sort by

176 publications mentioning hsa-mir-130b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-130b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 433
Other miRNAs from this paper: hsa-mir-23b, hsa-mir-122, hsa-mir-130a
As assessed by immunoblotting, down-regulation of miR-130b obviously restored the expression of PPARγ protein and led to up-regulation of E-cadherin and down-regulation of Vimentin in both Hep3B and MHCC97H cells (Figure 5A). [score:12]
In contrast, in the case of high miR-130b expression (b), there was no detectable PPAR-γ protein expression; (B) The expression level of miR-130b in the positive PPAR-γ expression group was significantly lower than that in the negative PPAR-γ expression group. [score:11]
As assessed by qRT-PCR, the expression of miR-130b was down-regulated by ectopically expressing miR-130b inhibitors in both cell lines (p < 0.05, respectively, Figure 3A). [score:10]
Our data showed that down-regulation of miR-130b increased the expression level of PPAR-γ and suppressed EMT in two different HCC cell lines, Hep3B and MHCC97H. [score:8]
Importantly, down-regulation of miR-130b increases PPAR-γ expression and subsequently suppressed EMT in HCC cells. [score:8]
Representative WB showed that down-regulation of miR-130b obviously increased protein expression of PPAR-γ and E-cadherin and reduced Vimentin expression in HCC cells; (B) miR-130b and its putative binding sequence in the 3'-UTR of PPAR-γ. [score:8]
PPAR-γ knockdown can abolish the effect of miR-130b down-regulation on anti-metastasis in HCC, suggesting that miR-130b functions as a pro-metastatic factor by downregulating PPAR-γ. [score:8]
We demonstrate that down-regulation of miR-130b reduces cell migration and invasion by restoring PPAR-γ expression and subsequently suppressing EMT in HCC cells. [score:8]
Furthermore, PPARγ knockdown by a specific siRNA abrogated the expression change of these genes induced by down-regulation of miR-130b in MHCC97H cells (Figure 5C). [score:7]
In conclusion, this study shows that the expression level of miR-130b is up-regulated in tumor tissues as compared with matched adjacent nontumor liver tissues and that high miR-130b expression level confers metastasis and recurrence of HCC. [score:7]
Furthermore, the expression level of Vimentin in the low miR-130b expression group was significantly lower than that in high miR-130b expression group (p < 0.05, Figure 2). [score:7]
We next analyzed the correlation among miR-130b expression, E-cadherin expression and Vimentin expression in 86 HCC cases. [score:7]
The expression of PPARγ levels in miR-130b high -expressing tumors was significantly lower than those in miR-130b low -expressing tumors (p < 0.05, Figure 4A). [score:7]
Lee E. K. Lee M. J. Ab delmohsen K. Kim W. Kim M. M. Srikantan S. Martindale J. L. Hutchison E. R. Kim H. H. Marasa B. S. miR-130 suppresses adipogenesis by inhibiting peroxisome proliferator-activated receptor gamma expression Mol. [score:7]
Interestingly, we found that the expression level of E-cadherin in low miR-130b expression group was significantly higher than that in the high miR-130b expression group. [score:7]
We found that the expression level of E-cadherin in low miR-130b expression group was significantly higher than that in high miR-130b expression group (p < 0.05, Figure 2). [score:7]
Down-regulation of miR-130b inhibits HCC cell migration and invasion in vitro. [score:6]
In contrast, Vimentin was expressed at significant lower levels in low miR-130b expression group as compared with that in high miR-130b expression group. [score:6]
Our loss-of-function experiments demonstrated that down-regulation of miR-130b expression significantly reduced the number of migrated and invaded cells in both Hep3B and MHCC97H cells. [score:6]
Taken together, these data indicate that miR-130b directly suppresses PPARγ expression that subsequently promotes EMT progression in HCC. [score:6]
Leone V. Langella C. D’Angelo D. Mussnich P. Wierinckx A. Terracciano L. Raverot G. Lachuer J. Rotondi S. Jaffrain-Rea M. L. Mir-23b and miR-130b expression is downregulated in pituitary adenomas Mol. [score:6]
Functional studies demonstrate that down-regulation of miR-130b inhibits HCC cell migration and invasion. [score:6]
The miR-130b expression was significantly up-regulated in all HCC cell lines as compared with that in LO2 (p < 0.05, Figure 1D). [score:5]
In contrast, in the case of high miR-130b expression (C, D), there was no detectable E-cadherin and strong Vimentin protein expression. [score:5]
In cases of low miR-130b expression (A, B); there was strong E-cadherin and no detectable Vimentin protein expression in the same tissue section. [score:5]
Thus, we determined the expression of epithelial marker (E-cadherin) and mesenchymal marker (Vimentin) in HCC samples with either low or high miR-130b expression. [score:5]
Quantification of the data indicated that miR-130b expression in tumor tissues was significantly up-regulated as compared with that in nontumor tissues. [score:5]
MiRNA vectors, including miR-130b inhibitor and the negative control for the miR-130b inhibitor, and PPAR-γ siRNA (5'-AAUAUGACCUGAAGCUCCAAGAAUAAG-3') were purchased from Genecopoeia (Guangzhou, China). [score:5]
Thus, miR-130b may promote EMT by inhibiting PPAR-γ expression in HCC. [score:5]
The effect of miR-130b down-regulation on EMT is blocked by PPAR-γ knockdown in MHCC97H cells. [score:5]
As expected, inhibition of endogenous miR-130b by miR-130b inhibitors led to increased luciferase activity of the wild-type reporter but not the mutant reporter (p < 0.05, Figure 5B). [score:5]
Clinical analysis found that miR-130b was expressed at significantly higher levels in HCC patients with venous infiltration, high Edmondson-Steiner grading and advanced TNM tumor stage, suggesting that high -expression of miR-130b is obviously correlated with poor prognostic features in HCC. [score:5]
Herein, we validated PPARγ as a direct functional target of miR-130b in HCC, adding information to previously reported cell types [18, 31]. [score:4]
According to PPARγ status, PPARγ negative -expressing tumors (n = 47) showed higher levels of miR-130b as compared with PPARγ positive -expressing ones (n = 39, p < 0.05, Figure 4B). [score:4]
Thus, the up-regulation of miR-130b may be responsible for the progression of EMT in HCC. [score:4]
In conclusion, we find that miR-130b is up-regulated in HCC tissues, especially in aggressive and recurrent tumor tissues. [score:4]
Thus, up-regulation of miR-130b level was correlated with metastasis and recurrence of HCC. [score:4]
Recently, PPAR-γ in colorectal cancers has been found to be a direct target of miR-130b and contribute to EMT mediated by miR-130b [18]. [score:4]
We found that down-regulation of miR-130b led to a significant reduction of cell migration in both Hep3B and MHCC97H cells (p < 0.05, respectively, Figure 3B). [score:4]
However, in melanoma [14], gastric cancer [15, 16], bladder cancer [17], colorectal cancer [18], and metastatic renal carcinoma [19], miR-130b was found to be up-regulated. [score:4]
And compared with CD133-cells with lower expression of miR-130b, CD133+ cells, which were identified as tumor-initiating cells of HCC, had higher expression of miR-130b and thereby possessed a greater ability to form undifferentiated tumor spheroids [23]. [score:4]
Notably, the regulatory effect of reduced miR-130b expression on PPAR-γ, E-cadherin and Vimentin were inverted by PPAR-γ siRNA in MHCC97H cells. [score:4]
PPAR-γ is identified as a direct target of miR-130b in HCC. [score:4]
Recently, Wang et al. [27] reported that miR-130b expression level was significantly higher in HCC tissues compared with normal adjacent liver tissues and high expression of miR-130b correlated with poor prognosis of HCC patients. [score:4]
In our study, the inverse correlation between miR-130b and PPAR-γ expression was observed in HCC tissues. [score:3]
The relative expression of miR-130b was shown as fold difference relative to U6. [score:3]
Moreover, miR-130b expression in the highly metastatic HCC cell line MHCC97H was obviously higher than those in the low metastatic HCC cell lines including HepG2, SMCC-7721, Huh7 and Hep3B (Figure 1D). [score:3]
We initially detected the expression level of miR-130b in 40 pairs of HCC tissues and adjacent nontumor tissues. [score:3]
To investigate the role of miR-130b in HCC, we suppressed the expression level of miR-130b in two HCC cell lines, Hep3B and MHCC97H. [score:3]
Clinical analysis indicated that high -expression of miR-130b was prominently correlated with poor clinicopathological parameters in HCC. [score:3]
An inverse correlation between miR-130b and PPAR-γ expression is observed in HCC tissues. [score:3]
The expression level of miR-130b is correlated with EMT markers in HCC tissues. [score:3]
Furthermore, as determined by Transwell assays, the number of invaded Hep3B and MHCC97H cells was significantly reduced after down-regulation of miR-130b (p < 0.05, respectively, Figure 3C). [score:3]
A positive relationship between the expression of miR-130b and Vimentin was observed in the same cohort of HCC cases (rho = 0.4590, p = 0.037). [score:3]
Eighty-six samples of HCC tissues were subjected to qRT-PCR for miR-130b expression. [score:3]
Comparing differences in the expression levels of miR-130b between (A) HCC and matched nontumor tissues; (B) aggressive and nonaggressive tumor tissues; (C) HCC tissues arising from recurrent and non-recurrent groups; and (D) HCC cell lines with different metastatic potentials and the immortalized hepatic cell line LO2. [score:3]
These data indicates that elevated miR-130b expression confers increased metastatic potential of HCC cells. [score:3]
Furthermore, miR-130b is inversely correlated with PPAR-γ in HCC tissues and it directly regulates PPAR-γ abundance in HCC cells. [score:3]
Repressed expression of miR-130b by p53 mutants led to zinc-finger E-box binding homeobox 1 (ZEB1) -dependent epithelial-mesenchymal transition (EMT) in endometrial cancer [11]. [score:3]
Wang W. Y. Zhang H. F. Wang L. Ma Y. P. Gao F. Zhang S. J. Wang L. C. High expression of microRNA-130b correlates with poor prognosis of patients with hepatocellular carcinoma Diagn. [score:3]
In this study, we demonstrate that elevated miR-130b expression is observed in the aggressive phenotype of HCC. [score:3]
Elevated miR-130b expression levels are observed in HCC cell lines, especially in the highly metastatic cell lines. [score:3]
Figure 1The expression levels of miR-130b in HCC (Hepatocellular Carcinoma) tissues and cells. [score:3]
Our results demonstrate that miR-130 potentiates the invasive behavior of HCC cells and may contribute to tumor metastasis by inhibiting PPAR-γ and promoting EMT. [score:3]
Moreover, elevated miR-130b expression was observed in HCC cell lines, especially in the highly metastatic HCC cell line MHCC97H. [score:3]
Importantly, our results showed that elevated miR-130b expression conferred a significant higher recurrence rate for HCC patients. [score:3]
Lai K. W. Koh K. X. Loh M. Tada K. Subramaniam M. M. Lim X. Y. Vaithilingam A. Salto-Tellez M. Iacopetta B. Ito Y. MicroRNA-130b regulates the tumour suppressor RUNX3 in gastric cancer Eur. [score:3]
These data indicate that miR-130b expression level may be correlated with the EMT of HCC. [score:3]
Moreover, miR-130b was positively associated with Vimentin expression in HCC tissues. [score:3]
Furthermore, an inverse correlation between miR-130b and E-cadherin expression was observed in HCC tissues. [score:3]
Previous studies reported that miR-130b led to PPARγ suppression that in turn promotes EMT progression in colorectal cancer [18]. [score:3]
Next, Hep3B and MHCC97H cells that were transfected with miR-130b inhibitors or negative control were subjected to western blot for PPARγ, E-cadherin and Vimentin. [score:3]
Otherwise, the expression level of miR-130b is correlated with EMT markers in HCC. [score:3]
The expression level of miR-130b in HCC tissues was significantly higher than that in matched adjacent nontumor liver tissues (p < 0.05, Figure 1A). [score:3]
Furthermore, miR-130b was expressed at significantly higher levels in aggressive tumors than in nonaggressive tumors. [score:3]
Elevated miR-130b Expression Confers Metastasis and Recurrence of HCC (Hepatocellular Carcinoma). [score:3]
High-Expression of miR-130b Correlates with Mesenchymal Phenotype of HCC. [score:3]
The predicted 3'-UTR sequence of PPARγ that interacted with miR-130b, together with a corresponding mutated sequence within the predicted target sites, were synthesized and inserted into the pRL-TK control vector (Promega, Madison, WI, USA). [score:3]
We determined 0.49 (mean level of miR130b) as a cutoff value for the expression level of miR-130b. [score:3]
MHCC97H cells that were seeded in a 96-well plate were transfected with 120ng miR-130b inhibitor or negative control. [score:3]
Spearman correlation analysis indicated an inverse correlation between the expression of miR-130b and E-cadherin (rho = −0.4920, p = 0.015). [score:3]
Clinical Significance of miR-130b Expression in HCC Specimens. [score:3]
Taken together, we consider that miR-130b may potentially act as an onco-miRNA, and may also be a therapeutic target, in HCC. [score:3]
The high -expression of miR-130b is evidently correlated with poor prognostic features in HCC. [score:3]
As compared with nonaggressive HCC tissues, miR-130b levels were prominently up-regulated in aggressive HCC tissues (p < 0.05, Figure 1B). [score:3]
The high -expression of miR-130b is associated with poor prognostic features in HCC. [score:3]
As shown in Table 1, the high -expression of miR-130b was prominently associated with venous infiltration (p = 0.009), high Edmondson-Steiner grading (p = 0.008) and advanced TNM tumor stage (p < 0.001). [score:3]
Spearman correlation analysis indicated that miR-130b was inversely correlated with PPARγ expression in HCC (rho = −0.6216, p < 0.001). [score:3]
Next, we analyzed miR-130b expression in a nontransformed hepatic cell line (LO2) and a panel of HCC cell lines (HepG2, SMMC-7721, Huh7, Hep3B and MHCC97H). [score:3]
We tested the expression of miR-130b by qRT-PCR and normalized against an endogenous control (U6 RNA) in 40 pairs of randomly selected tumor tissues and matched adjacent nontumor tissues from HCC patients who received liver resection. [score:3]
To further demonstrate that PPARγ is directly targeted by miR-130b in HCC cells, we investigated whether the miR-130b directly interacted with the 3'-UTR of PPARγ mRNA using a dual-luciferase reporter assay. [score:2]
Therefore, the functional significance of miR-130b in cancer development and progression seem to be cancer-type specific. [score:2]
miR-130b is proposed as a novel tumor-related miRNA and has been found to be significantly dysregulated in tumors [9]. [score:2]
Our results indicate that miR-130b might be critical for the regulation of tumor invasion and metastasis in HCC patients. [score:2]
n = 6; * p < 0.05 by t test; (B) Cell migration as measured by Boyden chamber assays was inhibited by down-regulation of miR-130b in Hep3B and MHCC97H cells as compared with control cells. [score:2]
However, the molecular pathways through which miR-130b modulates the development and progression of HCC have not been elucidated. [score:2]
The expression of miR-130b was considered as either low (<0.49, n = 46) or high (≥0.49, n = 40). [score:2]
MiR-130b Promotes EMT (Epithelial-Mesenchymal Transition) by Inhibiting PPARγ in HCC. [score:2]
Anti-miR-130b led to a noticeable increase in luciferase activity of wt 3'-UTR of PPAR-γ in MHCC97H cells. [score:1]
Thus, miR-130b exerts a pro-metastatic effect on HCC. [score:1]
This study reveals that miR-130b may play a critical role in the invasion and metastasis of HCC. [score:1]
These reports indicate that miR-130b acts as an onco-miRNA in HCC. [score:1]
Figure 4Correlation between miR-130b and PPAR-γ in HCC tissues. [score:1]
Recently, miR-130b was identified as a robust biomarker of hepatocellular carcinoma (HCC) with high positive predictive value [21]. [score:1]
However, the putative binding sequences of miR-130b were not found in the 3'-UTR of E-cadherin and Vimentin. [score:1]
Promoting Effect of miR-130b on HCC Cell Migration and Invasion. [score:1]
Thus, our results indicate that high -expression of miR-130b is correlated with malignant clinicopathologic characteristics in HCC. [score:1]
Recently, miR-130b was identified as a robust biomarker of HCC with high positive predictive value [21]. [score:1]
Furthermore, miR-130b is correlated with EMT markers, E-cadherin and Vimentin, in HCC tissues. [score:1]
ijms-15-20486-t001_Table 1 Table 1 Correlation between the clinicopathologic characteristics and miR-130b expression in HCC. [score:1]
We evaluated the correlation between PPARγ and miR-130b expression in our HCC samples. [score:1]
Altogether, these results suggest that miR-130b is critical for prognosis determination in HCC patients. [score:1]
The mutant miR-130b binding site was generated in the complementary site for the seed region of miR-130b (wt, wild type; mt, mutant type). [score:1]
Elevated miR-130b in plasma was associated with poor response of chemotherapy in colorectal cancer [20]. [score:1]
[1 to 20 of 114 sentences]
2
[+] score: 303
An increase in miR-130b by miR-130b mimics transfection leads to the reduced expression of integrin β1, while knockdown miR-130b with miR-130b inhibitor results in increased integrin β1 expression. [score:8]
In our study, we compared miRNA expression in specimens from CRC patients using a microRNA microarray and observed the significant upregulation of miR-130b expressed in the CRC specimens. [score:7]
B, Western blot analyses of integrin β1 expression in the SW480 cells transfected with NC, miR-130b mimics (panel a) and miR inhibitor control (Anti-NC) or miR-130b inhibitor (Anti-miR-130b) (panel b) from three independent experiments. [score:7]
MiR-130b inhibits cell migration and invasion through downregulation of the expression of integrin β1. [score:7]
The inhibition of migration and invasion of CRC cells through direct targeting of integrin β1 is consistent with the anti-metastatic role proposed for miR-130b [28], [29]. [score:6]
MiR-130b targets the 3′-UTR of integrin β1 to suppress its expression. [score:6]
Our data suggested that integrin β1 is a target gene of miR-130b and the downregulation of integrin β1 by miR-130b leads to the impaired migration and invasion of CRC cells. [score:6]
Knockdown endogenous miR-130b with miR-130b inhibitor boosts integrin β1 expression (Fig. 4B (b)). [score:6]
Taken together, these findings demonstrated that miR-130b suppresses cell migration and invasion, at least in part, through downregulation of integrin β1 in CRC cells. [score:6]
In summary, our data showed that miR-130b downregulates its novel target-integrin β1, leading to the impaired cell motility of CRC cells. [score:6]
These data indicated that miR-130b suppresses cell migration and invasion of CRC cells, at least in part, through downregulation of integrin β1. [score:6]
The results showed that the expression of integrin β1 is suppressed after transfection with miR-130b mimics (Fig. 4B (a)). [score:5]
Moreover, the inverse correlation between miR-130b expression and integrin β1 expression was found in 23 of 33 pairs (69.7%) of CRC clinical samples. [score:5]
We then generated lentiviral vector expressing primary microRNA 130b (Lenti-pri-miR-130b) (Fig. 1C upper panel), and constructed SW-480 cells with stable overexpression of miR-130b (Lenti-miR-130b cells) and the respective control (Lenti-vector cells). [score:5]
Nonetheless, one miRNA may on average control more than 200 target genes [45], our data do not preclude the existence of still-uncharacterized miR-130b target genes that are involved in the motility in a manner that is masked by the consequences of altering integrin β1 expression. [score:5]
Furthermore, the impaired motility of miR-130b overexpression cells is rescued partly by the expression of integrin β1 lacking the 3′-UTR (Fig. 5). [score:5]
We analyzed the expression of miR-130b by qRT-PCR and the expression level of integrin β1 by Western blot. [score:5]
It has been reported that in the TAp63 knockout mouse mo del, downregulation of miR-130b by the loss of TAp63 results in an increase in tumor metastasis [28]. [score:5]
Analysis of relationship between miR-130b expression and the clinicopathological features of 32 endometrial cancer patients showed that patients with higher expression of miR-130b survived longer [29]. [score:5]
Lower panel: Relative expressions of miR-130b (normalized to U6) in SW480 cells that stably expresses miR-130b (Lenti-miR-130b) or control (Lenti-control), examined by qRT-PCR (mean±s. [score:5]
Recently, miR-130b is revealed as one of novel tumor-related miRNAs and has significantly dysregulated in tumors by a comprehensive meta-analysis of miRNA expression microarray datasets, which comprises 33 comparisons and nearly 4,000 tumor and corresponding nontumors samples [4]. [score:4]
In the microarray readouts, we noticed that miR-130b is one of significantly upregulated miRNAs. [score:4]
MiR-130b suppresses integrin β1 expression via its 3′-UTR. [score:4]
Previous studies also have shown that miR-130b is downregulated in aggressive papillary thyroid carcinomas [47]. [score:4]
MiR-130b (Red Arrow) is one of significantly upregulated miRNAs. [score:4]
To test the potential roles of the increased expression of miR-130b in CRC, we performed functional assays after constructing CRC cell line with stable overexpression of miR-130b. [score:4]
The luciferase reporter assay showed that miR-130b binds to the 3′-UTR of integrin β1 and suppresses its expression (Fig. 4). [score:4]
Accordingly, miR-130b has been found upregulated in various types of cancer: gastric cancer [5], [6], cutaneous malignant melanoma [7], head and neck squamous cell carcinoma [8] and bladder cancer [9]. [score:4]
In addition, the downregulation of miR-130b confers a multidrug-resistant phenotype in ovarian cancer cells [30]. [score:4]
MiR-130b is one of the upregulated miRNAs. [score:4]
