that two tandem copies of the miR30 -based cassette can be expressed in a single transcript driven by a Pol II promoter [15], [16]. [score:3]
In addition to miR30 -based designs, mouse miR155 -based design has also been used to knockdown multiple genes [19]. [score:2]
In the transient transfection assay, the miR30-NP lentiviral vector and psicheck-2 dual luciferase reporter plasmid, in which the NP target sequence was cloned into the 3′ UTR of the synthetic Renilla luciferase gene, were co -transfected into DF-1 cells. [score:2]
A similar miR30 -based approach was utilized by Zhu et al to knockdown multiple genes [18]. [score:2]
Flanking and hairpin sequences are miR30. [score:1]
0022437.g001 Figure 1(a) Schematic diagram of the miR30-NP lentiviral vector. [score:1]
Psicheck-2 dual luciferase reporter plasmid (50 ng) and miR30-NP lentiviral vector (450 ng) were co -transfected in DF-1 cells. [score:1]
[1 to 20 of 16 sentences]
23
[+] score: 47
Therefore, we speculate that as F. tularensis infection or exposure occurs, the expression of hsa-miR-30c-5p may increase to downregulate caspase-3 expression. [score:8]
It is likely that similar to F. tularensis-exposed hPBMCs, hsa-miR-30c-5p may be upregulated to control caspase-3 expression in B. pseudomallei-exposed hPBMCs. [score:6]
For instance, hsa-miR-1226-3p, hsa-miR-23b-5p, hsa-let-7d-5p, and hsa-miR-30c-5p, which were initially identified as increasing in expression in response to F. tularensis exposure by RNAseq, were also found to increase in expression after exposure to E. coli or B. pseudomallei, although in the case of E. coli and B. pseudomallei exposure, this increase was detected by qPCR and not by RNAseq. [score:5]
Even after this correction for multiple testing, upregulation of hsa-miR-30c-5p in F. tularensis-exposed hPBMCs was statistically significant (Table 3). [score:4]
We present here our findings that hsa-miR-30c-5p is a potential biomarker for infection by the gram -negative pathogens B. pseudomallei and F. tularensis and that programmed cell death-related genes were the largest constituent of genes predicted to be regulated by differentially expressed miRNAs at early time points in F. tularensis infection of hPBMCs. [score:4]
Regardless, one of the 18 DE miRNA species in the RNAseq data from F. tularensis-exposed hPBMCs, namely, hsa-miR-30c-5p, was confirmed to have the same altered expression profile in qPCR data. [score:3]
In addition, this miRNA, hsa-miR-30c-5p, was also found to be differentially expressed in B. pseudomallei-exposed hPBMCs. [score:3]
Among the many miRNA species detected in this study, the one that stands out as having an unambiguously altered expression profile in response to infection is hsa-miR-30c-5p. [score:3]
It is our speculation that hsa-miR-30c-5p may be playing a role as a negative regulator of cell death upon infections by F. tularensis or B. pseudomallei. [score:2]
A recent study has shown that hsa-miR-30c, along with hsa-miR-30b, acted as a negative regulator of cell death induced by loss of attachment (anoikis) [35]. [score:2]
The RNAseq and qPCR results for hsa-miR-30c-5p were found to have a correlation coefficient of r > 0.95, and it also passed multiple testing. [score:1]
The overall disparity in response to the three different organisms between the two donors' cells serves to highlight the potential importance of hsa-miR-30c-5p as a potential biomarker for further study. [score:1]
Of these, three miRNA species hsa-miR-200b-3p (P = 0.0160), hsa-miR-548ai (P = 0.0489), and hsa-miR-30c-5p (P = 0.0274) met the statistical significance threshold (Figure 4(c)). [score:1]
From the RNAseq versus qPCR analysis, the following miRNA species were found to have a correlation coefficient > 0.95 and also met the statistical significance threshold (P < 0.05): in B. pseudomallei, hsa-miR-200b-3p, and in F. tularensis, hsa-miR-200b-3p, hsa-miR-548ai, and hsa-miR-30c-5p. [score:1]
In F. tularensis-exposed hPBMCs, five miRNAs were found to have an r > 0.95, namely, hsa-miR-200b-3p, hsa-miR-548ai, hsa-miR-125b-5p, hsa-let-7d-5p, and hsa-miR-30c-5p. [score:1]
This is interesting because the hPBMCs used in RNAseq and qPCR were from two different individuals, and yet hsa-miR-30c-5p still remained statistically significant. [score:1]
These 4 miRNAs are, in ascending P value order, hsa-miR-1226-3p (P = 0.0113), hsa-miR-23b-5p (P = 0.0136), hsa-let-7d-5p (P = 0.0175), and hsa-miR-30c-5p (P = 0.02408). [score:1]
[1 to 20 of 17 sentences]
24
[+] score: 47
Since the ADAM12-S 3′UTR lacks predicted target sites for these miRNA families and since miR-29, miR-30, or miR-200 levels are highly variable in breast cancer, selective targeting of the ADAM12-L 3′UTR by these miRNAs might explain why ADAM12-L and ADAM12-S expression patterns in breast tumors in vivo and in response to experimental manipulations in vitro often differ significantly. [score:7]
The miR-29, miR-30, and miR-200 families have potential target sites in the ADAM12-L 3′UTR and they may negatively regulate ADAM12-L expression. [score:6]
In this report, we asked whether ADAM12-L expression in breast cancer cells is regulated by members of the miR-200, miR-29, and miR-30 families. [score:4]
The predicted miR-29, miR-30, and two miR-200 target sites in the ADAM12-L 3′UTR reporter plasmid were mutated by site-directed mutagenesis. [score:4]
In this report, we examined whether three miRNA families, miR-29, miR-30, and miR-200, directly target the ADAM12-L 3′UTR in human breast cancer cells. [score:4]
We conclude that the miR-30 family does not contribute significantly to the regulation of ADAM12-L expression in the two cell lines examined here. [score:4]
We focused on the miR-29, miR-30, and miR-200 families, which act as tumor suppressors in breast cancer. [score:3]
Down-regulation of miR-30 family members was observed in non-adherent mammospheres compared to breast cancer cells under adherent conditions [37]. [score:3]
Of particular interest are the miR-200, miR-29, and miR-30 families, which all have been linked to the mesenchymal phenotype, invasion, or metastasis in breast cancer [28, 29], and which all have predicted target sites in the ADAM12-L 3′UTR, but not in the ADAM12-S 3′UTR. [score:3]
Destruction of the potential miR-30 target site by mutagenesis eliminated the effect of miR-30b mimic. [score:3]
Reduction of miR-30 levels was reported to promote self-renewal and to inhibit apoptosis in breast tumor-initiating cells [36]. [score:3]
The miR-30 family appears to modulate the stem-like properties of breast cancer cells as well. [score:1]
Among the three miRNA families tested, miR-30 elicited the least consistent effects. [score:1]
The miR-29 family consists of three members with the same seed sequence, miR-29a-c. The miR-30 family is made up of 5 members, miR-30a-e. The miR-200 family consists of five members: miR-200a-c, miR-141 and miR-429. [score:1]
[1 to 20 of 14 sentences]
25
[+] score: 44
0036157.g003 Figure 3 Activities of two miRNAs, including miR30 (A), miR-N367 (B), were imaged in live HeLa cell cultures that were transfected with the indicator vectors pmiR30:4tar(30), pmiR-N367:4tar(n) and their control vectors with miRNAs or target sequences only, respectively. [score:3]
Activities of two miRNAs, including miR30 (A), miR-N367 (B), were imaged in live HeLa cell cultures that were transfected with the indicator vectors pmiR30:4tar(30), pmiR-N367:4tar(n) and their control vectors with miRNAs or target sequences only, respectively. [score:3]
uk/) as byproducts, miR30 -based precursor stem-loops were used to exclusively express miR423-5p and miR-S1-5p [9] (see Figure S2A, B). [score:3]
The miRNA expression vector pmiR423-5p was constructed by inserting the miR30 precursor stem-loops based artificial pre-miR423-5p sequences into the EcoR V and Not I sites of. [score:3]
0036157.g002 Figure 2. (A) Sequences of miR30, hiv1-miR-N367 and their non-fully complementary targets. [score:3]
The miRNA expression vector pmiR-S1-5p was constructed by inserting the artificial pre-miR-S1-5p sequences that are based on the miR30 precursor stem-loops into the EcoR V and Not I sites of. [score:3]
The construction of is outlined in Figure 1. The miR30 expression vector pmiR30 was constructed by inserting the miR30 precursor (pre-miR30) sequences into the EcoR V and Not I sites of vector. [score:3]
Figure S4 Relative expression level determination of miR30, miR423-5p and miR192 using real-time quantitative PCR method. [score:3]
The construction of is outlined in Figure 1. The miR30 expression vector pmiR30 was constructed by inserting the miR30 precursor (pre-miR30) sequences into the EcoR V and Not I sites of vector. [score:3]
uk/) as a byproduct, the miR30 -based precursor stem-loops were used to exclusively express miR192 [9] (see Figure S2C). [score:3]
The miRNA expression vector pmiR192 was constructed by inserting the miR30 precursor stem-loops based artificial pre-miR192 sequences into the EcoR V and Not I sites of. [score:3]
For the fluorescence reporter assays, the indicator vector pmiR30:4tar(30) was constructed by the stepwise insertion of four tandem copies of miR30 non-fully complementary target sequence (tar(30)) into the 3′-UTR of the mCherry gene in pmiR30 using the Bgl II/Hind III and Hind III/EcoR I restriction sites. [score:2]
The expression of miR30, miR423-5p and miR192 was compared to mock transfected sample using 2 [–ΔΔCT] method. [score:2]
Figure S2 Secondary structure mo dels for artificial pre-miRNA based on stem-loops of miR-30 precursor. [score:1]
The vectors pmiR30 and pmiR-N367 were constructed to produce high levels of the human-encoded miR30 [12] and the HIV-1-encoded miR-N367, respectively. [score:1]
A. Secondary structure mo del for artificial pre-miR-S1-5p based on stem-loops of miR-30 precursor; B. Secondary structure mo del for artificial pre-miR423-5p based on stem-loops of miR-30 precursor; C. Secondary structure mo del for artificial pre-miR192 based on stem-loops of miR-30 precursor. [score:1]
* Artificial pre-miRNAs which were designed being based on stem-loops of miR-30 precursor (ref 9). [score:1]
The pre-miR30 sequences were generated by overlap extension PCR with the following two partially complementary oligonucleotides: 5′-CTCGTGATCTGCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAGATGGGCTTTCAGT-3′ and 5′-ATGTTATCCGCGGCCGCAAAAACTCGTGGATCCGCAGCTGCAAACATCCGACTGAAAGCCCATC-3′. [score:1]
As shown in Figure 2B, Northern blot analysis readily revealed detectable levels of the specific miRNAs in all of the HeLa cultures transfected with constructs producing the pre-miRNA sequences of miR30 and miR-N367. [score:1]
HeLa cells were mock -transfected (mock) or transfected with plasmids pmiR30, pmiR-N367 individually, and the location of the mature miR30 and miR-N367 is indicated. [score:1]
[1 to 20 of 20 sentences]
26
[+] score: 43
To illustrate the impact of miRNA overexpression on the expression of their target genes, we have selected two microRNAs, miR-30 and -128, that were previously shown to be upregulated during myogenic differentiation [26, 27], but their function in myogenesis is not well-established. [score:10]
Similarly, overexpressing miR-30 led to the downregulation of three of its five randomly selected transcriptome-supported targets. [score:8]
Transcriptome-supported target genes of miR-128 and miR-30 were downregulated when human rhabdomyosarcoma cells were transfected with lentiviral constructs overexpressing miR-128 (E) and miR-30 (F). [score:8]
Two remaining miR-30 target genes, PPIA and CASD1 could not be validated via qRT-PCR, as we did not observed significant changes in its expression level following miRNA precursor transfection (data not shown). [score:5]
