sort by

69 publications mentioning hsa-mir-382

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-382. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 293
Overexpression of HIF-1α (pEGFP-HIF-1α) upregulated endogenous miR-382 expression (Figure 2a), whereas HIF-1α siRNA downregulated miR-382 levels, under hypoxic conditions (Figure 2b). [score:11]
To identify the molecular target of miR-382, we predicted target candidates using three algorithmic programs (TargetScan, miRanda and cbio) and by examining miR binding efficacy to the 3′-UTR regions of target genes (Supplemental Figure S1). [score:9]
This study shows that miR-382 upregulation by hypoxia participates in hypoxia -induced angiogenesis, and in particular, miR-382 directly targets PTEN, a tumor suppressor, and stimulates the AKT/mTOR signaling pathway. [score:9]
When MKN1 cells were exposed to hypoxia for 6, 24 or 48 h, the expression of miR-382 was increased time -dependently until 48 h (Figure 1d), suggesting that its expression is substantially upregulated by subchronic hypoxia. [score:8]
As HIF-1α is a critical factor for drug resistance, EMT, metastasis and maintenance of cancer stem cell properties (51), miR-382 may have a role in the development of many diseases mentioned above, via HIF-1α or via targeting PTEN tumor suppressor. [score:8]
When we treated gastric cancer xenografted nude mice with a HIF-1α-specific inhibitor, echinomycin, for 10 days, echinomycin decreased the expression of miR-382 by 0.2-fold in tumor tissues, confirmed by real-time PCR, indicating that HIF-1α is involved in miR-382 expression in tumor tissues. [score:7]
MicroRNAs in chromosome 14q32 locus are downregulated in osteosarcomas, suggesting that these 14q32 microRNAs, including miR-382, potentially target the cMyc transcript and that the microRNAs-cMyc gene network is deregulated during the pathogenesis of osteosarcoma (44, 45). [score:7]
Mutants of these two regions in PTEN mRNA 3′-UTR did not inhibit the reporter activity induced by miR-382 oligomers (Figure 4f), suggesting that miR382 targets PTEN translation. [score:7]
Microarray data showed that its cluster at chromosome 14 (14q32 miRNAs) was upregulated under hypoxia, and we found that miR-382 overlapped between the upregulated miRNAs under hypoxia and the 14q32 miRNAs increased by 2-fold (Figure 1c). [score:7]
The upregulated or downregulation of miR-382 significantly increased or decreased endothelial cell proliferation, migration and tube formation, suggesting that miR-382 is an angiogenic miR. [score:7]
Furthermore, silencing PTEN with siRNA recovered the antagomiR-382 -induced inhibition of AKT, mTOR and p70S6K activities under hypoxic conditions (Figure 5c), suggesting that miR-382 regulates the AKT/mTOR signaling pathway by targeting PTEN under hypoxic conditions. [score:6]
We found that MKN1 cells overexpressing miR-382 oligomers exhibited significantly less luciferase activity than cells transfected with control miR (Figure 4e), suggesting that PTEN expression was regulated by miR-382. [score:6]
Therefore, taken together with our results and recent findings from other groups, chemotherapeutic efficacy for gastric cancer can be increased by the inhibition of the AKT/mTOR pathway (50), and cancer progression and metastasis through increased angiogenesis through miR-382 (Figures 3 and 6) can be inhibited by PTEN or antagomiR-382 in hypoxic gastric cancer. [score:5]
As HIF-1α is also synthesized by PI3K/AKT/mTOR pathway in hypoxia-independent mechanism (36), inhibition of miR382 can increase PTEN level, which inhibits the PI3K/AKT/mTOR pathway and in turn decrease HIF-1α. [score:5]
Controlled expression of miR-382 modulated in vitro angiogenesisNext, we tested whether the inhibition of miR-382 blocked hypoxia -induced angiogenesis. [score:5]
Here, we suggest that VEGF is involved in miR-382 -induced angiogenesis because VEGF secretion by hypoxia was reduced by antagomiR-382 and recovered by PTEN siRNA, and because PTEN overexpression suppressed miR-382 -induced VEGF secretion (Figure 6c and d). [score:5]
In addition, the overexpression of miR-382 dose -dependently decreased PTEN protein levels but not its mRNA expression (Figure 4b). [score:5]
Figure 3. Inhibition of miR-382 suppressed hypoxia -induced angiogenesis. [score:5]
Additionally, dose -dependent inhibition of miR-382 by antagomiR recovered PTEN expression under hypoxic conditions (Figure 4c). [score:5]
In the present study, miR-382 was found to be associated with tumor growth by increasing angiogenesis in vivo and in vitro and by decreasing the expression of PTEN (a tumor suppressor). [score:5]
When PTEN was co-expressed with miR-382, the miR-382 -induced activities of AKT, mTOR and p70S6K were significantly inhibited (Figure 5b). [score:5]
As PTEN is an inhibitor of the PI3K/AKT/mTOR signaling pathway and hypoxia increases miR-382, if PTEN is a real target of miR-382, the PI3K/AKT/mTOR signaling pathway might be increased by hypoxia or miR-382 synthetic oligomers. [score:5]
AntagomiR-382 successfully inhibited miR-382 expression hypoxic conditions (Figure 3a). [score:5]
In the present study, miR-382 was found to target PTEN directly by binding to its 3′-UTR region and to function as an oncogene and an angiogenic inducer under hypoxic conditions. [score:4]
These results show that HIF-1α is essential for the regulation of miR-382 expression. [score:4]
These results suggest that PTEN is regulated by miR-382 and that it might be a target of miR-382. [score:4]
These results suggest that miR-382 is a crucial regulator of tumor angiogenesis via VEGF under hypoxic conditions, and it achieves this by targeting PTEN. [score:4]
Figure 2. miR-382 expression was regulated by HIF-1α. [score:4]
The CAM assay also demonstrated that PTEN significantly suppressed miR-382 -induced in vivo angiogenesis to a degree similar to that induced by antagomiR-382, under hypoxic conditions (Figure 6b), indicating that miR-382 induces angiogenesis by targeting PTEN under hypoxic conditions. [score:4]
Accordingly, elevated miR-382 expression may be a tumor-specific marker in different cancer cells. [score:3]
PTEN is a target of miR-382. [score:3]
Figure 4. Identification of PTEN as a target of miR-382. [score:3]
Next, we tested whether the inhibition of miR-382 blocked hypoxia -induced angiogenesis. [score:3]
HIF-1α was involved in miR-382 expression. [score:3]
To determine whether miR-382 -induced angiogenesis was associated with tumor growth, we prepared MKN1 gastric cancer cells stably expressing antagomiR-382. [score:3]
Hypoxia and miR-382 were found to induce VEGF to similar extents, whereas antagomiR-382 inhibited hypoxia -induced VEGF secretion (Figure 6c). [score:3]
MKN1 cells transfected with miR-382 cloned plasmid (pENTR™/H1/TO vector) or PNA™ miR-382 inhibitor (antagomiR-382) and cultured under hypoxic or normoxic conditions were harvested with a lysis buffer (iNtRon Biotech, South Korea), and equal amounts of protein were subjected to SDS-PAGE. [score:3]
Furthermore, the overexpression of PTEN significantly reduced miR-382 -induced VEGF secretion (Figure 6c). [score:3]
In addition, algorithmic programs predicted that PTEN is targeted by miR-382, and in vitro and in vivo angiogenesis assays showed that PTEN is involved in miR-382-regulated angiogenesis under hypoxic conditions. [score:3]
Controlled expression of miR-382 modulated in vitro angiogenesis. [score:3]
However, from our findings and other reports, it appears that miR-382 is a strong oncomiR and hypoxamiR candidate, and that it is a potential therapeutic target and prognostic indicator in various types of cancer, especially in gastric cancer. [score:3]
These results suggest that the inhibition of miR-382 can block hypoxia -induced angiogenesis in vitro and in vivo. [score:3]
miR-382 overexpression and hypoxia significantly increased angiogenesis in matrigel inoculated under the CAM of chick embryos, whereas antagomiR-382 and hypoxia significantly decreased vessel formation (Figure 3e). [score:3]
This study shows that miR-382 modulates angiogenesis in highly proliferative tumors and under ischemic conditions by targeting PTEN. [score:3]
To modulate the expression of a novel angiogenic miR, miR-382, we used either a chemically modified antisense oligonucleotide (antagomiR) or synthetic miR-382 mimics. [score:3]
These results confirmed that PTEN is a real target of miR-382. [score:3]
PTEN inhibited miR382 -induced angiogenesis mediated by VEGF. [score:3]
As shown in Figure 6a, PTEN inhibited the miR-382 -induced tube formation of vascular ECs. [score:3]
However, the inhibition of miR-382 by antagomiR-382, under hypoxic conditions, restored the activities of AKT, mTOR and p70S6K (Figure 5a). [score:3]
Left panel shows miR-382 expression level in antagomiR-382-stable transfectants. [score:3]
PTEN was identified by all three programs, and therefore, was as a candidate target of miR-382. [score:3]
Figure 6. miR-382 -induced angiogenesis was inhibited by PTEN. [score:3]
We next examined whether PTEN was a real target of miR-382. [score:3]
miR-382 also target superoxide dismutase 2 (SOD2) to mediate TGF-β1 -induced epithelial-mesenchymal transition (EMT) (41), which results in the acquisition of cell invasion and drug resistance, and reversion to cancer stem cells (42). [score:3]
Relative miR-382 expression levels were also confirmed by real-time qPCR. [score:3]
Kriegel A. J. Liu Y. Cohen B. Usa K. Liu Y. Liang M. MiR-382 targeting of kallikrein 5 contributes to renal inner medullary interstitial fibrosisPhysiol. [score:2]
These results suggest that miR-382 induced by hypoxia regulates PTEN and that VEGF is a real angiogenic mediator of miR-382 -induced angiogenesis under hypoxia. [score:2]
Mor E. Kano S. Colantuoni C. Sawa A. Navon R. Shomron N. MicroRNA-382 expression is elevated in the olfactory neuroepithelium of schizophrenia patientsNeurobiol. [score:2]
In the present study, knockdown of HIF-1α by siRNA clearly diminished miR-382 promoter reporter activity induced by hypoxia. [score:2]
To confirm the role of PTEN in miR-382 -induced angiogenesis, we utilized CM from miR-382 overexpressing cells for in vitro and in vivo angiogenesis assays. [score:2]
To further examine the regulation of miR-382 by HIF-1α under hypoxic conditions, we cloned the miR-382 promoter region (−4 kb) harboring two hypoxia responsive element (HRE) sequences into a luciferase reporter vector. [score:2]
Thus, we cloned two 3′-UTR regions of the PTEN mRNA matching the miR-382 sequences into pGL3 control vector downstream of the luciferase ORF. [score:1]
Given the role of hypoxia in angiogenesis, it might be expected that hypoxia -induced miR-382 plays a role in this event. [score:1]
