Stem-loop hsa-mir-30c-1

Accession

MI0000736

Symbol

HGNC: MIR30C1

Description

Homo sapiens hsa-mir-30c-1 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR30C1 is a gene that interacts with several protein-coding genes, miRNAs, lncRNAs, and rRNAs [PMC9730017]. Two SNPs (GOLGA7 rs11337, MIR30C1 rs16827546) were excluded due to low minor allele frequency (MAF) [PMC5313634]. Frequent amplifications were observed in MIR30C1 and MIR30C2 genes, which encode the same mature miRNA, hsa-mir-30c [PMC4129468]. MIR30C1 on 1p34.2 had a high rate of loss in samples with a miR-30c cluster deletion [PMC5400605]. The same deletion was observed in MIR30C2 on 6q13 [PMC5400605]. The clones used for the study were RP11-2B6 for MIRLET7A1 (9q22.32), RP11-453C14 for MIRLET7A2 (11q24.1), CTD-2504J8 for MIRLET7A3 (22q13.31), RP11-170L4 for MIR30C1 (1p34.2), and RP11-756H9 for MIR30C2 (6q13) [PMC5400605]. These findings were obtained from a previous study that used array Comparative Genomic Hybridization to investigate the expression of let-7a and miR-30c genes in specific genomic locations [PMC5356719]. References: [PMC9730017] [PMC5313634] [PMC4129468] [PMC5400605] [PMC5356719]

Literature search

384 open access papers mention hsa-mir-30c-1
(1839 sentences)

Sequence

279699 reads, 1532 reads per million, 159 experiments

accaugcuguagugugUGUAAACAUCCUACACUCUCAGCugugagcucaagguggCUGGGAGAGGGUUGUUUACUCCuucugccaugga
.(((((..((((...(.(((((((.(((...(((((((((....(((...)))))))))))).))).))))))).)...))))))))).

Structure

a     cu    ugu U       U   ACA         guga   c 
 ccaug  guag   g GUAAACA CCU   CUCUCAGCu    gcu  
 |||||  ||||   | ||||||| |||   |||||||||    ||| a
 gguac  cguc   C CAUUUGU GGG   GAGGGUCgg    ugg  
a     --    uuC U       U   --A         ----   a 

Annotation confidence High

Comments

miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. [1]. Two human hairpin precursor sequences are predicted based on homology with the mouse sequences, on chromosomes 1 (MIR:MI0000736) and 6 (MIR:MI0000254) [3]. Expression of miR-30c was later validated in human HL-60 leukemia cells [2].

Genome context

chr1: 40757284-40757372 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-30c-1

Mature hsa-miR-30c-5p

• Accession: MIMAT0000244
• Description: Homo sapiens hsa-miR-30c-5p mature miRNA
• Sequence: 17 - UGUAAACAUCCUACACUCUCAGC - 39
• Evidence: experimental ; cloned [2,4-6]

Mature hsa-miR-30c-1-3p

• Accession: MIMAT0004674
• Description: Homo sapiens hsa-miR-30c-1-3p mature miRNA
• Sequence: 56 - CUGGGAGAGGGUUGUUUACUCC - 77
• Evidence: experimental ; cloned [5]

References

1. PubMed ID: 15325244
   Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
   "Kasashima K, Nakamura Y, Kozu T"
   "Biochem Biophys Res Commun (2004) 322:403-410


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


4. PubMed ID: 15978578
   Identification of human fetal liver miRNAs by a novel method
   "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
   "FEBS Lett (2005) 579:3849-3854


5. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


6. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73