sort by

76 publications mentioning hsa-mir-363

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-363. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 246
Other miRNAs from this paper: hsa-mir-22, hsa-mir-25, hsa-mir-361, hsa-mir-940
Figure 5miR-363 overexpression inhibits FBW7 signaling in gastric cancer cells in vitro A. Forced miR-363 expression reduced FBW7 expression while enhanced c-Myc, c-Jun, and cyclin E expression in gastric cancer cells. [score:11]
In summary, our findings indicate that increased miR-363 expression is a frequent event in gastric cancers and increased miR-363 expression promotes cell proliferation, chemo-resistance by inhibiting the FBW7 pathway, suggesting that targeting miR-363 in a subset of gastric cancer would be an optimal therapeutic strategy and miR-363 may be a biomarker for predicting responsiveness to chemotherapy treatment. [score:9]
Knockdown of FBW7 expression promotes proliferation and chemo-resistance of gastric cancer cells in vitroTo further confirm the hypothesis that miR-363 overexpression leads to comparative gastric cancer proliferation and resistance to chemotherapy agents by targeting FBW7, we generated FBW7 knockdown MGC-803 and HGC-27 cells. [score:9]
A. Forced miR-363 expression reduced FBW7 expression while enhanced c-Myc, c-Jun, and cyclin E expression in gastric cancer cells. [score:7]
To further confirm the hypothesis that miR-363 overexpression leads to comparative gastric cancer proliferation and resistance to chemotherapy agents by targeting FBW7, we generated FBW7 knockdown MGC-803 and HGC-27 cells. [score:6]
miR-363 directly targets FBW7 expression in gastric cancer cells. [score:6]
To elucidate the roles of miR-363 in gastric cancer cells, we generated MGC-803 and HGC-27 cells (which expressed lower levels of miR-363) overexpressing miR-363 (Supplementary Figure S1). [score:5]
There was a striking, and statistically significant inverse association between miR-363 expression intensity and overall survival (OS; P < 0.01) (Figure 1C), and to a less extent, a statistically positive association between miR-363 expression intensity and cumulative recurrence (P < 0.01) (Figure 1D). [score:5]
Similarly, shorter OS and higher cumulative recurrence in the high miR-363 expression group than those in the low expression group were also observed (Figure 1E and 1F) (Supplementary Table S3). [score:5]
To identify the potential target mRNA of miRNA-363, the databases TargetScan, PicTar, miRDB, and microcosm were used. [score:5]
miR-363 promotes proliferation and chemo-resistance of gastric cancer cells in vitroTo elucidate the roles of miR-363 in gastric cancer cells, we generated MGC-803 and HGC-27 cells (which expressed lower levels of miR-363) overexpressing miR-363 (Supplementary Figure S1). [score:5]
miR-363 overexpression inhibits FBW7 signaling in gastric cancer cells in vitro. [score:5]
C. Expression of FBW7 mRNA upon miR-363 overexpression was detected in two gastric cancer cell lines by real-time PCR. [score:5]
Together, these data suggest that miR-363 overexpression promotes gastric cancer cell resistance to chemotherapy agents by targeting FBW7. [score:5]
In this study, we showed that miR-363 promotes gastric cancer cells proliferation by inhibiting FBW7 expression and was associated with chemo-resistance of gastric cancer cells. [score:5]
C, D, E, and F. Patients in the training and validation cohorts were divided into a miR-363 [low] expression group and a miR-363 [high] expression group, respectively, according to the result of real-time PCR. [score:5]
miR-363 exerts its function by suppressing FBW7 expression. [score:5]
Therefore, we hypothesized that miRNA-363 might be capable of inhibiting the expression of FBW7, thereby promoting the proliferation and resistance to chemotherapy agents. [score:5]
Interestingly, as well as miR-363, FBW7-shRNA significantly inhibits c-Myc, Notch, cyclin E, and c-Jun expression at the protein level in MGC-803 and HGC-27 cells (Figure 5A and 5B). [score:5]
Collectively, these results indicate that FBW7 is a direct target of miR-363 in gastric cancer. [score:4]
To examine the relationship between miR-363 expression and clinicopathological features, we analyzed their correlations in the training cohort. [score:3]
Figure 3 A. Predicted target sequences in 3′-UTR of FBW7 bound to miR-363. [score:3]
However, the relationship between gastric cancer and miR-363 expression remains elusive. [score:3]
Gastric cancer cell lines infected with miR-363 expression lentivirus or NC were used in these studies. [score:3]
The diagram shows the miR-363 expression of each group. [score:3]
miR-363 is overexpressed in gastric cancer tissues, and a high level of miR-363 positively correlates with poor prognosis in gastric cancer patients. [score:3]
In addition, an inverse correlation between miR-363 and FBW7 mRNA expression was observed in gastric cancer tissues. [score:3]
In this study, we demonstrated that miR-363 expression is frequently increased in gastric cancer tissues and contributes to poor outcomes in clinical patient. [score:3]
Expression level of miR-363 was determined by real-time PCR and normalized to U6. [score:3]
miR-363 expression is inversely correlated with gastric cancer sensitivity to DCF. [score:3]
These results revealed that elevated expression of miR-363 was correlated with poor prognosis of gastric cancer, implicating that miRNA-363 was involved in gastric cancer progression. [score:3]
A. Expression of miR-363 in 110 pairs of gastric cancer tissues and their corresponding adjacent normal tissues in a training cohort. [score:3]
Therefore, miR-363 expression is a valuable predictor for recurrence and survival in gastric cancer patients. [score:3]
A. Predicted target sequences in 3′-UTR of FBW7 bound to miR-363. [score:3]
Next, we investigated the proliferation of the MGC-803-miR-363 and HGC-27-miR-363 cells with forced FBW7 expression and found that increased FBW7 expression was sufficient to block the miR-363 -induced proliferation in gastric cancer cells (Figure 5C-5E). [score:3]
The median OS was 21.0 months in the miR-363 -high group and 52.6 months in the miR-363-low group; therefore, we conclude that high levels of miR-363 expression lead to gastric cancer DCF resistance. [score:3]
Additionally, forced expression of miR-363 reduced FBW7 mRNA levels in gastric cancer MGC-803 and HGC-27 cells (Figure 3C). [score:3]
I. Forced miR-363 expression in gastric cancer cells reduced their sensitivity to low concentration DCF regimen (5-FU 20 mg/L, cisplatin 1 mg/L, and docetaxel 3 mg/L). [score:3]
To confirm whether FBW7 is a direct target of miR-363 in gastric cancer cells, we conducted luciferase reporter assays after transfection of wild type or mutated FBW7 3′-UTR into gastric cancer MGC-803 cells, with synthetic miR-363 mimic. [score:3]
Furthermore, the expression of miR-363 in human gastric cancer tissues was negatively related to FBW7 mRNA level (Figure 3D and 3E). [score:3]
These data suggested that increased miR-363 expression might be a frequent event in gastric cancers. [score:3]
Figure 1 A. Expression of miR-363 in 110 pairs of gastric cancer tissues and their corresponding adjacent normal tissues in a training cohort. [score:3]
Figure 2miR-363 promotes proliferation and chemotherapy resistance of gastric cancer cells in vitroGastric cancer cell lines infected with miR-363 expression lentivirus or NC were used in these studies. [score:3]
Recently, it has been reported that miR-940, miR-363, miR-25, and miR-269-5p function as oncogenes in gastric cancer [10– 12], whereas miR-22, and miR-361-5p function as tumor suppress genes [13– 15]. [score:3]
Moreover, these findings indicate that the miR-363/FBW7 axis is closely associated with the malignant phenotypes and serves as a potential therapeutic target for predicting response to DCF treatment in gastric cancer. [score:3]
In clinical stages, miR-363 expression in cancer tissues of stages III and IV was significantly higher than in cancer tissues of stages I and II (Figure 1B) (P < 0.01). [score:3]
FBW7 is a novel target of miR-363. [score:3]
Results show OS and recurrence of patients with high or low miR-363 expression in the training and validation cohorts. [score:3]
The results showed that miR-363 expression was significantly associated with poor clinicopathological features, including histologic grade (P = 0.018) (Supplementary Table S1). [score:3]
C-H. Forced miR-363 expression in gastric cancer cells reduced their sensitivity to 5-FU, cisplatin, and docetaxel. [score:3]
Our data illustrated that a high level of miR-363 expression led to DCF regimen resistance in gastric cancer cells (P<0.05) (Figure 2I). [score:3]
For further analysis, patients were separated into groups with high (n = 57) and low (n = 53) miR-363 expression groups. [score:3]
B. Comparison of PFS survival curves for patients with high and low miR-363 expression that were treated with DCF. [score:3]
C. Overexpressing FBW7 in MGC-803-miR-363 and HGC-27-miR-363 cells using a lentiviral vector. [score:3]
Multivariate analysis revealed that miR-363 expression in tumors was an independent predictor for both OS and cumulative recurrence (Supplementary Table S2). [score:3]
Forced miR-363 expression significantly increased the proliferation abilities of MGC-803 and HGC-27 cells compared with the NC group (Figure 2A and 2B). [score:2]
Compared with the corresponding adjacent normal tissues, miR-363 expression was significantly increased in 71 gastric cancer cases (64.5%; Figure 1A). [score:2]
B. The wild type or mutated FBW7 3′-UTR was transfected into gastric cancer cells with or without synthetic miR-363 mimic. [score:1]
miR-363 induces DCF resistance in gastric cancer patients. [score:1]
D and E. A negative correlation between miR-363 and FBW7 mRNA was observed in gastric cancer tissues. [score:1]
For MGC-803-NC and MGC-803-miR-363 cells, the 5-FU IC [50] values were 128.00 ± 16.31 mg/L and 463.83 ± 63.1 mg/L, respectively (P<0.05) (Figure 2C); for HGC-27-NC and HGC-27-miR-363 cells, the 5-FU IC [50] values were 104.2 ± 2.68 mg/L and 231.55 ± 12.41 mg/L, respectively (P<0.05) (Figure 2D). [score:1]
It has been confirmed that miR-363 plays an important role in gastric carcinogenesis [11]. [score:1]
To further explore the role of miR-363 in gastric cancer, we performed real-time PCR in 110 pairs of gastric cancer tissues and adjacent normal tissues in the training cohort. [score:1]
In order to better understand the mechanisms of miR-363 involved in proliferation and resistance to chemotherapy agents in gastric cancer cells, western blotting was used to detect the FBW7-shRNA- and miR-363 -induced signaling pathway changes in MGC-803 and HGC-27 cells. [score:1]
miR-363 expression levels were then measured (Figure 6A), and Kaplan-Meier survival analysis indicated that the OS probability for the miR-363 -high group was much lower than that for the miR-363-low group (Figure 6B). [score:1]
Red line indicates fold change of miR-363 equal to 2. B. 110 patients were divided into stage I-II and stage III-IV groups. [score:1]
Furthermore, we examined the role of miR-363 in gastric cancer cells sensitive to chemotherapy agents. [score:1]
miR-363 promotes proliferation and chemo-resistance of gastric cancer cells in vitro. [score:1]
Furthermore, the miR-363/FBW7 axis promotes the proliferation and chemo-resistance of gastric cancer cells. [score:1]
miR-363 is frequently increased in gastric cancer and significantly correlated with poor prognosis. [score:1]
We found that miR-363 reduced luciferase activity in cells transfected with wt FBW7 3′-UTR, but had no effect on luciferase activity in cells transfected with mutant FBW7 3′-UTR (Figure 3B). [score:1]
For MGC-803-NC and MGC-803-miR-363 cells, the docetaxel IC [50] values were 11.06 ± 0.80 mg/L and 18.53 ± 1.73 mg/L, respectively (P<0.05) (Figure 2G); for HGC-27-NC and HGC-27-miR-363 cells, the docetaxel IC [50] values were 11.17 ± 1.52 mg/L and 17.92 ± 1.73 mg/L, respectively (P<0.05) (Figure 2H). [score:1]
For MGC-803-NC and MGC-803-miR-363 cells, the cisplatin IC [50] values were 3.46 ± 0.23 mg/L and 7.83 ± 1.23 mg/L, respectively (P<0.05) (Figure 2E); for HGC-27-NC and HGC-27-miR-363 cells, the cisplatin IC [50] values were 3.09 ± 0.41 mg/L and 7.19 ± 0.82 mg/L, respectively (P<0.05) (Figure 2F). [score:1]
Silencing FBW7 largely phenocopied miR-363 -induced resistance to chemotherapy agents and promoted proliferation in gastric cancer cells. [score:1]
Next, we examined the effects of low concentration DCF regimen (5-FU 20 mg/L, cisplatin 1 mg/L, and docetaxel 3 mg/L) on cell viability of MGC-803-NC, MGC-803-miR-363, HGC-27-NC, and HGC-27-miR-363 cells. [score:1]
We found that the 3′-UTR of FBW7 mRNA contains a sequence motif, which perfectly matching with the “seed-sequence” of the miR-363 (Figure 3A). [score:1]