miR-382 is one of the microRNAs in chromosome 14q32 locus and has been reported to be induced in the brain of the Rett syndrome mo del (39) and in the olfactory neuroepithelium of schizophrenia patients (40). [score:1]
However, transfection with the HIF-1α siRNA diminished hypoxia -induced miR-382 reporter activity (Figure 2c). [score:1]
miR-382 activated the AKT/mTOR signaling pathway. [score:1]
The stabilization of HIF-1α by hypoxia enhances miR-382 transcription by HIF-1 binding to the HRE site of miR-382 promoter (Figure 2). [score:1]
One harbored a 25-bp miR-382-matching sequence (starting from 21, ‘3UTR-1’) and the other, a downstream 23-bp sequence (starting from 956, ‘3UTR-2’) of the 3′-UTR region of PTEN mRNA. [score:1]
miR-382 or hypoxia activated AKT, mTOR and p70S6K. [score:1]
An overlapping target molecule for microRNA382 from these databases was PTEN and was considered for further experimental analysis. [score:1]
Figure 5. miR-382 activated the AKT/mTOR signaling pathway. [score:1]
Furthermore, because increased HIF-1α synthesis is mediated by the AKT/mTOR signaling pathway (36), an increase in the activity of this pathway by miR-382 might crucially increase angiogenesis by inducing VEGF via HIF-1α (Figure 5). [score:1]
The luciferase activity of miR-382 promoter was increased by hypoxia in MKN1 cells (Figure 2c). [score:1]
Thus, it appears that the increase of HIF-1 activity might be a first step in miR-382 -induced angiogenesis and oncogenesis. [score:1]
Two 3′-UTR regions of PTEN mRNA (369 or 244 bp) matching miR-382 sequences were synthesized by PCR and cloned into pGL3 control vector downstream of the luciferase open reading frame (ORF) after digestion with XbaI. [score:1]
Increasing reports indicate that microRNAs in the chromosomal region 14q32 may be associated with cancer progression and multi-drug resistance, but the role of individual miRs in 14q32 and miR-382 in cancer progression or other disease pathogenesis should be investigated further. [score:1]
Significance, *** P < 0.0001 versus the control, [#] P < 0.001 versus the miR-382 group. [score:1]
Comparison of miR-382 sequences in human, rhesus monkey, rat, horse and cow. [score:1]
The involvement of miR-382 has also been reported during leukemogenesis (46). [score:1]
After cloning the mature miR-382 into pENTR™/H1/TO vector (Invitrogen), MKN1 cells were transfected and conditioned media (CM) was obtained by culturing cells in serum free media for 24 h. BAECs (5 × 10 [3] cells/well) were seeded onto 48-well plates and allowed to attach for 24 h. The medium was then replaced with low serum medium (1% FBS in DMEM) for 20 h and treated with CM from MKN1 cells transfected with miR-382-cloned pENTR™/H1/TO vector or PNA™-antagomiR-382. [score:1]
[#] P < 0.05 versus miR-382 or antagomiR-382 group. [score:1]
We investigated the involvement of HIF-1α in miR-382 expression under hypoxia. [score:1]
Therefore, we selected miR-382 as a candidate miR in angiogenic function for further study. [score:1]
When we aligned the sequences of miR-382 with PTEN 3′-UTR sequences in various species, a highly conserved 3′-UTR region of the PTEN gene was found to match the miR-382 sequence (Figure 4d). [score:1]
However, the scarcity of miR-382 in angiogenesis research made us select miR-382 for our experiments. [score:1]
However, the roles of miR-382 have not been determined in relation to hypoxia, angiogenesis or cancer progression. [score:1]
There are two HRE sites within 4 kb upstream of the miR-382 transcription starting site. [score:1]
Cells were plated in six-well plates, cultured until 80–90% confluent, and transfected with miR-382 oligomers. [score:1]
To confirm this result, we prepared deletion mutants of miR-382-matching sequences in PTEN mRNA 3′-UTR regions (3UTR-m1 and 3UTR-m2, in Figure 4d). [score:1]
Sequence alignment of miR-382 with the PTEN 3′-UTR region is shown in the middle box. [score:1]
When MKN1 cells were transfected with pEGFP-HIF-1α, miR382-reporter activity was increased to the level of the hypoxia control. [score:1]
The promoter region of miR-382 (−4 kb) was synthesized and cloned into pGL3 vector upstream of the luciferase ORF. [score:1]
These findings suggest that increased VEGF by miR-382 might be mediated by increased HIF-1α synthesis. [score:1]
[1 to 20 of 93 sentences]
2
[+] score: 268
More importantly, co-transfection with miR-382 inhibitor and siRNA-PTEN (sequence-01 or -02) abolished the inhibitory effect of miR-382 inhibitor on hepatocyte proliferation and cell growth (Figure 5C-5F). [score:7]
B. qRT-PCRs showed that miR-382-5p was upregulated, while miR-504-3p, -3068-3p, -664-5p, and -5100 were downregulated in the mouse liver at PH-48h (n=5). [score:7]
Using PTEN siRNA and Akt activator/inhibitor, our data further provide key evidence indicating that Akt phosphorylation, at least in part associated with PTEN inhibition, is essential for miR-382 overexpression -induced hepatocyte proliferation and cell growth. [score:7]
For overexpression or suppression of miR-382, cells were transfected with miR-382 mimics (50 nM, RiboBio, China), miR-382 inhibitor (100 nM, Ribobio, China), or their negative controls for 48 hrs, respectively. [score:7]
Figure 7CCK-8 cell counting (n=10) A., EdU (green) cell proliferation assay (n=5) B., Ki67 (red) immunostaining (n=5) C., and flow cytometry (n=5) D. demonstrated that Akt activator (Akt-a) reversed miR-382 inhibitor (miR-382-i) -induced suppression of NCTC1469 cell proliferation and cell cycle progression, while Akt inhibitor (Akt-i) abolished miR-382 mimics (miR-382-m) -induced cell proliferation and cell growth. [score:6]
miR-382-m or miR-382-i. CCK-8 cell counting (n=10) A., EdU (green) cell proliferation assay (n=5) B., Ki67 (red) immunostaining (n=5) C., and flow cytometry (n=5) D. demonstrated that Akt activator (Akt-a) reversed miR-382 inhibitor (miR-382-i) -induced suppression of NCTC1469 cell proliferation and cell cycle progression, while Akt inhibitor (Akt-i) abolished miR-382 mimics (miR-382-m) -induced cell proliferation and cell growth. [score:6]
We further found that miR-382 overexpression increased Akt phosphorylation in NCTC1469 cells, while miR-382 downregulation showed inverse effect (Figure 4A and 4B). [score:6]
We further found that miR-382 overexpression was associated with a reduced cell population in G1 phase and an increased cell population in S phase using flow cytometry, indicating that miR-382 promoted the transition of NCTC1469 cell population from G1 phase to S phase of the cell cycle, while miR-382 downregulation had inverse effect (Figure 2E). [score:6]
miR-382 overexpression negatively correlates with PTEN protein level and parallels with increased Akt phosphorylation both in vitro and in vivoPTEN has previously been confirmed as a direct target of miR-382 in HIF-1α-stimulated vascular endothelial cells [25]. [score:6]
Noteworthy, miR-382-5p (previous IDs: miR-382) overexpression or suppression was found to be effective to modify hepatocyte proliferation (for detail see following results). [score:5]
Our data show that miR-382 overexpression increases cell proliferation and induces a G1 to S phase transition of the cell cycle in both mouse NCTC1469 and human HL7702 liver cells, while miR-382 inhibition exhibits inverse effects, indicating miR-382 as a promoter for hepatocyte proliferation and cell cycle progression that might contribute to liver regeneration at proliferative stage. [score:5]
Additionally, miR-382 overexpression negatively correlated with PTEN expression at post transcriptional level both in vivo and in vitro. [score:5]
Here we demonstrated that miR-382 mimics reduced, while miR-382 inhibitor increased PTEN expression at protein level in NCTC1469 liver cells (Figure 4A and 4B). [score:5]
In conclusion, the present study shows an induction of miR-382 in the mouse liver during the proliferative phase of liver regeneration, and further demonstrates that miR-382 overexpression promotes hepatocyte proliferation and cell growth via targeting PTEN-Akt axis. [score:5]
We further confirm that PTEN inhibition and Akt phosphorylation are required for miR-382 overexpression -induced hepatocyte proliferation and cell cycle progression. [score:5]
Here we showed that miR-382 mimics or Akt activator enhanced, while miR-382 inhibitor or Akt inhibitor reduced the proliferation of NCTC1469 liver cells (Figure 7A-7C). [score:5]
Using PTEN siRNA and Akt activator/inhibitor, we further confirmed that PTEN inhibition and Akt phosphorylation were essential for mediating the promotive effect of miR-382 in hepatocyte proliferation and cell growth. [score:5]
Noteworthy, co-treatment with miR-382 mimics and Akt inhibitor significantly abolished miR-382 overexpression -induced hepatocyte proliferation and cell growth (Figure 7A-7D). [score:5]
MiR-382 mimics increased, while miR-382 inhibitor reduced miR-382 level in NCTC1469 and HL7702 liver cells, confirming that these mimics and inhibitor took effects (Figures 2A and 3A). [score:5]
Meanwhile, miR-382 mimics or Akt activator induced a G1 to S phase transition of NCTC1469 cells, while miR-382 inhibitor or Akt inhibitor caused a G1 phase arrest (Figure 7D). [score:5]
Furthermore, we demonstrate that miR-382 negatively regulates PTEN expression and increases Akt phosphorylation in cultivated hepatocytes. [score:4]
CCK-8 cell counting (n=10) C., EdU (green) cell proliferation assay (n=5) D., and Ki67 (red) immunostaining (n=5) E. demonstrated that siRNA-PTEN (sequence-01 or -02) reversed the suppressive effect of miR-382 inhibitor (miR-382-i) on the proliferation of NCTC1469 cells. [score:4]
PTEN has previously been confirmed as a direct target of miR-382 in HIF-1α-stimulated vascular endothelial cells [25]. [score:4]
First, as multiple secreted and soluble factors, such as tumor necrosis factor (TNF), interleukin-6 (IL-6), hepatocyte growth factor (HGF), epidermal growth factor (EGF) and transforming growth factor-α (TGF-α), are responsible for initiating and promoting the liver regeneration process [43], it will be of interest to examine whether miR-382 upregulation during liver regeneration is related to these factors. [score:4]
The upregulation of miR-382 during the proliferative phase of liver regeneration is intriguing. [score:4]
PTEN, has previously been identified as a direct target gene of miR-382 contributing to hypoxia -induced angiogenesis [25]. [score:4]
The overexpression of miR-382 may be considered as a prospective novel therapeutic target to improve liver regeneration. [score:4]
miR-382 is upregulated in mouse regenerating liver. [score:4]
Moreover, miR-382 negatively regulates PTEN expression and increases Akt phosphorylation both in vitro and in vivo. [score:4]
Figure 3 A. qRT-PCR analysis for miR-382 level in HL7702 cells transfected with miR-382 mimics (miR-382-m), miR-382 inhibitor (miR-382-i), or their respective negative controls (nc-m or nc-i) (n=5). [score:3]
