Stem-loop hsa-mir-130b

Accession

MI0000748

Symbol

HGNC: MIR130B

Description

Homo sapiens hsa-mir-130b precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR130B is characterized as an endogenous short noncoding RNA that is expressed by a distinct subset of PMN-MDSCs during an H. pylori infection [PMC8699100]. This RNA molecule, along with TNF-α, has been implicated in the development of immunotherapy-resistant gastric cancer [PMC8699100]. Research has identified Cyld as a direct target of MIR130B, suggesting a role in the regulatory pathways that may influence cancer progression [PMC7377952]. Additionally, the NFκb subunit p65 has been proposed as a potential regulator of the MIR130B locus, indicating a complex regulatory mechanism at play [PMC7377952]. Investigations using the HL-60 cell line have been conducted to explore whether there is an interactive feedback loop between NFκb activation and MIR130B expression, which could further elucidate the role of MIR130B in immune responses and gastric cancer pathology [PMC7377952].

Literature search

176 open access papers mention hsa-mir-130b
(1004 sentences)

Sequence

270908 reads, 1850 reads per million, 129 experiments

ggccugcccgacACUCUUUCCCUGUUGCACUACuauaggccgcugggaagCAGUGCAAUGAUGAAAGGGCAUcggucagguc
((((((.((((..(((((((..(((((((((.((.(((....)))...)).)))))))))..)))))))..)))).))))))

Structure

      c    cA       CC         A  --a   g 
ggccug ccga  CUCUUUC  UGUUGCACU Cu   uag c
|||||| ||||  |||||||  ||||||||| ||   |||  
cuggac ggcU  GGGAAAG  GUAACGUGA ga   guc c
      u    AC       UA         C  agg   g 

Annotation confidence High

Comments

This sequence is the predicted human homologue of mouse miR-130b cloned from mouse embryonic stem cells [1,2]. Its expression was later verified in human BC-1 cells [3].

Genome context

chr22: 21653304-21653385 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-130b

Disease association

hsa-mir-130b is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-130b-5p

• Accession: MIMAT0004680
• Description: Homo sapiens hsa-miR-130b-5p mature miRNA
• Sequence: 13 - ACUCUUUCCCUGUUGCACUAC - 33
• Evidence: experimental ; cloned [4-5]

Mature hsa-miR-130b-3p

• Accession: MIMAT0000691
• Description: Homo sapiens hsa-miR-130b-3p mature miRNA
• Sequence: 51 - CAGUGCAAUGAUGAAAGGGCAU - 72
• Evidence: experimental ; cloned [3-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 12919684
   Embryonic stem cell-specific MicroRNAs
   "Houbaviy HB, Murray MF, Sharp PA"
   "Dev Cell (2003) 5:351-358


4. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


5. PubMed ID: 15800047
   Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
   "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
   "Proc Natl Acad Sci U S A (2005) 102:5570-5575