miR-363 promotes proliferation and chemotherapy resistance of gastric cancer cells in vitro. [score:1]
[1 to 20 of 77 sentences]
2
[+] score: 241
Overexpression of miR-363 specifically downregulates HAND1 expression in differentiating hESCsTo test the association between miRNA expression and target-gene expression, miRNA precursors were transfected into differentiating hESCs, and expression of putative mRNA targets, HAND1 and HAND2, was analyzed with qPCR. [score:18]
Overexpression of miR-363 specifically downregulates HAND1 expression in differentiating hESCs. [score:8]
Overexpression of pre-miR-363 was associated with significant downregulation of HAND1 relative to HAND2 expression (Figure 3A). [score:8]
These data demonstrate that inhibition of miR-363 results in upregulation of HAND1 translation and enriches a left ventricular cell population. [score:8]
Overexpression of pre-miR-363 had no effect on expression of any of the other cardiac transcription factors tested, and overexpression of pre-miR-181a or -miR-181c had no effect on any of the cardiac transcription factors tested (Figure 7). [score:7]
We also showed that BMP4 treatment induced the expression of HAND2 with less effect on HAND1, whereas miR-363 overexpression selectively inhibited HAND1. [score:7]
Further analysis showed that miR-363 overexpression resulted in downregulation of HAND1 mRNA and protein levels. [score:6]
Likewise, all eight miRNAs showed a steady increase in expression during differentiation; however, beating CMs showed a significant downregulation of all miR-363, -367, -181a, and -181c (Figure 2A-D). [score:6]
Figure 3 miR-363 -dependent downregulation of HAND1 expression. [score:6]
NKX2.5 also has been implicated in left/right asymmetric expression of HAND1 and HAND2[28]; however, a role for miR-363 in regulating NKX2.5 expression was not suggested by our results. [score:6]
In vivo regional expression, in silico predictions, and experimental validation demonstrated that miR-363 is an upstream regulator of HAND1 translation, leading to a role in left ventricular CM differentiation. [score:6]
This conclusion is supported by the differential response of HAND1 and HAND2 to BMP4, which has been shown selectively to downregulate HAND1 in conjunction with overexpression of pre-miR-363. [score:6]
These data show that miR-363 negatively regulates the expression of HAND1 and suggest that suppression of miR-363 could provide a novel strategy for generating functional left-ventricular CMs. [score:6]
These data confirmed the presence of functional miR-363 binding sites(s) in the 3′UTRs of both human HAND1 and HAND2, suggesting that the changes in HAND gene expression with miR-363 overexpression resulted from binding of miR-363 to the 3′UTRs of these genes. [score:5]
The isolated cardiogenic cells overexpressing anti-miR-363 expressed the left-specifying factor HAND1 at levels significantly higher than control. [score:5]
Overexpression of anti-miR-363 markedly increased the number of HAND1 -expressing CMs (Figure 8A). [score:5]
These results are consistent with the miR-363 expression in chick embryo reported previously [27], in which miR-363 was observed in ectoderm, pharyngeal arches, notochord, and limb bud, suggestive of wide function in limb development, patterning, and central nervous system development. [score:5]
hiPSC-derived beating CMs displayed high levels of HAND gene expression and low levels of miR-363, -367, -181a, and -181c expression. [score:5]
Figure 7 miR-363 selectively inhibits HAND1 expression. [score:5]
Pre-miR-363 overexpression completely abrogated HAND1 protein expression with little effect on HAND2 protein (Figure 3B). [score:5]
miR-363 inhibits HAND1 expression through 3′UTR binding. [score:5]
Expression of anti-miR-363 in-vitro resulted in enrichment for HAND1 -expressing CM subtype populations. [score:5]
Data shown are mean ± SEM (n = 3); * P < 0.05. miR-363 regulates BMP4 -mediated HAND gene expression during cardiomyocyte differentiationWe tested various growth factors known for their roles in routing mesoderm formation. [score:4]
miR-363 regulates BMP4 -mediated HAND gene expression during cardiomyocyte differentiation. [score:4]
Anti-miR-363 directs the differentiation of HAND1-enriched cardiomyocytesIn light of the preceding data, we used miRNA inhibition to define further their role in hESC differentiation toward the cardiac lineage. [score:4]
Pre-miR-363 overexpression significantly reduced HAND1 expression compared with HAND2. [score:4]
Endogenous miR-363 was expressed primarily in brain, limb, liver, pancreas, notochord, and skin, but not heart (Figure 4), consistent with its negative regulatory role in CM differentiation (Figure 3). [score:4]
Our results demonstrate for the first time that miR-363 plays an important role in posttranscriptional regulation of CM differentiation by targeting HAND1. [score:4]
miR-363 regulates HAND1 expression, independent of NKX2.5, leading to left ventricular CM-subtype specification. [score:4]
Figure 5 miR-363 targeting of the 3′UTRs of HAND1 and HAND2. [score:3]
Overexpression of pre-miR-363 repressed luciferase activity in both hESCs and HEK293 cells co -transfected with HAND1 and HAND2 3′UTR reporters. [score:3]
Fluorescent-green staining indicated positive detection of miR-363 expression in various mouse organs. [score:3]
BMP4 stimulation also induced the expression of endogenous miR-363 and miR-181c, but not miR-367 or miR-181a (Figure 6B). [score:3]
We identified four miRNAs (miR-363, -367, -181a, and -181c) that putatively target HAND1 and/or HAND2. [score:3]
The left/right ventricle transcriptional determinants, HAND1 and HAND2, were identified as targets of four miRNAs, (miR-363, -367, -181a, and -181c). [score:3]
Figure 4 Analysis of miR-363 expression by F- ISH in E 10.5 mouse embryos. [score:3]
Figure 6 Relative expression of HAND2 mRNA-miR-363 on BMP4 stimulation. [score:3]
It appears that differentiation in the presence of anti-miR-363 causes progenitor cells to differentiate into a HAND1-rich population, and left-ventricular CMs constitute the greatest percentage of cells expressing HAND1. [score:3]
miR-363 was expressed in the developing limb bud, notochord, ectoderm, and brain. [score:3]
Reduced luciferase activity in HEK293 (A) and hESCs (B) overexpresses pre-miR-363 and HAND1 or HAND2 reporters. [score:3]
Taken together, these findings suggested a mo del for BMP -mediated cardiac induction and CM-subtype specification through miR-363 and differential expression of HAND1/2 (Figure 8B). [score:3]
We also examined the expression of miR-363 in E10.5 mouse embryos by using fluorescence in situ hybridization. [score:3]
The expression of miR-363 was detected with fluorescence in situ hybridization in E10.5 mouse embryos. [score:3]
Attention is called to the exclusion of miR-363 expression from the developing heart. [score:3]
Two evolutionarily conserved miR-363 seed-pairing sites in human HAND1 3′UTR suggested that the miRNA pairing sequences predicted in silico contribute to HAND1 regulation. [score:2]
Anti-miR-363 directs the differentiation of HAND1-enriched cardiomyocytes. [score:2]
miR-363 inhibits HAND1 expression through 3′UTR bindingWe performed dual-luciferase reporter assays to investigate the functional interaction between miR-363 and the 3′UTR of HAND1 and HAND2. [score:2]
Interestingly, a subset of miRNAs (miR-363, -367, -181a, -181c) expressed significantly higher levels in hESC-derived non-CMs compared with CMs (Additional file 1: Figure S1C). [score:2]
Process miR-363 miR-367 miR-181a miR-181c miR-1     (PcT score) (PcT score) (PcT score) (PcT score) (PcT score)GATA6 (18)Regulate terminal differentiation/proliferationNpNpACUUACAa (0.52)ACUUACAa (0.52)NpNKX2.5 (5)Commitment to myocardial lineageNpNpACUUACAa (0.52)ACUUACAa (0.52)NpHAND1 (5)Left ventricular cardiac morphogenesis, giant cell differentiationCACGUUAa (0.78)CACGUUAa (0.78)NpNpNp HAND2 (4) Cardiac morphogenesis, particularly right ventricle and aortic arch CACGUUAa (0.76) CACGUUAa (0.76) ACUUACAa (0.52) ACUUACAa (0.52) Np Np, No pairing. [score:2]
HAND1 mRNA levels decreased with addition of pre-miR-363, relative to HAND2 and other transcription factors. [score:1]
The hybridization mix was prepared with 20 pmol of miR-363 double-labeled LNA probes in hybridization solution. [score:1]
This indicates that the effect can be attributed primarily to miR-363- HAND1 mRNA interactions. [score:1]
Cells were incubated with 5 ng/ml recombinant BMP4 (Peprotech, Rocky Hill, NJ, USA), followed by 100 n M pre-miR-363 precursors. [score:1]
hESCs pretreated with BMP4 were transfected with pre-miR-363. [score:1]
Pre-miR-363 treatment caused a decrease in relative levels of HAND1 mRNA and protein. [score:1]
HAND1 3′UTR reporter activity was completely abolished by miR-363 in contrast to HAND2 3′UTR activity. [score:1]
The full-length 3′UTR containing the predicted miR-363/miR-367 recognition elements present in HAND1 (two sites) and HAND2 (single site) were inserted downstream of the firefly luciferase cDNA in pEZX-MT01 (Additional file 2: Figure S2B). [score:1]
The hybridization temperature used was 15°C below the melting temperature of the miR-363 probe. [score:1]
CM commitment after differentiation of hESCs was studied in the presence of a miR-363 antagomir. [score:1]
Figure 8 Cardiac cell fate with anti-miR-363 treatment. [score:1]
hESCs were differentiated in the presence of anti-miR-363, and beating clusters were microdissected and analyzed with qPCR. [score:1]
Fluorescent in situ hybridizationFluorescent in situ hybridization (F-ISH) with double-Dig-labeled miR-363 miRCURY LNA probes (Exiqon, Copenhagen, Denmark) on E10.5 mouse embryos was performed as described in the manufacturer’s protocol. [score:1]
F- ISH was performed with miR-363 antisense and negative control. [score:1]
Fluorescent in situ hybridization (F-ISH) with double-Dig-labeled miR-363 miRCURY LNA probes (Exiqon, Copenhagen, Denmark) on E10.5 mouse embryos was performed as described in the manufacturer’s protocol. [score:1]
[1 to 20 of 64 sentences]
3
[+] score: 175
After studying the tumor-specific microRNAs using microarray analysis and validation in many GBM cell lines and human specimens, we studied forced expression of the antagonists of miR-363 and miR-582-5p, finding that in both GBM stem cells and other cancers, the miR inhibitors caused an up-regulation of apoptosis and vastly increased cell death, indicating that GBMs up-regulate certain oncogenic miRNAs in order to suppress apoptotic targets. [score:15]
miR-363 was predicted to target Bim (BCL2L11) and Caspase 3 by TargetScan seed match analysis, and miR-582-5p was predicted to target Caspase 3 and Caspase 9 (Figure 4A ). [score:7]
As expected, the increase in Bim expression observed with forced expression of anti-miR-363 was prevented with co -expression of Bim siRNA (Figure 5B ). [score:7]
To test the importance of Caspase and Bim targeting in the effects of miR-582-5p and miR-363 on cell numbers, we performed Caspase and Bim inhibition combined with anti-miR expression. [score:7]
miR-582-5p and miR-363 Regulate Pro-apoptotic Gene Expression by Directly Targeting Caspase 3, Caspase 9, and Bim 3′-UTRs. [score:7]
The strong up-regulation of both miR-363 and miR-582-5p across many GSC samples and their co -targeting of intrinsic apoptotic pathway components suggest that GSCs have a susceptibility to mitochondrial membrane destabilization and apoptosis. [score:6]
Furthermore, miR-363 also directly targets Caspase 3 to enhance the effects on apoptosis inhibition in GSCs. [score:6]
We confirmed several apoptotic targets of miR-582-5p and miR-363 including Caspase 3, Caspase 9, and Bim using immunoblot and luciferase reporter assays including rescue of luciferase reporter signal with 3′UTR mutagenesis, and we also performed a phenotypic rescue using siRNA against the targets in the context of miR inhibition. [score:6]
GBM cell lines treated with miR-363 expressed less Bim and Caspase 3 protein, whereas GBM lines treated with anti-miR-363 expressed more Bim protein (Figure 4C, bands shown were quantified by densitometry in Figure S3A in File S1). [score:5]
Evaluation of the biological effects of miR-582-5p and miR-363 through forced expression of their specific inhibitors (stabilized short antisense inhibitor molecules) in GBM neurosphere stem cell lines and serum-maintained GBM lines confirmed their oncogenic potential. [score:5]
miR-582-5p and miR-363 were strongly upregulated in all available GSC samples, most human GBM specimens, and the GBM stem cell lines. [score:4]
miR-363 and miR-582-5p are Strongly Upregulated in GSC Samples, Multiple GBM Human Tumor Specimens, and GBM Neurosphere Stem Cell Lines. [score:4]
The novel up-regulated miRNAs were miR-582-5p, miR-363, miR-577, and miR-887, which have not been previously associated with any cancer. [score:4]