Instead, our predictions suggest that miR-30 might target genes involved in the regulation of protein phosphorylation and kinase activity, cell cycle control, intracellular transport, cytoskeleton organization, protein ubiquitination, DNA damage response and nucleotide biosynthesis (Figure  5, Additional file 9). [score:4]
These qRT-PCR validated miR-30 targets include PLXNB (plexin B2), C11orf45 (chromosome 11 open reading frame 45) and ATP2B1 (ATPase, Ca++ transporting, plasma membrane 1) (Figures  4D). [score:3]
miR-30 was shown to induce apoptosis [71] and regulate cell motility by influencing extracellular the matrix remo delling process [72- 74]. [score:2]
Human rhabdomyosarcoma cells (RD) were transfected with plasmids coding for miR-128 and miR-30 precursors or scrambled sequence (scr) (B). [score:1]
phrGFP-1 vector was from Stratagen, pcDNA3.2/V5 hsa-mir-128 (#26308) [115] and pCMV-miR30 (#20875) [116] vectors were provided by Addgene. [score:1]
miR-30c. [score:1]
[1 to 20 of 10 sentences]
27
[+] score: 42
The antagomirs designed to inhibit the expression of endogenous miR-30 members and Antagomir Negative Control were obtained from Ribobio. [score:5]
HWJMSC-EVs Deliver and Restore the Expression of miR-30 in Injured Rat Kidney. [score:3]
Mitochondrial Apoptotic Pathways Are Inhibited by EVs-Derived miR-30. [score:3]
Meanwhile, antagomir -treated EVs group revealed lower miR-30 expression as well as the vehicle group (Figure 2(c)). [score:3]
Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) showed that IRI caused lower expression of miR-30b, miR-30c, and miR-30d (miR-30a and miR-30e did not exist in rat kidney) and EVs treatment entirely reversed the reduction (Figure 2(a)). [score:3]
We demonstrated that hWJMSC-EVs may ameliorate acute renal IRI by inhibition of mitochondrial fission via miR-30. [score:3]
We next explored the miR-30 expression of rat kidney during IRI in vivo. [score:3]
Given that miR-30 has been reported to regulate mitochondrial fission through the DRP1 pathway on cardiomyocytes [20], we hypothesized that human Wharton Jelly MSCs (hWJMSCs) derived EVs may be involved in the modulation of mitochondrial fission via miR-30, thereby protecting kidney from IRI. [score:2]
To understand how hWJMSC-EVs exert effects on mitochondrial fission, we test whether EVs-derived miR-30 family plays a crucial role in regulating mitochondrial fission through DRP1. [score:2]
EVs-Derived miR-30 Members Regulate Mitochondrial Fission through DRP1. [score:2]
To further explore the mechanism of miR-30 reversion, we used specific miR-30 antagomir to treat MSCs. [score:1]
As we expected, miR-30 antagomir mitigated this effect, especially in miR-30b/c/d antagomir cotreated group. [score:1]
The miR-30 family is involved in several cellular processes, including cardiomyocytes exposed to oxidative stress or ischemia injury and apoptosis of type II alveolar epithelial cells [20, 32, 33]. [score:1]
Here we have identified a miR-30-related antiapoptotic pathway involving DRP1 and mitochondria, which may be one of the mechanisms by which hWJMSC-EVs alleviate renal ischemia reperfusion injury. [score:1]
The absence of miR-30 in EVs canceled the miR-30 restoration effects in normal EVs treatment group in vitro. [score:1]
Then, we treated hWJMSCs with miR-30 antagomir. [score:1]
We used at least six rats for each group: (1) sham (n = 6); (2) vehicle (n = 6); (3) EVs (n = 6); (4) EVs + antagomir control (n = 6); (5) EVs + antagomir miR-30b (n = 6); (6) EVs + antagomir miR-30c (n = 6); (7) EVs + antagomir miR-30d (n = 6); (8) EVs + antagomir miR-30b/c/d (n = 6). [score:1]
The sequence of miR-30b antagomir is 5′-AGCUGAGUGUAGGAUGUUUACA-3′; miR-30c antagomir is 5′-GCUGAGAGUGUAGGAUGUUUACA-3′; miR-30d antagomir is 5′-CUUCCAGUCGGGGAUGUUUAGA-3′. [score:1]
The levels of miR-30 family members analyzed by qRT-PCR were normalized to that of U6. [score:1]
Taken together, it appears that EVs-derived miR-30 can block the mitochondrial apoptotic pathways. [score:1]
Our research reveals links among EVs, miR-30, and DRP1 in the apoptotic program of the kidney. [score:1]
Our results suggest that modulation of miR-30 from EVs may represent a therapeutic approach to treat apoptosis-related renal ischemia reperfusion injury. [score:1]
The absence of miR-30 in EVs canceled the miR-30 restoration effects in normal EVs treatment group. [score:1]
[1 to 20 of 23 sentences]
28
[+] score: 40
Using 15 down-regulated miRNAs (let-7 g, miR-101, miR-133a, miR-150, miR-15a, miR-16, miR-29b, miR-29c, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b and miR-342), known to be associated with cancer, we found 16.5% and 11.0% of our PLS-predicted miRNA-targets, on average, were also predicted as targets for the corresponding miRNAs by TargetScan5.1 and miRanda, respectively (Table 2). [score:10]
This network (Figure 2B) indicated that two mRNAs (V KORC1 and CSTB; in red) were predicted to be targets of five miR-30 miRNAs, six mRNAs (ANXA2, GPATCH3, OAZ1, PSMB4, SLC7A11, ZNF37A; in turquoise) were targeted by four of the miRNAs, and ten mRNAs (CAPG, C7orf28A, DAP, GPX1, ITPA, MMP11, NEBL, POLR2H, S100A11 and GTF2IRD1; 3 in green and 7 in blue) were targeted by three of the miRNAs (Figure 2B). [score:7]
We found that ten of the down-regulated miRNAs (miR101, miR26a, miR26b, miR30a, miR30b, miR30d, miR30e, miR34b, miR-let7 g and miRN140) were grouped together in a functional network (Figure 3A) and nine of the down-regulated miRNAs (miR-130a, miR-133a, miR-142, miR-150, miR15a, miR-16, miR-29b, miR-30c and miR-99a) were grouped together in a second network (Figure 3B). [score:7]
We developed a network to demonstrate the overlapping miRNA targets for miRNAs in the miR-30 family (a-e) (Figure 2B) since these miRNAs have a large number of mRNA targets. [score:5]
With the aid of IPA pathway designer, we found that 27 of the 31 down-regulated miRNAs were linked to one or more mRNA networks and 20 of them (let-7 g, miR-101, miR-126, miR-133a, miR-142-5p, miR-150, miR-15a, miR-26b, miR-28, miR-29b, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b, miR-99a, mmu-miR-151, mmu-miR-342 and rno-miR-151) were involved in all of the top 4 networks. [score:4]
The number of predicted targets for each member of the miR-30 family (a-e) was 22, 20, 15, 25 and 17, respectively. [score:3]
The number of targets for miR-30 a-e was 22, 20, 15, 25 and 17, respectively (Table 3). [score:3]
B. A sub-network depicting miRNA-mRNA interactions predicted from the miR-30 family. [score:1]
[1 to 20 of 8 sentences]
29
[+] score: 38
However, miR-409-3p, Let-7i and miR-30c already exhibited a significant down-regulation while miR-148b was the only up-regulated miRNA in hippocampus at this age (Fig 3C). [score:7]
The down-regulated miRNAs miR-9, miR-30 and miR-20 were all strongly predicted to affect target genes involved in axonal guidance. [score:6]
In addition, this study showed that miR-30c was down-regulated in hippocampus at an early stage of disease (Braak stages 3 and 4). [score:6]
Interestingly, dihydropyrimidinase-related protein 2, DPYSL2, a highly abundant protein in brain, is targeted by miR-30, 20 and 181 and has been shown to be up-regulated in proteomic studies on APP23 mice already at a very early age [63]. [score:6]
The overlap between human AD and our in vitro and in vivo AD mo dels indicates that amongst the complex pathology in human AD brain, down-regulation of miR-9, miR-181c, miR-30c, miR-20b, miR-148b and Let-7i could be attributed at least in part to the presence of Aβ. [score:4]
In addition, specific members of the miR-30 family (30c and 30b) were also significantly down-regulated in response to Aβ. [score:4]
Axon guidance was among the most significant pathways to be affected by the predicted target genes and was the top prediction for miR-9, miR-30 and miR-20. [score:3]
Individual TaqMan assays (Applied Biosystems) were used to analyse the expression of the following mature mouse miRNAs: miR-181c, miR-9, miR-20b, miR-21, miR-30c, miR-148b, miR-361, miR-409-3p and Let-7i. [score:2]
[1 to 20 of 8 sentences]
30
[+] score: 32
Auxiliary pairing regulates miRNA–target specificity in vivoAs a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:7]
As a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:4]
identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m). [score:4]
We examined miR-30a, miR-30c and miR-125a targets sites predicted to form more stable pairing with a specific paralogue and which were ligated to only that paralogue in at least two experiments. [score:3]
Constructs expressing miR-30a from the miR-30c locus and miR-125b from the miR-125a locus were also made, in an effort to control for processing efficiency. [score:3]
Conversely, more subtle differences in predicted pairing (2.8 kcal mol [−1]) enhanced miR-30c activity at a 6mer site with predicted supplementary 3′-pairing (Fig. 8f). [score:1]
Evaluation of miR-125a (blue), miR-125b (red) and negative control miRNA (black) overexpression on (j) a miR-30 site as a negative control for miR-125 paralogs and (k– m) sites with predicted miR-125a preference. [score:1]
Interestingly, a number of major miRNAs enriched for seedless interactions (for example, miR-9, miR-181, miR-30 and miR-186) have AU-rich seed sites, indicating that weak seed-pairing stability may favour seedless non-canonical interactions 10. [score:1]
Shuffling analysis of miR-30 family members revealed similar specificity, although certain preferences were more significant than others (Fig. 7d). [score:1]
Specifically, miR-30b and miR-30c showed more significant differences from miR-30a, miR-30d and miR-30e than from each other and vice versa. [score:1]
Base pairing profiles from duplex structure maps for let-7 (a) and miR-30 (b) family members are shown. [score:1]
Genomic fragments for miR-125b, miR-30a and miR-30c spanning ∼200 nucleotides upstream and downstream of primary hairpins were synthesized as gBlocks (IDT) and inserted into the SBI vector between EcoRI and BamHI. [score:1]
Evaluation of miR-30a (red), miR-30c (blue) and negative control miRNA (black) overexpression on (b) a full miR-30 8mer site as a positive control for miR-30 paralogues; (c) a miR-125 site as a negative control for miR-30 paralogues; (d, e) sites with predicted miR-30a preference; and (f– i) sites with predicted miR-30c preference. [score:1]
An exception was G–U wobble interactions, which showed strong preferences such as miR-30 position 3 (Supplementary Fig. 3d). [score:1]
An exception was an 8mer mismatch miR-30c site with G–U wobble pairing at miRNA position 3, which showed similar repression by both miR-30a and miR-30c despite extensive predicted 3′-pairing with miR-30c (Fig. 8i). [score:1]
The cel-miR-67 hairpin was cloned into the miR-30c genomic locus. [score:1]
[1 to 20 of 16 sentences]
31
[+] score: 32
In contrast, neither knockdown nor overexpression of miR-30 substantially altered the expression of p66Shc, p52Shc, and p46Shc. [score:6]
As shown in Fig. 1(D), nascent Shc protein synthesis in AS-let-7a -expressing cells was ~3.2- to 4.1-fold higher than what was observed in control cells, while Shc translation in AS-miR-30 -expressing cells was comparable with that measured in control cells. [score:5]
The levels of p66Shc mRNA, which could potentially be used for synthesis of all Shc proteins, were not substantially altered by modulating let-7a or miR-30 abundance (Fig. 1C), suggesting that let-7a does not affect Shc expression at the level of mRNA turnover and instead may affect Shc translation. [score:5]
The effect of let-7a was specific, as inhibition of let7c, let-7d, miR-9, miR-22, and miR-30 did not affect the levels of Shc proteins, while inhibition of let-7b moderately increased the levels of Shc proteins (Fig. S2). [score:5]