E. Flow cytometry showed that miR-382 mimics induced a G1 to S phase transition of the cell cycle of NCTC1469 cells, while miR-382 inhibitor had inverse effect (n=5). [score:3]
Figure 4miR-382 negatively correlates with PTEN expression at protein level both in vitro and in vivo A. for PTEN, p-AKT, and total AKT in NCTC1469 cells transfected with miR-382 mimics (miR-382-m) or negative control (nc-m) (n=3). [score:3]
On the other hand, miR-382 has been identified as metastasis-suppressive miRNA in melanoma [33]. [score:3]
F. Flow cytometry showed that miR-382 inhibitor -induced G1 phase arrest of NCTC1469 cells was significantly abolished by siRNA-PTEN (sequence-01 or -02) (n=5). [score:3]
miR-382 promotes hepatocyte proliferation and cell growth via targeting PTEN. [score:3]
Akt activation is involved in miR-382 overexpression -induced hepatocyte proliferation. [score:3]
siRNA-PTEN reverses miR-382 inhibition -induced NCTC1469 cell growth arrest. [score:3]
Thus, the present study identifies miR-382 as a promoter for hepatocyte proliferation and cell growth via targeting PTEN-Akt axis. [score:3]
Meanwhile, miR-382 inhibitor caused a G1 phase arrest in NCTC1469 cells, while siRNA-PTEN-01 or -02 induced a transition of the cell population from G1 to S phase (Figure 5F). [score:3]
A. qRT-PCR analysis for miR-382 level in HL7702 cells transfected with miR-382 mimics (miR-382-m), miR-382 inhibitor (miR-382-i), or their respective negative controls (nc-m or nc-i) (n=5). [score:3]
A. qRT-PCR analysis for miR-382 level in NCTC1469 cells transfected with miR-382 mimics (miR-382-m), miR-382 inhibitor (miR-382-i), or their respective negative controls (nc-m or nc-i) (n=5). [score:3]
The total Akt protein level was found unchanged in NCTC1469 cells either with miR-382 mimics or inhibitor transfection (Figure 4A and 4B). [score:3]
Figure 2 A. qRT-PCR analysis for miR-382 level in NCTC1469 cells transfected with miR-382 mimics (miR-382-m), miR-382 inhibitor (miR-382-i), or their respective negative controls (nc-m or nc-i) (n=5). [score:3]
Collectively, these data indicate that miR-382 is a promoter for hepatocyte proliferation and liver regeneration via targeting PTEN-Akt axis. [score:3]
These data indicate a potential relationship between miR-382 overexpression and the PTEN/Akt signaling pathway during the proliferative phase of liver regeneration that might contribute to the cell growth and proliferation of hepatocytes. [score:3]
E. Flow cytometry showed that miR-382 mimics induced a G1 to S phase transition of the cell cycle of HL7702 cells, while miR-382 inhibitor had inverse effect (n=5). [score:3]
B. for PTEN, p-AKT, and total AKT in NCTC1469 cells transfected with miR-382 inhibitor (miR-382-i) or negative control (nc-i) (n=3). [score:3]
Akt activation is required for miR-382 overexpression -induced hepatocyte proliferation. [score:3]
miR-382 negatively correlates with PTEN expression at protein level both in vitro and in vivo. [score:3]
Also, Akt activator could reverse miR-382 inhibition -induced NCTC1469 cell growth arrest (Figure 7A-7D). [score:3]
miR-382 overexpression promotes hepatocyte proliferation and G1/S phase transition of the cell cycle in vitro. [score:3]
Also, miR-382 inhibits tumor growth and metastasis in osteosarcoma [34, 35]. [score:3]
miR-382 overexpression negatively correlates with PTEN protein level and parallels with increased Akt phosphorylation both in vitro and in vivo. [score:3]
These data suggest that the promotive effect of miR-382 on hepatocyte proliferation and cell growth is closely related to PTEN inhibition. [score:3]
Next, qRT-PCRs were further conducted, verifying that the expression of miR-382-5p was significantly increased, while miR-3068-3p, -664-5p, and -5100 decreased in the mouse liver at PH-48h (Figure 1B). [score:3]
miR-382-m or miR-382-i. Liver regeneration after PH is principally mediated by the proliferation of hepatocytes which can be impacted by dysregulated miRNAs, though the underlying molecular mechanisms are still largely unclear. [score:2]
However, whether the PTEN/Akt axis is regulated by miR-382 in hepatocytes is unknown. [score:2]
CCK-8 cell counting, EdU cell proliferation assay, and Ki67 immunostaining showed that NCTC1469 cell proliferation was reduced by miR-382 inhibitor, while increased by siRNA-PTEN-01 or -02 (Figure 5C-5E). [score:2]
CCK-8 cell counting, EdU cell proliferation assay, and Ki67 immunostaining showed that miR-382 mimics promoted, while miR-382 inhibitor reduced the proliferation of NCTC1469 liver cells (Figure 2B-2D). [score:2]
CCK-8 cell counting (n=10) B., EdU (green) cell proliferation assay (n=5) C., and Ki67 (red) immunostaining (n=5) D. demonstrated that miR-382 mimics promoted while miR-382 inhibitor reduced NCTC1469 cell proliferation. [score:2]
CCK-8 cell counting (n=10) B., EdU (green) cell proliferation assay (n=5) C., and Ki67 (red) immunostaining (n=5) D. demonstrated that miR-382 mimics promoted while miR-382 inhibitor reduced HL7702 cell proliferation. [score:2]
As certain cyclins such as cyclin D1 and cyclin E are key regulators for G1/S phase transition, further study is needed to examine the molecular mechanisms by which miR-382 impacts the proliferation and cell cycle progression of hepatocytes [36- 39]. [score:2]
Transfection with miR-382 mimics or siRNA-PTEN (sequence-01 or -02) alone also induced a transition of cell population from G1 to S phase in NCTC1469 cells (Figure 6D). [score:1]
miR-382-i. To further examine to which extent PTEN modulation mediates the role of miR-382 on hepatocyte proliferation, miR-382 mimics and siRNA-PTEN were co -transfected to NCTC1469 liver cells. [score:1]
miR-382-i. To further examine to which extent PTEN modulation mediates the role of miR-382 on hepatocyte proliferation, miR-382 mimics and siRNA-PTEN were co -transfected to NCTC1469 liver cells. [score:1]
miR-382-m or miR-382-i. Our group has previously demonstrated that hepatocyte proliferation peaked at 48 hrs after PH in the mouse liver as represented by a peak of PCNA protein level and EdU positive cells [4]. [score:1]
Thus, the biological functions of miR-382 are tissue and cell dependent. [score:1]
miR-382 promotes hepatocyte proliferation and cell growth in vitroTo investigate the effects of miR-382 on the cell growth and proliferation of hepatocytes, miR-382 mimics, inhibitor, or their negative controls were transfected to mouse NCTC1469 and human HL7702 normal liver cells, respectively. [score:1]
miR-382-m or miR-382-i; ##, P<0.01 vs. [score:1]
miR-382 promotes the proliferation and cell growth of mouse NCTC1469 liver cells. [score:1]
A. for PTEN, p-AKT, and total AKT in NCTC1469 cells transfected with miR-382 mimics (miR-382-m) or negative control (nc-m) (n=3). [score:1]
To investigate the effects of miR-382 on the cell growth and proliferation of hepatocytes, miR-382 mimics, inhibitor, or their negative controls were transfected to mouse NCTC1469 and human HL7702 normal liver cells, respectively. [score:1]
These data, together with the results of PTEN, fully support that the PTEN/Akt signaling pathway is a downstream mechanism mediating the role of miR-382 in hepatocyte proliferation and cell growth. [score:1]
Thus, miR-382 is validated as a promoter for cell growth and proliferation of hepatocytes in vitro. [score:1]
Indeed, it will be highly needed to further examine the in vivo effect of miR-382 in liver regeneration in the future. [score:1]
Meanwhile, the promotive effect of miR-382 in the proliferation and cell growth of hepatocytes were also found in human HL7702 liver cells (Figure 3B-3E). [score:1]
Our data showed that miR-382 could promote hepatocyte proliferation and cell growth in vitro. [score:1]
miR-382 promotes hepatocyte proliferation and cell growth in vitro. [score:1]
However, co-transfection with miR-382 mimics and siRNA-PTEN did not further enhance the proliferation or cell growth of hepatocytes (Figure 6A-6D). [score:1]
Previously, miR-382 induced by HIF-1α has been identified as an angiogenic miRNA in vascular endothelial cells [25]. [score:1]
miR-382-i; ##, P<0.01 vs. [score:1]
miR-382 promotes the proliferation and cell growth of human HL7702 liver cells. [score:1]
In the current study, we found a marked induction of miR-382 in the mouse liver at 48 hrs after 70% PH. [score:1]
D. Flow cytometry showed that siRNA-PTEN (sequence-01 or -02) did not further enhance the miR-382 mimics -induced G1 to S phase transition of the cell cycle of NCTC1469 cells (n=5). [score:1]
siRNA-PTEN does not further enhance the promotive effect of miR-382 on the proliferation and cell growth of NCTC1469 cells. [score:1]
Besides that, increased serum miR-382 has been suggested to be a potential biomarker for breast cancer [32]. [score:1]
In this study, we found a significant elevation of miR-382 in the mouse liver at 48 hrs after 70% PH using microarrays and quantitative reverse transcription-polymerase chain reactions (qRT-PCRs). [score:1]
As PTEN is an inhibitor for Akt phosphorylation, we further investigated whether Akt contributes to the promotive effect of miR-382 on hepatocyte proliferation and cell growth. [score:1]
miR-382, one of the miRNA located in chromosome 14q32 locus, has been reported to be involved in angiogenesis as well as in cancer growth and invasion [25, 28- 31]. [score:1]
[1 to 20 of 89 sentences]
3
[+] score: 213
Other miRNAs from this paper: hsa-mir-21, mmu-mir-21a, mmu-mir-382, mmu-mir-21b, mmu-mir-21c
Inhibiting the expression of miR-382 with anti-miR-382 led to an increased expression of Trx, as well as a decreased expression of 3-NT in UUO mice. [score:9]
LNA-anti-miR-382 treatment (10 mg/kg) significantly reversed the downregulation of Trx and suppressed the expression of 3-NT in mice subjected to UUO (10 mg/kg anti-382 group versus anti-NC group, Trx: 0.43 ± 0.13 versus 0.20 ± 0.06, P < 0.05; 3-NT: 2.11 ± 0.27 versus 4.52 ± 0.16, P < 0.05). [score:8]
Anti-miR-382 oligo treatment inhibited the upregulation of miR-382 and reversed the decrease of HSPD1 expression induced by TGF- β1 in cultured HK2 cells (Figure 3(b)). [score:8]
Treatment with anti-miR-382 oligos significantly reversed TGF- β1 -induced suppression of E-cadherin expression and augmentation of α-SMA expression [5]. [score:7]
The current study suggests that upregulation of miR-382, which targets antioxidative stress genes and HSPD1, may partially contribute to the development of renal tubulointerstitial fibrosis. [score:7]
Meanwhile, the downregulation of Trx or the upregulation of Bax secondary to UUO was partially reversed after anti-miR-382 treatment but not reversed with anti-miR-382 treatment combined with HSPD1 siRNA treatment (Figures 9(b), 9(c), and 9(e)). [score:7]