Real-time PCR verification of miR-582-5p and miR-363 up-regulation in GSCs. [score:4]
We found that miR-363 and miR-582-5p directly target the apoptotic mRNAs Caspase 3, Caspase 9, and Bim. [score:4]
The mechanisms by which miR-363 and miR-582-5p down-regulate apoptosis seem clear. [score:4]
We show here that miR-363 regulation of Bim prevents GBM stem cell apoptosis, enhances Bcl-2 expression, and decreases PARP cleavage. [score:4]
We rescued the effects of miR-363 and miR-582-5p antagonism with knockdown of Bim and Caspase 3, respectively, showing them to be the key targets of these oncomiRs in cancer. [score:4]
Anti-miR-363 treated cells exhibited higher Caspase 3/7 Glo activity or Annexin V/7-AAD expression in all GBM stem cell lines (Figure 3D ). [score:3]
Caspase 3 and Bim are critical targets of miR-582-5p and miR-363. [score:3]
We also show less cleaved PARP with miR-363 forced expression in two cell lines, an indicator of decreased apoptotic activity (Figure 4D ). [score:3]
We show that miR-363 and miR-582-5p are highly expressed in many human GSC populations and GBM tumor specimens. [score:3]
Progress is being made with local delivery of siRNAs and miRNAs or miRNA inhibitors for brain tumor therapy, and anti-miR-582-5p and anti-miR-363 may represent potent payloads. [score:3]
Caspases and Bim are Critical Targets of miR-582-5p and miR-363, Respectively. [score:3]
PARP cleavage immunoblot with forced expression of miR-363 (D). [score:3]
Baseline relative expression of miR-582-5p and miR-363 in established (A172 and U373) and stem-like GBM cell lines (0308, 0822, and 1228), as well as normal astrocytes (E and F). [score:3]
miR-582-5p and miR-363 target Caspases and Bim. [score:3]
Forced expression of anti-miR-363 and anti-miR-582-5p triggers apoptosis. [score:3]
0096239.g002 Figure 2 Relative expression of miR-582-5p and miR-363 are depicted for qPCR confirmation of the experimental CD133+ microarray GSC and NPC samples (A and B). [score:3]
Figure S5: Further miR-363 and miR-582-5p data showing targets related to apoptosis. [score:3]
Relative expression of miR-582-5p and miR-363 are depicted for qPCR confirmation of the experimental CD133+ microarray GSC and NPC samples (A and B). [score:3]
anti-miR-363 caused growth -inhibition of the GBM stem cell line (0822) and the established cell line U373 (Figure 3A ). [score:3]
The interaction of miR-582-5p and miR-363 with the predicted target 3′-UTRs was shown to be specific via luciferase reporter assays in multiple GBM lines, with normalization using control miRNA and empty plasmid, for BIM and CASP3 for miR-363 (Figure 4E–F, Figure S5B in File S2), and for CASP3 and CASP9 for miR-582-5p (Figure 4G–H ). [score:2]
Relative expression of miR-582-5p and miR-363 in nine separate human tumor specimens compared to an average of three normal human brain tissue controls with three technical replicates per sample (C and D). [score:2]
3′-UTR luciferase reporter activity for wild-type and mutagenized BIM and CASP3 target 3′-UTR putative binding sites for miR-582-5p or miR-363 compared to control miR (I). [score:2]
miR-582-5p and miR-363 Regulate GSC Growth and Apoptosis. [score:2]
Beginning with this approach, we further studied two novel anti-apoptotic miRs, miR-363 and miR-582-5p. [score:1]
0096239.g004 Figure 4 Seed match regions for miR-363 and miR-582-5p in the 3′UTRs of Bim (BCL211), Caspase 3 (CASP3), and Caspase 9 (CASP9), with arrows over mutagenized bases in 3′UTR mutant constructs (A). [score:1]
Seed match regions for miR-363 and miR-582-5p in the 3′UTRs of Bim (BCL211), Caspase 3 (CASP3), and Caspase 9 (CASP9), with arrows over mutagenized bases in 3′UTR mutant constructs (A). [score:1]
In order to understand the biological relevance of miR-582-5p and miR-363, we evaluated potential targets. [score:1]
The cell number decrease that was expected for populations treated with anti-miR-363 was prevented by RNA silencing of Bim (Figure 5A ). [score:1]
For the miR-363 binding site in BCL2L11 (Bim) 3′UTR, Forward: 5′ CTTATCAACTGAGCCAAATGTCTGT CGCGCCGGGTGTTTCCTTTACCTTGTAAAATTTTG 3′, Reverse: 5′ CAAAATTTTACAAGGTAAAGGAAACAC CCGGCGCGACAGA CATTTGGCTCAGTTGATAAG 3′; with wild-type sequence: 5′ CTTATCAA CTGAGCCAAATGTCTGT GTGCAATTGTGTTTCCTTTACCTTGTAAAATTTTG 3′. [score:1]
miR-363 and miR-582-5p behave as oncogenes, causing increased growth in immortalized astrocytes and well-established GBM cell lines, while the antagonism of miR-363 and miR-582-5p results in apoptotic cell death and decreased cell numbers in GBM stem cell lines. [score:1]
To further delineate the level of expression of the miRNAs in GBM tumor versus normal tissue, we next measured miR-582-5p and miR-363 via qPCR in many GBM and three normal human tissue specimens. [score:1]
We also tested the levels of miR-582-5p and miR-363 in GBM lines that have been maintained in serum, A172 and U373 (Figure 2E–F ) and others, (Figure S2A–B in File S1) as well as immortalized astrocytes, by traditional qPCR and/or Taqman. [score:1]
of Bim and Caspase for miR-363- or anti-miR-363, three to four days post-transfection of miR-582-5p (+) or control miRNA (–), or anti-miR-582-5p (+) or control scrambled anti-miR (–) (C). [score:1]
miR-363 fold change in GBM established cell lines T98G, U87, and U251, relative to level of the miR in normal astrocytes (B). [score:1]
Bim, Caspase 3, and Parp protein in several cell lines was quantified using an Adobe Photoshop pixel intensity histogram and normalized to corresponding alpha-tubulin protein bands from the same lanes in immunoblots of control scrambled miR, miR-363, control scrambled anti-miR, and anti-miR-363 treated cell lysates (A). [score:1]
Two miR-363 binding sites, one for BCL211 and one for CASP3, were mutagenized, and the binding region for CASP3 for miR-582 was also mutagenized. [score:1]
Figure S2: Further quantification of miR-582-5p, miR-363, and known oncogenic miR-221 in GBM cell lines. [score:1]
These data are consistent with the hypothesis that miR-582-5p and miR-363 are oncogenic. [score:1]
Levels of miR-582-5p and miR-363 were next assessed in three previously published GBM stem cell lines, which have been maintained in neurobasal medium with supplements and without serum (0308, 0822, and 1228) (Figure 2E and F ) [44]. [score:1]
These results support an anti-apoptotic mechanism of action of miR-363 and miR-582-5p. [score:1]
miR-363 has not been specifically studied in cancer, though it lies within a known oncomiR cluster [62], [63]. [score:1]
Caspase 3 3′UTR reporter activity response to miR-363 (C) in U87, an established GBM cell line. [score:1]
For miR-363, illustrated bands were quantified using a histogram in Adobe Photoshop, and for miR-582-5p, all available blots were quantified in Image J using the Gel Analysis tool, and full-length scans are supplied as examples in Figure S6 in File S2. [score:1]
For the miR-363 binding site in CASP 3′UTR, Forward: 5′ AAATTAGGAATAAATAAAAAT GGATACTG CGCGCCGCATTATGAGAGGCAATGTTGTTAA 3′, Reverse: 5′ TTAACAA CATTGCCTCTCAT AATG CGGCGCGCAGTATCCATTTTTATTTATTCCTAATTT 3′ with wild type sequence: 5′ AAATTAGGAATAAATAAAAATGGATACTG GTGCAGTCA TTATGAGAGGCAATGATTGTTAA 3′. [score:1]
This work establishes miR-582-5p and miR-363 as important physiologic drivers of GSC resistance to apoptosis, providing new points of therapeutic leverage against these treatment-resistant cells. [score:1]
[1 to 20 of 58 sentences]
4
[+] score: 150
Similarly, with transfectants for miR-363-5p mimic 27 of 29 miRNAs exhibited significantly decreased expression (about 50% of the level found in scrambled controls), only miR-363-5p and miR-485-5p exhibited increased (some 40-fold) expression (D). [score:5]
In cells transfected with miR-363-5p mimic, however, and increased level of EGFR protein was observed (Figure 4), suggesting that the level of EGFR protein is also regulated at the level of translation. [score:4]
Dysregulated miR-363 affects head and neck cancer invasion and metastasis by targeting podoplanin. [score:4]
Figure 3 MicroRNAs differentially expressed in cultured human squamous carcinoma (E10) cells transfected with scrambled control, miR-19a -, miR-20b -, miR-92a, or miR-363-5p- mimic. [score:3]
Microarray results suggested that levels of expression of five members of the miR-17-92 cluster (miR-17, miR-18a, miR-19a, miR-19b, and miR-92a) were significantly decreased only in cells transfected with miR-363-5p mimic (Figure 3). [score:3]
Results from microarrays (Figure 3) and qRT-PCR (Figure 7) suggested that levels of expression of all members of the miR-106b-25 cluster (miR-106b, miR-25, and miR-93) were decreased in cells transfected with miR-20b mimic or with miR-363-5p mimic (Figures 7A,B). [score:3]
Figure 8 Levels of expression of the microRNAs encoded by the miR-106a-363 cluster in cultured, human squamous carcinoma cells (E10) following transfection with miR-19a, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
Preliminary mRNA profiling using microarrays (results not shown) had suggested that ATF1, KRT14, KRT15, PSMB6 were differentially expressed in miR-363-5p transfectants and AFT1 and PSMB6 in miR-20b transfectants. [score:3]
The miRNAs, and seed sequences, associated with the various cellular functions are presented in Table 2. Figure 5 Bioinformatic analysis of miRNAs found differentially expressed in cultured human squamous carcinoma cells (E10) transfected with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
These five mRNAs were predicted to be targeted by miR-20b or miR-363-5p using MicroCosm, IPA or SVMicro software. [score:3]
pl) KRT14 was found to be targeted by miR-363-5p. [score:3]
from microarrays (Figure 3) and qRT-PCR (Figure 7) suggested that levels of expression of all members of the miR-106b-25 cluster (miR-106b, miR-25, and miR-93) were decreased in cells transfected with miR-20b mimic or with miR-363-5p mimic (Figures 7A,B). [score:3]
The miRNAs, and seed sequences, associated with the various cellular functions are presented in Table 2. Figure 5 Bioinformatic analysis of miRNAs found differentially expressed in cultured human squamous carcinoma cells (E10) transfected with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
Profiling of miRNAs which were differentially expressed in E10 cells transfected with miR-19a-, miR-20b-, miR-92a-, or miR-363-5p mimic. [score:3]
obtained using qRT-PCR showed that ATF1, KRT14, KRT15, and PSMB6 were differentially expressed in miR-363-5p transfectants and AFT1 and PSMB6 in miR-20b transfectants (Table 1). [score:3]
SVMicro (Liu et al., 2010) suggested ATF1, KRT14, KRT15, PSMB6 as potential targets for miR-20b and miR-363-5p. [score:3]
The heat-map presented in Figure 3 resulted from hierarchical clustering of 53, 43, 61 and 29 miRNAs found differentially expressed (p ≤ 0.05) in E10 cells transfected with mimic for miR-19a (A), miR-20b (B), miR-92a (C), or miR-363-5p - (D), respectively. [score:3]
Results obtained using qRT-PCR showed that ATF1, KRT14, KRT15, and PSMB6 were differentially expressed in miR-363-5p transfectants and AFT1 and PSMB6 in miR-20b transfectants (Table 1). [score:3]
One single mirNA, miR-423-5p, was found differentially expressed (decreased by about 50%) in transfectants for either miR-19a -, miR-20b -, or miR-363-5p mimic. [score:3]
ANOVA (P ≤ 0.05) was used for the isolation of the 53 mirNA differentially expressed in transfectants with miR-19a mimic (A), 43 miRNAs in miR-20b transfectants (B), 61 miRNAs in miR-92a transfectants (C) and 29 miRNAs in transfectants with miR-363-5p mimic (D). [score:3]
For cells transfected with mimic for miR-19a, miR-20b, or miR-363-5p (Figure 3) differentially expressed miRNAs yielded highly significant associations to, e. g., “Cell Cycle,” “Cell Death,” and “Cellular Growth and Proliferation” (Figure 5). [score:3]
” Follow-up studies using qRT-PCR revealed that the “anti-proliferative” miR-363-5p markedly decreased expression of all other miRNAs in the three clusters. [score:3]
Results presented in Figure 8 show relative levels of expression of the miRNAs encoded by the miR-106a-363 cluster after transfection of E10 cells with mimic for miR-19a-, miR-20b -, miR-92a -, or miR-363-5p. [score:3]
presented in Figure 8 show relative levels of expression of the miRNAs encoded by the miR-106a-363 cluster after transfection of E10 cells with mimic for miR-19a-, miR-20b -, miR-92a -, or miR-363-5p. [score:3]
A similar case can be made as regards the 40-fold increase in the level of miR-485-5p in cells transfected with miR-363-5p mimic, as miR-485-5p has been shown to functions as a tumor suppressor in breast carcinoma cells (Anaya-Ruiz et al., 2013). [score:3]
Effects of transfection cultured human squamous carcinoma cells with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic on expression of the primary transcripts pri-17-92, pri-106a-363, and pri-106b-25. [score:3]