To test this hypothesis, IDH4 cells transiently expressing antisense let-7a or antisense miR-30 were incubated in medium containing L-[[35]S] methionine and L-[[35]S] cysteine for 20 min, cell lysates were then prepared and subjected to immunoprecipitation to analyze the level of nascent Shc proteins. [score:3]
In addition, transfection of cells with inhibitor of let-7c, let7d, miR-9, miR-22, or miR-30 did not alter the levels of Shc proteins (Fig. S2B,C). [score:3]
In control reactions, knockdown of let-7a or miR-30 did not influence the levels of nascent GAPDH. [score:2]
Using the cells described in Fig. 3(A,B), the levels of let-7a, miR-30, U6, as well as p66Shc mRNA levels in 2BS and IDH4 cells progressing toward senescence were determined by Northern blot analysis (Fig. 3D) and by conventional RT-PCR analysis (Fig. 3E) respectively. [score:1]
In contrast, the levels of miR-30, U6, and p66Shc mRNA remained unchanged during senescence of 2BS (Fig. 3D) and IDH4 cells (Fig. 3E). [score:1]
As shown in the Fig. S2(A), transfection of IDH4 cells with let-7a siRNA, but not miR-30 siRNA, elevated the levels of Shc proteins. [score:1]
[1 to 20 of 10 sentences]
32
[+] score: 31
Since previous microarray -based analysis had indicated that members of the miR-30 family were downregulated in latency III cells compared to latency I cells or EBV -negative cells, we examined the role of these miRs in RGC-32 translation control. [score:5]
Although we found that miR-30c and miR-30d could direct translational repression via the RGC-32 3′UTR in reporter assays, mutation of the miR-30 binding site in the RGC-32 3′UTR did not relieve repression mediated by the RGC-32 3′UTR. [score:4]
We were also not able to confirm previously published reports (54) of miR-30c or miR-30d downregulation in the latency III cell lines we examined. [score:4]
We therefore conclude that the miR-30 family have the potential to repress RGC-32 expression, but are not the main mediators of RGC-32 3′UTR directed repression in the B cells used in our assays. [score:3]
In contrast, miR-30 with a mutated seed sequence did not repress reporter gene expression. [score:3]
We found that the miR-30 family of miRNAs were predicted to target the 3′UTR of RGC-32. [score:3]
However, when we mutated the miR-30 target sequence in the RGC-32 3′UTR reporter construct, we did not observe any loss of 3′UTR mediated repression in our transient transfection assays (Figure S7C). [score:2]
We were also unable to detect any differences in miR-30c or miR-30d expression between latency I and latency III cells using sensitive Taqman PCR assays, in contrast to the previous microarray -based study (data not shown). [score:2]
Interestingly, a previous microarray analysis detected lower miR-30c and miR-30d expression in latency III cell lines compared to latency I or EBV -negative cells (54). [score:2]
For miRNA experiments, 2 × 10 [4] HeLa cells were plated in a 96-well plate 24 h prior to transfection with 100 ng of psicheck2 RGC32 3′UTR ΔDSE or psicheck2 RGC-32 ORF in combination with 100 nM of miR-30c, miR-30d or a mutant miR-30c (Invitrogen) using Dharmafect Duo transfection reagent (Dharmacon, GE Healthcare). [score:1]
The miR-30 family (miR-30a, b, c, d, e) were the only miRNAs identified by most programmes used (Supplementary Figure S7A). [score:1]
We therefore investigated whether miR30-c and miR30-d were able to repress reporter gene expression via the RGC-32 3′UTR when they were transfected into cells. [score:1]
[1 to 20 of 12 sentences]
33
[+] score: 30
Of those 70 miRNAs up- or down-regulated during adipocyte differentiation, 2 of the most significantly over-expressed (miR-30c and miR-378) and 4 of the most down-regulated (miR-210, miR-221, miR-424 and miR-503) were selected for validation by semi-quantitative Real Time-PCR. [score:9]
Thus, FAS, ACC, FABP4, PPARg, ADIPOQ and RBP4 gene expression levels were significantly and directly correlated with miR-30c and miR-378 but significantly and inversely related with miR-210, miR-221, miR-503 and miR-424 expression levels in RNA samples from cell lines [Figure S2]. [score:6]
On the other side, miR-378 (6.6-fold), miR-30c (5.1-fold), miR-30a (4.0-fold), miR-30b (3.1-fold), miR-30e (3.1-fold), miR-30a* (2.8-fold) and miR-34a (2.5-fold), were up-regulated in mature adipocytes (Figure 2). [score:4]
Also related to pancreas development and regulation, the cluster of miRNAs related to miR-30 (miR-30a, b, c, d and e) increased during adipocyte maturation as well as during differentiation of pancreatic islet-derived mesenchymal cells into hormone-producing cells [32] –[34]. [score:3]
Our findings are also in agreement with those of Esau et al. [27], that identified a similar expression pattern regarding miR-30c, miR-30a*, miR-30d, miR-196, miR-107, miR-30b and miR-100 during differentiation of human adipocytes. [score:3]
The miRNA expression levels were assessed by RT-PCR for miR-210 (MIMAT 0000267), miR-221 (MIMAT 0000278), miR-503 (MIMAT 0002874), miR-424 (MIMA 0001341), miR-378 (MIMAT 0000732), and miR-30c (MIMAT 0000244). [score:3]
In the 3T3-L1 cell line, the findings with miR-100, miR-107, miR-148a and miR-30c were similar to those described here in human adipocytes [11]. [score:1]
It should be noted that, while 3 of these miRNAs (miR-30c, miR-210 and miR-221) have been previously described as obesity and/or adipogenesis-related [11], [26], the 3 others (miR-503, miR-378 and miR-424) were not. [score:1]
[1 to 20 of 8 sentences]
34
[+] score: 30
Recent studies have also revealed that the miR-30 family is downregulated in tumors, where it is involved in EMT and participates in the mechanisms of tumor development and progression in several types of cancer. [score:5]
The miR-30 family has been reported to suppress EMT by targeting Snail in human hepatocytes and pancreatic epithelial cells [28, 29]. [score:5]
MiR-30c inhibits EMT via targeting Slug or Snail in renal cell carcinoma and non-small cell lung cancer [31, 32]. [score:4]
Although these reports suggest that the miR-30 family works as a tumor suppressor via regulating EMT, their roles in CCA have not been fully elucidated. [score:4]
These results suggested that miR-30e was the most important candidate miRNA among the miR-30 family for suppressing EMT in CCA. [score:3]
This indicated that miR-30e has the potential to be an onco-suppressor gene, similar to the other miR-30 family members. [score:3]
Thus, we assessed miR-30 family expression in HuCCT1 cells after incubation with TGF-β. [score:3]
The newly-identified miR-30 family is composed of miR-30a, miR-30b, miR-30c, miR-30d and miR-30e, and there have been inconsistent results regarding their function in cancer [26]. [score:1]
RNA was extracted and qRT-PCR for the miR-30 family was performed. [score:1]
Figure 3RNA was extracted and qRT-PCR for the miR-30 family was performed. [score:1]
[1 to 20 of 10 sentences]
35
[+] score: 28
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
miR-30c was upregulated by HDI in all the three experiments, miR-30d was upregulated in two of the three experiments, while miR-30b and miR-30e were upregulated in one of the three experiments but were downregulated in the other two experiments. [score:13]
In addition to miR-23b, miR-30a, and miR-125b, which, as we showed by qRT-PCR and miRNA-Seq, are upregulated by HDI, several other putative Prdm1 targeting miRNAs, including miR-125a, miR-96, miR-351, miR-30c, miR-182, miR-23a, miR-200b, miR-200c, miR-365, let-7, miR-98, and miR-133, were also significantly increased by HDI. [score:6]
All the five miR-30 miRNAs were expressed in B cells stimulated by LPS plus IL-4. The abundance of miR-30b, miR-30c, miR-30d, and miR-30e were greater than that of miR-30a (Figure 8). [score:3]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
The miR-30 family consists of five miRNAs (miR-30a, miR-30b, miR-30c, miR-30d, and miR-30e) encoded by different host genes. [score:1]
The miR-30 family members are similar to each other and have identical seed sequences. [score:1]
Like human PRDM1 (48), the 3′ UTR of mouse Prdm1 mRNA contains three highly conserved bindings sites complementary to the seed sequence of miR-30a and other miR-30 family members (Figure 8). [score:1]
[1 to 20 of 7 sentences]
36
[+] score: 26
To test the reporter derepression, we employed LNA miRNA family inhibitors targeting let-7 and miR-30 families. [score:5]
Indeed, both, let-7 and miR-30 reporters showed good repression relative to non -targeted controls upon transient transfection into HeLa or 3T3 cells (Figure 1C). [score:3]
In our hands, it showed mild inhibitory potential in two of the four dose-response reporter assays in 3T3 cells (1xP miR-30 & 4xB let-7). [score:2]
Here, we present the development and use of high-throughput cell -based firefly luciferase reporter systems for monitoring the activity of endogenous let-7 or miR-30 miRNAs. [score:2]
Perfect complementarity sequences match let-7a and miR-30c. [score:1]
The luciferase reporter plasmids PGK-FL-let-7-3xP-BGHpA, PGK-FL-let-7-4xB-BGHpA, and PGK-FL-miR-30-4xB-BGHpA used to produce reporter cell lines for HTS were built stepwise on the HindIII-AflII pEGFP-N2 (Clontech) backbone fragment using PCR-amplified fragments carrying appropriate restriction sites at their termini. [score:1]
We used a pair of reporters, one of which had an inserted single miR-30 perfect binding site (1xP miR-30) while the other did not have the insertion (Figure 6B). [score:1]
Furthermore, the dose-response trends were highly similar for the majority of the compounds; the pattern was the most striking for the miR-30 experiment in HeLa cells (Figure 6A). [score:1]
For let-7 and miR-30 bulged reporters, we produced and tested stable HeLa cells but without specific clonal selection (Figure 1E). [score:1]
Accordingly, we designed firefly luciferase reporters with multiple miRNA binding sites: either three let-7 perfect binding sites or four let-7 or miR-30 bulged sites. [score:1]
Let-7 and miR-30 miRNAs were chosen as good candidates for setting up reporters as they are abundant in somatic cells and their biogenesis and activities have been well studied (Pasquinelli et al., 2000; Hutvágner and Zamore, 2002; Zeng et al., 2002, 2005; Zeng and Cullen, 2003, 2004; Pillai et al., 2005). [score:1]
Except for the control and 1xP miR-30 reporters, which utilized the SV40 promoter and 3′ UTR, all other reporters were driven by the PGK promoter and had BGH 3′ UTR. [score:1]
Remarkably, the majority of compounds yielded a comparable impact on luciferase activity regardless of the presence of the miR-30 perfect binding site. [score:1]
The pGL4_SV40_1xmiR-30P plasmid was generated by inserting the fragment with the miR-30 1xP binding site from phRL_SV40_1xmiR-30P (Ma et al., 2010) into pGL4_SV40 using XbaI and ApoI restriction sites. [score:1]
Of the 163 compounds, 69 and 104 showed at least 2-fold increase of the let-7 mutated reporter in HeLa cells and miR-30 mutated reporter in 3T3 cells, respectively. [score:1]
Finally, the miRNA binding sites were inserted into the plasmid using in vitro synthesized oligonucleotides carrying miRNA binding sites for let-7 or miR-30 miRNA, which were annealed and cloned into a BamHI site downstream of the luciferase CDS; the plasmids were validated by sequencing. [score:1]
To develop reporters for miRNA activity for HTS, we opted for well-established “perfect” and “bulged” binding sites for let-7 and miR-30 miRNAs in previously developed reporters (Pillai et al., 2005; Ma et al., 2010; Figure 1A). [score:1]