The inverse relationship between miR-382 expression and renal expression of HSPD1 also exists in the obstructed kidneys of UUO mice as well as in patients with chronic kidney disease. [score:7]
Renal histological analysis showed that blocking the expression of miR-382 could attenuate renal interstitial fibrosis (Figures 1(a), 1(c), and 1(d)) and the immunohistochemical staining indicated that the upregulation of α-SMA and Vimentin was partially reversed in obstructed kidneys after 10 mg/kg anti-miR-382 treatment (Figures 1(e) and 1(f)). [score:6]
The antioxidative capacity of renal tissue declined when HSPD1 expression was downregulated, which suggested that excessive oxidative stress may be an important mechanism whereby miR-382 participates in renal fibrosis. [score:6]
Anti-miR-382 treatment with a dosage of 10 mg/kg suppressed the downregulation of HSPD1 in UUO mice (Figure 4). [score:6]
Overexpression of miR-382 Reduces the Antioxidant Capacity of Renal Tissues by Downregulating HSPD1. [score:6]
Similarly, HSPD1 expression was upregulated and TIF in the obstructed kidneys was alleviated after LNA-anti-miR-382 (10 mg/kg) treatment. [score:6]
Her study revealed that the upregulation of miR-382 contributed to the inner medullary interstitial fibrosis in mice, partially mediated by targeting of KLK5 [30]. [score:6]
In our previous study, the abundance of miR-382 in HK2 cells was upregulated with the development of EMT induced by TGF- β1. [score:5]
Treatment with 10mg/kg dosage of anti-miR-382 suppressed the expression of Vimentin in UUO mice, but not with the dosage of 20mg/kg. [score:5]
In vitro experiments revealed that the mRNA expression of HSPD1 was significantly suppressed by pre-miR-382 in HK2 cells, whereas anti-miR-382 treatment significantly reversed the decrease of HSPD1 mRNA. [score:5]
In this study, we found that transfecting HK2 cells with pre-miR-382 significantly suppressed the protein expression of HSPD1 (pre-382 versus pre-NC, 0.60 ± 0.04 versus 1.00 ± 0.04, resp. [score:5]
Treatment with 10mg/kg anti-miR-382 suppressed the expression of α-SMA in obstructed kidneys but not with the dosage of 20mg/kg. [score:5]
Intravenous injection of LNA-anti-miR-382 oligonucleotides (10 mg/kg) significantly alleviated the pathological damage in the obstructed kidneys and suppressed the protein expression of Vimentin and α-SMA. [score:5]
Owing to only a subset of target genes of a miRNA being expressed in a tissue, limited tissue-specific functional roles of the miR-382 can be expected. [score:5]
Mutations introduced into the predicted binding site of miR-382 within the 3′-UTR of HSPD1 prevented the suppression of HSPD1 by pre-miR-382 (Figure 3(c)). [score:4]
In the anti-miR-382 group, the expression of miR-382 was significantly suppressed by 10 mg/kg LNA-anti-miR-382 treatment compared with the antiscrambled (10 mg/kg anti-382 versus antiscrambled, 1.95 ± 0.33 versus 3.98 ± 0.54, resp. [score:4]
Fluorescence immunoblotting test showed that the downregulation of 3-NT secondary to anti-miR-382 treatment was blocked by HSPD1 siRNA (Figures 9(f) and 9(h)). [score:4]
Therefore, HSPD1 serves as one of the target genes of miR-382, which was further verified by site-directed mutagenesis. [score:4]
In addition, in vivo study found that the renal protective effects of miR-382 blockade against fibrosis, apoptosis, and redox imbalance of the obstructed kidneys were abolished by renal knockdown of HSPD1, which further proved our hypothesis that miR-382 might contribute to renal interstitial fibrosis by oxidative stress -induced apoptosis secondary to the inhibition of HSPD1. [score:4]
As excessive oxidative stress contribute to the development of TIF, therefore, inhibiting the antioxidative capacity of renal tissue may be one of the important mechanisms in which miR-382 promotes renal tubular interstitial fibrosis. [score:4]
Besides ECM genes, a cluster of mitochondrial proteins including HSPD1 was identified as new predicted target genes of miR-382, suggesting that the contribution of miR-382 in the development of TIF could be mediated by pathways of different mechanisms [5]. [score:4]
Recently, Xu et al. reported miR-382 as an inhibitor of metastasis and EMT in osteosarcoma, which was contradictory to our results from renal tissue [27]. [score:3]
Expression levels of miR-382 were quantified by real-time reverse transcription-PCR with the TaqMan chemistry (Applied Biosystems) as previously described [5, 13]. [score:3]
Kriegel AJ, a member of our research group, had demonstrated that Kalliken5 (KLK5), a (chymo) trypsin-like proteinase that mediates degradation of many extracellular matrix proteins, was a target of miR-382 in the mouse UUO mo del. [score:3]
In IgAN patients with TIF, miR-382 abundance was significantly upregulated compared to that in IgAN patients with no TIF (5.59 ± 0.79 versus 1.00 ± 0.23, P < 0.01, Figure 5(c)). [score:3]
Identification of HSPD1 as a New Target of miR-382. [score:3]
We also found that anti-miR-382 treatment alone could, to some extent, induce HSPD1 expression independently of TGF- β1. [score:3]
Since enhanced oxidative stress or redox imbalance has been proved to correlate with renal dysfunction [10, 11], miR-382 or HSPD1 might potentially serve as a new target for therapy in advanced CKD. [score:3]
Tubulointerstitial fibrosis developed after 7 days of UUO in the obstructed kidneys (Figure 1(a)), and the expression of miR-382 was higher in the UUO group (UUO versus control, 4.32 ± 0.45 versus 1.00 ± 0.13, resp. [score:3]
Proteomic and bioinformatic analyses revealed that heat shock protein 60 (HSPD60, HSPD1) was a target gene of miR-382 [5]. [score:3]
Expression of miR-382 was detected by in situ hybridization (ISH), following the protocol of “One-day microRNA ISH” suggested by Exiqon. [score:3]
According to our previously published data, we found that miR-382 targeted a cluster of oxidative-related genes including HSPD1 [5]. [score:3]
We proved that miR-382 -targeted HSPD1 participated in the setting of renal tubulointerstitial fibrosis. [score:3]
Primers used for introducing point mutations for HSPD1 were as follows: forward primer, 5- CAAGGCAGTGTTCCTCACCAATA gaTTCAGAGAAGACAGTTG -3; reverse primer, 5- CAACTGTCTTCTCTGAA tcTATTGGTGAGGAACACTGCCTTG -3. Underlined nucleotides represent the mutations introduced, and these nucleotides are located in the core region of the predicted target site for miR-382. [score:2]
Fibrosis quantification from Sirius red-stained tissues indicated that anti-miR-382 -treated mice with renal knockdown of HSPD1 were not protected from developing tubulointerstitial fibrosis (Figures 9(f) and 9(g)). [score:2]
In this study, we explored the role of miR-382 in the development of renal fibrosis and its possible mechanism. [score:2]
Therefore, the goals of this study mainly were to verify the complementary relationship between miR-382 and HSPD1, as well as to further explore the role of miR-382 in the development of renal tubulointerstitial fibrosis. [score:2]
It is possible that miR-382 may serve as either the downstream of TGF- β1 or being in parallel to TGF- β1. [score:1]
In our in vivo animal study, mice that underwent UUO were treated with either anti-miR-382 or antiscrambled control. [score:1]
Therefore, the role of miR-382 could be different in different subtypes of EMT [22]. [score:1]
3.1. miR-382 Contributes to the Progression of Renal Tubulointerstitial Fibrosis in UUO Mice. [score:1]
More work is needed to examine, and miR-382 is a potential therapeutic candidate for prevention or treatment of renal tubulointerstitial fibrosis in combination with others. [score:1]
Briefly, HeLa cells (80–90% confluency) were cotransfected with the following: a 3′-UTR reporter construct (100 ng per well), a pRL-TK internal control plasmid (50 ng per well), and control pre-miR-382 oligonucleotides (10 pmol per well, from Ambion). [score:1]
Pre-miR-382 or anti-miR-382 oligonucleotides were obtained from Ambion. [score:1]
Locked nucleic acid- (LNA-) modified anti-miR-382 oligonucleotides antiscrambled (Exiqon) were diluted in saline (5 mg/ml) and intravenously delivered via tail vein (10 mg/kg) within 30 mins prior to UUO, and the dosage was repeated 24 hours after the surgery. [score:1]
Besides, anti-miR382 treatment also attenuated renal injury with less increased serum creatinine (Figure 1(f)) and blocked inflammatory cell infiltration in the obstructed kidney (Figure 2). [score:1]
There also existed an inverse relationship between HSPD1 and miR-382 abundance. [score:1]
Cotransfection with pre-miR-382 to the HeLa cells reduced the luciferase activity significantly. [score:1]
Renal HSPD1 Mediates the Protective Effects of miR-382 Blockade against Renal Tubulointerstitial Fibrosis. [score:1]
Locked nucleic acid- (LNA-) modified anti-miR-382 (10 mg/kg) was delivered by tail vein injection 30 min prior to UUO, and the dosage was repeated 24 h after the surgery. [score:1]
In the mouse UUO mo del, we found that the progression of TIF was accompanied with an increased abundance of miR-382 in the obstructed kidneys. [score:1]
Besides, the endogenous abundance of miR-382 in HK2 cells should be taken into account. [score:1]
The interaction between miR-382 and HSPD1 was also observed in a clinical study. [score:1]
2.8. miR-382 In Situ Hybridization. [score:1]
[1 to 20 of 60 sentences]
4
[+] score: 88
Other miRNAs from this paper: hsa-mir-134, hsa-mir-154, hsa-mir-379, hsa-mir-544a, hsa-mir-544b
We conclude that downregulation of 14q32 miRNA expression is an evolutionarily conserved mechanism that contributes to the biological behavior of osteosarcoma, and that quantification of representative transcripts from this family, such as miR-382, miR-134, and miR-544, provide prognostic and predictive markers that can assist in the management of patients with this disease. [score:8]
Because metastasis genes are enriched in miR-382 correlated gene signature in canine osteosarcoma and miR-382 expression levels showed potential prognostic significance (ability to predict poor outcome) in the canine osteosarcoma cohort, we tested whether expression levels of 14q32 miRNAs in human showed similar association with outcomes. [score:5]
Dogs in which miR-382 -positively correlated mRNAs were expressed at lower levels and in which miR-382 -negatively correlated mRNAs were expressed at higher levels had significantly shorter survival times than the other group of dogs. [score:5]
The mRNA expression data were composed of human tumors and normal bone samples which had been previously profiled for miRNA expression levels, allowing us to directly calculate Pearson correlation coefficients between miR-382 and mRNA transcript levels. [score:4]
Osteosarcoma samples were ranked based on expression levels of miR-382 from highest to lowest. [score:3]
Differentially expressed mRNA in osteosarcoma negativelly correlated to 14q32 encoded miR-382. [score:3]
