miRBase entry: hsa-mir-30c-1

Stem-loop hsa-mir-30c-1


Accession
MI0000736
Symbol
HGNC: MIR30C1
Description
Homo sapiens hsa-mir-30c-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR30C1 is a gene that encodes a microRNA involved in various cellular processes and is located on chromosome 1p34.2 [PMC5400605]. It interacts with the protein HNRNPK and is part of a cluster that includes another gene, MIR30C2, which encodes the same mature miRNA, hsa-mir-30c [PMC9730017]. In a study using cBioPortal, MIR30C1 was found to have frequent amplifications and significant changes in the levels of hsa-mir-30c in many patients [PMC4129468]. Additionally, MIR30C1 exhibited a high rate of loss at 88% in samples with miR-30c cluster deletion [PMC5400605]. In contrast to MIR30C2 which was deleted in 4 out of 5 cases with miR-30c cluster deletion, MIR30C1 was deleted in only 2 out of 5 cases [PMC5400605]. The clones used for studying these genes included RP11-170L4 for MIR30C1 and RP11-756H9 for MIR30C2 [PMC5400605]. These findings were part of an array Comparative Genomic Hybridization study that investigated genes expressing let-7a and miR-30c clusters on specific chromosomal locations [PMC5356719].

Literature search
419 open access papers mention hsa-mir-30c-1
(1882 sentences)

Sequence

1283446 reads, 2091.0 reads per million, 189 experiments
accaugcuguagugugUGUAAACAUCCUACACUCUCAGCugugagcucaagguggCUGGGAGAGGGUUGUUUACUCCuucugccaugga
.(((((..((((...(.(((((((.(((...(((((((((....(((...)))))))))))).))).))))))).)...))))))))).

Structure
a     cu    ugu U       U   ACA         guga   c 
 ccaug  guag   g GUAAACA CCU   CUCUCAGCu    gcu  
 |||||  ||||   | ||||||| |||   |||||||||    ||| a
 gguac  cguc   C CAUUUGU GGG   GAGGGUCgg    ugg  
a     --    uuC U       U   --A         ----   a 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. [1]. Two human hairpin precursor sequences are predicted based on homology with the mouse sequences, on chromosomes 1 (MIR:MI0000736) and 6 (MIR:MI0000254) [3]. Expression of miR-30c was later validated in human HL-60 leukemia cells [2].

Genome context
chr1: 40757284-40757372 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-30c-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature hsa-miR-30c-5p

Accession MIMAT0000244
Description Homo sapiens hsa-miR-30c-5p mature miRNA
Sequence 17 - UGUAAACAUCCUACACUCUCAGC - 39
Evidence experimental
cloned [2,4-6]
Database links
Predicted targets

Mature hsa-miR-30c-1-3p

Accession MIMAT0004674
Description Homo sapiens hsa-miR-30c-1-3p mature miRNA
Sequence 56 - CUGGGAGAGGGUUGUUUACUCC - 77
Evidence experimental
cloned [5]
Database links
Predicted targets

References

  1. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73