In cells transfected with miR-363-5p mimic the level of expression of both of these transcripts were decreased. [score:3]
Whether the distinct populations of differentially expressed miRNAs found in transfectants for miR-19a -, miR-20b -, or miR-363-5p mimic (Figure 3) reflect different ant-proliferative mechanisms remains to be established. [score:3]
In cells transfected with miR-363-5p mimic levels of expression of both pri-miR-17 and pri-miR-92a-1 were significantly decreased. [score:3]
This correlates with the observed decreased expression of the mature miRNAs encoded by this cluster following transfection with miR-363-5p mimic (Figure 7A). [score:3]
As expected, high levels of expression of miR-19a/miR-19b, or miR-20b, or miR-363-5p were found in cells transfected with mimic for miR-19a, or miR-20b - or miR-363-5p, respectively. [score:3]
com) suggested KRT15 to be targeted by miR-363-5p. [score:3]
Only miR-423-5p was shared between the 30–50 differentially expressed miRNAs in cells transfected with mimic for miR-19a, miR-20b, or miR-363-5p. [score:3]
The miRNAs (53, 43, 61 and 29) found differentially expressed following transfection with miR-19a - miR-20b -, miR-92a -, or miR-363-5p mimic were subjected to bioinformatic analysis using Ingenuity Pathways Analysis. [score:3]
Western blotting results, with proteins selected from among mirNA targets, can be regarded to verify this as all exhibited altered levels in cells transfected with mimic for miR-20b or miR-363-5p (Figure 4). [score:3]
Figure 6 Levels of expression of the microRNAs encoded by the miR-17-92 cluster in cultured human squamous carcinoma cells (E10) following transfection with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
Figure 7 Levels of expression of the microRNAs encoded by the miR-106b-25 cluster in cultured human squamous carcinoma cells (E10) following transfection with miR-19a miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
MiRNAs with significantly altered expression following transfection with mimics for miR-19a, miR-20b or miR-363-5p on miRNA were identified using human deoxyoligonucleotide microarrays for miRNA (OneArray® Microarray v2). [score:3]
Fractions of RNA enriched with respect to microRNA were isolated from cultured human squamous carcinoma cells (E10) transfected with miR-363-5p (A), miR-92a - (B), miR-20b - (C), miR-19a - (D) or scrambled control. [score:1]
The decreased levels of miRNAs can be associated with diminished transcription of the cluster genes as suggested by a general decrease in levels of both mature miRNAs and of corresponding primary transcript in transfectants for miR-363-5p mimic (Figures 6– 9). [score:1]
2014.00246/abstract Supplementary Figure 1 The Figure show micrographs of E10 cells transfected with scrambled control, miR-20b-, miR-363-3p or miR-363-5p mimic. [score:1]
Fractions of RNA enriched with respect to microRNA were isolated from cultured human squamous carcinoma cells (E10) transfected with mimic for miR-363-5p (A), miR-92a - (B), miR-20b - (C), miR-19a - (D) mimic or scrambled control as shown in the Figure. [score:1]
Microarrays were used to profile miRNAs in cultured human oral squamous carcinoma cells (E10) 72 h after transfection with mimics for miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic or with scrambled control. [score:1]
Cells counts following transfection with scrambled control or with mimic for miR-20b, miR-92a, miR-363-3p, or miR-363-5p (means derived from three separate transfections with SD indicated, A3). [score:1]
In cultures transfected with miR-363-3p mimic less apparent changes in cellular morphology were observed (Figure 2A1), even though the number of cells were about 70% of that of the scrambled control (Figure 2A3). [score:1]
obtained with transfectants for miR-363-5p further illustrate the heterogeneity of effects on sibling miRNAs: only in these transfectants were levels of the sibling miRNAs from all three clusters found significantly decreased (Figures 6– 9). [score:1]
Cultured human squamous oral carcinoma cells (E10) exhibited both altered morphology and diminished proliferation at 72 h after transfection with mimic for either miR-20b, or miR-363-3p, or miR-363-5p. [score:1]
Effects of transfection of cultured squamous carcinoma cells with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic on levels of miRNAs encoded by the miR-106a-363 or miR-106b-25 clusters. [score:1]
An anti-proliferative effect has previously been observed for miR-19a (Qin et al., 2010), miR-106a (Yang et al., 2011) and miR-363-3p (Sun et al., 2013). [score:1]
Studies with miR-363-3p were not included as miR-363-3p has been shown to have an anti-proliferative effect (Sun et al., 2013). [score:1]
Searching the literature revealed no such findings as regards miR-20b and miR-363-5p. [score:1]
Figure 2Effects of transfection with mimic for miR-19a, miR-20b, miR-92a, miR-363-3p (miR-363), or miR-363-5p (miR-363 [*]) on cell densities of cultured human squamous carcinoma (E10) cells. [score:1]
The levels of expression of hsa-pri-miR-17, hsa-pri-miR-92a-1, hsa-pri-miR-106b, hsa-pri-miR-25, hsa-pri-miR-106a, and hsa-pri-miR-92a-2 were measured in E10 cells after transfection with miR-19a, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:1]
Effects of transfection with miR-18a, miR-19a-, miR-20b-, miR-92a-, miR-363-3p or miR-363-5p mimic on proliferation of cultured carcinoma cells. [score:1]
It may, however, be associated with the relatively low levels of miR-20b and miR-363-5p found in E10 cells (Figure 8). [score:1]
With miR-363-3p transfectants changes in morphology were less clear, the cells appearing more like those of the scrambled control. [score:1]
Both miR-20b and miR-363-5p transfectants showed altered morphology; cells appeared larger and less elongate than scrambled control cells. [score:1]
The miR-17-92 cluster, located on human chromosome 13, encodes six miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1. The miR-106a-363 cluster, located on human chromosome X, encodes six miRNAs: miR-106a, miR-18b, miR-20b, miR-19b-2, miR-92-2, and miR-363. [score:1]
In cultures transfected with mimics for miR-20b or miR-363-5p the number of cells were about 55 and 75%, respectively, of that found in scrambled control (Figure 2A3). [score:1]
This correlates with the observed decrease in levels of mature miRNAs encoded by the cluster following transfection with miR-363-5p mimic (Figure 6A). [score:1]
Total RNA were isolated from cultured human squamous carcinoma cells (E10) transfected with miR-19a, miR-20b -, miR-92a - miR-363-5p mimic or scrambled control. [score:1]
Figure 4 Levels of selected proteins in cultured human squamous carcinoma cells (E10) transfected with miR-20b - or miR-363-5p mimic. [score:1]
presented in Figure 2 suggest that the significantly decreased cell densities observed with transfectants for mimic of miR-19a, miR-20b -, mir-106a, miR-363-3p -, and miR-363-5p were caused by diminished proliferation. [score:1]
Typical results obtained using the Single Channel Annexin V/Dead Cell Apoptosis Kit with cells transfected miR-363-5p -mimic showing no evidence of induced apoptosis. [score:1]
A markedly decreased number of cells was also observed with cultured keratinocytes and HaCaT cells transfected with miR-363-5p mimic (76 ± 2% and 74 ± 2% (n = 4) of scrambled control, respectively) suggesting that this phenomenon is not restricted to cultured E10 cells. [score:1]
The results for pri-miR-17-92 and pri-miR-106b-25 are presented in Figure 9. Figure 9 Levels of the miR-17-92 - and the miR-106b-25 primary transcript in cultured human squamous carcinoma cells (E10) following transfection with mimic for miR-19a, miR-20b, miR-92a, or miR-363-5p. [score:1]
A general decrease in all detected mirNA was found only in cells transfected with mirNA-363-5p mimic (Figure 8A). [score:1]
The results for pri-miR-17-92 and pri-miR-106b-25 are presented in Figure 9. Figure 9 Levels of the miR-17-92 - and the miR-106b-25 primary transcript in cultured human squamous carcinoma cells (E10) following transfection with mimic for miR-19a, miR-20b, miR-92a, or miR-363-5p. [score:1]
Effects of transfection of cultured squamous carcinoma cells with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic on levels of miRNAs encoded by the miR-17-92 cluster. [score:1]
Fractions of RNA enriched with respect to microRNA were isolated from cultured human squamous carcinoma cells (E10) transfected with miR-363-5p (A), miR-92a - (B), miR-20b - (C), miR-19a - (D) mimic or scrambled control shown in the Figure. [score:1]
[1 to 20 of 70 sentences]
5
[+] score: 103
Briefly, to attain RNAi, 5x10 [6] freshly seeded cells were transfected with targeting miR-10b inhibitor, miR-363 inhibitor, miR-149 inhibitor (Thermofisher Scientific, Carlsbad, CA) or the negative control at a final concentration of 30 nM, using HiPerfect Transfection Kit (Qiagen, Valencia, CA), according to the manufacturer’s instructions. [score:9]
Only SNAT1 and SNAT2 demonstrated significant increase in gene expression after miRNA-363 inhibition (SNAT1 mRNA: control: 1.0045±0.0935 versus inhibition: 1.2053±0.0406; p<0.001) (Fig 5B) (SNAT2 mRNA: control: 1.0066±0.1188 versus inhibition: 1.2109±0.0728; p<0.005 by Student’s t-test) (Fig 5C). [score:9]
Protein expression of SNAT1 and SNAT2 was also significantly increased after miR-363 inhibition (SNAT1 protein: control: 100±18.47 versus inhibition: 146.0022±21.10; p<0.03 by Student’s t-test) (Fig 5D) (SNAT2 protein: control: 100±2.969 versus inhibition: 119.394±11.65; p<0.03 by Student’s t-test) (Fig 5E). [score:9]
S2 Fig(A) miR-10b expression, (B) miR-363 expression, and (C) mir-149 expression at baseline and after 1, 3, 6, and 24 hours of NR in HTR8 trophoblast cells. [score:7]
Of those targets, only SNAT1 and SNAT2 demonstrated differential gene and protein expression in trophoblasts after miR-363 inhibition. [score:7]
For miRNA-363, inhibition of gene expression was confirmed (control: 1.3242±0.2791 versus inhibition: 0.4527±0.1812; p<0.02 by Student’s t-test) (Fig 5A). [score:7]
0176493.g003 Fig 3(3A) miR-10b expression increases after 24 hours of NR, (3B) miR-363 expression decreases after 24 hours of NR, and (3C) mir-149 expression increases after 24 hours of NR in HTR8 trophoblast cells, but does not achieve statistical significant (p<0.07). [score:7]
While its role in human disease is not well described, down-regulation of miRNA-363 in pre-eclamptic placentas has been described [52, 69]. [score:6]
0176493.g005 Fig 5Inhibition of miR-363 in HTR8 cells results in increased amino acid transporter expression. [score:5]
Inhibition of miR-363 in HTR8 cells results in increased amino acid transporter expression. [score:5]
miRNA-363 was also up-regulated in the initial microarray data, and validated by the whole placental qRT-PCR data. [score:4]
To establish a cause-and-effect paradigm, using a mo del of nutrient restriction of trophoblast cells in vitro to mimic human and an animal mo del of IUGR secondary to nutrient restriction resulting in placental insufficiency, we demonstrate that nutrient deprivation to trophoblasts alters the expression of our candidate miRNAs, e. g. miR-10b, miR-363, and miR-149. [score:3]
Targets of miR-363 include SNAT1, SNAT2, insulin receptor, epidermal growth factor, and glucose transporter 3 (G LUT3). [score:3]
For miRNA-363, gene expression of downstream targets, EGF, Glut-3, insulin receptor, SNAT1 and SNAT2 (n = 3-6/group), was evaluated by qRT-PCR. [score:3]
Gene expression of downstream targets of miRNA-363, EGF, Glut-3, insulin receptor, SNAT1 and SNAT2, were evaluated by qRT-PCR. [score:3]
miR-363 was also detected under control conditions and interestingly, expression was significantly decreased following nutrient restriction (baseline: 1.1052±0.2323 versus 1 hour post-NR: 1.0378±0.3625 versus 3 hours post-NR: 0.7080±0.3130 versus 6 hours post-NR: 1.1045±0.2218 versus 24 hours post-NR: 0.3176±0.1601; p<0.0001 by ANOVA with Fisher PLSD). [score:3]
This discrepancy between whole IUGR placentas and in-vitro nutrient restriction (~50%) upon miR-363 expression may relate to the lack of ischemia in-vitro that is the end result of utero-placental insufficiency in-vivo. [score:3]
Interestingly, nutrient restriction in vitro of trophoblast cells resulted in lowering of miR-363 expression. [score:3]
We chose to focus further investigations on miR-10b, miR-363, and miR-149 based on the following criteria: a) mean signal values greater than background, b) established significance of these miRNAs in placental function by others and our own murine studies [18, 32, 33], and/or c) target mRNAs with known function pertinent to angiogenesis, nutrient transfer, cell proliferation and/or patterning/development. [score:2]
Most importantly, our present in-vitro studies demonstrated a change in miR-363 in response to nutrient restriction alone. [score:1]