Next, to confirm the regulation of miR-130b to integrin β1 in CRC cells, we tested the integrin β1 protein level in the cells transfected with miR-130b mimics and miR-130b inhibitor (Anti-miR-130b) respectively (Fig. 4B). [score:4]
As mentioned before, upregulated miR-130b was found in some types of cancer, such as: gastric cancer [5], [6], cutaneous malignant melanoma [7], bladder cancer [9] and head and neck squamous cell carcinoma [8]. [score:4]
The effect of miR-130b on luciferase expression was eliminated when the 3′-UTR of integrin β1 was cloned in reverse orientation (3′-ITGB1-rev) (Fig. 4A). [score:3]
B, Relative expressions of miR-130b (normalized to U6) in tumors over adjacent control tissues (T/N) from P1, P2, and P3, determined by qRT-PCR (mean±s. [score:3]
The consistent result was observed in SW-620 cells with overexpression of miR-130b (Fig. 3B). [score:3]
D, Western blot analyses of caspase-3 and caspase-8 expression in Lenti-control cells and Lenti-miR-130b cells from three independent experiments. [score:3]
C, Protein expression of E-cadherin analyzed by immunoblot in Lenti-control cells and Lenti-miR-130b cells from three independent experiments. [score:3]
0087938.g003 Figure 3 A, Upper panel: Western blot analyses of integrin β1 protein expression in Lenti-control cells and Lenti-miR-130b cells (SW480 cells) from three independent experiments. [score:3]
Elevated miR-130b results in decreased integrin β1 expression level. [score:3]
Taken together, our data suggested that integrin β1 is a target gene of miR-130b. [score:3]
The hsa-miR-130b mimics, hsa-miR-130b inhibitor (anti-miR-130b), control mimics and siRNA against integrin β1 [18] were synthesized by Ribobio (Guangzhou, China). [score:3]
All these results suggested that overexpression of miR-130b results in the impaired cell motility of CRC cells, but it has no effect on proliferation and apoptosis of CRC cells. [score:3]
Increased miR-130b expression observed in CRC specimens. [score:3]
Inverse correlation between miR-130b and integrin β1 expression in CRC specimens. [score:3]
However, another report has suggested that the overexpression of miR-130b in CD133 (+) liver tumor-initiating cells increases their self-renewal capacity and chemoresistance [31]. [score:3]
Moreover, we didn't observe the obvious different expression levels of apoptotic caspases- caspase 3 and caspase 8 between Lenti-vector cells and Lenti-miR-130b cells (Fig. 2D). [score:3]
To better understand its potential functions in CRC, we firstly used qRT-PCR to confirm the miR-130b expression in the 3 CRC patients (Fig. 1B). [score:3]
The sequences used were as follows: hsa-miR-130b mimics, 5′-CAGUGCAAUGAUGAAAGGGCAU-3′; hsa-miR-130b inhibitor, 5′-AUGCCCUUUCAUCAUUGCACUG-3′; integrin β1 siRNA, (sense) 5′-GGAACAGCAGAGAAGCUCA-3′ [18]; The SW480 cells were transfected using RNAiMax (Invitrogen, Carlsbad, USA) or Lipofectamine 2000 (Invitrogen, Carlsbad, USA) according to the manufacturer's instructions. [score:3]
Overexpression of integrin β1-ORF rescues partly the motility of the Lenti-miR-130b cells. [score:3]
Moreover, miR-130b expression is likely reduced in later stages of tumor progression in endometrial cancer patients [29]. [score:3]
These results suggest that miR-130b may have a dual function as a tumor suppressor or an oncogene, which depends on the cancer type and cellular context. [score:3]
Inverse correlation between miR-130b and integrin β1 expression in human colorectal specimens. [score:3]
The relative expression ratio of miR-130b (normalized to U6) in T over N (T/N) was represented as a fold difference (columns in dark gray). [score:3]
Our data showed that miR-130b exerts a significant inhibitory effect on motility of the CRC cells (Fig. 2), but has no effects on cell proliferation and apoptosis. [score:3]
We observed that miR-130b significantly inhibits the migration of the Lenti-miR-130b cells (Fig. 2A). [score:3]
A decreased level of integrin β1 protein was observed due to overexpression of miR-130b in CRC specimens (Fig. 3D) and in CRC cells (Fig. 3A and 3B) as well. [score:3]
As shown in Fig. 7, by comparing tumors to normal tissues, an inverse correlation between miR-130b and integrin β1 expression was found in 23 of 33 (69.7%) pairs of clinical samples. [score:3]
A, Upper panel: Western blot analyses of integrin β1 protein expression in Lenti-control cells and Lenti-miR-130b cells (SW480 cells) from three independent experiments. [score:3]
In this study, we identified that integrin β1 is a novel target of miR-130b. [score:3]
A, Left panel: Western blot analyses of integrin β1 expression in Lenti-control cells, Lenti-miR-130b cells, Lenti-miR-130b cells transfected with control vector or β1-ORF vector from three independent experiments. [score:3]
Consistent with the microarray readouts in Fig. 1A, the qRT-PCR results revealed the enhanced expression of miR-130b in the 3 CRC tumor tissues (Fig. 1B). [score:3]
0087938.g005 Figure 5 A, Left panel: Western blot analyses of integrin β1 expression in Lenti-control cells, Lenti-miR-130b cells, Lenti-miR-130b cells transfected with control vector or β1-ORF vector from three independent experiments. [score:3]
It is notable that the decreased level of integrin β1 protein was detected in the overexpression miR-130b CRC cells (Lenti-miR-130b cells) and CRC specimens as well. [score:3]
B (a), Relative expressions of miR-130b (normalized to U6) in SW620 cells infected with lenti-control virus or lenti-miR-130b virus, examined by qRT-PCR (mean±s. [score:3]
MiR-130b suppresses cell migration and invasion of CRC cells. [score:2]
Similarly, in pancreatic cancer, the deregulated miR-130b is correlated with worse prognosis [46]. [score:2]
Furthermore, cell migration assays showed that the ectopic expression of integrin β1-ORF was capable of partly recovering the motility of the Lenti-miR-130b cells by 76% (Fig. 5B and 5C). [score:2]
In this study, we found that ectopic expression of miR-130b in SW480 cells results in a decrease in the endogenous integrin β1 protein level of four Lenti-miR-130b colonies by approximate 50%, compared with that of the Lenti-vector cells (Fig. 3A). [score:2]
The SW-480 cells were co -transfected with pmirGlo vector containing the 3′-UTR of integrin β1 and miR-130b mimics (Fig. 4A), the result showed significantly lower expression of the luciferase compared with the cells transfected with the same reporter vector and control microRNA mimics (NC) (Fig. 4A). [score:2]
MicroRNA 130b (miR-130b) is significantly dysregulated in many human tumor types. [score:2]
We observed a clear increase in integrin β1 expression in the Lenti-miR-130b cells transfected with β1-ORF, compared to the cells with control vector (Fig. 5A). [score:2]
0087938.g007 Figure 7 The expression of miR-130b was measured by qRT-PCR, the expression of integrin β1 was measured by Western blot analysis in a cohort of 33 matched-pairs of adjacent normal (N) and tumor (T) tissues. [score:1]
Therefore, we postulate that the increased miR-130b in CRC might indicate less metastasis. [score:1]
The four colonies of Lenti-miR-130b cells (SW480 cells) are referred to 1,2,3,4. [score:1]
Lenti-miR-130b+β1-ORF: the Lenti-miR-130b cells transfected with β1-ORF vector. [score:1]
Of the 23 pairs, 12 pairs showed the increased miR-130b and the decreased integrin β1; 11 pairs demonstrated the decreased miR-130b and the elevated integrin β1. [score:1]
Additionally, the correlations between miR-130b and progression and metastasis were reported in renal cell carcinoma [48]. [score:1]
However, the role of miR-130b in CRC is not well understood. [score:1]
The four colonies of Lenti-miR-130b cells are referred to 1,2,3,4. [score:1]
C, Upper panel: Schematic diagram of a lentiviral pLVX-IRES-Hyg vector containing the primary microRNA 130b (Lenti-miR-130b). [score:1]
We next examined how miR-130b might function inside colorectal cancer cells. [score:1]
To further test the correlation between integrin β1 and miR-130b, we extended our analysis in a cohort of 33 matched-pairs of clinical adjacent normal (N) and colorectal tumor tissues (T). [score:1]
Detection of increased miRNA-130b levels in CRC specimens. [score:1]
To further investigate that suppression of integrin β1 by miR-130b results in the impaired motility of Lenti-miR-130b cells, we performed an integrin β1 rescue experiment using the Lenti-miR-130b cells. [score:1]
A growing number of studies have reported miR-130b as tumor-related miRNA and miR-130b plays an important role during oncogenesis [4]. [score:1]
The repression of miR-130b by a p53 mutant results in the enhancement of ZEB1 -dependent EMT and cell invasion in endometrial cancer cells [29]. [score:1]
A, The complete 3′-UTR of the integrin β1 gene (3′-ITGB1) were cloned into the pmirGlo Dual-luciferase reporter vector and co -transfected with miR-130b mimics (miR-130b) and control miR mimics (NC) into the SW480 cells, respectively. [score:1]
All these data suggested the anti-metastatic role of miR-130b. [score:1]
Our results open a possibility that miR-130b is a miRNA with potential anti-metastasis activity in CRC. [score:1]
The PCR amplicon of pri-miR-130b was also subcloned into the pWPI lentiviral vector (Addgene, Cambridge, MA, USA) to generate pWPI-miR-130b. [score:1]
Pri-miR-130b cloning, lentivirus production and transduction. [score:1]
The Lenti-vector cells and Lenti-miR-130b cells were utilized to analyze the effects of miR-130b on CRC cells. [score:1]
The primers used were as follows: hsa-miR-130b Forward 5′-GCCGCCAGTGCAATGATGAA-3′ hsa-miR-130b Reverse 5′-GTGCAGGGTCCGAGGT-3′; U6 Forward 5′-CGCTTCGGCAGCACATATACTA-3′; U6 Reverse 5′-CGCTTCACGAATTTGCGTGTCA-3′ The full-length 3′-untranslated region (3′-UTR) fragments of the integrin β1 gene were amplified by PCR from human genomic DNA using primers Forward 5′-GTACTGCCCGTGCAAATCCCACAAC-3′ and Reverse 5′-TGCTTTTCCTCAACTTCTTTAATC-3, and were cloned into a pMD18-T vector (TaKaRa, Dalian, China). [score:1]
0087938.g004 Figure 4 A, The complete 3′-UTR of the integrin β1 gene (3′-ITGB1) were cloned into the pmirGlo Dual-luciferase reporter vector and co -transfected with miR-130b mimics (miR-130b) and control miR mimics (NC) into the SW480 cells, respectively. [score:1]
The expression of miR-130b was measured by qRT-PCR, the expression of integrin β1 was measured by Western blot analysis in a cohort of 33 matched-pairs of adjacent normal (N) and tumor (T) tissues. [score:1]
Together, it has been estimated that miR-130b plays key roles during oncogenesis. [score:1]
The significance and clinical relevance of miR-130b in CRC is clearly needed to further demonstrate. [score:1]
Interesting, there is no significant difference in proliferation between Lenti-vector cells and Lenti-miR-130b cells (Fig. 2C). [score:1]
The virus particles were harvested 48 h after the transfection of pLVX-miR-130b into HEK-293T cells using the Lenti-HT packaging mix (TaKaRa, Dalian, China). [score:1]
Lenti-miR-130b+control vector: the Lenti-miR-130b cells transfected with control vector. [score:1]
[1 to 20 of 100 sentences]
3
[+] score: 273
The qRT-PCR and western blot results showed that the overexpression of miR-130b downregulated the expression of STAT3 in pancreatic cancer cells by both interfering with and degrading mRNA, whereas the anti-miR-130b upregulated the STAT3 expression. [score:13]
To explore the potential target through which the miR-130b inhibits the proliferation and invasion of pancreatic cancer cells, we took advantage of bioinformatics to predict the putative miR-130b targets by using TargetScan, miRanda and PicTar algorithms. [score:9]
Finally, the inverse correlation between miR-130b and STAT3 expression in PC and NP tissues was further confirmed that miR-130b downregulation resulted in STAT3 overexpression. [score:8]
Yang et al. showed that the miR-130b downregulation promoted the development of multidrug resistant ovarian cancer partially by targeting the 3′-UTR of CSF-1, while miR-130b silencing might be mediated by DNA methylation [32]. [score:7]
To date, miR-130b has been found to be deregulated in some types of cancers including being overexpressed in gastric cancer [13], [14], glioma [15] and renal cell cancer [16], while being downregulated in endometrial cancer [17] and papillary thyroid carcinoma [18]. [score:7]
On the contrary, transfection of anti-miR-130b resulted in an upregulation in the STAT3 expression. [score:6]
This study also implied that miR-130b played an important role in the regulation of pancreatic cancer malignant behavior including cell proliferation and invasion by directly targeting STAT3. [score:5]
Taken together, these data demonstrated that miR-130b could inhibit cell growth and invasion of pancreatic cancer by targeting STAT3. [score:5]
Lai et al. demonstrated that miR-130b was obviously overexpressed in gastric cancer and its overexpression increased cell viability and reduced cell death [13]. [score:5]
Moreover, the Kapan-meier survival analysis revealed that the patients with a low miR-130b expression had a significantly poorer prognosis than those with a high expression (Fig. 1C). [score:5]
It was also revealed that miR-130b suppressed the pancreatic cancer cells proliferation both in vitro and in vivo by induction of apoptosis and cell cycle arrest, as well as inhibited invasiveness in vitro. [score:5]
However, the other results demonstrated that miR-130b was significantly upregulated and acted as a tumor promoter. [score:4]
Our research further identified the potential direct target by which the miR-130b exerted its function on pancreatic cancer cells. [score:4]
STAT3 could be the Direct Target of miR-130b. [score:4]
The miR-130b downregulation was significantly correlated with an overall shorter survival. [score:4]
In summary, our present study demonstrated that the deregulated expression of miR-130b was associated with poor prognosis and aggressive phenotype of pancreatic cancer. [score:4]
STAT3 is the direct target of miR-130b in PANC-1 cells. [score:4]
In this study, we found that miR-130b was frequently down-regulated in both pancreatic cancer tissues and cell lines. [score:4]
The luciferase activity data showed that miR-130b was able to directly target the 3′UTR of STAT3. [score:4]
Yip et al. revealed that the downregulated miR-130b was highly correlated with the aggressive phenotype of papillary thyroid carcinoma [18]. [score:4]
STAT3 was Upregulated in Pancreatic Tissues and was Inversely Correlated with miR-130b Levels. [score:4]
These results demonstrated that miR-130b inhibited the proliferation of pancreatic cancer cells both in vitro and in vivo. [score:3]
Moreover, patients with a higher expression of miR-130b were less frequently associated with invasion/metastasis. [score:3]
Therefore, approaches to introduce miR-130b into cancer cells might be potentially feasible for clinical treatment of pancreatic cancer, especially for those with lower miR-130b expression in tumor tissues. [score:3]
Furthermore, the correlation between the expression of miR-130b and STAT3 in pancreatic cancer samples was further explored. [score:3]
In addition, multivariate analysis indicated that the low miR-130b expression, advanced TNM stage and distant metastasis were significant prognostic factors for a poor overall survival rate of pancreatic cancer patients. [score:3]
Analysis of miR-130b expression in human pancreatic cancer tissues and cell lines, and the pancreatic cancer patient survival. [score:3]
A significant inverse correlation was observed between STAT3 and miR-130b expressions in pancreatic cancer tissues (Spearman’s correlation, r = −0.4903; P<0.01) and adjacent noncancerous tissues (r = −0.4026; P<0.001) (Fig. 6B). [score:3]
Furthermore, patients with tumor invasion and metastasis had a significantly lower miR-130b expression. [score:3]
In present study, the expression of miR-130b between pancreatic cancer and the normal adjacent pancreatic tissues were analyzed. [score:3]
The bioinformatics analysis indicated that STAT3 might be one of the potential targets for miR-130b. [score:3]
After transfection with miR-130b mimics, the proliferation was significantly inhibited in PANC-1 and ASPC-1 cells by 30.35±2.90% and 22.03±7.64%, respectively (P<0.01). [score:3]
These results implied that miR-130b might act as an inhibitor in the progress of pancreatic carcinogenesis. [score:3]
Furthermore, the growth of xenograft tumors was significantly inhibited after being transfected with LV-miR-130b. [score:3]
Meanwhile, the anti-miR-130b decreased the miR-130b expression by 2.34 and 2.88 folds in PANC-1 and ASPC-1 cells, respectively. [score:3]
Our analysis identified STAT3, a key oncogene, as one of the potential targets for miR-130b. [score:3]
The PANC-1 cells were further transfected with miR-130b and were examined for STAT3 expression by qRT-PCR and western blot. [score:3]
In general, these results indicated that miR-130b might be applied as a potential prognostic biomarker and inhibitor in pancreatic cancer. [score:3]
Therefore, the dual luciferase assay was applied to identify whether STAT3 was directly targeted by miR-130b. [score:3]
Liu et al. showed that miR-130b was overexpressed in hepatic cell cancer and might be a serum biomarker with clinical values for hepatic cell cancer screening [33]. [score:3]
The microRNA prediction software indicated that the signal transducer and activator of transcription 3 (STAT3) might be the downstream target of miR-130b. [score:3]
The relationship between miR-130b and STAT3 expression was explored by Spearman’s correlation. [score:3]
As shown in Fig. 1D, the χ [2] analysis showed that patients with a lower miR-130b expression were more frequently associated with tumor invasion and metastasis. [score:3]
The survival rates for miR-130b expression were estimated by using the Kaplan–Meier method and the difference in survival curves were tested by log-rank test. [score:3]
0073803.g001 Figure 1(A) The relative expression level of miR-130b in human pancreatic cancer tissues (n = 52) and matched adjacent noncancerous pancreatic tissues (n = 52). [score:3]
As shown in Fig. 5C, the miR-130b transfection led to an obvious decrease in STAT3 mRNA and protein expression. [score:3]
As shown in Fig. 2A, the miR-130b mimics caused a 63.32 and 28.75-fold increase in the miR-130b expression in PANC-1 and ASPC-1 cells, respectively. [score:3]
MiR-130b Suppressed Cell Proliferation both in vitro and in vivo In order to identify the effects of miR-130b on pancreatic cancer cells, we transfected PANC-1 and ASPC-1 cells with 50 nM miR-130b mimics, anti-miR-130b and their respective NCs. [score:3]
QRT-PCR (left panel) and western blot (right panel) were used for monitoring the STAT3 expression in PANC-1 cells 48 h after the transfection with miR-130b or anti-miR-130b (50 nM). [score:3]
Meanwhile, Cox’s multivariate analysis showed that miR-130b expression, TNM stage, and distant metastasis were significantly associated with overall survival of pancreatic cancer patients as independent prognostic factors (Table 2). [score:3]
After restoration of miR-130b, the invasiveness of PANC-1 and ASPC-1 cells was clearly inhibited. [score:3]
The low miR-130b expression group showed a higher incidence of an increased tumor size (P = 0.001), late TNM stage (P = 0.005), lymphatic invasion (P = 0.012) and distant metastasis (P = 0.012). [score:3]
The restoration of miR-130b was found to significantly suppress the proliferation of PANC-1 and ASPC-1 cells by induction of apoptosis and cell cycle arrest at S phase. [score:3]
The miR-130b expression in xenograft tumors of LV-miR-130b group was obviously higher than that of the control group (Fig. 2D). [score:3]
The miR-130b expression was compared in pancreatic cancer tissues and cells by the unpaired Student’s t test. [score:2]
As shown in Fig. 1A, 45 PC tissues showed low expression of miR-130b as compared to that of the NP tissues and the median fold change was 1.86 (P<0.01). [score:2]
Furthermore, the correlation of miR-130b downregulation correlated with pancreatic cancer prognosis was investigated. [score:2]
Microarray studies have identified a number of microRNAs that were deregulated in pancreatic cancer, including miRNA-130b [10]– [12]. [score:2]
Meanwhile, the miR-130b expression was significantly decreased in all five pancreatic cancer cell lines examined as compared to that of the normal pancreatic samples (Fig. 1B). [score:2]
Meanwhile, the clinical data showed that miR-130b deregulation was significantly associated with large tumor size, late TNM stage, lymphatic invasion and distant metastasis. [score:2]
MiR-130b inhibited the invasion of pancreatic cancer cells. [score:2]
MiR-130b Inhibited the Pancreatic Cancer Cell Invasiveness. [score:2]
These results showed that the miR-130 deregulation was correlated with a worse prognosis and was involved in invasion/metastasis of pancreatic cancer. [score:2]
MiR-130b inhibited the growth of pancreatic cancer cells in vitro and in vivo. [score:2]
MiR-130b Suppressed Cell Proliferation both in vitro and in vivo. [score:2]
The survival analysis of present study revealed that miR-130b deregulation correlated with shorter survival time of pancreatic cancer patients. [score:2]
In this study, an important molecular association between miR-130b and STAT3 was demonstrated. [score:1]
It revealed that the miR-130b mediated the pancreatic cancer cell invasiveness. [score:1]
The final concentration of miR-130b mimic and anti-miR-130b was 50 nM. [score:1]
Hence, our study was aimed to identify the role of miR-130b in pancreatic cancer. [score:1]
To further confirm the above findings, an in vivo tumor mo del was constructed by implanting the PANC-1 cells transfected with LV-miRNA-130b or negative control. [score:1]
Flow cytometric analysis of the effects of miR-130b induced apoptosis (C) and cell cycle arrest (D). [score:1]
Throughout the tumorigenic period, tumors from the miR-130b transfected cells grew significantly slower (Fig. 2C). [score:1]
We further identified the role of miR-130b in pancreatic cancer cell invasiveness. [score:1]
However, no specific studies have been conducted to reveal the role of miR-130b in pancreatic cancer. [score:1]
Since the effect of miR-130b in pancreatic cancer was far from defined, this study aimed to identify the function of miR-130b in pancreatic cancer. [score:1]
These results intensively implied that miR-130b could be involved in the pancreatic cancer metastasis progression. [score:1]