Click here for file Differentially expressed mRNA in osteosarcoma positively correlated to 14q32 encoded miR-382. [score:3]
The heterogeneity in expression levels was seen in 14q32 locus miRNAs, and is specifically shown for two members at this locus: miR-382 and miR-154 (Figure  1C). [score:3]
Human osteosarcoma tumor samples that had the lowest levels of miR-382 were at higher risk for metastasis (p-value 0.01) and showed a trend for death (p-value 0.08) than patients with moderate miR-382 expression independently confirming the observation that 14q32 miRNAs are a potential prognostic tool for osteosarcoma. [score:3]
Directional Functional enrichment analyses (Ingenuity Pathways Analyses) shows that correlating transcripts are enriched in transcripts involved in metastasis, and direction of change is consistent with increased activity of metastatic function in tumors with decreased levels of 14q32 miRNA member, miR-382. [score:3]
Here we show that an inverse correlation exists between aggressive tumor behavior (increased metastatic potential and accelerated time to death) and the residual expression of 14q32 miRNAs (using miR-382 as a representative of 14q32 miRNAs) in a series of clinically annotated samples from human osteosarcoma patients. [score:3]
The results of this analysis in human osteosarcoma samples uncovered 288 and 97 genes that were positively (Additional file 6: Table S5) and negatively (Additional file 7: Table S6) correlated, respectively, to miR-382 expression (R [2] > 0.7). [score:3]
Differentially expressed mRNA in osteosarcoma positively correlated to 14q32 encoded miR-382. [score:3]
Patients with lowest levels of miR-382 expression showed decreased likelihood of survival. [score:3]
Since all the tested 14q32 miRNAs expression levels were highly correlated on a sample-by-sample basis, we selected miR-382, as a representative of 14q32 miRNAs. [score:3]
Click here for file Differentially expressed mRNA in osteosarcoma negativelly correlated to 14q32 encoded miR-382. [score:3]
Taken together, these results suggest that the level of miR-382 may have prognostic utility for predicting the likelihood of developing metastatic tumors and disease outcomes. [score:3]
The expression levels observed for miR-382 and miR-154 showed a high level of correlation (R [2] = 0.95), exemplary of the high correlations observed across the 14q32 miRNAs. [score:3]
We further noticed that there was a negative correlation between the levels of miR-382 expression and patient survival (Figure  3A and see Additional file 3: Table S3). [score:3]
Patients with lowest levels of miR-382 expression showed increased likelihood of metastasis. [score:3]
As a next step in comparative assessment, we mapped the human osteosarcoma genes that positively and negatively correlated with miRNA-382 (Figure  2A, direction of change marked in yellow and blue) to orthologous canine genes that were included in the Affymetrix canine 2.0 platform (Figure  2B). [score:2]
All of these 385 genes and their direction of change in relation to miR-382 are shown as a heatmap in Figure  2A. [score:2]
The yellow and blue bars represent correlations to miR-382 (positive = yellow or negative = blue) observed in the human data indicating that the direction of change shows similar trends between human and canine data. [score:2]
We further validated this by for both miR-382 and miR-154 for osteosarcoma tumors from this initial dataset. [score:1]
As we noticed in the first human osteosarcoma dataset, the lowest levels of miR-382 were found in primary osteosarcoma tumors from patients where metastases and/or death were later observed as follow-up. [score:1]
Further, to examine the prognostic utility of the 14q32 miRNA level, we split the cohort into two groups based on whether the miR-382 level was above the median value (Group 1) or below the median value (Group 2). [score:1]
miR-382 and miR-154 show a high level of correlation (R [2] = 0.95). [score:1]
Human genes that showed positive and negative correlation to miR-382 were mapped to canine genes using gene symbols. [score:1]
A positive correlation to miR-382 is shown in yellow (n = 288), and a negative correlation to miR-382 is shown in blue (n = 97), at the right of the heatmap. [score:1]
We also showed that the lowest levels of miR-382 were significantly associated with metastasis and significantly worse survival in a second independent set of human primary osteosarcoma tumors where full clinical follow-up information was available. [score:1]
In order to confirm that the results obtained by miRNA microarray for the magnitude of the 14q32 miRNA decreases were meaningful, we carried out for miR-382 and miR-154. [score:1]
To further examine the association between low 14q32 miRNA levels in osteosarcoma tumors and clinical outcomes, we tested a representative 14q32 miRNA (miR-382) in an independent set of primary tumor samples from 16 human osteosarcoma patients that had more robust clinical follow-up annotation (Additional file 3: Table S3). [score:1]
miR-382 and miR-154 show a high level of correlation (R [2] = 0.99). [score:1]
This result shows that genes that correlate with miR-382 are capable of showing survival trends in dogs with osteosarcoma that are consistent with our hypothesis in humans, thus independently supporting a prognostic role for the 14q32 miRNA transcript level in osteosarcoma. [score:1]
We then determined mRNA that positively and negatively correlated to miR-382. [score:1]
[1 to 20 of 35 sentences]
5
[+] score: 55
GAPLINC Knockdown Upregulates miR-382-5p and miR-575 Expression in RA-FLSs. [score:7]
In addition, we verified some of candidate microRNAs and identified the silencing effects of GAPLINC upregulation on the expression of miR-382-5p and miR-575. [score:6]
Although GAPLINC inhibition induced a significant upregulation of miR-382-5p and miR-575 as compared with the control group, there were no statistically significant changes in miR-149-3p detection in two groups (Figure 5). [score:5]
The results, thus far, show GAPLINC induced suppression to be a significant upregulation mechanism of miR-382-5p and miR-575 as compared with control group. [score:5]
Since there were no statistically significant changes in miR-149-3p detection in two groups, it is likely that miR-382-5p and miR-575 may be the direct targets of GAPLINC. [score:4]
These results suggested that miR-382-5p and miR-575 may be the direct target of GAPLINC. [score:4]
Since the results of this analysis suggested that there may be a targeting relationship between GAPLINC and miR-149-3p, miR-382-5p and miR-575, the relative expression of these miRNAs between NC group and GAPLINC-siRNA groups was further measured by qRT-PCR. [score:3]
We further verified the expression of three microRNAs (hsa-miR-575, hsa-miR-149-3p, hsa-miR-382-5p) between NC and GAPLINC-siRNA groups using qRT-PCR. [score:3]
In this investigation, the expression of miR-382-5p and miR-575 had significant increases after GAPLINC suppression, suggesting GAPLINC may promote RA-FLS tumor-like behaviors in an miR-382-5p -dependent and miR-575 -dependent manner. [score:3]
The results suggest that there may be a targeting relationship between GAPLINC and miR-149-3p, miR-382-5p, or miR-575. [score:3]
Figure 5The verification of the target microRNAs of LncRNA GAPLINC (miR-149-3p, miR-382-5p, miR-575). [score:3]
A research group found that microRNA-382-5p aggravates breast cancer progression by regulating the RERG/Ras/ERK signaling axis. [score:2]
In this study, miR-382-5p was found to promoted breast cancer cell viability, clonogenicity, survival, migration, invasion, thereby, it was thought to be a oncomiR for the breast cancer cell (37). [score:1]
Based on these observations, miR-382-5p and miR-575 could be highly related to cell pathologic behaviors. [score:1]
Following a preliminary understanding of the GAPLINC-microRNA-mRNA network by the bioinformatics analysis, three candidate microRNAs (hsa-miR-575, hsa-miR-149-3p, hsa-miR-382-5p) were selected to make a binding site prediction with this methodology. [score:1]
We found 64 microRNAs may be the interactions of GAPLINC, including hsa-miR-575, hsa-miR-149-3p, hsa-miR-382-5p, hsa-miR-516a-3p, hsa-miR-1184, hsa-miR-1261, hsa-miR-3127-5p, hsa-miR-4649-3p, and so on. [score:1]
We selected six microRNAs as superior candidates (hsa-miR-575, hsa-miR-149-3p, hsa-miR-382-5p, hsa-miR-516a-3p, hsa-miR-1184, hsa-miR-1261) according to their comprehensive assessments and constructed a co-action network graph. [score:1]
Next, we selected top three candidate microRNAs (hsa-miR-575, hsa-miR-149-3p, hsa-miR-382-5p) to construct a binding site prediction. [score:1]
The microRNA intersections in three softwares suggested that 64 microRNAs (e. g., hsa-miR-575, hsa-miR-149-3p, hsa-miR-382-5p, hsa-miR-516a-3p, hsa-miR-1184, hsa-miR-1261, hsa-miR-3127-5p, hsa-miR-3127-5p, hsa-miR-4649-3p) could be highly related to GAPLINC, and therefore, could be selected as candidates (shown by Venn graph, Figure 4A). [score:1]
[1 to 20 of 19 sentences]
6
[+] score: 36
An interesting finding by Huang et al. suggested that a cluster of miRNAs (miR-28-5p, miR-125b-5p, miR-150-5p, miR-223-3p and miR-382-5p) have enriched expression in resting primary CD4+ T lymphocytes and have direct target sites on HIV-1 mRNA, thus leading to differential HIV-1 infectivity/resistance to different cells lying at varying developmental stages 11. [score:7]
One of the elite suppressors showed very low expression of miR-382-5p, but barring this case, no general conclusion could be drawn for the elite suppressors. [score:7]
LTNP individuals have down-regulated expression (Fig. 6A) of miR-382-5p compared to regular progressors (ART positive). [score:5]
We found that expression of miR-382-5p showed positive correlation with viral load amongst LTNPs (Fig. 5C). [score:3]
Our results indicate that reduced expression of miR-382-5p and miR-155-5p may be critical in establishing slow progression. [score:3]
Empirically, we found that average expression of two miRNAs, miR-382-5p and miR-155-5p can substantially distinguish LTNP individuals from regular progressors (Fig. 7E). [score:3]
When we compared the expression of the anti-HIV miRNAs among four patients classes (segregated into LTNPs, Regular, Rapid and Ambiguous), we found (Fig. 5A,B) miR-155-5p and miR-382-5p showed a significant (p < 0.05) down regulation in LTNPs when compared to Rapid/regular progressors. [score:2]
The fold repression, (at 2.5 fold) was highest when miR-382-5p expression is compared between LTNPs and Regular Progressors while miR-155-5p showed a 1.8 fold down regulation in LTNPs when separately compared to both regular and rapid progressors. [score:2]