In our studies, the reciprocal effect of miR-363 on SNAT1 and SNAT2 mRNAs and protein sets the stage for extrapolation to the in-vivo situation of human IUGR placentas. [score:1]
Again in the IUGR placenta, miR-363 increased in our present study, and as demonstrated by others, the IUGR placenta revealed reduced SNAT 1 and SNAT2 concentrations and System A amino acid transport activity [70– 73]. [score:1]
Protein levels of SNAT1 (5D) and SNAT2 (5E) in HTR8 cells as measured by western immunoblotting also increase after inhibition of miR-363. [score:1]
The first row depicts data for miR-10b (Panels 2A, 2B), the second row for miR-363 (Panels 2C, 2D), and the third row for miR-149 (Panels 2E, 2F). [score:1]
[1 to 20 of 24 sentences]
6
[+] score: 103
For top 10 downregulated microRNAs (hsa-miR-106b-5p, hsa-miR-26b-5p, hsa-miR-494, hsa-miR-425-5p, hsa-miR-363-3p, hsa-miR-15b-5p, hsa-miR-185-5p, hsa-miR-150-5p, hsa-miR-223-3p, hsa-miR-142-5p), we included those have been shown to be deregulated in cancer (having no controversial expression status; some of these microRNAs have been shown to be upregulated in some cancer types, whereas, downregulated in other cancer types), and have either expression data or functional studies in stem cells. [score:15]
Among those significantly differentially expressed miRNAs, five downregulated (miR-26b-5p, miR-200c-3p, miR-203a, miR-223-3p, miR-363-3p) and three upregulated (miR-328, miR-574-3p, miR-1825) miRNAs were selected as a result of detailed literature search for further confirmation with qRT-PCR. [score:9]
MicroRNA profiling of CD133 [+] and CD133 [−] LCa samples with microarray revealed that miR-26b, miR-203, miR-200c, and miR-363-3p were significantly downregulated and miR-1825 was upregulated in CD133 [+] larynx CSLCs. [score:7]
MYC was also found to be destabilized by miR-363-3p through directly targeting and inhibiting USP28 [50] in hepatocellular carcinoma, pointing to a putative role for miR-363-3p in contribution to carcinogenesis and establishment of stemness features. [score:6]
Furthermore, miR-363-3p was found to directly target and repress GATA6, which is a transcription factor enhancing the expression of LGR5 in colorectal cancer [47]. [score:6]
Interestingly, MYC, which has been implicated in stem cell self-renewal, maintenance of pluripotency, and control of cell fate decisions as well as carcinogenesis [51], was reported to directly bind to promoter of miR-363-3p and inhibit its expression [50]. [score:6]
Expressions of miR-26b, miR-200c, and miR-203 were significantly correlated with miR-363-3p, miR-203, and miR-363-3p expressions, respectively. [score:5]
Correlation of those microRNAs expressions supports a recent report, which demonstrated that decreased expressions of miR-200c, miR-363, and miR-203 were associated with poor prognosis in human head and neck squamous cell carcinoma [81]. [score:5]
g Relative expression levels of miR-363-3p in each CD133 [+] and CD133 [−] sample pairs, and (h) mean relative expression levels miR-363-3p in CD133 [+] cells with respect to CD133 [−] cells. [score:5]
Among those, miR-26b (Fig.   2a, b), miR-200c (Fig.   2c, d), miR-203 (Fig.   2e, f), and miR-363-3p (Fig.   2g, h) were found to have significantly reduced expression in CD133 [+] larynx CSLCs, whereas miR-1825 (Fig.   2i, j) were validated to have increased expression in these CD133 enriched LCa cells. [score:5]
We here also demonstrated that miR-200c, and miR-203 expressions were significantly correlated with miR-203, and miR-363-3p expressions, respectively, in CD133 [+] LCa tissue samples. [score:5]
As to the analysis of validated targets of these miRNAs, miRTarBase database analysis revealed that miR-26b, miR-200c, miR-203, and miR-363-3p, and miR-1825 cooperatively target stem cell associated signaling pathways like Wnt, Hedgehog, and Notch (Fig.   4). [score:5]
To evaluate their correlation, we used Pearson correlation analysis, which demonstrated that miR-26b, miR-200c, and miR-203 expressions were significantly correlated with miR-363-3p, miR-203, and miR-363-3p expressions, respectively, in CD133 [+] LCa tissue samples (Fig.   3). [score:3]
To validate the differential expression of miR-26b, miR-200c, miR-203, miR-223, miR-328, miR-363-3p, 574-3p, and miR-1825, a total of 25 pairs of CD133 [+] and CD133 [−] cell populations collected from 25 tumor samples including those used in microarray experiments were studied. [score:3]
Ectopic expression of miR-363-3p decreased in vivo metastatic capacity of human neuroblastoma cells [56] and reversed the resistance of the breast cancer cell to the chemotherapeutic agent cisplatin [57]. [score:3]
Furthermore, miRWalk analysis showed that 3’UTR of several oncogenes were predicted to be targeted by miR-26b (202 out of 348 oncogenes), miR-200c (161 out of 348 oncogenes), miR-203 (216 out of 348 oncogenes), and miR-363-3p (175 out of 348 oncogenes). [score:3]
In addition to miR-200c and miR-203, which have been demonstrated in distinct cancers as having CSLCs specific deregulation pattern, we propose miR-1825, miR-363-3p, and miR-26b as specific miRNAs with potential roles in acquisition and maintenance of stem cell associated features as well as in contributing to tumor initiation, progression, metastasis, chemoresistance, and recurrence. [score:2]
On the other hand, miR-363-3p, derived from the miR-106a-363 cluster on chromosome X, has been previously reported to be dysregulated in multiple cancers [47]. [score:2]
Besides, miR-1825 has a tendency to have increased and miR-363-3p and miR-203 have a tendency to have decreased expression in T4 stage tumors compared to early stage tumors, although not significant. [score:2]
Additionally, miR-363 was reported to be repressed in head and neck squamous cell carcinoma tissues with lymph node metastasis and cell lines with increased invasive potential [49]. [score:1]
These findings strengthen the potential role of miR-363-3p as a CSLCs specific miRNA in larynx pathogenesis. [score:1]
Yellow, high fold change in CD133 [+] patient sample as compared to its corresponding CD133 [−] paired sample; blue, high fold change in CD133 [−] sample compared to CD133 [+] paired sample The qRT-PCR results confirmed that five of the eight selected miRNAs had a differential expression between groups: miR-26b, miR-200c, miR-203, miR-363-3p, and miR-1825 (Fig.   2, p values and fold changes are provided in Table  2). [score:1]
Only hsa-miR-26b-5p, hsa-miR-363-3p, and hsa-miR-223-3p met these criteria. [score:1]
Considering these findings and those of our own study, we suggest miR-363-3p as a strong candidate for establishment of stemness of CD133 [high] CSLCs. [score:1]
Yellow, high fold change in CD133 [+] patient sample as compared to its corresponding CD133 [−] paired sample; blue, high fold change in CD133 [−] sample compared to CD133 [+] paired sample The qRT-PCR results confirmed that five of the eight selected miRNAs had a differential expression between groups: miR-26b, miR-200c, miR-203, miR-363-3p, and miR-1825 (Fig.   2, p values and fold changes are provided in Table  2). [score:1]
[1 to 20 of 25 sentences]
7
[+] score: 92
Furthermore, in HepG2 and Huh7 cells transfected with NNT-AS1 plasmid vector or siRNAs, miR-363 expression was significantly down-regulated or up-regulated, showing the opposite relationship within NNT-AS1 and miR-363 (Figure 5F). [score:9]
Moreover, in HCC progression, miR-363 has been found to be downregulated and inhibits the tumorigenesis via directly targeting specificity protein [14]. [score:9]
Expression level of miR-363 assessed in HCC tissue samples showed that miR-363 was down-regulated in HCC tissue compared with adjacent noncancerous tissue (Figure 5D). [score:5]
showed that miR-363 directly targeted CDK6 3’-UTR (Figure 6B). [score:4]
On the contrary, in HepG2 cells transfected with miR-363 inhibitor, NNT-AS1 and CDK6 mRNA expression were both increased compared with controls group (Figure 6D). [score:4]
Comprehensive RT-PCR and western blot assay revealed that miR-363 expression was negatively correlated with CDK6 mRNA and NNT-AS1 expression. [score:4]
CDK6 acts as the target mRNA of miR-363, which is a vital molecular on cell cycle progression regulation. [score:4]
Results indicated that CDK6 was one of target mRNA for miR-363 with 7 binding sites (Figure 6A). [score:3]
Figure 5 (A) The putative complementary binding sequence of NNT-AS1 3’-UTR and miR-363 according to starBase, TargetScan and miRBase. [score:3]
CDK6 was target gene of miR-363. [score:3]
In summary, our study and results summarize that NNT-AS1 functions as an oncogenic lncRNA for HCC tumorigenesis through miR-363/CDK6 axis, which might be a useful diagnostic index and prognostic biomarker, providing a novel therapeutic target for human HCC. [score:3]
Briefly, wild-type (WT) or mutated-type (Mut) of NNT-AS1 or CDK6 3’-UTR sequence containing the miR-363 targeting sites were inserted into pGL3 promoter vector (Invitrogen, Carlsbad, Calif, USA) to construct pGL3-luc-NNT-AS1. [score:3]
NNT-AS1 promoted CDK6 expression through miR-363. [score:3]
Figure 6 (A) The putative complementary binding sequence of CDK6 3’-UTR and miR-363 according to TargetScan and miRBase. [score:3]
Furthermore, we predicted and validated that CDK6 was one of the target gene of miR-363. [score:3]
Similarly, miR-363 expression in HCC cells was significantly decreased (Figure 5E). [score:3]
Pearson’s correlation analysis and long rank analysis showed the negatively association within the expression of NNT-AS1 and miR-363 in 42 cases of HCC tissues (Figure 5G). [score:3]
To investigate the role of NNT-AS1/miR-363 in the cell cycle regulation, bioinformatics analysis was performed to discover the target gene of miR-363 in HCC tumorigenesis. [score:2]
Moreover, co-transfection of pcDNA-NNT-AS1 and miR-363 mimics recovered the CDK6 expression compared with control group (Figure 6E, 6F). [score:2]
MiR-363 has been tested as tumor suppressor in several cancers, such as gastric cancer, papillary thyroid carcinoma, renal cancer [12, 13]. [score:2]
With the help of bioinformatics analysis and online tools, we predicted that miR-363 contained complementary binding site targeting NNT-AS1 3’-UTR, which was confirmed by luciferase reporter assay. [score:2]
In HepG2 cells transfected with miR-363 mimics, NNT-AS1 and CDK6 mRNA expression were both decreased compared with negative controls group (Figure 6C). [score:2]
Our study revealed that NNT-AS1 promoted HCC progression and tumor growth via sponging miR-363, which might illustrate the regulatory way for HCC. [score:2]
NNT-AS1 directly bound miR-363 at 3’-UTR. [score:2]
In summary, results revealed the direct binding within NNT-AS1 and miR-363, suggesting the potential miRNA ‘sponge’ role of NNT-AS1 for miR-363. [score:2]
Moreover, NNT-AS1 was negatively correlated with miR-363, acting as ceRNA in the modulation. [score:1]
validated the decreasing of luciferase vitality in HepG2 and Huh7 cells transfected with NNT-AS1 wild type and miR-363 mimics, suggesting the binding within NNT-AS1 3’-UTR and miR-363 (Figure 5B). [score:1]
In present study, we provide evidence that NNT-AS1 exerts oncogenic role in the HCC progression and metastasis via miR-363/CDK6 axis. [score:1]
Bioinformatics prediction program indicated that NNT-AS1 contained complementary binding sequence with miR-363 at 3’-UTR (Figure 5A). [score:1]
NNT-AS1/miR-363/ CDK6 axis provides a novel insight for the pathological process. [score:1]
Thus, combined with the verified oncogenic role of NNT-AS1 in HCC, we could conclude that NNT-AS1 exert the tumor-promoting role via miR-363/CDK6 axis. [score:1]
HCC cells (HepG2 and Huh7) were seeded into 96-well plates and transfected with of pGL3-luc-NNT-AS1 (50 ng) and Renilla luciferase (5 ng) and miR-363 mimics or NC (5 pmol) using the Lipofectamine 2000 according to the manufacturer’s instructions. [score:1]
[1 to 20 of 32 sentences]
8
[+] score: 69
Additionally, miR-363-3p has been shown to exhibit an opposite effect in gastric cell lines; knock-down of expression of miR-363-3p was found to suppress carcinogenesis in certain gastric cancer cells (SC-M1-, KATO III-, and SNU-16) by upregulation of MBP-1 [83]. [score:9]
Here, overexpression of miR-363-3p resulted in downregulation of amount of both HAND1 mRNA and protein. [score:6]
miR-363-5p is shown to regulate the expression of angiocrine factors tissue inhibitor of metalloproteinases-1 (Timp-1) and thrombospondin 3 (THBS3). [score:6]
A high level of miR-363-3p suppresses proliferation of human hepatocellular carcinoma cells by targeting S1PR1 or USP28 [79, 80]. [score:5]
Tumors with low levels of expression of miR-363-3p or miR-363-5p, as well as high levels of expression of B7-H3 or E2F4, were associated with lower probability of survival [74, 76, 77]. [score:5]