Furthermore, also STAT3 was characterized as a functional target for miR-130b. [score:1]
Similar results were also obtained for the invasiveness of ASPC-1 cells transfected with the miR-130b mimics (Fig. 4B). [score:1]
We found that the number of invading PANC-1 cells transfected with the miR-130b mimics (57±5 cells/HP; HP: high power magnification field) was remarkably lower than the number of those transfected with miR-NC (122±9 cells/HP; Fig. 4A). [score:1]
Clinicopathologic Significance of miR-130b in Pancreatic Cancer Patients. [score:1]
The LV-miR-130b or LV-NC was transfected into PANC-1 cells in the presence of the virus at a multiplicity of infection (MOI) of 20. [score:1]
0073803.g005 Figure 5(A) (Top panel) The human STAT3 3′UTR fragment containing wild-type or mutated miR-130b–binding sequence. [score:1]
However, anti-miR-130b promoted the growth of PANC-1 and ASPC-1 cells by 15.23±7.40% and 16.70±3.56%, respectively (P<0.01; Fig. 2B). [score:1]
Thus, we propose that our observations provide insights to the importance of miR-130b that could be a novel biomarker to predict the prognosis and progression of patients with pancreatic cancer. [score:1]
STAT3 was inversely correlated with the miR-130b levels in pancreatic cancer tissues. [score:1]
We then studied the correlation between miR-130b expression and clinical pathological characteristics of pancreatic cancer. [score:1]
Our results showed that the miR-130b significantly decreased the firefly luciferase activity in the reporter with wild type 3′UTR, but the activity of mutant 3′UTR vector remained unaffected (Fig. 5B). [score:1]
They were stored at −80°C for future miR-130b and STAT3 extraction. [score:1]
A total of 100 ng wild type (WT) or mutant (MUT) reporter constructs were co -transfected with Lipofectamine 2000 transfection reagent into the pancreatic cancer cells with 50 nM miR-130b or miR-NC according to the manufacturer’s instruction. [score:1]
Furthermore, these results showed heterogeneity in the function of miR-130b that was dependent on the cancer type and cellular context. [score:1]
The miR-130b mimics significantly increased the apoptosis rate in PANC-1 (3.57±0.83% vs. [score:1]
Our clinical results showed that miR-130b was significantly decreased in the patients with invasion/metastasis. [score:1]
Moreover, the miR-130b mimics significantly reduced the proportion of G0/G1 and G2/M phases. [score:1]
To investigate the mechanisms of miR-130b inhibition on pancreatic cancer cell proliferation, we analyzed the apoptosis and cell cycle in the transfected PANC-1 and ASPC-1 cells using flow cytometry. [score:1]
Lentiviral miR-130b (LV-miR-130b) and empty lentiviral vector (LV-NC) were constructed by Genechem Company (Shanghai, China) and were transfected into the pancreatic cancer cells according to the manufacturer’s instruction. [score:1]
588) 0.373 Distant metastasis 8.358(2.127–32.845)0.002 * 5.819(2.149–15.754)0.001 * miR-130b 0.291(0.123–0.688)0.005 * 0.352(0.155–0.797)0.012 * HR, hazard ratio; CI, confidence interval; * Statistically significant (P<0.05). [score:1]
After 24 h of being in the culture, the cells were transfected with 50 nM miR-130b mimics, anti-miR-130b and their respective control using Lipofectamine 2000 (Invitrogen). [score:1]
Pancreatic cancer cells were collected after 48 h treatment with 50 nM miR-130b mimic or anti-miR-130b and corresponding controls. [score:1]
Using a qRT-PCR method, miR-130b was detected in all the 52 pairs of pancreatic cancer tissues and their matched noncancerous pancreatic tissues, as well as pancreatic cancer cell lines. [score:1]
In order to identify the effects of miR-130b on pancreatic cancer cells, we transfected PANC-1 and ASPC-1 cells with 50 nM miR-130b mimics, anti-miR-130b and their respective NCs. [score:1]
[1 to 20 of 101 sentences]
4
[+] score: 238
Other miRNAs from this paper: hsa-mir-130a, hsa-mir-301a, hsa-mir-301b
As described above, the deregulation of miR-130b and miR-301b has been observed in several PrCa miRNA profiling studies, with the majority of them showing an upregulation of the cluster expression in malignancy as depicted in Table  1. Several studies evidenced a positive association of miR-130b/301b cluster expression and clinicopathological parameters, comprising cancer disease diagnosis [22, 38, 40– 42], presence of local and distant metastasis [59], disease stage [59], Gleason Score [59], pre-operatory PSA [54], disease recurrence [44– 48, 55] and patient overall survival [38, 59]. [score:15]
c Level of miR-130b in PrCa tissue of patients in which the primary therapy outcome is complete remission indicated as Remission (median = 4.45) or Disease-including stable and progressive disease—(median = 5,36) (n = 438, Mann–Whitney test) As discussed above, a list of empirically validated miR-130b/301b direct targets, comprising both TSG and oncogenes (OG) has been proposed. [score:8]
We included the 7 direct targets reported in PrCa (MMP2, DEDD2, NDRG2, AR, LMNB1, PARVA, SLC8A1) and 16 direct targets empirically validated in other cancers compiled in TarBase (RUNX3, TP53INP1, PPARG, CSF1, UVRAG, ZEB1, DICER1, STAT3, PDGFRA, ZBTB4, PTEN, SMAD4, ITGB1, CCNA2, PPARGC1A, FMR1 for miR-130b and TP63 and DNMT1 for miR-301b) [61] (Table  2). [score:7]
The expression profile of miR-130b and miR-301b, their correlation with candidate TSG targets, as well as their association with PrCa aggressiveness in the TCGA-PRAD support an oncogenic function for these miRNAs for the disease. [score:7]
Interestingly, miR-130b was shown to be present in CA-24 exosomes (in comparison to RWPE-1), and their uptake induced PrCa patient adipose-derived stem cells (pASC) neoplastic reprogramming through the upregulation of hRAS, kRAS and the downregulation of TSG PDCD4 [69]. [score:7]
The correlation between the expression of validated direct targets of miR-130b and miR-301b supports their oncogenic function in PrCa. [score:6]
Firstly, Chen et al., reported the downregulation of miR-130b in PrCa and present evidence in favor of its ability to inhibit PrCa cell migration (in M12 and P69 cell lines) and in vitro invasion (in PC-3 cells). [score:6]
Table 2 Association between the expression of miR-130b/301b and putative direct target genes in TCGA-PRAD Gene PMID Role in PrCa miR-130b miR-301b r p value r p value PPARGC1A 23868745 TSG? [score:6]
We then analyzed this dataset for associations between the genomic status and expression of miR-130b/301b cluster and several aspects of the disease. [score:5]
Overall, the association between the expression of miR-130b/301b cluster and PrCa evolution in TCGA-PRAD strongly support an oncogenic action of this miRNA cluster in the disease. [score:5]
b Expression of miR-301b in normal and tumor (normal = 22, Tumor = 273) prostate tissues obtained from small RNA-seq data of TCGA-PRAD cohort The molecular basis for the increment of miR-130b and miR-301b expression in tumors is currently unknown. [score:5]
Correlations between miR-130b and target mRNAs expression in TCGA-PRAD. [score:5]
The positive correlation of LMNB1 and miR-130b/301b expression (also observed by TP53INP1 and CCNA2) may be caused by a non-canonical effect of the miRNAs on these targets. [score:5]
b Relationships between fold change (FC) in DNA methylation and miR-130b expression in matched normal vs tumor tissue (n = 35), r 0.4736, p 0.0041 c Relationships between DNA methylation and miR-130b expression in all available samples (n = 241), r 0.5242 and p < 0.0001. [score:5]
Indeed, a tumor suppressor function has been proposed for miR-130b [29, 52] and miR-301b [29], which were shown to inhibit PrCa invasion, homing or cell cycle progression. [score:5]
Secondly, Ramalho-Carvalho et al. found an expression profile and a function consistent with a tumor suppressor role of miR-130b and miR-301b in PrCa, showing their ability to reduce cell viability, induce DNA damage, apoptosis and cell senescence [29]. [score:5]
We confirmed an upregulation of both miR-130b and miR-301b in tumor vs normal tissue in TCGA-PRAD specimens. [score:4]
No qualifier- miR-130b directed targets with strong experimental evidence assigned by TarBase. [score:4]
On the contrary, 5 studies found that either miR-301b, miR-130b or both are downregulated in PrCa, including malignant tissue [29, 52], high Gleason Score tumors [53], high pre-operatory PSA levels [54] and recurrent patients [53, 55]. [score:4]
On the contrary, since this locus is preferentially methylated at the gene body, and this region is known to stimulate transcription elongation [68], it is tempting to speculate that the molecular etiology of the upregulation of miR-130b/301b in PrCa is the increase in DNA methylation at the gene body. [score:4]
A later study confirmed miR-130b upregulation in an independent cohort, and demonstrated its positive influence on cell viability and its negative influence on apoptosis in LNCaP and PC-3 cell lines, reversing the effect of luteolin [59]. [score:4]
Recently, further proof of an oncogenic role of miR-130b has been provided by Cannistraci et al. [38], who showed its impact in PrCa cell invasion in vitro and in vivo (22-Rv1, C41IM and LNCaP), and its ability to directly repress the expression of the androgen receptor AR, thus increasing the resistance to androgen therapy. [score:4]
Due to the conflictive reports about the role of miR-130b/301b in PrCa, both OGs and TSGs have been proposed as targets of repression. [score:3]
The expression of miR-130b and miR-301b increases in PrCa neoplastic tissue and metastasis. [score:3]
Chr chromosome miRNA microRNA miR-130b hsa-miR-130b-3p miR-301b hsa-miR-301b-3p OG oncogene PRAD prostate adenocarcinoma PrCa prostate cancer RPM reads per million TCGA The Cancer Genome Atlas TSG tumor suppressor gene Study conception MAD, Study design MAD, Acquisition of the clinical data RSF, Analysis of the data RSF, CM, COR, Interpretation of the data RSF, CM, COR, JRSS, MAD, Drafting of the manuscript MAD, Critical Revision RSF, CM, COR, BG, JRSS, MAD. [score:3]
The expression of miR-130b and miR-301b associates with negative PrCa patient clinical outcome. [score:3]
We thoroughly revised the PrCa literature and found 25 independent articles in which a differential expression of miR-130b or miR-301b is recognized. [score:3]
The failure of miR-301b to associate with clinical variables may be due to its reduced expression in prostatic tissue relative to miR-130b. [score:3]
Likewise, the expression of miR-130b positively correlates with clinical parameters such us T stage, residual tumor and primary therapy outcome. [score:3]
The genomic and epigenomic context of the miR-130b/301b cluster support their coordinated expression in PrCa. [score:3]
Fig.  2Expression of miR-130b and miR-301b in normal and tumor prostate tissue. [score:3]
Here we sought to progress into the understanding of the clinical significance of the miR-130b/301b cluster in PrCa through the unified analysis of most of the published literature and the available PrCa gene expression datasets (small RNA and mRNA transcriptomic, methylomic and clinical data). [score:3]
Nevertheless, two independent groups proposed a tumor suppressor role of the miR-130b/301b cluster in PrCa. [score:3]
c Co -expression of miR-130b and miR-301b in prostate clinical samples of TCGA-PRAD, including normal and tumor tissue. [score:3]
Nevertheless, the most relevant finding is the positive correlation between DNA methylation and miR-130b/301b expression in TCGA-PRAD, which demonstrates that the methylation of this locus is not causing its repression in PrCa. [score:3]
TarBase does not identify targets for miR-130b/301b in PrCa. [score:3]
We analyzed the putative association between the expression of miR-130b and miR-301b and the clinical data, including preoperative PSA, Gleason Score, number of positive lymph nodes, pathological N-stage, pathological T-stage, residual tumor, primary therapy outcome success and biochemical recurrence. [score:3]
Since LMNB1, as well as TP53INP1 and CCNA2, lacks miR-130b/301b binding sites at their promoters it is tempting to speculate that miR-130b/301b may be stimulating the translation of these mRNA causing the stabilization of their transcripts [72]. [score:3]
These candidates are expected to correlate negatively with the expression of miR-130b or miR-301b in PrCa if the oncogenic hypothesis holds true in the clinical samples. [score:3]
a Comparison of pathological T-stage in patients with levels of miR-130b in the upper and lower deciles of expression (n = 96, Fisher’s exact test). [score:3]
Yet, a small proportion of studies have reported a negative association between miR-130b/301b expression and tumor status [29, 52] (miR-130b and miR-301b), preoperatory PSA [54] (miR-130b) and biochemical recurrence (miR-130b in serum in [53] and miR-301b in tissue [55]). [score:3]
Correlations with p < 0.0001 are highlighted in italics Lately, independent PrCa studies have analyzed the expression of miR-130b/301b cluster or the individual miRNAs derived from it. [score:3]
a Expression of miR-130b in prostate tissues obtained from small RNA-seq data of TCGA-PRAD cohort (normal = 52, tumor = 492). [score:3]
Then, we performed new analyses of publicly available PrCa datasets, with emphasis in the largest cohort such as The Cancer Genome Atlas (TCGA-PRAD) to collect further evidence of the role of miR-130b/301b cluster in this disease. [score:3]
The miR-130b and miR-301b are expressed in PrCa and their abundance is positively associated with the DNA methylation of their locus. [score:3]
In a functional screening of gain of function of miRNAs in 5 PrCa cell lines, Aakula et al. identified miR-130b in a group of 14 miRNAs that increase PrCa cell proliferation and change consistently its expression in clinical samples; using Taylor et al. dataset, they found that only miR-130b associates with patient survival and increases cell viability while reducing apoptosis [44]. [score:3]
However, when we analyzed the correlation between the miRNAs-target pairs proposed in the PrCa literature in the TCGA-PRAD cohort, we only found highly significant (p < 0.0001) negative and positive correlations with TSGs and OGs respectively, which provides additional indication of the oncogenic role of the miR-130b/301b cluster in PrCa. [score:3]
The non-parametric Spearman correlation coefficient (r) is indicated The genomic and epigenomic structure of the miR-130b/301b cluster indicate that both miRNAs are co-regulated at the level of transcription. [score:2]
The non-parametric Spearman correlation coefficient (r) is indicated The genomic and epigenomic structure of the miR-130b/301b cluster indicate that both miRNAs are co-regulated at the level of transcription. [score:2]
The stem-loop precursors of miR-130b and miR-301b are coded 327 bp apart, where mir-301b is in the first intron of the transcript (chr22:22007270-22007347 of GRCh37/hg19 or chr22:21652981-21653058 of GRCh38/hg38) and mir-130b spans from the first intron to the beginning of exon 2 (chr22:22007593-22007674 of GRCh37/hg19 or chr22:21653304-21653385 of GRCh38/hg38) (see Fig.   1b and Additional file 1: Figure S1 for a detailed view of the region). [score:1]
Fig.  1Genomic and epigenomic context of the human miR-130b/301b gene cluster. [score:1]
Overall, the analysis of correlations for miRNA-mRNA pairs in the TCGA-PRAD favors the repression of TSGs, supporting an oncogenic action of the miR-130b/301b cluster in prostate. [score:1]
On the contrary, we observed a positive association between the level of miR-130b, pathological tumor stage (Fig.   4a), residual tumor [60] (Fig.   4b) and primary therapy outcome success (Fig.   4c). [score:1]
The role of the cluster miR-130b/301b in PrCa carcinogenesis has been addressed by several groups. [score:1]
Pattern of DNA methylation of the miR-130b/miR-301b locus in prostate cell lines. [score:1]
Of note, miR-301b is about ten time less abundant than miR-130b in prostatic tissue (Fig.   1c), and this probably explains why the former is less reported in the literature. [score:1]
Fig.  3Pattern of DNA methylation of the miR-130b/miR-301b locus in prostate tissue of TCGA-PRAD. [score:1]
The miRNAs derived from the miR-130b/301b gene cluster precursors share an identical seed region (Fig.   1a). [score:1]
To assess this possibility, we used the TCGA-PRAD samples to determine if DNA methylation is associated with miR-130b level in the tissue. [score:1]
The level of increase in miRNA abundance in malignant samples is 1.2–8.6 folds for miR-130b (p 0.05 to < 0.0001) and 1.5–2.2 folds for miR-301b (p 0.025 to < 0.0066). [score:1]
Meanwhile, an oncogenic role has been proposed for miR-130b [38, 44, 62] and miR-301b [63] in PrCa, which were revealed to promote cell proliferation, viability, migration, invasion or tumor initiating properties. [score:1]
b Genomic view of the miR-130b/301b gene cluster region in UCSC Genome browser (GRCh37/hg19) centered at the transcription star point of the di-cistronic transcript. [score:1]
In agreement with TCGA-PRAD, the miR-130b/301b cluster is globally less methylated in non-malignant PrECs and RWPE-1 than in malignant cell lines (LNCaP, DU145 and PC-3) and the methylation of the CpG island at the promoter is invariably low (Additional file 3: Figure S3). [score:1]
Meanwhile, oncogenic MMP2, proposed to be repressed by the cluster in a study in PrCa, shows a weak negative correlation with the miRNAs (r − 0.11 p = 0.01 for miR-130b and r − 0.13 p = 0.03 for miR-301b). [score:1]
Independent groups studied the effect of miR-130b/301b cluster on PrCa cell phenotype achieving contradictory results. [score:1]
Supporting the relevance of the associations identified for miR-130b/301b in the TCGA-PRAD, we found r values below − 0.21 for highly significant targets (p < 0.0001 yield by 9 out of the 11 evaluated) (Additional file 6: Table S1). [score:1]
miR-130 gene family (miRbase record MIPF0000034) [33] is vertebrate specific. [score:1]
We found a significant increase in miR-130b abundance in tumor tissue, with a median change of 2.02-fold (p < 0.0001) (Fig.   2a). [score:1]
b Level of miR-130b in patients without (R = 0 median = 5.00) or with residual tumor (R = 1 median = 5.65) (n = 456, Mann–Whitney test). [score:1]
The accessibility of the miR-130b/301b CpG island, as well as its unmethylated status in PrCa (β-value < 0.2 [66]) determined by our study, argue against its silencing by DNA methylation. [score:1]
The precursor RNAs hsa-mir-130b and hsa-mir-301b are processed preferentially from the 3′ arm of the hairpin to generate mature miRNAs hsa-miR-130b-3p and hsa-miR-301b-3p (hereafter referred as miR-130b and miR-301b, respectively). [score:1]
Correlation between the levels of miR-301b (x axis) and miR-130b (y axis) of the TCGA-PRAD cohort. [score:1]
In the human genome, it is composed by four miRNA precursor genes: mir-301a (at chr17), mir-130a (at chr11), mir-130b and mir-301b (at chr22). [score:1]
Since the largest available dataset, the TCGA-PRAD cohort has not been interrogated for the miR-130b/301b cluster yet, we examined the levels of both miRNAs in normal vs tumor prostate tissue samples. [score:1]
Pattern of DNA methylation of the miR-130b/miR-301b locus in prostate datasets. [score:1]
Correlations with p < 0.0001 are highlighted in italics miR-130 gene family (miRbase record MIPF0000034) [33] is vertebrate specific. [score:1]
a Sequence alignment of the miR-130b/301b gene cluster. [score:1]
Fig.  4Association between the expression of miR-130b and clinical characteristics in the TCGA-PRAD cohort. [score:1]
Detailed genomic view of the miR-130b/301b gene cluster region in UCSC Genome browser (GRCh37/hg19). [score:1]
The analysis of the genomic and epigenomic features of the miR-130b/301b cluster revealed its active transcription in PrCa cells. [score:1]
Mounting evidence across several cancer types, including breast [14], bladder [15], glioblastoma [16], lung [17], ovarian [18], pancreatic [19] supports the involvement of the miR-130b/301b gene cluster in carcinogenesis. [score:1]
hsa-miR-301b hsa-miR-130b TCGA miRNA Prostate Cancer DNA Methylation Transcriptome Microarray Clinical outcome Worldwide, prostate cancer (PrCa) is the second most frequently diagnosed cancer and the sixth major cause of cancer-related deaths in men. [score:1]
[1 to 20 of 82 sentences]
5
[+] score: 217
Other miRNAs from this paper: hsa-mir-130a
In both mo dels of pulmonary (bleomycin exposure) and liver (CCl [4] exposure) fibrosis, Short-130 inhibited miR-130/301 and reversed the down-regulation of miR-130/301 target genes Pparγ and Lrp8 (Figs 5 and 6C), decreased Lox expression, reduced collagen expression and collagen crosslinking (Figs 5C,E,F and 6C,E,F), and reduced Yap nuclear localization (Figs 5C and 6C) and YAP activation, as reflected by CTGF expression (Fig. 5E and 6E). [score:14]
Second, such pitfalls may be exaggerated by the widespread but cell-type specific functions of this miRNA family beyond the fibroblast, presumably dictated by a non-identical cohort of miR-130/301-specific target genes active in differing cell types 9. Nonetheless, selective pharmacologic targeting of the fibroblast in specific disease conditions holds promise, and future biological confirmation of the broader, network -based actions of miR-130/301 family could further guide such a systems pharmacology approach to targeting fibrosis which has not yet been pursued in great depth. [score:9]
To demonstrate the putative unifying biology of miR-130/301 in this cohort of physiologic states, pulmonary fibrosis (Index Diseases #11 and #19, Table S1) and fibrotic liver disease (Index Disease #4, Table S1) were selected for further interrogation. [score:7]
Consistent with our prior findings of a positive feedback loop in PH involving YAP/TAZ-miR-130/301 that both initiates and results from ECM stiffening 9, GW3965 treatment also reduced YAP nuclear localization (Fig. 7A) and YAP activation, as reflected by decreased Ctgf expression (Fig. 7C), as well as reversed Pparγ and Lrp8 down-regulation (Fig. 7A). [score:6]
Alternatively, if certain fibrotic disease states exist (i. e., potentially at earlier time points of disease progression or specific clinical subtypes) where individual molecules are activated in isolation such as miR-130/301 or ApoE, more tailored therapy could be attempted and may be effective in those cases. [score:5]