Using a library of 12,816 compounds at 1 μM concentration, we performed HTS experiments in HeLa cells with reporters carrying miR-30 bulged and let-7 bulged and perfect binding sites, as well as an HTS experiment in 3T3 cells with a reporter carrying let-7 perfect binding sites. [score:1]
[1 to 20 of 18 sentences]
37
[+] score: 26
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-30b, hsa-mir-30e
MicroRNA30 -based shRNA (miRshRNA) encoded in expression plasmid DNA was shown to have higher gene downregulation activity than conventional shRNA. [score:6]
MicroRNA30-Based shRNA Expressed by RRV Has Higher Potent Gene Downregulation Activity than Conventional shRNA. [score:5]
We generated human U6 promoter driven-MLV -based RRV expressing conventional shRNA (RRV-shGFP) or microRNA30 -based shRNA (RRV-miRGFP) targeted to GFP (Figure 1). [score:5]
Although construction of multiple shRNA or miRshRNA cassettes have been reported in various expression vectors, 17, 22, 39, 40 incorporating such a design in an RRV genome could be technically challenging due to the repeated sequence in miRNA30-derived backbone in the same vector that may lead to early emergence of deletion mutants. [score:3]
RRVs derived from pAC3-yCD2 [41] containing human H1, U6 Pol III, or RSV Pol II promoter were generated to express conventional 21-nucleotide stem shRNA (shGFP and shPDL1) or microRNA30-derived shRNA with a 21-nucleotide stem as described [37] against GFP (miRGFP), human PDL1 (miRPDL1), human IDO-1 (miRIDO1), or human TGF-β2 (miRTGFb2) (Table S4 for sequences tested). [score:3]
For example, processing and stability of miRNA30 could be affected by such changes. [score:1]
Our short-term vector stability data indicate that miRNA30-derived miRshRNA in general is stable in the RRV genome in various cell lines tested. [score:1]
3, 9, 10 With increasing understanding of miRNA processing, Zeng et al. first demonstrated that artificially designed miRNA derived from miRNA-30 (miRshRNA) can function as siRNA. [score:1]
10, 25 One of the advantages of generating siRNA from the miR30-derived shRNA backbone is potential further minimization of type I IFN response. [score:1]
[1 to 20 of 9 sentences]
38
[+] score: 26
Thus, we selected these five miRNAs for further confirmation (Table  1) and found that expression of hsa-miR-337-3p and miR-508-5p was four times greater in the primary cancer tissues compared to the metastatic gastric cancer tissues, while miR-483-5p expression was 2.6 times greater, miR-30c expression was 2.14 times greater, and miR-134 expression was 4.9 times greater in the primary cancer tissues compared to the metastatic gastric cancer tissues (Table  1). [score:7]
Our data showed differential expression of hsa-miR-508-5p, hsa-miR-483-5p, hsa-miR-134, hsa-miR-30c, and hsa-miR-337-3p in these 16 paired samples (Figure  1), while expression levels of hsa-miR-337-3p and hsa-miR-134 were significantly reduced in the metastatic tissues compared to the primary gastric cancer tissues (Table  1). [score:4]
Taqman gene expression assays (Applied Biosystems) were used to assess expression levels of hsa-miR-508-5p, hsa-miR-337-3p, hsa-miR-30c, hsa-miR-483-5p, hsa-miR-134, and U6 in tissues or cultured cells by the 7900HT fast real-time PCR system (Applied Biosystems, Darmstadt, Germany). [score:4]
Among these five miRNAs (i. e., hsa-miR-508-5p, hsa-miR-30c, hsa-miR-337-3p, hsa-miR-483-5p, and hsa-miR-134), expression of hsa-miR-337-3p and hsa-miR-134 was significantly downregulated in these 16 lymph node metastatic tissues compared to their primary tumor tissues (P<0.05) and in nine gastric cancer cell lines compared to the nonmalignant GES cell line. [score:4]
Specifically, expression of hsa-miR-508-5p, hsa-miR-483-5p, hsa-miR-134, hsa-miR-30c, and hsa-miR-337-3p was reduced in all three metastatic cancer tissues. [score:3]
Differential expression of hsa-miR-508-5p (A), hsa-miR-483-5p (B), hsa-miR-134 (C), hsa-miR-30c (D), and hsa-miR-337-3p (E) in 16 paired samples of primary gastric cancer (GC) and the corresponding metastatic lymph node tissues (LN) as determined by qRT-PCR. [score:3]
Figure 1 hsa-miR-508-5p, hsa-miR-483-5p, hsa-miR-134, hsa-miR-30c, and hsa-miR-337-3p in primary gastric cancer and the corresponding metastatic lymph node tissue. [score:1]
[1 to 20 of 7 sentences]
39
[+] score: 25
Among these candidates, miR-30a-3p was selected for further analysis because its expression was down regulated in Poly (I:C)- and IFN-γ-activated RAFLS and SScHDF; such inverse correlation with the expression of BAFF transcripts in the same cells and the same conditions indicated that miR-30-3p family members might have a role in the regulation of BAFF expression. [score:9]
The prediction provided by bioinformatic tools and this inverse correlation between miR-30 family members and BAFF expression prompted us to analyze their likely direct interaction. [score:4]
Importantly, additional results (data not shown) indicate that additional members (and closely related) of the miR-30a-3p family (miR30-d-3p and -e-3p) also regulate BAFF expression in RAFLS and SScHDF stimulated with Poly (I:C) or IFN-γ. [score:4]
uk/enright-srv/microcosm/htdocs/targets/v5) identified several miRNAs candidates: miR-144*, miR-452, miR-340, miR-202, miR-500, miR-626, miR-330-3p, miR-302c* and miR-30 family members (miR-30a, d and e which share the same seed sequence). [score:3]
A. Luciferase reporter constructs with wild-type or mutated (for miR-30-3p binding sites) BAFF 3′UTR were generated. [score:1]
D. NHDF (n = 3) transfected with miR-30-3p antisense, were stimulated with poly (I:C). [score:1]
C. NFLS (n = 3) and NHDF (n = 3) were transfected with miR-30-3p antisense oligonucleotides (20 pM/sample) or with an AllStars negative control (CT). [score:1]
For this, we added anti-BAFF antibodies to poly (I:C)-stimulated NHDF treated with miR-30-3p antagomiRs. [score:1]
0111266.g003 Figure 3 A. Luciferase reporter constructs with wild-type or mutated (for miR-30-3p binding sites) BAFF 3′UTR were generated. [score:1]
[1 to 20 of 9 sentences]
40
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Among the downregulated miRNAs; miR-29 was found to target DNMT1, DNMT3A, DNMT3B and HDAC4),while miR-30 targets DNMT3A, HDAC2, HDAC3, HDAC6 and HDAC10, miR-379 targets DNMT1 and HDAC3 and miR-491 (miR-491 targets DNMT3B and HDAC7. [score:12]
A triple comparison was also done that included cbs [–/–], cbs [+/–] and STZ retinas, which revealed 6 miRNAs (miR-194, miR-16, miR-212, miR-30c, miR-5128 and miR-669c) that were commonly changed among cbs [–/–], cbs [+/–] and diabetes; 2 of these miRNAs were consistently changed among the three groups (miR-194 was upregulated and miR-16 was downregulated). [score:7]
Furthermore, the pathway analysis links a group of miRNAs that were differentially expressed in cbs [+/–] retina to oxidative stress pathway such as miR-205, miR-206, miR-217, miR-30, miR-27, miR-214 and miR-3473. [score:3]
Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31. [score:1]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
[1 to 20 of 5 sentences]
41
[+] score: 24
Regarding these observations, we performed qRT-PCR for 8 target genes of commonly regulated miRNA; 4 target genes (ATG5, ITGA6, NCKAP1, SARBS1) of the 2 up-regulated miRNA (mmu-miR-291b-5p, mmu-miR-296-5p) and 4 target genes (AKT1, APC, LMO7, MSN) of the 3 down-regulated miRNA (mmu-miR-30c-1*, mmu-miR-467b* and mmu-miR-374*). [score:14]
Interestingly, in cluster A, 3 miRNAs (mmu-miR-30c-1*, mmu-miR-374* and mmu-miR-497b*) were identified as being down-regulated by all nine polyphenols tested, while in cluster 2, 2 miRNAs (mmu-miR-291b-5p and mmu-miR-296-5p) were observed as up-regulated by all nine polyphenols (Table 2). [score:7]
Moreover, changes in miRNA expression were observed after polyphenol supplementation, and five miRNAs (mmu-miR-291b-5p, mmu-miR-296-5p, mmu-miR-30c-1*, mmu-miR-467b* and mmu-miR-374*) were identified as being commonly modulated by these polyphenols. [score:3]
[1 to 20 of 3 sentences]
42
[+] score: 23
We performed Monte Carlo analysis on the 2102Ep and NTera-2 differential gene expression datasets and cross-referencing with the results with the differential miRNA expression results revealed 10 miRNAs in 2102Ep cells (mir-26a, miR-28, miR-30c, miR-148a, miR-200b, miR-517b, miR-518a-3p, miR-518b, miR-518c, miR-518f) and two miRNAs in NTera-2 cells (miR-200c and miR-367) to be potential master regulators of their inversely regulated target genes. [score:9]
The significant representation of known and putative miRNA inhibitors of EMT with validated EMT targets (miR-200b, miR-200c, miR-30c, miR-148a and miR-26a) provides functional significance to the wider SOX2-regulated miRNA-target network revealed in this study. [score:8]
Four of these miRNAs, miR-200b, miR-200, miR-30c and miR-148a, are established inhibitors of EMT and metastasis by targeting ZEB1 and ZEB2 (miR-200b/200c), TWF1 and VIM (miR-30c) and mesenchymal-to-epithelial transition (MET) (miR-148a) [68, 73, 74]. [score:5]
While miR-26a, miR-30c, miR-148a, miR-200b, miR-200c and miR-367 are broadly conserved across vertebrate species, miR-28 is conserved only in mammals and miR-517b, miR-518f, miR-518b, miR-518c, miR-518a-3p, all as members of the C19MC polycistron, are found only in primates. [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 22
Of the miRNAs expressed, miR-23b, miR-30b, miR-30c, and miR-125b expression were significantly increased in H69 cells after exposure to live C. parvum infection for 12 h (p< = 0.05; Figure 1A and Table S1). [score:5]
Although transactivation of mir-30c-1 and mir-15b-16-2 genes was observed in C. parvum-infected cells and potential NF-κB binding sites were identified in their promoter elements, inhibition of p65 activation failed to inhibit transactivation of either mir-30c-1 or mir-15b-16-2 in H69 cells following C. parvum-infection. [score:5]
Treatment of cells with SC-514 failed to block C. parvum -induced expression of pri-miR-30c-1 (A). [score:3]
Expression of pri-miR-125b-1, pri-miR-21, pri-miR-23b-27b-24-1, pri-miR-30b, pri-miR-30c-1, pri-miR-15a-16-1, and pri-miR-15b-16-2 showed a time -dependent increase in cells following C. parvum infection, with a peak at 8 h or 12 h after exposure to the parasite (Figure 3). [score:3]
Figure S7p65-independent expression of miR-30c and miR-16 in cholangiocytes in response to C. parvum infection. [score:3]
Nevertheless, it appears that C. parvum infection increases transcription of pri-miR-30c-1, pri-miR-15a-16-1 and pri-miR-15b-16-2 in cholangiocytes through a p65-independent mechanism (Figure S7). [score:1]
analysis revealed an increase of pri-miR-30c-1(A), but not pri-miR-30c-2 (B), in H69 cells following C. parvum infection. [score:1]
Using the same approaches, we analyzed p65 promoter element binding in C. parvum -induced transcription of pri-miR-21, pri-miR-23b-27b-24-1, pri-miR-30b, pri-miR-30c-1, pri-miR-30c-2, pri-miR-15a-16-1, and pri-miR-15b-16-2. Our data are summarized in Table 2 and presented in detail in Figures S4, S5, S6 and S7. [score:1]
[1 to 20 of 8 sentences]
44
[+] score: 22
Two members of the miR-30 family (miR-30b and miR-30d), putative regulators of the genes implicated in oxidative stress -mediated ocular diseases, were significantly (miR-30b: p=0.001, FC 3.52; miR-30d: p=0.001, FC 2.14) upregulated under the oxidative environment, and curcumin alone significantly (p<0.05) reduced the expression of all five members of the miR-30 family, compared to the controls, and significantly reduced induction by H [2]O [2] (Figure 5). [score:8]
All five members of the miR-30 family (miR-30a-e) were upregulated and downregulated by H [2]O [2] and curcumin, respectively. [score:7]