Three LTNP samples (P06, P12 and P30, encircled in black) with very low viral loads (<150, 232 and 413 copies/ml) showed a strong repression of miR-382-5p. [score:1]
However, four miRNAs (miR-382-5p, miR-155-5p, miR-150-5p and miR-92a-3p) showed differences in a few patient subgroups. [score:1]
We propose that individuals with lower miR-382-5p are better at clearing the virus infected reservoir, thus in turn repressing the viral replication. [score:1]
Four miRNAs (miR-138-5p, miR-149-5p, miR-326, and miR-382-5p) show non-significant changes. [score:1]
[1 to 20 of 12 sentences]
7
[+] score: 29
The inhibition of miR-382 upregulated E-cadherin expression and altered the cellular phenotypes in diabetic kidneys [26, 29]. [score:8]
In cancer, miR-382 was shown to suppress osteosarcoma metastasis by targeting YB-1 oncogene [30, 31]. [score:5]
The regulatory roles of hsa-miR-382-5p in tendon biology remain unexplored and in our study, downregulation of hsa-miR-382-5p and was found to hold a strong correlation with increased ECM damage in Group 1 tendons suggesting its role in maintaining tendon ECM integrity. [score:5]
Superoxide dismutase 2 (SOD2) was identified to be one of the direct targets of miR-382 suggesting their protective role in oxidative stress. [score:4]
The microRNA hsa-miR-382-5p was found to regulate 10 genes associated with tendon matrisome and its major targets include MMP2, FOS, FOSL1. [score:4]
TGF-β1 -mediated induction of miR-382-5p in mouse kidneys was found to inhibit kallikrin-5 which is catalyzed by the degradation of ECM proteins [28]. [score:3]
[1 to 20 of 6 sentences]
8
[+] score: 23
The double-stranded oligonucleotides encoding the pre-miRNA sequences of miR-376a, miR-299, miR-382 or irrelevant miRNA (a miR -negative control, predicted not to target any known vertebrate gene) were cloned into the pcDNA6.2-GW/EmGFP-miR expression vector such that the pre-miRNA insertion site was in the 3′ untranslated (3′UTR) region of the green fluorescent protein (GFP) gene as per the instruction manual (Invitrogen, Carlsbad, CA). [score:7]
To determine whether the overexpression of the identified signature miRNAs could confer phenotypic changes, stable cell lines were created by cloning the pre-miRNA sequences of miR-376a, miR-376abc, miR-299, or miR-382 into the pcDNA6.2-GW/EmGFP-miR vector, which contains a green fluorescent protein (GFP) cassette, and introducing them into the non-tumorigenic 10-87 LP cells. [score:3]
As found for 10-87 HP cells and 10-87 T cells, SF-VERO cells and A4497 VERO cells expressed increased levels of miR-376a, miR-654-3p, miR-543, and miR-382 over the levels found in pAGMK cells (Table 4). [score:3]
No change in migration and invasion phenotypes was observed in cells expressing miR-382 or miR-299-5p. [score:3]
However, little or no migration was observed for cells expressing miR-299 or miR-382. [score:3]
In agreement with the wound-healing assay, over -expression of miR-376a or miR-376abc also resulted in more than a four-fold increase in invasiveness, whereas miR-299 or miR-382 had no effect (Fig. 4B). [score:2]
qRT-PCR analysis confirmed that miR-376a, miR-654-3p, miR-543, miR-382, miR-31, miR-200c, miR-218, and miR-183 paralleled the microarray miRNA levels. [score:1]
miR-299-5p sense, 5′- tgctGAAGAAATGGTTTACCGTCCCACATACATTTTGAATATGTATGTGGGATGGTAAACCGCTTCTT-3′ and miR-299-5p anti-sense 5′-cctgAAGAAGCGGTTTACCATCCCACATACATATTCAAAATGTATGTGGGACGGTAAACCATTTCTTC-3′, miR-382 sense 5′- tgctGTACTTGAAGAGAAGTTGTTCGTGGTGGATTCGCTTTACTTATGACGAATCATTCACGGACAACACTTTTTTCAGTA-3′ and miR-382 anti-sense 5′-cctgTACTGAAAAAAGTGTTGTCCGTGAATGATTCGTCATAAGTAAAGCGAATCCACCACGAACAACTTCTCTTCAAGTAC-3′. [score:1]
[1 to 20 of 8 sentences]
9
[+] score: 22
miRNAs Deregulated in OS Expression Levels Compared to the Controls Overall Function miR-382 Down-regulated Poor survival outcome and metastasis marker[70, 83] miR-154 Down-regulated Poor survival outcome[70] miR-33a Up-regulated Chemoresistance[84] miR-34c Down-regulated Chemoresistance[85] Most forms of human cancer have changes in the epigenome compared to the normal cellular counterparts from which they are derived. [score:14]
Xu M. Jin H. Xu C. X. Sun B. Song Z. G. Bi W. Z. Wang Y. miR-382 inhibits osteosarcoma metastasis and relapse by targeting Y box -binding protein 1 Mol. [score:5]
We confirmed that subset of these 50 miRNAs (miR-382, miR-369-5p, miR-544 and miR-134) could target the 3′ UTR of cMYC transcript. [score:3]
[1 to 20 of 3 sentences]
10
[+] score: 18
Given that more miRNAs increase than decrease in the circulation with acute liver injury it would require a highly selective process of altered clearance to explain the specific decrease in miR-382-5p and decreased tissue expression seems more plausible. [score:3]
Across all our human array studies and in mice mo dels miR-382-5p decreased in circulating concentration with liver injury. [score:1]
The mechanism of this circulating decrease of miR-382-5p is unknown, but conceptually could be either a decrease in production (such as reduced gene transcription in the injured liver) or increased clearance. [score:1]
The most abundant miRNA species in the liver 20, miR-122-5p, was the highest increased circulating miRNA but other species were elevated to comparable degrees (miR-885-5p, miR-151-3p) or were ranked higher by random forest analysis in terms of ability to report injury (miR-382-5p). [score:1]
The largest fold change miRNAs (miR-122-5p, miR-885-5p and miR-151-3p) and the best discriminating miRNA (miR-382-5p) were taken forward and tested for specificity. [score:1]
Cisplatin had no effect on miR-122-5p, miR-885-5p, miR-151a-3p or miR-382-5p (Fig. 5E–H). [score:1]
Figure (A– D) present circulating miR-122-5p, miR-885-5p, miR-151a-3p and miR-382-5p in APAP-no TOX patients and patients with acute liver injury (ALI) induced by APAP overdose or another aetiology (non-APAP). [score:1]
Figure (E– H) present miR-122-5p, miR-885-5p, miR-151a-3p and miR-382-5p in control mice, APAP overdose mice and cisplatin -induced acute kidney injury (AKI) mice. [score:1]
There was a group of patients with lower miR-30b-5p, miR-186-5p, miR-382-5p, miR-27a-3p, miR-15a-3p and miR15a-5p. [score:1]
miR-122-5p, miR-885-5p, miR-151-3p and miR-382-5p reported acute liver injury due to causes other than acetaminophen, which is consistent with them being liver specific and demonstrates that this panel has utility in the diagnosis of acute liver injury due to multiple causes. [score:1]
The 3 largest fold increase miRNAs (miR-122-5p, miR-885-5p and miR-151a-3p) and the miRNA with the lowest prediction error from the classifier mo del (miR-382-5p) were taken forward and tested for specificity and sensitivity. [score:1]
miR-885-5p, miR-151a-5p and miR-382-5p were inferior to ALT for early prediction of liver injury (Fig. 7). [score:1]
In line with the array data, both miR-382-5p and miR-19a substantially decreased in concentration and, interestingly, they remained below the hospital admission level (Fig. 6C,D). [score:1]
Comparative biomarker profiles for miR-122-5p, miR-885-5p, miR-151-3p and miR-382-5p are summarized in supplementary Table 5. Although miR-122-5p had the highest fold increase in APAP-TOX patients, it was ranked 11th place in the miRNA panel, suggesting that other microRNA species may have greater clinical utility. [score:1]
By contrast with vehicle treated controls (N = 7), acetaminophen toxicity in mice resulted in increased miR-122-5p and miR-151a-3p, and decreased miR-382-5p, in line with our human data (Fig. 5E–H). [score:1]
However, there was no difference in miR-122-5p, miR-885-5p, miR-151a-3p or miR-382-5p (Table 1). [score:1]
[1 to 20 of 16 sentences]
11
[+] score: 17
Other miRNAs from this paper: hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-455
BLC mediated its effects via controlling the expression of miR-382, which led to the upregulation of its direct target, Dio2. [score:9]
Upregulation of miR-382 markedly inhibited the differentiation of adipocytes into beige adipocytes, whereas BLC recovered beige adipocyte differentiation and increased the expression of Dio2 and Ucp1 [76] (Figure 3). [score:8]
[1 to 20 of 2 sentences]
12
[+] score: 17
A total of 3 μL or 6 μL of 10 μM miRNA mimics (mirVana miRNA mimic for hsa-mir-328-3p and hsa-mir-382-5p, Thermo Fisher Scientific), inhibitor (mirVana miRNA inhibitor for hsa-mir-let-7d-5p), or negative controls were diluted in 150 μL serum-free media (the final concentrations were 10 nM and 20 nM, respectively), and then mixed with 9 μl Lipofectamine iRNAiMAX in 150 μL serum free media for 5 minutes at room temperature. [score:5]
However, altered mir-328 and mir-382 expression was not observed (Figure 1D). [score:3]
The opposite results were observed for mir-328, and no changes in mir-382 expression were observed. [score:3]
An increase in mir-328 and mir-382, and a decrease in let-7d expression, were observed in hPSCs co-cultured with Panc-1 or BxPC-3 cells (Figure 1C and Supplementary Figure 1). [score:3]
We validated the expression of three miRNAs (mir-328, mir-382, and let-7d) by real-time PCR. [score:3]
[1 to 20 of 5 sentences]
13
[+] score: 15
In addition, 10 miRNAs; miR-720, miR-891a, miR-522, miR-518c, miR-3665, miR-3620, miR-382, miR-452, miR-122 and miR-147 were found down-regulated in the patient group, indicating tumor suppressor properties. [score:6]
Remaining in the same context, both initial and meta-analyses showed that miR-720, miR-891a, miR-3665, miR-3620, miR-382, miR-452, and miR-122 were down-regulated in the patient group and therefore indicating that they might possess tumor-suppressive activities. [score:6]
Finally, ten miRNAs were found overexpressed in the control group when compared to the patients group (relapsed or in Complete Remission (CR)); miR-720 (I), miR-891a (J), miR-522 (K), miR-518c (L), miR-3665 (M), miR-891a (N), miR-382 (O), miR-452 (P), miR-122 (Q), miR-147 (R). [score:2]
For instance, reduced levels of miR-720 and miR-382 have been hitherto demonstrated in breast cancer [60, 61] and MBs [23], respectively. [score:1]
[1 to 20 of 4 sentences]
14
[+] score: 15
miR-125b is a member of anti-HIV-1 miRNA family (including miR-28, miR-125b, miR-150, miR-223, and miR-382) that targets the 3′UTR of HIV-1 transcripts and inhibit viral translation, a post entry step. [score:7]
Our microarray data revealed downregulation of an array of cellular miRNAs (data not shown) including anti-HIV-1 miRNAs (miR-125b, miR-150, miR-28-5p, miR-223, and miR-382) in cocaine treated cells (Fig. 3A). [score:4]
The table shows that cocaine treatment downregulated a family of anti-HIV-1 miRNAs including miR-125b, miR-150, miR-28p, miR-223, and miR-382 in CD4+ T cells. [score:4]
[1 to 20 of 3 sentences]
15
[+] score: 14
FGFR1 is a direct target of miR-16, miR-133b, miR-198,, miR-382, miR-424, and miR-503. [score:4]