Network analysis reveals that miR-130/301 members target a shared cohort of fibrotic genes across human diseases and physiologic states related to PH. [score:5]
We previously demonstrated that forced expression of miR-130/301 in the lung of mice is sufficient to induce pulmonary hypertension 12 and pulmonary vessel fibrosis 9. To determine if miR-130a is sufficient to induce liver fibrosis, chronic liver expression of miR-130a was studied. [score:5]
Furthermore, consistent with the direct down-regulation of the associated factors peroxisome proliferator-activated receptor gamma (PPARγ), apolipoprotein E (APOE) and the apolipoprotein E receptor LRP8 by miR-130/301 in PH 9, both Pparγ and Lrp8 were decreased in pulmonary fibrosis (Fig. S1). [score:5]
In regard to the relationship of this disease network to PH specifically, identification of the centrality of the YAP/TAZ-miR-130/301 circuit also provides molecular insight into the heterogenous clinical associations of secondary diseases found with this enigmatic vascular condition 54. [score:5]
Inhibition of the miR-130/301 family prevents ECM remo deling and disease progression in mouse mo dels of pulmonary fibrosis and liver fibrosis. [score:5]
Especially since YAP/TAZ and miR-130/301 appear to activate a positive feedback loop for robust ECM stiffening at least in PH 9, a pharmacologic combination of miR-130/301 inhibition via shortmers 59 in addition to manipulating downstream miR-130/301 -dependent pathways such as LXR/APOE activity (Fig. 7) offers a rational avenue for cooperative therapeutic targeting of fibrosis. [score:5]
It not only suggests the utility of related pharmacologic strategies (i. e., inhibitors of miR-130/301) for such associated diseases but also the importance of selective use to avoid unintended detrimental consequences of manipulating a pathway so broadly shared among fibrotic processes. [score:5]
Coupled with the top ranking of this miRNA family by spanning score in relation to the fibrosis network directly (Fig. 1B), these findings predicted that miR-130/301 members are integral to the fibrotic program across a variety of diseases and tissue beds. [score:4]
To define the exact cell types in which miR-130/301 was up-regulated, an in situ protocol was developed to stain simultaneously for miRNA and protein (see ). [score:4]
First, because fibrosis and matrix production also have positive and adaptive attributes in certain conditions (i. e., normal wound healing and organ development), inhibition of miR-130/301 may have substantial pitfalls, if used in non-selective contexts. [score:4]
First, these diseases may develop in a cell autonomous fashion, driven by separate injuries [such as hypoxia, inflammation, and specific genetic mutations linked to PH 12] that induce miR-130/301 in distinct tissue beds. [score:4]
Thus, it is tempting to speculate that genetic mutations linked to PH and miR-130/301 9 may also contribute to separate fibrotic lung and liver diseases. [score:4]
Our results showcase the power of advanced analysis of gene network architecture not only to predict a relevant fibrotic gene “program” shared among related human diseases and physiologic states but also to identify its overarching regulators, such as the miR-130/301 family, across those conditions (Figs 1 and 7D). [score:4]
Positive correlation of ECM stiffening and YAP/TAZ -dependent expression of miR-130/301 in mice and humans suffering from lung fibrosis. [score:3]
Utilizing an in silico “fibrosis network” 9 composed of curated seed genes known to be causatively involved in ECM remo deling and their first degree interactors (Fig. 1B), we found a broad and diverse contingent of factors related to ECM remo deling within the predicted pool of miR-130/301 target genes and their related network neighbors. [score:3]
Moreover, by offering proof of our in silico predictions, these findings identify the fibrotic actions of the miR-130/301 family as a unifying molecular basis for the convergent relationship of seemingly disparate diseases (Fig. 7D). [score:3]
Forced miR-130/301 expression activates ECM remo deling and liver fibrosis in mice. [score:3]
The coupling of such network -based mo deling with experimental validation also facilitated the identification of the YAP/TAZ-miR-130/301 circuit as a broad mediator of mechanotransduction across a variety of tissue beds and disease contexts. [score:3]
Positive correlation of ECM stiffening and YAP/TAZ -dependent expression of miR-130/301 in mice and humans suffering from liver fibrosis. [score:3]
In that vein, our network analysis also uncovered shared miR-130/301-specific commonalities among diseases that have rarely, if ever, been clinically associated with fibrosis (i. e., Ebola infection, schizophrenia, among others; Table S1). [score:3]
In doing so, miR-130/301 inhibition significantly reduced end-stage fibrosis, as assessed by Metavir (Fig. 5D) score and Ashcroft score (Fig. 6D). [score:3]
Moreover, consistent with the known relevance of miR-130/301 in PH 12, among the 137 networks described above, a subset, ranked highly by their interconnectedness with the fibrosis network and the miR-130/301 family (Table S1, S3), was found to share a distinct cohort of fibrotic genes embedded in the overlap with a previously reported 12 PH disease gene network (Fig. 1D, Table S3). [score:3]
To determine whether miR-130/301 family members are necessary for control of fibrosis across both pulmonary and liver fibrosis, mice were serially administered control versus Short-130, an antisense oligonucleotide confirmed to inhibit all miR-130/301 family members in cultured cells 12 and in vivo in mouse liver (Fig. 5A,B) and mouse lung (Fig. 6A,B). [score:3]
Inhibition of miR-130/301 in a mouse mo del of liver fibrosis. [score:3]
Furthermore, it is possible that an even more complex and wide-reaching interactome exists among miR-130/301 and additional miRNAs predicted to recognize large portions of the same fibrotic disease network (Fig. 1, Table S2). [score:3]
By using network -based computational mo deling and in vivo experimentation, we have defined the YAP/TAZ-miR-130/301 molecular circuit and its downstream control of ECM remo deling as a shared and unifying in vivo origin of a network of human diseases and physiologic conditions (Fig. 7D). [score:3]
Consistent with induction of miR-130/301 by the mechanosensitive YAP/TAZ transcription factors in PH 9, a positive correlation was observed among miR-130a expression, YAP nuclear localization, and downstream collagen crosslinking in pulmonary fibrosis (Fig. 2C). [score:3]
Together, the results herein define the control of a fibrotic gene program by the YAP/TAZ-miR-130/301 circuit, shared among a network of related diseases. [score:3]
Correspondingly, as predicted by our network algorithm (Index Diseases #11 and #19, Table S1), the same relationships between miR-130/301, YAP/TAZ, and collagen crosslinking were observed in pulmonary tissue derived from a cohort of patients suffering from idiopathic pulmonary fibrosis (Fig. 2E,F, Fig. S1). [score:3]
Similarly, in a mouse mo del of carbon tetrachloride (CCl [4]) -induced liver fibrosis (Fig. 3), miR-130/301 was increased (Fig. 3A,B) and Pparγ and Lrp8 were correspondingly decreased (Fig. S2), accompanied by a positive correlation among collagen crosslinking, miR-130a expression, and YAP nuclear localization (Fig. 3C). [score:3]
Thus, a combination of network analyses predicted a unique position for the miR-130/301 family at the intersection of fibrotic gene programming and this set of associated diseases and physiologic states. [score:3]
Moreover, forced miR-130a and increased ECM stiffening was sufficient to activate a self-amplifying feedback loop and further increase endogenous miR-130/301 family expression (Fig. 4A). [score:3]
miR-130/301 was ranked among the top five miRNAs, underlining its importance to diseases with a strong fibrotic component (red box). [score:3]
miR-130/301 inhibition ameliorates pulmonary fibrosis. [score:3]
Thus, as delineated by our in silico predictions, distinct from PH, the YAP/TAZ-miR-130/301 circuit is activated across both pulmonary and hepatic diseases in animals and humans. [score:3]
Inhibition of miR-130/301 in a mouse mo del of pulmonary fibrosis. [score:3]
In mouse mo dels of bleomycin -induced pulmonary fibrosis (Fig. 2), miR-130/301 expression was increased (Fig. 2A,B). [score:3]
miR-130/301 expression correlates with activation of YAP/TAZ, the PPARY-APOE-LRP8 axis, and matrix stiffening in pulmonary fibrosis and liver fibrosis. [score:3]
miR-130/301 overexpression activates ECM remo deling and liver fibrosis progression in mouse. [score:3]
How to cite this article: Bertero, T. et al. A YAP/TAZ-miR-130/301 molecular circuit exerts systems-level control of fibrosis in a network of human diseases and physiologic conditions. [score:3]
Eight-week-old mice (C57Bl6) were injected with bleomycin (1.5U/kg Sigma Aldrich) followed by 10 intraperitoneal injections (every 2 days) of control or miR-130/301 shortmer oligonucleotides, designed as antisense inhibitors recognizing the seed sequence of this miRNA family (20 mg/kg/dose; Regulus). [score:3]
miR-130/301 inhibition ameliorates liver fibrosis. [score:3]
In a mo del of lung fibrosis (bleomycin-induction), mice were treated with control (Short-NC) or miR-130/301 inhibitor (Short-130) (n = 8/10 per group). [score:3]
miR-130/301-specific fibrotic activity is active throughout a network of human diseases and physiologic conditions. [score:3]
miR-130/301 was ranked among the top five miRNAs by spanning score in this network (targets encircled in black), reflecting its robust, systems-level control over fibrosis and matrix remo deling. [score:3]
Upon identifying the miR-130/301 family as a critical regulator of fibrosis across contexts, we ranked each of the 137 networks according to (a) its overlap with the fibrosis network and (b) the spanning score rank assigned to miR-130/301 in that context. [score:2]
Unlike prior studies of miR-130/301 family members focusing on specialized conditions such as liver cancer 45 46, breast cancer 47 48, scleroderma 49, our findings here emphasize the global dysregulation of the miR-130/301 family and its elusive interconnections with the molecular fibrotic machinery of the fibroblast. [score:2]
Consequently, we can conclude that the YAP-TAZ-miR-130/301 circuit acts as a master regulator of both fibrotic gene programming and ECM remo deling across multiple pathobiological contexts in vivo. [score:2]
Moreover, given increased miR-130/301 levels in plasma of PH patients 12 56, pathogenic transfer and endocrine signaling of miR-130/301 between lung and liver is an intriguing possibility. [score:1]
Pharmacologic activation of APOE with LXR agonist GW3965 decreases peri-arteriolar fibrosis and improves lung fibrosis in vivoTo determine whether downstream ApoE is critical for miR-130/301 -induced fibrosis, we attempted to prevent lung fibrosis in bleomycin-exposed mice via treatment with a pharmacological activator of ApoE 13, the liver-X nuclear hormone receptor agonist GW3965 (Fig. 7). [score:1]
Conditions in red were ranked highly based on their interconnectedness with the fibrosis network and the miR-130/301 family (top 25%, as ranked in Table S1), and all were found to share a distinct cohort of fibrotic genes embedded in the overlap with the PH network. [score:1]
This was quantified as the average of two values: (1) the fraction of network genes that were shared with the fibrosis network and (2) the fraction of the highest possible rank achieved by miR-130/301 [1 – rank [130]/rank [MAX]]. [score:1]
For instance, in WHO Group III PH associated with pulmonary fibrosis, our results indicate that, independent of hypoxia, parenchymal fibrosis may activate the YAP/TAZ-miR-130/301 circuit in adventitial fibroblasts and perhaps other related mesenchymal stem cells 55, thus accelerating vascular stiffness. [score:1]
Given its adjustable, feedback -driven property, the miR-130/301-YAP/TAZ circuit may be responsible, in part, for individualized “tuning” of ECM remo deling observed among different fibrotic disorders. [score:1]
miR-130/301 was significantly increased by RT-qPCR (A), and serial sections of lung (B) displayed increased collagen (Picrosirius Red), miR-130a, and YAP by in situ hybridization. [score:1]
Thus, beyond PH, the YAP/TAZ-miR-130/301 feedback loop is active in pulmonary fibrosis and specifically in fibroblasts anatomically far removed from the pulmonary vasculature itself. [score:1]
To determine whether downstream ApoE is critical for miR-130/301 -induced fibrosis, we attempted to prevent lung fibrosis in bleomycin-exposed mice via treatment with a pharmacological activator of ApoE 13, the liver-X nuclear hormone receptor agonist GW3965 (Fig. 7). [score:1]
The prevalence of fibrotic states predicted to involve miR-130/301 provides evidence for a shared fibrotic program controlled by this miRNA family in a wide range of human pathology and conditions beyond the pulmonary vasculature (see Table S3). [score:1]
Given our growing appreciation of YAP/TAZ activity resulting from physical stimuli such as shear stress 50, it is also possible that miR-130/301 and other YAP/TAZ -associated miRNAs may constitute a newly defined set of factors responding to a wide range of physical alterations (i. e., vascular hemodynamics) of the microenvironment in addition to stiffness alone. [score:1]
The putative connection of miR-130/301 and ECM biology to schizophrenia is particularly intriguing, as it is a disorder where ECM remo deling in perineuronal nets is already suspected to control final psychiatric manifestations 17. [score:1]
Eight-week-old mice (C57Bl6) were injected with CCl [4] (1mL per kg of body weight) every 5 days accompanied by intraperitoneal injections (every 2 days) of control or miR-130/301 shortmer oligonucleotides (20mg/kg/dose; Regulus). [score:1]
Although it appeared that many miRNAs may have relevant actions in fibrosis, with these data, we identified miR-130/301 family members among the most highly ranked miRNAs (Rank #4) with a robust one-way inverse correlation (one way ANOVA) between their assigned spanning score rank and the size of the fibrotic component for each of the 137 networks (Fig. 1C, Table S2). [score:1]
Given the importance of the YAP/TAZ-miR-130/301 circuit in PH 9, we postulated that this feedback loop may be similarly active in controlling ECM plasticity in other fibrotic states. [score:1]
[1 to 20 of 68 sentences]
6
[+] score: 215
After overexpression of p53 in Hep3B cells, the q-PCR results indicated that the expression levels of miR-138 and GADD45A were upregulated, and the expression levels of AGO2 and miR-130b were downregulated (Supplementary Fig.   S4). [score:13]
Downregulation of miR-130b promotes the expression of GADD45A in human NSCLC cellsTo determine the biological functions of miR-130b regulation by the p53-miR-138-AGO2 pathway, we inhibited the expression of miR-130b using a miR-138 mimic or AGO2 siRNA in human NSCLC cells. [score:11]
Cell proliferation was significantly inhibited by overexpression of GADD45A, which was consistent with the results of p53 overexpression, transfection with the miR-138 mimic and AGO2 siRNA, and treatment with miR-130b inhibitors (Fig.   4i). [score:9]
Here, for the first time, we demonstrated that miR-138 downregulated AGO2 expression induced by p53, resulting in decreased miR-130b abundance, which increased GADD45A expression. [score:8]
The miRNA target prediction analysis suggested that the AGO2 3′ UTRs of humans, mice and rats have target sites for miR-138 (Supplementary Fig.   S3a) and the GADD45A 3′ UTRs of humans, mice and rats contain the target sites for miR-130b (Supplementary Fig.   S3b). [score:7]
miR-130b inhibitors significantly increased the expression levels of the GADD45A protein in H1299 cells, which was consistent with the results observed when p53 and miR-138 were overexpressed or when AGO2 was reduced (Fig.   4d). [score:7]
Forced expression of AGO2 caused a decrease in pre-miR-130b but an increase in miR-130b, while silencing AGO2 expression either with AGO2 siRNA or a regulatory miR138 mimic demonstrated the opposite trend, i. e., an increase in pre-miR-130b but a decrease in miR-130b, with no detectable change in the pri-miR-130b levels (Fig.   2c). [score:6]
The results showed that the expression of GADD45A was significantly upregulated in IR -treated H460 cells and decreased after treatment with miR-130b mimic and by p53 siRNA. [score:6]
Downregulation of miR-130b promotes the expression of GADD45A in human NSCLC cells. [score:6]
The downregulated mRNA level of GADD45A was partially rescued by the miR-138 mimic, AGO2 siRNA, or miR-130b inhibitor in human H460 cells. [score:6]
To determine the biological functions of miR-130b regulation by the p53-miR-138-AGO2 pathway, we inhibited the expression of miR-130b using a miR-138 mimic or AGO2 siRNA in human NSCLC cells. [score:6]
Taking into account the results showing that AGO2 regulated miR-130b and the aforementioned p53-miR-138-AGO2 regulatory pathway, we postulated a p53-miR-138-AGO2-miR-130b pathway, which suggested downregulation of miR-130b by p53. [score:6]
To investigate whether miR-130b was capable of p53 feedback regulation, we also analyzed the possible target sites of miR-130b in p53 using miRNA target prediction software (miRanda 2010, TargetScan or PicTar). [score:6]
Similar to the above results, the abundance of miR-130b was decreased by silencing AGO2 expression, and this decrease was reversed by reconstitution of AGO2 expression in all DMSO cohorts. [score:5]
We then observed that cell cycle arrest could be reversed by p53 siRNA, a miR-138 inhibitor, or overexpression of AGO2 or miR-130b. [score:5]
To identify whether GADD45A is a target of miR-130b, a miRNA target prediction analysis (http://www. [score:5]
The results showed that miR-130b significantly reduced the luciferase activity of the vector pGL3-GADD45A-wt, but not that of the pGL3-GADD45A-mut vector, indicating that miR-130b directly targets the 3′ UTR of GADD45A (Fig.   4g). [score:4]
Thus, the results revealed the possibility that miR-138 and miR-130b are involved in the p53 -mediated regulation of the expression levels of GADD45A in human NSCLC cells. [score:4]
When p53 was downregulated by siRNA in H460 cells, the miR-130b level significantly increased. [score:4]
We first ruled out the possibility of direct transcriptional upregulation of miR-130b by p53 in NSCLC cell lines by luciferase reporter assay. [score:4]
Subsequent q-PCR indicated that the expression level of miR-130b was negatively correlated to that of GADD45A in the tested H460 and H1299 cells (Fig.   4c). [score:3]
We deduced that the direct transcriptional regulatory effect of p53 on miR-130b might be cell-type specific because we reproduced it in Hela cells but not in NSCLC cells. [score:3]
Among the differentially expressed miRNAs (Fig.   2a,b), miR-130b decreased the most significantly both in the AGO2 siRNA group and the miR-138 mimic group. [score:3]
Our subsequent searching of miR130b targets in the p53 signalling pathway identified GADD45A, which affect cell cycle and proliferation in human NSCLC cells. [score:3]
We found that miR-138 specifically targeted AGO2, which affected the stability and maturation of miR-130b. [score:3]
Similar results were observed in H1299 cells, i. e., overexpression of p53 significantly reduced the miR-130b content, which is consistent with the effects of the miR-138 mimic and AGO2 siRNA in the cells (Fig.   3g). [score:3]
However, only the miR-130b inhibitor had such an effect in mouse NIH/3T3 and rat H9C2 cells (Supplementary Fig.   S3c), suggesting that the p53-miR-138-AGO2-miR-130b pathway was absent in mice or rats. [score:3]
We confirmed that there is no target site for miR-130b in p53. [score:3]
These results were consistent with those obtained in H460 and H1299 cells, suggesting that the p53-miR-138-AGO2-miR-130b-GADD45A pathway may be universal in its regulation of human cancer development. [score:3]
We also deduced that deviation may exist in the p53-miR-138-AGO2-miR-130b regulation pathway of GADD45A among humans, mice and rats, which may be due to differences in the regulation of miR-138 by p53. [score:3]
The p53-miR-138-AGO2-miR-130b pathway regulation of GADD45A differs among species. [score:2]
Figure 3The regulatory effect of p53 on miR-130b. [score:2]
Our results revealed that deviation may exist in the p53-miR-138-AGO2-miR-130b regulation pathway of GADD45A among humans, mice and rats. [score:2]
Negative regulation of miR-130b by p53 in human NSCLC cells. [score:2]
Quantitative RT-PCR assays were performed to examine the effects of AGO2 overexpression, the miR-138 mimic or AGO2 siRNA transfection on miR-130b processing. [score:2]
These results suggested that there is no direct transcriptional activation of miR-130b by p53 in human NSCLC cells (H460 and H1299). [score:2]
We next compared the native expression level of miR-130b in H460 and H1299 cells. [score:2]
These results suggested a complex one-way regulatory pathway from p53 to miR-130b via miR-138 and AGO2 in human NSCLC cells. [score:2]
Figure 4p53-miR-138-AGO2-miR-130b pathway regulation of GADD45A in human NSCLC cells. [score:2]
The full length sequence (641nt, NM_001199742), or the sequence with a deletion mutation of the miR-130b binding sites of the GADD45A 3′ UTR was cloned into the downstream region of a firefly luciferase reporter gene (named pGL3-GADD45A-wt and pGL3-GADD45A-mut, respectively). [score:2]
Decreased AGO2 induced by miR-138 affects miR-130b abundance. [score:1]
Pre-miR-130b was incubated with Dicer (2 U) and AGO2 in vitro. [score:1]
Figure 2AGO2 affects miR-130b abundance in human NSCLC cells. [score:1]
Indeed, when we co-incubated the pre-miR-130b with recombinant AGO2 and Dicer protein, the production of the intermediate Ac-pre-miR-130 was significantly increased, in a manner dependent on the AGO2 concentration, and thus, the production of mature miR-130b from the 3′ end by Dicer was also elevated (Fig.   2g). [score:1]