H [2]O [2] treatment significantly upregulated miR-30b and miR-30d, two members of the miR-30 family, which is consistent with our previous results [17], and all five members of the family were downregulated by the curcumin treatments. [score:7]
[1 to 20 of 3 sentences]
45
[+] score: 21
Sixteen of 359 miRNAs detected were differentially expressed between tumor and matched benign tissue (adjusted p < 0.05): 9 were upregulated (hsa-miR-19a; hsa-miR-512-3p; hsa-miR-27b; hsa-miR-20a; hsa-miR-28-3p; hsa-miR-200c; hsa-miR-151-3p; hsa-miR-223; hsa-miR-20b), and 7 downregulated (hsa-miR-22; hsa-miR-516-3p; hsa-miR-370; hsa-miR-139-5p; hsa-let-7e; hsa-miR-145-3p; hsa-miR-30c) in tumor tissue in comparison to matched benign tissue (Table 2). [score:9]
miRNA Expression Cancer association (Y/N) Upregulated (Y/N) hsa-miR-19a Common YY (10) hsa-miR-512-3p T and E only YN (11) hsa-miR-27b Common YY (12) and N (13) hsa-miR-20a Common YY (14) hsa-miR-28-3p Common YY (15) hsa-miR-200c Common YY (16) and N (17) hsa-miR-151-3p Common YY (18) hsa-miR-223 Common YY (19) and N (15) hsa-miR-20b Common YY (20) hsa-miR-22 T and E only YY (19, 21) and N (22) hsa-miR-516-3p T only N N/A hsa-miR-370 Common YY (23) hsa-miR-139-5p Common YN (24) hsa-let-7e Common YN (25) hsa-miR-145-3p T and E only YN (26) hsa-miR-30c Common YN (27) T, tumor; E, exosome. [score:6]
Of the seven tumor-tissue miRNAs downregulated, four (hsa-miR-370; hsa-miR-139-5p; hsa-miR-let-7e; hsa-miR30c) were expressed in both tumor and plasma (both free and within exosomes); hsa-miR-516-3p was present in tumor only, and hsa-miR-22 and hsa-miR-145-3p were present in tumor and exosome only. [score:6]
[1 to 20 of 3 sentences]
46
[+] score: 20
Unlike synthetic MTP inhibitors, miR-30c did not cause hepatic steatosis, likely due to the simultaneous downregulation of genes involved in de novo lipid synthesis, such as lysophosphatidylglycerol acyltransferase 1 (LPGAT1) [27]. [score:6]
In vivo, miR-30c expression reduced hepatic MTP expression and reduced plasma concentrations of triglyceride-rich lipoproteins (TRL). [score:5]
Milenkovic et al. [72] found that in vivo supplementation with nine different polyphenols modulated the expression of some combination of miRNAs, including miR-10b, miR-30, miR-144, miR-197, and miR-370, all of which are regulators of cholesterol metabolism [5, 27, 42, 63, 73]. [score:4]
Recently, MTP was identified as a target of miR-30c [27]. [score:3]
Indeed, miR-30c decreased MTP mRNA, activity, and ApoB secretion (but not synthesis) in vitro [27]. [score:1]
Therefore, miR-30c may hold promise as a VLDL, LDL, and/or TG lowering agent, though further trials and a more comprehensive understanding of the systemic impacts of miR-30c are necessary. [score:1]
[1 to 20 of 6 sentences]
47
[+] score: 19
An increase of miR-30c and miR-31 miRNAs, targeting osteogenic transcripts such as RUNX2 and Osterix, [23, 26- 28] and of miR-125a known to be significantly downregulated during osteogenic differentiation in human adipose-derived stem cells [38] and predicted to target the osteogenic genes Smad 2 and 4 [39], could be found in hOst incubated with hAdi-CM. [score:8]
Five miRNAs, miR-138, miR-30c, miR-125a, miR-125b and miR-31, were selected for their capacity to inhibit osteoblast gene expression [25- 28]. [score:5]
We observed in hMSC-Ost incubated in hAdi-CM an increase in the adipogenic PPARγ, leptin, CEBPα and CEBPδ transcripts as well as the anti-osteoblastic miR-138, miR30c, miR125a, miR-125b, miR-31 miRNAs, probably implicated in the observed osteocalcin (OC) and osteopontin (OP) expression decrease. [score:3]
We observed in the osteoblastic population an increase in the adipogenic PPARγ, leptin, CEBPα and CEBPδ transcripts, dependent on mRNA amount as shown by conditioned media obtained from adipocytes at several differentiation stages and PPARγ silencing experiments, as well as the anti-osteoblastic miR-138, miR30c, miR125a, miR-125b, miR-31 miRNAs [23- 26], probably implicated in osteocalcin (OC) and osteopontin (OP) expression decrease. [score:3]
[1 to 20 of 4 sentences]
48
[+] score: 18
The backbone of miR-30 is one of the most frequently used microRNA sequence to direct the processing and maturation of shRNA, because its stem sequence could be substituted with exogenous sequences that match different target genes and to produce 12 times more mature shRNAs than simple hairpin designs [12], [14], and its ability to prevent interferon-stimulated gene expression and associated off-target effects and toxicity in cultured cells and mouse brain [17], [28]. [score:8]
Efficient Knockdown of Reporter Gene In Vivo by Mir-shRNAIt has been previously shown that the 5′ and 3′ flanking sequences of miRNA precursor are crucial for miRNA processing and maturation [16], and the hairpin shRNA can be expressed from a synthetic stem-loop precursor flanked by the 5′ and 3′ flanking sequences of either human miR-30 [14] or mouse miR-155 gene [13]. [score:4]
It has been previously shown that the 5′ and 3′ flanking sequences of miRNA precursor are crucial for miRNA processing and maturation [16], and the hairpin shRNA can be expressed from a synthetic stem-loop precursor flanked by the 5′ and 3′ flanking sequences of either human miR-30 [14] or mouse miR-155 gene [13]. [score:3]
In combination with a natural backbone of the primary miR-30 microRNA (miRNA), higher amounts of synthetic shRNAs can be produced from the pol III promoter than from the simple hairpin design [12]. [score:1]
We first identified zebrafish homologues of mammalian miR-30 and miR-155 genes based on their sequence identity (data not shown), and cloned both zebrafish pri-miR-30e (409 bp) and pri-miR-155 (447 bp) genomic precursor sequences into the pCS2 [+] vector (Figure 1A. [score:1]
The resultant construct mir-shRNA [EGFP-ORF] contained the same sequence (including a di-nucleotide bugle [17]) as the native miR-30e precursor, except that the strand of the mir-30 hairpin stem has been replaced with the 22 nt-long sequences complementary to EGFP open reading frame (ORF) at the position of 121–142 (Figure 1A and Figure 2A). [score:1]
[1 to 20 of 6 sentences]
49
[+] score: 18
Because miR-30a shares the same “seed sequence” with other miR-30 family miRNAs for targeting mRNA (Figure  5A), we hypothesized that EZH2 may also regulate miR-30a and that miR-30a may inhibit KPNB1 in MPNST cells. [score:6]
We also found that EZH2 inhibited expression of another miR-30 family member, miR-30a, in MPNST cells. [score:5]
These microarray studies revealed that, in addition to miR-30d, another miR-30 family member, miR-30a, was also upregulated in EZH2-knockdown cells compared with negative controls in MPNST724, S462, and STS26T cells [5]. [score:4]
Together with our findings, these data suggest that EZH2-regulated miR-200 and miR-30 family members may modulate cell survival and EMT in numerous different cancers. [score:2]
The miR-200 and miR-30 families have been shown to induce mesenchymal-epithelial transition [25]. [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
For instance, miR-29c was expressed abundantly in stomach but only in trace amounts in thymus and ovary and miR-30c was relatively strongly expressed in heart, lungs, stomach and endometrium (Figure 3B). [score:5]
miR-22, miR-26b, miR-29c, miR-30c and miR-126 exhibited almost similar expression patterns in all tissues examined (Figure 3B). [score:3]
The observation that miR-22, miR-26b, miR-126, miR-29c and miR-30c are ubiquitously expressed in 14 different tissues of pig is interesting. [score:3]
Additionally, many other miRNAs, such as let-7, miR-98, miR-16, miR22, miR-26b, miR-29c, miR-30c and miR126, were also expressed abundantly in thymus (Figure 3). [score:3]
miR-22, miR-26b, miR-29c and miR-30c showed ubiquitous expression in diverse tissues. [score:3]
[1 to 20 of 5 sentences]
51
[+] score: 17
Of the miRNAs expressed, miR-20a, miR-125, miR-19a, miR-19b, miR-27b and miR-30c expression were significantly increased (p< = 0.05) in human macropahge after exposure to Toxoplasma infection for 24 h (Figure  1A). [score:5]
Our analysis of miRNAs upregulated by Toxoplasma in human macrophage revealed that miR-30c-1, miR-125b-2, miR-23b-27b-24-1 and miR-17 ~ 92 genes are transactivated via potential promoter binding of the STAT3. [score:4]
Increased expression of miR-20a, miR-125, miR-19a, miR-19b, miR-27b and miR-30c were noted in human macrophage at 6 h and 12 h postinfection, the abundance of these miRNAs significantly increased by ~23.5-fold at 24 h postinfection. [score:3]
Expression of pri-miR-30c-1, pri-miR-125b-2, pri-miR-23b-27b-24-1 and pri-miR-17 ~ 92 showed a time -dependent increase in cells following Toxoplasma infection (p< = 0.05, Figure  2). [score:3]
We demonstrated that miR-30c-1, miR-125b-2, miR-23b-27b-24-1 and miR-17 ~ 92 cluster genes were transactivated through promoter binding of the STAT3 following T. gondii infection. [score:1]
In this study, we demonstrated that promoter binding of the STAT3 is required for transactivation of the miR-30c-1, miR-125b-2, miR-23b-27b-24-1 and miR-17 ~ 92 genes in cells following Toxoplasma infection. [score:1]
[1 to 20 of 6 sentences]
52
[+] score: 17
miR-301a and miR-454, located in the first intron of host gene SKA2, are co-transcriptionally regulated by PPAR-α and HIF-1αOur previous studies show PlGF treatment of HPMVECs attenuates expression of miR-30c and miR-301a, which target the 3′-UTR of PAI-1 mRNA and thus affect its turnover [24]. [score:6]
Our studies also show PlGF attenuates the expression of miR-30c and miR-301a in cultured endothelial cells, both of which target the 3′-UTR of PAI-1 under basal conditions [24]. [score:5]
Our previous studies show PlGF treatment of HPMVECs attenuates expression of miR-30c and miR-301a, which target the 3′-UTR of PAI-1 mRNA and thus affect its turnover [24]. [score:5]
Indeed, PlGF -mediated induction of PAI-1 was achieved by a transcriptional mechanism involving HIF-1α [23] and post-transcriptionally by specific miRNAs (miR-30c and miR-301a) that bind to the 3′-UTR of PAI-1 mRNA [24]. [score:1]
[1 to 20 of 4 sentences]
53
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
These indicated that miR-21, miR-30, and miR-27 and their target lncRNAs may play an important role in the androgen deficiency-related fat deposition, as it is wi dely known that miR-30a targets the androgen receptor (AR) gene [22]. [score:5]
Cai et al. (2014) found that 18 miRNAs were differentially expressed between intact and castrated male pigs, including miR-15a, miR-21, miR-27, miR-30, and so on [23]; Bai et al. (2014) reported that 177 miRNAs had more than 2-fold differential expression between castrated and intact male pigs, including miR-21, miR-30, miR-27, miR-103, and so on [22]. [score:5]
Our results were consisted with these reports, it was predicted that there were lncRNAs were the target genes for miR-21, miR-30, and miR-27. [score:3]
We found 13 adipogenesis-promoting miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) target 860 lncRNA loci. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 5 sentences]
54
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
Within 6 hrs of the presence of E. coli, the expression of 6 miRNAs in MAC-T cells was significantly altered (P < 0.05), three were down regulated (bta-miR-193a-3p, miR-30c and miR-30b-5p) while three were up-regulated (bta-miR-365-3p, miR-184 and miR-24-3p) (Table  3). [score:7]
For example, gene targets of five differentially expressed miRNAs (miR-365-3p, miR-30b-5p, miR-30c, let-7a-5p and miR-23a) were enriched for pathways in immune system (B-cell receptor signaling pathway, chemokine signaling, T-cell receptor signaling and Fc gamma R -mediated phagocytosis). [score:5]