FGFR1 is a direct target of miR-16 (Chamorro-Jorganes et al., 2011), miR-133b (Wen et al., 2013), miR-198 (Yang et al., 2014), (Wang et al., 2013b), miR-382 (Mor et al., 2013), miR-424 (Chamorro-Jorganes et al., 2011), and miR-503 (Kim et al., 2013b). [score:4]
Upregulation of miR-382 in olfactory neuroepithelium of schizophrenia patients repress FGFR1 (Mor et al., 2013). [score:4]
MicroRNA-382 expression is elevated in the olfactory neuroepithelium of schizophrenia patients. [score:2]
[1 to 20 of 4 sentences]
16
[+] score: 13
For example, hsa-miR-382, hsa-miR-31, and hsa-miR-149 are downregulated in medulloblastoma [51], hsa-miR-378 is downregulated in Alzheimer’s disease [52], and abnormal expression of hsa-miR-218 has been detected in samples from Parkinson’s disease patients [53]. [score:13]
[1 to 20 of 1 sentences]
17
[+] score: 12
According to this criterion, 156 qualified miRNAs (Table S1) were subject to the statistical analyses and two miRNAs, miR-133a and miR-382, showed significant upregulation in the low BMD group compared with the high BMD group (Figure 1). [score:3]
We further performed qRT-PCR to validate the differential expression of miR-133a and miR-382. [score:3]
The difference in expression of miR-382 in monocytes in the low vs. [score:3]
Expression levels (2 [−ΔΔCT]) of miR-133a and miR-382 measured by qRT-PCR analysis in circulating monocytes in the low and high BMD groups (*: P<0.05). [score:1]
0034641.g002 Figure 2Expression levels (2 [−ΔΔCT]) of miR-133a and miR-382 measured by qRT-PCR analysis in circulating monocytes in the low and high BMD groups (*: P<0.05). [score:1]
0.65±0.75, P=0.007), and miR-382 showed a fold change of 3.65 between the low and high BMD groups (2.74±2.18 vs. [score:1]
[1 to 20 of 6 sentences]
18
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
Among the miRNAs examined, 79 miRNAs (24%) responded to the hyperandrogenic condition and interestingly, 80% of which were upregulated compared to the control group supporting the notion that hyperandrogenic condition down-regulates androgen receptors in the granulosa cells [35] which could be mediated by these upregulated miRNAs (rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p). [score:9]
A list of differentially expressed miRNAs (Fold change ≥ 2 and their corresponding P value) is presented in Figure  4. Beside this group, miRNAs which were also highly abundant in DHT -treated ovaries are rno-miR-221, rno-miR-222, rno-miR-25, rno-miR-26b, rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 11
miRNAExpression change [a] miRbase accession numberExpression change [b] miR-132-5p Down MIMAT0004594 DownLi et al., 2013 miR-125b-1-3p Down MIMAT0004592 DownLi et al., 2013; Mar-Aguilar et al., 2013a miR-34c-5p Down MIMAT0000686 DownYang et al., 2013 miR-382-3p Down MIMAT0022697 DownLi et al., 2013; Mar-Aguilar et al., 2013b miR-485-5p Down MIMAT0002175 DownAnaya-Ruiz et al., 2013 miR-323b-3p Down MIMAT0015050 NA NA miR-598-3p Down MIMAT0003266 NA NA miR-224-5p Up MIMAT0000281 UpHuang et al., 2012 miR-1246 Up MIMAT0005898 UpPigati et al., 2010 miR-184 Up MIMAT0000454 NA NA a Expression change in this study. [score:7]
Notably, miR-382 (Mar-Aguilar et al., 2013b), miR-224 (Huang et al., 2012), and miR-1246 (Pigati et al., 2010) were also reported as valuable potential biomarkers of breast cancer and diseases. [score:3]
The previous study (Mar-Aguilar et al., 2013b) showed that combination of miR-145, miR-155, and miR-382 could distinguish breast cancer from normal controls. [score:1]
[1 to 20 of 3 sentences]
20
[+] score: 10
Moreover, Hu et al. reported that lncRNA RP5-833A20.1 may regulate NFIA expression by modulating miR-382-5p expression in vitro (Table 2 and Figure 2). [score:6]
Hu Y. W. Zhao J. Y. Li S. F. Huang J. L. Qiu Y. R. Ma X. Wu S. G. Chen Z. P. Hu Y. R. Yang J. Y. RP5-833A20.1/miR-382-5p/ NFIA -dependent signal transduction pathway contributes to the regulation of cholesterol homeostasis and inflammatory reaction Arterioscler. [score:2]
Based on multiple lines of evidence, authors ultimately concluded that the RP5-833A20.1/miR-382-5p/ NFIA pathway is essential for the regulation of cholesterol homeostasis and inflammatory responses [62]. [score:2]
[1 to 20 of 3 sentences]
21
[+] score: 10
In HIV infection, miRNA-223, miRNA-382, miRNA-125b, and miRNA-28, targets the 3′ untranslated region (UTR) of the HIV-1 messenger RNA, while miRNA-150 binds to Nef 3′ long terminal repeats (LTR) at 773 and 89 positions (Huang et al., 2007). [score:5]
In HIV infection, increased expression of miRNA-223, miRNA-382, miRNA-125b, and miRNA-28 targets the 3′ UTR of HIV-1 mRNA, which may subsequently decrease HIV replication. [score:5]
[1 to 20 of 2 sentences]
22
[+] score: 9
MicroRNA-382 induced by HIF-1alpha is an angiogenic miR targeting the tumor suppressor phosphatase and tensin homolog. [score:5]
Interestingly miR-382 was significantly upregulated in ocular medulloepitheliomas in this study. [score:4]
[1 to 20 of 2 sentences]
23
[+] score: 9
Rescue experiments by overexpression of mir-382 in FXS iPSCs-derived neurons reduced elevated levels of REST and restored axon guidance related gene expression. [score:5]
Interestingly, REST itself is upregulated in FXS iPSC-derived neurons, most likely by the increase in mir-382 mRNA levels. [score:4]
[1 to 20 of 2 sentences]
24
[+] score: 9
miR-382-5p has been reported to inhibit tumor growth and enhance chemosensitivity in osteosarcomas [56]. [score:3]
To discover the molecular mechanisms through which Runx1, Runx2, and the Runx -targeting miRNAs, miR-23b-5p, miR-139-5p, miR-205-5p, miR-221-3p, miR-375-3p, miR-382-5p, and miR-384-5p, drive prostate tumorigenesis, we interrogated well-accepted bioinformatics tools; DAVID [57, 58] and Ingenuity Pathway Analysis (IPA-www. [score:3]
Runx1 is uniquely targeted by miR-139-5p and miR-382-5p, neither miRNA has been extensively examined in association with prostate cancer. [score:3]
[1 to 20 of 3 sentences]
25
[+] score: 8
Compared to the activated CD4 [+] T-cells, resting memory CD4 [+] T-cells displayed upregulation of five miRNAs—miR-28, miR-125b, miR-150, miR-223, and miR-382, which negatively targeted the 3′-ends of HIV-1 mRNAs [179]. [score:5]
Wang et al. [223] reported that monocytes expressed elevated levels of the cellular miRNAs miR-125b-5p, miR-28-5p, miR-150-5p, miR-223-3p, and miR-382-5p, all previously shown by Huang et al. [179] to impair HIV-1 replication in resting CD4 [+] T-cells. [score:3]
[1 to 20 of 2 sentences]
26
[+] score: 8
For example, stimulation of TLR3 was shown to induce an anti-HIV effect in primary macrophages, partially through upregulation of miR-28, miR-125b, miR-150, and miR-382 (182). [score:4]
In a ground-breaking study, Huang et al. showed that a selected group of miRNAs, including miR-28, miR-125b, miR-150, miR223, and miR-382, bound to the 3′ UTR of viral mRNAs and showed that activation of resting CD4+ T cells resulted in downregulation of these miRNAs, which correlated with enhanced HIV-1 susceptibility (181). [score:4]
[1 to 20 of 2 sentences]
27
[+] score: 7
In addition, the up-regulation of four anti-HIV-1 miR (miR-28, miR-125b, miR-150, miR-382) was reported in macrophages treated with both IFN-α and IFN-β, and was shown to partially contribute to inhibition of HIV-1 infection in these cells [116]. [score:6]
[111] ↑ miR-155; miR-7 IL4-DCs (Setting 3)IFN-α/ β TNF α/ PGE [2]/ IFN-α/βSTAT1STAT4[62] pDCs IFN-α↑ miR-155 miR-155 *[114] pDCs IFN-α/β ↑ miR-146a[115] IFN-DCs (Setting 1) IFN-α/ω IFN-βCXCL11FCGR, MARCO, CLEC5A, DEFB1, IDO1[32] MDMs IFN-α/β ↑ miR-28; miR-125b; miR-150; miR-382[116] IFN-DCs (Setting 1) IFN-α LOX-1[40] IL4-DCs (Setting 3) RSV/ IFN-β * ↑ miR Let7b[117] IFN-DCs (Setting 1) IFN-α TLR7[27] PBMCs Type I IFNs ↑ miR146a[118] IFN-DCs (Setting 1) IFN-α TRAIL, granzymes, KLRs and other NK cell receptors, DCLAMP, CCR7 and CD49d[26] PBMCs MS/ IFN-β ** ↓ mir-29 family[119] IFN-DCs (Setting 1) IFN-β IL-6, IL-1β, IL-10, CCL20, CCL3, CCL5, CXCR4, CCR5, CCR2,CD44, TLR2, TLR4, CLECSF12, PRG1, TAP1, β2 microglobulin, CD74, CD1a, CD68 LAMP-3, NFkB2, SOD2, Cdc42, IFIT1[31] PBMCs (healthy donors) IFN-α ↑ miR-1; miR-30; miR-128; miR-196; miR-296;[120] PBMCs (CHC) IFN-α ** ↑ miR-1; miR-30; miR-296; Notes: A summary of representative type I IFN modulated genes (left column) or miR (right column). [score:1]
[1 to 20 of 2 sentences]
28
[+] score: 6
In ovarian cancer cells, miR-382 inhibits cell migration and invasion by targeting ROR1 to regulate EMT 20. [score:6]
[1 to 20 of 1 sentences]
29
[+] score: 6
The incubation of NHDF cell cultures for 2 hours with a biological drug leads to changes in the expression of 12 miRNAs (hsa-miR-1231, hsa-miR-1275, hsa-miR-143, hsa-miR-16, hsa-miR-1909, hsa-miR-196a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-3162, hsa-miR-34a, hsa-miR-382, and hsa-miR-939), regulating the expression of the analysed transcripts. [score:6]
[1 to 20 of 1 sentences]
30
[+] score: 6
For example, miR-382, miR-198, miR-223, miR-125b, and miR-28 inhibit HIV replication by modulating host cellular factors or by directly targeting the HIV genome (10, 11). [score:6]
[1 to 20 of 1 sentences]
31
[+] score: 5
In the pathogenic miRNAs caspase-3 network (Figure 5C), 16 miRNAs contribute to the caspase-3 regulatory network, six miRNAs (hsa-miR-382-5p, hsa-miR-17-3p, hsa-miR-20a-3p, hsa-miR-26a-5p, hsa-miR-22-5p, and hsa-miR-19a-3p) repress caspase-3 directly, and the rest of the miRNAs regulate five other genes to affect caspase-3 indirectly. [score:5]
[1 to 20 of 1 sentences]
32
[+] score: 5
The highly expressed cellular miRNAs miR-125b, miR-150, miR-28, miR-223 and miR-382 repress HIV-1 replication by targeting nef 3′-long-terminal repeat (LTR) region and contribute to viral latency in resting CD4 [+] T lymphocytes [15]. [score:5]
[1 to 20 of 1 sentences]
33
[+] score: 5
The bioinformatics predictions identified a subset of these 50 miRNAs (miR-382, miR-369-5p, miR-544, and miR-134) that could potentially target the 3′UTR of the cMYC transcript (Thayanithy et al., 2012). [score:3]
The mentioned authors, in concurrence with our observation, found the deregulation in miR-382 and cMYC levels in osteosarcoma, further suggesting the role of miRNAs in osteosarcoma progression. [score:2]
[1 to 20 of 2 sentences]
34
[+] score: 5
0.76±0.37, P = 0.044), and the qRT-PCR expression levels of miR-382 were not significant (6.56±2.84 vs. [score:3]
0.65±0.75, P = 0.007), and miR-382 showed a fold change of 3.65 between the low and high BMD groups (2.74±2.18 vs. [score:1]
As we previously reported, two miRNAs- miR-133a and miR-382- showed a statistically significant difference in array analysis between the low and high BMD groups [23]. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Functional involvement of miR-224, miR-378, and miR-382 in regulation of aromatase expression during follicle development has been demonstrated, and miR-21 promoted follicular cell survival during the ovulation (Donadeu et al. 2012). [score:5]