Furthermore, we analyzed the effects of AGO2 on the stability of miR-130b. [score:1]
The probes labelled with biotin in this study were as follows: anti-miR-130b probe (5′-bio-TTGCCCTTTCTTCTTTGCTCTG-3′) and anti-let-7a-3 probe (5′-bio-TTCTTTTC TTCCTTCTTCCTCT-3′). [score:1]
Briefly, 20 pmol of miR-130b precursors were incubated with 2 U of Dicer in vitro for 4 h and then a northern blot analysis was performed as in c. Lane 1: 22 nt biotin-ssRNA; 2: pre-miR-130b; 3: Ac-pre-miR-130b. [score:1]
Luciferase reporter constructs containing two potential binding sites for p53 protein at upstream of miR-130b (locations −4223 and −3540) predicted by BioSun software and a p53MH algorithm 29, 30 (Fig.   3a), termed pGL4-(−4223) and pGL4-(−3540), respectively, were used to detect whether p53 showed the appropriate transcriptional activity by binding to the predicted sites. [score:1]
Moreover, Ago2 increased miR-130b levels by modulating miRNA stability in a slicing-independent manner. [score:1]
Sequencing and putative secondary structure results showed that Ac-pre-miR-130b was 47 nt in length and was produced from pre-miR-130b by cleavage of the passenger strand at a position 13 nucleotides from its 5′ end (Fig.   2e), which is different from the reported AGO2 processing of the 3′ arm of pre-miRNAs such as pre-let-7a [27]. [score:1]
The result showed that 60-nt pre-miR-130b could be sliced into the mature miR-130b (21 nt) by Dicer protein as expected but could also be sliced into an unexpected band when treated with AGO2 protein (Fig.   2d). [score:1]
miR-130b precursors were prepared by in vitro transcription. [score:1]
The WT GADD45A 3′UTR lacking the predicted miR-130b binding site was cloned into a pGL3-Control Vector and named pGL3-GADD45A-mut. [score:1]
H460 cells transfected with p53 siRNA, anti-miR-138, miR-130b, pCMV-AGO2 or control plasmid were treated with or without 2 Gy IR. [score:1]
This unexpected intermediate band, named as Ac-pre-miR-130 for AGO2-cleaved pre-miR-130, was recycled from the gel and subjected to sequencing. [score:1]
In addition, the Ac-pre-miR-130b was further processed by Dicer into mature miR-130b more efficiently than the pre-miR-130b was (Fig.   2f). [score:1]
The double-stranded DNA templates with a T7 RNA polymerase promoter sequence were synthesized by Invitrogen: pre-mir-130b sense, 5′-taatacgactcactatagACTCTTTCCCTGTTGCAC TACTATAGGCCGCTGGGAAGCAGTGCAATGATGAAAGGGCAT-3′; pre-let-7a-3 sense, 5′-taatacgactcactatagTGAGGTAGTAGGTTGTATAGTTTGGGG CTCTGCCCTGCTATGGGATAACTATACAATC-3′; and Ac-pre-miR-130b sense, 5′-taatacgactcactatagUGCACTACTATAGGCCGCTGGGAAGCAGTGCAATGATG AAAGGGCAT-3′; Ac-pre-let-7a-3 sense: 5′-taatacgactcactatagTGAGGTAGTAGGT TGTATAGTTTGG GGCTCTGCCCTGCT ATGGGATAACTATACAATC-3′. [score:1]
A pathway enrichment analysis using miRWalk2.0 database showed that miR-130b was involved in p53 signalling pathway and multiple signaling pathway in NSCLC cells (Supplementary Fig.   S1b). [score:1]
Lane 1: 22 nt biotin-ssRNA; 2: pre-miR-130b; 3: pre-miR-130b with Dicer; 4: pre-miR-130b with AGO2. [score:1]
Therefore, we demonstrated that AGO2 could facilitate the Dicer -induced processing of miR-130b by production of the intermediate forms of Ac-pre-miR-130b. [score:1]
org/) was performed, and we found potential miR-130b binding sites in the 3′ UTR of GADD45A mRNA (Fig.   4f). [score:1]
To further test the hypothesis of slicer catalytic activity of AGO2 on pre-miR-130b, in vitro cleavage experiments were then performed. [score:1]
As all the aforementioned adopted cells are human NSCLC cells, we also used the human hepatoma cell line Hep3B, with a p53 deletion, to test the existence of the p53-miR-138-AGO2-miR-130b-GADD45A pathway. [score:1]
Reconstitution of AGO2 simultaneously with silencing treatment showed a rescue of the silencing effect on both the pre-miR-130b and mature miR-130b abundance to a certain degree (Fig.   2c), demonstrating an AGO2-specific effect. [score:1]
Furthermore, the p53 mRNA and protein levels were not significantly changed after transfection of a miR-130b mimic into H460 cells (Supplementary Fig.   S2). [score:1]
The mutant 3′ UTR without the miR-130b binding sites is shown in the bottom image. [score:1]
In this study, we demonstrated that AGO2 is capable of slicing pre-miR-130b into an Ac-pre-miRNA precursor, followed by Dicer -mediated cleavage of intermediates to produce mature miRNAs. [score:1]
These results support the idea that AGO2 is involved in pre-miR-130b to miR-130b processing but not in pri-miR-130b to pre-miR-130b processing. [score:1]
The miR-130b content in H1299 cells was significantly higher than that in H460 cells (Fig.   3e). [score:1]
The p53 -binding site oligonucleotides (bold) containing the XhoI site at the 5′-end and the HindIII sequence (italic) at the 3′-end (miR-130b (−4223): 5′- CTCGAG AAGCTAGTGAAAGGTGCATTATTGAGCAAGTTA AAGCTT-3′ and miR-130b (−3540): 5′- CTCGAG GGGCATGGTGGCTCATGCCT AAGCTT-3′) were separately inserted upstream of a minimal promoter of the luc2 gene and named pGL4-(−4223) and pGL4-(−3540), respectively. [score:1]
However, miR-130b is a 3′-end miRNA, and we demonstrated that pre-miR130b is sliced at the passenger strand from the 5′ end. [score:1]
A previous study showed that p53 can promote the transcription of miR-130b in human endometrial cancer cells (HEC-50 and HEC-1) [42], and these data conflict with our findings. [score:1]
The miRNA mimics and siRNA sequences were as follows: miR-138 mimic, 5′-AGCUGGUGUUGUGAAUCAGGCCG-3′ (sense); miR-130b mimic, 5′-CAGUG CAAUGAUGAAAGGGCAU-3′ (sense); p53 siRNA, 5′-UAUGAAUCGUCGUC CUAUUC-3′ (sense); AGO2 siRNA, GCCUGUAUCAAGCUAGAAA; GADD45A siRNA, ACAUCCUGCGCGUCAGCAAC. [score:1]
To investigate whether AGO2 could affect the processing of miR-130b, the abundance of pri-miR-130b (primary-miR-130b), pre-miR-130b (precursor-miR-130b), and mature miR-130b were detected using q-PCR in cells with either AGO2 overexpression or AGO2 silencing using AGO2 siRNA or a miR-138 mimic. [score:1]
Briefly, 20 pmol of pre-miR-130b was incubated with 2 U of Dicer or 200 ng of Ago2 for 4 h. The processed products were detected using northern blotting with a biotin -labelled anti-miR-130b probe. [score:1]
Furthermore, the results showed that generation of Ac-pre-miR130b promoted the maturation of miR-130b by Dicer. [score:1]
The results suggested the pivotal impacts of AGO2 on the abundance of miR-130b and unveiled variant mechanisms of AGO2 -mediated processing. [score:1]
[1 to 20 of 77 sentences]
7
[+] score: 159
miR-130b-5p directly silences endogenous CCNG2 expression levels in MDA-MB-231 cellsTo understand how these deregulated miRNAs might function in triple -negative breast cancer, we performed target prediction of the miRNAs as described in the section. [score:7]
Furthermore, our work extends the potential target network of miRNAs by showing that the cyclin G2 gene (CCNG2) is a direct target of miR-130b-5p from the miR-301b-130b cluster. [score:6]
Among those putative target candidates, five potential tumor suppressors, including CCNG2, FOXP1, NRG1, LRIG1, and TNFSF10, were shown to have a direct binding site with miR-130b-5p. [score:6]
miR-130b-5p expression was significantly (p <0.001) up-regulated in triple -negative breast cancers. [score:6]
The endogenous expression levels of CCNG2 were significantly repressed after the forced expression of miR-130b-5p in MDA-MB-231 cells. [score:5]
Forced expression of miR-130b-5p was found to significantly repress the endogenous expression levels of CCNG2 in triple -negative breast cancer cells. [score:5]
Quantitative RT-PCR data confirmed that the endogenous expression levels of CCNG2 were significantly repressed in MDA-MB-231 cells after overexpression of miR-130b-5p (Figure  4C). [score:5]
These results strongly support that miR-130b-5p plays a role in cell cycle progression through suppression of CCNG2 expression in triple -negative breast cancer. [score:5]
A direct correlation between high miR-130b-5p expression (p <0.001; fold change 2.8) and low CCNG2 expression (p <0.001; fold change 0.5) was observed in our triple -negative breast cancer samples as compared with normal breast tissue controls (Additional file 3A and B). [score:5]
Triple -negative breast cancer Deep sequencing MicroRNA expression MicroRNA cluster miR-130b-5p CCNG2 Breast cancer is a heterogeneous disease that can be classified into several histological forms in current clinical practice. [score:5]
Additional file 3: Expression levels of miR-130b-5p and CCNG2 were inversely regulated between normal breast tissues (n = 14) and triple -negative breast cancers (n = 24) in our cohort of 38 samples. [score:4]
Quantitative RT-PCR data confirmed that miR-301b-5p, miR-130b-5p, and miR-130b-3p were all up-regulated in 19 triple -negative breast cancer samples (Figure  3B-D, respectively). [score:4]
It would be interesting to test whether this novel regulatory mechanism of miR-130b-5p and its CCNG2 target in triple -negative breast cancer may be involved in other malignancies as well. [score:4]
Compared with the negative control, overexpression of miR-130b-5p was shown to significantly inhibit luciferase reporter activity with Luc- CCNG2-UTR, but not with Luc- CCNG2-UTR-mt3. [score:4]
Two luciferase reporter constructs, Luc- CCNG2-UTR and Luc- CCNG2-UTR-mt3, were made to test whether miR-130b-5p might directly target CCNG2 in the putative binding site. [score:4]
It is thus important that we identified CCNG2 as a direct target of miR-130b-5p. [score:4]
Compared with negative controls, a marked reduction (>50%) in CCNG2 expression level was observed in the miR-130b-5p -overexpressed MDA-MB-231cells. [score:4]
Two luciferase reporter constructs, Luc- CCNG2-UTR and Luc- CCNG2-UTR-mt3, were made to test whether miR-130b-5p directly targets the putative binding site in the 3′-UTR of CCNG2. [score:4]
miR-130b-5p directly silences endogenous CCNG2 expression levels in MDA-MB-231 cells. [score:4]
Figure 4 miR-130b-5p directly silences CCNG2 expression in triple -negative breast cancer cells. [score:4]
We were able to identify CCNG2 as a direct target of miR-130b-5p in triple -negative breast cancer. [score:4]
Overexpression of miR-130b-5p was carried out in MDA-MB-231 cells using plasmid DNA transfection of a lentiviral vector containing the precursor sequence of miR-130b-5p. [score:3]
The ability of miR-130b-5p to repress CCNG2 expression may enhance malignancy by accelerating cell cycle transition in triple -negative tumor cells. [score:3]
Moreover, we extended the current knowledge of microRNA regulatory network by showing that miR-130b-5p in the miR-301b-130b cluster directly silences CCNG2 in triple -negative breast cancer. [score:3]
miR-130b-5p expression was significantly associated with both early-stage and advanced-stage triple -negative breast cancers. [score:3]
The luciferase reporter assays revealed that miR-130b-5p significantly reduced the luciferase activity of the wild-type CCNG2 gene reporter, but not that of the site-directed mutant (Figure  4B), suggesting that miR-130b-5p had a suppressive effect at the predicted binding site in the 3′-UTR of CCNG2. [score:3]
Relative expression levels of (B) miR-301b-5p, (C) miR-130b-5p, and (D) miR-130b-3p in triple -negative breast cancer tissues (n = 19) and adjacent normal tissues (n = 4) are shown. [score:3]
Expression of miR-130b-5p was verified and quantified using KAPA PROBE Fast qPCR Master Mix (Kapa Biosystems, Boston, MA, USA), and the LightCycler 480 System (Roche, Basel, Switzerland). [score:3]
Moreover, miR-130b-5p from the miR-301b-130b cluster was shown to directly repress the cyclin G2 (CCNG2) gene, a crucial cell cycle regulator, in triple -negative breast cancer cells. [score:3]
After overexpression of miR-130b-5p, MDA-MB-231 cells showed significant alterations (p <0.05) in cell cycle profile (Additional file 2). [score:3]
Sequencing data of miR-130b-5p expression were shown to be significantly associated with tumor progression in both early-stage triple -negative breast cancers (p = 0.002; n = 7) and advanced stage triple -negative breast cancers (p <0.001; n = 17) in Figure  4D. [score:3]
Next, we examined whether miR-130b-5p might repress endogenous CCNG2 expression in triple -negative breast cancer cells. [score:3]
Additional file 2: showed significant alterations in cell cycle profile in MDA_MB-231 cells after miR-130b-5p overexpression. [score:3]
miR-130b-5p was cloned into a lentiviral vector PreMiR-130b (System Biosciences, Mountain View, CA, USA) that was used to overexpress the miRNA in MDA-MB-231 cells. [score:3]
miR-130b-5p or empty vector (control) were overexpressed in the MDA-MB-231 cells. [score:3]
A significant decrease in G1 phase and increases in S and G2/M phases were observed with the miR-130b-5p -overexpressed MDA-MB-231cells in the cell cycle analysis. [score:3]
Site-directed mutagenesis of the putative miR-130b-5p binding site was made using a facile PCR procedure [40]. [score:2]
Luciferase reporter assays showed that miR-130b-5p -mediated repression of CCNG2 was dependent on the sequence of the 3′-untranslated region. [score:2]
Compared with vector controls, there was a significant decrease with the cell population in G1 phase along with increases in S and G2/M phases in the miR-130b-5p -overexpressed MDA_MB-231 cells. [score:2]
The functional relevance of miR-130b-5p in cell cycle regulation with triple -negative breast cancer cells was analyzed in this study. [score:2]
The possible binding sequence of miR-130b-5p with the 3′-UTR of CCNG2 is shown in red. [score:1]
The findings described in this study implicate a miR-130b-5p- CCNG2 axis that may be involved in the malignant progression of triple -negative breast cancer. [score:1]
A schematic diagram of the putative miR-130b-5p binding site in the 3′-UTR of CCNG2 is shown in Figure  4A. [score:1]
A CCNG2 luciferase reporter construct was made by introducing the CCNG2 3′-UTR carrying a predicted miR-130b-5p binding site (5′-CCTTGGAGATACTGAAAGAGA-3′) into the pmirGLO control vector (Promega, Madison, WI, USA). [score:1]
We then investigated an association between miR-130b-5p expression and malignancy of triple -negative breast cancer from the sequencing data in our cohort. [score:1]
The other luciferase reporter construct, Luc- CCNG2-UTR-mt3, was made to carry three mutated nucleotides at the putative binding site to disrupt binding of miR-130b-5p to CCNG2. [score:1]
MDA-MB-231 cells were transfected with empty vectors (control) or vectors containing miR-130b-5p precursor sequence. [score:1]
[1 to 20 of 47 sentences]
8
[+] score: 107
The results showed that transfection of pre-miR-130b upregulated vimentin, N-cadherin, Twist, zeb2 and Snail expression, but downregulated E-cadherin expression. [score:11]
Alternatively, HDAC inhibitors may disrupt the repressive transcriptional complex that binds to miR-130b regulatory elements, leading to miR-130b up-regulation and consequent inhibition of E-cadherin expression. [score:11]
In particular, silencing of miR-130b induced E-cadherin expression to inhibit EMT process, while ectopic expression of miR-130b and knockdown of DICER1 increased the expression of Vmentin, zeb2, N-cadherin, Twist and Snail to promote EMT process. [score:10]
Furthermore, following treatment with HDAC inhibitor, the expression of miR-130b was upregulated 21.2-fold in Ishikawa cells and 23.3-fold in AN3CA cells. [score:8]
Silencing of miR-130b induced E-cadherin expression, while ectopic expression of miR-130b and knockdown of DICER1 increased the expression of Vimentin, zeb2, N-cadherin, Twist and Snail in EC cells. [score:8]
To understand the role of miR-130b and DICER1 in the regulation of EMT, we manipulated the expression of miR-130b and DICER1 in EC cells and examined the effects on the expression of EMT-related genes such as E-cadherin, Twist, Snail, N-cadherin, zeb2 and vimentin. [score:6]
An important issue of our study presented here is the mechanism by which demethylating agents and HDAC inhibitors cause dysregulation of miR-130b expression. [score:6]
qRT-PCR analysis of miR-130b, miR-301a, and miR-200b expression as well as DICER1, zeb2, CDH1, and vimentin mRNA expression levels in Ishikawa and AN3CA cells treated with 10 μM 5'-aza-CdR and 10 μM TSA. [score:5]
To explore the mechanisms underlying the upregulation of miRNAs in endometrial cancers, we examined the methylation status of miR-130a, miR-130b, miR-625 and miR-200b by bisulfite-specific PCR sequencing (Table  1). [score:4]
We further examined whether miR-130b expression was regulated by CpG methylation. [score:4]
After treatment with demethylation agents for 72 h, the expression of miR-130b increased 36.8-fold in Ishikawa cells and 29.6-fold in AN3CA cells (P < 0.01) (Figure  1). [score:3]
Notably, we found that 5’-Aza-CdR reversed the hypermethylation of miR-130b promoter and inhibited the maglinant behaviors of EC cells. [score:3]
Figure 3. A. The expression and correlation of miR-130b and DICER1 in clinical samples. [score:3]
Ishikawa and AN3CA cells were transiently transfected with anti-miR-130b inhibitor and anti -negative control (anti-NC), along with DICER1 siRNA and siRNA negative control. [score:3]
The scatter plots indicated an inverse correlation between miR-130b and DICER1 mRNA expression, as determined by real-time PCR. [score:3]
B, C. Western blots showing E-cadherin, N-cadherin, Twist1, Snail, Zeb2 and vimentin expression levels in AN3CA cells after transfection with DICER1 siRNA, anti-miR130b or pre-miR130b. [score:3]
These data indicated that miR-130b was inversely correlated with DICER1 expression at the mRNA level. [score:3]
Here we presented for the first time a comprehensive analysis of miR-130 family and DICER1 expression in endometrial cancer tissues, compared with normal endometrium. [score:2]
miR130b and DICER1 regulate EMT realted genes. [score:2]
These results suggest that miR-130b and DICER1 have opposite effects on the regulation of EMT. [score:2]
We found dramatic differential expression of miR-130b and the level of its CpG methylation associated with EMT-related genes in endometrial cancer cells treated with 5’-Aza-Cdr or TSA, compared to untreated cells. [score:2]
qRT-PCR analysis indicated that miR-130b was lower in normal endometrium than in endometrial cancer while DICER1 was higher in normal endometrium than in endometrial cancer (Figure  3A). [score:1]
We detected hypomethylation of miR-130b in EECs. [score:1]
miR-130b hypermethylation was found in ovarian cancer tissues as well as in drug-resistant cell lines [8]. [score:1]
Cells were washed with PBS and transiently transfected with 100 nM pre-miR-130b or anti-miR-130b with their corresponding negative controls (miR negative control #1 or anti-miR negative control#1; Applied Biosystems; Foster City, CA, USA) in Opti-MEM (Invitrogen, Carlsbad, CA, USA) using siPORT NeoFX transfection agent (Applied Biosystems; Foster City, CA,USA) following the manufacturer’s protocol. [score:1]
Figure 2 to assess CpG islands of miR130b. [score:1]
[1 to 20 of 26 sentences]
9
[+] score: 93
Other miRNAs from this paper: hsa-mir-30c-2, hsa-mir-34a, hsa-mir-195, hsa-mir-155, hsa-mir-30c-1
For example, miR-34a-5p regulated Cdk4, and miR-195-5p regulated CDC42; both miR-34a-5p and miR-195-5p were up-regulated by DHA and co-regulated Cdk6, VEGF, E2F3, and Cdk4; the up-regulated microRNA miR-30c-5p regulated Rac1, and co-regulated MEK1 with miR-34a-5p and E2F3 with miR-34a-5p and miR-195-5p; the up-regulated microRNA miR-130b-3p co-regulated E2F1 with miR-34a-5p; and the down-regulated microRNA miR-155-5p regulated p16. [score:20]
Here, we found that DHA treatment up-regulated miR-34a-5p, miR-195-5p, miR-130b-3p, and miR-30c-5p expression and down-regulated the expression of the target mRNAs Cdk4, Cdk6, E2F3, and E2F1, respectively; DHA treatment also decreased protein levels translated from these mRNAs. [score:15]
To analyze the mechanism by which DHA suppresses growth, inhibits angiogenesis, and promotes apoptosis in tumor tissues, expression of the microRNAs (miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p) that were up-regulated by DHA and their target mRNAs (Cdk4, Cdk6, VEGF, IKKα, MEK1, E2F3, Rac1, E2F1, and CDC42) were analyzed using qRT-PCR. [score:12]
miR-34a-5p, miR-195-5p, miR-30c-5p, miR-130b-3p, mir-34a-5p specific inhibitor (miR-34a-5p antisense oligodeoxyribonucleotide, AMO-34a-5p), mir-195-5p specific inhibitor (miR-195-5p antisense oligodeoxyribonucleotide, AMO-195-5p), mir-30c-5p specific inhibitor (miR-30c-5p antisense oligodeoxyribonucleotide, AMO-30c-5p), mir-130b-3p specific inhibitor (miR-130b-3p antisense oligodeoxyribonucleotide, AMO-130b-3p), and negative control miRNA (NC) were obtained from RiboBio (Guangzhou, China). [score:9]
To assess the regulatory relationships between the microRNAs and target mRNAs identified via microarray and systematic analysis, we next transfected PANC-1 and BxPC-3 cells with miR-34a-5p, miR-195-5p, miR-30c-5p, or miR-130b-3p or their inhibitors and examined the protein levels of their target mRNAs, including Cdk4, Cdk6, VEGF, IKKα, MEK1, E2F3, Rac1, E2F1, and CDC42 in western blots. [score:8]
To confirm the results of microarray experiments and mRNA data obtained from the experimentally validated databases, all of the microRNAs (miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p) that were up-regulated by DHA, suppressed growth and angiogenesis, and promoted apoptosis in pancreatic cancer cells, and their target mRNAs (Cdk4, Cdk6, VEGF, IKKα, MEK1, E2F3, Rac1, E2F1, and CDC42), were analyzed with qRT-PCR. [score:8]
Surprisingly, we found that four crucial microRNAs (miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p) regulated the expression of many mRNAs (Cdk4, Cdk6, VEGF, IKKα, MEK1, E2F3, Rac1, E2F1, ERK1, and CDC42) and their proteins, and thus were crucial to the anti-pancreatic cancer effects of DHA. [score:4]
Finally, miR-130b-3p overexpression reduced, and inhibition of endogenous miR-130b-3p increased, E2F1 at levels in both PANC-1 and BxPC-3 cells compared to the control group. [score:4]
Our results provide mechanistic evidence that the anti-proliferative, pro-apoptotic, and anti-angiogenesis effects of DHA were associated with the up-regulation of miR-34a-5p, miR-195-5p, miR-30c-5, and miR-130b-3p. [score:4]
