MIR30C1 is a gene that encodes a microRNA involved in various cellular processes and is located on chromosome 1p34.2 [PMC5400605]. It interacts with the protein HNRNPK and is part of a cluster that includes another gene, MIR30C2, which encodes the same mature miRNA, hsa-mir-30c [PMC9730017]. In a study using cBioPortal, MIR30C1 was found to have frequent amplifications and significant changes in the levels of hsa-mir-30c in many patients [PMC4129468]. Additionally, MIR30C1 exhibited a high rate of loss at 88% in samples with miR-30c cluster deletion [PMC5400605]. In contrast to MIR30C2 which was deleted in 4 out of 5 cases with miR-30c cluster deletion, MIR30C1 was deleted in only 2 out of 5 cases [PMC5400605]. The clones used for studying these genes included RP11-170L4 for MIR30C1 and RP11-756H9 for MIR30C2 [PMC5400605]. These findings were part of an array Comparative Genomic Hybridization study that investigated genes expressing let-7a and miR-30c clusters on specific chromosomal locations [PMC5356719].
a cu ugu U U ACA guga c ccaug guag g GUAAACA CCU CUCUCAGCu gcu ||||| |||| | ||||||| ||| ||||||||| ||| a gguac cguc C CAUUUGU GGG GAGGGUCgg ugg a -- uuC U U --A ---- a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0000244 |
| Description | Homo sapiens hsa-miR-30c-5p mature miRNA |
| Sequence | 17 - UGUAAACAUCCUACACUCUCAGC - 39 |
| Evidence |
experimental
cloned [2,4-6] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004674 |
| Description | Homo sapiens hsa-miR-30c-1-3p mature miRNA |
| Sequence | 56 - CUGGGAGAGGGUUGUUUACUCC - 77 |
| Evidence |
experimental
cloned [5] |
| Database links |
|
| Predicted targets |
|
|