[1 to 20 of 1 sentences]
36
[+] score: 5
Similarly, a cluster of cellular miRNAs, including miR-28, miR-125b, miR-150, miR-223 and miR-382, target the 3′ ends of HIV-1 mRNAs in cultivated resting CD4 [+] T cells to affect HIV-1 latency, and potently inhibit HIV-1 production [7]. [score:5]
[1 to 20 of 1 sentences]
37
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-28, hsa-mir-29a, hsa-mir-93, hsa-mir-100, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-34a, hsa-mir-181c, hsa-mir-182, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-217, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-134, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-106b, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-372, hsa-mir-148b, hsa-mir-196b, hsa-mir-424, hsa-mir-448, hsa-mir-449a, hsa-mir-483, hsa-mir-491, hsa-mir-501, hsa-mir-503, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320c-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320c-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
The miRNAs that directly bind to the 3′UTR of HIV-1 RNA (Fig.   2) include miR-28, miR-125b, miR-150, miR-223 and miR-382, which are highly expressed in resting CD4+T cells [73]. [score:4]
[1 to 20 of 1 sentences]
38
[+] score: 4
The rest of co-expressed clusters were listed for regions at 6q13 (including mir-30a and mir-30c-2), Xp11.23 (including mir-362, mir-500, mir-501, mir-502 and mir-532), 14q32.2 (including mir-134, mir-379 and mir-382), 14q32.31 (including mir-127, mir-432 and mir-770), 9q22.32 (including let-7d, mir-23b and mir-27b) and 7q22.1 (including mir-93 and mir-106b) (Table 3). [score:3]
Loss of regions including 14q32.2 (location of mir-127, mir-432 and mir-770) and 14q32.31 (mir-134, mir-379, and mir-382) were reported in previous studies of renal cancer and osteosarcoma [16], [44]. [score:1]
[1 to 20 of 2 sentences]
39
[+] score: 4
On the other hand, we found eight down-regulated miRNAs, some of them implicated in multiple processes such as cancer (miR20b-5p, miR-1291) 52, 53, organ injury in toxicity drug mo dels (miR-382-5p) [54], metabolic processes and steroidogenesis (miR-378b) [55], and tissue inflammation (miR-3085-3p) [56]. [score:4]
[1 to 20 of 1 sentences]
40
[+] score: 4
Nine miRNAs were significantly down-regulated (P < 0.05): miR-29b-3p, miR-200a-3p, miR-126-3p, miR-26b-5p, miR-200a-3p, miR-15b-3p, let7c/7i-3p and miR-382-5p. [score:4]
[1 to 20 of 1 sentences]
41
[+] score: 4
As shown in Table 2, 15 miRNAs (miR-222, miR-320, miR-24, miR-132, let-7b, miR-106a, miR-19b, miR-16, miR-186, miR-339-3p, miR-17, miR-323-3p, miR-197, miR-20a, and miR-382) were down-regulated in Group 2 and were chosen for subsequent verification analysis. [score:4]
[1 to 20 of 1 sentences]
42
[+] score: 3
Human immunodeficiency virus-1 mRNA is suppressed by a cluster of miRNAs, including miR-28, miR-125b, miR-150, miR-223 and miR-382 (9). [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Expression signatures of a minimum of two (miR-126/126*), three (miR-224, miR-368, and miR-382), and seven (miR-17-5p and miR-20a, along with the aforementioned five) miRNAs could correctly distinguish CBF, t (15;17), and MLL-rearrangement AMLs, suggesting that these microRNAs may cooperate with specific translocation in leukemogenesis [107]. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 3
Conversely, HIF-1 promotes the expression of several hypoxamiRs including miR-210 [97], miR-146a [98], miR-145 [99], miR-382 [100], miR-191 [101], miR-363 [102], miR-421 [103] in tumor cells, miR-204 in neuronal cells [104], miR-30a and miR-21 in cardiomyocytes [105, 106], miR-687 in embryonic kidney cells [107], miR-155 in intestinal epithelial cells [108], and miR-429 [109] and miR-19a [110] in endothelial cells. [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 3
Several recent studies profiling miRNA expression in skeletal muscle of young and old mice have revealed that several miRNAs, including miR-206, miR-698, miR-744-5p, and miR-468, are increased, whereas others, such as miR-29, miR-434, miR-455, miR-382, miR-181a, and miR-221, are reduced in skeletal muscle cells of old animals [82– 84]. [score:3]
[1 to 20 of 1 sentences]
46
[+] score: 3
Similarly, higher expression of miR-382 in the CNS cell-lines can be observed in the datasets of this (table S2) as well as the Blower and Gaur studies [21], [22]. [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 3
Huang et al. reported that a cluster of cellular miRNAs, including miR-28, miR-125b, miR-150, miR-223 and miR-382, targets the 3′ ends of various human immunodeficiency virus 1 (HIV-1) mRNAs. [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
In turn, the cytoplasmic miRNA cluster, consisting of miR-28, miR-125b, miR-150, miR-223 and miR-382 molecules, interacts with human immunodeficiency 1 virus (HIV-1) in non-activated T CD4+ lymphocytes and inhibits its multiplication [87]. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
Other miRNAs from this paper: hsa-mir-134, hsa-mir-154
To evaluate the co -expression of imprinted genes and miRNAs at the 14q32 locus, we analyzed the expression of DLK1-DIO3 cluster genes (DIO3, DLK1, MEG3, and MEG8) and representative 14q32 miRNAs (miR-134, miR-154, and miR-382) in an independent set of 43 osteosarcoma tumor samples. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
Recent studies also indicated that multiple miRNAs have been identified to act as tumor suppressors in PCa such as miR-372 [9], miR-382 [10], miR-486-5p [11] and miR-135a-1 [12]. [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
Five of the miRNAs (hsa-miR-154-3p, hsa-miR-4999-5p, hsa-miR-382-3p, hsa-miR-487a-5p, hsa-miR-539-5p) were expressed only in adjacent normal tissues, at the cut-off criteria of 5 read counts in 50% of the samples. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 2
MicroRNA-382 expression is elevated in the olfactory neuroepithelium of schizophrenia patients. [score:2]
[1 to 20 of 1 sentences]
53
[+] score: 2
MicroRNA-382 expression is elevated in the olfactory neuroepithelium of schizophrenia patients. [score:2]
[1 to 20 of 1 sentences]
54
[+] score: 2
MicroRNA-382 expression is elevated in the olfactory neuroepithelium of schizophrenia patients. [score:2]
[1 to 20 of 1 sentences]
55
[+] score: 2
At the moment, it has been reported that Xrn1 and RRP41 regulate miR-382 stability in HEK293T after 8 h actinomycin D treatment 17 and PNPaseold-35 modulates specific miRNA levels in human melanoma cells 18. [score:2]
[1 to 20 of 1 sentences]
56
[+] score: 2
Sequences 200 nucleotides upstream to the transcription start site of miR-654, miR-431, miR-127, miR-432, miR-411, miR-544, miR-369-3p, miR-382 and miR-134 were then amplified using qPCR from DNA present in the immune complexes. [score:1]
Specifically, reintroduction of 14q32 -associated miR-544, miR-369, miR-382, and miR-134 reduced steady state levels of cMYC protein and induced apoptosis of Saos2 cells. [score:1]
[1 to 20 of 2 sentences]
57
[+] score: 1
To add to this intriguing interplay between cellular miRNAs and viral pathogens, Huang and colleagues has demonstrated that HIV, an enveloped RNA virus of the Retreoviridae family utilise host cellular miR-28, miR-125b, miR-150, miR-223 and miR-382 to control viral protein synthesis in order to evade host immune system [47]. [score:1]
[1 to 20 of 1 sentences]
58
[+] score: 1
Nine of those 11 miRNAs including miR-433, miR-127, miR-381, miR-377, miR-299-3p, miR-409-3p, miR-154, miR-382, and miR-376c are associated with OS. [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
After cross-contrast with the results of two software predictions, 14 candidate miRNAs were chosen for further verification (miR-15b, miR-497, miR-211, miR-206, miR-195, miR-204, miR-1s, miR-382, miR-613, miR-15a, miR-16, miR-103a, miR-182, and miR-107, Figure 3A). [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
In comparison to Mirg, the longest Meg9 clone has nine additional upstream exons and contains four more microRNAs: miR-382, miR-134, miR-668, and miR-485. [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
These include miR-17-5p, miR-34a, miR-107, miR-122, the brain-specific miR-132, the synaptic miR-134, miR-185, miR-382, and miR-652. [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
SNP rs610932 within the 3′ UTR of MS4A6A is predicted to disrupt a binding site of miR-382-3p. [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
The majority of these miRNAs (hsa-miR-130a, hsa-miR-93, hsa-miR-383, hsa-miR29c, hsa-miR-382, hsa-miR-31) were already found to be located in regions that exhibited DNA copy number abnormalities in breast cancer tumors [65]. [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
For example, Hamrick et al., (2010) reported that miR-7, miR-468, miR-542, and miR-698 levels in mouse muscle tissue substantially increased with age, whereas miR-124a, miR-181a, miR-221, miR-382, miR-434, and miR-455 levels substantially decreased with age. [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
3/3p21.32 −3.91 hsa-miR-487b 14q32.2 −3.82(29) hsa-miR-487a 14q32.2 −3.78 hsa-miR-758 14q32.2 −3.65 hsa-miR-485-5p 14q32.2 −3.60 hsa-miR-138-1* 16q13.3/3p21.32 −3.55 hsa-miR-382 14q32.2 −3.53(12, 29) hsa-miR-504 Xq26.3 −3.45(52) hsa-miR-128 2q21.3/3p22.3 −3.43(12, 14, 51, 59) hsa-miR-490-5p 7q33 −3.42 hsa-miR-770-5p 14q32.2 −3.35 hsa-miR-410 14q32.2 −3.30(29) hsa-miR-432 14q32.2 −3.29 hsa-miR-485-3p 14q32.2 −3.02 hsa-miR-490-3p 7q33 −2.88 hsa-miR-381 14q32.2 −2. [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
Impressively, our previous microarray data indicated that in addition to miR-127 and miR-379, several other miRNAs from the Dlk1-Gtl2 region, including miR-433, miR-300, and miR-382, were also increased in MRL-lpr and B6-lpr mice [34]. [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
Consistent with the interspecies shift based on PC2, 3 out of the first 5 implicated miRNAs (miR-411, miR-410, miR-382, miR-495 and miR-494) were differentially modulated in human and mouse samples (Table 1). [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
Recently, an analysis of circulating miRNAs have led to identify mir-21, miR-92a [167, 168], miR-10b, miR-125b, miR-155, miR-191, miR-382 [169] and miR-30a [170] as candidate biomarkers for early detection of BC. [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
Although miR-377and miR-382 have been implicated in renal fibrosis and HG response 26 27, our data show that multiple miRNAs of the megacluster and host lncRNA are concomitantly increased in the glomeruli and MCs under diabetic conditions. [score:1]
[1 to 20 of 1 sentences]