WARNING: This summary was generated by AI. MIR130B is characterized as an endogenous short noncoding RNA that is expressed by a distinct subset of PMN-MDSCs during an H. pylori infection [PMC8699100]. This RNA molecule, along with TNF-α, has been implicated in the development of immunotherapy-resistant gastric cancer [PMC8699100]. Research has identified Cyld as a direct target of MIR130B, suggesting a role in the regulatory pathways that may influence cancer progression [PMC7377952]. Additionally, the NFκb subunit p65 has been proposed as a potential regulator of the MIR130B locus, indicating a complex regulatory mechanism at play [PMC7377952]. Investigations using the HL-60 cell line have been conducted to explore whether there is an interactive feedback loop between NFκb activation and MIR130B expression, which could further elucidate the role of MIR130B in immune responses and gastric cancer pathology [PMC7377952].
c cA CC A --a g
ggccug ccga CUCUUUC UGUUGCACU CU uag c
|||||| |||| ||||||| ||||||||| || |||
cuggac ggcU GGGAAAG GUAACGUGA ga guc c
u AC UA C agg g
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004680 |
| Description | Homo sapiens hsa-miR-130b-5p mature miRNA |
| Sequence | 13 - ACUCUUUCCCUGUUGCACUACU - 34 |
| Evidence |
experimental
cloned [4-5] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000691 |
| Description | Homo sapiens hsa-miR-130b-3p mature miRNA |
| Sequence | 51 - CAGUGCAAUGAUGAAAGGGCAU - 72 |
| Evidence |
experimental
cloned [3-5] |
| Database links |
|
| Predicted targets |
|
|