The three miRNAs (bta-miR-193a-3p, miR-30c and miR-30b-5p) that were significantly down regulated or one miRNA (bta-miR-365-3p) that was significantly up regulated within 6 hrs of E. coli presence only showed a retarded significant down regulation by 24 or 48 hrs (bta-miR-193a-3p, 30c and 30b-5p) or up regulation (bta-miR-365-3p) by 48 hrs in the presence of S. aureus. [score:5]
[1 to 20 of 3 sentences]
55
[+] score: 16
More recently, it is demonstrated that up-regulated expression of miR-30 in breast cancer-initiating cells inhibits their self-renewal capacity by reducing the ubiquitin-conjugating enzyme 9 (Ubc9). [score:8]
Integrin β3 (ITGB3) is another direct target of miR-30, which contributes to apoptosis (22). [score:4]
These miRNAs include miR-200c, Let-7, miR-30, but presently, little is known about the mechanism by which it functions to regulate BT-IC self-renewal. [score:2]
A previous report has shown that unligated ITGB3 recruits caspase-8 to the cell membrane and activated caspase-8-mediates apoptosis in a death receptor-independent manner (25), while miR-30 induces apoptosis not in the death receptor-independent manner but through an unclear pathway. [score:1]
Other miRNAs, such as miR-30, miR-17-5p, miR-9, are phase-specific. [score:1]
[1 to 20 of 5 sentences]
56
[+] score: 16
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-30b, hsa-mir-30e
Expression of miR30b (Figure 2B) and miR30c (Figure 2C) was dowregulated significantly by BMP‐2 after 2 hours, before the observed upregulation of Runx2 mRNA, indicating that these miRs are plausible candidates to regulate Runx2 expression. [score:10]
Interestingly, CASMC calcification following downregulation of miR‐30b or miR30c alone was less than that observed in BMP‐2–stimulated cells, likely owing to the observation that downregulation of miR‐30b or miR‐30c alone did not increase alkaline phosphatase activity, a finding that has been reported by other investigators. [score:5]
Human CASMCs were treated with BMP‐2 (100 ng/mL) for 4 hours and (A) expression of miR30 family members (miR‐30a, miR‐30b, miR‐30c, miR‐30d, and miR‐30e) was evaluated by quantitative real‐time–polymerase chain reaction (PCR). [score:1]
[1 to 20 of 3 sentences]
57
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Other miRNAs recently implicated in breast cancer include miR-100, shown to target SMARCA5, SMARCD1, and BMPR2 genes, which directly influence tumor cell proliferation [80], and miR-30c, known to target TWF1 and IL-11 [81], both of which are expressed in the MaSC/basal lineage. [score:8]
Bockhorn J Dalton R Nwachukwu C Huang S Prat A Yee K MicroRNA-30c inhibits human breast tumour chemotherapy resistance by regulating TWF1 and IL-11Nat Commun. [score:3]
More specifically, the expression of some miRNAs has been linked to histopathological features such as HER2/ neu or ER/PR status (miR-30), metastasis (miR-126 and miR-335) and the EMT (miR-205 and miR-200 family) [43, 76– 79]. [score:3]
Zaragosi LE Wdziekonski B Brigand KL Villageois P Mari B Waldmann R Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesisGenome Biol. [score:2]
[1 to 20 of 4 sentences]
58
[+] score: 16
org) was used to visualize the correlations of graphically depicting the regulation of the mRNA targets of the most interesting up-regulated mmu-miR-669c, mmu-miR-329, and down-regulated mmu-miR-688, mmu-miR-30c-1 [*], mmu-miR-201, mmu-miR-761, mmu-miR-715 microRNAs in Tff2- KO mice in a convenient way. [score:10]
Briefly, we found that mmu-miR-688 and mmu-miR-30c-1 [*] targeting Tcf712 and Cdk4 are involved in colorectal and pancreatic cancer, respectively, while the same miRNAs targeting Bad, Mapk10, Mapk3 and Tgfbr1 are involved both in pancreatic as well as colorectal cancer. [score:5]
It has been demonstrated in completely independent experiments that mmu-miR-715 as well as mmu-miR30C-1 [*] are involved in specific cellular pathways essentially confirming our observation (40, 41). [score:1]
[1 to 20 of 3 sentences]
59
[+] score: 16
Other miRNAs from this paper: hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-30a, hsa-mir-32, hsa-mir-33a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-147a, hsa-mir-34a, hsa-mir-187, hsa-mir-204, hsa-mir-205, hsa-mir-200b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-138-2, hsa-mir-142, hsa-mir-144, hsa-mir-125b-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-190a, hsa-mir-200c, hsa-mir-155, hsa-mir-200a, hsa-mir-30e, hsa-mir-365b, hsa-mir-328, gga-mir-33-1, gga-mir-125b-2, gga-mir-155, gga-mir-17, gga-mir-148a, gga-mir-138-1, gga-mir-187, gga-mir-32, gga-mir-30d, gga-mir-30b, gga-mir-30a, gga-mir-30c-2, gga-mir-190a, gga-mir-204-2, gga-mir-138-2, gga-let-7d, gga-let-7f, gga-mir-146a, gga-mir-205b, gga-mir-200a, gga-mir-200b, gga-mir-34a, gga-mir-30e, gga-mir-30c-1, gga-mir-205a, gga-mir-204-1, gga-mir-23b, gga-mir-142, hsa-mir-449a, hsa-mir-489, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-33b, hsa-mir-449b, gga-mir-146b, gga-mir-147, gga-mir-489, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-144, gga-mir-460a, hsa-mir-147b, hsa-mir-190b, gga-mir-22, gga-mir-460b, gga-mir-1662, gga-mir-1684a, gga-mir-449c, gga-mir-146c, gga-mir-449b, gga-mir-2954, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, gga-mir-365b, gga-mir-33-2, gga-mir-125b-1, gga-mir-190b, gga-mir-449d, gga-mir-205c
It was also demonstrated the down-regulation of miR-30c caused the up-regulated expression of platelet-derived growth factor receptor-β (PDGFRβ), and then activated the PDGF signaling which leaded to the PASMCs proliferation and phenotypes switching in a hypoxia condition [7]. [score:9]
And Caruso et al firstly reported miRNAs dysregulation in the progress of PAH by the means of microarray analysis and quantitative polymerase chain reaction, who detected that miR-451and miR-322 up regulated, whereas miR-30, miR-22, and let-7f down regulated in PAH rodent mo dels [27]. [score:4]
This research highlighted the potential role of specific miRNAs in disease progress [23], like miR-21, miR-204, miR-17, miR-155, miR-138 and miR-30c in human and rat mo dels of PAH [7, 8, 28, 29]. [score:3]
[1 to 20 of 3 sentences]
60
[+] score: 16
The four genes were not identified as targets of miR-30 due to the inability to link them to the “four genes” mention, and subsequently to the “15 upregulated target genes” mention. [score:8]
An example is the following sentence: “Among 15 upregulated target genes of the miR-30 miRNA, four genes known to be expressed and/or functional in podocytes were identified, including receptor for advanced glycation end product, vimentin, heat-shock protein 20, and immediate early response 3” (PMID 18776119). [score:8]
[1 to 20 of 2 sentences]
61
[+] score: 16
The most highly connected microRNAs in the network included miR-638, miR-18a-3p, miR-483-3p, miR-181d, and miR-30c, which had greater than 50 positively or negatively correlated predicted targets, suggesting that these microRNAs may be important regulators of gene expression associated with emphysema severity. [score:6]
A subset, including miR-638, miR-30c, and miR-181d, had expression levels that were associated with those of their predicted mRNA targets. [score:5]
Five of these microRNAs (miR-638, miR-181d, miR-18a-3p, miR-30c, and miR-483-3p) were correlated with ≥50 of their predicted targets, suggesting that these microRNAs may play a key role in gene regulation in emphysema. [score:4]
These include Let-7c, Let-7d, Let-7e, and Let-7f from the Let-7/miR-98 family, miR-181c and miR-181d from the miR-181/4262 family, and miR-30a-3p, miR-30c, miR-30e-5p, and miR-30e-3p from the miR-30/384-5p family. [score:1]
[1 to 20 of 4 sentences]
62
[+] score: 16
Among these: 3 miRNAs (i. e. miR-26a-5p, miR-143-3p, and miR-4454) were expressed in both RAA and LAA; 6 miRNAs (i. e. miR-30c-5p, miR-125b-5p, miR-133b, miR- 145-5p, miR-451a, and miR-4484) were expressed in only RAA; and 3 miRNAs (i. e. miR-1, miR-23b-3p, and miR-494) were expressed in only LAA. [score:7]
Studies have shown that miRNAs may be involved directly or indirectly in AF by modulating atrial electrical remo deling (i. e. miR-1, miR-26, and miR-328) or structural remo deling (i. e. miR-30, miR-133, and mir-590). [score:3]
To determine the probable biological function of the AF -associated miRNAs, we predicted the putative targets and pathways of 10 validated miRNAs (i. e. miR-1, miR-23b-3p, miR-26a-5p, miR-30c-5p, miR-125b-5p, miR-133b, miR-143-3p, miR-145-5p, miR-4454, and miR-4484) using the miRFocus database. [score:3]
Li et al. [12] reported that miR-133 and miR-30, as anti-fibrotic miRNAs [33, 34], may play an important role in the control of structural changes in chronic AF. [score:1]
According to the qRT-PCR data, miR-26a-5p, miR-143-3p, miR-4454 were AF -associated miRNAs found in both RAA and LAA tissues, while miR-30c-5p, miR-125b-5p, miR-133b, miR-145-5p, miR-4484 were AF -associated miRNAs found in only RAA tissues and miR-1, miR-23b-3p were found only in LAA tissues (Figure  5). [score:1]
99E-02hsa-miR-486-5p632167−1.925.85E-02hsa-miR-16-5p683186−1.882.05E-02hsa-miR-455-3p22061−1.855.70E-02hsa-miR-222-3p389116−1.751.34E-02hsa-miR-195-5p902290−1.645.19E-02hsa-miR-221-3p25282−1.621.13E-02hsa-miR-22-3p302104−1.543.02E-02hsa-miR-331-3p21678−1.479.03E-02hsa-miR-43241409540−1.389.86E-02hsa-miR-30c-5p28221107−1.352.87E-02hsa-miR-378d17169−1.328.68E-02hsa-miR-125a-5p35061488−1.246.63E-02hsa-miR-151a-5p622267−1.225.18E-02hsa-miR-143-3p1732746−1.224.85E-02hsa-miR-151b556253−1.133.69E-02hsa-miR-44541276582−1.133. [score:1]
[1 to 20 of 6 sentences]
63
[+] score: 15
The X-axis represents the expression level of each miRNA normalized to miR-30c-3p using 2 [−ΔCt] method. [score:3]
We selected miR-30c-5p as a reference normalizer gene because it was moderately expressed and showed minimal variation across all cell types using two different methodologies for assessing variation. [score:3]
The commonly used normalizer, RNU6B, was expressed at lower levels and displayed more variability across the 5 blood cell types than miR-30c-5p (Table S8). [score:3]
Using miR-30c-5p as a normalizer in qRT-PCR, we validated expression levels of miR-301a-3p (Figure 4B; r = 0.969, p-value = 0.003). [score:3]
Notably, miR-30c-5p was superior to the commonly used normalizer RNU6B, and we would discourage the use of the latter for normalization purposes. [score:1]
Such genome-wide screens require validation, and we determined miR-30c-5p to be an ideal internal normalizer for qRT-PCR validation. [score:1]
Table S8 miR-30c-5p validation. [score:1]
[1 to 20 of 7 sentences]
64
[+] score: 15
In addition to these factors, KSHV can also downregulate miR-30b and miR-30c, whereas increasing the expression of their direct target, Delta-like 4 (DLL4), a functional protein in vascular development and angiogenesis [24], can induce KSHV -mediated LECs angiogenesis [25]. [score:10]
Interestingly, these miRNAs (miR-21, miR-31, miR-221/222, miR-30) can act as either “oncogenes” or “tumor-suppressor genes” in a variety of cancers in which they can regulate tumor cell proliferation, apoptosis, invasion, angiogenesis, metastasis and other important cellular functions [26, 27, 28, 29, 30], indicating functional relevance of these regulatory miRNAs in virus-related malignancies. [score:5]
[1 to 20 of 2 sentences]
65
[+] score: 14
Using microarray analysis, miRNA expression pattern in hearts revealed that miR-1, miR-29, miR-30, miR-133, and miR-150 have often been found to be down-regulated while miR-21, miR-125, miR-195, miR-199, and miR-214 are up-regulated with hypertrophy. [score:9]
It was established that increased expression of miR-23a, miR-27a, miR-30c, let-7g, and miR-199a-3p corresponds to resistance to platinum -based chemotherapy while reduced expression of miR-378 and miR-625 relates to resistance. [score:5]