As shown in Figure 5, miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p were up-regulated in DHA -treated PANC-1 and BxPC-3 cells compared to vehicle -treated controls, confirming the microarray results. [score:3]
As shown in Figure 8A, miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p were up-regulated in the DHA -treated group compared to the vehicle -treated group, confirming the microarray results in vivo. [score:3]
Figure 4 A. PANC-1 and BxPC-3 cells were transfected with miR-34a-5p, miR-195-5p, miR-30c-5p, miR-130b-3p, AMO-34a-5p, AMO-195-5p, AMO-30c-5p, AMO-130b-3p, or negative control miRNA. [score:1]
A. PANC-1 and BxPC-3 cells were transfected with miR-34a-5p, miR-195-5p, miR-30c-5p, miR-130b-3p, AMO-34a-5p, AMO-195-5p, AMO-30c-5p, AMO-130b-3p, or negative control miRNA. [score:1]
All of the microRNAs (miR-34a-5p, miR-195-5p, miR-30c-5p, and miR-130b-3p) were also analyzed with qRT-PCR in HPDE6-C7 cell line (Supplementary Figure S2). [score:1]
[1 to 20 of 14 sentences]
10
[+] score: 69
Other miRNAs from this paper: hsa-mir-17
Here, we report that miR130b up-regulates HIF1α activity (as well as down-regulates DDX6 expression), and that the up-regulation of the PPARα/HIF1α interplay is paralleled by the down-regulation of PPARγ, a miR130b target [37]. [score:17]
Moreover, miR130b is induced by hypoxia and increases HIF1α protein expression by facilitating HIF1α mRNA translation, via the down-regulation of DDX6 expression [36]. [score:10]
In keeping with the results above reported, miR130b expression was down-regulated by siHIF1 and siPPARα, and it was induced by PPARα over -expression in MCF7-MS (Figure 4F). [score:8]
We observed that the miR130b up-regulation in TAF supernatant-exposed MCF7-MS (Figure 4A) was paralleled by the reduction of DDX6 expression in MS (Figure 4B). [score:6]
TNFα binds TNFR1 on breast CSCs and activates the PPARα/HIF1α interplay which up-regulates miR130b expression. [score:6]
We then observed the up-regulation of miR130b expression in MCF7- and MCF10-MS compared to adherent cells (Figure 4E). [score:5]
To mechanistically elucidate the PPARα/HIF1α interplay, we examined microRNA130b (miR130b) expression. [score:3]
Finally, the transfection of pre-miR130b increased PPARα expression in MCF7-MS (Figure 4G). [score:3]
The two proteins promote mammospheres formation and enhance each other expression via miRNA130b/miRNA17-5p -dependent mechanism which is antagonized by PPARγ. [score:3]
Accordingly, the administration of miR130b antagonist (a-miR130b) in MCF7-MS reduced the activity of HRELuc (Figure 4C) and induced DDX6 expression (Figure 4D). [score:3]
These data point out that the antagonist interplay between PPARα and PPARγ is mediated by miR130b and miR17-5p. [score:1]
Pre-miRNA17-5p, miRNA130b, antago-miRNA17-5p and miRNA130b were purchased from Life Technologies (Rockville, MD, USA). [score:1]
Role of miR130b on the PPARα/HIF1α interplay in breast CSCs. [score:1]
In this regard, we show the involvement of miR130b. [score:1]
Opposing Roles of miRNA130b and miRNA17-5p on the PPARα/HIF1α Interplay. [score:1]
[1 to 20 of 15 sentences]
11
[+] score: 61
Transfection of miR-130b mimic suppressed the expression of various lipogenic genes in hepatocytes, while miR-130b inhibition augmented cellular lipid droplet (LD) contents [30]. [score:7]
HCV infection also downregulated miR-130b expression in primary hepatocytes and Huh7.5.1 cells (Supplementary Fig.   13b). [score:6]
We conducted using luciferase reporters and demonstrated that miR-130 mimic had limited effect on their 3′-UTR activities, except ROCK2 showed moderate inhibition (Supplementary Fig.   14c), suggesting that these genes probably are not targets of miR-130. [score:5]
Transfecting miR-130b mimic in cells markedly decreased both the 3′-UTR activities and mRNA levels of the six miR-130a -targeted genes, indicating that miR-130b targets the same panel of HCV host dependencies as miR-130a for its antiviral functions (Supplementary Fig.   13c–e). [score:5]
Notably, the inhibitors of less-abundant family members (e. g., miR-130b) exerted less effects than that of the more highly expressed (i. e., miR-130a). [score:5]
Altered hepatic lipid metabolism has also been attributed to other miRNAs, including miR-185 and miR-130b, which were shown to be downregulated by HCV. [score:4]
In our primary screen, two major miR-130 miRNAs, miR-130a-3p and miR-130b-3p (denominated as miR-130a/b hereafter), and another family member, miR-301a, were shown to effectively inhibit HCV infection (Supplementary Fig.   11a). [score:3]
This is likely due to the continued function of endogenous miR-130a when the less abundant miR-130b is inhibited. [score:3]
Transfection of miR-130b mimic or hairpin inhibitor significantly decreased or enhanced HCV infection, respectively (Supplementary Fig.   13a). [score:3]
Therefore, DDX6, E2F2, HCCS, INTS6, LDLR, and NPAT likely mediate miR-130’s inhibitory effect on HCV replication (Supplementary Fig.   12f). [score:3]
miR-130 miRNAs suppress HCV replication and assembly. [score:3]
All six genes contain at least one miR-130 seed match site in their 3′-UTRs (Supplementary Fig.   12c), the activities of which were drastically inhibited by miR-130a transfection (Fig.   6f). [score:3]
A recent study suggested that miR-130b, an immunometabolism-regulatory miRNA implicated in development of hepatic steatosis, plays a role in lipid metabolism in the liver [29]. [score:3]
The reliance of HCV infection on these miR-130 targets was validated by siRNA -mediated loss-of-function assays. [score:2]
We uncovered multiple miRNAs as regulators of HCV infection, including the miR-25, let-7, and miR-130 families. [score:2]
We also investigated the antiviral effect of miR-130b, though it is expressed at a lower level in hepatocytes than miR-130a (Supplementary Fig.   11b). [score:1]
We further dissected the functions and underlying mechanisms of three physiologically relevant miRNA families (miR-25, let-7, and miR-130) in modulating HCV infection. [score:1]
It is noteworthy that miR-27a/b, miR-185, miR-130b, and miR-146a-5p mentioned above are all mimic screen hits in our study (Supplementary Data  1). [score:1]
let-7a, miR-130a, miR-130b, and miR-25 expression levels were determined by qPCR using TaqMan Universal PCR Master Mix (Applied Biosystems) and specific miRNA primers and probes (TaqMan MicroRNA Assays, Applied Biosystems). [score:1]
[1 to 20 of 19 sentences]
12
[+] score: 61
Other miRNAs from this paper: hsa-mir-218-1, hsa-mir-218-2, hsa-mir-200c
QRT-PCR indicated that miR-130b expression in tumor tissues was strongly elevated than adjacent non-tumor tissues (P < 0.001), while the level of miR-218 expression in osteosarcoma tissues was down-regulated than adjacent non-tumor tissues (P < 0.001). [score:8]
Clinical correlation analysis showed that increased expression of miR-130b and decreased expression of miR-218 were significantly associated with advanced tumor stage (x [2] = 6.285, P < 0.007; x [2] = 7.172, P < 0.009), distant metastasis (x [2] = 5.528; P < 0.001; x [2] = 4.617, P < 0.001) and size of tumor (x [2] = 5.01, P = 0.013; x [2] = 4.271, P = 0.019), (Table  1). [score:5]
Clinical correlation analysis showed that increased expression of miR-130b and decreased expression of miR-218 were significantly associated with advanced tumor stage (x [2] = 6.285, P < 0.009; x [2] = 7.172, P < 0.007), distant metastasis (x [2] = 5.528; P < 0.001; x [2] = 4.617, P < 0.001) and size of tumor (x [2] = 5.01, P = 0.013; x [2] = 4.271, P = 0.019). [score:5]
Down-regulation of miR-130b has been documented in endometrial cancer, pituitary adenomas, papillary thyroid carcinoma, and pancreatic cancer [18– 21]. [score:4]
Moreover, the PPARγ is as a direct functional target of miR-130b in colorectal cancer. [score:4]
Down-regulation of miR-130b has been reported in endometrial cancer, pituitary adenomas, papillary thyroid carcinoma, and pancreatic cancer [18– 21]. [score:4]
Nevertheless, it has been shown that miR-130b expression was aberrantly increased in melanoma, colorectal cancer, bladder cancer, and gastric carcinoma [16, 17, 22– 24]. [score:3]
Elevated expression level of miR-130b was associated with poorer prognosis of osteosarcoma patients. [score:3]
It has been found that, miR-130b could contribute to EMT of cancer cells by targeting DICER1 [35]. [score:3]
QRT-PCR indicated that miR-130b expression in tumor tissues was strongly elevated than adjacent non-tumor tissues (1.04 ± 0.31 vs. [score:3]
The clinical features of all enrolled patients were shown in Table  1. Fig. 1 Expression levels of miR-130b and miR-218 in osteosarcoma tissues and adjacent non-tumor tissues Briefly, total RNA was extracted from the tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. [score:3]
On the other hand, it was shown that miR-130b expression was increased in melanoma, colorectal cancer, bladder cancer, and gastric carcinoma [16, 17, 22– 24]. [score:3]
Clinical correlation analysis showed that increased expression of miR-130b was significantly associated with advanced tumor stage, distant metastasis and size of tumor. [score:3]
A previous study indicated that in CRC miR-130b induces EMT through a pathway that appears to be independent of DICER1 and its downstream target miR-200c. [score:3]
Our findings indicated that miR-130b expression was strongly elevated in tumor tissues when compared with adjacent non-tumor tissues. [score:2]
The involvement of miR-130b in CRC-related angiogenesis and EMT has been previously shown. [score:1]
In hypoxic conditions, miR-130b represses DDX6 leading to increased activity of HIF1α, a well-known VEGF inducer. [score:1]
We utilized quantitative real-time PCR to evaluate the level of miR-130b and miR-218 expressions in OS patients and normal tissues and their relationship with clinicopathological features and survival in OS patients. [score:1]
Furthermore, miR-130b may play a key role in the progression of osteosarcoma. [score:1]
Mir-130b/218 Osteosarcoma Regulation Patient Diagnosis Osteosarcoma (OS) is a primary malignant bone tumor with high morbidity in children and young adults; hat is more common in males than in females [1– 4]. [score:1]
[1 to 20 of 20 sentences]
13
[+] score: 44
In multiple human cancers, PTEN expressions are downregulated by miRNAs, which are shown in Table 1. Table 1 miRNA Locus Expression status Tumor type Reference MiR-21 17q23.1 Upregulated Colorectal, bladder, and hepatocellular cancer[112– 114] MiR-19a 13q31.3 Upregulated Lymphoma and CLL[87, 115] MiR-19b Xq26.2 Upregulated Lymphoma[87] MiR-22 17p13.3 Upregulated Prostate cancer and CLL[116, 117] MiR-32 9q31.3 Upregulated Hepatocellular carcinoma[118] MiR-93 7q22.1 Upregulated Hepatocellular carcinoma[119] MiR-494 14q32.31 Upregulated Cervical cancer[120] MiR-130b 22q11.21 Upregulated Esophageal carcinoma[121] MiR-135b 1q32.1 Upregulated Colorectal cancer[122] MiR-214 1q24.3 Upregulated Ovarian cancer[123] MiR-26a3p22.2 (MIR26A1)12q14.1(MIR26A2) Upregulated Prostate cancer[113] MiR-23b 9q22.32 Upregulated Prostate cancer[114] Abbreviations: CLL, chronic lymphocytic leukemia. [score:44]
[1 to 20 of 1 sentences]
14
[+] score: 39
While miR-221, miR-125b, miR-34a and miR-100 were up-regulated and miR-130b, miR-210 and miR-185 were down-regulated in obese subjects; miR-130b and miR-210 were both down-regulated during differentiation and in subcutaneous fat depots from obese subjects. [score:10]
Of note, miR-185, miR-139-5p, miR-484, and miR-130b were down-regulated in obese without DM-2 when compared to non-obese subjects while the expression of miR-99a, miR-1229, miR-125b, miR-221 and miR-199a-5p was up-regulated [Figure 4A and Table S2]. [score:8]
In obese subjects with DM-2, the expression of miR-K12-7, miR-484 and miR-130b, was down-regulated, while miR-1229, miR-199a-5p, miR-221 and miR-125b, were up-regulated compared with non-obese subjects [Figure 4B and Table S2]. [score:8]
Several miRNAs (miR-125b, miR-130b and miR-221) were found to be down-regulated both in mature adipocytes and in subcutaneous fat from obese subjects with or without DM-2. Klöting et al. [26] identified several miRNAs associated with obesity and co-morbidities. [score:4]
Importantly, among these 15 miRNAs, miR-130b (r = −0.406, p = 0.032), miR-210 (r = −0.362, p = 0.049), miR-100 (r = 0.411, p = 0.030), miR-221 (r = 0.436, p = 0.020) and miR-125 (r = 0.477, p = 0.010) were down-regulated during differentiation. [score:4]
Similar discrepant results were observed for miR-130a and miR-130b expression levels. [score:3]
Several miRNAs, namely miR-221, miR-125b, miR-100, miR-130b, miR-210, miR-30a*, miR-34a, miR-503 and miR-185, were outstanding when integrating results from cells and subcutaneous fat tissue together. [score:1]
IntegratedSeveral miRNAs, namely miR-221, miR-125b, miR-100, miR-130b, miR-210, miR-30a*, miR-34a, miR-503 and miR-185, were outstanding when integrating results from cells and subcutaneous fat tissue together. [score:1]
[1 to 20 of 8 sentences]
15
[+] score: 38
Therefore, we speculate here that downregulation of miR-93 and miR-130b can result in elevated expression of tumor suppressor TP53INP1, which in turn can cause growth arrest of AR42J-B13 cells leading to transdifferentiation. [score:8]
Using these hepatocyte and non-hepatocyte cell lines and primary tissues, we performed unsupervised clustering analysis by selecting 7 down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) and 4 up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182). [score:7]
Total RNA extracted from Dex/OSM treated AR42J-B13 cells (7 Days) and mock controls were used for Northern blot analysis using antisense probes against down-regulated miRNAs (miR-93, miR-106b and miR-130b) and up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182). [score:7]
Both up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182) and down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) were chosen as a parameter for comparison. [score:7]
Interestingly, Yeung et al. reported that miR-93 and miR-130b have a potential to target tumor suppressor protein p53 -induced nuclear protein 1 (TP53INP1) in HTLV-1 infected/transformed cells [39]. [score:5]
Mature miRNA of miR-93, miR-106b, miR-130b, miR-21, miR-22 and miR-182 were differentially expressed after transdifferentiation. [score:3]
As shown in Table 1, both miR-93 and miR-130b were reduced in transdifferentiated hepatocytes. [score:1]
[1 to 20 of 7 sentences]
16
[+] score: 26
GO analysis of the miRNA targets showed that miR-19a-3p, miR-92b-3p and miR-130b-3p were mostly involved in the function of cell biological process, metabolic regulation and stimulating reaction (Fig 6 and S2 Table). [score:4]
Based on these up-regulated miRNAs, 3 specific miRNAs, namely hsa-miR-19a-3p, hsa-miR-92b-3p and hsa-miR-130b-3p, with the maximum difference between reprogrammed cells and DPSCs/SCAP were entered into further discussion. [score:4]
Among these 117 up-regulated miRNA genes, miR-19a-3p, miR-92b-3p and miR-130b-3p showed the maximum difference between reprogrammed iPS cells and DPSCs/SCAP. [score:4]
The specific expression of miRNAs, namely hsa-miR-19a-3p, hsa-miR-92b-3p and hsa-miR-130b-3p, which were prediction to be related to the cell cycle, TGF beta signaling pathway and epithelial mesenchymal transition, may reflect the difference between naturally pluripotent cells and reprogrammed cells. [score:3]
The following target prediction analysis on miR-19a-3p, miR-92b-3p and miR-130b-3p using bioinformatic neural nets are summarized in Table 2 (S1 Table). [score:3]
As shown in Fig 8A, the results detected on microarray indicated that the miR-19a-3p, miR-92b-3p and miR-130b-3p displayed substantial increase expression in DPSCs-iPSCs and SCAP-iPSCs. [score:3]
Our analysis on the hsa-miR-130b-3p showed its involvement in the cytokine-cytokine receptor interaction, AMPK and TGF-b signaling pathway and signaling pathways regulating pluripotency of stem cells, suggesting that hsa-miR-130b-3p may be a potential inducer of iPSCs. [score:2]
As for the miR-130b-3p, it was showed the participate in the cytokine-cytokine receptor interaction, AMPK and TGF-beta signaling pathway and signaling pathways regulating pluripotency of stem cells (Fig 7 and S3 Table). [score:2]
hsa-miR-130b-3p has been known to promotes CD133 [+] liver tumor-initiating cell growth and self-renewal via tumor protein 53 -induced nuclear protein 1 [26]. [score:1]
[1 to 20 of 9 sentences]
17
[+] score: 25
Lee E. K. Lee M. J. Ab delmohsen K. Kim W. Kim M. M. Srikantan S. Martindale J. L. Hutchison E. R. Kim H. H. Marasa B. S. miR-130 Suppresses Adipogenesis by Inhibiting Peroxisome Proliferator-Activated Receptor γ Expression Mol. [score:7]
These include the miR-130 family members that repress brown and white adipogenesis via direct inhibition of Pparg [30] and miR-378 that activates Cebpa and Cebpb expression during adipogenesis and enhances brown fat expansion [31, 32]. [score:6]
Expression of miR-130 is increased in adipocyte hypertrophy and fat inflammation [41] and interestingly, miR-130 of the current Fto- KO BAT was significantly decreased in comparison with WT, indicating a role for FTO in the regulation of miR-130 and the pathophysiology of obesity. [score:4]
PPARγ and C/EBPβ are important transcription factors in both brown and white adipogenesis and are inhibited by miR-130 and miR-155, respectively [30, 33]. [score:3]
Expression of miR-130b, a repressor of Pparg [30], was decreased 1.7-fold in Fto- KO mice compared with WT irrespective of the diet (Figure 2). [score:2]
Kim C. Lee H. Cho Y. M. Kwon O. J. Kim W. Lee E. K. TNFα-Induced miR-130 Resulted in Adipocyte Dysfunction during Obesity-Related Inflammation FEBS Lett. [score:1]
Furthermore, HFD induced a 2.3-fold increase in miR-130b, a repressor of Pparg [30], in the scWAT of WT mice but not in Fto- KO mice. [score:1]
In addition, miR-130 was reported to be increased in WAT of mice due to HFD [41], which was also observed in our WT mice but not in the Fto- KO mice. [score:1]
[1 to 20 of 8 sentences]
18
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-370, hsa-mir-371a, hsa-mir-375, hsa-mir-378a, hsa-mir-133b, hsa-mir-423, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-520c, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-33b, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-509-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
[192] miR-33b Decrease lipogenesis via early B cell factor 1 (EBF1) targeting C/EBPα and PPARγ signaling[193] miR-93 Sirt7 and Tbx3[194] miR-125a ERRα[195] miR-130 Inhibition of adipogenesis by inhibiting PPARγ[66] miR-138 Inhibition of adipocyte differentiation via EID-1. Lipid droplet reduction[196] miR-145 Preadipocyte differentiation by targeting IRS1[197] miR-155 C/EBPβ pathway[198] mirR-193a/b Adiponectin production in the adipose tissue. [score:11]
An interesting study from Wang et al. identified miR-130b as a potential biomarker for overweight, hypertriacylglycerolemia, and metabolic syndrome, suggesting a mechanism linking obesity and obesity-related metabolic diseases, through an adipose–muscle crosstalk mediated by circulating miRNAs [69]. [score:3]
Lower expression levels of miR-130a and miR-130b have been reported in the abdominal subcutaneous adipose tissue and in the plasma of obese women compared with those of lean subjects [67]. [score:2]
Activation of serotonin receptors 5-HT2AR and 5-HT2CR[203] miR-709 GSK3ß of Wnt/ß-catenin signaling[204] miR-143 and miR-130 are the best studied among the miRNAs linked to adipogenesis. [score:1]
Insulin resistance, obesity, metabolic syndrome, type 2 diabetes, and an adverse lipid profile[207, 208] ↑miR-122 and miR-199a Children obesity[161] ↓miR-375 T1D onset[209] Ortega et al. have reported that morbidly obese patients exhibit a marked increase of circulating miR-140-5p, miR-142-3p, and miR-222 and a decrease of miR-532-5p, miR-125b, miR-130b, miR-221, miR-15a, miR-423-5p, and miR-520c-3p. [score:1]
Alterations in circulating miR-23a, miR-27a, miR-130, miR-195, miR-197, miR-320a, and miR-509-5p have been associated to metabolic syndrome [153, 154]. [score:1]
They have also found that the addition of TGF-β in matured 3T3-L1 adipocytes dramatically elevated the level of miR-130b in the culture medium, while slightly decreasing intracellular level of miR-130b, thus confirming that this miRNA is released from differentiating adipocytes during adipogenesis. [score:1]
In contrast, circulating miR-130b has been found to be higher in obese children [68]. [score:1]
Insulin resistance, obesity, metabolic syndrome, type 2 diabetes, and an adverse lipid profile[207, 208] ↑miR-122 and miR-199a Children obesity[161] ↓miR-375 T1D onset[209] Ortega et al. have reported that morbidly obese patients exhibit a marked increase of circulating miR-140-5p, miR-142-3p, and miR-222 and a decrease of miR-532-5p, miR-125b, miR-130b, miR-221, miR-15a, miR-423-5p, and miR-520c-3p. [score:1]
Activation of serotonin receptors 5-HT2AR and 5-HT2CR[203] miR-709 GSK3ß of Wnt/ß-catenin signaling[204] miR-143 and miR-130 are the best studied among the miRNAs linked to adipogenesis. [score:1]
[1 to 20 of 10 sentences]
19
[+] score: 21
Thus, it is possible that the pathogenesis of diabetes in PDR causes the upregulation of the expression of miR-130b both in serum and in the vitreous of PDR eyes. [score:6]
The expression levels of nine miRNAs, such as miR-16, miR-92a, miR-130b, miR-21, miR-320, and miR-106b, were significantly upregulated in the PDV group (Fig 1C and 1E). [score:6]
Although we emphasized the expression of miR-21 in this study, we also observed a significant increase in the expression of miR-16, miR-92a, miR-130b, and miR-320. [score:5]
Furthermore, the expression of miR-130b in serum has been reported to be associated with the development of type 2 diabetes mellitus. [score:4]
[1 to 20 of 4 sentences]
20
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Finally, expression of miR-130a and miR-130b, controlled by BCR-ABL, down-regulated the expression of CCN3, a growth inhibitory protein [39]. [score:10]
Deregulation of miR-146a, miR-155, miR-150 and miR-223 was reported to affect cellular proliferation [151– 153] and alteration of miR-31, miR-130b and miR-93 were involved in apoptosis resistance [154], suggesting a possible role of miRNA expression in ATL progression and pathogenesis. [score:4]
