WARNING: This summary was generated by AI. MIR363 is a microRNA that has been implicated in prostate cancer (PCa) [PMC10067432]. RNA immunoprecipitation (RIP) assays have shown that MIR363 is associated with the RNA-induced silencing complex component Argonaute 2 (Ago2), which suggests a role in gene silencing [PMC10067432]. Additionally, MIR363 expression levels are significantly reduced in prostate cancer tissues and cell lines, including PC3 and DU145, compared to benign prostatic hyperplasia (BPH), suggesting that MIR363 may function as a tumor suppressor or serve as a biomarker in PCa [PMC10067432].
u gu CA A gaugagua guu CGGGUGGAU CG UGCAAUUUu u ||| ||||||||| || ||||||||| caa GUCUACCUA GC ACGUUAAaa c c AU UG - agaggaua
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003385 |
| Description | Homo sapiens hsa-miR-363-5p mature miRNA |
| Sequence | 7 - CGGGUGGAUCACGAUGCAAUUU - 28 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000707 |
| Description | Homo sapiens hsa-miR-363-3p mature miRNA |
| Sequence | 50 - AAUUGCACGGUAUCCAUCUGUA - 71 |
| Evidence |
experimental
array-cloned [1], cloned [2-3] |
| Database links |
|
| Predicted targets |
|
|