[1 to 20 of 2 sentences]
66
[+] score: 14
After determining the expression levels of these miRNAs in the same 7 pairs of NSCLC tissues and normal adjacent tissues, we observed that 8 miRNAs (miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101 and miR-9) were downregulated in the NSCLC tissues, while the other 5 miRNAs (miR-125, miR-98, miR-196, miR-23 and miR-499) were upregulated (Fig. S1). [score:9]
In addition to let-7, miR-181 26, miR-30 29, miR-9 27 28, miR-132 32 33, miR-101 30 and miR-212 31 have also been shown to directly bind the 3′-UTR of LIN28B and repress the translation of this protein. [score:4]
A total of 13 miRNAs, including miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101, miR-9, miR-125, miR-98, miR-196, miR-23 and miR-499, were identified as candidate miRNAs by all three computational algorithms (Table S2). [score:1]
[1 to 20 of 3 sentences]
67
[+] score: 14
And a larger flanking region may be necessary for optimal target knockdown by a mir-30 -based cassette [117]. [score:4]
However, it is noteworthy that a contradicting study shows shRNA with 19-nt stem and 9-nt loop may outperform the miR-30 based scaffold for target knockdown in some experimental setting [133]. [score:4]
To date, the well-defined endogenous miR-26a [123] and miR-30 [113, 116] have been used as typical scaffolds for the expression of RNAi triggers. [score:3]
Recently, second-generation shRNA libraries covering mouse and human genomes have been designed in the backbone or pri-miR30, showing improvement over the conventional shRNAs [132]. [score:1]
Successes of employing this pri-miR-Pol II system have been reported for miR-30 [118] and miR-155 [114]. [score:1]
Zeng et al. [116] have demonstrated that miR-30 miRNA backbone including siRNA sequences effectively degrades mRNAs of endogenous human genes such as the polypyrimidine tract binding protein. [score:1]
[1 to 20 of 6 sentences]
68
[+] score: 14
This observation suggests a possible unidentified interaction between miR-30 and BDNF promoter as well as multiple layers of regulation of BDNF level by targeting both 3′-UTR and promoter regions. [score:4]
One predicted target site of human miR-30c-1-3p also showed the presence of binding sites for AGO2 protein, which was reported to be involved in the miRNA mechanism of promoter binding (12). [score:3]
Members of the miR-30 family were previously reported to target both human and mouse BDNF at the 3′-UTR (55, 56). [score:3]
For example, members of the miR-30 family were good candidates given that they are predominantly nuclear-localized and were predicted to commonly target human and mouse BDNF sense promoter with strong favorable thermodynamic interaction. [score:3]
Experimental evidence for the existence of nuclear miRNAs was also present for the three miRNA families, namely miR-188, miR-671 and miR-30. [score:1]
[1 to 20 of 5 sentences]
69
[+] score: 14
In other works, the downregulation of miRNAs was also observed in cardiac disease mo dels including reductions in miR-133, miR-590, miR-30, miR155, miR-22, miR-29, and miR101 (van Rooij et al., 2008; Duisters et al., 2009; Shan et al., 2009; Pan et al., 2012; Kishore et al., 2013; Hong et al., 2016). [score:6]
Particularly, T3 treatment was found to be effective in countering the injury-related downregulation of miR-29c, miR-30c, and miR-133a resulting in the reduction of profibrogenic matrix metalloproteinase (MMP)-2 and CTGF expressions (Nicolini et al., 2015). [score:6]
miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remo deling. [score:2]
[1 to 20 of 3 sentences]
70
[+] score: 14
BMP treatment regulates multiple miRNA expression during osteoblastogenesis, and a number of those miRNAs feedback to regulate BMP signaling: [176–179] miR-133 targets Runx2 and Smad5 to inhibit BMP -induced osteogenesis; [176] miR-30 family members negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 and Runx2; 177, 178 miR-322 targets Tob and enhances BMP response. [score:14]
[1 to 20 of 1 sentences]
71
[+] score: 14
For lentiviral -mediated knockdown of Trp53, we generated a vector (pLenti X1 Puro DEST, Addgene 17297) containing the U6 promoter (derived from pENTR/pSM2 (U6), Addgene 17387) driving expression of a previously described (Dickins et al, 2005) miR30 format shRNA against Trp53 (1224) or expressing an empty (ns) miR30 backbone. [score:6]
Cells were infected with adenoviruses expressing GFP (Vector Biolabs, 1060) or Cre-GFP (Vector Biolabs, 1700), retroviruses (LMP) expressing non-silencing hairpin or miR30-shRNA against Trp53 (Dickins et al, 2005), lentiviruses (L KO. [score:5]
I. Proliferation assays of Vhl [fl/fl] MEFs infected with GFP or Cre and lentiviruses expressing an empty miR30 shRNA (shRNA-ns) or miR30-format shRNA directed against Trp53 (shRNA-Trp53). [score:3]
[1 to 20 of 3 sentences]
72
[+] score: 14
For example, the down-regulation of miR-30 family and miR-107 can up-regulated p53 expression in human cell lines (Li et al., 2010), and overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells (Le et al., 2009). [score:13]
Thus, reduced levels of both the miR-30 family and miR-107 in old adults seem to protect these individuals from malignant mesothelioma and neuroblastoma, whereas reduced levels of the let-7 family in old adults seem to promote tumor progression. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 14
Twelve of them (miR-10b, miR-15a, miR-19a, miR-26b, miR-30a, miR-30c, miR-125a, miR-125b, miR-148a, miR-148b, miR-195 and miR-320) are down-regulated both in dogs and in humans whereas one (miR-494) is up-regulated in both species and four (miR-29a, miR-181a, miR-196a and miR-374a) are down-regulated in dogs but up-regulated in humans. [score:13]
PCA plot reveals the distinct sample clusters for metastatic tumours and non-metastatic tumours The following ten microRNAs were selected for validation of microarray results: cfa-let-7c, cfa-miR-10b, cfa-miR-26a, cfa-miR-26b, cfa-miR-29c, cfa-miR-30a, cfa-miR-30b, cfa-miR-30c, cfa-miR-148a and cfa-miR-299. [score:1]
[1 to 20 of 2 sentences]
74
[+] score: 14
Of interest, all miRNAs predicted to regulate Blimp-1 expression were concordantly down-modulated by IFN-α; on the contrary, during DC differentiation driven by IL-4, miR-100 and miR-125b resulted up-modulated, whereas miR-23a, miR-30c and let-7e were not differentially expressed compared to the untreated control (Figure 1C). [score:5]
We found PRDM-1 gene, encoding Blimp-1, predicted to be the target gene of 5 out of 10 miRNAs regulated in IFN-α DC: miR-23a, miR-30c, miR-100, miR-125b and let-7e (Figure 1C). [score:4]
The assessment of the expression of miR-23a, miR-30c, miR-100, let-7e and miR-125b in pDC exposed to IFN-α for 24 hours revealed that IFN-α stimulated the down-modulation of miR-125b along with that of miR-30c. [score:3]
Interestingly, 8 out of these 10 miRNAs were modulated in the same direction in pDC, being miR-23a, miR-27b, miR-30c, miR-32, miR-100, miR-146a, and let-7e significantly down-modulated and miR-155 up-modulated. [score:2]
[1 to 20 of 4 sentences]
75
[+] score: 13
Compared to normal tissue with an expression profile normalized to 1, in tumor samples of the 14 CRC patients we observed a significant up-regulation for 3 miRNAs (miR-31, miR-21 and miR-708), and under expression in 7 others (miR-145, miR-139-5p, miR-486-5p, miR-378, miR-140-3p, miR-143 and miR-30c) (Table 3). [score:7]
Down -expression was observed only for miR-21, whereas over -expression was observed in 12 miRNA (miR-143, miR-145, miR-151-5p, miR-155*, miR-199a-5p, miR-23a, miR-30a, miR,30c, miR-21, miR-455-3p, miR-708 and miR-let-7i) and only two were not deregulated in a statistically significant way (miR-30a and miR-30c) (Table 3). [score:6]
[1 to 20 of 2 sentences]
76
[+] score: 13
Conversely, overexpression of miR-133 and miR-30c repressed the production of collagens, which was accompanied with a decrease in CTGF expression levels. [score:5]
Both miR-133 and miR-30 were found consistently down-regulated in several mo dels of heart failure and pathological hypertrophy. [score:4]
Duisters R. F. Tijsen A. J. Schroen B. Leenders J. J. Lentink V. van der Made I. Herias V. van Leeuwen R. E. Schellings M. W. Barenbrug P. miR-133 and miR-30 regulate connective tissue growth factor: Implications for a role of microRNAs in myocardial matrix remo deling Circ. [score:2]
Duisters et al. showed that miR-133 and miR-30 were involved in myocardial matrix remo deling through regulating CTGF [33]. [score:2]
[1 to 20 of 4 sentences]
77
[+] score: 12
Moreover, recent studies show that several tumor suppressor miRNAs are directly regulated by C/EBPα, such as miR-223, miR-34a and miR-30C, and that transactivation of all miRNAs is inhibited along with the down-regulated expression of C/EBPα [21– 23]. [score:12]
[1 to 20 of 1 sentences]
78
[+] score: 12
The down-regulated miRNAs miR-29b, miR-124, miR-6980, miR-1273h and miR-30c each are associated with at least 5 concordantly up-regulated target genes, with the only observed exceptions being the down-regulation of CCL2 and TNF. [score:12]
[1 to 20 of 1 sentences]
79
[+] score: 12
For example, the median log2 expression level change of the top 150 TargetScan conserved targets was 0.096 (6.9%) for mir-29 knockdown in fetal lung fibroblasts [89], 0.131 (9.5%) for mir-145 transfection of MB-231 breast cancer cells [90], 0.173 (12.7%) for mir-30 overexpression in melanoma cell lines [91], and 0.465 (38.0%) for mir-7 overexpression in A549 cancer cells [92]. [score:12]
[1 to 20 of 1 sentences]
80
[+] score: 12
In lung cancer, down-regulation of both miR-30b and miR-30c was demonstrated to inhibit cell proliferation 55. [score:6]
As reported previously, miR-30c could regulate NF-kappa B negatively underlying both inflammation and cancer 54. [score:2]
Pivot miRNA miR-30 family significantly regulated most modules in the subnetwork. [score:2]
TF BRG1, TF CEBPA, miRNA miR-27b and miRNA miR-30 family members recurred with relatively high degrees. [score:1]
Among these pivots, we showed that TF BRG1 and CEBPA and miRNA miR-27b and miR-30 family members recurred with relatively high degrees between the two different patterns, which thus turned out to be promising candidates for further confirmation. [score:1]
[1 to 20 of 5 sentences]
81
[+] score: 12
Meanwhile, overexpressing miR-30 could inhibit apoptosis through repression of p53 expression in cardiomyocytes [48], but upregulation of miR-30 in breast cancer cells induced apoptosis by targeting Ubc9 [49]. [score:12]
[1 to 20 of 1 sentences]
82
[+] score: 12
Briefly, the ‘Flp-In' targeting vector, called pCol-TGM, was configured with a GFP ‘spacer' between a tetracycline-regulated element and the miR30 -based expression cassette. [score:6]
Nine shRNA guide sequences predicted to target Rtn1 for knockdown were embedded into a miR30 -based expression cassette of a retroviral DOX-inducible shRNA vector. [score:6]
[1 to 20 of 2 sentences]
83
[+] score: 12
Total PDE-derived cells from 110 PD patients (82 new, 28 prevalent) showed significant miRNA upregulation of miR-15a, miR-21, and miR-192 when comparing new, prevalent and UF groups, while miR-17, miR-30, and miR-377 expression was similar between groups [36]. [score:6]
miR-30 significantly correlated with GFR and no detectable expression of miR-216a and miR-217 was found in patient samples [36]. [score:3]
Chen et al. [36] selected the following candidate miRNAs based on a report on EMT and kidney disease [46]: miR-15a, miR-17-92, miR-21, miR-30, miR-192, miR-216a, miR-217, and miR-377 [36]. [score:3]
[1 to 20 of 3 sentences]
84
[+] score: 11