Expression of miR-26a, miR-29c, miR-130b and miR-146a was higher in patients with an Imatinib response than in patients with Imatinib-resistant treatment [47]. [score:3]
High miR-130b and low miR-145 and miR-223 expression in aggressive-type ATL were associated with shorter overall survival. [score:3]
Among miR-130b, miR-145 and miR-223, only miR-145 can act as an independent risk factor for ATL prognosis by a multivariate prognostic analysis. [score:1]
[1 to 20 of 5 sentences]
21
[+] score: 21
miR-130b overexpression increases cell viability, reduces cell death, and decreases the expression of Bim in TGF-beta mediated apoptosis, subsequent to the downregulation of Runx3 protein expression. [score:10]
Lai et al. reported that miR-130b expression is upregulated in gastric cancer, and this is inversely associated with Runx3 hypermethylation. [score:6]
miR-25, miR-93, miR-106b, and miR-130 inhibit apoptosis by preventing the expression of the pro-apoptotic protein, Bim (Figure 2) [14]. [score:5]
[1 to 20 of 3 sentences]
22
[+] score: 20
Specifically, motif A, which involves the TF CEBPB, the miRNA hsa-mir-130 and various target genes, is an example of how co-regulatory network motifs may help to better understand the pathogenicity of PD. [score:4]
However, Lee and colleagues 2008 demonstrated that hsa-mir-130 regulates ATXN protein levels in human cells and its inhibition enhances the cytotoxicity caused by the ATXN protein 55, 56. [score:4]
Interestingly, the 11 motifs included mainly the TF CEBPB (see above) as a main regulator and varied between the two miRNAs hsa-mir-130b and hsa-mir-636 as well as various target genes (Table  S3). [score:4]
This sheds light on the potential collaborative role between the hub gene CEBPB and the hub miRNA hsa-mir-130 and their co-regulated genes/miRNAs in regulating ATXN. [score:3]
Also, expression disruption of the identified key miRNAs hsa-mir-130b, and hsa-mir-636 has been connected to pathogenesis in neuropsychiatric and other neurodegenerative disorders 41– 44. [score:3]
We identified 4 central hub miRNAs (hsa-mir-130b, hsa-mir-636, hsa-mir-383, hsa-mir-129-5p) and 2 hub genes (CEBPB, and FEZ1) (Fig.   3). [score:1]
Additionally, the miRNAs mir-130, mir-636, and mir-744 are involved in subnetworks created from enriched GO terms corresponding to abnormal adult neurogenesis, apoptosis, and cell death. [score:1]
[1 to 20 of 7 sentences]
23
[+] score: 20
Based on the fold changes, qRT-PCR was performed to validate microarray results on 12 miRNAs, specifically miRNAs up-regulated in both heart and plasma (miR-660-3p, miR-665, miR-1285-3p and miR-4491), down-regulated in heart but up-regulated in plasma (miR-206 and miR-1268b), up-regulated in heart but down-regulated in plasma (miR-130-3p, miR-199a and miR-330-3p), down-regulated in both heart and plasma (miR-221-30, miR-487b-3p and miR-4288), were chosen for validation test in the plasma of 45 control and 45 CHF patients. [score:19]
As a result, 8 of the 12 selected miRNAs (miR-660-3p, miR-665, miR-1285-3p, miR-4491, miR-206, miR-1268b, miR-130-3p and miR-330-3p) were successfully validated in the second cohort. [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 19
Strong inverse correlation was observed between the tumor suppressor PTEN and several members of the miR-17, miR-19, miR-130/301 and miR-26 families, which were upregulated in the osteosarcoma cell lines. [score:6]
In addition, the expression of the tumor suppressor gene phosphatase and tensin homolog (PTEN) inversely correlated with miR-17, miR-20b, miR-9* and miR-92a (Table 2), but also showed a modest inverse correlation (r = −0.4 to −0.5) with other miRNAs of the miR-17, miR-19, miR-130/301 and miR-26 families (Table S6). [score:5]
Furthermore, the upregulated miRNAs included miR-9/miR-9*, miR-21*, miR-31/miR-31*, miR-196a/miR-196b, miR-374a and members of the miR-29 and miR-130/301 families. [score:4]
Furthermore, the overexpressed miRNAs included miR-7, miR-9/miR-9*, miR-21*, miR-31/miR-31*, miR-181, miR-196a/miR-196b, miR-503 and members of the miR-29 and miR-130/301 families (Table 1). [score:3]
PTEN mRNA correlated inversely with miR-92a and members of the miR-17 and miR-130/301 families. [score:1]
[1 to 20 of 5 sentences]
25
[+] score: 19
The four studies considered for the comparison, including the present study, demonstrated the higher expression in naïve B-cells of mir-320, the up-regulation of mir-181b, mir-25, miR-130b in GC B cells as well as the greater expression of both mir-29a and seven members linked to the cluster miR-17/92 in mature B cells. [score:7]
In particular, we identified two selective miRNA lists: the first one, composed by miR-150, miR-130b, miR-141, miR-29b, miR-26a, miR-34a and miR-200c, able to target the ZEB1 gene; and the second one, composed by miR-150, miR-221, miR-21 and miR-25, able to target the TP53 gene. [score:5]
The miRNAs profile comparison between resting and activated B cells showed the up-regulation of 19 miRNA in activated B cells: mir-98, mir-106a, mir-20a, mir-17-5p, mir-20b, mir-16-2, mir-18a, mir-155, mir-21, mir-181d, mir-425-5p, mir-148a, mir-15b, mir-15a, mir-181b mir-181c, mir-181a, mir-130b, mir-148b (Table 3). [score:4]
Considering all differentially expressed miRNAs, we detected miR-150, miR-361, miR-130b, miR-181b and members of miRNA clusters miR-17-5p, miR-106a, miR-20a and miR-20b as the most variable miRNAs (FDR = 0.0077) (Table 1). [score:3]
[1 to 20 of 4 sentences]
26
[+] score: 17
We score genes as potential miR targets using three sets of binding site predictions: TargetScan (v. 7.1) [27], miRmap (201301e) [28] and miRanda-mirSVR [29]; for mirSVR, we use target site predictions with ‘good’ scores for conserved miRs (miR-130b-3p) and for non-conserved miRs (miR-508-5p,, and). [score:7]
MiR-130b-3p is also predicted to target CALM2, the calcium -binding protein calmodulin (TargetScan = 0.99, mirSVR = 0.85, miRmap = 0.83). [score:5]
8412) 4 Yang C, Cai J, Wang Q, Tang H, Cao J, Wu L, Wang Z 2012 Epigenetic silencing of miR-130b in ovarian cancer promotes the development of multidrug resistance by targeting colony-stimulating factor 1. Gynecol. [score:4]
miR-130b-3p. [score:1]
[1 to 20 of 4 sentences]
27
[+] score: 17
When miR-130b is overexpressed, it targets CCNA2, inhibiting the expression of CCNA, arresting the cell cycle in G [2] phase, and inhibiting the proliferation of PA cells [25]. [score:11]
This suggests that low expression of miR-130b may promote the proliferation of PA cells and subsequent tumor growth. [score:3]
MiR-130b is downregulated in GH adenomas and nonfunctioning PAs (NFPAs). [score:3]
[1 to 20 of 3 sentences]
28
[+] score: 17
From the real-time RT-PCR analysis, down-regulation of TP53INP1 and up-regulation of miR-130 and miR-155 in MCF7-ADR as compared with MCF-7 (Figure 2F and 2G). [score:6]
These included miR-130 and miR-155 also known as TP53INP1 binding miRNAs, and most of them are highly expressed in MCF7-ADR, indicating that these miRNAs and TP53INP1 expressions were inversely correlated. [score:5]
Taqman probes for human were used to assess the expression levels of miRNAs (hsa-miR-505, ID: 4373230, hsa-miR-130, ID: 000454, and hsa-miR-155, ID: 002623). [score:3]
One of them is tumor protein p53 inducible nuclear protein 1 (TP53INP1) (Figure 2D), which has been recently shown to be suppressed by several miRNAs such as miR-130 and miR-155 [16, 17]. [score:3]
[1 to 20 of 4 sentences]
29
[+] score: 17
The results showed that 5 miRNAs (miR-130b-5p (formerly designated as miR-130b*), miR-196a, miR-455-3p, miR-455-5p, and miR-801) or 2 miRNAs (miR-133b and miR-145) were significantly up-regulated or down-regulated, respectively in laryngeal cancers (Figure 1A). [score:7]
While miR-130b-5p, miR-455-3p, miR-455-5p, and miR-801 were up-regulated in laryngeal cancer in our study, much less study has been performed on these miRNAs before. [score:4]
miR-130b-3p complementary to miR-130b-5p was reported to be related to schizophrenia by targeting MECP2 protein [58]. [score:3]
Higher expression levels of miR-130b-5p were observed in cancer tissues compared with neighboring controls in 4 of 5 pairs. [score:2]
Thus, qRT-PCR analysis was performed on residual 4 miRNAs (i. e., miR-130b-5p, miR-196a, miR-455-5p, and miR-133b). [score:1]
[1 to 20 of 5 sentences]
30
[+] score: 16
Other miRNAs from this paper: hsa-mir-125b-1, hsa-mir-125b-2, hsa-mir-155, hsa-mir-663a
In addition, the over -expression of FLAG-ZNF224 decreased expression of TP53INP1α, but not TP53INP1β (Supplementary Figure 4A and 4B), which shows a possibility that ZNF224 could decrease p53 expression by TP53INP1α via miR-125b, miR-130b, and miR-155 as well. [score:7]
We found that the knock-down of ZNF224 using si -RNA decreased expression of miR-125b, miR-130b, and miR-155 in microarray (Supplementary Figure 3), and increased TP53INP1α expression in immunoblot. [score:6]
It has been known that miR-125b, miR-130b, and miR-155 promote tumor growth by decreasing tumor protein 53 -induced nuclear protein 1 (TP53INP1) that increases p53 expression [38– 41]. [score:3]
[1 to 20 of 3 sentences]
31
[+] score: 15
Authors specifically found the upregulation of miR-34a, miR-124a and miR-383 and the downregulation of miR-130b and miR-181a. [score:7]
miR-130b and miR-181a regulate the PI3K/AKT pathway through the inhibition of PTEN, a negative regulator of this pathway [118, 119]. [score:5]
Miao Y. Zheng W. Li N. Su Z. Zhao L. Zhou H. Jia L. MicroRNA-130b targets PTEN to mediate drug resistance and proliferation of breast cancer cells via the PI3K/Akt signaling pathwaySci. [score:2]
Interestingly, circulating levels of miR-130b increase after an intervention with polyunsaturated fatty acids in women [121]. [score:1]
[1 to 20 of 4 sentences]
32
[+] score: 15
As shown in Figure 6B, the CREB transcriptional targets AREG, Cyclin A and miR-130b showed an upregulated profile, whereas miR-1 appeared downregulated in Ccdc6 [−ex2/−ex2] mice with respect to the Ccdc6 [wt/wt] mice. [score:9]
In order to investigate whether the increase in the phosphorylation status may reflect the transcriptional ability of the thyroid cells, we have analysed the levels of some CREB1 target genes, such as AREG, Cyclin A, miR-130b (positively regulated by CREB1) and miR-1 (negatively regulated by CREB1) in hyperplastic thyroids of Ccdc6 [−ex2/−ex2] mice and controls. [score:3]
B. AREG, CCNA2, miR-1 and miR-130b genes expression by qRT-PCR from Ccdc6 [wt/wt] and Ccdc6 [−ex2/−ex2] thyroids. [score:3]
[1 to 20 of 3 sentences]
33
[+] score: 15
We have discovered a novel target of miR-130/301/454 family (Smad4), which has key function in TGF-β signaling, providing the possibility that the miR-130/301/454 family may control reprogramming by suppressing TGF-β/Smad4 activity. [score:5]
Recently, Pfaff et al. [25] showed that the miRNA family (miR-130/301/721) functions as an important regulator of iPSC induction by targeting the homeobox transcription factor, Meox2. [score:4]
The different expression features of miR-130a/301a may reflect the diverse roles of the miR-130/301 family in different types of cancer. [score:3]
These hypotheses indicate the need for further studies to reveal the entire “targetome” of the miR-130/301/454 family in colon carcinogenesis and progression. [score:3]
[1 to 20 of 4 sentences]
34
[+] score: 15
In endometrial cancer, oncogenes such as p53 gain-of-function mutations [21], KLF17 [79], EZH2, MCL-1 and FOS [8] promote EMT -associated invasiveness and enhance CSC properties including self-renewal capacity and chemoresistance, whereas miR-101, miR-106b, miR-130b and miR-194 [7, 8, 22, 80] serve as EMT suppressors and attenuate CSC features. [score:4]
For example, by binding to the promoter region of miR-130b, p53 transactivates this miRNA to reduce the levels of ZEB1 (a direct target gene of miR-130b), and thereby attenuates EMT and invasiveness in endometrial cancer cells [22]. [score:4]
b. Wild-type p53 represses cancer initiation, progression and metastasis by regulating downstream genes and microRNAs (miR-34, miR-130b, miR-192 and miR-200c)-target gene networks. [score:4]
Emerging evidence has demonstrated that WT p53 can also indirectly silence EMT-inducing transcription factors though the transcriptional regulation of some miRNAs, such as miR-34, miR-130b, miR-145, miR-192, miR-215 and miR-200c [21, 22, 23, 24, 25, 26, 27]. [score:3]
[1 to 20 of 4 sentences]
35
[+] score: 14
Moreover, miR-130b [99], miR-301a [100], miR-106a [101], miR-103a [102], miR-495 [103], and miR-532-5p [104] directly inhibit RUNX3 translation at the post-transcriptional level. [score:6]
In addition, increased H3K9 dimethylation and reduced H3 acetylation, as well as the increased miR-130b, miR-301a, miR-106a, miR-103a, miR-495, and miR-532-5p, synergistically inhibited the expression of RUNX3 Numerous studies have demonstrated that H. pylori infection is closely related to abnormal CpG island methylation. [score:5]
In addition, increased H3K9 dimethylation and reduced H3 acetylation, as well as the increased miR-130b, miR-301a, miR-106a, miR-103a, miR-495, and miR-532-5p, synergistically inhibited the expression of RUNX3 The exploitation of characteristic epigenetic alterations during the malignant transformation of gastric mucosa allows for the prevention, diagnosis, treatment, and prognostic evaluation of gastric cancer from a new perspective independent of protein expression. [score:3]
[1 to 20 of 3 sentences]
36
[+] score: 14
miR-130b overexpression increases cell viability and reduces cell death following the downregulation of RUNX3 protein expression. [score:8]
Lai et al. reported that miR-130b expression is upregulated in gastric cancer, and this is inversely associated with Runx3 hypermethylation [46]. [score:6]
[1 to 20 of 2 sentences]
37
[+] score: 13
For the first set of MSCs only 3 miRNAs (miR-324-3p, miR-494-3p, and miR-1260a) were observed to be statistically significant (p < 0.05) between passages 3 and 7. For the second set of MSCs, 7 miRNAs (let-7i, miR-25-3p, miR-106b-5p, miR-130b-3p, miR-199a-5p, miR-365a-5p, and miR-1260a) were statistically significant between passages 4 and 8. MiR-1260a was found to be significantly different between early and late passages for both MSC sets; however, it was upregulated at passage 7 for the first MSC set and downregulated at passage 8 for the second MSC set. [score:7]
For the tested miRNAs not expressed from the microarray experiments, 2 miRNAs, miR-25-3p and miR-130b-3p, were observed to be expressed based on the studies while 1 miRNA, miR-106b-5p, was not. [score:5]
Another 3 miRNAs (miR-25-3p, miR-106b-5p, and miR-130b-3p) were not expressed in all MSC samples using the microarray platform and were evaluated by to confirm our results. [score:1]
[1 to 20 of 3 sentences]
38
[+] score: 13
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-130a, hsa-mir-155, hsa-mir-33b
Accordingly, by using a CMV promoter -driven reporter harboring the 3′ UTR of MafB mRNA, we found that MafB expression could be inhibited by co-expressed miR-155 (Fig.   6b), to an extent similar to inhibition mediated by miR-130, a previously reported MafB -targeting microRNA [31]. [score:11]
Effect of miR-130 ectopic expression was compared as a positive control. [score:2]
[1 to 20 of 2 sentences]
39
[+] score: 12
Other miRNAs from this paper: ssc-mir-130b
Another study reported that miRNA-130b suppressed fat deposition by inhibiting PPARγ expression and demonstrated a significant ability to down-regulate PPARγ expression, which was associated with reduced adipogenesis and lipogenesis in primary cultured porcine adipocytes (Rosen and Spiegelman  2001; Taniguchi et al. 2014). [score:12]
[1 to 20 of 1 sentences]
40
[+] score: 12
miR-130 suppresses adipogenesis by inhibiting peroxisome proliferator-activated receptor gamma expression. [score:7]
Moreover, miR-92b-3p and miR-130b-5p were the only members of their respective families to be specifically associated with neural progenitors (Fig.  3F,G), which suggests that they play a role in regulating human neural progenitor proliferation. [score:2]
These two miRNAs are members of the miR-25 and miR-130 families, respectively, which previously have been identified for regulating cell proliferation (Lee et al., 2011; Xu et al., 2013). [score:2]
MiR-92b-3p and miR-130b-5p were identified as two miRNAs highly expressed in FB, MB and HB cells compared with hESCs, and also compared with ME and HLFs (Fig.  3F,G). [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 12
On the other hand, miR-130b has been shown to be highly expressed in CD133+ tumor-initiating cells in HCC [59] and to directly target the well-known tumor suppressor RUNX3, suggesting the prominent oncogenic role of miR-130b in hepatocarcinogenesis [60]. [score:8]
Combined Serum miR-15b and miR-130b. [score:1]
Thus, the combined miR-15b and miR-130b classifier may be useful as a serum biomarker with clinical value for HCC screening. [score:1]
In their study, combined miR-15b and miR-130b were demonstrated as a classifier for HCC detection. [score:1]
In the results of the study by Liu et al., the detection sensitivity of combined miR-15b and miR-130b in a subgroup of HCCs with low AFP (<20 ng/mL) was 96.7%. [score:1]
[1 to 20 of 5 sentences]
42
[+] score: 11
Conversely, three miRNAs (hsa-miR-130b*, hsa-miR-145, and hsa-miR-658) were upregulated in 11 diseases while not being downregulated in any other. [score:9]
The most significantly dysregulated miRNA, hsa-miR-130b*, reached an adjusted significance value of 1.9 × 10 [−14] (raw P =2.2 × 10 [−17]). [score:2]
[1 to 20 of 2 sentences]
43
[+] score: 11
Among these 17 miRNAs, 7 miRNAs (hsa-miR-130b*, hsa-miR-21*, hsa-miR-223, hsa-miR-302a, hsa-miR-424, hsa-miR-451, hsa-miR-486-5p) were differentially expressed between active TB and latent TB, 6 miRNAs were up-regulated in active TB patients, and only hsa-miR-130b* showed reduced gene expression level. [score:8]
Also we failed to retrieve the predicted or validated target genes for 3 miRNAs (hsa-miR-21*, hsa-miR-130b* and hsa-miR-550*) from the database. [score:3]
[1 to 20 of 2 sentences]
44
[+] score: 11
The top downregulated lung TIC -associated miRNAs include miR-23a, miR-130a, let-7 family, miR-513a-5p, miR-125b and miR-29a, whereas the top upregulated miRNAs include miR-1290, miR-130b, miR-1246, miR-630, miR-196a/b, miR-9/9* and miR-17∼92 cluster and its miR-106b∼25 analogues. [score:7]
More importantly, the comparative expression of other miRNA candidates such as miR-130b, miR-23a and miR-125b, which were initially found to be also enriched in TICs, did not provide strong evidence that they were restricted to tumours, whereas miR-1246 and miR-1290 did (Supplementary Fig. 1e). [score:3]
Taqman miRNA probes were as follow: hsa-miR-1246 (462575_mat), hsa-miR-1290 (002863), hsa-miR-130a (000454), hsa-miR-130b (000456), hsa-miR-196a (241070_mat), hsa-miR-196b (002215), hsa-miR-630 (001563), hsa-let-7b-5p (002619), hsa-let-7c (000379), hsa-let-7d-5p (002283), hsa-let-7i (002221), hsa-miR-106b (000442), hsa-miR-125b (000449), hsa-miR-23a (000399), hsa-miR-25 (000403), hsa-miR-320c (241053_mat), hsa-miR-3667-5p (462350_mat), hsa-513-5p (002090), hsa-miR-9* (002231). [score:1]
[1 to 20 of 3 sentences]
45
[+] score: 11
The expression of PTEN protein was significantly elevated When cells were treated with miR-130a-I, the expression of P-gp were upregulated by miR-130-M and downregulated by miR-130a-I. (C1,C2): PTEN and MDR1 mRNA in A2780/DDP cells after transfection. [score:11]
[1 to 20 of 1 sentences]
46
[+] score: 11
Hyperactivation of miR-130b directly suppressed MST1 activity, further leading to YAP/TAZ activation [91]. [score:4]
Upregulation of miR-130b enhances stem cell-like phenotype in glioblastoma by inactivating the Hippo signaling pathway. [score:4]
Recently, a study found that miR-130b, situated upstream of MST1/2-Lats-YAP/TAZ, was substantially overexpressed in human glioblastoma growth. [score:3]
[1 to 20 of 3 sentences]
47
[+] score: 11
Other miRNAs from this paper: hsa-mir-130a
Note: (A) the mRNA expressions of miR-130 in HCAECs detected by qRT-PCR; B, the mRNA expressions of PTEN and the key molecules of PI3K-Akt-eNOS signaling pathway in HCAECs detected by qRT-PCR; HCAECs, Human coronary artery endothelial cells; HCY, homocysteine; PTEN, phosphatase and tensin homolog deleted on chromosome 10; PI3K, phosphatidylinositol 3-kinase; Akt: protein kinase (B) eNOS: endothelial nitric oxide synthase; compared with the blank and the NC groups, * P < 0.05; compared with the miR-130a inhibitors + si-PTEN group, [#] P < 0.05; compared with the miR-130a mimics + Wortmannin group, [&] P < 0.05). [score:4]
Figure 6Note: (A) the mRNA expressions of miR-130 in HCAECs detected by qRT-PCR; B, the mRNA expressions of PTEN and the key molecules of PI3K-Akt-eNOS signaling pathway in HCAECs detected by qRT-PCR; HCAECs, Human coronary artery endothelial cells; HCY, homocysteine; PTEN, phosphatase and tensin homolog deleted on chromosome 10; PI3K, phosphatidylinositol 3-kinase; Akt: protein kinase (B) eNOS: endothelial nitric oxide synthase; compared with the blank and the NC groups, * P < 0.05; compared with the miR-130a inhibitors + si-PTEN group, [#] P < 0.05; compared with the miR-130a mimics + Wortmannin group, [&] P < 0.05). [score:4]
Effects of different doses (0, 0.1, 0.25, 0.5 and l. 0 mmol/L) of HCY on the mRNA expressions of miR-130 and key molecules of PI3K-Akt-eNOS signaling pathway in HCAECs detected by qRT-PCR. [score:3]
[1 to 20 of 3 sentences]
48
[+] score: 10
In the cases of miR-130b and miR-19a, up regulated in HP (with positive correlation with the cell-cycle genes), and miR-449a, miR-299, miR-154 and miR-145, downregulated in HP (with negative correlation with the cell-cycle genes), the effect of miRNA over -expression on proliferation was confirmed in cell lines. [score:7]
Of those over-expressed in the HP samples we found the strongest matching effect for miR-146b (MCF-7) and miR-150 (BT-474), but we also see an agreement for miR-19a and miR-130b (Figure 5A and B and Table S7). [score:3]
[1 to 20 of 2 sentences]
49
[+] score: 10