This was also observed in head and neck squamous cell carcinomas; miR-363-3p inhibits expression of the transmembrane glycoprotein podoplanin [75]. [score:5]
An intriguing study by Wagh et al. [84] demonstrated the critical role of miR-363 in posttranscriptional regulation of cardio myocyte differentiation by targeting the cardiac transcription factor HAND1, necessary for the development of left ventricle of the heart. [score:5]
The miR-363-3p has also been proposed to regulate the transition from mitotic clonal expansion to terminal differentiation during adipogenesis in adipose tissue-derived stromal cells (ADSCs) by targeting E2F3 [82]. [score:4]
The miRNA derived from the complimentary strand of miR-363-5p pre-miR, miR-363-3p, has been shown, depending on the type of cell involved, to have dual functions either as tumor suppressor or as oncogenic miRNA. [score:3]
Also, a miRNA derived from either the 3′- or 5′-strand may be active as shown for miR-363, although only one of the two strands is expressed at any given time [85]. [score:3]
Decreased expression of miR-363-5p was detected in head and neck carcinomas and breast cancer cell lines [74, 75]. [score:3]
Furthermore, transfection with miR-363-5p mimic led to diminished expression of miRNA members from miR-17-92 and miR-106b-25 cluster, which also resulted in reduced proliferation of E10 cells [85]. [score:3]
Blocking the expression of miR-363-5p was shown to affect endothelial cell response to angiogenic factors stimulation [78]. [score:3]
The miR-363-5p is also expressed in aged oral keratinocytes [85]. [score:3]
Moreover, the miR-363-5p regulates angiogenic properties of endothelial cells as well as their communication with hematopoietic precursor cells. [score:2]
This cluster encodes six miRNAs: miR-106a, miR-18b, miR-19b-2, miR-20b, miR-92a-2, and miR-363 [42]. [score:1]
Our group has shown that both miR-20b and miR-363 from this 106a-363 cluster are barely detectable in human oral carcinoma cell line E10 [85]. [score:1]
Other studies reported that the level of miR-363-5p was either increased or decreased in aged mice [86]. [score:1]
Both the evolutionary sequence analysis and the seed-sequence -based grouping partition these miRNAs into four families: the miR-106 family (miR-17, miR-20a/b, miR-106a/b, and miR-93), the miR-18 family (miR-18a/b), the miR-19 family (miR-19a/b-1/2), and the miR-92 family (miR-25, miR-92a-1/2, and miR-363). [score:1]
[1 to 20 of 19 sentences]
9
[+] score: 51
By conducting a cross-sectional analysis of miRNA expression in different age groups, we found that expression of hsa-miR-363* significantly declined with age in control individuals, whereas centenarians maintain comparably high expression levels, similar to the observed in the middle age group. [score:7]
A cross sectional expression analysis of the differentially expressed miRNAs in B-cells from Ashkenazi Jewish individuals between the 50 [th] and 100 [th] years of age indicated that expression levels of miR-363* declined significantly with age. [score:7]
C) A cross-sectional expression analysis of hsa-miR-363* by quantitative RT-PCR showed the youthful preservation mode: its expression levels significantly decline with age in control individuals (p < 0.05), while centenarians maintain the expression levels of the youngest age group (50–60). [score:7]
Among the differentially expressed miRNAs, we chose hsa-miR-363* for a further validation study because its upregulation in centenarians was detectable by qRT-PCR analysis with > 2 fold change (Figure 3). [score:6]
We found that the expression levels of hsa-miR-363* significantly declined with age in control individuals (p < 0.05), while centenarians maintained comparable “high” expression levels of the youngest age group (Figure 4C). [score:5]
Hsa-miR-363* shows reduced expression in control individuals with advancing age while maintaining relatively high expression levels in centenarians. [score:5]
By conducting a cross-sectional expression analysis, we found a candidate longevity -associated miRNA, hsa-miR-363* (Figure 4). [score:3]
The predicted targets of hsa-miR-363* include PTEN, BCL2, AKT1, and IGFBP5 among genes listed in the GenAge database [45]. [score:3]
Five miRNAs (hsa-miR-363*, hsa-miR-1974, hsa-miR-223*, hsa-miR-148a, hsa-miR-148a*) produced expression patterns consistent with the Illumina sequencing data (Figure 3). [score:3]
controls miRNA Up regulated in Control counts (standard error) Centenarian counts (standard error) P values Bonferonni adjusted p values Fold changehsa-miR-122Centenarian19 (6.26)102 (6.39)1.06E-162.44E-145.83hsa-miR-363*Centenarian184 (23.30)837 (81.32)3.6E-1128.2E-1104.94hsa-miR-345Centenarian59 (10.65)227 (32.69)9.84E-282.27E-254.18hsa-miR-20bCentenarian306 (25.72)1108 (240.38)7.7E-1221.8E-1193.93hsa-miR-454Centenarian39 (6.55)126 (34.59)1.02E-132.36E-113.51hsa-miR-1974Centenarian4515 (660.27)14179 (668.31)003.41hsa-miR-223*Centenarian580 (39.17)1800 (204.29)2.2E-1675. [score:2]
This result suggests that miR-363* may be a candidate longevity -associated miRNA. [score:1]
> 100) (Figure 4C), suggesting that hsa-miR-363* is a candidate longevity -associated miRNA. [score:1]
The results suggest that hsa-miR-363* is a candidate longevity -associated miRNA. [score:1]
[1 to 20 of 13 sentences]
10
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05 To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
Ssc-miR-106a, ssc-miR-363, ssc-miR-195, ssc-miR-497, ssc-miR-146b, ssc-miR-92b-5p, ssc-miR-20b and ssc-miR-935 were highly expressed in hpiPSCs than that in mpiPSCs (Fig 3A). [score:3]
[1 to 20 of 3 sentences]
11
[+] score: 16
Another study shows miR-148a-5p functions by directly targeting and inhibiting Myc expression, whereas miR-363-3p destabilizes Myc protein by directly targeting and inhibiting USP28. [score:13]
However, inhibition of miR-148a-5p or miR-363-3p induces hepatocarcinoma by promoting G1–S-phase cell cycle transition, whereas their activation has the opposite effect [74]. [score:3]
[1 to 20 of 2 sentences]
12
[+] score: 15
In turn, miR-148a-5p directly targets and inhibits c-Myc expression, whereas miR-363-3p destabilizes c-Myc by directly targeting ubiquitin-specific protease 28. [score:11]
c-Myc directly binds to the promoters of miR-148a-5p/ miR-363-3p genes and represses their expression, inducing hepatocellular tumorigenesis by promoting G1 to S phase progression. [score:4]
[1 to 20 of 2 sentences]
13
[+] score: 14
By combining the microarray expression data with results of the prediction software TargetScan, three up-regulated miRNAs (miR-33a, miR-25 and miR-363) potentially able to regulate TWIST 3′-UTR were selected and individually tested for their ability to affect luciferase expression in MG-63 human OS cells co -transfected with the TWIST-3′UTR-luciferase reporter. [score:11]
Among the selected miRNAs, miR-33a, miR-25 and miR-363 were differentially expressed between chemoresistant and control osteosarcoma tissues based on results of the microarray analysis. [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
MiR-92a, miR-19b and miR-363 were found to be highly expressed, while miR-17-5p, miR-18a, miR-20b and miR-106a were lowly expressed. [score:5]
As mentioned above, miR-17-5p, miR-363, miR-106a, miR-18a, miR-19b, miR-92a, miR-20b and miR-92b formed a complex cluster and family network, and they also showed different expression patterns. [score:3]
The combined results above imply that members of the cluster miR-363/92a/19b-2/20b/106a may be related to cell proliferation and development. [score:2]
We identified a typical polycistronic miRNA cluster, miR-363/92a/19b-2/20b, on chromosome X. Interestingly, the homologous cluster, miR-363/92a/19b-2/20b/106a on chromosome X, was located 33.5 kb downstream of miR-363/92a/19b-2/20b (Figure 11A, C), and a paraologous cluster miR-17/18a/19b-1/92a-1 was found on chromosome 11 (Figure 11B, C). [score:1]
In the genome, miR-92a/19b showed three copies; miR-363 and miR-20b had two copies; while miR-17, miR-18a and miR-106a had one copy. [score:1]
In porcine milk, miR-363/92a/19b-2/20b (miR-363/92a/19b-2/20b/106a) and miR-17/18a/19b-1/92-1 were also detected. [score:1]
Among all miRNAs clusters, there were several pre-miRNAs with intervening sequences of less than 1 kb, including 10 known clusters (miR-99b/let-7e/125a, miR-24-2/27b/23b, miR-99a/let-7c, miR-29b/29a, miR-221/222, miR-98/let-7f, miR-181c/d, miR-363/92a/19b-2/106a, miR-363/92a/19b-2, miR-181b-1/181a-1 and miR-17/18a/19b-1/92a-1) and 4 novel miRNAs clusters (cluster 3, 9, 12, 22). [score:1]
[1 to 20 of 7 sentences]
15
[+] score: 13
Upregulation of miR-16-2-3p in HPV16 E6/E7 -expressing HFKs is driven by E7 expression (Table S1A), whereas upregulation of miR-363-3p, -9-5p, and -450a-5p is driven by E6 (Table S1B). [score:11]
Chapman BV, Wald AI, Akhtar P, Munko AC, Xu J, Gibson SP, Grandis JR, Ferris RL, Khan SA 2015 MicroRNA-363 targets myosine 1B to reduce cellular migration in head and neck cancer. [score:2]
[1 to 20 of 2 sentences]
16
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-370, hsa-mir-371a, hsa-mir-375, hsa-mir-378a, hsa-mir-133b, hsa-mir-423, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-520c, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-33b, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-509-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
In the same pathway, miR-363 inhibits adipocyte differentiation by targeting E2F and concomitantly downregulating C/EBPα and PPARγ [73]. [score:8]
Decreases triglyceride accumulation[65] miR-363 Inhibits adipocyte differentiation by targeting E2F3. [score:5]
[1 to 20 of 2 sentences]
17
[+] score: 12
Of the differentially expressed miRNAs, miR-185, miR-150, miR-194, and miR-363 were downregulated in individuals with 22q11DS as compared to TD controls and miR-208, miR-190, and miR-1 were upregulated. [score:8]
Specifically, six miRNAs (miR-185, miR-15b-3p, miR-363, miR-324-5p, miR-361-5p, and miR-194) were dysregulated in individuals with 22q11DS when examining left hippocampal volume (Figure 5 ), and also with right hippocampal volume (Figure 6 ), while the expression level of two miRNAs (miR-361-5p, and miR-194) significantly decreased with increased whole brain volume (Figure 7 ). [score:4]
[1 to 20 of 2 sentences]
18
[+] score: 12
This might be explained by the involvement of the co-regulated miR-363 in eye development in MO19 injected embryos. [score:3]
We found that injection of MO19 not only profoundly reduced the expression of mature miR-19a-d, but very consistently also diminished the level of mature miR-363 (Fig. 3c). [score:3]
To exclude that loss of miR-363 is causing or contributing to the observed miR-19 deficiency phenotype, we used a morpholino targeting specifically miR-363 processing (suppl. [score:3]
miR-363 -deficient embryos most noticeably showed severe abnormalities specifically in eye development, with dramatically reduced eye size up to complete loss of any eye structure when injected with high dosages of the MO (suppl. [score:2]
miR-363 is encoded downstream of miR-19c on one pri-miRNA transcript (Fig. 1d). [score:1]
[1 to 20 of 5 sentences]
19
[+] score: 12
RXRβ and TRβ, which initiated the process of metamorphosis, were up-regulated, while their predicted interaction miRNAs (mfi-miR-133c, mfi-miR-25, mfi-miR-31a and mfi-miR-363–3p; mfi-miR-15a, mfi-miR-15b and mfi-miR-216) were down-regulated. [score:7]
Among these, 10 pairwise miRNAs (mfi-miR-142, mfi-miR-17, mfi-miR-18a, mfi-miR-20a, mfi-miR-181a, mfi-miR-182, mfi-miR-199a, mfi-miR-30a, mfi-miR-9a, and mfi-miR-9b) were found to have relatively lower expression levels of miR-#-3p than their miR-#-5p counterparts, while the other 5 pairwise miRNAs (miR-29c, miR-22, miR-363, miR-24a, and miR-126) showed relatively higher expression levels of miR-#-3p. [score:5]
[1 to 20 of 2 sentences]
20
[+] score: 12
Further, miR-20b and miR-363 show similar levels and are expressed from a common region on chromosome X. Direct comparison of dMMR with pMMR tumors by linear effects mixed mo del using the Bonferroni correction revealed that six miRNAs were differentially expressed, with high significance, between different tumor subtypes (Figure 2B; detailed statistics provided [see Additional file 5]). [score:6]
Further, miR-20b and miR-363 show similar levels and are expressed from a common region on chromosome X. miRNAs Show Striking Differences withDirect comparison of dMMR with pMMR tumors by linear effects mixed mo del using the Bonferroni correction revealed that six miRNAs were differentially expressed, with high significance, between different tumor subtypes (Figure 2B; detailed statistics provided [see Additional file 5]). [score:6]
[1 to 20 of 2 sentences]
21
[+] score: 11