The highly expressed hsa-miR-100-5p and hsa-miR-21-5p, and the differentially expressed hsa-miR-139-5p and hsa-miR-30c-5p, were detected in bulk cells and CSCs, and also in their exosomes. [score:5]
Thirteen miRNAs were overexpressed in exosomes from bulk cells: hsa-miR-218-5p, hsa-miR-7-5p, hsa-miR-1290, hsa-miR-17-5p, hsa-miR-20a-5p, hsa-miR-503-5p, hsa-miR-30c-5p, hsa-miR-125b-1, hsa-miR-21-5p, hsa-miR-93-5p, hsa-miR-378c, hsa-miR-378d and hsa-miR-25-3p (Table 2). [score:3]
In behalf of the premetastatic niche preparation, miR-21, miR-30 and miR-218 regulate osteoblast differentiation, increasing the production of RANKL, among other soluble factors. [score:2]
Finally, for the new targets genes prediction the mirMap bioinformatics software [73] was utilized with a pValue threshold of 0.01. cDNA was synthetized from miRNA samples (300 ng) from exosomes and cells with the TaqMan [®] MicroRNA Reverse Transcription Kit (Lifetechnologies) using a pool of primers included in the TaqMan miRNA assays for hsa-miR-100, hsa-miR-21-5p, hsa-miR-139-5p, hsa-miR-30c and U6 snRNA according to manufacturer's instructions. [score:1]
[1 to 20 of 4 sentences]
85
[+] score: 11
Similar results were observed in p53 [+/+] and p53 [−/−] cells (Figure 2c): the expression levels of miR-3151 and miR-663b were upregulated in p53 [−/−] cells, while the expression levels of miR-140, miR-30b, miR-506, miR-124 and miR-30c were downregulated in p53 [−/−] cells compared with that in p53 [+/+] cells. [score:10]
Several miRNAs were proposed, among which seven of them were reported to be related to p53: miR-140, miR-30b, miR-3151, miR-506, miR-124, miR-30c, and miR-663b 19, 20, 21, 22, 23, 24 (Figure 2a). [score:1]
[1 to 20 of 2 sentences]
86
[+] score: 11
pAPM is a lentiviral vector expressing puromycin-resistance and a miR30 -based knockdown cassette from the spleen focus forming virus LTR [48, 63, 64]. [score:4]
Jurkat T cells (A) or primary human CD4 [+] T cells (B) were transduced with lentiviral vectors bearing a puromycin resistance cassette and miR30 -based knockdown cassettes targeting either luciferase (black squares), CypA (gray diamonds), or TRIM5 (white triangles). [score:4]
As a control for miR30 lentiviral vector transduction and puromycin selection, Jurkat T cells were transduced with an otherwise isogenic lentiviral vector targeting luciferase (Luc), a gene that is not present in these cells. [score:3]
[1 to 20 of 3 sentences]
87
[+] score: 11
miR-30 and miR-133 are cardiomyocyte-enriched miRNAs which regulate connective tissue growth factor (CTGF)–a key molecule in the process of fibrosis and therefore an attractive therapeutic target of heart diseases. [score:6]
Downregulation of miR-30 is related to endoplasmic reticulum stress in cardiac muscle and vascular smooth muscle cells [34]. [score:4]
On the other hand the results of the study conducted by Goren et al. revealed elevated levels of miR-30 in the serum of stable chronic systolic heart failure patients [21]. [score:1]
[1 to 20 of 3 sentences]
88
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Izzotti et al. (2009a, b) have monitored the expression of 484 miRNAs in the lungs of mice exposed to cigarette smoking, the most remarkably downregulated miRNAs belonged to several miRNA families, such as let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223. [score:6]
Zhang and Pan (2009) have evaluated the effects of Hexahydro-1, 3, 5-trinitro-1, 3, 5-triazine (also known as hexogen or cyclonite) (RDX) on miRNA expression in mouse brain and liver, most of the miRNAs that showed altered expression, including let-7, miR-17-92, miR-10b, miR-15, miR-16, miR-26, and miR-181, were related to toxicant-metabolizing enzymes, and genes related to carcinogenesis, and neurotoxicity, in addition, consistent with the known neurotoxic effects of RDX, the authors documented significant changes in miRNA expression in the brains of RDX -treated animals, such as miR-206, miR-30a, miR-30c, miR-30d, and miR-195. [score:5]
[1 to 20 of 2 sentences]
89
[+] score: 11
In addition, three miRNAs miR-20b, miR-363 and miR-30c that were all solely down-regulated in ccRCC also showed significant correlation with the expression levels of 23, 25 and 37 of their predicted target genes, respectively (Table S6). [score:8]
However, no enriched biological process was found in the correlated target gene sets of miR-30c and miR-363. [score:3]
[1 to 20 of 2 sentences]
90
[+] score: 11
Expression analysis of miR-21, miR-29b, miR-30c and miR-133a (all previously implicated in the regulation of fibrosis [38]– [41]) revealed that the upregulation of miR-21 at weeks 3 and 4 was the only alteration observed between MHC-CnA and WT. [score:7]
Since four miRNAs were previously implicated in the regulation of fibrosis, namely miR-21, miR29b, miR-30c and miR-133a [12], their expression level was also determined. [score:4]
[1 to 20 of 2 sentences]
91
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
The miR-30(b/c/d/e) family regulates kidney development by targeting the transcription factor Xlim1/Lhx1 in Xenopus[66]. [score:5]
In addition, ssc-moRNA-3, belonging to new type of miRNA termed moRNA, was found at the 5’ end of pre-miR-30. [score:1]
In our study, 8 miRNA families (let-7, mir-1, mir-17, mir-181, mir-148, mir-30, mir-92 and mir-99) were found with at least 3 members among all exosome miRNAs. [score:1]
The let-7 family had 9 members, miR-181 family had 4 members (miR-181a/b/c/d) and miR-30 family had 5 members (miR-30a/b/c/d/e). [score:1]
#: due to miRNAs classification by seed sequence, 3p and 5p of miR-30 represent different miRNAs families. [score:1]
Similarly, miR-30a was the most abundant in the miR-30 family. [score:1]
At the 5’ end of pre-miR-30, a 18 nt RNA sequence was found to be generated from the loop, downstream of ssc-miR-30a-5p (Figure 10C). [score:1]
[1 to 20 of 7 sentences]
92
[+] score: 11
However, in another study, identifying miRNAs to be altered in human OC resistant cell lines, let-7e showed to be upregulated in Paclitaxel-resistant (A2780TAX) cells, but downregulated in other, both Paclitaxel- and Cisplatin-resistant, cell lines, whereas miR-30c was downregulated in all Paclitaxel- and Cisplatin-resistant cell lines. [score:10]
In our study, let-7e, miR-30c and miR-130a were negatively correlated to Paclitaxel, but only one patient in our study was treated with Paclitaxel. [score:1]
[1 to 20 of 2 sentences]
93
[+] score: 11
The top five differentially upregulated miRNAs in LGDN (Table  2) were: miR-141 (625-fold), miR-101 (208-fold), miR-22 (111-fold), miR-16 (61-fold), and miR-486 (35-fold); whereas, the top five downregulated were: miR-451a (513-fold), miR-378c (104-fold), miR-361 (95-fold), miR-122 (81-fold), and miR-30c (78-fold). [score:7]
The top five downregulated were: miR-20a (1 million-fold), miR-22–3p (1 million-fold), miR-26b (1 million-fold), Let-7f (1 million-fold), and miR-30c (3545-fold). [score:4]
[1 to 20 of 2 sentences]
94
[+] score: 11
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Out of the 114 differentially expressed miRNAs, the only 10 upregulated miRNAs in SzS samples were miR-145, miR-574-5p, miR-200c, miR-199a*, miR-143, miR-214, miR-98, miR-518a- 3p, and miR-7. The aberrant expression of MYC in SzS was found to correlate with the set of miRNAs including miR-30, miR-22, miR-26a, miR-29c, miR-30, miR-146a, and miR-150 which were downregulated. [score:11]
[1 to 20 of 1 sentences]
95
[+] score: 11
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-30b, hsa-mir-30e
The structural difference between the microRNA and the shRNA is that the microRNA contains flanking miR30 sequences while in the shRNA these sequences were removed, but the GRB2 targeting sequence is identical in both these suppressive RNAs. [score:5]
We cloned potential microRNA targeting sequences for GRB2 into a modified form of the human miR30 microRNA in viral packaging vectors that have a gene for YFP to identify transduced cells. [score:3]
However, there was no large difference in the effectiveness of each type of targeting sequence, since our studies in HuT78 T cell line performed utilizing both miR30 and shRNA constructs had identical results (data not shown). [score:3]
[1 to 20 of 3 sentences]
96
[+] score: 11
Recent analysis identified miRNAs expressed in undifferentiated mouse embryonic stem cells and differentiating cardiomyocytes and found increased level of miRNA-1, miRNA-18, miRNA-20, miRNA-23b, miRNA-24, miRNA-26a, miRNA-30c, miRNA-133, miRNA-143, miRNA-182, miRNA-183, miRNA-200a/b, miRNA-292-3p, miRNA-293, miRNA-295 and miRNA-335 in mice [14, 45]. [score:3]
In another study, Duisters et al. (2009) [79] has demonstrated that miRNA-133 and miRNA-30, both consistently down regulated in several mo dels of pathological hypertrophy and heart failure, regulate connective tissue growth factor (CTGF), a key molecule involved in fibrosis. [score:3]
These studies indicate that miRNAs, miRNA-208, miRNA-23a, miRNA-24, miRNA-125, miRNA-21, miRNA-129, miRNA-195, miRNA-199, and miRNA-212 are frequently increased in response to cardiac hypertrophy, whereas, miRNA-29, miRNA-1, miRNA-30, miRNA-133, and miRNA-150 expression are often found to be decreased. [score:3]
Duisters R. F. Tijsen A. J. Schroen B. Leenders J. J. Lentink V. van der Made I. Herias V. van Leeuwen R. E. Schellings M. W. Barenbrug P. miR-133 and miR-30 regulate connective tissue growth factor: Implications for a role of microRNAs in myocardial matrix remo deling Circ. [score:2]
[1 to 20 of 4 sentences]
97
[+] score: 10
The miR-30 family has been shown to be down-regulated in mdx4cv mice (mo dels for Duchenne muscular dystrophy), with in vitro analysis indicating that miR-30 miRNAs are decreased following injury and are increased during myoblast differentiation [45]. [score:4]
Two members of the miR-30 family, miR-30b-5p and miR-30e-5p, had decreased expression post-exercise. [score:3]
The largest number of gene targets were identified for the miR-30 family members. [score:3]
[1 to 20 of 3 sentences]
98
[+] score: 10
The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS). [score:3]
The two shRNA sequences were placed into miR30 context downstream eGFP CDS and thereby lentiviral vectors expressing the miR-shRNAs, named as FUW-eGFP-miR-shRNA in this article, were constructed (Fig. 1). [score:3]
0030560.g001 Figure 1 The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS). [score:3]
To place the shRNA sequences into miR30 context, a 97-mer sequence containing the designed shRNA was retrieved through the RNAi design algorithm, which was then subcloned into the site of pri-miRNA area downstream the eGFP coding sequence (CDS) in pRIME vector as previously described [10]. [score:1]
[1 to 20 of 4 sentences]
99
[+] score: 10
miR30 is significantly down-regulated in several cancers, including breast cancer [30] and lung cancer [31] and it has been hypothesized that miR30 may play an important role in tumorigenesis and tumor development. [score:5]
The results showed that CLCNs were able to transfect the cells with miR30b as well as DharmaFect did and the miR30-b expression in vitro was increased by using CLCNs or DharmaFect. [score:3]
However, the function of miR30 especially in NSCLC remains unclear [32]. [score:1]
The tissues sections were collected 24 hours after treatment with CLCN D275/miR30 b complexes (1.5 mg/kg). [score:1]
[1 to 20 of 4 sentences]
100
[+] score: 10
Additionally, we discovered that miR-30c and miR-30e were upregulated in EB, which are expressed in human leukaemia cells [68], indicating that they have a role in controlling cell cycle and cell proliferation. [score:6]
We also identified EB upregulated miRNAs that have not been previously reported such as miR-130a, miR-301a, and miR-135, miR-190, miR-30c, and miR-30e. [score:4]
[1 to 20 of 2 sentences]