The study revealed that 10 dysregulated miRNA signature among which hsa-miR-1271-5p and hsa-miR-574-3p were down-regulated; and hsa-miR-182-5p, hsa-miR-183-5p, hsa-miR-96-5p, hsa-miR-182-3p, hsa-miR-141-5p, hsa-miR-15b-5p, hsa-miR-130b-5p, and hsa-miR-135b-3p were overexpressed in ovarian cancer tissues. [score:7]
In contrast, other miRNAs such as miR-182-5p, miR-183-5p, miR-96-5p, miR-15b-5p, miR-182-3p, miR-141-5p, miR-130b-5p, and miR-135b-3p had a significantly higher expression level in ovarian cancer tissue sample group (C group) than in the normal group (P values are presented in Table 2). [score:3]
[1 to 20 of 2 sentences]
50
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Lai et al. have also reported that miR-130b suppresses TGFβ -induced BIM expression and apoptosis by targeting RUNX3 in GC cells. [score:7]
Lai K. W. Koh K. X. Loh M. Tada K. Subramaniam M. M. Lim X. Y. Vaithilingam A. Salto-Tellez M. Iacopetta B. Ito Y. MicroRNA-130b regulates the tumour suppressor RUNX3 in gastric cancer Eur. [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
We found eight miRs differentially expressed, six down-regulated (miR-9, miR-141, miR-200a, miR-200b, miR-429 and miR-376a) and two up-regulated (miR-450a-5p and miR130b*) in the Dlx5 [−/−] OE (Fig.  1a). [score:9]
[1 to 20 of 1 sentences]
52
[+] score: 9
Notably, although glioma pathway (hsa05214) was significantly affected by knockdown of miR-23b, it was not directly regulated by miR-23b, but by seven other miRNAs, i. e., miR-130b, -143, -181c, -181d, -424, -454, and -503, while miR-23b was directly implicated in the regulation of adherens junction (hsa04520), RNA degradation (hsa03018), and endocytosis (hsa04144). [score:6]
MiR-424, -130b, and -143 were common to −miR-23b, −β-catenin, −CBP, and −STAT3; miR-130b and -143 are known glioma risk factors [44], [51], and miR-424 has tumor-suppressor function [52]. [score:3]
[1 to 20 of 2 sentences]
53
[+] score: 9
Several miRNAs have been repeatedly reported to be significantly dys-expressed in prostate cancer, including the down-regulated miR-143/145 and up-regulated let-7a, miR-130b, miR-141, and miR-17-5p [46, 114, 115]. [score:9]
[1 to 20 of 1 sentences]
54
[+] score: 9
For example, miR-128, miR-130b and miR-210 were up-regulated and miR-424, miR-223, miR-23a, miR-27a were down-regulated in the patient group, indicating that there is a concordance between the findings despite using completely different miRNA expression analysis platforms, which suggests that these novel techniques are robust. [score:9]
[1 to 20 of 1 sentences]
55
[+] score: 8
Out of the 485 differentially stabilized transcripts, mRNA targets of miR-29, let-7, miR-137, and miR-130 were stabilized with quiescence while miR-17 and miR-200 targets were stabilized with proliferation. [score:5]
Our analysis of miRNA targets enriched for differential decay between P and CI7 fibroblasts highlight a potential role for the miR-17-92 cluster, and miR-200 in promoting transcript decay in quiescent cells, and miR-130 in promoting transcript decay in proliferating cells. [score:3]
[1 to 20 of 2 sentences]
56
[+] score: 8
Based on these data, the authors concluded that the participation of TAp63 in tumor and metastasis suppression involves the coordinate transcriptional regulation of Dicer and miR-130b [139]. [score:4]
Indeed, miR-130b [142] was down-regulated in metastatic HNSCCs cells lacking TAp63. [score:4]
[1 to 20 of 2 sentences]
57
[+] score: 8
Yang C. Cai J. Wang Q. Tang H. Cao J. Wu L. Wang Z. Epigenetic silencing of miR-130b in ovarian cancer promotes the development of multidrug resistance by targeting colony-stimulating factor 1Gynecol. [score:4]
miR-130b* has been reported to target colony-stimulating factor (CSF)-1 and to be involved in multidrug resistance in ovarian cancer (18) and in papillary thyroid carcinoma development (19). [score:4]
[1 to 20 of 2 sentences]
58
[+] score: 8
Importantly, this regulatory loop involves both transcriptional and post-transcriptional regulatory mechanisms, as OCT4 not only binds the SRSF2 promoter, but it also negatively regulates the expression of miRNAs targeting its 3′UTR, such as miR-301b and miR-130b [208]. [score:8]
[1 to 20 of 1 sentences]
59
[+] score: 8
Epigenetic silencing of miR-130b in ovarian cancer promotes the development of multidrug resistance by targeting colony-stimulating factor 1. Gynecol. [score:4]
Epigenetic silencing of miR-130b through hypermethylation of the adjacent CpG island has been also identified and low expression of miR-130b was correlated to ovarian cancer with high stage and multidrug resistance (Yang et al., 2012). [score:3]
In fact, treatment of ovarian-cancer cells with demethylating agents increased miR-130b levels and decreased the IC50 of paclitaxel and cisplatin treatment. [score:1]
[1 to 20 of 3 sentences]
60
[+] score: 8
Overexpressed miR-125b [16] could function as an oncogene, whereas downregulated miRNAs, including miR-194 [17], miR-130b [18], miR-106b [19] and miR-34 [20], could work as tumor suppressors in aggressive ECs. [score:8]
[1 to 20 of 1 sentences]
61
[+] score: 8
Based on the TargetScan context++ scores, the probability of the interaction between microRNA and its target gene seems to be higher in pairs miR-449c-5p and DKK1, miR-450b-5p, miR-424-5p, miR-130b-3p and IL15, miR-500a-5p and GADD45A, and miR-181a-2-3p and ACADSB. [score:5]
The increased expression of miR-130b and miR-449c-5p have been detected in endometrial cancer patients when compared to controls 73, 74. [score:2]
Of special interest are miR-130b-3p and ANXA4, miR-548n and SPP1, miR-548ah-3p, miR-30c-1-3p and EFNA1, miR-30c-1-3p and ARID5B, and miR-449c-5p and DKK1 pairs, where the meta-signature gene was validated in two independent validation analyses. [score:1]
[1 to 20 of 3 sentences]
62
[+] score: 8
Reexpression of both Dicer and miR130b in TAp63(−/−) MEFs decreased invasiveness of these cells, suggesting that TAp63's tumor suppressor role could be mediated at least in part through Dicer and miR130b [123]. [score:5]
As mentioned previously, miR130b targets ΔNp63 α for degradation [83]. [score:3]
[1 to 20 of 2 sentences]
63
[+] score: 8
The plexins dimerize with Neuropilin (NP1) to signal the Semaphorin ligand attachment; neuropilin is a predicted high-ranking target of let-7g and miR-130, both brain-expressed miRNAs. [score:5]
The positions of target sites for specific miRNAs (triangles above rectangles, with numbers indicating miR miRNAs, e. g. “130” is “mir-130”) are, in general, distributed nonuniformly. [score:3]
[1 to 20 of 2 sentences]
64
[+] score: 7
In fact, miRNAs which are direct transcriptional targets of TAp63, miR-130b [26] and let-7i [17] have been shown to be downregulated by mutant TP53. [score:7]
[1 to 20 of 1 sentences]
65
[+] score: 7
Ortega et al. [18] identified that miR-484 and miR-130b were lowly expressed in human subcutaneous adipose from obese and type 2 diabetes mellitus (DM), miR-199a-5p, miR-221, miR-125b and miR-1229 were lowly expressed, indicating that these miRNAs play a key role in obesity. [score:5]
In the present study, we found that hsa-miR-15a-5p, hsa-miR-106b-5p, hsa-miR-181a-5p, hsa-let-7 family, hsa-miR-27a-3p, hsa-miR-130b-3p, hsa-miR-152/148a-3p and hsa-miR-26b-5p got high degree means, which indicated that these miRNAs had a great weight in adipogenesis than others. [score:1]
As shown in Fig 6, hsa-miR-15a-5p, hsa-miR-106b-5p, hsa-miR-181a-5p, hsa-let-7 family, hsa-miR-27a-3p, hsa-miR-130b-3p, hsa-miR-152/148a-3p and hsa-miR-26b-5p got the highest degree means, which indicated that these miRNAs had more weight in adipogenesis than others. [score:1]
[1 to 20 of 3 sentences]
66
[+] score: 7
Leone V. Langella C. Esposito F. De Martino M. Decaussin-Petrucci M. Chiappetta G. Bianco A. Fusco A. miR-130b-3p Upregulation Contributes to the Development of Thyroid Adenomas Targeting CCDC6 GeneEur. [score:7]
[1 to 20 of 1 sentences]
67
[+] score: 7
For example, miR-130b [59], miR-150 [60], and miR-655 [61] inhibit EMT by directly targeting ZEB1. [score:6]
Similarly, miR-130b silencing can restore DICER1 to a threshold level that allows miR-200 family members to repress EMT in endometrial cancer [50]. [score:1]
[1 to 20 of 2 sentences]
68
[+] score: 7
Six under-expressed microRNAs that were altered at least four fold, including hsa-miR-3646, hsa-miR-17*, hsa-miR-3679-3p, hsa-miR-17, hsa-miR-155, and hsa-miR-146a, (Figure 5A) and ten under-expressed microRNAs that were highly expressed (normalized data ≥6), including hsa-miR-100, hsa-miR-10a, hsa-miR-130b, hsa-miR-146a, hsa-miR-17, hsa-miR-1973, hsa-miR-29a, hsa-miR-31, hsa-miR-31* and hsa-miR-762 (Figure 5B), were selected for further qRT-PCR analyses. [score:7]
[1 to 20 of 1 sentences]
69
[+] score: 7
Downregulation of the miR-130b–301b cluster impairs cellular senescence in prostate cancer [29], while miR-494-3p increases the radiosensitivity of oral squamous cell carcinoma cells through the induction of cellular senescence caused by the downregulation of Bmi1 [30]. [score:7]
[1 to 20 of 1 sentences]
70
[+] score: 7
Other miRNAs from this paper: hsa-mir-198
Recent evidence suggested that TA-P63 also inhibits metastasis either by transcriptionally activating metastasis suppressor genes, such as BHLHE41 (Sharp1) and CCNG2 (Cyclin G2) [20] or by directly up -regulating miR-130b and the microRNA processing enzyme Dicer [21]. [score:7]
[1 to 20 of 1 sentences]
71
[+] score: 7
Other miRNAs from this paper: hsa-mir-134, hsa-mir-149, hsa-mir-491, hsa-mir-146b, hsa-mir-181d
Moreover, a recent study revealed that in pancreatic cancer miR-130b could be a biomarker to predict the prognosis and progression of the patients as the down-regulated miR-130b was correlated with worse prognosis, lymphatic invasion and distant metastasis in pancreatic cancer 33. [score:4]
Finally, we have established 6 miRNA signatures (miR-130b, miR-134, miR-149, miR-491, miR-181d, miR-146b) which are significantly (p ≤ 0.05) differentially expressed and common in both the cisplatin resistant cell lines (SCC084/R and SCC131/R) compared to their parental cell lines (SCC084 and SCC131) (Fig. 7C and). [score:2]
There are 6 miRNAs, miR-130b, miR-134, miR-149, miR-491, miR-181d, miR-146b, which are common in both the resistant cells. [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 7
Bertero T. Cottrill K. A. Annis S. Bhat B. Gochuico B. R. Osorio J. C. Rosas I. Haley K. J. Corey K. E. Chung R. T. A YAP/TAZ-miR-130/301 molecular circuit exerts systems-level control of fibrosis in a network of human diseases and physiologic conditionsSci. [score:3]
Bertero and colleagues found that YAP/TAZ activation promoted the expression of the miR-130/301 family, which in turn enhanced collagen deposition and ECM remo deling to further enhance YAP activity [365]. [score:3]
Bertero T. Cottrill K. A. Lu Y. Haeger C. M. Dieffenbach P. Annis S. Hale A. Bhat B. Kaimal V. Zhang Y. Y. Matrix remo deling promotes pulmonary hypertension through feedback mechanoactivation of the YAP/TAZ-miR-130/301 circuitCell Rep. [score:1]
[1 to 20 of 3 sentences]
73
[+] score: 7
miR-130b was also up-regulated in human T-cell leukemia virus 1 (HTLV-1) -mediated cellular transformation [46]. [score:4]
miR-130b +miR-130b showed increased expression in patients with primary WHO grade II gliomas that spontaneously progressed to WHO grade IV secondary glioblastomas [45]. [score:3]
[1 to 20 of 2 sentences]
74
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-100, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-10a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-215, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-194-1, hsa-mir-195, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-302c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-324, hsa-mir-451a, hsa-mir-483, hsa-mir-484, hsa-mir-486-1, hsa-mir-500a, hsa-mir-92b, hsa-mir-595, hsa-mir-596, hsa-mir-421, hsa-mir-378d-2, hsa-mir-744, hsa-mir-885, hsa-mir-939, hsa-mir-940, hsa-mir-1229, hsa-mir-1233-1, hsa-mir-1290, hsa-mir-1246, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-4286, hsa-mir-500b, hsa-mir-1233-2, hsa-mir-3935, hsa-mir-642b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j, hsa-mir-486-2
Three miRNAs (miR-106a, miR-484, and miR-130b) were found to be significantly differentially expressed before the treatment, and all three miRNAs were upregulated in non-responders. [score:6]
Similarly, other groups have identified several circulating miRNAs as non-invasive diagnostic biomarkers, such as miR-21, miR-122, miR-223, miR-15b, miR-130b, miR-101, miR-483, miR-125, miR-143, miR-215, miR-200, miR-939, and miR-595 [44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56]. [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 7
The left panel shows the global miRNA-target interaction network, and the right panel shows a sub-network including four miRNAs (miR-17, miR-15b, miR-21 and miR-130b) and their key target genes. [score:5]
The top hub miRNAs (such as miR-17, miR-21, miR-130b and miR-15b) have been reported to be associated with tumor cell migration, invasion and metastasis (such as in glioma, breast cancer, ovarian carcinoma and endometrial cancer) [16, 20– 23]. [score:1]
The analysis identified a total of 11 hub miRNAs including miR-20a, miR-221, miR-17, miR-137, miR-21, miR-130b, miR-15b, miR-9, miR-106b, miR-93 and miR-155 shared by at least two cancer types (Figure 2C). [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
In a review, Gramantieri et al. (2008) show miRNAs aberrantly expressed in HCC compared to non-tumorous liver tissue (up -expression of miR-33, miR-130, miR-135a, miR-210, miR-213, miR-222, miR-331, miR-373, miR-376a, and down -expression of miR-130a, miR-132, miR-136, miR-139, miR-143, miR-145, miR-150, miR-200a, miR-200b, miR-214). [score:6]
Circulating miR-15b and miR-130b in serum as potential markers for detecting hepatocellular carcinoma: a retrospective cohort study. [score:1]
[1 to 20 of 2 sentences]
77
[+] score: 6
Overexpression of miR-23b and miR-130b arrested the cells in the G1 and G2 phase of the cell cycle [16]. [score:3]
miR-23b and miR-130b, which were reduced in GH, gonadotroph, and NFPA adenomas, were demonstrated to target HMGA2 and cyclin A2, respectively. [score:3]
[1 to 20 of 2 sentences]
78
[+] score: 6
For example, miR-130b, an oncogenic miRNA implicated in many advanced carcinomas, has been shown to drive by impairing E-cadherin expression (160). [score:3]
p53-R248Q can also bind to the promoter of miR-130b, inhibiting its transcription and subsequently allowing ZEB1 to bring about the EMT phenotype (249). [score:3]
[1 to 20 of 2 sentences]
79
[+] score: 6
On the other hand, recent studies have also demonstrated that TP53INP1 expression is often downregulated or silenced in cancer cells by numerous onco-miRNAs including miR-130b, miR-155, and miR-125b which are present in tumor cells [35, 46, 47]. [score:6]
[1 to 20 of 1 sentences]
80
[+] score: 6
Host miRNAs were previously shown to directly target viral genomic RNAs; for example, miR-122 facilitates hepatitis C virus replication [44], while miR-130b and miR-181 suppress the porcine reproductive and respiratory syndrome virus (PRRSV) [19, 45]. [score:6]
[1 to 20 of 1 sentences]
81
[+] score: 6
Genome-wide miR profiling has also shown that several miRs, including miR-138, miR-181a, miR-181b, miR-191 and miR-130b, target the 3′UTRs of p63 and regulate p63 expression [55]. [score:6]
[1 to 20 of 1 sentences]
82
[+] score: 6
Several brain enriched miRNAs (miR-128 and miR-132) and other miRNAs (e. g. miR-196, miR-222, and miR-9*, miR-7, miR-130b and miR-126-5p) that were previously shown to be associated with neurodegenerative diseases were downregulated in JEV-infected microglial cells at 48 h pi (Table S3). [score:6]
[1 to 20 of 1 sentences]
83
[+] score: 6
IL6ST, which is supposed to be up-regulated by decreased levels of has-miR-130b-3p and has-miR-505-3p, encodes glycoprotein 130 (gp130) [60]. [score:4]
In addition, ZMAT3, a predicted gene regulated by has-miR-7-5p and has-miR-130b-3p, encodes a double-stranded -RNA -binding zinc finger protein Wig-1 (for wild-type p53 -induced gene 1). [score:2]
[1 to 20 of 2 sentences]
84
[+] score: 6
Other miRNAs from this paper: mmu-mir-143, mmu-mir-130b, hsa-mir-143
Zhou D Cytidine monophosphate kinase is inhibited by the TGF-beta signalling pathway through the upregulation of miR-130b-3p in human epithelial ovarian cancerCell Signal. [score:6]
[1 to 20 of 1 sentences]
85
[+] score: 6
Five miRNAs were upregulated (miR-130b, miR-182, miR10b, miR320a, and miR769) ranging from a 2.9 to 30-fold induction in the NanoString miRNA assay, whereas six miRNAs were downregulated (miR122, miR451a, miR200a, miR139, miR148a, and miR375) ranging from −2.2 to −6 fold (Table  6). [score:6]
[1 to 20 of 1 sentences]
86
[+] score: 6
A reproducible repression of endogenous BTG1 protein was also observed for vectors expressing miR-19b and miR-130, suggesting the possibility that multiple miRNAs target BTG1. [score:5]
These miRNAs included hsa-mir-130, hsa-mir-301a, hsa-mir-302, hsa-mir-454-3p, and hsa-mir-19b. [score:1]
[1 to 20 of 2 sentences]
87
[+] score: 6
Microarray analysis showed altered expression of some miRNAs in hepatomas such as let-7a, miR-21, miR-23, miR-130, whereas the hepato-specific miR-122a and others were found downregulated in 70% of HCCs and in HCC-derived cell lines [20], [46], [47], as reported in our data (Table 1). [score:6]
[1 to 20 of 1 sentences]
88
[+] score: 6
MiR-130b has been suggested to regulate expression of the tumor suppressor gene RUNX3 [28] whereasmiR-146a has been shown to play an important role in oncogenic transformation of immune cells in mice mo del [29]. [score:6]
[1 to 20 of 1 sentences]
89
[+] score: 6
On the contrary, the miRNAs up-regulated in FF, especially let-7b-5p, miR-15b-5p, miR-24-3p, miR-130b-3p, miR-146b-5p, miR-212-3p, miR-222-3p, miR-223-3p, miR-339-3p and miR-483-5p, with fold change values higher than 100-fold, could be transcribed in somatic follicular cells and move to oocytes by means of exosomes. [score:4]
Interestingly, let-7b-5p, miR-15b-5p, miR-24-3p, miR-130b-3p, miR-146b-5p, miR-212-3p, miR-222-3p, miR-223-3p, miR-339-3p and miR-483-5p showed expression fold changes higher than 100-fold (ln RQ > 4.7) compared to oocytes (Figure 3B and Supplementary Table S1). [score:2]
[1 to 20 of 2 sentences]
90
[+] score: 6
OS upregulates a group of miRNAs (miR-329, miR-193b, miR-20a, miR-296, and miR-130b), which is associated with affecting 83 target genes. [score:6]
[1 to 20 of 1 sentences]
91
[+] score: 5
Indeed, some miRNAs that have been previously linked to carcinogenesis of different organs and tissues, such as miR-424-5p (previous ID: miR-424), miR-221-5p (previous ID: miR-221*), miR-675, miR-647, miR-125a-5p, miR-214-3p (previous ID: miR-214), miR-130b-3p (previous ID: miR-130b), miR-522-3p (previous ID: miR-522), and miR-16-5p (previous ID: miR-16) [18- 21] were found to be up- or downregulated in our analysis. [score:4]
hsa-miR-2355-3p2.000.001622hsa-miR-133b4.300.009926hsa-miR-451a2.200.0108517hsa-miR-4664-3p4.310.000228hsa-miR-130b-3p2.300.0462722hsa-miR-44314.350.003682hsa-miR-486-5p2.320.002088hsa-miR-4804-3p4.360.000235hsa-miR-361-5p2.330.04722Xhsa-miR-18b-3p4.620.00191Xhsa-miR-3156-3p2.500.0072910hsa-miR-675-3p4.680.0002811hsa-miR-4728-3p2.670.0002917hsa-miR-550b-3p4.720.013827hsa-miR-3191-5p2.670.0002019hsa-miR-551a4.750. [score:1]
[1 to 20 of 2 sentences]
92
[+] score: 5
High expression levels of miR-130b increase cell viability and reduce cell death by targeting RUNX3 in gastric cancer cells (Ref. [score:5]
[1 to 20 of 1 sentences]
93
[+] score: 5
Among the top 15 pathways, the pathway most significantly was associated with prion disease (p < 1e-16) was found to be influenced by a single miRNA, miR-130b-3p, which was predicted to target a single transcript PRNP (prion protein gene). [score:5]
[1 to 20 of 1 sentences]
94
[+] score: 5
However, the related family members miR-130a and miR-130b (that is, with the same seed regions as miR-301a and likely overlapping targets) both increased basal reporter activity by 4.5-fold (P = 0.04) and 3.6-fold (P = 0.06), respectively (see Additional file 1, Table S2). [score:3]
Hence, our results are in agreement with the Lu et al. study suggesting that the miR-301/miR-130 family positively regulates NF-κB signaling. [score:2]
[1 to 20 of 2 sentences]
95
[+] score: 5
Specifically, in TNFα -treated adipocytes, miR-146b, miR-130 and miR-155 were upregulated. [score:4]
Several miRNAs, such as miR-132 [15], miR-155 [16], miR-130 [17], miR-145 [18], miR-146b [19], and miR-29 [20] have been indentified in obesity -associated inflammation and insulin-resistance in adipocytes. [score:1]
[1 to 20 of 2 sentences]
96
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
In addition, many miRNA families showed low expression (count number <100) in milk exosomes, such as the miR-1, miR-130, miR-17, miR-10, miR-29, miR-374, mir-9, miR-15 and miR-491 families (Figure 12F), which are routinely expressed in specific tissues [53– 56]. [score:5]
[1 to 20 of 1 sentences]
97
[+] score: 5
For 6 of the 18 miRNAs conditioned upon, the number of verifications obtained was significantly (p<0.05) greater than what might be expected under the no -targeting null (miR-130b, -15a, -16, -181a, -181c, -30d), and analyses conducted on targets predicted for an additional three miRNAs (miR-192, -224 and -212) yielded numbers of identifications that were substantially greater (p = 0.08, 0.13 and 0.28 respectively). [score:5]
[1 to 20 of 1 sentences]
98
[+] score: 5
In this regard, a recent study suggested that miR-130 mediates suppression of HCV replication by inducing the expression of Interferon stimulating gene (ISG), IFITM3 [35]. [score:5]
[1 to 20 of 1 sentences]
99
[+] score: 5
Yoon et al. [8] found that MS2 -mediated pulldown of lincRNA-p21 could identify interacting target miRNAs with functional impact on the expression of lincRNA-p21, and at least four miRNAs (miR-130, miR-221, let-7b, let-7c) were enriched in the lincRNA-p21-MS2 pulldown. [score:5]
[1 to 20 of 1 sentences]
100
[+] score: 5
Other miRNAs from this paper: hsa-mir-223
Mutant p53 also reportedly exerts oncogenic functions and promotes EMT in endometrial cancer by binding directly to the promoter of miR-130b, a negative regulator of ZEB1, and inhibiting its transcription [53]. [score:5]
[1 to 20 of 1 sentences]