In addition, three miRNAs miR-20b, miR-363 and miR-30c that were all solely down-regulated in ccRCC also showed significant correlation with the expression levels of 23, 25 and 37 of their predicted target genes, respectively (Table S6). [score:8]
However, no enriched biological process was found in the correlated target gene sets of miR-30c and miR-363. [score:3]
[1 to 20 of 2 sentences]
22
[+] score: 9
Among 20 expressed miRNAs, the expression levels of hsa-mir-25, hsa-mir-221, hsa-mir-302b, hsa-mir-363, hsa-mir-372, hsa-mir-199a, hsa-mir-302d, hsa-mir-26a, hsa-mir-320, hsa-mir-744, hsa-mir-152 and hsa-let-7e in the study of Morin et al. exceed those obtained with miRExpress, but the levels of hsa-mir-423, hsa-let-7a, hsa-mir-1, hsa-mir-340, hsa-mir-302a, hsa-mir-130a, hsa-let-7f and hsa-mir-122 in the work by Morin et al. are lower than those obtained from miRExpress (Table 6) (full data are available in additional file 7). [score:9]
[1 to 20 of 1 sentences]
23
[+] score: 9
The differentially expressed miRNAs relative to fibroblasts included the strongly upregulated miR-363 (∼12 fold up), miR-204 (∼ 5 fold up), miR-582-5p (∼ 3 fold up) and the significantly downregulated miR-608 (∼70% down), miR-34a (∼60% down), miR-768-5p (∼80% down), and miR-582-3p (∼70% down). [score:9]
[1 to 20 of 1 sentences]
24
[+] score: 8
For instance, the paralog miRNA clusters miR-106a/363 (integrated by miR-106a, miR-363, miR-92-2, miR-19b-2, miR-20 and miR-18b), miR-106b/25 (compound of miR-106b, miR-25 and miR-93) and miR-17/92 (comprising miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1) are down-regulated upon differentiation, while clusters miR-29a/29b and miR221/222 are strongly up-regulated, suggesting an important role for coordinate regulatory miRNA networks during GIC differentiation. [score:8]
[1 to 20 of 1 sentences]
25
[+] score: 8
Interestingly, CEBPA, which was upregulated four-fold in our HES1 cells upon differentiation, is predicted to be itself regulated by miR-124, miR-25, miR-363 and miR-367 (among others) according to TragerScan 4.2, all of which were downregulated at least 1.5-fold in differentiated HES1 cells. [score:8]
[1 to 20 of 1 sentences]
26
[+] score: 7
Their results included two of the most upregulated (miR-221 and miR-222) and six downregulated miRNAs (miR-151-3p, miR-19a, miR-20b, miR-342-3p, miR-363, and miR-576-3p). [score:7]
[1 to 20 of 1 sentences]
27
[+] score: 7
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-10b
Consistently, CREB1 has also been identified to be highly expressed in glioma tissues and promote cell growth by activating the expression of oncogenic microRNA-23a [28], and plays an important role in the tumorigenesis of renal cancer by loss of tumor suppressive miR-10b-5p and miR-363-3p [29]. [score:7]
[1 to 20 of 1 sentences]
28
[+] score: 7
The top 8 downregulated (hsa-miR-200c, hsa-miR-212, hsa-miR-29a, hsa-miR-532, hsa-miR-141, hsa-miR-1, hsa-miR-363, hsa-miR-187) and 8 upregulated (hsa-miR-487, hsa-miR-452, hsa-miR-1233, hsa-miR-92a, hsa-miR-106b, hsa-miR-1290, hsa-miR-320, hsa-miR-26a) miRNAs were presented in Figure 1A. [score:7]
[1 to 20 of 1 sentences]
29
[+] score: 6
We plot–log10 values of the correlation coefficient qFDRs between miR-363 and the 11,278 genes along Y axis (blue dot). [score:1]
For example, miR-363 on Xq26.2 is correlated with 672 mRNA probes. [score:1]
The most frequently involved miRNA was miR-363, which was correlated with 672 mRNAs. [score:1]
Significance level of each mRNA probe for its correlation with miR-363 is demonstrated in Figure 1B. [score:1]
Above the line are the mRNA probes that were significantly correlated with the miR-363. [score:1]
For example, the miR-363 is significantly associated with the gene SASH (chromosome 6q24.3) at qFDR = 3.70×10 [−11] (equal to 10.43 of −log scale in the figure). [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 6
Since, among these differentially expressed miRNAs, miR-183, miR-215, and miR-363 were found downregulated in both the ectopic and eutopic tissues, the authors selected miR-183 for validation of further functional studies. [score:6]
[1 to 20 of 1 sentences]
31
[+] score: 6
We found several combinations of miRNAs including miRNA-155, miRNA-181 and miRNA-652 as well as miRNA-363, miRNA-532 and miRNA-582 which clustered or overlapped in their binding locations on these UTRs, suggesting possible competition for binding to control gene expression in a combinatorial fashion. [score:3]
A previous study from our institution had predicted eleven of these fourteen (79%) miRNAs (hsa-miR-454, has-miR-582-5p, has-miR-181d, has-miR-500, has-miR-181c, has-miR-411, has-miR-363, has-miR-381, has-miR-302c*, has-miR-652 and has-miR-452), to target CYP3A4/5/7 3’-UTR using in silico approach [29]. [score:3]
[1 to 20 of 2 sentences]
32
[+] score: 6
It is also a validated target of two other clearly rhythmic miRNAs in the present study, i. e., miR-363-3p (p = 0.006) and miR-106b-5p (p = 0.006). [score:3]
For the Per genes we find that Per1 is a weakly predicted target for 2 of the fluctuating plasma miRNAs, miR-28-3p and miR-103a-3p, discovered in the present study while Per2 is predicted to interact weakly with miR-24-3p and miR-363-3p. [score:3]
[1 to 20 of 2 sentences]
33
[+] score: 6
Examples of miRNAs with increased expression as development proceeds include: let-7f, miR-9 and miR-21, whereas, for example, miR-20b and miR-363 display reduced expression with increasing embryo age (Fig.  5D). [score:6]
[1 to 20 of 1 sentences]
34
[+] score: 6
Some of the enriched miRNAs, including has-miR-363–3p which was also reported to be dysregulated in Alzheimer’s disease [40], have been reported as differentially expressed in autistic brains [41]. [score:6]
[1 to 20 of 1 sentences]
35
[+] score: 6
Among aforementioned miRNAs, Peters et al. focused on the putative tumor suppressor miR-363, discovering that miR-363 RNA segment, which contains the GGAG motif, formed a relatively stable complex with the Lin28 protein. [score:3]
Knockdown of Lin28 could lead to decreased level of mature miR-363, implying that Lin28 functioned as a positive regulator of miR-363 biogenesis [34]. [score:3]
[1 to 20 of 2 sentences]
36
[+] score: 5
The strongest signal of overlap we identified was for a variant (rs3802177) within the 3′ UTR of the SLC30A8 gene, which maps to miRanda predicted target sites for six islet-expressed miRNAs (miR-363-3p, miR-25-3p, miR-32-5p, miR-92a-3p, miR-33a-5p, and miR-33b-5p) and reaches genome wide significance in T2D-association studies [11]. [score:5]
[1 to 20 of 1 sentences]
37
[+] score: 5
In fact, some tissue-specific miRNAs (e. g., miR-363 and miR-124) exhibit no obvious correlation with the expression levels of their target genes. [score:5]
[1 to 20 of 1 sentences]
38
[+] score: 5
Also, miR-125a-5p/-351, miR-200c/-429, miR-106b/-17, miR-363/-92b, miR-181b/-181d, miR-19a/-19b, let-7d/-7f, miR-18a/-18b, miR-128/-27b and miR-106a/-291a-3p pairs exhibited significant synergy and their association to aging and/or cardiovascular diseases is supported in many cases by a disease database and previous studies. [score:5]
[1 to 20 of 1 sentences]
39
[+] score: 5
In esophageal cancers cell line KYSE150, as shown in the up panel of Figure 2A, over -expression of MIR30e, MIR363, MIR498, MIR196, MIR422, MIR337 or MIR202 remarkably increase the LC3-I to LC3-II conversion whereas miR-20b modestly decrease. [score:3]
In addition to LC3, the sequestosome 1(SQSTM1/P62) protein were accumulated when MIR30e, MIR363, MIR498 or MIR196 were transfected whereas MIR20b significantly decreased (up panel of Figure 2B). [score:1]
In another esophageal cancers cell line TE3, transfection of MIR20b, MIR363, MIR498 or MIR196 affected the autophagy when monitoring both LC3 and p62 (down panel of Figure 2A and Figure 2B). [score:1]
[1 to 20 of 3 sentences]
40
[+] score: 5
Twelve miRNAs were upexpressed, while 84 miRNAs (has-miR-137, hsa-miR-133a, hsa-miR-143, hsa-miR-363, hsa-miR-4770, hsa-miR-490-5p, hsa-miR-133b, and so on) were deexpressed in tumors compared with those in normal tissues (adjusted P = 0.05) (Figure  1). [score:4]
On the other hand, we found seven statistically significant miRNAs, namely, miR-145, miR-363, miR-378*, miR-137, miR-100, miR-125a-5p, miR-143 in conditional forward method. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 5
For example 2 coupled feedback loops (LMO2, miR-223, miR-363) are necessary for normal hematopoiesis (Major personal communication), and it has been suggested these loop motifs may confer robustness to genetic regulatory networks [6, 23- 26], presumably by inhibiting stochastic transcriptional perturbation using feedback and feed forward loops to regulate transcriptional “gain” and control amplification of unwanted frequencies much as these loops are used in mechanical and electrical engineering for example [27- 29]. [score:5]
[1 to 20 of 1 sentences]
42
[+] score: 5
Vice versa, miR-363 and miR-181b are over expressed in CD56 positive cells and show significantly decreased expression in CD15 positive cells. [score:5]
[1 to 20 of 1 sentences]
43
[+] score: 4
Other miRNAs from this paper: hsa-mir-29b-1, hsa-mir-138-1, hsa-mir-146a, hsa-mir-34b
Pairwise analyses for transcriptome and microRNAome for RIFE showed that 6 up-regulated microRNAs (miR-138-1-3p, miR-29b-1-5p, miR-363-3p, miR-34b-3p, miR-146a-5p, and miR-363-3p) are overlapped by these two analyses (Fig 5A). [score:4]
[1 to 20 of 1 sentences]
44
[+] score: 4
Meanwhile, there were also 23 miRNAs including miR-3138, miR-363, miR-4271, significantly down-regulated in PATU8988/5-FU cells (Fig. 1B). [score:4]
[1 to 20 of 1 sentences]
45
[+] score: 4
The highly downregulated miRNAs presented in Table 1 were miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-363, miR-486-5p and members of the miR-1/miR-133a, miR-206/miR-133b, miR-451/miR-144 and miR-497/miR-195 clusters. [score:4]
[1 to 20 of 1 sentences]
46
[+] score: 4
Expression levels of miR-92a paralog miRNAs miR-25 (C) and miR-363 (D) in heart of WT and miR-92a [−/−] mice. [score:3]
All other cluster members and the paralog microRNAs miR-25 and miR-363 were not changed in miR-92a [−/−] mice (Figure S1C/D). [score:1]
[1 to 20 of 2 sentences]
47
[+] score: 4
In contrast, 11 miRNAs (miR-9-5p, miR-184, miR-328-3p, miR-363-3p, miR-372-3p, miR-518d-3p, miR-518f-3p miR-523-3p, miR-618, miR-625-5p, and miR-628-5p) were significantly up-regulated in human oocytes (with respect to FF) (Figure 3B and Supplementary Table S1). [score:4]
[1 to 20 of 1 sentences]
48
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-205, hsa-mir-210, hsa-mir-221, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-125b-2, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-130b, hsa-mir-26a-2, hsa-mir-361, hsa-mir-362, hsa-mir-376c, hsa-mir-371a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-342, hsa-mir-151a, hsa-mir-324, hsa-mir-335, hsa-mir-345, hsa-mir-423, hsa-mir-483, hsa-mir-486-1, hsa-mir-146b, hsa-mir-202, hsa-mir-432, hsa-mir-494, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-455, hsa-mir-545, hsa-mir-376a-2, hsa-mir-487b, hsa-mir-551a, hsa-mir-571, hsa-mir-574, hsa-mir-576, hsa-mir-606, hsa-mir-628, hsa-mir-629, hsa-mir-411, hsa-mir-671, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-889, hsa-mir-876, hsa-mir-744, hsa-mir-885, hsa-mir-920, hsa-mir-937, hsa-mir-297, hsa-mir-1233-1, hsa-mir-1260a, hsa-mir-664a, hsa-mir-320c-2, hsa-mir-2861, hsa-mir-378b, hsa-mir-1260b, hsa-mir-378c, hsa-mir-1233-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-664b, hsa-mir-378j, hsa-mir-486-2
Aberrant serum miRNA expression in non-vaccinated children that contracted varicella revealed a panel of five miRNAs (miR-197, miR-629, miR-363, miR-132, and miR-122) that could differentiate, with moderate sensitivity and specificity, varicella patients from HC, and also varicella patients from patients with three other microbial infections (B. pertussis, measles virus, and enterovirus) (217). [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
Table 7 showed serum PICP at total time points were significantly associated with miR-363 (r = −0.3347 p < 0.05), miR-1290 (r = −0.2908, p < 0.05), miR-103 (r = −0.2739, p < 0.05), miR-451a (r = −0.3204, p < 0.05), miR-130a (r = −0.3402, p < 0.05), miR-1234 (r = −0.2396, p < 0.05), and miR-20a (r = −0.3148, p < 0.05), respectively. [score:1]
miR-451a, miR-363, miR-1290, miR-363, miR-151-5p, and miR-151-3p had an optimal area value under the curve >0.85, indicating that these circulating miRNAs levels might be useful biological markers for assessing the risk of bed rest or simulated microgravity. [score:1]
The AUC of remaining eight miRNAs was 0.8929 for miR-1290 (95% CI 0.7736–1.012, p = 0.00069), 0.8896 for miR-363 (95% CI 0.7514–1.028, p = 0.0010), 0.8799 for miR-20a (95% CI 0.7171–1.043, p = 0.0014), 0.8701 for miR-151-5p (95% CI 0.7223–1.018, p = 0.0018), 0.8571 for miR-151-3p (95% CI 0.6948–1.019, p = 0.0026), 0.8036 for miR-103 (95% CI 0.6089–0.9983, p = 0.0087), 0.7532 for miR-199a-3p (95% CI 0.5381–0.9684, p = 0.033), and 0.6788 for miR-148a (95% CI 0.4504–0.9067, p = 0. 12). [score:1]
[1 to 20 of 3 sentences]
50
[+] score: 3
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
A 9-miRNA signature (hsa-miR-146b-5p, hsa-miR-146a, hsa-miR-21, hsa-miR-155, hsa-miR-500, hsa-miR-222, hsa-miR-363, hsa-miR-574-3p, and hsa-miR-574-5p) from study by Malumbres et al. [48] can precisely differentiate the DLBCL into ABC or GCB subtypes, and expression of some of these miRNAs correlated with clinical outcome. [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
34 hsa-miR-335 −0.35hsa-miR-345 [44], [53], [71] 1.16 hsa-miR-363 0.99 hsa-miR-371-5p 0.55 hsa-miR-421 0.50 hsa-miR-483-5p 1.33 hsa-miR-494 0.87 hsa-miR-505* −0.40 hsa-miR-513a-5p 1.06 hsa-miR-513b 1.19 hsa-miR-513c 1.22 hsa-miR-551b −0.40 hsa-miR-574-5p 0.97hsa-miR-630 [68], [73] 0.96 hsa-miR-769-5p −0.34 hsa-miR-801 0.66 hsa-miR-873 −0.64 hsa-miR-877* 0.72 hsa-miR-923 0.89 hsa-miR-940 0.49 hsa-miR-95 −0.44 hsa-miR-99a −0.64Irradiated and non-irradiated PBL of the same donors were incubated in static gravity (1 g) for 4 and 24 h, and miRNA expression profile was analyzed at the end of each incubation time. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 3
Conversely, HIF-1 promotes the expression of several hypoxamiRs including miR-210 [97], miR-146a [98], miR-145 [99], miR-382 [100], miR-191 [101], miR-363 [102], miR-421 [103] in tumor cells, miR-204 in neuronal cells [104], miR-30a and miR-21 in cardiomyocytes [105, 106], miR-687 in embryonic kidney cells [107], miR-155 in intestinal epithelial cells [108], and miR-429 [109] and miR-19a [110] in endothelial cells. [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 3
The other known hESC miRNA clusters detected highly represented in our study gave rise to several overexpressed moRNAs as well: moRNAs derived from both ends of mir-363 and miR-20b hairpins, moR-92a-2-5p from miR-106a-363 cluster and four moRNAs from the paralog miR-17-92 cluster. [score:3]
[1 to 20 of 1 sentences]
54
[+] score: 3
Dicer (Iliou et al., 2014) and multiple miRNAs [including, miR-34a (Bu et al., 2013, 2016), miR-106b (Zheng et al., 2015a), miR-140 (Zhai et al., 2015), miR-146a (Hwang et al., 2014), miR-183 (Wellner et al., 2009), miR-200 (Wellner et al., 2009), miR-203 (Wellner et al., 2009), miR-215 (Jones et al., 2015), miR-302b (Zhu et al., 2012), miR-328 (Xu et al., 2012b), miR-363 (Tsuji et al., 2014), miR-371 (Li et al., 2015c) and miR-451 (Bitarte et al., 2011)] reportedly regulate CRC TICs. [score:2]
The miR-363-GATA6-Lgr5 pathway is critical for colorectal tumourigenesis. [score:1]
[1 to 20 of 2 sentences]
55
[+] score: 3
In addition, changes were observed between the corpus and cauda regions with miR-200b, miR-10a, miR-424, miR-542, miR-31, miR-183 and miR-363 being significantly over-expressed in the corpus versus the cauda region (Fig. 2 B). [score:3]
[1 to 20 of 1 sentences]
56
[+] score: 3
Other miRNAs from this paper: hsa-mir-30c-2, hsa-mir-200c, hsa-mir-30c-1, hsa-mir-193b
U6 or GAPDH was used as the internal control, and the relative level of miR-363 or MCL-1 expression was determined with the 2 [−ΔΔCT] method to calculate the fold change of the RNA expression [12]. [score:3]
[1 to 20 of 1 sentences]
57
[+] score: 2
27E-02   MTMR14  8.00E-05 1.00E-021.73E-02 hsa-miR-339-5p ECOP 1.12E-029.00E-051.31E-029.37E-032.31E-03   FURIN  1.00E-04 2.36E-034.27E-02   MTMR14  8.00E-05 3.42E-031.73E-02 hsa-miR-363 ECOP 2.64E-029.00E-051.13E-033.00E-022.31E-03   FURIN  1.00E-04 2.33E-064.27E-02   MTMR14  8.00E-05 5.69E-041.73E-02rs7670734hsa-let-7i TP635.21E-052.20E-028.00E-052.44E-035.08E-053.95E-02 hsa-miR-20b TP63 4. 26E-02 9.45E-051.00E-02  hsa-miR-25 TP63 1.11E-02 1.65E-021.00E-02  hsa-miR-339-5p TP63 1.07E-02 1.31E-025.44E-04  hsa-miR-363 TP63 2.48E-02 1.13E-031.76E-06 rs7677704hsa-let-7i TP635.21E-052.20E-028.00E-052.44E-035.08E-053.95E-02 hsa-miR-20b TP63 4.26E-02 9.45E-051.00E-02  hsa-miR-25 TP63 1.11E-02 1.65E-021.00E-02  hsa-miR-339-5p TP63 1.07E-02 1.31E-025.44E-04  hsa-miR-363 TP63 2.48E-02 1.13E-031.76E-06 rs9312445hsa-let-7i TP635.21E-052.20E-028. [score:1]
00E-059.45E-051.00E-021.88E-02   DDR2  1.00E-05 2.00E-025.72E-03   ECOP  1.00E-04 4.76E-042.31E-03   EIF2AK3  1.00E-05 3.41E-051.54E-02   HMOX1  1.00E-04 2.55E-033.76E-02   HSPC159  7.00E-05 2.00E-021.27E-02   LARGE  5.00E-05 1.93E-041.05E-03   MEF2D  4.00E-05 1.11E-047.53E-03   PDK2  3.00E-05 2.38E-052.44E-02   PIK3R5  1.00E-04 8.33E-031.86E-02   RBM47  1.00E-04 4. 48E-045.55E-03   USP53  2.00E-05 3.00E-024.77E-02  hsa-miR-30d ABCD2  4.42E-023.00E-053.80E-038.57E-051.88E-02   DDR2  1.00E-05 3.55E-055.72E-03   ECOP  1.00E-04 3.52E-032.31E-03   HMOX1  1.00E-04 3.09E-033.76E-02   HSPC159  7.00E-05 4.68E-041.27E-02   LARGE  5.00E-05 1.00E-021.05E-03   PDK2  3.00E-05 1.00E-022.44E-02   PIK3R5  1.00E-04 1.46E-031.86E-02   USP53  2.00E-05 3. 12E-044.77E-02 hsa-miR-363 ABCD2 1.28E-023.00E-051.13E-031.74E-041.88E-02   DDR2  1.00E-05 3.94E-055.72E-03   ECOP  1.00E-04 3.00E-022.31E-03   EIF2AK3  1.00E-05 4.00E-031.54E-02   HSPC159  7.00E-05 1.35E-031.27E-02   LARGE  5.00E-05 1.07E-051.05E-03   MEF2D  4.00E-05 1.00E-027.53E-03   PDK2  3.00E-05 1.36E-042.44E-02   PIK3R5  1.00E-04 1.66E-061.86E-02   USP53  2.00E-05 3. 99E-064.77E-02rs4919716hsa-miR-20b ECOP1.95E-053.00E-029.00E-059.45E-054.76E-042.31E-03   FURIN  1.00E-04 3.00E-024.27E-02   MTMR14  8.00E-05 7.63E-031.73E-02 hsa-miR-30b ECOP 4.09E-029.00E-057.08E-033.57E-032.31E-03   FURIN  1.00E-04 2.43E-054.27E-02   MTMR14  8.00E-05 5.77E-031.73E-02 hsa-miR-30d ECOP 2.10E-029.00E-053.80E-033.52E-032.31E-03   FURIN  1.00E-04 1.69E-054. [score:1]
[1 to 20 of 2 sentences]
58
[+] score: 2
Moreover, miR-138, miR-203 and miR-363 previously uncharacterized in metastases are also downregulated in 3D vs. [score:2]
[1 to 20 of 1 sentences]
59
[+] score: 2
We did not have data on miR-106a and miR-363. [score:1]
MiRNA-20b clusters with miR-18b, miR-92a-2, miR-19b, miR-363, and miR-106a. [score:1]
[1 to 20 of 2 sentences]
60
[+] score: 2
Briefly, miRNA was reverse transcribed using sequence specific stem-loop primers (invitrogen) to the following miRNAs: hsa-miR-125b, hsa-miR-145, hsa-miR-153, hsa-miR-210, hsa-miR-143, hsa-miR-100, hsa-miR-363, hsa-miR-451, hsa-miR-572 and hsa-miR-508-5p, based on microarray analysis and their predicted target genes. [score:2]
[1 to 20 of 1 sentences]
61
[+] score: 2
The other three microRNAs (miR-100, miR-627 and miR-363) were also identified by the computational analysis but they were only significant in patients of either stage II or stage III. [score:1]
By applying the IMRE method to the six independent CRC mRNA microarray datasets, we identified four microRNAs (miR-29a, miR-29c, miR-100 and miR-627) in the stage II datasets and three microRNAs (miR-29a, miR-29c and miR-363) in the stage III datasets with a p value ≦ 0.1(Table 2). [score:1]
[1 to 20 of 2 sentences]
62
[+] score: 2
The other 14 miRNA showed significant down- regulation with miR-551b, miR-10a, miR-363 and miR-196b from 12 to 6 fold decrease displayed the highest fold-change. [score:2]
[1 to 20 of 1 sentences]
63
[+] score: 1
The third was located on chromosome X and includes miR-106a, miR-363, and miR-20b. [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
Other miRNAs from this paper: hsa-mir-17, hsa-mir-28, hsa-mir-223, hsa-mir-127, hsa-mir-188, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-30e, hsa-mir-362, hsa-mir-367, hsa-mir-379, hsa-mir-196b, hsa-mir-450a-1, hsa-mir-431, ssc-mir-28, hsa-mir-493, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-500a, hsa-mir-501, hsa-mir-502, hsa-mir-450a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-506, hsa-mir-508, hsa-mir-509-1, hsa-mir-532, hsa-mir-615, hsa-mir-660, bta-mir-127, bta-mir-30e, bta-mir-17, bta-mir-450a-2, bta-mir-532, bta-mir-363, bta-mir-660, hsa-mir-891a, hsa-mir-892a, hsa-mir-509-2, hsa-mir-450b, hsa-mir-892b, hsa-mir-708, hsa-mir-509-3, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1248, ssc-mir-17, bta-mir-155, bta-mir-188, bta-mir-194-2, bta-mir-196b, bta-mir-223, bta-mir-28, bta-mir-362, bta-mir-367, bta-mir-379, bta-mir-431, bta-mir-493, bta-mir-500, bta-mir-502a-1, bta-mir-502a-2, bta-mir-502b, bta-mir-615, bta-mir-708, bta-mir-1248-1, bta-mir-1248-2, ssc-mir-450a, bta-mir-2320, bta-mir-1388, bta-mir-194-1, bta-mir-450a-1, eca-mir-30e, eca-mir-367, eca-mir-684, eca-mir-196b, eca-mir-615, eca-mir-708, eca-mir-194-1, eca-mir-493a, eca-mir-17, eca-mir-1248, eca-mir-28, eca-mir-127, eca-mir-379, eca-mir-431, eca-mir-493b, eca-mir-155, eca-mir-194-2, eca-mir-188, eca-mir-223, eca-mir-362, eca-mir-363, eca-mir-450a, eca-mir-450b, eca-mir-450c, eca-mir-500-1, eca-mir-500-2, eca-mir-501, eca-mir-502, eca-mir-508, eca-mir-509a, eca-mir-532, eca-mir-660, ssc-mir-30e, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-127, ssc-mir-532, ssc-mir-708, ssc-mir-1285, ssc-mir-500, hsa-mir-514b, ssc-mir-363-1, ssc-mir-450c, hsa-mir-500b, ssc-mir-194b, ssc-mir-155, ssc-mir-362, bta-mir-3601, ssc-mir-615, ssc-mir-2320, bta-mir-450b, ssc-mir-194a, ssc-mir-196b-2, ssc-mir-363-2, ssc-mir-493, hsa-mir-892c, eca-mir-1388, eca-mir-514b, eca-mir-506a, eca-mir-509b, bta-mir-194b, ssc-mir-1388, ssc-mir-223, ssc-mir-660, bta-mir-194b-2, bta-mir-1949
The mir-17 and mir-363 clusters are well conserved and supported by reads (Additional file 1: Figure S15 and S16). [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
Each clusters had at least 2 genes, with miR-532∼miR-188 cluster in chromosome X having 2 genes, and mir-363∼106a cluster having 6 genes. [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
Additionally, two miR-17-92 paralogs have been identified: (i) the miR-106a-363 cluster, which is located on the X chromosome and houses miR-106a, miR-18b, miR-20b, miR-19b-2,2a-2, and miR-363, and (i) the miR106b-25 cluster, which is located on chromosome 7 and houses miR-106b,3, and miR-25 [35]. [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
For example, four families (mir-17, mir-19, mir-25 and mir-363) are located at three different clusters (at cluster 7.4, cluster 13.2, and cluster X. 8). [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
We discovered pro-proliferative miRNAs (miR-9 [*], miR-93, miR-130a, miR-130b, miR-301, miR-302b, miR-302d, miR-363, miR-372, miR-373), and anti-proliferative miRNAs (miR-7, miR-124a, miR-192, miR-193a, miR-193b, miR-199a [*], miR-432 [*], miR-497, miR-506, miR-517c) in A2780 cells. [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
mir-106a∼mir-363 designates mir-106a/mir-18b/mir-20b/mir-19b-2/mir-92a-2/mir-363 cluster and mir-941-1∼3 designates mir-941-1/mir-941-2/mir-941-3 cluster. [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
07] 0.01 1p36.33 hsa-miR-126 −0.36 [−0.64 – −0.08] 0.01 9q34.3 hsa-miR-888 −0.56 [−1.02 – −0.10] 0.02 Xq27.3 hsa-miR-517b −0.22 [−0.41 – −0.03] 0.03 19q13.42 hsa-miR-363 −0.43 [−0.80 – −0.05] 0.03 Xq26.2 hsa-miR-216b −0.26 [−0.50 – −0.03] 0.03 2p16.1 hsa-miR-1285 −0.27 [−0.53 – −0.02] 0.04 7q21. [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
H8255 [12] Brain tumor Rhbg Brainmir-196b a * 403_0_8 [17] myeloid Hoxa7/Hoxa9 BM* M15-5S8 [10] B cell* M35-5B3 [10] B cell* M17-5B5-1 [10] B cell* 45f23 [17] myeloid* 443_0_8 [17] myeloid* SL024-1 [18] myeloid* 143_1 [17] T cell* M35-5S2-1 [10] B cell* M8-5S2-1 [10] B cell mir-135a-1Dkm4.24 [15] B cell Wdr82 N/D Lung, breast cancer let-7gDkm83.2 [15] B cell Wdr82 Thymus mir-363* 0249. [score:1]
[1 to 20 of 1 sentences]
72
[+] score: 1
miR-330, miR-582-5p, and miR-363 promote GSC migration and invasion by reducing apoptosis [94, 95]. [score:1]
[1 to 20 of 1 sentences]
73
[+] score: 1
rhPDGF-BB combined with ADSCs in the treatment of Achilles tendinitis via miR-363/PI3 K/Akt pathway. [score:1]
[1 to 20 of 1 sentences]
74
[+] score: 1
One of these, miR-363, was further characterised to target the genes RGS17 and HIPK3, which have previously been associated with therapeutic response in AML patients [96]. [score:1]
[1 to 20 of 1 sentences]
75
[+] score: 1
The human cluster contains six miRNAs (MIR363, MIR19A2, MIR19B2, MIR20B, MIR18B and MIR106A), all six of which were predicted from Meug_1.0 (ENSMEUG000000: 16895, 17431, 17730, 17261, 17356, and 17668 respectively). [score:1]
[1 to 20 of 1 sentences]
76
[+] score: 1
170 hsa-miR-34b2.061.00E-04 hsa-miR-30a-5p−2.130 hsa-miR-34c2.022.00E-04 hsa-miR-95−2.161.00E-04 hsa-miR-4552.063.00E-04 hsa-miR-378−2.081.00E-04 hsa-miR-91.993.00E-04 hsa-miR-218−1.881.00E-04 hsa-miR-2961.933.00E-04 hsa-miR-368−2.002.00E-04 hsa-miR-3012.023.00E-04 hsa-miR-363−1.832.00E-04 hsa-miR-130b1.973.00E-04 hsa-miR-128a−1.904.00E-04 hsa-miR-196b1.934.00E-04 hsa-miR-655−1.946.00E-04 hsa-miR-200a1. [score:1]
[1 to 20 of 1 sentences]